Datasets:

autoevaluate

/

autoeval-staging-eval-project-c967fc98-8385124

like 0

potassium ( gik ) , when administered very early during the course of cardiac ischemia , reduces ischemia - induced arrhythmias and myocardial injury . clinical trials in humans , however , have produced conflicting results [ 25 ] which have been postulated to be due to the variable delay in the administration of gik after the onset of ischemia . supporting the importance of very early identification of suitable patients and treatment , the immediate ( immediate myocardial metabolic enhancement during initial assessment and treatment in emergency care ) trial , which studied very early administration of gik to patients with an acute coronary syndrome ( acs ) by emergency medical service ( ems ) , showed reduction in the composite endpoint of cardiac arrest or in - hospital mortality in the study group , thereby supporting the importance of prompt identification of these patients . as treatment of acs has evolved , including early primary percutaneous coronary intervention ( pci ) , there have been significant reductions in mortality . to maximize this impact , there is a need to identify patients with suspected acs who are at high risk for cardiac arrest or death very early in their clinical course , such as during initial evaluation by ems . this identification remains challenging , however . among patients presenting with chest pain or other symptoms suggesting acs , only about a quarter truly have acs , and among those with acs , rapid identification of those at high risk is crucial in order to provide prompt treatment and allocation of valuable attention and resources . to address this need , using data from the immediate trial , we used logistic regression to develop a predictive model to stratify the risk of cardiac arrest or death among patients presenting with suspected acs . we then examined the degree of gik 's treatment effect across risk groups defined by the predictive model . it was a randomized , placebo - controlled , double - blind , multicenter clinical effectiveness trial conducted across the united states that assessed the effect of intravenous gik infusion initiated by ems in the out - of - hospital setting for patients with suspected acs . of its 871 randomized participants ; for the development of the predictive model , we used only data from the control ( placebo ) group , to represent the clinical course of acs uninfluenced by gik . screened patients included those transported by ems who were 30 years of age or older and had an out - of - hospital electrocardiogram ( ecg ) done for symptoms suggestive of acs . to be included , a patient 's out - of - hospital ecg had to meet at least one of the following criteria : a 75% or higher prediction of acs by the acute ischemia time insensitive predictive instrument ( aci - tipi ) , the generation by the thrombolytic predictive instrument ( tpi ) of a statement recognizing st elevation myocardial infarction ( stemi ) , or a judgment by the paramedic that the ecg showed definite stemi using local standards . excluded were patients who had a language barrier , impaired reasoning , were prisoners , pregnant , or had rales suggesting heart failure . informed consent was obtained from each patient and the study protocol conforms to the ethical guidelines of the 1975 declaration of helsinki as reflected in a priori approval by the institution 's human research committee . for analyses , these included age , sex , body mass index , time of initiation of study drug ( gik or placebo ) after the onset of ischemic symptoms , vital signs ( pulse , and systolic and diastolic blood pressures ) obtained out - of - hospital and in the emergency department ( ed ) , medical history of coronary artery disease ( myocardial infarction , coronary artery revascularization , heart failure , and stroke ) , cardiovascular risk factors ( diabetes mellitus , hypertension , and hyper - lipidemia ) , history of hemodialysis , previous use of aspirin , and treatment with beta blocker . electrocardiographic variables included st elevation , pr interval , qrs duration , corrected qt interval ( qtc ) , and the axes of the p , t , and qrs waves . we also used the probability of acs computed by the aci - tipi and for the qtc variable , categories previously developed in a cardiac arrest model , and for heart rate and blood pressure , variables previously used in predictive models of cardiac arrest and in - hospital mortality [ 1113 ] . the outcome of interest was the composite of cardiac arrest or in - hospital mortality , as adjudicated for the immediate trial . using data from the immediate trial control participants , we compared baseline characteristics of those with and without the cardiac arrest or mortality composite outcome . between group differences variables that were significant at p < 0.01 were included in the multivariable model building process to identify patients at highest risk for the composite outcome ( who thereby might benefit most by early administration of gik ) . collinearity was tested by examining the variance inflation factor ( vif ) ; if its square root was more than two , collinearity was suspected and the variable with lowest p value was used in further analyses . stepwise multivariable logistic regression analysis was performed using the most promising variables from the univariate analyses . clinical meaningfulness and the akaike information criteria ( aic ) were used in variable selection , resulting in the model with four variables described below . the final model was tested for predictive discrimination by c statistic ( the equivalent of the area under the receiver - operating characteristic [ roc ] curve ) . predicted values from the final model were calculated for all patients ( gik and placebo treated ) , which were used to stratify patients into tertiles of risk . the observed event rates in each risk category were calculated and compared between the gik and placebo groups . we checked for interactions of gik with different covariates in the model and also with the different risk categories . finally , we evaluated the clinical characteristics of patients in the highest risk group for consideration for early gik therapy . it was a randomized , placebo - controlled , double - blind , multicenter clinical effectiveness trial conducted across the united states that assessed the effect of intravenous gik infusion initiated by ems in the out - of - hospital setting for patients with suspected acs . of its 871 randomized participants ; for the development of the predictive model , we used only data from the control ( placebo ) group , to represent the clinical course of acs uninfluenced by gik . screened patients included those transported by ems who were 30 years of age or older and had an out - of - hospital electrocardiogram ( ecg ) done for symptoms suggestive of acs . to be included , a patient 's out - of - hospital ecg had to meet at least one of the following criteria : a 75% or higher prediction of acs by the acute ischemia time insensitive predictive instrument ( aci - tipi ) , the generation by the thrombolytic predictive instrument ( tpi ) of a statement recognizing st elevation myocardial infarction ( stemi ) , or a judgment by the paramedic that the ecg showed definite stemi using local standards . excluded were patients who had a language barrier , impaired reasoning , were prisoners , pregnant , or had rales suggesting heart failure . informed consent was obtained from each patient and the study protocol conforms to the ethical guidelines of the 1975 declaration of helsinki as reflected in a priori approval by the institution 's human research committee . these included age , sex , body mass index , time of initiation of study drug ( gik or placebo ) after the onset of ischemic symptoms , vital signs ( pulse , and systolic and diastolic blood pressures ) obtained out - of - hospital and in the emergency department ( ed ) , medical history of coronary artery disease ( myocardial infarction , coronary artery revascularization , heart failure , and stroke ) , cardiovascular risk factors ( diabetes mellitus , hypertension , and hyper - lipidemia ) , history of hemodialysis , previous use of aspirin , and treatment with beta blocker . electrocardiographic variables included st elevation , pr interval , qrs duration , corrected qt interval ( qtc ) , and the axes of the p , t , and qrs waves . we also used the probability of acs computed by the aci - tipi and for the qtc variable , categories previously developed in a cardiac arrest model , and for heart rate and blood pressure , variables previously used in predictive models of cardiac arrest and in - hospital mortality [ 1113 ] . the outcome of interest was the composite of cardiac arrest or in - hospital mortality , as adjudicated for the immediate trial . using data from the immediate trial control participants , we compared baseline characteristics of those with and without the cardiac arrest or mortality composite outcome . between group differences variables that were significant at p < 0.01 were included in the multivariable model building process to identify patients at highest risk for the composite outcome ( who thereby might benefit most by early administration of gik ) . collinearity was tested by examining the variance inflation factor ( vif ) ; if its square root was more than two , collinearity was suspected and the variable with lowest p value was used in further analyses . stepwise multivariable logistic regression analysis was performed using the most promising variables from the univariate analyses . clinical meaningfulness and the akaike information criteria ( aic ) were used in variable selection , resulting in the model with four variables described below . the final model was tested for predictive discrimination by c statistic ( the equivalent of the area under the receiver - operating characteristic [ roc ] curve ) . predicted values from the final model were calculated for all patients ( gik and placebo treated ) , which were used to stratify patients into tertiles of risk . the observed event rates in each risk category were calculated and compared between the gik and placebo groups . we checked for interactions of gik with different covariates in the model and also with the different risk categories . finally , we evaluated the clinical characteristics of patients in the highest risk group for consideration for early gik therapy . table 1 shows the baseline characteristics of the study sample and rates of cardiac arrest or in - hospital mortality . of the 871 trial participants ( 411 given gik and 460 given placebo ) , 58 had an out- or in - hospital cardiac arrest or died during the index hospitalization . forty occurred in the control group ( 29 cardiac arrests , 23 with in - hospital mortality , and 12 with both ) , and 18 in the gik group ( 15 cardiac arrests , 13 with in - hospital mortality , and 10 with both ) . to construct the risk predictive model of baseline risk as in table 1 , when compared to the participants without any events , those with one of these events were slightly older and more likely women , presented later ( but not significantly ) , had systolic blood pressures that were about 10 mm hg lower and pulse rates about 10 beats per minute higher , had more frequent histories of previous coronary artery disease , more often had st elevation on their presenting ecg , and had higher aci - tipi probabilities of having acs . these differences are consistent with those who have cardiac arrest , are of more advanced age , have lower systolic blood pressure , tachycardia , history of coronary artery disease , st elevation on presentation , and higher aci - tipi score , these were considered appropriate variables for the predictive model . among 34 candidate variables , 11 were statistically significant and one borderline significant . among demographic variables , age was significant and gender was not . neither traditional cardiovascular risk factors , nor history of coronary artery disease , heart failure , stroke , use of aspirin , or beta blocker were significantly related to the outcome . further characterization of age using restricted cubic spline demonstrated a nonlinear relationship of age with the outcome of interest . two nodes were noted at 60 and 85 years of age . graphically there was no obvious difference in the outcome rates below 60 and above 85 years of age . thus , based on the data the age variable was truncated at 60 and 85 years , and ages between 60 and 85 years demonstrated a smooth pattern and was treated as a continuous variable . univariate analyses of systolic blood pressure suggested a non - linear relationship ; systolic blood pressure less than 105 mm hg was adversely related to the outcome . time from onset of chest pain to presentation as a continuous linear variable was not predictive of the outcome . based on clinical considerations and numbers of participants , the duration of symptoms was divided into two categories : early ( within 1 h ) , and late ( beyond 1 h ) . the odds of the outcome were four times higher in those treated ( with placebo ) within an hour of symptom onset compared to those presenting late , consistent with other analyses of cardiac arrest in acute infarction having a sharp drop - off after 1 h . as many of the interventional trials used two or 3 h as the duration of symptoms at presentation , a sensitivity analysis was performed to look for any difference . however , no significant difference was found in its predictive value when two or 3 h were used as the cutoff points in place of 1 h. previous investigators have suggested a predictive role of qtc as a function of time since onset of symptoms suggestive of acs , reflects myocardial injury and prolongation of qtc ( and qt dispersion ) [ 14 , 15 ] , potentially promoting ventricular arrhythmias and cardiac arrest . although univariate analyses did not demonstrate significant predictive value of qtc or duration of symptoms , a composite variable of qtc with duration of chest pain since onset was created as described in the literature . this variable was tested in the multivariable model , and no improvement in model performance was found . we used both heart rate and systolic blood pressure to account for the hemodynamic state of the patient , including a composite variable found significant for predicting mortality from acs in another study . no improvement was noted in the model as measured by c statistic . in the out - of - hospital setting , systolic blood pressure was found to be a significant covariate and respiratory rate was of borderline significance . when vital signs recorded in the ed were analyzed , systolic and diastolic blood pressures , heart rate , and respiratory rate were significantly related to the outcome . higher serum potassium level had a significant protective role , whereas glucose and c - reactive protein ( crp ) levels did not show predictive significance . however , blood tests were judged unattractive as presenting clinical variables and were not used for the predictive model . among ecg - based variables , st elevation on the presenting ecg and a high aci - tipi score were significant predictors in the univariate models tested . based on all these considerations , stepwise multivariable logistic regression selection resulted in a final model with four variables : age ( truncated at 60 and 85 years ) , systolic blood pressure ( dichotomized at 105 mm hg ) , presence of st elevation in the initial ecg , and duration of time from symptom onset until initiation of treatment ( dichotomized at 1 h ) , in table 2 . 1 in the appendix shows the roc curve for the model 's predictions ; good discrimination is reflected by the c statistic ( roc area ) of 0.75 , and calibration , in table 3 , shows good agreement of predicted to actual outcomes . the c statistic for the gik group was 0.73 with a 95% confidence interval of 0.610.85 . 2 in the appendix shows the roc curve for the treatment group while the adjoining table 1 and fig . based on the final model , we calculated a predicted risk score as a continuous 0100% variable . for potential clinical use , tertiles of risk categories were created and event rates calculated for each risk category . among the placebo group participants , the event rate was 3.4% in the low risk category , 5.6% in the moderate risk category , and 17.6% in high - risk category ( table 4 ) . finally , we applied the model to the entire immediate trial dataset ( placebo and gik arms ) and examined the effect of gik on the different risk categories by introducing an interaction term . a significant interaction was not found across all the risk categories . in the entire cohort , the odds of the composite outcome cardiac arrest or in - hospital mortality related to gik was 0.45 ( ci 0.24 , 0.83 , p = 0.01 ) . assuming a constant odds ratio across the spectrum of calculated risk , the predicted absolute risk reduction was much more pronounced for the high - risk group compared to the low - risk group ( 8.6% vs. 0.8% ) , with corresponding numbers needed to treat ( nnt ) of 12 and 125 respectively . a constant odds ratio was used as there was no interaction noted between gik and the risk categories . we studied the clinical profile of the patients in different risk groups among the immediate trial participants . the high - risk group is about four years older than the entire cohort , has a mean systolic blood pressure on presentation about 11 mm hg lower , with a much higher proportion of patients having systolic blood pressure below 105 mm hg . more often patients in the high - risk group presented within 1 h of ischemic symptom onset , and twice as often had st elevation on their initial ecg . the presence of these clinical characteristics in high - risk patients is consistent with our predictive model and with the objective of expediting treatment of the most at - risk patients . for potentially easier use in the field by the first responder ems we developed a simple scoring system based on the rounding to the integer scores of the coefficients of the four variables in our final model . in this scoring system , henceforth called immediate score , age below 60 years has been assigned a score of 0 and the age group above 60 and less than or equal to 65 years has been assigned a score of 1 , with each 5-year increment increasing the score by 1 to a maximum of 6 for age 85 years . presence of st elevation in the presenting ecg gives a score of 5 , low systolic blood pressure ( < 105 mm hg ) at the first assessment by the ems gives a score of 3 and presentation within 1 h of symptom onset gives a score of 2 . absence of st elevation , systolic blood pressure more than 105 mm hg and presentation later than 1 h from the onset of symptoms each gives a score of zero in this scale . table 2 in the appendix illustrates the scale with the estimated probabilities of death or cardiac arrest for each possible score . reasonably maintains the power of discrimination demonstrated by the predictive model with a c statistic of 0.70 ( 95% ci : 0.63 to 0.77 ) compared to the c statistic of 0.75 in the final model . although the c statistic and the corresponding area under the roc curve ( fig . 5 in the appendix ) for the scoring system is found to be marginally less than that of the final full model , this difference was not statistically significant . for each model subjects were categorized into 3 risk groups using two methods , first into 3 groups of equal size and second into groups of equal risk ranges . we assessed the degree of reclassification using predictable package in r. no significant difference was noted between the two models by either approach as measured by categorical net reclassification improvement ( nri ) or integrated discrimination improvement ( idi ) ( table 3 in the appendix ) apparent reclassification in favor of the lower risk categories ( table 4 ) and its effect on arr and nnt ( arr 2.9% and nnt 35 in both moderate and high risk categories ) while an equal number of patients are used to create risk tertiles is possibly explained by varying weights of different predictors and rounding to the nearest integer in the simple risk scoring model in addition to the small number of events in different risk groups . although taking higher integers to represent the coefficients of the model may reduce this shift and maintain rigor in the predictive value of the variables , they may be difficult to use at the bedside . we encourage a computer based use of the predictive model to estimate the probability of cardiac arrest or death . nevertheless , this simple and easy to use risk scoring system can be utilized by the ems to identify patients at higher risk without any significant loss of discrimination power of the original model . this may expedite important treatment decisions and use of valuable resources , more so in areas where access to computer based risk stratification is not readily available . for potentially easier use in the field by the first responder ems we developed a simple scoring system based on the rounding to the integer scores of the coefficients of the four variables in our final model . in this scoring system , henceforth called immediate score , age below 60 years has been assigned a score of 0 and the age group above 60 and less than or equal to 65 years has been assigned a score of 1 , with each 5-year increment increasing the score by 1 to a maximum of 6 for age 85 years . presence of st elevation in the presenting ecg gives a score of 5 , low systolic blood pressure ( < 105 mm hg ) at the first assessment by the ems gives a score of 3 and presentation within 1 h of symptom onset gives a score of 2 . absence of st elevation , systolic blood pressure more than 105 mm hg and presentation later than 1 h from the onset of symptoms each gives a score of zero in this scale . table 2 in the appendix illustrates the scale with the estimated probabilities of death or cardiac arrest for each possible score . reasonably maintains the power of discrimination demonstrated by the predictive model with a c statistic of 0.70 ( 95% ci : 0.63 to 0.77 ) compared to the c statistic of 0.75 in the final model . although the c statistic and the corresponding area under the roc curve ( fig . 5 in the appendix ) for the scoring system is found to be marginally less than that of the final full model , this difference was not statistically significant . for each model subjects were categorized into 3 risk groups using two methods , first into 3 groups of equal size and second into groups of equal risk ranges . we assessed the degree of reclassification using predictable package in r. no significant difference was noted between the two models by either approach as measured by categorical net reclassification improvement ( nri ) or integrated discrimination improvement ( idi ) ( table 3 in the appendix ) apparent reclassification in favor of the lower risk categories ( table 4 ) and its effect on arr and nnt ( arr 2.9% and nnt 35 in both moderate and high risk categories ) while an equal number of patients are used to create risk tertiles is possibly explained by varying weights of different predictors and rounding to the nearest integer in the simple risk scoring model in addition to the small number of events in different risk groups . although taking higher integers to represent the coefficients of the model may reduce this shift and maintain rigor in the predictive value of the variables , they may be difficult to use at the bedside . we encourage a computer based use of the predictive model to estimate the probability of cardiac arrest or death . nevertheless , this simple and easy to use risk scoring system can be utilized by the ems to identify patients at higher risk without any significant loss of discrimination power of the original model . this may expedite important treatment decisions and use of valuable resources , more so in areas where access to computer based risk stratification is not readily available . based on patients with acs not receiving gik in the immediate trial , we developed a predictive model for the composite outcome of cardiac arrest or in - hospital mortality , based on four variables : age , systolic blood pressure , st elevation on the presenting ecg , and time from onset of ischemic symptoms . applied to its development set , its predictive accuracy was good , reflected by a c statistic of 0.75 , as was its calibration , represented by agreement between the predicted and actual outcome rates . when the model 's predictions were used to create three equal - sized risk groups , there were noticeable differences between risk tertiles . these categories showed potential for identifying those patients with the most to gain from early treatment with gik . whereas the overall odds ratio for gik 's impact on the composite endpoint of cardiac arrest or mortality in the entire immediate trial cohort was 0.45 ( p = 0.01 ) those in the high - risk group had an absolute risk reduction by gik of 8.6% , with a nnt of 12 , versus in the low - risk group having an absolute risk reduction of 0.8% and a nnt of 125 . an apparent increase in the event rate in the intermediate risk category was possibly due to the statistical effect of the small number of events in this category . treatment of acs has evolved substantially over the last three decades , resulting in significant reductions in morbidity and mortality , but early mortality remains high . to help address this , there have been efforts to develop predictive models and risk stratification methods [ 7,1721 ] to support evidence - based treatment that parallel advances in thrombolysis , antiplatelet therapy , and coronary interventions . to represent the underlying risk of patients with suspected acs for the composite outcome of cardiac arrest or mortality , we used data from the untreated ( placebo ) group of the immediate trial . compared to previous models , ours is simpler , having just four variables that are clinically straight - forward and easily collected in ems and ed settings . once validated on other data , the model should be applicable to use in the field . in such use , our findings suggest that it could assist identification of the high - risk patients who would benefit most from administration of gik by the ems and thus could help focus treatment on them . the overall effect of gik in the immediate trial on our study outcome , and confirmed in our analyses , was an odds ratio of 0.45 ( p = 0.01 ) . this is independent of other patient - level variables and is very encouraging , but in clinical settings , it is understood that there is heterogeneity of treatment effect , and being able to select those most likely to benefit is important . the utility of this is illustrated by the difference in potential benefit in the high versus the low risk groups : 8.6% compared to 0.8% , respectively . thus avoiding cardiac arrest or mortality should be much more efficient in the high - risk group , for whom only 12 must be treated to prevent one outcome , versus 125 in the low - risk group . if validated in an independent group of patients , our model may help identify the high - risk patients who may be priori - tized for treatment with gik , and potentially other important treatments . for ease of use in resource limited areas where computer based risk stratification is not easily available we developed a simple integer version of the scoring system , the immediate score . by using this 16 point scoring system , the ems responders can estimate the risk of death or cardiac arrest for an individual patient in the appropriate clinical context and tailor clinical decisions accordingly . the strengths of our study come from data used for the analysis , the immediate trial , a double - blinded placebo - controlled nih - sponsored clinical effectiveness trial that used carefully adjudicated outcomes . another strength is our model 's use of few and readily recognizable clinical predictors ( age , sbp , duration from symptom onset , and st elevation in ecg on presentation ) and its very good predictive performance . also , following further validation , it shows promise as being potentially attractive for identifying patients for treatment in varied ems and ed settings . the overall immediate trial with 871 participants had a total of 58 of the composite events , and for our model , using only the placebo group , we had only 40 events . also , data were not collected for a few traditional cardiovascular risk factors such as smoking and family history of premature coronary artery disease and , from a practical perspective , reliable collection of these data was seen as challenging in the acute ems setting . it might be of interest to investigate laboratory parameters like crp , initial glucose level , and potassium levels , but only the relatively small immediate trial biological mechanism cohort had these data . moreover , these tests are not uniformly and promptly available in the ems setting and thus were considered unattractive for this predictive model ultimately aimed at immediate use in ems and ed care . finally , for validation of our findings and prior to general clinical use this also applies to the finding of the greater benefit from gik in the high - risk group , although such an effect is consistent with other studies of intervention that find more effect with higher risk patients . we encourage such testing on analogous data sets , understanding that extant data on very early treatment with gik in a placebo - controlled trial are still hard to find . the overall immediate trial with 871 participants had a total of 58 of the composite events , and for our model , using only the placebo group , we had only 40 events . also , data were not collected for a few traditional cardiovascular risk factors such as smoking and family history of premature coronary artery disease and , from a practical perspective , reliable collection of these data was seen as challenging in the acute ems setting . it might be of interest to investigate laboratory parameters like crp , initial glucose level , and potassium levels , but only the relatively small immediate trial biological mechanism cohort had these data . moreover , these tests are not uniformly and promptly available in the ems setting and thus were considered unattractive for this predictive model ultimately aimed at immediate use in ems and ed care . finally , for validation of our findings and prior to general clinical use this also applies to the finding of the greater benefit from gik in the high - risk group , although such an effect is consistent with other studies of intervention that find more effect with higher risk patients . we encourage such testing on analogous data sets , understanding that extant data on very early treatment with gik in a placebo - controlled trial are still hard to find . this immediate trial - based predictive model appears to accurately identify patients with suspected acs who are at high risk of cardiac arrest or death and who could benefit most from gik . that the model 's risk factors include earliness of treatment once the model has been validated in other datasets and in practice , it could be helpful in identifying patients most likely to deserve immediate attention and acute interventions for acs , including very early out - of - the - hospital gik .

backgroundthe immediate trial of emergency medical service use of intravenous glucose insulin potassium ( gik ) very early in acute coronary syndromes ( acs ) showed benefit for the composite outcome of cardiac arrest or in - hospital mortality.objectivesthis analysis of immediate trial data sought to develop a predictive model to help clinicians identify patients at highest risk for this outcome and most likely to benefit from gik.methodsmultivariable logistic regression was used to develop a predictive model for the composite endpoint cardiac arrest or in - hospital mortality using the 460 participants in the placebo arm of the immediate trial.resultsthe final model had four variables : advanced age , low systolic blood pressure , st elevation in the presenting electrocardiogram , and duration of time since ischemic symptom onset . predictive performance was good , with a c statistic of 0.75 , as was its calibration . stratifying patients into three risk categories based on the model 's predictions , there was an absolute risk reduction of 8.6% with gik in the high - risk tertile , corresponding to 12 patients needed to treat to prevent one bad outcome . the corresponding values for the low - risk tertile were 0.8% and 125 , respectively.conclusionsthe multivariable predictive model developed identified patients with very early acs at high risk of cardiac arrest or death . using this model could assist treating those with greatest potential benefit from gik .

t cells and b cells derived from the lymphoid lineage belong to the adaptive immune system . function via production of effector cytokines after differentiation and activation . in comparison to the cytotoxic feature of both adaptive cd8 t cells and innate cnk cells , the helper feature of cd4 th cells was considered to be a unique characteristic of the adaptive system acquired during evolution . however , over the past few years several groundbreaking works on a novel member of the innate immune system , the innate lymphoid cell ( ilc ) , have dramatically changed our knowledge about the composition of the innate lymphoid lineage and led us to reconsider the relationship between innate and adaptive lymphoid lineages in the context of evolution . like other lymphocytes , ilcs also develop from the common lymphoid progenitors ( clps ) found in fetal liver and adult bone marrow . they were not discovered and classified as a new lymphocyte family until recently , partly due to their distinct enrichment in nonlymphoid tissues such as mucosal tissues , skin , and adipose tissues , with scarce distribution in lymphoid tissues . their lack of any known lineage surface markers may also contribute to their belated discovery . in actuality , scientists noticed certain subsets of ilcs such as lymphoid tissue inducers ( ltis ) as early as the 1990s [ 3 , 4 ] , but it was not until three independent reports on type 2 cytokine producing innate lymphoid cells ( ilc2s ) in 2010 [ 57 ] that people began to recognize the possible existence of an innate population with a helper feature mirroring adaptive th cells . the nomenclature of innate lymphoid cells ( ilcs ) was then formed based on the existence of helper lymphocyte in the innate arm of the immune system . similar to the classification of th cells , mature helper - like ilcs can be categorized into three groups based on their master regulator expression and signature effector cytokine production . ilc2s , the innate counterpart of th2 cells , express high levels of gata-3 and are capable of producing type 2 cytokines such as il-5 and il-13 [ 57 ] . ilc3s express rort and are capable of producing il-22 and il-17 , similar to th17/th22 cells [ 810 ] . the ccr6 lineage includes lymphoid tissue inducer ( lti ) cells , while ccr6ilc3 can give rise to a special population of rort ilc3s that express the natural cytotoxicity receptor ( ncr ) nkp46 ( encoded by ncr1 ) in mice and nkp44 ( encoded by ncr2 ) in humans . ccr6ilc3s can also express t - bet which drives further development of this lineage into the ncr stage [ 1113 ] . finally , ilc1s are the innate counterpart of th1 cells . they are t - bet positive and better ifn- producers than cnk cells [ 14 , 15 ] . absence of rort and eomes expression in ilc1s distinguishes them from rort - expressing ncr ilc3 and eomes - expressing cnk cells . initially , the nomenclature of ilcs included cnk cells , a notion many scientists still hold . but in this review , we limit ilcs to helper - like ilcs to distinguish these special innate lymphocytes from cnk cells . a defining function of ilcs is their production of a similar set of effector cytokines as those produced by cd4 th cells in the adaptive immune system . this feature of ilcs enables them to mount robust immune responses at the innate stage via acting on other immune or structure cells . through production of il-5 and il-13 , ilc2s may induce the first wave of eosinophil recruitment and stimulate epithelial and smooth muscle cells , during type 2 responses to helminth infection or allergen inoculation [ 17 , 18 ] . steady state production of il-22 by ilc3s is crucial for the homeostasis between host and commensals within the mucosal tissues . upon infection , ilc3s are also the major innate source of il-22 after receiving il-23 stimulation [ 8 , 10 ] . ilc1 cells are relatively scarce in the gut but enriched in the liver in steady state [ 14 , 20 ] . during early type 1 responses , ilc1s are better ifn- producers than cnk cells and they provide the initial protection in mice infected with t. gondii . ilc2s and th2 cells may collaborate to mount robust type 2 immune responses during the effector phase . some ilc2s express mhc class ii and thus are able to stimulate th2 cells to produce il-2 , which in turn promotes ilc2 proliferation and cytokine production [ 21 , 22 ] . however , possibly due to the lack or low level of costimulatory molecules cd80/cd86 on ilc3s , this type of antigen presentation functions through a suppressive mechanism to maintain the homeostasis of commensal specific th cell in the colon . ilcs have additional functions , which may or may not be shared by th cells . for example , ilc2 can produce amphiregulin , which facilitates the repair and reorganization of damaged tissues after viral infection . for example , ilc2s are enriched in adipose tissues and contribute to the beiging of white adipose tissue through production of cytokines and/or methionine - enkephalin [ 26 , 27 ] . through il-22 and lymphotoxin production , ilc3s can induce intestinal epithelial cell expression of fucosyltransferase 2 ( fut2 ) and thus regulate the epithelial fucosylation , which provides the metabolic substrates for commensals [ 28 , 29 ] . the development , maturation , and maintenance of distinct ilc subsets are regulated by a set of specific transcriptional regulators , including t - bet , gata-3 , and rort , similar to the regulation of effector th cell differentiation . a master regulator that determines th cell differentiation towards a particular subset also seems to direct the development of the related ilc subset . in addition , other factors such as ror , bcl11b , and ahr are involved in regulating the development and functions of ilc subsets . mirroring their critical functions during th1 , th2 , and th17 differentiation , the master regulators t - bet , gata-3 , and rort are also implicated in fate determination of ilc subsets . furthermore , gata-3 is required for the maintenance and function of fully developed ilc2s [ 30 , 31 ] . deletion of gata3 in mature ilc2s results in dramatic diminution of il-5 and il-13 production followed by the rapid disappearance of these cells . gata-3 is also expressed in ilc1 and ilc3 cells as well as in ilc progenitors , in which gata-3 has a critical function ; we will discuss gata-3 function during early ilc development in detail in the progenitor section below . t - bet induction in ilc3s may be driven by notch signals , il-23 stimulation , and the microbiota . the gradient increment of t - bet levels directs further development of ccr6ilc3s into ncr ilc3s . some cells may even turn off rort expression to become t - betncr ex - ilc3s . in addition , t - bet regulates ifn- production by the ncr ilc3s . besides ccr6ilc3s accordingly , t - bet deficient mice lack ilc1s and ncr ilc3s but have normal ilc2s and ccr6 ilc3s . ilc1s were previously confused with cnk cells as both express t - bet and are capable of producing ifn-. however , cnk cells express eomes while ilc1s do not . in addition , ilc1s may also express cell surface markers such as cd49a , cd160 , and/or cd127 , which are usually absent on cnk cells . ror is highly expressed by ilc2s and is necessary for their development [ 32 , 33 ] . ror deficiency results in dramatic reduction of ilc2s but does not affect the development of other ilc subsets . thus , mice reconstituted with ror deficient bone marrow are useful tools for studying ilc2 functions during immune responses . bcl11b is a critical factor during early stages of t cell development [ 34 , 35 ] . but during ilc development , bcl11b deficiency only blocks the development of ilc2s as shown by two independent studies published this year [ 3638 ] . bcl11b is expressed as early as the common ilc progenitor stage and it may suppress the development of ilc3s . the mechanism of how bcl11b specifies ilc2 fate is yet to be determined . unlike gata-3 function in mature ilc2s , bcl11b deletion does not affect the maintenance or function of mature ilc2s despite bcl11b being highly expressed in mature ilc2s . the aryl hydrocarbon receptor ( ahr ) is well known to be involved in th17 cell differentiation and function . ahr is also expressed by both ccr6 and ccr6 ilc3s [ 40 , 41 ] . in adult ahr deficient mice , ilc3 cell number in the gut is dramatically reduced , probably due to the defective accumulation and/or enhanced apoptosis of ilc3s . ahr is also critical for the function of ilc3s by regulating il-22 production and the ahr effects on ilcs seem to be ilc3 specific . ilcs , cnk cells , and t cells all develop from clps found in fetal liver and adult bone marrow . at late stages of t cell development , nave cd4 and cd8 t cells develop from the cd4cd8 double positive cells in the thymus whereas cd4 t effector th cells are differentiated from nave cd4 t cells in the periphery . considering the functional similarity between mature ilcs and cd4 th cells thus , a hypothesis concerning ilc development is that , like t cells , there may be a common progenitor for all innate lymphocytes , including ilcs and cnk cells , after the clp stage . in a subsequent stage , a common ilc progenitor would be capable of giving rise to all ilcs , in parallel with the potential of nave cd4 t cells to become different th effector cells . this hypothesis is supported by the fact that certain gene deletions affect the development of all innate lymphocytes and/or all ilcs . indeed , during the last year , we have witnessed a few breakthrough studies in identifying the common progenitors for ilcs [ 14 , 42 ] . id2 is required for the development of all ilc populations since its deficiency results in the loss of all ilcs . using an id2 reporter mouse strain , a lineagecd127flt-3integrin47 population has been reported in a stage after clp and has lost the potential to become t , b , and cnk cells . id2 expression within this population has been shown by expression of an id2 fluorescent reporter . previously reported immature ilc2s in bone marrow are also id2 ; however , they can be excluded by cd25 staining . the multipotential capacity of these id2cd25 progenitors for all ilc subsets was also confirmed by in vitro single cell development assay . these lineagecd127flt-3integrin47id2cd25 progenitors are thus termed as common helper - like innate lymphoid progenitors ( chilps ) . in addition to the critical role in maintenance and function of ilc2s , gata-3 is also crucial in the general development of all ilcs . it has been recently reported that gata3 deficiency prior to the clp stage affects the development of all ilcs in a cell intrinsic manner , indicating that gata-3 is a critical regulator for ilc development . in mice carrying a cre construct driven by the vav1 promoter to conditionally delete gata3 at the hematopoietic stem cell stage , dramatic defects in all il-7r-expressing ilcs in the periphery are noted . moreover , these gata3 conditional - deficient mice do not generate lymph nodes or peyer 's patches , consistent with the finding that the development of functional lti cells is defective at the fetal stage . they also succumb to citrobacter rodentium infection , consistent with another report showing that gata-3 mediates the development of ilc3s by using chimera mice with hematopoietic precursor cells from e12.513.5 gata3 embryos . the essential role of gata-3 during ilc development is consistent with its indispensable function during cd4 t cell development after the cd4cd8 stage in the thymus . consistent with its critical role during ilc development , gata-3 expression levels in the common ilc progenitors , such as chilps , are comparable to that in ilc2s . thus , gata-3 is likely a master regulator for the development of common ilc progenitors . given that both id2 and gata-3 are highly expressed in ilc progenitors , it is reasonable to speculate that while id2 may direct the acquisition of the innate feature of ilcs similar to cnk cells gata-3 may play an indispensable role in directing the helper feature of ilcs similar to cd4 t cells . because of this , gata-3 may distinguish the helper lineage from cytotoxic cnk lineage during innate cell development . altogether , id2 and gata-3 coexpression during the common ilc progenitor stage may establish a special regulatory network that determines the innate and helper features of the ilcs . by analyzing a plzf fate mapping mouse strain , researchers found that the majority of mature ilcs have expressed plzf with the exception of the ccr6 ilc3 lineage . plzf is hardly detectable in mature ilcs but is transiently expressed by a subset of the chilp population in fetal liver and adult bone marrow . these plzf progenitors are multipotential cells and are able to give rise to all ilcs except ccr6 lti cells . furthermore , these plzf progenitors do not develop into t cells , b cells , or cnk cells . plzf progenitors may develop after the chilp stage and have lost the potential to develop into lti lineage . the function of plzf during ilc development remains elusive particularly because plzf is only transiently expressed during the early development stage . furthermore , although zbtb16 mice with plzf deficiency have altered ilc development especially for ilc2s , all the ilcs can still be detected in these mice . an obvious issue for these defined common ilc progenitors is that they are actually heterogeneous populations . within the chilp cells , there should be some ccr6 ilc3 progenitors within the plzf population , which will never turn on plzf expression . even within the plzf population , only a minority of the cells have the potential to become multiple ilcs during in vitro single cell development assay . it is likely that both id2 chilps and plzf common ilc progenitors contain a large fraction of partially committed ilc immediate progenitors . common progenitor multipotent for all ilcs is still required . meanwhile , in addition to fetal liver and adult bone marrow , the common ilc progenitors may also exist in other tissues , such as fetal intestine , as was shown in a recent study using arginase-1 reporter mice . this report suggests that we should not limit ourselves to study fetal liver and adult bone marrow cells to gain further knowledge on ilc progenitors . as mentioned above , many ilc progenitors found in fetal liver and adult bone marrow may have already committed partially to a specific ilc lineage . indeed , bcl11b - expressing progenitors appear within the chilp population ; yet these cells have already committed to the ilc2 fate . there are also abundant immature ilc2s , presumably the most immediate ilc2 precursors , present in the bone marrow ; these cells express mature ilc2 markers sca-1 and cd25 . plzf fate mapping analysis indicates that most immature ilc1s have expressed plzf and thus are derived from the plzf ilc progenitors rather than the cnk progenitors . a couple of other transcription factors , nfil3 [ 4851 ] and tox , have also been found to be involved in the development of both ilcs and cnk cells . since their expression is detected earlier than id2 expression , which occurs at the chilp stage , the expression of these transcription factors may mark even earlier common progenitors for both ilcs and cnk cells , similar to cd4cd8 thymocytes during t cell development . however , the phenotypes of ilc development in mice deficient in either of these regulators are not as dramatic as those resulting from id2 or gata3 deficiency . the mechanisms through which nfil3 and tox function during ilc and cnk cell development require further investigation . given the functional similarities between the innate ilcs and cnk cells and the adaptive cd4 and cd8 t cells , it is reasonable to propose that ilcs and cnk cells follow a similar developmental pathway to that of t cells . a clp may give rise to a common progenitor for all innate lymphocytes including ilcs and cnk cells , which subsequently gives rise to chilps . distinct ilc subsets are further developed from the plzf chilp stage as the differentiation of th effectors from nave cd4 t cells . thus , the development of innate lymphocyte subsets , including ilcs and cnk cells , to a certain extent , mirrors that of t cells ( figure 1 ) . as discussed above , more and more regulators are being found to be involved in the development of ilcs . interestingly , most of these regulators are also involved with t cell development . however , distinct from t cell development , the regulatory functions of the various transcription factors during ilc development are not related to tcr - mediated thymic selection , which , to some extent , may explain why the deficiency of certain regulators has distinct effects on ilc and t cell development . although deletion of either one of the newly identified genes , including nfil3 , tox , or tcf7 [ 53 , 54 ] , results in defective ilc development to a various extent , none of these defects are as severe as that resulting from id2 or gata3 deficiency . thus , it is possible that in the early progenitors of the ilc lineage , these regulators may function through a network designed for fine - tuning ilc development . id2 and gata-3 might form the core complex , while other regulators are involved in tuning the optimal function of the core components . id2 or gata3 deficiency dramatically affects ilc development , whereas deletion of other regulatory components results in various incomplete defects of ilc development . nuclear factor interleukin-3 ( nfil3 ; also known as e4-binding protein 4 , e4bp4 ) , a basic region leucine zipper transcription factor , is critical for cnk cell development . based on this , it is possible that nfil3 is expressed and functions at a progenitor stage common to both ilcs and cnk cells . nfil3 deficient mice showed dramatic defects during the transition from clp to chilp stage [ 48 , 51 ] . however , ilc development is not completely abolished in nfil3 deficient mice ; in the periphery , there are still substantial numbers of ilcs that have escaped the developmental block , although the population is too small to control infectious challenges . nfil3 expression is induced by il-7 signaling , which is also critical for the development of ilcs . after development , nfil3 maintains a very high level of expression in mature ilcs , a level higher than that in cnk cells . nfil3 is dispensable for ilc3 maintenance ; however , its function in other mature ilcs remains unclear . thymocyte selection - associated high - mobility group box protein ( tox ) is a member of the high - mobility group box superfamily . it contains a dna - binding domain and is required for the development of t [ 56 , 57 ] , nk , nkt , and lti cells . a new study this year showed that tox also has broad effects in ilc development . in tox deficient mice , the chilps as well as mature ilcs were severely reduced compared with these cells in wild type mice . there is an intrinsic defect in the notch signaling pathway in tox deficient chilps , which may explain the defect in ilc development in tox deficient mice . t cell factor 1 ( tcf-1 ) is a critical transcription factor for t cell fate specification at the early development stage . tcf7 ( gene encode tcf-1 ) deficiency affects both ilcs [ 53 , 54 ] and cnk cells . similar as during t cell development , tcf-1 is regulated by notch signaling and may be involved in the induction of il-7r and gata-3 expression during ilc development [ 53 , 54 ] . based on the sequential expression of nfil3 , tox , tcf-1 , id2 , and gata-3 and the knowledge we have concerning their relationships in different systems , it is likely that nfil3 expression initially increases after the clp stage , which in turn regulates the expression of tox and id2 . after id2 is turned on , the core assembly involved in directing the innate features of ilc development begins to function . although gata-3 is expressed at low levels at the clp stage , its function during ilc development requires high expression levels . tox is involved in the regulation of notch signaling pathway , which in turn regulates tcf-1 and gata-3 . tcf-1 is then required for optimal expression of gata-3 . upon increased expression of gata-3 , the helper transcription factor assembly nfil3 , tox , and tcf-1 , in connection with the notch pathways , form a network to prepare for the upregulation of id2 and gata-3 , which together form the executive regulatory network to direct lineage fate determination of ilcs , possibly with continued assistance from the initiation transcription factors such as tcf7 , tox , and nfil3 ( figure 2 ) . additional experiments are required to confirm this proposed regulatory network model and it is likely that additional regulators for ilc development may soon be discovered . studies on the newly identified ilcs in recent years have enriched our knowledge on the innate lymphoid lineage development and have provided us with more evidence supporting the close relationship between the innate and adaptive immune systems during evolution . the classification of the ilc population was initially based on their capacity to produce a similar set of effector cytokines compared to th cells . subsequent studies have revealed that the development of ilcs is also regulated by a similar set of key transcription factors required for t cell development . after the clp stage , innate lymphoid lineages and t cells lineages start to develop separately but the regulatory mechanisms may still be shared . nfil3 , tox , and tcf-1 expression at an early stage immediately after clp in the innate lymphoid lineage may mark the common progenitor for both ilcs and cnk cells . ilc and cnk lineages are further separated by the induced expression of id2 and gata-3 in the common ilc progenitors . at later stages , additional regulators are upregulated to drive the distinct fates of different ilc subsets . in conclusion , the ilc cell fate is precisely regulated during development by a network of multiple serially expressed regulators , which may form a regulatory network during development and render the developed ilcs with both innate and helper features .

recent studies on innate lymphoid cells ( ilcs ) have expanded our knowledge about the innate arm of the immune system . helper - like ilcs share both the innate feature of conventional natural killer ( cnk ) cells and the helper feature of cd4 + t helper ( th ) cells . with this combination , helper - like ilcs are capable of initiating early immune responses similar to cnk cells , but via secretion of a set of effector cytokines similar to those produced by th cells . although many studies have revealed the functional similarity between helper - like ilcs and th cells , some aspects of ilcs including the development of this lineage remain elusive . it is intriguing that the majority of transcription factors involved in multiple stages of t cell development , differentiation , and function also play critical roles during ilc development . regulators such as id2 , gata-3 , nfil3 , tox , and tcf-1 are expressed and function at various stages of ilc development . in this review , we will summarize the expression and functions of these transcription factors shared by ilcs and th cells . we will also propose a complex transcriptional regulatory network for the lineage commitment of ilcs .

in particular , osteoimmunology investigates how the immune system impacts on bone turnover in physiological and pathological conditions through the immunoskeletal interface . researchers recently hav - egained better understanding of the dialogue between immune and bone cells and a new reading register of bone remodeling is emerging , in which the various phases of bone formation and resorption , that coexist in a dynamic equilibrium , are under strict immunological control . bone and immune system are functionally integrated through complex homeostatic networks and , in all respects , osteoporosis could be considered a chronic immune mediated inflammatory disease which shares clinical and biological features with many other inflammatory conditions , as well as of other immune mediated diseases . in this context immune and bone systems appear to be integrated and sharing signaling pathways and regulatory mechanisms whose understanding provides a framework for obtaining new insights for the discovery of novel treatments for diseases related to both systems . thus osteoimmunology appears definitely as an interdisciplinary research and clinical field which also allowed new pathogenetic and clinical interpretations of well - known and common diseases , such as osteoporosis . its fields of interest are constantly expanding , thus enriching with an increasing number of translational implications , even in clinical practice and in various branches of medicine . here , the most important concepts in osteoimmunology are addressed in the context of physiopatological states bridging these two organ systems , including osteoporosis , ageing , menopause , inflammatory arthritis , cancer , dysmetabolism and neurological disorders . purpose of this review is to outline a new panorama of osteoimmunology that is not limited to immune mediated bone turnover but also consider , in the light of the latest findings in this field , interesting connections with other systems and regulatory functions over bone remodeling . bone is a dynamic tissue formed by a protein and mineral salt matrix in which are embedded the bone cells , osteocytes ( ocy ) , osteoblasts ( ob ) and osteoclasts ( oc ) . in addition , many other types of cells take part in bone composition , including cartilage , stromal , hematopoietic and mesenchimal stem cells , all linked by a dense network of signals . antagonistic signaling between skeletal stem cell - derived subsets is a key mechanism in skeletal subset lineage commitment . bone tissue undergoes continuous adaptation during lifetime to preserve the structure of the skeleton and to control the mineral homeostasis . bone turnover requires two coordinated processes : bone formation , driven by ob and bone resorption , mediated by oc . ocy , through a complex network of tiny channels , transmit mechanical and microtraumatic signals leading to the activation of repair processes . moreover , ocy synthesize the bone matrix proteins which , along with the mineral component , determine the quality of the bone . ob are the precursors of ocy , i.e , the structural cells in the bone , and interact with oc to drive their differentiation and function . the mesenchymal stem cell ( msc ) from which the ob originate , can also give rise to chondrocytes , marrow stromal cells , and adipocytes . there are multiple subpopulations of perisinusoidal mesenchymal stem / progenitor cells ( mspcs ) , that have specific relationships with the different kinds of niche , i.e. the surrounding microenvironment in which the self - renewal and multilineage stem cells proliferate and differentiate [ 7 - 9 ] . the stem cells that maintain and repair the postnatal skeleton is an osteochondroreticular ( ocr ) stem cell that generate ob , chondrocytes , and reticular marrow stromal cells , but not adipocytes . they are characterized by the expression of the bone morphogenetic protein ( bmp ) antagonist gremlin 1 ( grem 1 ) . the perisinusoidal msc population also contains nes - gfp , leptin receptor ( lepr)-cre and cd146 expressing cells with osteogenic and adipogenic potential . the osteoblast precursor cells ( obp ) after increasing the osteopontin receptor ( cd44 ) and the receptor for stromal cell - derived factor 1 - sdf1 ( cxcr4 ) expression , migrate and become mature ob , attracted by vascular endothelial cells expressing sdf1 along chemotactic gradients into regions of bone formation . oc are multinucleated myeloid cells , specialized to remove mineralized bone matrix through the production of lysosomal enzymes , such as tartrate - resistant acid phosphatase ( trap ) and catepsin k , against which a selective inhibitor ( odanacatib ) has been recently synthesized to be employed in osteoporotic patients . they derive from a bone marrow precursor which gives rise also to professional antigen presenting cells ( apc ) , i.e. dendritic cells and macrophages . ob , ocy and oc continuously communicate with each other to optimize the quality of the bone . for example , ob provide essential signals for the differentiation of the myeloid lineage precursors of oc by producing macrophage colony - stimulating factor ( m - csf ) , receptor activator of nuclear factor - kb ( nf - kb ) ligand ( rankl ) and other co - stimulatory factors . the binding of rank receptor on oc and their precursors by its ligand rankl , expressed by ob and stromal cells , is the main activation signal for bone resorption . the ob derived m - csf links to its receptor c - fms on the surface of osteoclast cell precursors ( ocp ) , enabling the rank / rankl signal . osteoprotegerin ( opg ) inhibits osteoclastogenesis by acting as a decoy receptor of rankl , thus preventing bone resorption . rank receptor on oc , through the adapter protein tumor - necrosis - factor - receptor - associated factor 6 ( tr - af6 ) , bound to its cytoplasmic tail , activates nf - kb and other transcription factors , such as mapks , c - fos , activator protein 1 ( ap1 ) , up to nuclear factor of activated t cells ( nfatc1 ) , the hub of various signaling pathways . simultaneously , the activation of rank induces the phosphorylation of ig - like receptor associated adaptor proteins , such as the immunoreceptor tyrosine - based activation motif ( itam ) and fc - receptor common gamma ( fcr ) subunit . in the nucleus nfatc1 , together with other transcription factors , such as ap1 , pu.1 , microphthalmia - associated transcription factor ( mitf ) and cyclic amp responsive - element - binding protein ( creb ) , induces oc specific genes , including those codifying for calcitonin receptor , cathepsin k and trap , leading to oc differentiation and proliferation . many other receptor pathways interact with rank , some costimulators and amplificators , others inhibitors and modulators , and many of these are shared by immune cells . an inhibitor receptor system for rank signal is ephrin ( eph ) b2/b4 . ephb2 receptor on oc , stimulated by ephb4 ligand on ob , inhibits the oc differentiation blocking c - fos and the nfatc1 transcriptional cascade . a peculiar property of this membrane receptor complex is its capacity to control bone turnover through bidirectional signals : the cell expressing the receptor and the one that expresses the ligand influence each other at the same time . therefore , ephb4 activation on ob , through the induction of osteogenetic regulatory genes , contemporaneously favours the coupling of bone formation and resorption . the canonical wingless ( wnt)/ catenin pathway , involved mainly in the response to mechanical load , promotes differentiation , proliferation and mineralization activity of ob and also inhibits their apoptosis . it encompasses a family of proteins that bind to complex transmembrane receptors , formed by the association of frizzled ( fz ) proteins and low density lipoprotein related receptors ( lrp-5 , lrp-6 ) which stabilize the -catenin substrate that concentrates in the cytosol and migrates into the obp nucleus to regulate the transcription of target genes to induce ob differentiation and bone formation . wnt signaling inhibits msc commitment towards adipogenic and chondrogenic lineages , stimulating the differentiation towards osteoblastogenesis . wnt--catenin signaling also indirectly inhibits osteoclastogenesis and bone resorption by increasing opg secretion in ob and ocy . the bmp pathway acts as a wnt associative stimulator signal in skeletogenesis by expanding primitive mesenchymal cells and thus laying the foundation for subsequent endochondral ossification . at the same time , various natural inhibitors , produced both by ob and ocy , exert a negative feed - back control on wnt system , such as the wnt/-catenin signaling pathway inhibitor dickkopf homolog-1 ( dkk-1 ) , the secreted frizzled related protein ( sfrp ) and the sclerostin , synthesized by the sost gene , which binds to lrp5/6 receptors . the inflammatory cytokine tumor necrosis factor- ( tnf- ) induces ob apoptosis and reduces osteoblastogenesis by stimulating dkk-1 and sost expression . cortison augments dkk-1 and sfrp expression thus suppressing the wnt/-catenin signal on ob inducing osteoporosis . an anti - sclerostin moab has recently been produced as a new osteoanabolic drug useful in the therapy of osteoporosis . other potential osteoanabolic drugs acting on the wnt pathway are also dkk inhibitor molecules , now in the experimental stage . bone is a dynamic tissue formed by a protein and mineral salt matrix in which are embedded the bone cells , osteocytes ( ocy ) , osteoblasts ( ob ) and osteoclasts ( oc ) . in addition , many other types of cells take part in bone composition , including cartilage , stromal , hematopoietic and mesenchimal stem cells , all linked by a dense network of signals . antagonistic signaling between skeletal stem cell - derived subsets is a key mechanism in skeletal subset lineage commitment . bone tissue undergoes continuous adaptation during lifetime to preserve the structure of the skeleton and to control the mineral homeostasis . bone turnover requires two coordinated processes : bone formation , driven by ob and bone resorption , mediated by oc . ocy , through a complex network of tiny channels , transmit mechanical and microtraumatic signals leading to the activation of repair processes . moreover , ocy synthesize the bone matrix proteins which , along with the mineral component , determine the quality of the bone . ob are the precursors of ocy , i.e , the structural cells in the bone , and interact with oc to drive their differentiation and function . the mesenchymal stem cell ( msc ) from which the ob originate , can also give rise to chondrocytes , marrow stromal cells , and adipocytes . there are multiple subpopulations of perisinusoidal mesenchymal stem / progenitor cells ( mspcs ) , that have specific relationships with the different kinds of niche , i.e. the surrounding microenvironment in which the self - renewal and multilineage stem cells proliferate and differentiate [ 7 - 9 ] . the stem cells that maintain and repair the postnatal skeleton is an osteochondroreticular ( ocr ) stem cell that generate ob , chondrocytes , and reticular marrow stromal cells , but not adipocytes . they are characterized by the expression of the bone morphogenetic protein ( bmp ) antagonist gremlin 1 ( grem 1 ) . the perisinusoidal msc population also contains nes - gfp , leptin receptor ( lepr)-cre and cd146 expressing cells with osteogenic and adipogenic potential . the osteoblast precursor cells ( obp ) after increasing the osteopontin receptor ( cd44 ) and the receptor for stromal cell - derived factor 1 - sdf1 ( cxcr4 ) expression , migrate and become mature ob , attracted by vascular endothelial cells expressing sdf1 along chemotactic gradients into regions of bone formation . oc are multinucleated myeloid cells , specialized to remove mineralized bone matrix through the production of lysosomal enzymes , such as tartrate - resistant acid phosphatase ( trap ) and catepsin k , against which a selective inhibitor ( odanacatib ) has been recently synthesized to be employed in osteoporotic patients . they derive from a bone marrow precursor which gives rise also to professional antigen presenting cells ( apc ) , i.e. dendritic cells and macrophages . ob , ocy and oc continuously communicate with each other to optimize the quality of the bone . for example , ob provide essential signals for the differentiation of the myeloid lineage precursors of oc by producing macrophage colony - stimulating factor ( m - csf ) , receptor activator of nuclear factor - kb ( nf - kb ) ligand ( rankl ) and other co - stimulatory factors . the binding of rank receptor on oc and their precursors by its ligand rankl , expressed by ob and stromal cells , is the main activation signal for bone resorption . the ob derived m - csf links to its receptor c - fms on the surface of osteoclast cell precursors ( ocp ) , enabling the rank / rankl signal . osteoprotegerin ( opg ) inhibits osteoclastogenesis by acting as a decoy receptor of rankl , thus preventing bone resorption . rank receptor on oc , through the adapter protein tumor - necrosis - factor - receptor - associated factor 6 ( tr - af6 ) , bound to its cytoplasmic tail , activates nf - kb and other transcription factors , such as mapks , c - fos , activator protein 1 ( ap1 ) , up to nuclear factor of activated t cells ( nfatc1 ) , the hub of various signaling pathways . simultaneously , the activation of rank induces the phosphorylation of ig - like receptor associated adaptor proteins , such as the immunoreceptor tyrosine - based activation motif ( itam ) and fc - receptor common gamma ( fcr ) subunit . in the nucleus nfatc1 , together with other transcription factors , such as ap1 , pu.1 , microphthalmia - associated transcription factor ( mitf ) and cyclic amp responsive - element - binding protein ( creb ) , induces oc specific genes , including those codifying for calcitonin receptor , cathepsin k and trap , leading to oc differentiation and proliferation . many other receptor pathways interact with rank , some costimulators and amplificators , others inhibitors and modulators , and many of these are shared by immune cells . an inhibitor receptor system for rank signal is ephrin ( eph ) b2/b4 . ephb2 receptor on oc , stimulated by ephb4 ligand on ob , inhibits the oc differentiation blocking c - fos and the nfatc1 transcriptional cascade . a peculiar property of this membrane receptor complex is its capacity to control bone turnover through bidirectional signals : the cell expressing the receptor and the one that expresses the ligand influence each other at the same time . therefore , ephb4 activation on ob , through the induction of osteogenetic regulatory genes , contemporaneously favours the coupling of bone formation and resorption . the canonical wingless ( wnt)/ catenin pathway , involved mainly in the response to mechanical load , promotes differentiation , proliferation and mineralization activity of ob and also inhibits their apoptosis . it encompasses a family of proteins that bind to complex transmembrane receptors , formed by the association of frizzled ( fz ) proteins and low density lipoprotein related receptors ( lrp-5 , lrp-6 ) which stabilize the -catenin substrate that concentrates in the cytosol and migrates into the obp nucleus to regulate the transcription of target genes to induce ob differentiation and bone formation . wnt signaling inhibits msc commitment towards adipogenic and chondrogenic lineages , stimulating the differentiation towards osteoblastogenesis . wnt--catenin signaling also indirectly inhibits osteoclastogenesis and bone resorption by increasing opg secretion in ob and ocy . the bmp pathway acts as a wnt associative stimulator signal in skeletogenesis by expanding primitive mesenchymal cells and thus laying the foundation for subsequent endochondral ossification . at the same time , various natural inhibitors , produced both by ob and ocy , exert a negative feed - back control on wnt system , such as the wnt/-catenin signaling pathway inhibitor dickkopf homolog-1 ( dkk-1 ) , the secreted frizzled related protein ( sfrp ) and the sclerostin , synthesized by the sost gene , which binds to lrp5/6 receptors . the inflammatory cytokine tumor necrosis factor- ( tnf- ) induces ob apoptosis and reduces osteoblastogenesis by stimulating dkk-1 and sost expression . cortison augments dkk-1 and sfrp expression thus suppressing the wnt/-catenin signal on ob inducing osteoporosis . an anti - sclerostin moab has recently been produced as a new osteoanabolic drug useful in the therapy of osteoporosis . other potential osteoanabolic drugs acting on the wnt pathway are also dkk inhibitor molecules , now in the experimental stage . both clinical observations and basic research demonstrated that mediators driving inflammatory processes are also closely involved in bone remodeling . inflammation and bone turnover share the same mediators , such as cytokines and transcription factors . various molecules mediating communication between bone cells have been identified and several immunological mediators are involved in this crosstalk . t lymphocytes resident in the bone marrow are the key immune cells that regulate bone remodeling and responsiveness of bone cells to parathyroid hormone ( pth ) , in physiological and pathological conditions . during inflammatory diseases or in conditions characterized by low - grade systemic inflammation , such as menopause and aging , oc bone resorption is driven by inflammatory cytokines produced by activated t lymphocytes . however , bone marrow t cells also support bone homeostasis by inducing bone formation via direct interactions with bone cells . two mechanisms are involved : the binding of t cell costimulatory molecules to their counter receptors on bone cells and their precursors , and the release of cytokines and wnt ligands that activate wnt signaling in osteoblastic cell lineage . the final effect of t lymphocytes on bone depends on their activation state and their specific phenotype . the prevailing bone marrow t cells are activated central memory cd8 + lymphocytes , secreting relatively high levels of effector cytokines , mainy tnf-. these cells are abundant in postmenopausal women with osteoporotic fractures . t helper ( th17 ) cells are capable of stimulating bone resorption and play a pivotal role in the bone loss of inflammatory conditions such as psoriasis , rheumatoid arthritis , periodontal disease , and inflammatory bowel disease . th17 cells induce osteoclastogenesis by secreting interleukin ( il)-17 , rankl , tnf- , il-1 , and il-6 , along with low levels of ifn-. moreover , il-17 stimulates the release of rankl by ob and ocy and upregulate rank expression on oc . treg exert anti - osteo - clastogenic activity by producing suppressor cytokines , including il-4 , il-10 , and tgf- . for example it is interesting to note how even the cells of the immune sytem , mainly activated t and b lymphocytes and dendritic cells , express rankl . moreover , ran - kl , the principal osteoclastogenic mediator , stimulates bone resorption through the nfatc1 , which is also a crucial factor in the immune system regulation . rankl , initially regarded as activator of apc by t lymphocytes , also plays an important role in the generation of treg , which suppress the development of cd8 + lymphocytes into cytotoxic cells . the expression of rankl on t lymphocytes is also central for the differentiation of medullary epithelial cells which are responsible for self - reactive t lymphocyte negative selection in the thymus . thus , depending on the context in which it acts , rankl can stimulate or suppress immune reactions . other examples of shared receptor signals are the immunoglobulin ( ig)-like receptors which amplify the nfatc1 signal . the toll like receptors ( tlr ) , stimulated by pathogen associated molecular patterns ( pamp ) , utilize traf6 in their cascade signaling . tlr are able to activate both the synthesis and release of proinflammatory and osteoclastogenic cytokines from immune cells , leading to bone resorption stimulation . their involvement in the bone remodeling process provides a further key in the comprehension of the osteoporosis of infectious diseases . the osteoclast associated receptor ( oscar ) , which belongs to the ig - like receptor family , mediates interactions between ob and oc and is also involved in the regulation of both the adaptive and innate immunity . it associates with the adaptor molecule fcr subunit , which harbors an immunoreceptor tyrosine - based activation motif ( itam ) critical for calcium signaling activation in the immune system . also , the itam - harboring adaptor dap12 plays a role in oc differentiation and function . therefore , receptors such as dap12 and ig - like receptors associated with fcr , initially characterized in myeloid cells and in natural killer lymphocytes , are also involved in rank induced osteoclastogenesis . tnf induces the expression of oscar and other receptors important for oc differentiation on the surface of monocytoid peripheral blood cells . for example , cd80/cd86 blocks oc generation by binding to ctla4 , an inhibitory molecule of the monocyte induced t lymphocyte costimulation , which is highly expressed on treg surface . cathepsin k is expressed in oc and plays a central role in the degradation of bone matrix components , such as type i collagen . in addition to osteoclastic bone resorption , cathepsin k is also implicated in dendritic cell activation through tlr 9 . moreover , cathepsin k supports the secretion of il-6 and il-23 , inflammatory cytokines involved in the production of th17 cells , which in turn promote osteoclastic bone resorption . eph receptors and their associated ligands , expressed by cells found within the bone marrow microenvironment , including ob and oc , are implicated in the regulation of physiological and pathological bone remodeling , but also are central in many other different cellular processes including , in addition to immune regulation , angiogenesis , neuronal development and neoplastic metastatization . osteoclast semaphorin 4d sustains bone resorption by inhibiting osteoblastogenesis . since sema4d also regulates a variety of immune functions , such as antigen presentation , b lymphocyte activation and chemotaxis of monocytes , it could be regarded as an osteoimmunological mediator . the matrix glycoprotein osteopontin ( opn ) , produced by different types of cells , including immune cells , oc , endothelial and epithelial cells , increases bone resorption by inducing the expression of the osteoclastic immune receptor cd44 , essential for cell migration , and by directly enhancing oc attachment to bone extracellular matrix ( ecm ) , required for ocp activation . as a consequence of bone resorption , more opn is further released from the ecm into the bone microenvironment and into the blood , thus amplifying local and systemic osteoclastogenesis . rankl and cd40l expressed on t cells , apc , stromal cells and ob , activate the cognate receptors rank and cd40 in ocp and ob , respectively . cd40/cd40l signaling promotes macrophage activation and differentiation , antibody isotype switching , and the development of b cell memory . cd40l also increases the commitment of msc to the osteoblastic lineage . through cd80/86 signaling in ocp boh these conditions are mimicked by continuous pth infusion ( cpth ) , whereas daily or intermittent pth injection ( ipth ) , therapeutically employed in several osteoporotic conditions , stimulates bone formation . pth binds its receptors ( ppr ) on stromal cells , ob , and ocy but also on t cells and macrophages . the catabolic effect of cpth is mostly mediated by enhanced production of rankl and decreased production of opg by ob and stromal cells . the pth anabolic effect is mediated by wnt signaling activation : pth increases -catenin levels in ob , promotes lrp6 signaling and decreases the production of sclerostin . cpth stimulates bone cells and immune cells to release growth factors and cytokines , including il-6 and tnf- , which induce th17 cell differentiation and the production of il-17 , that plays a pivotal role in the pth induced bone loss . tnf- in turn stimulates oc formation and activity via multiple mechanisms , including increased rankl production . moreover , tnf- upregulates the expression of cd40 in ob and stromal cells , increasing their sensitivity to cpth and suppressing opg . bone marrow t cells provide cell surface signals and secrete cytokines that direct the differentiation of mesenchimal progenitors towards ob characterized by a high sensitivity to pth . therapy with teriparatide , a form of ipth treatment , increases the bone marrow levels of wnt10. bone marrow cd8 + t cells potentiate the anabolic activity of pth by providing wnt10 . inflammation results in disturbances in the immunoskeletal interface , i.e. the convergence of cells and cytokines that regulate both the immunity that the bone , causing osteoporosis . the inflammatory cytokines tnf- , il-1 , il-6 and il-17 are crucial in acute and chronic inflammation and strong inducers of bone resorption . an excessive or abnormal immune activation can induce osteoporosis , as for example in autoimmune diseases , infections and also in senile and postmenopausal osteoporosis . all these conditions go along with an increased inflammatory background and the presence of rankl producing activated t cells . however , in addition to osteoclastogenic cytokines , there are also cytokines which counteract bone resorption and exert osteoblastogenic properties , resulting in a complex bone remodeling cytokine network . each cytokine has also pleiotropic functions and it is therefore not surprising that same cytokines can exert different and often contrasting effects depending on the specific context in which they act , the maturation stage of target cells and/or the influence of other cytokines . for example , the pleiotropic cytokine ifn- exerts anti - osteoclastogenic effects in physiological bone remodeling , by binding to specific oc receptors and inducing traf6 proteosomal degradation with consequent inhibition of the transduction signal mediated by rankl . however , in postmenopausal osteoporosis , inflammation or infections , the final effect of ifn- is skewed towards bone resorption through t lymphocyte activation and rankl expression . in fact , ifn- is a powerful stimulator of class ii major histocompatibility complex ( mhcii ) antigen expression on apc , with consequent increased stimulation of t cells through their antigen specific receptor ( tcr ) , inducing further immune activation and production of osteoclastogenic proinflammatory cytokines [ 35 - 40 ] . a cascade of cytokines drives ocp homing , differentiation and activation . circulating bone marrow produced ocp function as a tank of progenitor cells for several effector cells , in relation to the different cytokines implicated . the activation of cd8 t cells by oc induces il-2 , il-6 , il-10 and ifn- production . ocp can also enhance the expression of the suppressor of cytokine signaling ( socs ) . treg , whose main marker is the transcription factor foxp3 , balance il-17 induced bone resorption closely interacting with oc and expressing ctla-4 , which in turn inhibits oc activity . endothelial cells , activated by il-1 and tnf- , attract circulating ocp at sites of inflammation where they migrate through high endothelial venules driven by the expression of cell adhesion molecules ( cam ) , such as icam-1 and cd44 . these cd14 + monocytoid cells , under the stimulation of rankl , become activated bone resorbing oc . resident tissue macrophages of bone , termed osteal macrophages , are predominantly located adjacent to ob . osteal macrophages play diverse roles in skeletal homeostasis , their specific functions depending on the macrophage subset considered . a central function of macrophages is their phagocytic ability . in particular , efferocytosis ( phagocytosis of apoptotic cells ) is a critical process in both clearing dead cells and replacement of progenitor cells to maintain bone homeostasis . finally , not only the immune system regulates bone remodeling , but also the bone is able to influence the immune system , actively interacting with immune cells . the same bone cells would then be able to influence or even also perform many immune functions , such as cytokine production and antigen presentation [ 46 - 48 ] . in this sense , the bone would be regarded as a sort of expanded immune system . cytokines secreted by bone cells drive naive t cell differentiation into several lineages , leading to expansion of mature t cell populations that further regulate bone homeostasis . oc selectively recruit and activate cd8 + t cells expressing cd25 and foxp3 ( oc - induced regulatory cd8 t cells ) . in turn , these cd8 + treg cells suppress bone resorption , decrease inflammatory / osteoclastogenic cytokine production , and stimulate bone formation , creating a regulatory loop : oc and rankl induce treg , and then treg blunt osteoclastic bone resorption . osteocalcin , expressed on mature bone cells , regulates the production of thymic - seeding t lymphoid progenitors . they secrete a variety of proinflammatory and immunosuppressive factors . a subset of mesenchimal cells expressing osterix , a marker of bone precursors , regulate the maturation of early b lymphoid precursors by promoting pro - b to pre - b cell transition through insulin - like growth factor 1 ( igf-1 ) production . skeletal stem cells are also able to recruit and activate neutrophils via the release of il-6 and il-8 , ifn- , gm - csf and mif . they inhibit b cell proliferation , differentiation , and antibody production , and can also directly inhibit t cell function , rendering them anergic or shifting their phenotype to that of functional regulatory cells . msc induce macrophages to switch from classically activated proinflammatory ( m1 ) to alternatively activated anti - inflam - matory ( m2 ) phenotype , and inhibit mast cell degranulation attenuating allergic reactions . msc express active tlr , through which they sense bone microenvironment , recognizing exogenous ( bacterial products ) and endogenous ( heat shock proteins , rna ) danger signals . the common tlr signaling feature is the activation of the nf- b transcription factors implicated in controlling the expression of inflammatory cytokines and cell maturation molecules . both clinical observations and basic research demonstrated that mediators driving inflammatory processes are also closely involved in bone remodeling . inflammation and bone turnover share the same mediators , such as cytokines and transcription factors . various molecules mediating communication between bone cells have been identified and several immunological mediators are involved in this crosstalk . t lymphocytes resident in the bone marrow are the key immune cells that regulate bone remodeling and responsiveness of bone cells to parathyroid hormone ( pth ) , in physiological and pathological conditions . during inflammatory diseases or in conditions characterized by low - grade systemic inflammation , such as menopause and aging , oc bone resorption is driven by inflammatory cytokines produced by activated t lymphocytes . however , bone marrow t cells also support bone homeostasis by inducing bone formation via direct interactions with bone cells . two mechanisms are involved : the binding of t cell costimulatory molecules to their counter receptors on bone cells and their precursors , and the release of cytokines and wnt ligands that activate wnt signaling in osteoblastic cell lineage . the final effect of t lymphocytes on bone depends on their activation state and their specific phenotype . the prevailing bone marrow t cells are activated central memory cd8 + lymphocytes , secreting relatively high levels of effector cytokines , mainy tnf-. these cells are abundant in postmenopausal women with osteoporotic fractures . t helper ( th17 ) cells are capable of stimulating bone resorption and play a pivotal role in the bone loss of inflammatory conditions such as psoriasis , rheumatoid arthritis , periodontal disease , and inflammatory bowel disease . th17 cells induce osteoclastogenesis by secreting interleukin ( il)-17 , rankl , tnf- , il-1 , and il-6 , along with low levels of ifn-. moreover , il-17 stimulates the release of rankl by ob and ocy and upregulate rank expression on oc . treg exert anti - osteo - clastogenic activity by producing suppressor cytokines , including il-4 , il-10 , and tgf- . for example it is interesting to note how even the cells of the immune sytem , mainly activated t and b lymphocytes and dendritic cells , express rankl . moreover , ran - kl , the principal osteoclastogenic mediator , stimulates bone resorption through the nfatc1 , which is also a crucial factor in the immune system regulation . rankl , initially regarded as activator of apc by t lymphocytes , also plays an important role in the generation of treg , which suppress the development of cd8 + lymphocytes into cytotoxic cells . the expression of rankl on t lymphocytes is also central for the differentiation of medullary epithelial cells which are responsible for self - reactive t lymphocyte negative selection in the thymus . thus , depending on the context in which it acts , rankl can stimulate or suppress immune reactions . other examples of shared receptor signals are the immunoglobulin ( ig)-like receptors which amplify the nfatc1 signal . the toll like receptors ( tlr ) , stimulated by pathogen associated molecular patterns ( pamp ) , utilize traf6 in their cascade signaling . tlr are able to activate both the synthesis and release of proinflammatory and osteoclastogenic cytokines from immune cells , leading to bone resorption stimulation . their involvement in the bone remodeling process provides a further key in the comprehension of the osteoporosis of infectious diseases . the osteoclast associated receptor ( oscar ) , which belongs to the ig - like receptor family , mediates interactions between ob and oc and is also involved in the regulation of both the adaptive and innate immunity . it associates with the adaptor molecule fcr subunit , which harbors an immunoreceptor tyrosine - based activation motif ( itam ) critical for calcium signaling activation in the immune system . also , the itam - harboring adaptor dap12 plays a role in oc differentiation and function . therefore , receptors such as dap12 and ig - like receptors associated with fcr , initially characterized in myeloid cells and in natural killer lymphocytes , are also involved in rank induced osteoclastogenesis . tnf induces the expression of oscar and other receptors important for oc differentiation on the surface of monocytoid peripheral blood cells . for example , cd80/cd86 blocks oc generation by binding to ctla4 , an inhibitory molecule of the monocyte induced t lymphocyte costimulation , which is highly expressed on treg surface . cathepsin k is expressed in oc and plays a central role in the degradation of bone matrix components , such as type i collagen . in addition to osteoclastic bone resorption , cathepsin k is also implicated in dendritic cell activation through tlr 9 . moreover , cathepsin k supports the secretion of il-6 and il-23 , inflammatory cytokines involved in the production of th17 cells , which in turn promote osteoclastic bone resorption . eph receptors and their associated ligands , expressed by cells found within the bone marrow microenvironment , including ob and oc , are implicated in the regulation of physiological and pathological bone remodeling , but also are central in many other different cellular processes including , in addition to immune regulation , angiogenesis , neuronal development and neoplastic metastatization . osteoclast semaphorin 4d sustains bone resorption by inhibiting osteoblastogenesis . since sema4d also regulates a variety of immune functions , such as antigen presentation , b lymphocyte activation and chemotaxis of monocytes , it could be regarded as an osteoimmunological mediator . the matrix glycoprotein osteopontin ( opn ) , produced by different types of cells , including immune cells , oc , endothelial and epithelial cells , increases bone resorption by inducing the expression of the osteoclastic immune receptor cd44 , essential for cell migration , and by directly enhancing oc attachment to bone extracellular matrix ( ecm ) , required for ocp activation . as a consequence of bone resorption , more opn is further released from the ecm into the bone microenvironment and into the blood , thus amplifying local and systemic osteoclastogenesis . rankl and cd40l expressed on t cells , apc , stromal cells and ob , activate the cognate receptors rank and cd40 in ocp and ob , respectively . cd40/cd40l signaling promotes macrophage activation and differentiation , antibody isotype switching , and the development of b cell memory . cd40l also increases the commitment of msc to the osteoblastic lineage . through cd80/86 signaling in ocp boh these conditions are mimicked by continuous pth infusion ( cpth ) , whereas daily or intermittent pth injection ( ipth ) , therapeutically employed in several osteoporotic conditions , stimulates bone formation . pth binds its receptors ( ppr ) on stromal cells , ob , and ocy but also on t cells and macrophages . the catabolic effect of cpth is mostly mediated by enhanced production of rankl and decreased production of opg by ob and stromal cells . the pth anabolic effect is mediated by wnt signaling activation : pth increases -catenin levels in ob , promotes lrp6 signaling and decreases the production of sclerostin . cpth stimulates bone cells and immune cells to release growth factors and cytokines , including il-6 and tnf- , which induce th17 cell differentiation and the production of il-17 , that plays a pivotal role in the pth induced bone loss . tnf- in turn stimulates oc formation and activity via multiple mechanisms , including increased rankl production . moreover , tnf- upregulates the expression of cd40 in ob and stromal cells , increasing their sensitivity to cpth and suppressing opg . bone marrow t cells provide cell surface signals and secrete cytokines that direct the differentiation of mesenchimal progenitors towards ob characterized by a high sensitivity to pth . therapy with teriparatide , a form of ipth treatment , increases the bone marrow levels of wnt10. bone marrow cd8 + t cells potentiate the anabolic activity of pth by providing wnt10 . inflammation results in disturbances in the immunoskeletal interface , i.e. the convergence of cells and cytokines that regulate both the immunity that the bone , causing osteoporosis . the inflammatory cytokines tnf- , il-1 , il-6 and il-17 are crucial in acute and chronic inflammation and strong inducers of bone resorption . an excessive or abnormal immune activation can induce osteoporosis , as for example in autoimmune diseases , infections and also in senile and postmenopausal osteoporosis . all these conditions go along with an increased inflammatory background and the presence of rankl producing activated t cells . however , in addition to osteoclastogenic cytokines , there are also cytokines which counteract bone resorption and exert osteoblastogenic properties , resulting in a complex bone remodeling cytokine network . each cytokine has also pleiotropic functions and it is therefore not surprising that same cytokines can exert different and often contrasting effects depending on the specific context in which they act , the maturation stage of target cells and/or the influence of other cytokines . for example , the pleiotropic cytokine ifn- exerts anti - osteoclastogenic effects in physiological bone remodeling , by binding to specific oc receptors and inducing traf6 proteosomal degradation with consequent inhibition of the transduction signal mediated by rankl . however , in postmenopausal osteoporosis , inflammation or infections , the final effect of ifn- is skewed towards bone resorption through t lymphocyte activation and rankl expression . in fact , ifn- is a powerful stimulator of class ii major histocompatibility complex ( mhcii ) antigen expression on apc , with consequent increased stimulation of t cells through their antigen specific receptor ( tcr ) , inducing further immune activation and production of osteoclastogenic proinflammatory cytokines [ 35 - 40 ] . a cascade of cytokines drives ocp homing , differentiation and activation . circulating bone marrow produced ocp function as a tank of progenitor cells for several effector cells , in relation to the different cytokines implicated . the activation of cd8 t cells by oc induces il-2 , il-6 , il-10 and ifn- production . ocp can also enhance the expression of the suppressor of cytokine signaling ( socs ) . treg , whose main marker is the transcription factor foxp3 , balance il-17 induced bone resorption closely interacting with oc and expressing ctla-4 , which in turn inhibits oc activity . endothelial cells , activated by il-1 and tnf- , attract circulating ocp at sites of inflammation where they migrate through high endothelial venules driven by the expression of cell adhesion molecules ( cam ) , such as icam-1 and cd44 . these cd14 + monocytoid cells , under the stimulation of rankl , become activated bone resorbing oc . resident tissue macrophages of bone , termed osteal macrophages , are predominantly located adjacent to ob . osteal macrophages play diverse roles in skeletal homeostasis , their specific functions depending on the macrophage subset considered . a central function of macrophages is their phagocytic ability . in particular , efferocytosis ( phagocytosis of apoptotic cells ) is a critical process in both clearing dead cells and replacement of progenitor cells to maintain bone homeostasis . finally , not only the immune system regulates bone remodeling , but also the bone is able to influence the immune system , actively interacting with immune cells . the same bone cells would then be able to influence or even also perform many immune functions , such as cytokine production and antigen presentation [ 46 - 48 ] . in this sense , the bone would be regarded as a sort of expanded immune system . cytokines secreted by bone cells drive naive t cell differentiation into several lineages , leading to expansion of mature t cell populations that further regulate bone homeostasis . oc selectively recruit and activate cd8 + t cells expressing cd25 and foxp3 ( oc - induced regulatory cd8 t cells ) . in turn , these cd8 + treg cells suppress bone resorption , decrease inflammatory / osteoclastogenic cytokine production , and stimulate bone formation , creating a regulatory loop : oc and rankl induce treg , and then treg blunt osteoclastic bone resorption . osteocalcin , expressed on mature bone cells , regulates the production of thymic - seeding t lymphoid progenitors . a subset of mesenchimal cells expressing osterix , a marker of bone precursors , regulate the maturation of early b lymphoid precursors by promoting pro - b to pre - b cell transition through insulin - like growth factor 1 ( igf-1 ) production . skeletal stem cells are also able to recruit and activate neutrophils via the release of il-6 and il-8 , ifn- , gm - csf and mif . they inhibit b cell proliferation , differentiation , and antibody production , and can also directly inhibit t cell function , rendering them anergic or shifting their phenotype to that of functional regulatory cells . msc induce macrophages to switch from classically activated proinflammatory ( m1 ) to alternatively activated anti - inflam - matory ( m2 ) phenotype , and inhibit mast cell degranulation attenuating allergic reactions . msc express active tlr , through which they sense bone microenvironment , recognizing exogenous ( bacterial products ) and endogenous ( heat shock proteins , rna ) danger signals . the common tlr signaling feature is the activation of the nf- b transcription factors implicated in controlling the expression of inflammatory cytokines and cell maturation molecules . osteoporosis is a systemic disease of the skeleton , whose main features are loss of bone mass , bone mineral density ( bmd ) decrease and disruption of bone microarchitecture , so the skeleton becomes fragile , exposing patients to increased risk of fractures . aside from senile and postmenopausal osteoporosis , the first recognized types of primary osteoporosis , many other causes of secondary osteoporosis have been subsequently recognized , for example vitamin d and calcium deficits , lack of sun exposure , immobility , drugs such as cortisone , malabsorption syndromes , endocrine and dismetabolic diseases such as diabetes , disthyroidisms , hypercortisolism , and so on . only later , clinical and experimental findings evidenced a close connection between osteoporosis and immune mediated inflammatory conditions , for example , rheumatoid arthritis ( ra ) and acquired immune deficiency syndrome ( aids ) , and a common inflammatory background has been finally discovered as pathogenetic factor even in conditions of major osteoporotic risk , such as old age and estrogen deficiency [ 57 - 59 ] . more recently , other unpredictable pathological conditions , such as obesity , are coming out as potential osteoporotic risk factors . even in these cases , the main pathogenetic mechanism leading to bone tissue alteration seems to be inflammation . from this point of view osteoporosis could be therefore regarded as an immune mediated disease in which immune activation , through the induction of cytokine production and inflammation , leads to a remodeling of oc and ob activity and dysregulation of bone turnover with consequent increased bone resorption and osteoporosis . paradigmatic examples of the link between inflammation and osteoporosis are inflammatory arthritis , mainly ra ( fig . 1 ) . ra is an autoimmune disease that is characterized by inflammation of the synovial joint , leading to severe structural damage and bone destruction . an increased bone resorption is the main pathogenetic mechanism in both disease progression leading to juxta - articular bone erosions and irreversible joint damage and systemic osteoporosis . bisphosphonates , drugs used for some time in the therapy of osteoporosis , are potent inhibitors of oc activity both in the primitive and secondary osteoporosis , such as that associated with autoimmune diseases . a decreased bmd in the spine and hip and higher prevalence of osteoporosis have been described in ra patients . in early untreated ra , bmd is related to longer symptom duration , the presence of rheumatoid factor ( rf ) and cyclic citrulinated peptide antibodies ( anti - ccp ) , disease activity score , and the presence and progression of joint damage [ 1 , 19 ] . monoclonal antibodies ( moab ) against various proinflammatory cytokines and their receptors , such as tnf- , are useful in preventing and/or reversing bone erosions as well as systemic osteoporosis . autoimmune reactions induce rankl expression and subsequent osteoclastogenesis . that the rank/ rankl / opg pathway is central to the osteoporosis pathogenesis is confirmed by the elevated antiresorptive capacity of denosumab , an anti - rankl moab , utilized in osteoporosis therapy . activated immune cells at sites of inflammation produce a wide spectrum of proinflammatory and osteoclastogenic cytokines , resulting in bone erosions , osteitis , and peri - inflammatory and systemic bone loss . local peri - inflammatory bone loss and osteitis occur early and precede and predict erosive bone destruction in ra . moreover , peri - inflammatory bone formation is impaired , resulting in non - healing of erosions , and this allows a local vicious circle of inflammation between synovitis , osteitis , and local bone loss . rankl is highly expressed in the ra synovium , and inflammation - mediated bone damage is largely attributable to its abnormally high expression . in addition to activated t lymphocytes and macrophages , a pivotal role in inducing bone erosions is also played by rankl - expressing b cells , as highlighted by the observation of the therapeutic effect of anti - cd20 antibody in ra . cd4+t - cells , especially th17 cells , play a prominent role , particularly in the initiation of systemic immune response in ra . the interaction between immune and mesenchymal cells in joints , including synovial fibroblasts , which are characterized by hyperproliferative and hyperactive properties in response to an inflammatory environment , is of paramount importance in rheumatoid inflammation . in fig . thus , in the affected joints , hyperplasia of the synovial membrane is characterized by both hyperproliferation of synovial fibroblasts and massive infiltration of inflammatory immune cells , including cd4 + t cells and innate immune cells . autoimmune diseases , including arthritis , often result from an imbalance between treg cells and th17 cells . the th17 cells derived from foxp3 + t cells in ra comprise a novel th17 cell subset with a distinct pattern of gene expression and arthritogenic properties . the fate of plastic foxp3 + t cells may be a key determinant of the treg / th17 balance that is critically involved in the self - tolerance and autoimmunity . mesenchymal cells are a determinant of the development of ra that links the systemic immune response and the local disorder in the joints . mesenchymal cells contribute to the th17 mediated chronic inflammation by promoting the migration of th17 cells to the inflamed joint and concomitant increase in il-17 production . thus , the interaction of immune and mesenchymal cells plays a key role in both the chronic inflammation and bone destruction in ra . in particular , pathogenetic autoreactive immune cells migrate into joints and activate the mesenchymal cells resident in joint , such as synovial fibroblasts . moreover , since soluble inhibitors of the wnt pathway , such as dkk-1 , produced by synovial fibroblasts , are upregulated by tnf- , antibodies against dkk1 could be able to both promote bone formation and prevent bone erosions in ra . osteoporosis has long been regarded as simply the consequence of the menopausal estrogen decline . os- the progression of articular erosions is clearly driven by proinflammatory and osteoclastogenic cytokines produced by immune cells in the inflamed joint . both activated lymphocytes and macrophages stimulate osteoclast differentiation by producing proinflammatory mediators . activated lymphocytes of the synovial pannus overexpress rankl and tnf- that stimulate bone marrow cd11b+ ocp to proliferate and enter the bloodstream where they themselves produce inflammatory factors amplifying inflammation . activated macrophages in the inflamed joints produce various chemokines which drive the localization of periarticular bone ocp . the stimulation of osteoclastogenesis induced by the high concentrations of rankl and tnf- results in bone resorption . these cells do not produce antiosteoclastogenic cytokines , such as ifn- or il4 , while expressing high levels of rankl and secrete il-17 , that in turn stimulates ob , synoviocytes and fibroblasts to express rankl , and induces macrophages to produce proinflammatory cytokines , such as tnf- and il-6 in the synovium amplifying local inflammation . il-17 also induces the synthesis of enzymes capable of degrading the bone matrix such as matrix metalloproteinases ( mmp ) . these effects are balanced by treg that inhibit bone destruction by suppressing oc formation through both cell - cell contact and the secretion of inhibitory cytokines such as tgf- , il-4 and il-10 . teoimmunology , suggesting that immune cells take part in the bone changes typical of menopause , has led to a shift in the concept of osteoporosis , that is currently considered an inflammatory condition . post - menopausal osteoporosis is a clear example of the mutual influences between immune system , bone and endocrine system . like many other hormones , in addition to specific target organs ( breast and reproductive system ) , estrogens have their receptors also on immune cells and bone , as well as on bone marrow precursors . ( 3 ) shows the effects of estrogen deficiency on cells and molecules involved in bone metabolism . menopausal estrogen decline leads to proliferation and activation of t cells by increasing mhcii expression on monocytes and apc function and by inhibiting t cell apoptosis . these effects leads to the expansion of activated t lymphocytes resulting in hyperproduction of inflammatory cytokines and chronic oc stimulation which is responsible for bone loss and increased fracture risk . maintenance of inflammatory reactions leading to bone resorption and skeletal fragility is also present during senescence and inflammaging ( fig . 4 ) , that is the condition of chronic inflammation characterizing aging , as the result of the immune system s ability to cope with stressors . inflammaging is now considered the background of a broad range of age - related diseases with an inflammatory pathogenesis . many of the biological mechanisms implicated in the aging process , such as cell senescence , proinflammatory immune profile , apoptosis and metabolism imbalance , are also implicated in bone remodeling . also in the absence of overt inflammatory diseases , the heightened catabolic signals induced by inflammation enhance apoptosis of ob and muscle cells , causing both osteoporosis and sarcopenia . during aging , the lifelong exposure to oxidative stress and chronic antigenic load leads to the loss of the regulatory process which counteracts t cell activation induced bone resorption . in aged people , lipid oxidation mediated by ros oxidized polyunsaturated fatty acids induce the association of ppar with -catenin and promote its degradation . oxidized lipids also potentiate oxidative stress , enhance ob apoptosis and inhibit bmp-2 induced ob differentiation . antioxidant agents seem to have some action on bone remodeling : resveratrol decreases nf - k activation induced by rankl and oc differentiation and also promotes osteogenesis in msc via the sirt1/foxo3 axis stimulation . during senescence , besides the impaired treg function , the number of effector memory cells is increased . these are senescent cells with proinflammatory properties , secreting several inflammatory cytokines able to influence bone remodeling . interestingly , this immunological pattern ( accumulation of activated cells and memory / effector lymphocytes secreting proinflammatory cytokines ) characterizing immunosenescence , is also peculiar of other immunological conditions associated with osteoporosis , such as ra , aids , chronic viral infections , etc . . the already complex cross - talk between bone and immune system is further expanding as they emerge new mediators involved . interestingly , the scenario of osteoimmunolgy is increasingly including interconnections with other organs and systems , therefore influencing several homeostatic functions in addition to bone turnover and immunity , such as hemopoiesis , metabolic and neuro - endocrine functions . the crosstalk between skeletal and bone marrow is crucial to hematopoietic stem cell ( hsc ) function and throughout the hemopoiesis . hsc occupy specific locations in the bone marrow microenvironment , commonly referred to as niches , comprising multiple cell types able to regulate hsc proliferation and differentiation . hematopoietic and skeletal stem cell homeostasis are closely related : msc progeny express numerous cytokines necessary for hsc maintenance and hematopoiesis , including kit ligand and stromal - derived factor , but also stem and progenitor cells of the hematopoietic system may reciprocally regulate skeletal progenitors by expressing myriad factors associated with skeletogenesis , whose cognate receptors are highly expressed by skeletal stem cells . interestingly , these latter exhibit receptors to circulating hormones , such as leptin and thyroid - stymulating hormone , suggesting that skeletal stem cells and their progeny may link systemic exocrine regulation to both skeletal and hematopoietic system . primitive mesenchymal progenitors are more critical for hsc function , whereas lineage - restricted mesenchymal cells control more committed hematopoietic progenitors . bone microenvironment is therefore a composite of specialized niches providing distinctive functional units to regulate hematopoiesis . the estrogen deficiency induces a marked increase of inflammatory cytokines and mediators of inflammation , in particular ifn- , m - csf , tnf- , il-1 , il-6 and il-7 , in addition to prostaglandins ( pge ) and reactive oxygen species ( ros ) , which play a driving role in the development of osteoporosis . of particular interest is the expansion in the peripheral blood from postmenopausal women of two particular lymphocyte subsets , cd3 + cd56 + t lymphocytes , major producers of tnf- , and b220 + igm - b lymphocyte precursors , that under certain stimuli can differentiate into ocp and are strong producers of inflammatory cytokines . the enhanced tnf- production by activated t cells has a central role in bone loss due to estrogen decline in menopausal women . the same ifn- , which in some situations could be protective against osteoporosis , during estrogen deficiency has a prevailing osteoclastogenic stimulating action . the estrogen decline also results in the decrease of opg and tgf- that normally contrast the effects of inflammatory mediators on bone . the age - related increase of inflammatory cytokines results from a chronic activation of macrophages and memory / effector t cells , in addition to an impaired treg function . a peculiar finding of immunosenescence is the increased number of senescent memory cells expressing rankl and secreting osteoclastogenic cytokines , mainly tnf- , il-1 , il-6 and il-17 . these cytokines are able to facilitate ocp expansion which amplify the systemic inflammation by producing further proinflammatory factors able to recruit other inflammatory cells and perpetuating the flogistic vicious cycle . both the increased transcriptional activity of nf - kb due to genotoxic , inflammatory , and oxidative stresses in aging , and the chronic p53 activation induced by the age - related progressive loss of telomere length , result in impaired ob proliferation and osteoporosis development . cells of the immune system and bone cells derive from bone marrow precursors and develop in the same bone marrow microenvironment . hematopoietic and immune cells share same signaling pathways with cells of the bone and their precursors , which surprisingly do not take part in the regulation of immunity and hemopoiesis . ob , together with msc , are crucial components of the niche of growth of hsc . ob overexpression of the wnt antagonist dkk1 reduces wnt signaling in hsc and disrupts hsc self - renewal potential . the wnt antagonist secreted frizzled - related protein 1 ( sfrp1 ) is involved in osteoblastic mediated hsc regulation ; through its regulation of ob , pth controls the hematopoietic niche function , involving crosstalk with wnt signaling . the upregulation of notch ligand protein jagged-1 ( jag1 ) expression in ob and the increased notch signaling are involved in increasing hsc numbers ; angiopoietin-1 receptor activation on hsc by ob produced angiopoietin-1 promotes strict adhesion of hsc to the niche , inducing quiescence of these cells . osteopontin , an ob - secreted protein , participates in hsc location and is a negative regulator of their proliferation . also , ocy derived from ob that become embedded within the bone matrix , are involved in the complex regulation of hemopoiesis through the osteoimmune interface : mainly by the production of sclerostin , they appear to have an inhibitory effect on hsc support . even oc , as well as activated endothelial cells , are likely involved in the mobilization of hsc by cytokine induced cam expression . being the only cells capable of bone resorption , in addition to allowing the renewal of the skeleton , they also open the space in the bone marrow for hematopoietic cells . moreover , osteoclastic bone resorption releases calcium , which attracts and retains calcium sensing receptor expressing hsc at the endosteal region . macrophages play diverse roles in the bone and marrow . at the sites of bone remodeling , a subset of hsc is located in close proximity to megakaryocytes in the bone marrow , where ob undergo rapid expansion in response to the secretion of megakaryocyte - derived mesenchymal growth factors , such as platelet derived growth factor ( pdgf)- , to promote hsc proliferation . the bone marrow microenvironment can also act as a niche for the onset and progression of neoplastic diseases , including both hematologic malignancies and metastases of solid tumors , mainly breast and prostatic cancer . in multiple myeloma , an osteolytic hematological malignancy characterized by an important skeletal involvement , neoplastic plasma cells produce a large amount of mediators that induce osteoclastic bone resorption and block the activity of ob . in addition to osteolytic factors , myeloma cells produce dkk1 , which inhibits obp differentiation by binding to the lrp5/6 coreceptors expressed on their surface . on the other hand , the same bone cells produce growth factors and angiogenetic cytokines able to support the development and progression of myeloma , perpetuating a vicious circle of mutual reinforcement . a promising new field of interest in this regard is the osteo - immune - oncology . there is in fact a close relationship between immune regulation of bone turnover and tumor growth . often , cancer cells express rank and in proneoplastic inflammation various cell types express rankl that acts as chemotactic factor favoring the skeletal metastasis . tumor cells in the bone cause activation of osteoclasts that mediate bone resorption and additional growth factor release from the bone matrix , fueling a vicious circle of impaired bone turnover and tumor proliferation ( fig . not always the tumor associated inflammation is the expression of an immune system that successfully opposes the neoplastic growth , as previously believed , but sometimes some patterns of immune activation can be facilitators of the development of tumors . then the block of rankl , in addition to inhibiting bone resorption , also decreases tumor growth , enhances apoptosis of malignant cells and diminishes proneoplastic inflammation . osteal macrophages , as well as macrophages in other tissues , have a role in tumor progression , supporting cancers which preferentially metastasize to the skeleton , in particular breast and prostate cancer . osteal macrophages expressing cd68 , a phagocytic capacity marker of cells infiltrating metastatic lesions , could facilitate tumor establishment and growth . tumor - derived pthrp drives myeloid cell recruitment via ob produced ccl2 , which is high in the bone microenvironment and whose levels are associated with poor prognoses in primary breast tumors . as for bone , adipose tissue is a kind of immune tissue and produces immunoregulatory factors . adipocytes and ob derive from the same msc , as well as visceral adipose tissue macrophages and oc derive from the same hsc . shared transcription factors regulate the shift between the different cell lines and the subsequent differentiation cascade . by action of peroxisome proliferative activated receptor gamma ( ppar ) , the principal regulator of adipogenesis , the msc differentiates into adipocytes rather than into ob . in contrast , the expression of runt - related transcription factor 2 ( runx2 ) , associated with ob differentiation , and osterix , an ob zinc finger mechanical loading promotes ob differentiation and inhibits adipogenesis by down - regulating ppar or by stimulating a durable -catenin signal . not surprisingly , ppar agonists such as thiazolidinediones used to increase insulin sensitivity in type 2 diabetes , also increase the risk of osteoporotic fractures . leptin is a pro - inflammatory adipokine that exerts its actions via central nervous system regulation of feeding behavior , where it promotes satiety and prevents weight gain . leptin can also directly signal through its receptor expressed on immunocytes , where it induces tnf- and il-6 production by monocytes , chemokines by macrophages , and th1 cytokines from polarized cd4 + t cells . adiponectin is an anti - inflammatory adipokine whose plasma levels are strongly correlated with insulin sensitivity and glucose tolerance . it can directly interfere with inflammatory cytokine production in macrophages and can induce expression of the anti - inflammatory cytokine il-10 . tnf- and il-6 inhibit adiponectin production in adipocytes . adipose tissue produced pro - inflammatory cytokines and adipokines further modulate the activity of oc and ob . fat tissue , mainly visceral fat tissue , may increase bone resorption through the production of inflammatory cytokines such as il- 6 and tnf- , which stimulate oc activity through the regulation of the rankl / rank / opg pathway . leptin and adiponectin act on the bone through different signaling pathways with contrasting effects ( table 2 ) . it promotes adipogenesis and inhibits osteogenesis in response to diet and adiposity by activating jak2/stat3 signaling . therefore , leptin receptors on skeletal msc function as a sensor of systemic energy homeostasis . various cell populations within the fat tissue can exacerbate the development of the chronic , low - grade inflammation associated with obesity and metabolic dysfunction . white adipocytes store lipid as triglycerides within unilocular droplets , and are responsive to various stimuli , such as insulin . brown adipocytes store lipid in multilocular droplets that are quickly catabolized for fuel when the tissue is stimulated . beige adipocytes , dispersed within white adipose tissue , can dissipate heat , similarly to classical brown adipocytes , when exposed to cold temperatures or after prolonged highfat diet feeding . visceral fat tissue infiltrating macrophages in the setting of diet - induced obesity , have a pro - inflammatory phenotype which initiates and/or exacerbates the chronic inflammation that contributes to adipocyte dysfunction in obesity . conversely , in lean humans adipose tissue macrophages may promote tissue remodeling and temper inflammation by secreting anti - inflammatory cytokines . notwithstanding epidemiological evidence indicates that an increase in body mass index ( bmi ) is related to increased bone mass , probably due to the effects of the mechanical load of the body weight on the skeleton , not always obesity , and mainly the increase in visceral fat mass , has a positive effect on bone . obesity is associated with increased leptin and decreased adiponectin serum levels . moreover , in the visceral adipose tissue there are activated macrophages producing cytokines . in obese subjects , especially with central obesity , in which the visceral fat is increased , there is a significant increase of several markers of inflammation such as c reactive protein ( crp ) , il-1 , il-6 and tnf- , that can alter the quality of the bone , making it more fragile . therefore , these new clinical and experimental evidences definitively connect obesity and other related pathological conditions , such as metabolic syndrome , nonalcoholic fatty liver disease ( nafld ) and diabetes , to impaired bone health and fragility fractures [ 90 - 93 ] . in conclusion , it is currently emerging that adipose tissue , liver , bone and immune system modulate each other through a complex network of interconnected signals . both adipocytes and ob express opg and rankl and their modulation is influenced by adipokines , sex hormones , redox balance , ppar and liver x receptors ( lxr ) . osteocalcin , an ob secreted bone matrix noncollagen protein , takes part in calcium metabolism and in bone deposition , as well as in energy homeostasis and glucose metabolism . fetuin - a , produced by the liver , is involved in the regulation of bone metabolism and insulin action , vascular calcification , neurodegenerative diseases and cancer cell proliferative signaling . ob lineage cells express receptors for adiponectin , leptin , angiotensin ii , insulin and insulin - like growth factor-1 , able to influence rank / rankl / opg signaling pathway . interestingly , these hormones are implicated in the pathogenesis of type - ii diabetes , obesity and hypertension , all of which are risk factors for metabolic syndrome . the development and progression of diabetes - associated osteoporosis are mediated by the interaction between advanced glycation end products ( age ) and receptor of age ( rage ) . age are the end products of glucose , as well as other sugars , proteins , lipids , and nucleic acids via a non - enzymatic glycosylation reaction , able to bind to multiple membrane receptor proteins , including rage . age / rage interaction is involved in the pathophysiological processes of many inflammatory and dysmetabolic diseases . in particular , age are involved in the development and progression of osteoporosis by inhibiting proliferation and inducing ob apoptosis . the binding of age to organic bone matrix may also increase the fragility of bones . autophagy is a metabolic process by which eukaryotic cells degrade and recover damaged macromolecules and organelles into autophagosomes autophagy is upregulated in stressful conditions . however , excessive autophagy is harmful to cells and leads to damage or massive death of cells . autophagy deficiency increases oxidative stress levels in ob , decreases bone mineralization and induces ran - kl secretion . it is well eatablished that several neuroendocrine pathways modulate both immune responses and bone remodeling . in turn sympathetic nerves produce catecholamines , which are delivered to the bone microenvironment by the blood circulation or by secretion from the nerve endings . hsc express catecholaminergic receptors , suggesting that they are able to directly respond to signals from the sympathetic nervous system . adrenergic signaling reduces cxcl12 expression in the bm . affecting maintenance of hsc and the differential lineage commitment . an association between major depression and osteoporosis has been recognized [ 96 - 99 ] . the prevalence of low bmd is higher in people with depression than the general population . interestingly , patients on antidepressant therapy with selective serotonin reuptake inhibitors develop decreased bmd and increased risk of fracture compared to those treated with tricyclic antidepressants such as amitriptyline or patients with untreated depression , who also have a lower bmd compared with healthy controls [ 100 , 101 ] . neuroendocrine abnormalities of the hypothalamo - pituitary - adrenal ( hpa ) and sympathoadrenal axes are a common finding in depressed patients leading to increased catecholamine turnover and hypersecretion of corticotropin - releasing hormone ( crh ) . leptin is expressed in the hypothalamus and pituitary gland , where it modulates corticotropin - releasing hormone and acth secretion , probably acting in an autocrine - paracrine manner . it inhibits steroid - hormone secretion from the adrenal cortex but enhances catecolamine release from the adrenal medulla , activating the sympathoadrenal axis . the neuromodulator serotonin or 5-hydroxy - tryptamine ( 5ht ) , which is an important vasoactive mediator of allergic reactions , in addition , it has recently been emerged that proinflammatory cytokines can modulate the central nervous system 5ht signaling , resulting in the conceptualization that 5ht participates in an integrated behavioral response to pathogens and inflammatory events . on the other hand , 5ht receptor expression on ocy and their precursors is involved in bone metabolism and its mechanoregulation . moreover , serotonin blocks the proliferation of ocp through the suppression of intracellular transcription factor creb , which regulates many genes involved in circadian rhythms in different tissues ( period 1,2,3 and clock genes ) . there are two anatomically and functionally distinct pools of serotonin : the first one , synthesized through the activity of the enzyme tryptophane - hydroxylase type 2 in the central nervous system , where it functions as neurotransmitter ; the second one is synthesized in the periphery through the activity of the tryptophane - hydroxylase 1 , regulated by the low - density lipoprotein receptor ( ldlr)-related protein-5 ( lrp5 ) . the circulating serotonin does not exceed the blood brain barrier and is for 95% produced by intestinal enterochromaffin cells in the intestine , where it stimulates peristalsis in response to the meal . the peripherally produced serotonin acts as a hormone inhibiting bone formation , whereas serotonin produced in the brain functions as a neurotransmitter , enhancing bone formation and limiting bone resorption . the neurological mechanism of action of serotonin on bone implicates also the interaction with the adipokine leptin , in an integrated homeostatic network with fat tissue and metabolism ( fig . a portion of 5ht is also produced by the mammary gland , where it acts as an autocrine - paracrine regulator of the epithelial homeostasis exerting antiproliferative and proapoptotic effects . in the course of pregnancy , lactation and menopause , the local serotonin production increases , contributing to the increased bone resorption typical of these phases of the woman 's life . small molecules able to specifically inhibit the intestinal tryptophane - hydroxylase and do not cross the blood brain barrier , have recently been proposed for the treatment of osteoporosis . in alzheimer s disease ( ad ) , a neurodegenerative disorder characterized by cortical and cerebrovascular amyloid peptide ( a ) deposits , neurofibrillary tangles , chronic inflammation , and neuronal loss , increased bone fracture rates and reduced bmd are commonly observed , suggesting common denominators between both disorders . amyloid precursor protein ( app ) is transmembrane protein involved in ad pathogenesis : app gene mutations characterize early - onset ad , and many risk factors or genes associated with late - onset ad appear to affect app trafficking and a production . rage , acting as an app / a binding partner , is therefore implicated in the pathogenesis of both ad and osteoporosis . the role of rage in oc maturation and activation is also mediated by its interaction with proinflammatory associated mac-1/2 integrin , the s100 family , and the high mobility group box 1(hmgb1 ) . in particular , hmgb1 is a proin - flammatory cytokine released from activated macro - phages , that promotes rankl - induced oc differentiation in a rage - dependent manner . shared signaling pathways among the complex immunological machineries involved in bone remodeling activate vicious cycles underlying both bone destruction and cancer growth . the release of growth factors in the skeletal microenvironment as a result of osteolysis induced by oc mediated bone resorption enhances metastases and cancer cell proliferation . in addition to the hyperproduction of proinflammatory cytokines , rank /rankl signal alterations are central in the pathogenesis of neoplastic osteolysis . the upregulation of rankl , particularly in myeloma and breast cancer , promotes the growth of neoplastic cells which express rank and protects them from dna damage induced programmed cell death . in this context , bone cells may represent potential therapeutic targets in the treatment of both secondary neoplastic osteoporosis and the underlying neoplasia . for example , bisphosphonate treatment of individuals with multiple myeloma reduces osteolytic events and tumor burden as well . the block of rankl by the monoclonal antibody denosumab , in addition to inhibiting bone resorption , is also useful in reducing tumor growth , in increasing apoptosis of malignant cells and in decreasing the inflammation that supports the neoplasia . its predominant effect on bone is through the central nervous system : by stimulating specific receptors ( lepr ) on both serotonergic brainstem neurons and the hypothalamic ventromedial nucleus , which interact each other , it increases central sympathetic activity . inhibitory signals are transmitted through sympathetic fibers from the hypothalamic ventromedial nucleus to 2-adrenergic receptors ( 2-ar ) expressed on ob , suppressing their differentiation and osteocalcin production . serotonin is synthesized in serotonergic neurons of the central nervous system , exerting various functions in the brain ; it is also synthesized in the gut , mediating different peripheral functions . it acts on bone cells using three different receptors : through 5ht1b receptors , it negatively regulates bone mass , while it enhances bone formation through 5ht2b and 5ht2c receptors . the crosstalk between skeletal and bone marrow is crucial to hematopoietic stem cell ( hsc ) function and throughout the hemopoiesis . hsc occupy specific locations in the bone marrow microenvironment , commonly referred to as niches , comprising multiple cell types able to regulate hsc proliferation and differentiation . hematopoietic and skeletal stem cell homeostasis are closely related : msc progeny express numerous cytokines necessary for hsc maintenance and hematopoiesis , including kit ligand and stromal - derived factor , but also stem and progenitor cells of the hematopoietic system may reciprocally regulate skeletal progenitors by expressing myriad factors associated with skeletogenesis , whose cognate receptors are highly expressed by skeletal stem cells . interestingly , these latter exhibit receptors to circulating hormones , such as leptin and thyroid - stymulating hormone , suggesting that skeletal stem cells and their progeny may link systemic exocrine regulation to both skeletal and hematopoietic system . primitive mesenchymal progenitors are more critical for hsc function , whereas lineage - restricted mesenchymal cells control more committed hematopoietic progenitors . bone microenvironment is therefore a composite of specialized niches providing distinctive functional units to regulate hematopoiesis . the estrogen deficiency induces a marked increase of inflammatory cytokines and mediators of inflammation , in particular ifn- , m - csf , tnf- , il-1 , il-6 and il-7 , in addition to prostaglandins ( pge ) and reactive oxygen species ( ros ) , which play a driving role in the development of osteoporosis . of particular interest is the expansion in the peripheral blood from postmenopausal women of two particular lymphocyte subsets , cd3 + cd56 + t lymphocytes , major producers of tnf- , and b220 + igm - b lymphocyte precursors , that under certain stimuli can differentiate into ocp and are strong producers of inflammatory cytokines . the enhanced tnf- production by activated t cells has a central role in bone loss due to estrogen decline in menopausal women . the same ifn- , which in some situations could be protective against osteoporosis , during estrogen deficiency has a prevailing osteoclastogenic stimulating action . the estrogen decline also results in the decrease of opg and tgf- that normally contrast the effects of inflammatory mediators on bone . the age - related increase of inflammatory cytokines results from a chronic activation of macrophages and memory / effector t cells , in addition to an impaired treg function . a peculiar finding of immunosenescence is the increased number of senescent memory cells expressing rankl and secreting osteoclastogenic cytokines , mainly tnf- , il-1 , il-6 and il-17 . these cytokines are able to facilitate ocp expansion which amplify the systemic inflammation by producing further proinflammatory factors able to recruit other inflammatory cells and perpetuating the flogistic vicious cycle . both the increased transcriptional activity of nf - kb due to genotoxic , inflammatory , and oxidative stresses in aging , and the chronic p53 activation induced by the age - related progressive loss of telomere length , result in impaired ob proliferation and osteoporosis development . cells of the immune system and bone cells derive from bone marrow precursors and develop in the same bone marrow microenvironment . hematopoietic and immune cells share same signaling pathways with cells of the bone and their precursors , which surprisingly do not take part in the regulation of immunity and hemopoiesis . ob , together with msc , are crucial components of the niche of growth of hsc . ob overexpression of the wnt antagonist dkk1 reduces wnt signaling in hsc and disrupts hsc self - renewal potential . the wnt antagonist secreted frizzled - related protein 1 ( sfrp1 ) is involved in osteoblastic mediated hsc regulation ; through its regulation of ob , pth controls the hematopoietic niche function , involving crosstalk with wnt signaling . the upregulation of notch ligand protein jagged-1 ( jag1 ) expression in ob and the increased notch signaling are involved in increasing hsc numbers ; angiopoietin-1 receptor activation on hsc by ob produced angiopoietin-1 promotes strict adhesion of hsc to the niche , inducing quiescence of these cells . osteopontin , an ob - secreted protein , participates in hsc location and is a negative regulator of their proliferation . also , ocy derived from ob that become embedded within the bone matrix , are involved in the complex regulation of hemopoiesis through the osteoimmune interface : mainly by the production of sclerostin , they appear to have an inhibitory effect on hsc support . even oc , as well as activated endothelial cells , are likely involved in the mobilization of hsc by cytokine induced cam expression . being the only cells capable of bone resorption , in addition to allowing the renewal of the skeleton , they also open the space in the bone marrow for hematopoietic cells . moreover , osteoclastic bone resorption releases calcium , which attracts and retains calcium sensing receptor expressing hsc at the endosteal region . macrophages play diverse roles in the bone and marrow . at the sites of bone remodeling , a subset of hsc is located in close proximity to megakaryocytes in the bone marrow , where ob undergo rapid expansion in response to the secretion of megakaryocyte - derived mesenchymal growth factors , such as platelet derived growth factor ( pdgf)- , to promote hsc proliferation . the bone marrow microenvironment can also act as a niche for the onset and progression of neoplastic diseases , including both hematologic malignancies and metastases of solid tumors , mainly breast and prostatic cancer . in multiple myeloma , an osteolytic hematological malignancy characterized by an important skeletal involvement , neoplastic plasma cells produce a large amount of mediators that induce osteoclastic bone resorption and block the activity of ob . in addition to osteolytic factors , myeloma cells produce dkk1 , which inhibits obp differentiation by binding to the lrp5/6 coreceptors expressed on their surface . on the other hand , the same bone cells produce growth factors and angiogenetic cytokines able to support the development and progression of myeloma , perpetuating a vicious circle of mutual reinforcement . a promising new field of interest in this regard is the osteo - immune - oncology . there is in fact a close relationship between immune regulation of bone turnover and tumor growth . often , cancer cells express rank and in proneoplastic inflammation various cell types express rankl that acts as chemotactic factor favoring the skeletal metastasis . tumor cells in the bone cause activation of osteoclasts that mediate bone resorption and additional growth factor release from the bone matrix , fueling a vicious circle of impaired bone turnover and tumor proliferation ( fig . 5 ) . in skeletal metastases , not always the tumor associated inflammation is the expression of an immune system that successfully opposes the neoplastic growth , as previously believed , but sometimes some patterns of immune activation can be facilitators of the development of tumors . then the block of rankl , in addition to inhibiting bone resorption , also decreases tumor growth , enhances apoptosis of malignant cells and diminishes proneoplastic inflammation . osteal macrophages , as well as macrophages in other tissues , have a role in tumor progression , supporting cancers which preferentially metastasize to the skeleton , in particular breast and prostate cancer . osteal macrophages expressing cd68 , a phagocytic capacity marker of cells infiltrating metastatic lesions , could facilitate tumor establishment and growth . tumor - derived pthrp drives myeloid cell recruitment via ob produced ccl2 , which is high in the bone microenvironment and whose levels are associated with poor prognoses in primary breast tumors . as for bone , adipose tissue is a kind of immune tissue and produces immunoregulatory factors . adipocytes and ob derive from the same msc , as well as visceral adipose tissue macrophages and oc derive from the same hsc . shared transcription factors regulate the shift between the different cell lines and the subsequent differentiation cascade . by action of peroxisome proliferative activated receptor gamma ( ppar ) , the principal regulator of adipogenesis , the msc differentiates into adipocytes rather than into ob . in contrast , the expression of runt - related transcription factor 2 ( runx2 ) , associated with ob differentiation , and osterix , an ob zinc finger containing transcription factor , shift the equilibrium towards the osteoblastogenesis . mechanical loading promotes ob differentiation and inhibits adipogenesis by down - regulating ppar or by stimulating a durable -catenin signal . not surprisingly , ppar agonists such as thiazolidinediones used to increase insulin sensitivity in type 2 diabetes , also increase the risk of osteoporotic fractures . leptin is a pro - inflammatory adipokine that exerts its actions via central nervous system regulation of feeding behavior , where it promotes satiety and prevents weight gain . leptin can also directly signal through its receptor expressed on immunocytes , where it induces tnf- and il-6 production by monocytes , chemokines by macrophages , and th1 cytokines from polarized cd4 + t cells . adiponectin is an anti - inflammatory adipokine whose plasma levels are strongly correlated with insulin sensitivity and glucose tolerance . it can directly interfere with inflammatory cytokine production in macrophages and can induce expression of the anti - inflammatory cytokine il-10 . tnf- and il-6 inhibit adiponectin production in adipocytes . adipose tissue produced pro - inflammatory cytokines and adipokines further modulate the activity of oc and ob . fat tissue , mainly visceral fat tissue , may increase bone resorption through the production of inflammatory cytokines such as il- 6 and tnf- , which stimulate oc activity through the regulation of the rankl / rank / opg pathway . leptin and adiponectin act on the bone through different signaling pathways with contrasting effects ( table 2 ) . it promotes adipogenesis and inhibits osteogenesis in response to diet and adiposity by activating jak2/stat3 signaling . therefore , leptin receptors on skeletal msc function as a sensor of systemic energy homeostasis . various cell populations within the fat tissue can exacerbate the development of the chronic , low - grade inflammation associated with obesity and metabolic dysfunction . white adipocytes store lipid as triglycerides within unilocular droplets , and are responsive to various stimuli , such as insulin . brown adipocytes store lipid in multilocular droplets that are quickly catabolized for fuel when the tissue is stimulated . beige adipocytes , dispersed within white adipose tissue , can dissipate heat , similarly to classical brown adipocytes , when exposed to cold temperatures or after prolonged highfat diet feeding . visceral fat tissue infiltrating macrophages in the setting of diet - induced obesity , have a pro - inflammatory phenotype which initiates and/or exacerbates the chronic inflammation that contributes to adipocyte dysfunction in obesity . conversely , in lean humans adipose tissue macrophages may promote tissue remodeling and temper inflammation by secreting anti - inflammatory cytokines . notwithstanding epidemiological evidence indicates that an increase in body mass index ( bmi ) is related to increased bone mass , probably due to the effects of the mechanical load of the body weight on the skeleton , not always obesity , and mainly the increase in visceral fat mass , has a positive effect on bone . obesity is associated with increased leptin and decreased adiponectin serum levels . moreover , in the visceral adipose tissue there are activated macrophages producing cytokines . in obese subjects , especially with central obesity , in which the visceral fat is increased , there is a significant increase of several markers of inflammation such as c reactive protein ( crp ) , il-1 , il-6 and tnf- , that can alter the quality of the bone , making it more fragile . therefore , these new clinical and experimental evidences definitively connect obesity and other related pathological conditions , such as metabolic syndrome , nonalcoholic fatty liver disease ( nafld ) and diabetes , to impaired bone health and fragility fractures [ 90 - 93 ] . in conclusion , it is currently emerging that adipose tissue , liver , bone and immune system modulate each other through a complex network of interconnected signals . both adipocytes and ob express opg and rankl and their modulation is influenced by adipokines , sex hormones , redox balance , ppar and liver x receptors ( lxr ) . osteocalcin , an ob secreted bone matrix noncollagen protein , takes part in calcium metabolism and in bone deposition , as well as in energy homeostasis and glucose metabolism . fetuin - a , produced by the liver , is involved in the regulation of bone metabolism and insulin action , vascular calcification , neurodegenerative diseases and cancer cell proliferative signaling . ob lineage cells express receptors for adiponectin , leptin , angiotensin ii , insulin and insulin - like growth factor-1 , able to influence rank / rankl / opg signaling pathway . interestingly , these hormones are implicated in the pathogenesis of type - ii diabetes , obesity and hypertension , all of which are risk factors for metabolic syndrome . the development and progression of diabetes - associated osteoporosis are mediated by the interaction between advanced glycation end products ( age ) and receptor of age ( rage ) . age are the end products of glucose , as well as other sugars , proteins , lipids , and nucleic acids via a non - enzymatic glycosylation reaction , able to bind to multiple membrane receptor proteins , including rage . age / rage interaction is involved in the pathophysiological processes of many inflammatory and dysmetabolic diseases . in particular , age are involved in the development and progression of osteoporosis by inhibiting proliferation and inducing ob apoptosis . the binding of age to organic bone matrix may also increase the fragility of bones . autophagy is a metabolic process by which eukaryotic cells degrade and recover damaged macromolecules and organelles into autophagosomes autophagy is upregulated in stressful conditions . however , excessive autophagy is harmful to cells and leads to damage or massive death of cells . autophagy deficiency increases oxidative stress levels in ob , decreases bone mineralization and induces ran - kl secretion . it is well eatablished that several neuroendocrine pathways modulate both immune responses and bone remodeling . in turn sympathetic nerves produce catecholamines , which are delivered to the bone microenvironment by the blood circulation or by secretion from the nerve endings . hsc express catecholaminergic receptors , suggesting that they are able to directly respond to signals from the sympathetic nervous system . adrenergic signaling reduces cxcl12 expression in the bm . affecting maintenance of hsc and the differential lineage commitment . an association between major depression and osteoporosis has been recognized [ 96 - 99 ] . the prevalence of low bmd is higher in people with depression than the general population . interestingly , patients on antidepressant therapy with selective serotonin reuptake inhibitors develop decreased bmd and increased risk of fracture compared to those treated with tricyclic antidepressants such as amitriptyline or patients with untreated depression , who also have a lower bmd compared with healthy controls [ 100 , 101 ] . neuroendocrine abnormalities of the hypothalamo - pituitary - adrenal ( hpa ) and sympathoadrenal axes are a common finding in depressed patients leading to increased catecholamine turnover and hypersecretion of corticotropin - releasing hormone ( crh ) . leptin is expressed in the hypothalamus and pituitary gland , where it modulates corticotropin - releasing hormone and acth secretion , probably acting in an autocrine - paracrine manner . it inhibits steroid - hormone secretion from the adrenal cortex but enhances catecolamine release from the adrenal medulla , activating the sympathoadrenal axis . the neuromodulator serotonin or 5-hydroxy - tryptamine ( 5ht ) , which is an important vasoactive mediator of allergic reactions , is also likely involved in interactions between the central nervous and immune systems . in addition , it has recently been emerged that proinflammatory cytokines can modulate the central nervous system 5ht signaling , resulting in the conceptualization that 5ht participates in an integrated behavioral response to pathogens and inflammatory events . on the other hand , 5ht receptor expression on ocy and their precursors is involved in bone metabolism and its mechanoregulation . moreover , serotonin blocks the proliferation of ocp through the suppression of intracellular transcription factor creb , which regulates many genes involved in circadian rhythms in different tissues ( period 1,2,3 and clock genes ) . there are two anatomically and functionally distinct pools of serotonin : the first one , synthesized through the activity of the enzyme tryptophane - hydroxylase type 2 in the central nervous system , where it functions as neurotransmitter ; the second one is synthesized in the periphery through the activity of the tryptophane - hydroxylase 1 , regulated by the low - density lipoprotein receptor ( ldlr)-related protein-5 ( lrp5 ) . the circulating serotonin does not exceed the blood brain barrier and is for 95% produced by intestinal enterochromaffin cells in the intestine , where it stimulates peristalsis in response to the meal . the peripherally produced serotonin acts as a hormone inhibiting bone formation , whereas serotonin produced in the brain functions as a neurotransmitter , enhancing bone formation and limiting bone resorption . the neurological mechanism of action of serotonin on bone implicates also the interaction with the adipokine leptin , in an integrated homeostatic network with fat tissue and metabolism ( fig . a portion of 5ht is also produced by the mammary gland , where it acts as an autocrine - paracrine regulator of the epithelial homeostasis exerting antiproliferative and proapoptotic effects . in the course of pregnancy , lactation and menopause , the local serotonin production increases , contributing to the increased bone resorption typical of these phases of the woman 's life . small molecules able to specifically inhibit the intestinal tryptophane - hydroxylase and do not cross the blood brain barrier , have recently been proposed for the treatment of osteoporosis . in alzheimer s disease ( ad ) , a neurodegenerative disorder characterized by cortical and cerebrovascular amyloid peptide ( a ) deposits , neurofibrillary tangles , chronic inflammation , and neuronal loss , increased bone fracture rates and reduced bmd are commonly observed , suggesting common denominators between both disorders . amyloid precursor protein ( app ) is transmembrane protein involved in ad pathogenesis : app gene mutations characterize early - onset ad , and many risk factors or genes associated with late - onset ad appear to affect app trafficking and a production . rage , acting as an app / a binding partner , is therefore implicated in the pathogenesis of both ad and osteoporosis . the role of rage in oc maturation and activation is also mediated by its interaction with proinflammatory associated mac-1/2 integrin , the s100 family , and the high mobility group box 1(hmgb1 ) . in particular , hmgb1 is a proin - flammatory cytokine released from activated macro - phages , that promotes rankl - induced oc differentiation in a rage - dependent manner . shared signaling pathways among the complex immunological machineries involved in bone remodeling activate vicious cycles underlying both bone destruction and cancer growth . the release of growth factors in the skeletal microenvironment as a result of osteolysis induced by oc mediated bone resorption enhances metastases and cancer cell proliferation . in addition to the hyperproduction of proinflammatory cytokines , rank /rankl signal alterations are central in the pathogenesis of neoplastic osteolysis . the upregulation of rankl , particularly in myeloma and breast cancer , promotes the growth of neoplastic cells which express rank and protects them from dna damage induced programmed cell death . in this context , bone cells may represent potential therapeutic targets in the treatment of both secondary neoplastic osteoporosis and the underlying neoplasia . for example , bisphosphonate treatment of individuals with multiple myeloma reduces osteolytic events and tumor burden as well . the block of rankl by the monoclonal antibody denosumab , in addition to inhibiting bone resorption , is also useful in reducing tumor growth , in increasing apoptosis of malignant cells and in decreasing the inflammation that supports the neoplasia . its predominant effect on bone is through the central nervous system : by stimulating specific receptors ( lepr ) on both serotonergic brainstem neurons and the hypothalamic ventromedial nucleus , which interact each other , it increases central sympathetic activity . inhibitory signals are transmitted through sympathetic fibers from the hypothalamic ventromedial nucleus to 2-adrenergic receptors ( 2-ar ) expressed on ob , suppressing their differentiation and osteocalcin production . serotonin is synthesized in serotonergic neurons of the central nervous system , exerting various functions in the brain ; it is also synthesized in the gut , mediating different peripheral functions . it acts on bone cells using three different receptors : through 5ht1b receptors , it negatively regulates bone mass , while it enhances bone formation through 5ht2b and 5ht2c receptors . immune system and skeletal system interact with each other both in physiological and pathological conditions . considerable progress has been made in clarifying the crosstalk between bone and immune system that occurs in a complex and dynamic bone microenvironment . a central role in this crosstalk osteoimmunology therefore represents a new approach to studying osteoporosis that in the past was not considered an inflammatory condition . moreover , the discoveries of the existence of the immunoskeletal interface has also highlighted interesting repercussions for a wide range of pathological conditions beyond osteoporosis , including infections , autoimmune diseases , and neoplasia , in which same pathogenetic pathways are shared . osteoporosis could be therefore considered as a systemic model of integrated signaling pathways and cytokines working in a cooperative fashion . further important research horizons are opened with the extension of the discoveries of osteoimmunology and the disclosure of the immunoskeletal interface , whose practical implications may provide novel therapies for diseases other than osteoporosis , by targeting specific transcription factors , cytokines and their receptors . the correct understanding and decoding of the complex language through which immune system and bone communicate , although still in its dawn , is the essential requirement for the identification of such potentially useful therapeutic targets for both osteoporosis and other correlated inflammatory conditions , which share same mediators and signaling pathways .

abstract : objectiveosteoimmunology investigates interactions between skeleton and immune system . in the light of recent discoveries in this field , a new reading register of osteoporosis is actually emerging , in which bone and immune cells are strictly interconnected . osteoporosis could therefore be considered a chronic immune mediated disease which shares with other age related disorders a common inflammatory background . here , we highlight these recent discoveries and the new landscape that is emerging.methodextensive literature search in pubmed central.resultswhile the inflammatory nature of osteoporosis has been clearly recognized , other interesting aspects of osteoimmunology are currently emerging . in addition , mounting evidence indicates that the immunoskeletal interface is involved in the regulation of important body functions beyond bone remodeling . bone cells take part with cells of the immune system in various immunological functions , configuring a real expanded immune system , and are therefore variously involved not only as target but also as main actors in various pathological conditions affecting primarily the immune system , such as autoimmunity and immune deficiencies , as well as in aging , menopause and other diseases sharing an inflammatory background.conclusionthe review highlights the complexity of interwoven pathways and shared mechanisms of the crosstalk between the immune and bone systems . more interestingly , the interdisciplinary field of osteoimmunology is now expanding beyond bone and immune cells , defining new homeostatic networks in which other organs and systems are functionally interconnected . therefore , the correct skeletal integrity maintenance may be also relevant to other functions outside its involvement in bone mineral homeostasis , hemopoiesis and immunity .

the unique architecture of axons poses a significant demand on the cell body , as most newly synthesized proteins , organelles , and mrnas originate in the soma and require long - distance delivery into axons . axonal dysfunction and impaired axonal transport are frequently described as among the earliest and possibly causative changes in age - related neurodegenerative diseases ( adalbert and coleman , 2013 ; millecamps and julien , 2013 ) . as axonal transport declines during normal aging however , little is known about the nature of this decline in individual axons , specifically regarding timing , affected cargoes , similarities between peripheral nerves and the central nervous system ( cns ) , and the potential to reverse these changes . most studies either analyze the bulk transport of several cargoes in all axons of a nerve ( brunetti et al . , 1987 ; cross et al . , 2008 ; frolkis et al . , 1997 ; geinisman et al . , 1977 ; mcquarrie et al . , 1989 ; stromska and ochs , 1982 ) or investigate a specific cargo in all axons ( castel et al . , 1994 ; fernandez and hodges - savola , 1994 ; goemaere - vanneste et al . , 1988 ; li et al . , 2003 ; mcmartin and o'conner , 1979 ; tashiro and komiya , 1994 ) without giving insight into individual axons . it is , for example , important to clarify whether a global reduction in axonal transport reflects reduced transport in individual axons or simply axon loss . conventional tracking of radiolabeled cargoes or newer approaches using tetanus neurotoxin ( millecamps and julien , 2013 ) do not easily allow this distinction . video - enhanced imaging provides information on transport rates in individual axons ( viancour and kreiter , 1993 ) but does not easily distinguish between different cargoes . mitochondrial transport declines in individual peripheral nerve axons between 8 and 24 months of age ( gilley et al . , 2012 ) , but how much this is representative of other cargoes and other regions of the nervous system , especially in the cns , remains unknown . in addition , little is known about when during adulthood these changes occur , or whether they can be reversed . live - imaging studies of axonal transport in nervous system tissue have largely focused on mitochondria ( gilley et al . , 2012 ; mar et al . , 2014 ; marinkovic et al . , 2012 ; misgeld et al . , 2007 ) but whether this is fully representative of other cargoes is unclear . one cargo that appears to be of particular importance is nicotinamide mononucleotide adenylyltransferase 2 ( nmnat2 ) , as we propose that a reduced supply of this critical axon - survival factor could place axons at increased risk of degeneration ( conforti et al . , 2014 ) . we previously described the use of nmnat2-venus mice to visualize axonal transport of fluorescently tagged nmnat2 ( milde et al . , 2013a ) . here , we use live imaging of peripheral nerve and cns explants to study age - associated changes in the fast axonal transport of nmnat2 and mitochondria . the data reveal 2 separate periods of declining axonal transport in some parts of the nervous system , 1 period as the growth phase plateaus and the other in old age . intriguingly , we show that neurons in aged mice are still capable of supporting higher rates of fast axonal transport , suggesting the existence of signals that can reverse the age - related decline in axonal transport . all animal work was approved by the babraham institute animal welfare and experimentation committee and carried out in accordance with the animals ( scientific procedures ) act , 1986 , under project licenses 80/2254 and 70/7620 . the generation , breeding , genotyping , and initial characterization of nmnat2-venus mice expressing nmnat2-yfp(venus ) under the neuron - specific thy1.2 promoter was described previously ( milde et al . , 2013a ) . mitos mice ( thy1.2-mitocfp - s ) ( misgeld et al . , 2007 ) were kindly provided by prof . animals were used for transport imaging ( see 2.3 below ) at indicated ages ( see results ) . we observed no significant difference between transport parameters in male and female animals of the same age for any of the measures used , so data from both sexes was combined for all analyses . all animals were heterozygous for the relevant transgene and c57bl/6jbabr mice ( babraham institute ) were used for breeding . animals were kept on a 12:12 hours light : dark cycle at a constant temperature of 19 c in a pathogen - free environment with up to 5 animals per cage . mice were humanely killed by cervical dislocation followed by exsanguination . for analysis of pns axonal transport , sciatic nerves were dissected rapidly and immersed immediately into pre - warmed ( 37 c ) , pre - oxygenated neurobasal - a medium ( gibco ) . for analysis of cns axonal transport , mice were subsequently decapitated and the head immersed in pre - warmed , pre - oxygenated neurobasal - a medium . optic nerves and the fimbria of the hippocampus were then dissected out and transferred into pre - warmed oxygenated neurobasal - a medium . optic nerves were removed by transection behind the eye globe and at the rostral limit of the optic chiasm . to remove the fimbria of hippocampus , first the cortex and striatum were dissected out on both sides of the brain , followed by the hippocampus . the fimbria and body of fornix were cleaned of any attached gray matter before imaging . imaging of axonal transport in tissue explants was performed on an olympus cell imaging system ( ix81 microscope , hamamatsu orca er camera , 100 1.45 na apochromat objective ) . during imaging , tissues were maintained in oxygenated neurobasal - a medium at 37 c in an environment chamber ( solent scientific ) . images were captured using fixed light intensity and camera exposure time settings at a rate of 2 frames per second for 1.5 to 3 minutes . five to 10 individual movies ( often containing multiple axons ) were captured for each tissue explant . to ensure reproducibility between experimental days , 3-month - old animals were imaged on all experimental days along with animals of other ages . individual axons were straightened ( except where indicated ) using the straighten plugin in imagej software version 1.44 ( rasband , w.s . , imagej , u. s. national institutes of health , bethesda , md ; http://imagej.nih.gov/ij/ , 19972012 ) . axonal transport parameters were determined for individual axons using the differencetracker set of imagej plugins ( andrews et al . , 2010 ) . the principal output of these plugins is the number of moving particles identified in each frame of the image , normalized to axon length ( presented as particle count per second per 100 m axon length ) and the average and maximum velocities of the detected moving particles ( shown in m / s ) . it is important to note that the plugin does not track a particle once it has become stationary and thus does not take into account pauses in movement or reversals of direction . these are instead represented as new tracks in the output ( see andrews et al . , 2010 ) . details of analysis parameters are listed in table 2 . on average , 14 , 12 , and 17 axons were analyzed for each sciatic nerve , optic nerve and fimbria explant , respectively . for nerve crush and regeneration experiments , mitos ( n = 4 , male ) and nmnat2-venus ( n = 4 , female ) animals at 23 months of age were anaesthetized with isoflurane and the distal part of the sciatic nerve was exposed and crushed above knee level by applying firm pressure using fine forceps ( dumont # 5 ) for 20 seconds . four weeks after surgery , recovery of motor function was assessed based on gait , grasp and posture , all of which showed good functionality . eight weeks after surgery , animals were killed by cervical dislocation , and both tibial nerves were dissected and processed for live imaging as described above . both tibial nerves were removed into warm , oxygenated neurobasal a medium immediately after the animal had been killed . the order of imaging of control and crushed nerves was alternated between animals to control for the amount of time that nerves were kept in medium before imaging . after live imaging , nerves were processed for semi - thin sectioning ( 500-nm section thickness ) , staining , and imaging as described previously ( adalbert et al . , 2005 ; milde et al . , 2013a ) , to confirm the extent of axon regeneration and to assess the morphology of the regenerated nerve . statistical analyses were performed using graphpad prism 6 ( graphpad software inc ) and spss statistics 20 ( ibm ) . where indicated , age groups were combined to increase statistical power . the critical axon survival factor nmnat2 ( gilley and coleman , 2010 ; gilley et al . , 2013 ) associates with a golgi - derived axonal transport vesicle population through palmitoylation of a double - cysteine motif in its central isoform - specific targeting and interaction domain ( lau et al . , 2010 ; milde et al . , 2013b ) and undergoes fast axonal transport ( gilley and coleman , 2010 ; milde et al . , 2013a ) . to study the transport parameters of nmnat2 vesicles in aging animals , we used nmnat2-venus mice ( milde et al . , 2013a ) . we assayed axonal transport using fluorescence live imaging of acute tissue explants combined with semi - automated image analysis using the imagej differencetracker plugins with settings shown in table 2 ( see methods ) . importantly , however , stationary or pausing particles are excluded from the analysis and not quantified ( see methods for details ) . for a thorough characterization of the time course of age - associated changes , we studied 6 groups of animals at ages ranging from 1.5 to 24 months . to investigate age - associated changes of nmnat2 vesicles in peripheral axons , we imaged and quantified the axonal transport of nmnat2-venus particles in sciatic nerve axons ( fig 1a ) . average ( total displacement of a particle / time tracked ) and maximal ( farthest displacement of each tracked particle between 2 frames ) particle velocities in both anterograde and retrograde directions remained stable from 1.5 and 18 months , but then reduced significantly in animals at 24 months of age ( fig 1b and c ) . surprisingly , the number of particles observed moving anterogradely and retrogradely showed a significant drop even in young animals between the ages of 3 and 6 months . this was followed by a relatively stable plateau that was maintained at least up to 18 months . from 18 to 24 months , another significant reduction in the number of anterogradely moving particles was observed , along with a similar , but statistically nonsignificant trend in the retrograde direction ( fig 1d and e ) . to test whether these changes could have been caused by changes in expression level of the transgene over the lifetime of the animals , which might impair tracking of particles , we quantified the average fluorescence intensity of labeled axons from animals of different ages . as shown in table 3 , there were no consistent trends or differences in fluorescence intensity that would explain the observed changes in the number of moving particles . the significant drop in transport rates of nmnat2-venus particles observed from 3 to 6 months of age prompted us to ask whether this was a general effect on multiple fast axonal transport cargoes , or perhaps a more specific effect on nmnat2 vesicles . to start addressing this question , we imaged mitochondrial transport in sciatic nerves of mitos mice expressing mitochondrially targeted cfp under the same thy1.2 promoter ( fig 2a ) . we previously reported a fall in axonal transport in these mice between 8 and 24 months ( gilley et al . , 2012 ) , but earlier ages have not been studied . here , we observed a significant drop in the number of anterogradely and retrogradely transported mitochondria from 3 to 6 months of age , with no further change until at least 12 months ( fig 2b and c ) . over the same time course , no significant changes in transport velocities , changes in the average fluorescence intensity of labeled axons are unlikely to account for these differences ( table 3 ) . these findings parallel the results for nmnat2-venus above and suggest a general reduction in fast axonal transport rates in peripheral nerves between 3 and 6 months of age , followed by a more stable plateau during adult life . combined with our findings in older mitos mice ( gilley et al . , 2012 ) , these results suggest 2 major periods of reduction in the fast axonal transport of several cargoes , 1 occurring in young animals between 3 and 6 months of age , and the other during old age after 18 months . most of the existing studies that have reported fluorescence live imaging of axonal transport have , presumably at least in part because of technical difficulties , focused on the peripheral nervous system . however , many age - associated neurodegenerative conditions affect the cns ( adalbert and coleman , 2013 ; millecamps and julien , 2013 ) , highlighting the need to understand how aging affects the function of cns neurons , including their axonal transport . thus , we aimed to use nmnat2-venus mice to investigate age - associated changes in cns axonal transport . in addition to technical advantages ( easy accessibility , rapid dissection ) , degeneration of retinal ganglion cells and their axons , which constitute the optic nerve , contributes critically to pathology in glaucoma ( beirowski et al . bidirectional fast axonal transport of nmnat2-venus particles was readily and reproducibly detectable in optic nerve explants . individual axons were identified in time - lapse recordings and straightened , and quantification of axonal transport was performed in the same way as for sciatic nerve axons , above ( fig 3a ) . however , the dissection and imaging procedures used here mean that anterograde and retrograde transport were not analyzed separately and , instead , only overall transport rates were measured . interestingly , we observed an overall similar profile of transport changes from 1.5 to 24 months of age as for sciatic nerve axons . however , the reduction in the number of moving particles at a young age occurred earlier , from 1.5 to 3 months , with a stable plateau from 3 to 18 months and a further significant drop at 24 months of age ( fig 3b ) . average and maximal transport velocities were more variable overall than for sciatic nerve , but no consistent trends or significant changes were observed ( fig 3c ) . although the average fluorescence intensity of labeled axons in the optic nerve varied somewhat with age ( table 3 ) , there is no decline relative to young mice and no consistent relationship between increases or decreases in label intensity and the number of moving particles detected . thus , simple changes in expression level are unlikely to account for the observed differences . instead , these results indicate that , as for sciatic nerve axons above , 2 phases of reductions in axonal transport rates in young and old animals are separated by a stable plateau in adults . to extend our observations to an additional cns region this white matter bundle consists of a large number of parallel axons that can be dissected free from surrounding tissue while maintaining a considerable length of intact axon . although some optimization of dissection technique and duration was required ( fig 4a h and methods ) , we reproducibly observed a large number of bidirectionally mobile particles undergoing fast axonal transport along the axon tracts in the left and right side fimbria . it is important to note that the bidirectional orientation of axons in this area prevents separate analysis of anterograde and retrograde axonal transport ( fig 4i ) . as in optic and sciatic nerves , axonal transport of nmnat2-venus in the fimbria we observed a significant drop in the number of nmnat2-venus particles undergoing axonal transport from 1.5 to 3 and from 3 to 6 months of age , followed by a stable plateau ( fig 4j ) . intriguingly , there was no evidence of a second period of decreasing axonal transport rates up to 24 months of age . instead , the plateau observed in adult animals from 6 months onward appeared to be stable until at least 24 months . over the complete time course of our analysis , no significant changes in average or maximal transport velocities these findings hint at possible tissue - specific effects of old age on axonal transport rates of nmnat2-venus particles . as for the other tissues investigated , changes in the average fluorescence intensity of labeled axons are unlikely to account for the observed differences in transport ( table 3 ) . we also attempted to measure mitochondrial transport in optic nerve and fimbria explants from mitos mice in the same way as for nmnat2-venus . however , a reliable quantification of mitochondrial transport in these tissues was not achieved , as we frequently observed little or no movement with mitochondria that had adopted a rounded - up morphology ( data not shown ) . this could be linked to the known sensitivity of mitochondrial trafficking to calcium influx ( wang and schwarz , 2009 ) and suggests that , for analysis of cns axonal transport in explanted tissue , nmnat2-venus mice could be a more robust model than mitos . given the above results showing a significant decline in nmnat2-venus transport from 18 to 24 months of age in several parts of the nervous system , together with previous results indicating a similar decline in mitochondrial transport ( gilley et al . , 2012 ) , the possibility of reversing this decline could be useful both to study its consequences and for application in age - related disorders . to test whether aged neurons in an old systemic environment can , in principle , support a higher rate of transport given the right signals , we reasoned that a regenerative response could be a way to provide these signals . for this , we performed a crush injury in 1 of the tibial nerves in 23-month - old nmnat2-venus or mitos mice . peripheral nerve regeneration has been previously been shown to still occur in aged mice , albeit at slower speeds than in young mice ( tanaka and webster , 1991 ; tanaka et al . , 1992 ) , and in younger animals it is known to transiently enhance axonal transport ( mar et al . , 2014 ; in agreement with this , we found that functional recovery was well advanced 4 weeks after injury , as judged based on posture , gait , and grasp . in order to focus the study on longer - term effects of nerve repair rather than any residual , longitudinal axon growth , we allowed animals to survive for several more weeks to study rates of axonal transport in the regenerated nerves at or approaching 8 weeks after the original injury . semi - thin sections of tibial nerves from the injured leg revealed large numbers of intact myelinated axons , confirming that successful regeneration had taken place , with myelin sheaths and axon calibers still slightly thinner than in uninjured contralateral nerves as expected ( fig 5a ) . interestingly , these regenerated axons also showed myelin irregularities similar to those observed in the uninjured control axons , suggesting that newly regenerated and remyelinated axons very quickly acquire these structural abnormalities in old animals . measuring the rates of axonal transport in these axons , we observed a consistent , statistically significant increase in the number of anterogradely moving particles in the regenerated axons in mitos ( fig 5b ) and nmnat2-venus mice ( fig 5d ) compared to axons in the contralateral uninjured nerve . the regenerated nerves supported a level of anterograde axonal transport not dissimilar to those in much younger mice ( figs 1 and 2 ) . retrograde transport was not significantly increased in either mitos ( fig 5c ) or nmnat2-venus mice ( fig 5e ) , although we did observe a statistically nonsignificant trend for increased retrograde transport in regenerated mitos axons ( fig 5c ) . average or maximum transport velocities were not altered in regenerated axons relative to uninjured control axons ( data not shown ) . these findings suggest that neurons in 24- to 25-month - old mice are still capable of supporting significantly higher levels of axonal transport , indicating that the age - related decline in transport rates described above is at least partially reversible . interestingly , the structural abnormalities and myelin invaginations we observed in the regenerated axons of mitos and nmnat2-venus mice ( fig 5a ) , suggest that an improvement in the structural appearance of the regenerated axons is not required for this response . here we report evidence to suggest that 2 independently transported cargoes mitochondria and the axon survival factor nmnat2show a similar pattern of declining axonal transport during aging . an early drop between 1.5 and 6 months of age is followed by a stable plateau during adult life and a significant , tissue - specific reduction in transport rates after 18 months . importantly , we find that such age - associated changes could be reversible , and that old neurons are still able to support higher rates of transport , similar to those observed in younger animals . there are few existing studies of transport rates of a specific cargo in individual axons of aging animals , but we previously observed a significant decline in the rate of mitochondrial transport in mitos mice from 8 to 24 months of age ( gilley et al . , 2012 ) . although this study starts to shed light on the behavior of an individual organelle , the repertoire of cargoes studied needs to be extended for several reasons . first , mitochondria are most likely not representative for the majority of axonal transport cargoes . vesicle - mediated and mitochondrial transport use different ( albeit partially overlapping ) sets of transport motors and adaptors ( hirokawa and noda , 2008 ; hirokawa et al . , 2009 ) , and we have shown that nmnat2 and mitochondria are transported independently of one another in primary culture and in vivo ( milde et al . , 2013a , 2013b ) . this means that impairments in the transport of 1 of these cargoes do not necessarily affect the other . second , any alteration in the balance between mitochondrial fusion and fission in the axon could affect the perceived rates of mitochondrial axonal transport , especially because smaller mitochondria appear to move more frequently than larger ones ( misgeld et al . , 2007 ) . however , such processes would not necessarily affect vesicular axonal transport in the same way . third , even the energy sources driving vesicular and mitochondrial transport appear to differ from each other , and might thus be affected differently during aging ( zala et al . , 2013 ) . thus , it is difficult to extrapolate findings from mitochondrial to vesicular transport or vice versa , and a range of cargoes need to be studied quantitatively to gain a more complete picture of the change in axonal transport during aging . in addition , many studies on age - associated changes in axonal transport analyze only 2 time - points ( young and old , or adult and old ) . this means that the time course of the decline in axonal transport was not well characterized , and the question largely remains as to whether transport decreases slowly throughout adult life , or whether there are periods of sudden change . using transgenic animals for live imaging of axonal transport in mice aged 1.5 to 24 months , we observed a pronounced early drop in the rate of nmnat2-venus as well as mitochondrial axonal transport in sciatic nerves . in addition , a similar reduction was observed for nmnat2-venus particles in optic nerves and the fimbria of the hippocampus . although the precise timing of this change is tissue dependent , it appears to be complete by 6 months of age in all tissues investigated . these findings are consistent with previous studies in which bulk radiolabeling revealed a reduction in the rate of slow axonal transport between 1 and 6 months of age in peripheral and cns axons in rats ( mcquarrie et al . , 1989 ) and from 2 to 7 months of age in rat sciatic nerves ( tashiro and komiya , 1994 ) , but the present study reveals how this operates at the level of specific cargoes in individual axons . these early changes could reflect the final stages of growth and development in 1.5- and 3-month - old mice . even though they are usually considered young adults , mice at this age are still in the late phase of body growth ( somerville et al . , 2004 ) . this means that their peripheral axons are still extending , resulting in a higher demand for energy and cell body - derived structural materials that need to be supplied by axonal transport . at 6 months of age , peripheral axons have reached their final length , and axonal transport has settled to a plateau that is maintained until at least 18 months of age . however , given that skull and brain size do not change significantly after about 1 month of age ( aggarwal et al . 2010 ) , it is difficult to explain the observed drop in axonal transport rates in the optic nerve and fimbria simply through longitudinal axon growth . other potential late developmental changes that could account for the observed reduction in transport from 1.5 to 3 or 6 months of age include hormonal changes , a decrease in general locomotor and exploratory activity ( elias et al . , 1975 ; rogers et al . , 2001 ) , or late - phase myelination ( agrawal et al . , 2009 ) . the finding that , depending on the precise cargo and tissue , fast axonal transport does not settle down to its adult plateau until 3 to 6 months of age also has important implications for the choice of young control mice in aging studies more generally . thus , a comparison of axonal transport rates between 3- and 24-month - old mice would not only detect the old - age drop but also include the much earlier reduction in young adulthood . our study also demonstrates the importance of the analysis of multiple time - points , as the precise pattern of age - associated changes can not be deduced from 2 or 3 individual age groups . here , we find an early reduction in transport rates of mitochondria in peripheral nerve axons from 3 to 6 months , followed by a stable plateau until at least 12 months of age . together with results from a previous study in which mitochondrial transport declined significantly from 8 to 24 months of age ( gilley et al . , 2012 ) , these results suggest an overall profile for age - associated changes in mitochondrial transport in peripheral axons that is similar to what we found for nmnat2-venus , with a significant drop in transport rates between 12 and 24 months . thus , even though the precise timing of the old - age associated drop in mitochondrial transport has not been as precisely defined as for nmnat2 , our findings suggest that these 2 cargoes behave in a broadly similar way , indicating that at least some of the underlying mechanisms could be shared as well . interestingly , the reduction in axonal transport of nmnat2-venus in 24-month - old animals observed in sciatic and optic nerves was not detectable in fimbria . the fact that the earlier drop between 1.5 and 6 months was readily observed in the fimbria suggests that our method was sensitive enough to detect potential changes . thus , our data support the conclusion that axonal transport rates in some regions of the aging central nervous system might not change significantly until at least 24 months of age . for the optic nerve , previous results indicate a reduction in the extent of dendritic and axonal arborization of mouse retinal ganglion cell axons from 3 to 24 months of age ( samuel et al . , 2011 ) . however , in the absence of a more detailed time course of the loss of terminal arborization , it is not possible to draw conclusions about any potential causative relationships between the reduction in the rate of nmnat2-venus axonal transport and the loss of axonal arbor area . it is , however , interesting to speculate that the extent of an axon s terminal arbor could be 1 of the factors driving age - associated changes . if and when axonal arborization declines with age , axonal transport could fall simply to reflect the reduction in the amount of material needed to support a smaller distal arbor , rather than ( or perhaps in addition to ) a reduced capacity of the axon to support higher levels of axonal transport . with this in mind , the regeneration experiment may have increased the demand for materials to be delivered to the distal axon to support longitudinal and radial growth , with the axon responding accordingly , rather than necessarily reversing a decline in capacity . overall , our results support the conclusion that , at least in peripheral and optic nerves , axonal transport of the axon survival factor nmnat2 in mice declines substantially at old age , following a previous period of decline at a young adult stage and a relatively stable plateau during adulthood . given the extensive evidence of impaired axonal transport at early stages in models of neurodegenerative disease ( adalbert and coleman , 2013 ; chevalier - larsen and holzbaur , 2006 ; de vos et al . , 2008 ) , it will be important to extend the study of age - associated changes in axonal transport rates to human aging and age - associated neurodegenerative disease . albeit technically challenging , this information is vital , given the longer lifespans and more diverse genetic and environmental factors affecting human aging . one method that has been used to study axonal transport rates in humans is the measurement of kinetic biomarkers in cerebrospinal fluid ( csf ) , which revealed significant impairments in transport rates in parkinson 's disease patients compared to control subjects ( fanara et al . , 2012 ) , thus further substantiating findings from animal models that suggest impaired transport rates in neurodegenerative disease . although no age - associated changes were observed in the control subjects in that study , it is possible that the age span used ( 3660 years ) corresponds to the adult plateau observed in our study , and more extensive investigations using this or similar methods on a broader range of ages are needed to elucidate the time - course of axonal transport changes both in healthy aging humans and in the presence of neurodegenerative disease . it is , for example , interesting to speculate that any disruption of axonal delivery caused by age - associated neurodegenerative disease could synergize with age - associated changes and deplete nmnat2 levels below its threshold , contributing to axon degeneration in age - associated neurodegeneration . importantly , our results also suggest that old neurons in an old systemic environment still have the capacity to sustain higher rates of axonal transport and that appropriate signals can trigger this increase . it will be interesting to determine whether other signals in addition to injury and regeneration can lead to higher rates of axonal transport in old axons . these could include demyelination and remyelination , or the activation of autophagy to promote the clearance of existing axonal structures and the need to deliver new materials into axons . identifying the signaling pathways , both locally within the axon and within corresponding cell bodies that drive the increase in transport capacity , could highlight more targeted means to trigger these changes and to investigate their effects on axon survival during normal aging and in age - associated neurodegenerative disease .

axonal transport is critical for supplying newly synthesized proteins , organelles , mrnas , and other cargoes from neuronal cell bodies into axons . its impairment in many neurodegenerative conditions appears likely to contribute to pathogenesis . axonal transport also declines during normal aging , but little is known about the timing of these changes , or about the effect of aging on specific cargoes in individual axons . this is important for understanding mechanisms of age - related axon loss and age - related axonal disorders . here we use fluorescence live imaging of peripheral nerve and central nervous system tissue explants to investigate vesicular and mitochondrial axonal transport . interestingly , we identify 2 distinct periods of change , 1 period during young adulthood and the other in old age , separated by a relatively stable plateau during most of adult life . we also find that after tibial nerve regeneration , even in old animals , neurons are able to support higher transport rates of each cargo for a prolonged period . thus , the age - related decline in axonal transport is not an inevitable consequence of either aging neurons or an aging systemic milieu .

topiramate is a sulfamate - substituted monosaccharide , used in the treatment of epilepsy , depression , migraine , and neuropathic pain . secondary angle closure glaucoma due to topiramate is well recognized and has been related to supraciliary effusions and forward rotation of ciliary processes . furthermore , the medication is associated with drug - induced myopia , due to anterior displacement of the iris - lens diaphragm . in most cases , this secondary angle closure glaucoma and myopic shift resolves rapidly with discontinuation of the medication and management of intraocular pressure ( iop ) with topical therapy . a 36-year - old caucasian female presented to the emergency department with a one - day history of severe headache , abdominal pain , and decreased vision in the left eye ( os ) . the patient reported that she had been suffering from headaches for the past 11 months , for which she was being treated by a neurologist . during previous headache episodes , she experienced decreased vision in either eye and a frontal headache centered around or behind the affected eye lasting 810 hours . her medical history was significant for crohn s disease , migraines , erosive gastritis , and kidney stones . her medications included mesalamine , sumatriptan , topiramate ( prescribed 10 months prior by neurologist ) , dexlansoprazole , oxycodone / acetaminophen , ondansetron , and promethazine . on examination , visual acuity was 20/30 in the right eye ( od ) and count fingers at 6 inches os . iop via tono - pen ( tono - pen avia tonometer , reichert technologies , depew , ny , usa ) was 31 mmhg od , and 53 mmhg os . anterior segment examination os revealed mild conjunctival injection , diffuse microcystic edema of the cornea , and a narrow anterior chamber with 12 + pigmented cells . gonioscopy revealed appositionally closed angles bilaterally , which did not open with goniocompression os , and opened with a plateau iris configuration ( double hump sign ) od . undilated funduscopic examination findings were asymmetric with a cup - disc ratio of 0.3 od , and 0.7 os . topical therapy was initiated with brimonidine / timolol and dorzolamide ophthalmic drops . while iop od improved to 18 mmhg the patient had a history of kidney stones , therefore oral and intravenous carbonic anhydrase inhibitors were avoided . the patient was also advised to discontinue use of topiramate . while the mechanism of acute angle closure was thought to be secondary to topiramate use , underlying chronic angle closure could not be ruled out given the history of repeated episodes of vision loss during headaches , even prior to initiation of topiramate and the advanced cupping of the optic nerve os . ultrasound biomicroscopy was not available , therefore , based on the clinical examination ( gonioscopy ) , plateau iris angle closure was suspected while recognizing that secondary angle closure from ciliary body effusion may also be a factor . therefore , in addition to advising discontinuation of topiramate , a laser peripheral iridotomy ( pi ) was performed os with reduction in iop to 22 mmhg os . twelve hours later , visual acuity was 20/30 od , and 20/70 os with iop of 09 mmhg od , and 34 mmhg os , despite the discontinuation of topiramate and the use of topical bimatoprost and brimonidine / timolol . gonioscopy revealed plateau iris configuration with patent iridotomies and an open angle od , but peripheral anterior synechiae with a closed angle despite goniocompression os . at this time because the patient was visiting from out of state and had to return home immediately , follow - up with a glaucoma specialist was arranged . at the patient s initial consultation with the glaucoma specialist 2 days later , visual acuity was 20/20 od , and 20/40 os with an iop of 12 mmhg od , and 50 mmhg os . the plan was to proceed with a trabeculectomy the following day , however , this was postponed as the patient was admitted to the hospital for a flare - up of her crohn s disease . throughout her hospitalization , iop remained well controlled in the range of 1012 mmhg ou without topical medications od , and on topical bimatoprost , brimonidine / timolol and dorzolamide os . one day after the patient was discharged from the hospital , she was found to have elevated iop 53 mmhg os with a patent iridotomy . the following day , the iop was elevated again to 51 mmhg os and the patient underwent an urgent trabeculectomy with mitomycin c os . postoperatively , the patient s visual acuity os returned to 20/20 and iop os was controlled with trabeculectomy in the range of 0910 mmhg . banta et al1 , sanka et al2 , and rhee et al3 were among the first to report cases of secondary angle closure glaucoma associated with the use of topiramate in 2001 . they described uveal effusions , ciliary process swelling , and forward displacement of the iris - lens diaphragm leading to myopic shift and secondary angle closure glaucoma . by 2003 , they found that 85% of cases of topiramate associated secondary angle closure glaucoma occurred within the first 2 weeks of treatment . there were 17 reports of acute bilateral myopia ( up to 8.75 diopters ) , and vision returned to normal within a few days to a few weeks of discontinuation of topiramate . management of topiramate induced secondary angle closure glaucoma based on fraunfelder et al4 included : 1 ) prompt discontinuation of topiramate , as iop decreases rapidly after the medication is stopped ; 2 ) maximal medical therapy ( oral medications and aqueous suppressants ) , and avoiding topical miotics in order to avoid relative pupillary block . furthermore , laser pi was not found to be beneficial if glaucoma was only associated with topiramate . topiramate induced secondary angle closure glaucoma has been found to resolve within 2448 hours of discontinuation of the mediation , while the myopia resolves within 12 weeks.5 we present the case of a 36-year - old caucasian female with plateau iris configuration , acute onset angle closure , and acute angle closure superimposed on chronic angle closure in the setting of topiramate use . while it is difficult to prove the exact etiology of her angle closure without ultrasound biomicroscopy , which we did not have the luxury of obtaining during this patient s acute attack , it is presumed that her topiramate use may have contributed to the acute attack . her acute change in vision in a previous emmetropic eye and improvement in visual acuity with discontinuation of the medication support this assumption . regardless of the mechanism , this case raises a few notable points : 1 ) the multifactorial etiology of some forms of angle closure ; 2 ) the prescription of topiramate in eyes with underlying narrow angles ; and 3 ) the possibility of delayed secondary angle closure with topiramate use . our patient did not have a prior ophthalmology examination diagnosis of narrow angles or angle closure glaucoma , but had clinical symptoms of angle closure which preceded the topiramate use , and clinical findings including narrow angles ( plateau iris od ) and chronic angle closure os , which suggests multiple etiologies as an underlying mechanism for angle closure . follow - up examination od revealed a more open , narrow , non - occludable angle with a patent pi off topiramate but with a plateau iris configuration , which could explain the presenting angle closure od , while the 360 degree peripheral anterior synechiae os ( likely from chronic intermittent angle closure episodes ) explains the persistent elevated iop and permanently closed angle os . finally , topiramate use could have further contributed to the angle closure precipitating the attack by a ciliary body effusion that led the patient to present to our emergency department . of note , this patient was on other systemic medications with anticholinergic properties which could further contribute to her risk of angle closure . her case highlights the often multifactorial nature of angle closure glaucoma that can indicate multiple therapeutic interventions . in this patient s case , while topiramate induced secondary angle closure was one suspected mechanism , a peripheral iridotomy was also warranted based on other clinical findings ( plateau iris ) and to help rule out aqueous misdirection once the topiramate was discontinued . furthermore , when plateau iris is identified on gonioscopy but the patient is asymptomatic with a normal iop , we typically attempt laser pi first . we find that this will often open up the angle and resolve the occludability . if , however , the peripheral iridotomy fails to open up the angle or the patient is symptomatic or develops elevated iop , we would then perform peripheral iridoplasty . the multifactorial nature of this patient s angle closure also raises the question of whether this patient was a suitable candidate for topiramate therapy and whether her underlying narrow occludable angles should have been a relative contraindication to this drug . it suggests that perhaps , baseline ophthalmic examination with gonioscopy should be performed on all individuals being considered for topiramate therapy . finally , our patient had been receiving topiramate therapy for roughly 10 months , far longer than the average timeframe of 2 weeks post - initiation of therapy to induce secondary angle closure glaucoma , and by taking into account her history we suspect the patient was having angle closure symptoms prior to commencing topiramate . only one such report exists by czyz et al7 who reported a delayed onset of topiramate induced angle closure glaucoma , 262 days after initiation of therapy , which resolved with topical aqueous suppressants and discontinuation of topiramate . this finding suggests that patients on topiramate should be monitored and counseled regarding angle closure beyond the initial 24 weeks after initiation of therapy . while angle closure secondary to topiramate therapy has been widely recognized as a potential side effect of this medication , our report suggests that perhaps baseline ophthalmic examination should be performed prior to initiation of therapy , and that findings of narrow occludable angles should be a relative contraindication to treatment with this medication . patients with angle closure symptoms could be mistaken by non - ophthalmologists as suffering from migraines . further analysis of combined - mechanism angle closure is warranted to elucidate whether exclusion of patients with narrow angle glaucoma from topiramate treatment would reduce the occurrence of this side effect .

this is a case report describing recurrent intermittent acute angle closure episodes in the setting of topiramate use in a female suffering from migraines . despite laser peripheral iridotomy placement for the pupillary block component , and the discontinuation of topiramate , the acute angle closure did not resolve in the left eye with chronic angle closure and the patient required urgent trabeculectomy . the right eye responded to laser peripheral iridotomy immediately and further improved after the cessation of topiramate . while secondary angle closure glaucoma due to topiramate use has been widely reported , its effects in patients with underlying primary angle closure glaucoma have not been discussed . our report highlights the importance of recognizing the often multifactorial etiology of angle closure glaucoma to help guide clinical management .

with increasing medical care costs and a weakening economy more attention is being placed upon obtaining value from how health care dollars are spent . initiatives to obtain increased value from health care purchases are especially focused upon perceived waste ( aaron , 2008 ) . the frequency and cost of hospital acquired complications are at the forefront of perceived waste since hospitals , patients and payers are all adversely impacted by their occurrence . following the final implementation of the national uniform billing committee changes ( ub 04 ) on may 23 , 2007 , the standard claims form was modified to allow the submission of a present on admission ( poa ) indicator for each diagnosis . in october of 2007 , medicare began requiring that the poa indicator be submitted on all medicare claims . this change has permitted , for the first time , the ability to distinguish , using standard claims data , complications that are hospital acquired from those developed prior to admission . both payers and hospital providers have responded to this newly acquired , and evolving , information source by developing initiatives to reassure stakeholders that they are focused upon meaningful change to improve the quality of health outcomes . as required by the deficit reduction act of 2005 ( p. l. 109 - 171 ) , cms has led the way for payers by enacting a policy whereby any payment increase due to the occurrence of a limited range of hospital acquired complications is eliminated . for cms the anticipated reduction in spending is $ 21million out of the total $ 105 billion ( .02% ) that is currently paid for inpatient hospital operating payments within the inpatient prospective payment system for short term acute hospitals ( centers for medicare & medicaid services , 2008 ) . as preemptive initiatives , many hospital associations have responded by creating voluntary guidelines for specified adverse events ( so called never events ) where no charge is made to payers . while the purpose of these payment reductions is to provide incentives to improve quality , the amount of payment currently associated with these efforts , relative to the total cost of hospital care , is very small . it is the purpose of this article to develop an estimate of the incremental cost of different types of hospital acquired complications and to determine the total incremental cost burden of hospital acquired complications on the health care system . improved estimates of the magnitude of incremental cost incurred by short term acute hospitals due to hospital acquired complications should stimulate debate around the financial justification for supporting quality improvement efforts aimed at reducing hospital acquired complication rates . further , the availability of estimates of the incremental cost of individual types of hospital acquired complications will expand the policy options open to cms for broadening the range of the hospital acquired complications subject to payment reductions . while it is important to understand that not all hospital acquired complications can reasonably be thought of as being preventable , high complication rates at individual facilities , after adjusting for the mix and severity of illness of patient admissions , are indicative of low quality care and system waste ( peng , kurtz , and johannes , 2006 ) . in order to identify the complete spectrum of hospital acquired complications the potentially preventable complication ( ppc ) were used in this analysis ( hughes et al . , 2006 ) . ppcs identify potentially preventable harmful events or negative outcomes originating during inpatient care that result from the processes of care and treatment rather than from the natural progression of underlying disease . ppcs contain 64 mutually exclusive types of inpatient complications that are identified from 1,450 icd-9-cm secondary diagnosis codes not present on admission , and from selected icd-9-cm procedure codes . a post admission complication may be preventable for some types of patients but not for others . therefore , the ppc methodology includes a series of clinical exclusions that prevent a ppc from being assigned to a patient when there are other underlying diseases present at admission for which the complication would represent an inevitable , natural or expected progression , consequence or manifestation of a pre - existing underlying condition . patients having one or more ppcs present can be hypothesized as having additional costs in comparison to similar patients who do not . for example hospital costs will increase when a patient develops a urinary tract infection ( uti ) due to an indwelling urinary catheter ( iuc ) during a hospital stay . patient treatment costs vary depending upon the patient 's reason for admission , severity of illness at the time of admission and the presence of post admission complications . isolating and quantifying the incremental cost of a specific type of complication requires the disentangling of these interrelated factors . in order to adjust for the mix and severity of illness of patients , all patient refined diagnosis related groups ( apr drg ) were used to classify patients in terms of their reason for admission and severity of illness at the time of admission ( averill et al . , 2002 ; sedman et al . , 2004 ) . version 26.1 of the apr drg system incorporates an admission apr drg as standard output . the admission apr drg differs from the discharge apr drg in that only those conditions that were reported as present , or can be clinically assumed to be present , at the time of admission are used in making the apr drg assignment . conditions or complications that occurred during the hospital stay are not used to assign a patient to an admission apr drg . procedures that were clearly related to a post - admission event ( i.e. , complications ) are also excluded from the admission apr drg assignment . apr drgs assign each patient to one of 314 base apr drgs that describe the patient 's reason for admission and further subdivides each base apr drg into four levels of illness severity ( soi ) subclasses . the term apr drg is used to refer to the 1,256 base apr drg and soi subclass combinations . maryland and california require the reporting of the poa indicator for all short - term acute hospital patients . in maryland , hospital data can be obtained from the health services and cost review commission ( hscrc ) , while in california , hospital data can be obtained from the office of statewide planning and development . fiscal year 2008 ( july 2007 june 2008 ) maryland data and fiscal year 2006 ( october 2005 the consistency of reporting of the poa data in the two data sets was evaluated using an extensive set of edits . of the 48 hospitals in the maryland database , five hospitals comprising 83,863 patient claims were removed . of the 353 hospitals in the california database , patient claims with a discharge status of transferred ( 2 ) or expired ( 20 ) were excluded from analysis , as were claims that were classified within claims that had total charge values below $ 200 or above $ 2,000,000 were similarly excluded because extraordinarily high and low cost claims have the potential to introduce significant estimation error into the regression model . further , the dollar exclusion threshold was introduced in the absence of a systematically applied policy to determine outliers within apr drgs and the lack of availability of hospital specific cost to charge ratios for the california data . maryland 's hscrc regulates hospital charges to closely track efficient hospital costs thereby obviating the need to incorporate cost to charge ratios . in applying its rate setting methodology the hscrc creates approved base rate values , charge per case ( cpc ) , that factor in estimates for indirect medical education ( ime ) , disproportionate share ( dsh ) , uncompensated care , capital and labor variations . additionally , charge patterns are constrained so as to match reported cost at a service level . maryland claims charges were standardized using hospital specific cpcs to equate individual hospital charges with the statewide average . the california data lacked both the hospital specific payment variables available in the maryland data and a hospital specific identifier that could be linked to hospital cost data made public through the medicare program . instead a single standard approximation of a statewide cost to charge ratio was applied to all charges to transform charge values to more closely approximate actual cost . the cost to charge ratio used was 0.264 and derived from the hospital unweighted median cost to charge ratio used by california 's division of workers compensation effective april 1 , 2007 ( division of workers compensation , 2007 ) . this is a linear transformation with the singular purpose of simplifying subsequent interpretation of coefficient values rather than correcting estimation error . california data was therefore not adjusted for the effect of variation in cost to charge ratios across hospitals and service lines . similarly , the known effects upon costs posed by teaching programs , the prevalence of indigent patients and geographically induced input cost variation was not adjusted for . as with any predictive estimate attempting to relate costs to charge patterns , the inability to adjust for these factors in the california data reduces the accuracy of the incremental cost estimates . the final california analysis database contained 235 hospitals comprising 1,836,396 patients . inpatient hospital claims for the maryland and california data sets no adjustment , other than the specified $ 200/$2 million exclusion , was made to exclude extraordinarily high or low cost claims having created two independent analysis databases ( maryland and california ) , with admission apr drgs assigned , approximate claim level costs calculated and ppcs identified , a simple linear regression was specified of the form : cost i is the adjusted charge for claim i apr drg k , i is a binary variable ( 0,1 ) indicating which of the 1,256 admission apr drg k was assigned to the i claim ppc ji is a binary variable ( 0,1 ) indicating which of the j ppcs were present on the i claim is the average cost for a reference apr drg , excluding the incidence of ppcs , which acts as a constant cost contribution to each claim k is the coefficient associated with apr drg k and measures the incremental cost above due to the patient 's reason for admission and admission severity of illness level j is the coefficient associated with ppc j and measures the incremental cost for patients with ppc j relative to patients that do not have ppc j i is the residual error of the model for discharge i as specified , the regression model hypothesizes that cost increases associated with ppcs are both uniform and act independently of the base apr drg and severity level to which they are assigned . the hypothesized model treats the cost of complications as both additive and uniform across apr drgs . estimates of incremental cost associated with a specific ppc can therefore be interpreted as constant amounts independent of the specific apr drg in which they occur and independent of the presence of other ppcs . to calculate stable estimates first , if an apr drg had fewer than 21 claims assigned , all patients assigned to the apr drg were omitted from the analysis . correcting for low volume apr drgs is particularly important because an imprecise estimate of the average cost in an apr drg could impact the estimate of the constant coefficient for a ppc applied across all apr drgs . second , a t - test was applied to identify apr drgs that had coefficients that were not statistically significant at the 0.05 level . such apr drgs were omitted from the analysis database because lack of statistical significance implies excessive cost volatility in those apr drgs . no attempt was made to retain apr drgs by introducing a synthetic outlier policy to reduce the impact of extraordinary costly claims . to do so would be to import assumptions surrounding the causation of outliers and potentially their relationship with ppcs . as detailed below , the application of these statistical edits had minimal impact on the final retention of claims within the analysis database . twenty - nine of the possible 1,256 apr drgs had no claim volume while 217 apr drgs had fewer than 21 claims , resulting in 1,920 claims being removed from the analysis database . an additional 22 apr drgs were not statistically significant resulting in an additional 5,914 claims to being removed from the analysis database . in total 7,834 ( 1.2% ) claims after standardization the sum of adjusted charges ( approximate cost ) for the remaining claims was $ 6,504,557,501 , approximately $ 9,980 per included claim . in the maryland database 36,474 patients had one ppc ( 5.6% ) and 14,518 patients had multiple ppcs ( 2.2% ) . nineteen of the possible 1,256 apr drgs had no claim volume while 150 apr drgs had fewer than 21 claims , resulting in 1,214 claims to being removed from the analysis database . an additional 10 apr drgs were not statistically significant resulting in an additional 1,147 claims to being removed from the analysis database . in total 2,361 ( 0.1% ) claims after standardization the sum of adjusted charges ( approximate cost ) for these remaining claims was $ 18,509,876,873 , approximately $ 10,090 per included claim . in the california database 72,819 patients had one ppc ( 4% ) and 29,026 patients had multiple ppcs ( 1.6% ) . the fit of the regression model for estimating per patient cost , measured by the adjusted r statistic , was 0.58 for maryland data and 0.60 for california data . this result is obtained by using the apr drg assigned at admission with separate identification of ppcs that occur after admission to predict patient cost . the combination of admission apr drgs and ppcs therefore offers a robust fit for the variation in per claim costs . for each of the 64 ppcs in the second column of table 1 , the coefficient value ( coeff ) measures the incremental patient cost ( i.e. , j ) above that of patients in the same admission apr drg associated with the presence of the ppc after accounting for the presence of other ppcs . this value is referred to as the incremental cost of the ppc . since the regression model is additive , multiplying the frequency ( freq ) of the ppc by its incremental cost calculates a total cost associated with each ppc . the total cost for all included claims in the maryland data is $ 6,504,557,501 , of which $ 626,416,710 ( 9.63% ) is associated with ppcs . an asterisk in the standard error column indicates that the incremental cost estimate for the ppc is not statistically significant . ppc 32 transfusion compatibility reaction is statistically significant but should be interpreted cautiously due to the low volume of observations . the impact upon total costs of the 13 ppcs that are not statistically significant is minimal . in column 6 the total estimated cost for each ppc , ( freq*coeff ) , thus , pneumonia and other lung factors , ppc 5 , contributes 0.93% to total inpatient cost . in column 7 the total estimated cost for each ppc , ( freq*coeff ) , is divided by the total cost of all patients who had that ppc expressed as a percentage . thus , for patients who had the ppc , column 7 is the average per patient cost increase due to the ppc . for example , utis ( ppc 22 ) account for 0.67% of total inpatient hospital costs ( column 6 ) and on average when a uti occurs patient level cost increases by 19.6% ( column 7 ) . california claims constitute a similar percentage of total costs associated with ppcs ( 9.39% percent for california versus 9.63% for maryland ) . as shown in table 2 , 3 ppcs have no volume and 8 ppcs lacked statistical significance . as with maryland data table 3 ranks 48 ppc coefficient estimates that are considered statistically significant in both databases . the spearman 's rank correlation coefficient is 0.90 indicating that the relative value of coefficient estimates is highly correlated between the two states . the coefficient estimates for both california and maryland data in table 3 show significant bunching around ppc types . for example the eight ppcs with the lowest predicted values of incremental cost in the california data ( ranks 48 41 ) correspond with the same eight ppcs in maryland data and occupy a range of $ 2,720 in california and $ 2,312 in maryland . the california ppc coefficients are larger for 41 of the 48 ppcs while the estimation of the percentage of total cost associated with complications is greater in maryland . given the independence of the two data sources it is not to be expected that the two sets of results would be identical , but it is worth addressing these findings in more detail . firstly , while the estimated incremental cost per ppc is generally higher in california than maryland , the cost per claim utilized in the estimates for california is also higher ( $ 10,090 versus $ 9,980 ) . moreover , to interpret the difference in coefficient magnitude from the two databases , the average claims value for each needs to be adjusted for case mix intensity . relative weights for this purpose were calculated using the healthcare cost and utilization project ( hcup ) claims data for cy2006 . apr drg v26.1 weights were calculated from claims data based upon time of discharge for this portion of the analysis . the resultant average statewide case mix value , case mix index ( cmi ) , was computed for california and maryland . the cmi for the california claims was found to be 1.08 , while the cmi for maryland claims was 1.12 . deflating the average value observed for each database by its cmi yields adjusted values of $ 9,323 for california and $ 8,929 for maryland . a more accurate comparison of coefficients is therefore obtained by reducing the magnitude of coefficients in the california data by 4.4% ( $ 9,323/$8,929 ) . this adjustment results in ppc 14 having a larger estimated coefficient for maryland than california while the estimation differences between other ppcs is narrowed . a second contributing factor to the observed differences is the relationship between patient severity at the time of admission and the frequency of complications ( hughes et al . , 2006 ; thomas and brennan , 2000 ) . academic medical centers ( amcs ) tend both to treat patients of higher severity and to be higher cost hospitals . the combination of these two factors means that complications at amcs are likely to be more frequent and to be relatively more costly as they originate in settings with relatively more expensive cost structures . maryland data was adjusted for the inflationary effects of ime and dsh while california data was not . the lack of standardization acts to increase the estimated coefficients within california relative to maryland . a third contributing factor to the observed differences is the relative completeness with which diagnoses are coded upon claims . within the california database secondary diagnosis codes were submitted at an average rate of 5.1 per claim . for the maryland database this figure rises to 9.1 per claim . unsurprisingly the frequency with which ppcs are submitted on maryland claims is greater than that observed in california , both for claims with single ( 5.6% versus 4.0% ) and multiple ( 2.2% versus 1.6% ) ppcs . maryland 's allpayer claims data is the basis for hospital payment and uses the apr drg classification system . the change to apr drg based payment has been accompanied by an increase in coding completeness ( health services cost review commission , 2005 ) . variation in coding completeness impacts both the estimation of per ppc cost and the estimate of total cost associated with complications . the regression model can not distinguish increased cost attributed to complications where no complication is reported . since the incremental cost associated with a ppc is estimated relative to the underlying average apr drg cost , the estimate of incremental ppc costs will be reduced if no complications are reported . this results because the cost of unreported complications within the regression is attributed to the apr drg average cost . this effect is likely to be relatively small as claims with ppcs make up relatively small percentages of claims within an apr drg . however , for claims with at least one ppc , the failure to code all ppcs which are truly present causes the incremental cost associated with other uncoded ppcs to be attributed to the incremental cost estimate of coded ppcs . this effect may have a more substantial impact on the estimate of incremental ppc cost than the costs of some ppcs being incorrectly attributed to the apr drg average cost . if complications are being more consistently reported in maryland then the expectation would be for the estimate of incremental ppc cost in maryland to be lower than that for california . data limitations and differences in the pattern of coding may therefore explain variations in both the frequency of complications and their associated contribution to total hospital cost . the source of variation may also stem from real differences being observed in the data . for example , the increased frequency of complications may result from lower quality hospital care in maryland an interpretation that can neither be rejected nor supported in this analysis ; however , there is no externally corroborating evidence that lower quality care in maryland is a causal factor . external rankings of statewide hospital quality tend to indicate that the opposite is in fact true ( healthgrades , 2007 ) . alternatively the frequency of reported complications may be higher in maryland due to a greater underlying complexity in patient mix . the accuracy of the incremental cost estimates for the ppcs assumes that apr drgs provide an adequate measure of patient severity of illness . it is particularly important that there are no unmeasured aspects of severity of illness with strong correlation to the presence of ppcs that would serve to increase costs and upwardly bias estimates of the incremental cost of ppcs . if such unmeasured aspects of severity of illness existed then it can be hypothesized that patients with unmeasured severity would be concentrated in hospitals with certain characteristics . one study simulated an apr drg based payment system using california data in which payments were reduced when a major ppc was present ( averill et al . , 2006 ) . using the hospital payment reduction due to ppcs as the dependent variable , the impact of the reduction upon the hospital case - mix index and number of hospital discharges was estimated using a regression model . the adjusted r for the model was only 13.28 indicating a weak association between ppc related payment reductions and these hospital characteristics . while not conclusive , the results suggest that the extent to which unmeasured severity influences the estimates of incremental cost associated with ppcs is minimal . central to the analysis is an assumption that the post admission complications identified by the ppcs are preventable . one study demonstrated that catheterrelated blood stream infections , ppc 54 , could be reduced by 66 percent through evidence based interventions ( pronovost , goeschel , and wachter , 2008 ) . unfortunately , there is very little data like that for catheter - associated blood stream infection that explicitly quantifies the preventability of specific types of complications . the new york department of health has provided comparative reports on ppc rates to new york hospitals for several years . some hospitals have reported that they have been able to use the ppc reports to lower the occurrence of complications ( editorial board , 2009 ) . except for a few so - called never events that are almost always related to preventable medical errors such as foreign objects left in after surgery complications will never be totally preventable even with optimal care ( averill et al . , 2009 ) . most post - admission complications ( such as pulmonary embolism or post - operative mi ) are not clearly linked to medical errors , and although they may relate to errors in judgment or lapses in execution that reflect poor quality care , they can not be considered always preventable . of the 64 categories of preventable complications ( ppcs ) evaluated with the maryland and california data , statistically significant estimates for incremental costs incremental ppc costs are estimated to account for more than 9% of total inpatient hospital cost . earlier studies have estimated the cost of catheter - related blood stream infections at $ 18,000 compared to the $ 22,000 observed in the maryland data found here which offers a measure of reasonableness for the results ( perencevich and pittet , 2009 ) . the impact ppcs are seen to have on hospital cost demonstrates that there are substantial opportunities for both hospitals and payers to improve quality while reducing expenditure . the medicare inpatient pps fully incorporates ppc related cost into relative weights . the narrow definition of hacs , as currently employed by cms , has such a limited impact on payments that the medicare inpatient pps essentially continues to pay the full ms drg payment rate for virtually all patients . thus , if hospitals can reduce their ppc rates , they can substantially increase their per case profit margins . conversely , payers are paying hospitals at a level that includes substantial costs associated with ppcs . payers need to provide hospitals greater incentive to reduce complications by reducing payments when a ppc occurs . hospital payment systems can be complex with many interrelated adjustments , necessitating payment redesign to be carried out with care . for example , in the medicare inpatient pps , the removal of a ppc diagnosis from ms drg assignment can be used to assign the patient to a lower paying ms drg . however , the assignment to a lower paying ms drg may make the hospital eligible for outlier payments which could entirely or partially offset the payment reduction . thus , as payment adjustments for complications are imposed , the impact on outlier payments must be taken into consideration by adjusting outlier threshold levels . data on the cost of specific types of complications , such as those presented in this article , will be essential to such adjustments . identifying the cost of specific complication types can also act as a basis for payers contracting under per diem arrangements to introduce actuarially representative quality incentives . the inherent probabilistic nature of the preventability of complications presents significant problems for the expansion of the current cms payment policy related to hospital acquired complications ( hacs ) . for every case with an hac , the hac payment policy eliminates the entire payment increase generated by the hac implying that hacs are always preventable . as a result , hacs have been limited to the relatively few complications that are , arguably , nearly always preventable but have minimal impact on medicare inpatient hospital expenditures . in order to substantially increase the scope of hacs , the current hac case - by - case payment reductions and the implied preventability of the hac for similarly , the hac payment policy could be revised to reduce payments for hospitals with high hac rates . assuming that the number of excess hacs in a hospital can be identified by comparison of risk - adjusted hac rates then the number of excess hacs in a hospital will need to be converted into a payment adjustment amount for the hospital . estimates of incremental costs for ppcs , like those computed here , can provide a basis for converting the excess complications observed in a hospital into a payment adjustment amount , thereby expanding the policy options open to cms for expanding the range of complications applicable to a payment reduction . it was beyond the scope of this analysis to include additional costs associated with a complication that are incurred beyond the inpatient stay . the end of a hospitalization does not mark the period where all hospital acquired complications have become apparent . the estimate of incremental ppc costs carried out here does not factor in the degree of preventability of a complication or how much of the identified hospital cost may be considered fixed rather than variable . the use of claims data , whether to identify complications or to estimate incremental costs , is not free from criticism . claims submissions are subject to variation in accuracy , both through the coding and documentation process . hospital accounting functions are rarely sophisticated enough to identify and allocate patient level costs , while the standardizing of hospital cost data has already been described here as both imperfect and offering the potential for bias . variation in coding completeness can contribute to both bias in the total estimated cost of complications and the estimate of incremental costs for individual ppcs . despite these potential data limitations the hypothesized model delivers statistically valid estimates for the incremental cost of complications within the data sets from which they are drawn . these results , obtained from two distinct sources , are generally consistent providing an indication of the robustness of both the method and results . two state 's claims databases , from disparate regions of the country , with hospitals paid under different auspices and with cost standardized using different methods , independently yield very similar estimates for the cost of potentially preventable complications . at a patient level the impact of preventable complications on cost for many routinely observed complications , such as utis and catheter - related blood stream infections , is substantial . potentially preventable complications are estimated to add 9.4% - 9.7% to hospital inpatient costs . with national estimates of inpatient hospital care costs totaling $ 940 billion in 2006 ( american hospital association , 2008 ) , the 0.02 % hac payment reduction currently implemented by medicare while very limited in scope is an important first step toward addressing a problem with substantial cost implications . the robust incremental cost estimates for complications , obtained by treating hospital acquired complications as additive , categorical events , may open the door to alternative ways to design payment systems so as to provide greater incentives to significantly reduce hospital complications .

california and maryland hospital data are used to estimate the incremental cost associated with 64 categories of hospital acquired complications . the reason for admission , severity of illness at admission and the presence of hospital acquired complications are used in a linear regression model to predict incremental per patient cost yielding an adjusted r2 of 0.58 for maryland data and 0.60 for california data . the estimated incremental cost due to each of the 64 categories of complications was consistent across both databases and accounted for an increase in total short term acute inpatient hospital cost of 9.39 percent in the california data and 9.63 percent in the maryland data .

stress is broadly defined as an actual or anticipated threat of well - being or disruption of organism homeostasis . although the sensing and reaction to stress evolved to promote adaptation , modern workstyles and lifestyles represent challenges that render individuals susceptible to physical and mental disorders [ 25 ] . multiple factors influence an individual 's ability to cope with stress , for example , early life experiences , gender , or personality traits . both vulnerability and resilience may be determined by genetic and epigenetic ( gene environmental interactions ) background [ 59 ] . since the discovery of the communication between hypothalamus and pituitary in early 70s that opens a new window in our understanding of the brain - body communication , there are plethora of studies describing the high biological significance of stress and its responses which enables various adaptive processes to changing conditions . the most easily measureable and critical physiological response to stress involves the release of glucocorticoids ( glucocorticoids , gcs ) . these hormones are synthesized and secreted into systemic circulation from the adrenal glands following stimulation by the anterior pituitary hormone adrenocorticotropic hormone ( acth ) . the release of acth itself is increased in response to the secretion of corticotropin - releasing hormone ( crh ) and arginine vasopressin ( avp ) from neurons in the hypothalamic paraventricular nucleus ( pvn ) . together , the hypothalamus , pituitary , and adrenal glands constitute the so - called hypothalamo - pituitary - adrenal ( hpa ) axis , which plays an essential role in the adaptive response to psychogenic ( e.g. , fear ) and physical ( e.g. , cellular lesion or pathogen invasion ) stressors . the adaptive responses that are initiated by gcs occur in multiple tissues and involve alterations in numerous physiological ( e.g. , metabolic , cardiovascular , and immune ) as well as behavioral ( e.g. , emotion , cognition , and motor ) processes [ 1 , 1012 ] . normally , gc - driven negative feedback mechanisms at the different levels of the hpa axis serve to normalize gc secretion and restore homeostasis ; however , and depending on the type , duration , and intensity of the stressful stimulus , gc hypersecretion may persist and become a potential threat for health . there is now abundant evidence that gcs can exert profound modulatory effects on a variety of brain functions from early development through to late life . their actions are mediated by two receptors : the mineralocorticoid receptor ( mr ) and glucocorticoid receptor ( gr ) , which belong to the superfamily of nuclear receptors that act as transcription modulators [ 13 , 14 ] . in the brain , gr is ubiquitously expressed , whereas mr expression is more restricted to just a few structures ( hippocampus , locus coeruleus , amygdala , prefrontal cortex , and nucleus of the solitary tract , as well as pvn neurons ) . mr is also present in nonneuronal cells , namely , in glia and epithelial cells of the choroid plexus and ependyma . binding assays using [ h ] corticosterone have shown the mr has a 10-fold higher affinity ( kd = 0.5 nm ) for gc compared to gr ( kd = 5 nm ) , which means that , at basal gc levels , mr is occupied and activated whereas gr is only activated when gc levels reach a certain level , for example , during the circadian peak of gc secretion and during stress . importantly , brain mr and gr both respond to the same endogenous ligand ( cortisol in humans and larger mammals , corticosterone in rodents ) ; further , mr and gr were reported to colocalize in the same pyramidal and granular neurons of the hippocampus . given the gr and mr colocalization and relatively small difference in their affinity for endogenous gcs , the question arises as to whether they regulate distinct genes and/or coregulate transcription by heterodimerization . heterodimerization of gr and mr was shown with high concentration of gc ( stress level ) in the nuclei of cultured hippocampal neurons . moreover , evidence suggests that their cellular responses through regulation of distinct gene expression ( as homodimers ) depend strongly upon specific recruitment of coregulators [ 18 , 19 ] . synthetic gcs ( e.g. , dexamethasone , methylprednisolone ) are routinely used in clinical situations due to their powerful anti - inflammatory and immunosuppressive actions . however , a growing body of evidence suggests that high gc exposure in early life can adversely program the hpa axis and increase the susceptibility to develop metabolic , neuropsychiatric , and neurodegenerative disorders [ 5 , 20 , 21 ] . in addition , there is now ample experimental evidence where elevated gc levels and prolonged exposure to stressful conditions induce structural remodeling of neurons with synaptic loss as well as alterations in glial functions , which are frequently maladaptive ; see also figure 1 . in this brief review we discuss some of current knowledge about cellular targets and mechanisms through which stress and altered gc levels trigger changes in the brain that may lead towards the development and progression of neurodegenerative pathologies such as alzheimer 's ( ad ) and parkinson ( pd ) disease . in addition to nongenomic mechanisms that are still incompletely identified , chronic stress and gc levels most likely influence neuronal function and connectivity by activating gr - mediated transcription . grs are normally located in the cytoplasm in association with chaperone proteins such as the heat shock proteins hsp90 and 70 and the immunophilins fkbp51 and fkbp52 . upon gc binding , conformational change of the gr - chaperone complex results in nuclear translocation of the gr [ 24 , 25 ] . in the nucleus , gr binds to specific regions of dna , which possess glucocorticoid response elements ( gre ) within the promoters of target genes , leading to cell - type and context - dependent gene expression [ 2628 ] . transcriptional regulation by gr may occur by ( a ) direct binding of gr homodimers to gre within dna sequences to stimulate transcription , for example , mitogen - activated protein kinase phosphatase-1 gene ; ( b ) direct binding to negative gre elements to repress transcription ; the gene encoding the prohormone from which acth is derived ( proopiomelanocortin , pomc ) , crh , and the crh receptor genes are examples of negatively regulated genes ; and ( c ) trans - repression or tethering , that is , association with other transcriptional factors that inhibit the transcriptional activity of gr . in the brain , identification of gr - modulated genes is difficult due to the anatomical complexity and cellular heterogeneity . nevertheless , transcriptomic studies in the hippocampus have identified functional classes of gr target genes which include genes coding for neurotransmitter catabolism , neurotrophic factors and their receptors , signal transduction , energy metabolism , and cell adhesion . in addition to altering gene expression , growing evidence suggests that epigenetic mechanisms represent a means through which stress and gcs can leave long - lasting memories of past experiences which , in turn , contributes to shaping the organism 's physical and mental health trajectory [ 21 , 30 , 31 ] ; see figure 1 . broadly , epigenetics refers to stable changes in the regulation and/or function of dna , rna , and/or proteins that do not involve alterations of their primary sequences . two well - known examples of epigenetic marks induced by environmental stimuli ( e.g. , stress ) are dna methylation and histone modification . the first evidence of epigenetic programing in the brain by early life adversity showed that poor maternal care in rats leads to methylation of exon 17 in the gr promoter , being accompanied by aberrant behaviors and altered hpa axis responses during adulthood [ 32 , 33 ] . subsequently , similar mechanisms were reported in humans who had experienced childhood adversity and in infants born to depressed mothers . the earlier studies in rats were replicated in mice in paradigms of prenatal gc exposure and early postnatal stress ; we showed that these pre- and postnatal manipulations resulted in epigenetic modifications of the promoters of neurotransmitter ( dopamine receptor 2 ) , gr , and various gr target genes [ 37 , 38 ] with long - lasting maladaptive behavioral consequences . recent studies also suggest that early life events ( e.g. , intrauterine infections , maternal stress , and poor maternal and perinatal nutrition ) may play a role in the onset of alzheimer 's disease ( ad ) , an age - related neurodegenerative disorder characterized progressive memory and cognitive deficits . from this perspective , ad is probably not determined by a single etiologic factor but results from the interplay between genetic and environmental factors throughout life , possibly explaining why monozygous twins can be discordant for ad . albeit this is still controversial and the literature is sparse , it has been suggested that adverse events in early life , for example , maternal stress and poor maternal and perinatal nutrition , can potentially predispose eventually to ad through epigenetic programing of specific genes / pathways related to ad neurodegeneration . for example , maternal separation for the first 3 weeks of rodent life is shown to result in increase of ad cellular pathways ( e.g. , app misprocessing and tau hyperphosphorylation ; see below ) followed by synaptic and neuronal damage as well as cognitive deficits in adulthood suggesting the potential impact of early - life stress exposure to the precipitation of ad neurodegeneration later in life . while most current research on epigenetic mechanisms focuses on dna methylation , one recent study demonstrated that gc , acting via gr , increase the levels of histone deacetylase 2 ( hdac2 ) , an enzyme regulating dna expression , in the ck - p25 mouse . in general , how early life stressors reprogram the fetal brain and contribute to late - life development of neurodegenerative disorders ( e.g. , ad ) is emerging as an exciting , new research field . experimental evidence in animal studies indicates that stressful events in early life can impact the etiopathogenesis of another neurodegenerative disorder , parkinson 's disease ( pd ) , which is characterized by both motor and nonmotor symptoms . depression , anxiety , apathy and interestingly fatigue are common nonmotor features occurring in around 30 to 58% of patients before the onset of motor symptoms in pd patients . in addition , the prevalence of cognitive impairment in pd ranges from 19 to 36% . the cellular mechanisms underlying these nonmotor symptoms in pd may share similarities to ad , particularly with respect to the molecular pathways activated by stress . maternal separation was reported to exacerbate motor deficits and nigrostriatal lesion in an experimental model of pd . in an interesting study , pups of female animals , exposed to the bacterial endotoxin lipopolysaccharide ( lps ) during pregnancy , showed loss of dopaminergic ( da ) neurons . since loss of dopaminergic neurons as well as related motor deficits is a characteristic feature of pd pathology , the above findings suggest that high lps levels in mothers might interfere with the development of da neurons in the fetus , thus enhancing susceptibility to pd . accordingly , developmental stress may represent the first imprint in the brain and accumulatively with later stressful stimuli to affect nigrostriatal neurochemical reserve and precipitate the pd phenotype . ad is a multifactorial neurodegenerative disorder with complex etiopathology . besides early life stress ( see above ) , accumulating clinical evidence strongly suggests that chronic stress in adulthood as well as elevated gc levels may have a role in the development of ad pathology and related dementia [ 47 , 48 ] . in fact , high levels of cortisol are commonly found in ad patients ' plasma , saliva , and/or csf [ 4953 ] ; ad patients also show higher total daily secretion of cortisol . the potential link between stress / gc and ad described above is strengthened by emerging evidence that stress may advance the age of onset of the familial form of ad [ 47 , 48 , 55 ] and that cortisol levels in ad patients correlate with their memory deficits [ 56 , 57 ] suggesting a role for gc on ad . nevertheless , in the absence of longitudinal studies it is not clear from the available evidence as to whether elevated gc secretion is a cause or a consequence of ad disease . an important brain area in unraveling the interrelationship between stress , elevated gc , and ad pathology is the hippocampus , which is among the first areas affected in ad patients . hippocampal lesions in ad brain are not only associated with the deficits in declarative , spatial , and contextual memory but could also be responsible for the suggested hpa axis dysregulation and the subsequent overproduction of gc found in ad patients due to the inhibitory role that hippocampus exhibits on hpa axis . indeed , previous studies from our laboratories ( and others ) have shown that hippocampal neurons are particularly vulnerable to the adverse effects of stress and gc , their effects being manifested as dendritic atrophy and apoptotic cell death [ 22 , 58 ] . moreover , a large number of studies have shown that stress and elevated gc levels affect neurogenesis in adult brain with subsequent impairments of mood and cognitive behavior [ 59 , 60 ] . more specifically , both acute and chronic exposure stress reduces adult neurogenesis , affecting hippocampal cell proliferation and , in certain studies , survival of newborns [ 61 , 62 ] . in addition , administration of corticosterone showed the ability of glucocorticoids to damage neurogenesis in adult brain by inhibiting cell proliferation , differentiation and survival while the deleterious effect of stress and/or corticosterone on neurogenesis is gc - dependent . in a vicious cycle , alteration in neurogenesis of adult brain is recently shown to impact on gc negative feedback on the central elements regulating hpa axis activity [ 65 , 66 ] . moreover , perturbations in adult neurogenesis may also be related to the cognitive deficits associated with ad whereas contradictory findings support both increases and decreases of neurogenesis in brain of ad patients and tg animal models . here , it is also worthwhile noting that stress and gc interfere with hippocampal - prefrontal cortex ( pfc ) connectivity and dendritic and synaptic plasticity in the pfc , thus disrupting executive functions . these pfc structural deficits are also likely to have consequences for central regulation of the hpa axis providing another neuroanatomical link between hpa axis dysregulation and subsequent gc hypersecretion and ad pathology . at the molecular level , ad pathology is characterized by amyloid beta ( a ) that forms deposits ( senile plaques ) and hyperphosphorylated forms of the cytoskeletal protein tau that aggregate into neurofibrillary tangles ( nft ) [ 6971 ] . a is the proteolytic product of a large transmembrane protein called amyloid precursor protein ( app ) , which is sequentially cleaved by -secretase ( bace-1 ) and -secretase ( a complex of enzymes ) to generate the production of a ; this cellular pathway is often called app misprocessing . many studies have demonstrated that the products of app misprocessing trigger neuropathological processes associated with ad such as synaptic malfunction ( including impairment of long - term potentiation ) , neuronal atrophy and synaptic disintegration and loss as well as mitochondrial dysfunction , oxidative stress , and glial activation . although still a subject of debate , several studies suggest that a also triggers the abnormal hyperphosphorylation of tau , nft formation , and neuronal loss . moreover , cumulative evidence suggests that the detrimental effects of a are abolished in tau - ko mice , highlighting the essential mediatory role of tau protein in the neuro- and synaptotoxic effects of a [ 7377 ] . further support for an essential role of tau in the establishment of ad pathology derives from clinical findings that have consistently shown that the cognitive deficits in ad patients correlate better with nft rather with a deposition per se . moreover , gmez - isla et al . demonstrated a strong correlation between neuronal loss in the cerebral cortex and increased nft burden with disease progression ; no such correlation was found with a. in addition , the reduction of hippocampal volume in ad patients correlates better with csf levels of phosphorylated tau than with those of a . the evidence of a causal relationship between stress / gc and ad includes that from studies showing that either high gc levels and/or stress increase the production of a and exacerbate memory deficits in transgenic mouse models of ad [ 80 , 81 ] . specifically , chronic immobilization stress in transgenic mice expressing the amyloid precursor protein ( app ) v717ict-100 ( a mutation which results in aggressive early onset ad ) accelerates the appearance of extracellular a deposits and worsens memory deficits . similar findings were obtained in vivo when young ( prodromal ) 3xtg - ad mice were treated with the synthetic gc , dexamethasone ; the same authors also reported dexamethasone - induced app misprocessing in the n2a cell line , a finding matched by our own observations in pc12 cells . further , green et al . demonstrated that gcs upregulate the transcription of app and -secretase , whose promoters contain a glucocorticoid response element ( gre ) . consistent with the above , our studies in middle aged rats showed that stress and chronic gc drive app processing towards the generation of a and its precursor molecule ( c99 ) , both of which have neurotoxic and cognition - impairing properties ( see also figure 1 ) . the latter changes were accompanied by increases in the levels of -secretase ( bace-1 ) and nicastrin , a protein found in the -secretase complex . further experiments that attempted to mimic intermittent stressful events that may exert cumulative effects over the lifetime indicated that gc potentiate the app misprocessing pathway in previously stressed rats receiving a-infusions ( see figure 2 ) . in addition to triggering the amyloidogenic pathway , high levels of gc and stress can also instigate the aberrant hyperphosphorylation of tau protein that also characterized ad brain . among the first reports suggesting a potential connection between gcs and tau was that from stein - behrens et al . who demonstrated that gc exacerbate kainic acid - induced hippocampal neuronal loss with a contemporaneous increase in tau immunoreactivity . a later study showed that chronic treatment of 3xtg ad mice with dexamethasone leads to the somatodendritic accumulation of tau in the hippocampus , amygdala and cortex . supporting those earlier studies , we showed that chronic stress or gc increase the levels of aberrantly hyperphosphorylated tau in the rat hippocampus and pfc ( see figure 2 ) . importantly , the hyperphosphorylation occurred at certain tau epitopes that are strongly implicated in cytoskeletal dysfunction and synaptic loss ( e.g. , pser262 ) [ 86 , 87 ] and hippocampal atrophy ( e.g. , pthr231 ) in ad patients . here , it is pertinent to note that the extent of phosphorylation at thr231- and ser262-tau correlates strongly with severity of memory impairment , speed of mental processing , and executive functioning in ad patients [ 8991 ] . although chronic stress and gc treatment exert similar , but not identical , effects on individual tau phosphoepitopes in vivo and in vitro , the overall evidence points to gc as the key mediator of the ad - like pathology induced by stress . on the other hand , some studies have suggested a role for at least one other stress - related molecule , namely , corticotrophin - releasing hormone ( crh ) , as deletion of the crh receptor 1 gene in mice was found to block the detrimental effects of stress on tau phosphorylation [ 92 , 93 ] . as shown at figure 2 , information on the mechanisms underlying stress / gc - induced hyperphosphorylation of tau is only just beginning to emerge . for example , in vitro experiments indicate that the effects of stress / gc are mediated by glycogen synthase kinase 3 ( gsk3 ) and cyclin - dependent kinase 5 ( cdk5 ) , both of which have well - established roles in tau hyperphosphorylation and the subsequent disruption of microtubules , features seen in the ad brain . we now also know that gc exposure increases tau accumulation by affecting turnover of the protein by reducing its degradation ; the latter appears to result from dysregulation of molecular chaperones ( e.g. , hsp90 and hsp70 ) that are responsible for tau proteostasis ( see figure 2 ) . interestingly , both these heat shock proteins also serve to maintain gr in a high affinity state , suggesting that these proteins may be the point at which gc / gr signaling intersects with the cellular machinery that regulates tau degradation . using a transgenic mouse that expresses human p301l - tau ( the most common tau mutation ) , we recently showed that chronic stress triggers different aspects of tau pathology in addition to inducing , its aberrant hyperphosphorylation and aggregation of tau into insoluble forms . adding to the mechanistic understanding of stress - driven aggregation of tau , we also showed that chronic stress enhances caspase 3-mediated truncation of tau at its c - terminal , leading to an abnormal conformation of tau in the hippocampus ( figure 2 ) . this truncation - dependent misfolding of tau into an abnormal conformation is known to facilitate nucleation and recruitment of other tau molecules into neurotoxic aggregates [ 95 , 96 ] before nft are formed [ 95 , 97 , 98 ] . it is interesting to note that chronically elevated gc secretion , usually in response to stress , is a major cause of major depressive illness . in light of the increasing volume of data implicating high gc levels in ad , it is important to consider that epidemiological studies implicate depression as a risk factor for the development of ad ; this is supported by the observation that previously depressed subjects have increased amyloid plaque and nft loads . different studies have in fact sought to discriminate between subjects undergoing normal aging from those suffering from depression or ad through the measurement of the various app cleavage products [ 101104 ] . while much remains to be discovered about the potentially important role of depression in ad pathology , it is interesting to note that antidepressant drugs , whose actions often involve reductions in gc secretion , inhibit the proteolytic cleavage of app into amyloidogenic products [ 104 , 105 ] . lastly , it deserves mentioning that a recent epidemiological study found that the prevalence and incidence of dementia in war veterans suffering from posttraumatic depression ( ptsd ) is twice as high as that in age - matched ptsd - free subjects . while ptsd is a condition quite distinct from major depression , these findings hint at the important influence lifetime stressful experiences can have on mental health , possibly through epigenetic mechanisms . the findings are also interesting since ptsd patients usually show hypoactivity of the hpa axis ( versus hyperactivity in depression ) , suggesting that just a single but major stressful event involving transient gc hypersecretion can have long - lasting neuropathological consequences . chronic inflammation is one of the central pathological features of ad with reactive microglia and astrocytes surrounding senile -amyloid plaques observed in both postmortem ad brain and animal models [ 107 , 108 ] . evidence from human studies suggests that glial activation is an early event ; thus inflammatory markers are present in mild cognitive impairment cases that eventually progress to ad . thus proinflammatory cytokines produced by activated glia in response to amyloid fibrils would be expected to activate hpa axis and increase gc levels . in vitro studies clearly show that a can be taken up through phagocytosis in microglia and thereafter degraded [ 110 , 111 ] ; thus , in ad setting , microglial likely have a beneficial role early in pathology . however , elevation of proinflammatory cytokines such as il-1 may also participate in mood disorders such as depression in ad . the importance of immune - related responses in the emergence of a burden , tau pathology , and dementia is gaining momentum as molecular comprehension of their actions is increasingly unraveled by human genetic and animal studies . recent genome - wide association studies have identified variants in at least 16 genes involved in microglia / macrophage functions as risks for developing ad . among them , 4 allele of apoe gene is a known strong risk factor , accelerating the age of onset of ad . apoe is produced by both microglia and astrocytes ; it regulates not only lipid and a metabolism but also microglial chemotaxis and proinflammatory cytokine expression . trem2 is specifically expressed in myeloid cells where it promotes phagocytosis whilst inhibiting cytokine production . these and most other gwas genes identified are involved in aberrant microglial / macrophage responses with regard to a clearance and spread of tau pathology . thus , crucial microglial functions such as motility and phagocytosis were impaired in app / ps1 mice ; also in these mice the levels of a receptors ( sra , cd36 , rage ) and a degrading enzymes ( neprilysin , mmp9 ) were decreased with concomitant increase in proinflammatory cytokines tnf- and il-1 . age , a primary risk factor for ad , is also an important contributor to dysfunction of innate immune responses . microglial dystrophy and fragmentation observed in aging brain occur before the appearance of abnormal tau suggesting dysfunctional microglia could contribute to appearance of tau pathology . chronic stress through gcs is known to prime and augment neuroinflammatory processes in the cortex and hippocampus upon subsequent proinflammatory challenges such as lps [ 119 , 120 ] . peripheral infections and stress are both known to affect the activation state of microglia and in ad pathology both could have detrimental effects on the functions of microglia . there is little known on how glucocorticoids influence glial functions during prodromal to emergence and progression of ad pathology . it would be important to understand whether gc through gr has any role in a degradation in astrocytes or myeloid cells . parkinson 's disease ( pd ) is a complex systemic and progressive neurodegenerative disease associated with both motor and nonmotor symptoms . the cardinal motor symptoms such as akinesia , resting tremor and rigidity mostly arise from preferential and substantial loss of dopaminergic neurons ( 5060% ) in the substantia nigra pars compacta ( snpc ) with significant dopamine depletion in the sensorimotor striatum . the nonmotor symptoms include olfactory dysfunction and sleep behavior disorder as well as mood changes and cognitive impairment as discussed above . one principle histopathological feature is the presence of lewy bodies ( lbs ) , which are proteinaceous inclusions containing mainly structurally altered presynaptic protein , alpha - synuclein , which , as recent evidence shows , plays a central role in pd pathology . alpha - synuclein lb deposition was used by braak et al . as a principle pathological marker to monitor the progression and severity of pd . pd is believed to originate from olfactory nucleus and autonomic nervous system progressing in an ascending manner to many brain regions such as substantia nigra , striatum , raphe , locus coeruleus , hypothalamic nuclei , hippocampus , amygdala , and cerebral cortex accounting for both motor and nonmotor symptoms [ 121123 ] . thus , for example , pd patients with cortical lbs also suffer from dementia and visual hallucinations . while several gene mutations have been identified in familial forms of pd , the majority of pd cases are sporadic and of unknown etiology . nevertheless , significant advances in the last decade on pd genetics , particularly genome - wide association , as well as pathophysiological mechanisms in various pd model systems , have contributed much to our comprehension of pd . cellular processes such as oxidative and nitrative stress , mitochondrial dysfunction , and deregulated intracellular calcium levels as well as damaged proteostasis related to alpha - synuclein aggregation are the most studied and relate to dopamine neurodegeneration . as in ad patients , specifically , previous studies [ 54 , 126128 ] including our own work show that plasma cortisol levels are significantly higher in idiopathic pd patients compared to control subjects ; however , these high levels do not correlate to disease duration or to l-3,4-dihydroxyphenylalanine ( l - dopa ) treatment . interestingly , the diurnal pattern of cortisol secretion in pd patients , in particular the normally quiescent nocturnal cortisol secretory pattern , is affected . chronically elevated gc levels in pd patients suggest that hpa regulated - stress responses may impact pd pathology . indeed , the role of stress was proposed as one of the underlying causes of pd as clinical reports show that stress triggers the appearance of pd symptoms or exacerbates the motor symptoms [ 130132 ] . the role of stress in pd is supported by few experimental studies such as food deprivation and tail - shock and maternal separation aggravate motor deficits in the 6-hydroxydopamine ( 6-ohda ) pd model ( 6-hydroxydopamine local injections lesions the nigrostriatal pathway ) . in combined chronic stress exposure with 6-ohda lesion , stress was shown to worsen the 6-ohda - driven motor deficits , aggravate the neurodegeneration of nigrostriatal system , and completely block compensatory recovery of motor tasks [ 131 , 134 ] . the precise actions of high gc levels in motor control following nigrostriatal lesions are yet not known . analysis of gr expression in pd brains revealed that gr levels were reduced in the snpc and augmented in the putamen , compared to age - matched control subjects ; similar results were found in mptp- ( 1-methyl 4-phenyl 1,2,3,6-tetrahydropyridine- ) treated mice . the role of gc on the limbic arm of the dopaminergic circuitry related to reward and motivation as well as neuropsychiatric diseases has been extensively investigated ( see below ) . thus , from its known roles in mesolimbic circuitry , it has been postulated that gr also likely affect motor automated or habitual skills of the sensorimotor circuitry in the striatum by influencing nmda / ampa receptor functions in d1 and d2 receptor - medium spiny neurons ( figure 3 ) . indeed , it has been shown that chronic stress leads to opposing structural changes in the limbic / associative and sensorimotor striatal circuitry with atrophy in the former and hypertrophy of sensorimotor striatum , leading to habit behavior . in addition , the roles of both glucocorticoids and noradrenaline were recently reported in habit memory . it is possible that gr - mediated changes in the putamen during the prodromal stage of pd play a role in preventing the appearance of motor symptoms , culminating in dopamine depletion and death of dopaminergic neurons in the substantia nigra . altered stress responses most likely play an important role in nonmotor pd symptoms , particularly anxiety , depression , and mild cognitive impairment , which often precede motor symptoms . interestingly , there is also evidence in pd for lower novelty - seeking and high harm avoidance personality traits with anxiety - associated symptoms [ 43 , 137 ] . these observations suggest that , in the initial disease stage , stress - related alterations in gc - gr activity could impact both the motivation / cognitive - associated dopaminergic as well as nondopaminergic ( serotonergic and noradrenergic ) neuronal circuitry . this would also implicate dopaminergic neurons in the ventral tegmentum area ( vta ) , which although relatively spared in pd are well - known to regulate reward and aversion by stress and have been implicated not only in addiction but also depression involving the transcriptional factor creb and bdnf [ 138141 ] . on the other hand , dorsolateral dopamine neurons in the sn ( vulnerable in pd ) were shown to respond to tasks involving working memory ; thus , their demise could explain , in part , the cognitive deficits observed in pd . in fact , firing patterns of dopamine neurons in vta correlated with depressive - like behaviors in mice , although the effect appears to depend on the stress paradigm used to induce the depressive - like behavior [ 139 , 143 ] . electrophysiological evidence implicates changes in both d1r and d2r - medium spiny neurons ( msns ) in the ventral striatum , but the depressive - behaviors seems to preferentially affect d1r msns ( figure 3 ) . glutamatergic receptors , nmda and ampa receptor functions were shown to be also altered in the d1r msns , notably nmdar - dependent ltd , reduced ampa / nmda receptor ratio and increased endocytosis of ampa receptors . accumulating evidence points to inflammation resulting from chronic activation of innate and adaptive immune cells as playing an important role in both neurodegenerative processes and in nonmotor symptoms of pd . using radiolabeled ligand c - pk-11195 for translocator protein , positron emission tomography ( pet ) studies in pd patients revealed an early activation of microglia in many brain regions including basal ganglia and midbrain [ 147 , 148 ] . furthermore , postmortem studies as well as analyses of serum and cerebrospinal fluid from pd showed high levels of proinflammatory mediators such as tnf- , il-1 , inos , ifn- , and cox-2 . in line with observations in pd patients , presence of inflammatory mediators and glial reactivity in striatum and substantia evidence from recent genome - wide studies points to involvement of the immune system in the etiology of idiopathic pd . a number of susceptibility loci identified relate to genes expressed in immune cells such as hla - dqb1 , lrrk2 or bst-1 [ 151 , 152 ] . in addition , identified pd risk factors [ such as age , environmental toxins ( e.g. , heavy metals or pesticides , ) traumatic brain injury , and bacterial or viral infections ] activate immune responses in periphery and brain . activated microglia functioning as innate - immune competent cells are likely involved in releasing the above inflammatory molecules , thereby inducing dopamine neurodegeneration . indeed , the important role of these proinflammatory mediators in promoting degeneration of dopaminergic neurons of substantia nigra was demonstrated using mice with specific knockout of these genes [ 153156 ] . the synthetic analogue of gcs , dexamethasone , was shown to attenuate dopamine neuronal loss by precluding activated microglia from releasing toxic inflammatory molecules [ 157 , 158 ] . in adrenalectomized mice ( lacking endogenous production of gcs ) , dopamine neuronal loss was augmented following mptp intoxication indicating that endogenous gcs do play a role in protecting dopamine neurons . examination of gr in microglia revealed an increase in nuclear localization of gr following mptp treatment in mice , which coincided with a rise in systemic corticosterone levels , indicating that gr is activated in microglia during the degeneration of dopamine neurons . the unequivocal evidence that gr in microglia normally protects dopamine neurons was provided by experiments with mice in which the gr gene was selectively deleted in microglia / macrophages . mptp treatment in these mice resulted in increased dopamine neuronal loss as well as increased microglial activation and expression of proinflammatory mediators . indeed , the absence of gr in microglia resulted in sustained activation of nf-b as was shown in these microglial gr mutants . the above findings have a significant relevance for pd pathogenesis as nuclear expression of p65 subunit of nf-b , indicative of transcriptional activity , was found in the substantia nigra microglia of pd postmortem . inflammatory reaction mediated by immune - competent cells such as microglia is normally a very tightly regulated process of limited duration . it is very likely that the processes involved in the regulation of glial immune responses including the expression and secretion of inflammatory mediators are compromised in pd and also ad resulting in a chronic inflammatory state with sustained activation of glia spanning many years . immune - regulatory processes are compromised in aging ( immunosenescence ) and also during chronic stress where there is an increased susceptibility to infections as well as proinflammatory cytokine production . in aging , microglia show enhanced sensitivity to inflammatory stimuli , a process called priming which could be also induced by chronic stress and a dysregulated hpa axis . in this regard , there are several studies showing that chronically elevated gcs levels in response to different stressors cause proinflammatory cytokine production and sensitization or priming of microglia . importantly , subsequent inflammatory or toxic stimuli result in aggravation of neuronal injury [ 119 , 120 , 163 ] . moreover high and sustained gcs can exacerbate inflammation because of gc resistance whereby gr activity is affected . thus it is plausible that gr transcriptional activity regulating inflammatory response of microglia is compromised in ad and pd patients who display persistently high gc levels . recent experimental evidence shows that glia and peripheral immune cells are activated upon chronic psychogenic stress and that their actions are important in mood and behavior [ 164167 ] . glial production of potent proinflammatory cytokines such as tnf- , il-6 , and inf- are implicated in depression through stimulation of the kynurenine pathway ( shift of serotonin synthesis from tryptophan to kyneurin ) in activated astroglia , microglia , and infiltrating peripheral immune cells . kynurenine , produced from tryptophan by activation of indoleamine 2,3-dioxygenase ( ido ) , can be further converted to kynurenic acid or quinolinic acid , the latter affecting the function of both monoaminergic and glutamatergic neurons . quinolinic acid toxicity with increased glutamate release results in lipid peroxidation and nitrative stress [ 168 , 169 ] evidence shows that the kynurenic acid / tryptophan ratio is altered in csf and serum in pd patients . another means by which glial activation and proinflammatory cytokines promote mood anomalies in pd is through reducing neurogenesis in hippocampal subgranular zone , thus affecting hippocampus - mediated regulation of mood and cognition . clinical and preclinical studies suggest that chronic stress / elevated gc levels may be an etiological factor in the development and progression of both ad and pd pathologies . growing evidence indicates that the pathological manifestations of chronic stress include neuronal and synaptic atrophy / malfunction as well as immunosuppression , but our understanding of the underpinning mechanisms is still poor and calls for more research not only to identify therapeutic inroads but , also , preventative measures or ways to delay onset of disease .

stress and stress hormones , glucocorticoids ( gcs ) , exert widespread actions in central nervous system , ranging from the regulation of gene transcription , cellular signaling , modulation of synaptic structure , and transmission and glial function to behavior . their actions are mediated by glucocorticoid and mineralocorticoid receptors which are nuclear receptors / transcription factors . while gcs primarily act to maintain homeostasis by inducing physiological and behavioral adaptation , prolonged exposure to stress and elevated gc levels may result in neuro- and psychopathology . there is now ample evidence for cause - effect relationships between prolonged stress , elevated gc levels , and cognitive and mood disorders while the evidence for a link between chronic stress / gc and neurodegenerative disorders such as alzheimer 's ( ad ) and parkinson 's ( pd ) diseases is growing . this brief review considers some of the cellular mechanisms through which stress and gc may contribute to the pathogenesis of ad and pd .

seasonal influenza is a known cause of morbidity and mortality among cancer and transplant patients . during influenza season , 20 to 30% of stem cell transplant sct recipients with respiratory symptoms can test positive for influenza with a mortality rate of up to 28% . non - transplant cancer patients can also have a high mortality rate of up to 38% , being higher in patients with lung , hematological and colorectal cancer , in patients that develop lower respiratory tract infections , and in patients with other co - morbid conditions . in argentina , seasonal influenza in onco - hematological patients is associated to a 12% incidence of pneumonia and to a 5% of 30-day mortality . in march 2009 a novel influenza a virus , later known as 2009 pandemic influenza a ( h1n1 ) , emerged in mexico . the new strain initially spread among travelers to the usa and canada , and subsequently infected people worldwide . clinical presentations ranged from mild symptoms to severe cases that lead to pneumonia and respiratory failure related deaths . the first cases of pandemic influenza a ( h1n1 ) in argentina were reported in may 2009 , in travelers returning from mexico and the usa . from may to december 2009 there were 11931 cases of confirmed influenza a h1n1 in argentina , 617 deaths , and over 90% of the circulating respiratory viruses in adults were the novel influenza a h1n1 . data from different studies on the impact of this new virus in the adult cancer and sct population are somewhat contradictory . many studies from different countries were reported 1 , 6 16 . in these studies , the incidence of pneumonia ranges from 20 to 52% , while the reported mortality rate ranges from 010% 6 , 11 , 12 , 14 , 16 to as high as 2131% 7 10 , 15 . during the 2013 winter season , pandemic influenza a h1n1 continued to circulate ( flunetdb , who , http://apps.who.int/globalatlas/dataquery/default.asp ) . in this study , we examined the effects and severity of pandemic h1n1 influenza during the 2009 influenza season , in patients with cancer and sct in two cities of argentina . to august 2009 , cancer and sct patients older than 16 years , who presented a confirmed influenza infection by real - time pcr were included . the following data were obtained anonymously : underlying illness , type and date of sct , whether patients were or were not receiving immunosuppressive treatment , at the time of the influenza diseases , immunization for seasonal influenza , clinical presentation ( influenza like or pneumonia ) , laboratory and radiology results , anti - viral treatment , and outcome . in addition , data on the time between the onset of symptoms and the initiation of antiviral therapy , need for ventilation support , and presence of co - infections were also collected . the rt - pcr tests for pandemic influenza a h1n1 virus were performed on nasopharyngeal swabs or bronchoalveolar lavage samples when available . either of two pcr protocols were used for detection of the pandemic influenza a h1n1 virus depending on test availability : the real - time ready influenzaa / h1n1detectionset version june 2009 ( roche diagnostics gmbh , roche applied science68298 mannheim , germany ) and the pcr protocol used by the who ( cdc protocol of real - time rtpcr for influenza a h1n1 28 april 2009 , revision 1 , 30 april 2009 ) . categorical variables are shown as percentages and they are compared with the -distribution test or fisher test . the association between baseline variables and events is presented as or with the 95% ci . in all cases , from may to august 2009 , 12 centers sent data of 65 cancer patients with 2009 h1n1 virus disease confirmed by positive pcr in bal ( 3 ) or nasopharyngeal wash ( 62 ) . the median age of the patients was 51 years ( range 17 to 81 ) , and 57% were female . the majority of patients ( 47 ) had onco - hematological cancer ( 72% ) and 18 ( 28% ) had solid tumors . cancer treatment included chemotherapy ( 46 ) , sct ( 16 ) , no treatment ( 2 ) and surgery ( 1 ) . the median time of patients follow up from the onset of symptoms was 61 days , range 5 to 259 . pneumonia and pneumonia with oxygen saturation < 96% were the most common clinical presentations ( 43/65 , 66% and 30/65 , 46% , respectively ) . co - infections were present in a minority of cases ( 9/65 , 14% ) and only among patients with community acquired influenza . * 4 pneumonias ( 3 s. pneumoniae , 1 moraxella catarrhalis ) , 3 bacteremia ( k. pneumoniae , mrcns , streptococcus group c ) ; * * influenza b and parainfluenza 3 infection . patients started treatment at a median of two days from onset of symptoms ( range 0 to 45 days ) . sixty eight percent ( 43/63 ) of patients started treatment within the 48h after the onset of symptoms . some patients received combined antiviral treatment because of the potential circulation of seasonal influenza a h1n1 known to be resistant to oseltamivir . most patients acquired the infection in the community ( 58 , 89% ) while 7 ( 11% ) of infections were acquired in the hospital setting despite the implementation of adequate standard precautions and isolation measures during this outbreak . detailed descriptions of the outcome of patients with community acquired ( capia ) and nosocomially - acquired ( napia ) pandemic influenza a h1n1 infection patients are described in figure 1 and figure 2 . the 30-day mortality was higher among patients with napia ( 3/7 , 43% ) than among those with capia ( 9/58 , 15,5% ) . urti : upper respiratory tract infection ; icu : intensive care unit ; mv : mechanical ventilation ; ards : acute respiratory distress syndrome . urti : upper respiratory tract infection ; icu : intensive care unit ; mv : mechanical ventilation ; ards : acute respiratory distress syndrome . reasons for patient admission included mainly oxygen desaturation , but , in many cases , patients were admitted because of their severe state of immune suppression and the lack of information about this emergent virus , especially when the patient s social environment prevented him / her from easy access to medical care . outpatients who presented with upper respiratory tract symptoms ( urti ) , had the most benign course since the majority ( 11/19 , 52% ) resolved their infections with antiviral therapy in the outpatient setting , and , among the 8 ( 42% ) who were admitted , none of them required icu admission or developed signs of pneumonia . the 30-day mortality among capia urti was 0 . outpatients who presented with pneumonia had a more severe course since almost all of them ( 37/39 , 96% ) were admitted , 15/39 ( 38% ) required icu , 11/39 ( 28% ) required mechanical ventilation ( mv ) , and the 30-day mortality in this group was of 23% ( 9/39 ) . the worst prognosis in this group was seen among those who presented with pneumonia and desaturation ( 25 ) , leading to an admission rate of 100% ( 52% in icu , 44% needed mv ) , and a 30-day mortality of 36% . patients , who developed napia , belonged to 3 different centers and started having symptoms at median of 20 days after admission ( range 2 to 33 ) . this group had the poorest prognosis since the 30-day mortality rate was 43% ( 3/7 ) . one of three ( 33% ) napia urti progressed to pneumonia , while none of the 19 patients with capia urti did . therefore , the overall progression from urti to pneumonia was of 4.5% ( 1/22 ) . the 30-day mortality according to the clinical presentation and setting is best described in table 2 for comparison . it is shown that having pneumonia at presentation and developing of the infection in the hospital setting tended to be associated with a higher 30-day mortality without achieving statistical significance . urti : upper respiratory tract infection ; capia : community - acquired pandemic influenza a infection ; napia : nosocomially acquired pandemic influenza a infection . bacterial complications were documented in 6 ( 9% ) patients and included 3 bacteremias ( cvc related mrcns , acinetobacter baumanii , and gnr that was only seen in direct examination ) , 2 pneumonias ( mrsa , s. pneumoniae ) and 1 meningitis ( ps . aeruginosa ) . the median time from the onset of symptoms to the development of a bacterial complication was 11 days , range 034 . bacterial complications developed only among patients who presented with pneumonia ( 6/43 , 14% ) by the pandemic influenza a h1n1 . non - infectious complications developed in 14 ( 22% ) patients . they included : renal failure ( 5 ) , respiratory failure ( 5 ) , shock ( 3 ) , hypokalemia ( 3 ) , nonbacterial infections ( 3 ) ( cmv reactivation , candidiasis by c. glabrata , and pcp ) and bleeding ( 2 ) ( lung and brain ) . no deaths were observed among patients who had been vaccinated against seasonal influenza in the same year . however , we do know that the first case was detected on may 12 , while the seasonal influenza vaccine was available since march . therefore , there is a high probability that at least 14 days might have passed between vaccination and the onset of symptoms . the presence of any co - infection ( bacterial or viral ) at onset of symptoms and the delay in treatment were not associated to death or mechanical ventilation . by univariate analysis lack of history of vaccination , and the following baseline characteristics : pneumonia , oxygen saturation < 96% , and lymphocyte count < 800 cells/l , were associated to 30-day mortality and mechanical ventilation . by multivariate analysis only lack of history of vaccination ( or did not apply because none died in the vaccinated group ) and baseline oxygen saturation < 96% ( or 19.5 ; 95% ci 2.28 - 165.9 ; p=0,007 ) were associated to mechanical ventilation and death . there might be a bias regarding the apparent benefit of vaccination because in cancer patients , immunization is usually advised when the period of major immunosuppression has finished . sct : stem cell transplantation ; gvhd : graft vs host disease ; chemo : chemotherapy ; is : immunosuppression ; urti : upper respiratory tract infection ; nfw : nasopharyngeal washing ; bal : bronchi - alveolar lavage ; ifd : indirect immunofluorescence assay ; chest ct : chest computed tomography ; hd : hodgkin disease ; all : acute lymphoblastic leukemia ; cll : chronic lymphoblastic leukemia ; mm : multiple myeloma ; aml : acute myeloid leukemia ; cml : chronic myeloid leukemia click here for additional data file . our study shows the clinical course of the infection by the 2009 pandemic influenza a h1n1 virus in 65 cancer patients from 12 institutions located in two cities of argentina . overall we found a high rate of pneumonia ( 66% ) and mortality ( 18% ) . the clinical course was less severe in those who presented with an urti in the outpatient setting in contrast to those who presented with pneumonia and desaturation especially in the hospital setting . we also found that the best predictors of death were oxygen desaturation at presentation and lack of vaccination against seasonal influenza . the incidence of pneumonia we found is higher than the one reported with seasonal influenza in cancer patients ( 544% ) 3 , 18 20 and it is also higher than the incidence of lower respiratory tract infections ( lrti ) caused by the 2009 pandemic influenza a h1n1 in the hospitalized general population ( 4044% ) , in solid organ transplant recipients ( 23% ) , in hct recipients ( 2156% ) 1 , 6 , 8 , 12 14 , 22 and in patients with hematological malignancies ( 48% ) . only one small study that includes 15 confirmed cases of 2009 pandemic influenza a h1n1 infection in onco - hematological patients reports a higher incidence of pneumonia ( 87% ) . the 30-day mortality rate we show in this study is more than three times the one observed in argentina in the same patient population when looking at infections by other respiratory viruses such as adenovirus , influenza , parainfluenza , and rsv ( 5% ) . however , it is similar to the mortality rate reported in hematological patients with pneumonia by influenza , parainfluenza , picornavirus and rsv at a us institution ( 15% ) . it is well known that seasonal influenza - induced pneumonia is independently associated with mortality after hct ( adjusted hr 2.6 ; 95% ci 1.40 - 4.86 ) . the pandemic influenza a h1n1 virus is an independent risk factor for progression to lrti ( or 5.64 ; 95% ci 1.3 - 25 ) and hypoxemia ( or 5.91 ; 95% 1.424 ) compared with seasonal influenza virus in hct recipients . in addition , immunosuppression was a main risk factor for early mortality among 337 argentinean patients admitted to icu with influenza like illness and respiratory failure that required mechanical ventilation . these data explain our high mortality rate observed among the 17 patients who were admitted to icu ( 11/17 ; 65% ) or among the 12 patients who developed respiratory failure ( 11/12 ; 92% ) . these values are comparable to those reported in the same type of population 1 , 8 , 12 , 22 , but are higher than those reported in other populations , which ranged from 024% 21 , 26 29 . indeed , the overall mortality rate observed among argentinean patients admitted to icu and requiring mechanical ventilation was 46% . to further support the high mortality of patients with pandemic 2009 influenza pneumonia , we identified hypoxemia at onset of symptoms as an independent predictor of mortality . lymphocytopenia has been described as a risk factor for progression from upper to lower viral respiratory tract infection in cancer patients 24 , 30 , and profound lymphopenia ( < 100 cell/l ) was reported as a significant risk factor for requirement of mechanical ventilation and death in hct recipients infected with seasonal influenza virus . in our study , having fewer than 800 lymphocytes/l at presentation was a predictor for the need for mechanical ventilation and death in a univariate but not in a multivariate analysis . we did not analyze a lower value such as < 100 of lymphocytes due to the small number of patients included with this value . it is noteworthy that co - infections or bacterial complications developed in less than 15% of patients . neuraminidase inhibitor therapy appears to be effective in preventing progression to lrti 2 , 30 and hypoxemia when instituted early after onset of symptoms . it was reported that delaying therapy in cancer patients with the pandemic influenza a h1n1 virus infection was significantly associated with death . early initiation of antiviral therapy in these patients may attenuate the severity of disease 21 , 27 . in our series , antiviral therapy was started early after a median of two days after the onset of symptoms , with a range from 045 days . we did not find any correlation between days from onset of symptoms to therapy or diagnosis to therapy by univariate or multivariate analysis . it is known that patients with urti can be treated as outpatients and can recover completely from their infection . in our series half of the outpatients with urti remained as such , while the other half was admitted but did not require icu . there is a possibility that most of the admitted patients could have been managed as outpatients as well . the global progression from urti to pneumonia in our study was of 4.5% ( 1/22 ) . this single patient had a nosocomial infection and died 21 days later with sepsis , respiratory failure and neutropenia . this is according to reports of progression to lrti that may occur even after one week of symptoms . in contrast , patients with lrti required hospitalization with a high number of them requiring admission to icu for ventilation support . the dismal outcome seen in these patients despite treatment with oseltamivir probably indicates that this high - risk group needs to be treated differently from patients with isolated urti . some authors have suggested an initial treatment with high dose of oseltamivir and/or combination therapy approaches in the case of respiratory failure . all our patients received standard dose of oseltamivir ( 75 mg po twice a day ) for a minimum of 10 days based on data on slower viral clearance . nosocomial outbreaks of seasonal and pandemic 2009 influenza a h1n1 infection can develop even in the setting of appropriate infection control measures . this mortality rate is higher than the previously reported 1327% , however , the number of patients in our report is too small to make any conclusion . seasonal influenza vaccination is recommended yearly for all patients with cancer and hsct recipients . in our study all deaths occurred among the non - vaccinated patients , while there were no deaths among the vaccinated patients . individuals vaccinated against seasonal influenza a or with previous seasonal influenza infection may benefit from preexisting cross - reactive memory cd4 t cells and cd8 t cells reducing their susceptibility to influenza a h1n1 infection or explaining , at least in part , the unexpected mild illness in the community 35 39 . whether the trivalent seasonal influenza vaccine is protective against the pandemic influenza a h1n1 virus in cancer patients is still a matter of debate . in conclusion , we report a series of cancer patients with the pandemic influenza a h1n1 infection with a high incidence of hospitalization , severe pneumonia , icu admission , mechanical ventilation , and 30-day mortality . in our series hypoxemia and lack of vaccination with seasonal trivalent influenza vaccine a larger study is needed to evaluate the possibility of cross protection with the seasonal influenza vaccination . baseline characteristics , clinical presentation , treatment and outcome of 65 cancer or sct patients doi : 10.5256/f1000research.5251.d35377

background : during march 2009 a novel influenza a virus emerged in mexico . we describe the clinical picture of the pandemic influenza a ( h1n1 ) influenza in cancer patients during the 2009 influenza season . methods : twelve centers participated in a multicenter retrospective observational study of cancer patients with confirmed infection with the 2009 h1n1 influenza a virus ( influenza - like illness or pneumonia plus positive pcr for the 2009 h1n1 influenza a virus in respiratory secretions ) . clinical data were obtained by retrospective chart review and analyzed . results : from may to august 2009 , data of 65 patients were collected . median age was 51 years , 57 % of the patients were female . most patients ( 47 ) had onco - hematological cancers and 18 had solid tumors . cancer treatment mainly consisted of chemotherapy ( 46 ) , or stem cell transplantation ( sct ) ( 16 ) . only 19 of 64 patients had received the 2009 seasonal influenza vaccine . clinical presentation included pneumonia ( 43 ) and upper respiratory tract infection ( 22 ) . forty five of 58 ambulatory patients were admitted . mechanical ventilation was required in 12 patients ( 18% ) . treatment included oseltamivir monotherapy or in combination with amantadine for a median of 7 days . the global 30-day mortality rate was 18% . all 12 deaths were among the non - vaccinated patients . no deaths were observed among the 19 vaccinated patients . oxygen saturation < 96% at presentation was a predictor of mortality ( or 19.5 ; 95%ci : 2.28 to 165.9 ) . conclusions : in our cancer patient population , the pandemic 2009 influenza a ( h1n1 ) virus was associated with high incidence of pneumonia ( 66% ) , and 30-day mortality ( 18.5% ) . saturation < 96% was significantly associated with death . no deaths were observed among vaccinated patients .

avascular necrosis ( avn ) of the femoral or humeral heads in patients with sickle cell anemia is a common and painful condition . typically , the pain is managed with narcotics and activity restriction until there has been collapse of the subchondral bone with a degree of arthrosis sufficient to warrant total joint arthroplasty . this method entails prolonged pain for the patient and decreases the ability to function occupationally and recreationally . a 51-year - old african - american woman with a history of sickle cell anemia presented for the evaluation of significant bilateral shoulder pain that was confirmed to be avn via radiographs and magnetic resonance imaging of both her humeral heads without joint collapse . she tried and failed conservative management with physical therapy and optimization of sickle cell treatment with pain medications for years , so she desired surgical management . arthroscopically assisted core decompression of her humeral heads with synthetic grafting was performed in an attempt at joint preservation . this report demonstrates a technique of staged decompression of necrotic bone in the bilateral humeral heads with synthetic bone grafting to determine if this could function as a joint preservation strategy . this procedure was considered successful to alleviate the patients pain in both of her arms . the application of this procedure is significant because it could be used in various future medical joint preservation cases for a wide range of patients . avascular necrosis ( avn ) of the femoral and humeral heads is a frequent and debilitating finding in many patients with sickle cell anemia [ 1 , 2 , 3 , 4 ] . the standard treatment is observation with symptomatic pain control until the arthrosis has progressed to the point requiring total joint arthroplasty [ 5 , 6 , 7 , 8 ] . there is a lack of published research with regard to joint preservation strategies in this patient population with new data starting to be published on the outcomes of core decompression and arthroplasty on atraumatic osteonecrosis . this case illustrates a patient with bilateral humeral head avn in which staged decompression of the necrotic bone with synthetic bone grafting was performed as a joint preservation strategy . it is our goal to delay end - stage arthrosis and cartilaginous degeneration with early intervention . a 51-year - old african - american woman with a history of sickle cell anemia presented for the evaluation of significant bilateral shoulder pain that was interfering with her activities of daily living and requiring narcotic medication for pain control . the pain and disability had been increasing progressively over several years and was recalcitrant to physical therapy . radiographs and magnetic resonance imaging ( mri ) confirmed avn of her humeral heads without joint collapse ( fig . preoperative magnetic resonance imaging demonstrates extensive subchondral osteonecrosis without joint collapse staged surgery was then performed approximately 4-month apart using the identical technique on both shoulders . this consists of admission the evening before surgery to the internal medicine service with acquisition of routine blood work , intravenous hydration , and preoperative blood transfusion as indicated based on hemoglobin level . surgery was performed in the beach chair position with the c - arm coming in perpendicular to the patient . diagnostic arthroscopy was performed to evaluate for intra - articular pathology and confirm that there was no significant chondromalacia , which would negate the benefits of the joint preservation procedure . in this case , arthroscopy revealed small partial thickness articular sided supraspinatus tears that were debrided but no visible chondral damage was present . upon probing , the cartilage was quite soft over the areas of avn noted on mri . under fluoroscopic guidance , a guide wire was directed into the center of the region of avn , which was done via a small deltoid splitting approach laterally . the arthroscopic probe was placed in the center of the most depressible cartilage region on the head and utilized fluoroscopically to guide pin placement . once the guide wire was in the center of the defect , an expandable reamer was utilized and the necrotic bone was removed ( fig . the arthroscope is critical in this stage to allow complete extraction of necrotic subchondral bone while ensuring no penetration of the cartilage . after full decompression was performed , synthetic bone graft ( pro - dense , wright medical ) was injected under fluoroscopy and direct visualization . given the immediate structural integrity of the graft , maximal removal of necrotic segments was attempted . care was taken under fluoroscopic guidance not to penetrate the articular surface and no cartilaginous defects were encountered . for both procedures , the standard sickle cell protocol was followed with overnight admission for intravenous hydration followed by discharge with 2 weeks of deep venous thrombosis ( dvt ) chemoprophylaxis . she was allowed activity as tolerated and physical therapy initiated 2 weeks after each surgery . at 8-month follow - up from the index procedure , she is asymptomatic with a full range of motion on the first shoulder and some mild residual stiffness in the second shoulder ( 4-month follow - up ) . radiographs demonstrate incorporation of the bone graft without evidence of joint collapse or further avn ( fig . ( a and b ) 4-month and 8-month images show progressive replacement of graft with new vascularized bone . there are no published articles on surgical shoulder joint preservation in sickle cell anemia to the authors knowledge . in this report , we show a potential method to mitigate this process and prevent or delay the need for total joint arthroplasty with early intervention . synthetic grafting with an injectable calcium sulfate and calcium phosphate composition ( pro - dense ) has been shown to be effective in allowing relatively rapid bone regrowth in the setting of femoral head avn [ 10 , 11 ] . removal of necrotic bone back to healthy vascularized bone with interposition of a structurally strong osteoconductive substrate allows for gradual revascularization and re - ossification of the region . while decompression and grafting will not change the underlying sickle cell disease process , it is our hope to provide improved the quality of life for these patients . further study is required to demonstrate the long - term efficacy of joint preservation strategies in the humeral heads of sickle cell patients with humeral head avn before evidence of cartilaginous damage . in terms of indications and contraindications or inclusion and exclusion criteria , we do not feel that joint preservation strategies would be effective after the onset of subchondral collapse , rather in the setting of mri - confirmed symptomatic avn with intact cartilage . the risk profile of any surgical intervention in the setting of sickle cell anemia must also be considered , with appropriate care taken to prevent acute sickle crisis , dvt , and pulmonary embolism . therefore , coordination with an established sickle cell program is critical to ensure appropriate pre - hydration , transfusion , and anticoagulation protocols are followed to prevent perioperative medical complications . there is no known increased risk in this patient population to using the bone graft material , so the main consideration for contraindications are related to the surgical risk of a sickle cell patient and how well his or her disease is being managed . avn is a common problem for patients with sickle cell disease and this report demonstrates a technique of staged decompression of necrotic bone in the bilateral humeral heads with synthetic bone grafting to determine if this could function as a joint preservation strategy . this procedure was considered successful to alleviate the patients pain in both of her arms ( bilateral humeral heads ) . the application of this procedure is significant because it could be used in various future medical joint preservation cases for a wide range of patients . joint degeneration and long - term pain are common outcomes of sickle cell anemia and other disease processes . while decompression and grafting will not change the underlying disease process , it is our hope to provide improved the quality of life for these patients using this procedure . our goal is to apply this joint preservation technique to more sickle cell patients and patients with other diseases causing joint pain and degeneration to improve not only the quality of joint function , but also the quality of life .

introduction : avascular necrosis ( avn ) of the femoral or humeral heads in patients with sickle cell anemia is a common and painful condition . there is currently no gold standard treatment protocol for this condition . typically , the pain is managed with narcotics and activity restriction until there has been collapse of the subchondral bone with a degree of arthrosis sufficient to warrant total joint arthroplasty . this method entails prolonged pain for the patient and decreases the ability to function occupationally and recreationally.case report : a 51-year - old african - american woman with a history of sickle cell anemia presented for the evaluation of significant bilateral shoulder pain that was confirmed to be avn via radiographs and magnetic resonance imaging of both her humeral heads without joint collapse . she tried and failed conservative management with physical therapy and optimization of sickle cell treatment with pain medications for years , so she desired surgical management . arthroscopically assisted core decompression of her humeral heads with synthetic grafting was performed in an attempt at joint preservation.conclusion:this report demonstrates a technique of staged decompression of necrotic bone in the bilateral humeral heads with synthetic bone grafting to determine if this could function as a joint preservation strategy . this procedure was considered successful to alleviate the patients pain in both of her arms . the application of this procedure is significant because it could be used in various future medical joint preservation cases for a wide range of patients .

oral leukoplakia ( olep ) is defined as a white plaque of questionable risk that is diagnosed after excluding other known diseases or disorders that carry no additional risk for cancer . olep is a clinical term that requires the application of strict diagnostic criteria for its classification . olep may present a wide spectrum of histopathological patterns , including hyperkeratosis , epithelial dysplasia , carcinoma in situ , and squamous cell carcinoma ( scc ) . the ki67 protein is localized to the nucleus in all actively dividing cells , and its expression level is proportional to the severity of dysplasia in olep . the upregulation of ki67 in both dysplastic and malignant tissues qualify ki67 as a reliable marker of cell proliferation with prognostic significance . cyclooxygenase ( cox)-2 is an enzyme that catalyzes the synthesis of prostaglandins ( pg ) whose expression is associated with carcinogenesis owing to its roles in apoptosis , angiogenesis , inflammation and immunosuppression , invasion , and metastasis . cox-2 expression was investigated for its relation with specific markers of these multiple mechanisms and correlations between high levels of cox-2 expression and carcinogenic progression were reported . additionally , cox-2 was reported to activate several classes of chemical carcinogens and its peroxidase function was contributed to the activation of procarcinogens . the mode of action of cox-2 in carcinogenesis was linked to pgs , especially of the e series . due to their effects on proliferation , angiogenesis , immune surveillance and apoptosis , increased synthesis of pgs are believed to be important in the pathogenesis of cancer [ 8 - 10 ] . cox-2 was found to be overexpressed in various carcinomas as well and high levels have been detected in scc compared to normal epithelium [ 11 - 14 ] . the aim of this clinicopathological study was to assess the prognostic value of cox-2 and ki67 expression for oral leukoplakia by determining their association with histomorphological data . to model the process of malignant transformation , samples of normal oral mucosa and squamous cell carcinoma were also investigated . tissue samples were collected from olep patients who were referred to the department of oral diagnosis and radiology in the faculty of dentistry at marmara university , istanbul , turkey . informed consent was obtained from the patients and the study was approved by the ethics committee of marmara university ( mar - yc-2006 - 0123 ) . patients using non - steroidal anti - inflammatory drugs at the time of diagnosis and in the month prior to their clinical examination were excluded from the study because of the potential effects of these agents on cox-2 levels . smoking and alcohol habits were recorded . with respect to the former , patients were divided into two groups . smokers were individuals who were smoking regularly at the time of diagnosis and for at least 1 year prior . non - smokers comprised patients who reported never having smoked as well as former smokers who had previously smoked but were not doing so at time of diagnosis . individuals who had one or more drinks three or more times per week were defined as habitual drinkers and placed in the alcohol consumption group , with one unit of an alcoholic drink corresponding to 12 g of ethanol . clinically , leukoplakia was subdivided into homogeneous ( c1 ) and non - homogeneous ( c2 ) types . c1 was defined as flat , thin , and uniformly white ; c2 referred to predominantly white , or white and red lesions that were irregular in shape , flat , nodular , or exophytic . a conservative excisional biopsy was performed for any lesion smaller than 2 cm in diameter ; larger lesions were treated according to histopathological results by applying previously described management protocols . biopsied specimens were evaluated in the department of tumour pathology at the institute of oncology of istanbul university . the final diagnosis was confirmed by histopathological examinations and any other definable lesions were excluded . olep samples were divided into four subgroups according to histopathological features : hyperkeratosis ( hk ) and - when epithelial dysplasia was present - three oral intraepithelial neoplasia ( oin ) subgroups classified according to severity as mild dysplasia ( oin1 ) , moderate dysplasia ( oin2 ) , and severe dysplasia and carcinoma in situ ( oin3 ) . a total of 20 samples , presenting 10 samples of intact normal oral mucosa ( n ) and 10 samples of scc were retrieved from the archives of the department of tumour pathology and used as negative and positive control groups , respectively . the control tissue samples were used only in the immunohistochemical evaluation in order to form a gradually increasing model for the process of malignant transformation ( figure 1 ) and not evaluated in terms of habits of smoking and alcohol consumption . olep = oral leukoplakia ; nsaid = non - steroidal anti - inflammatory drugs ; hk = hyperkeratosis ; oin = oral intraepithelial neoplasia ; n = normal mucosa ; scc = squamous cell carcinoma . the 50 tissue samples were embedded in paraffin and serial sections were cut at a thickness of 5 m that were collected on charged slides , then permeabilized and dried overnight in an autoclave at 56 c . after deparaffinization , sections were subjected to antigen retrieval by heating in a microwave four times for 5 min in citrate buffer ( ph 6.0 ) , then cooling to room temperature and washing in phosphate buffered saline ( pbs ) for 5 min . endogenous peroxidase activity was quenched by incubating the sections in 3% h2o2 followed by washes in distilled water . slides were incubated for 2 h with rabbit anti - cox-2 ( thermo scientific , lab vision corporation , fremont , ca 94538 - 6406 , usa ) and rabbit monoclonal anti - ki-67 ( thermo scientific , thermo fisher scientific , anatomical pathology , fremont , ca 94538 , usa ) antibodies , while negative control sections were treated with pbs . all slides were incubated with biotinylated goat anti - rabbit secondary antibody ( tr-015-bn ; lab vision corp . ) for 25 min , followed by a streptavidin peroxidase reagent for 25 min ; the chromogenic substrate 3-amino-9-ethylcarbazole was used to visualize immunoreactivity . sections were counterstained with mayer s hematoxylin , covered with a coverslip , and evaluated under a light microscope ( olympus , tokyo , japan ) . quantification of cox-2 and ki67 staining cox-2 and ki67 staining was evaluated by a pathologist who was blinded to the experimental protocol . slides were scanned at low magnification under a light microscope and five areas with the highest degree of staining were selected for cell counts . only nuclear staining was accepted as positive for ki67 . for cox-2 , cytoplasmic and membranous staining the number of cells in the epithelium and in the tumour island of scc specimens was counted . the immunoreactivity score was calculated as the mean percentage of positively stained cells to the total number of cells . note the strong reaction in the cytoplasms of oral intraepithelial neoplasia cells marked by arrows . positive staining was observed in the nucleus of oral intraepithelial neoplasia cells marked by arrows . kruskal - wallis test was used to compare variables among multiple groups with mann - whitney u test ( bonferroni corrected ) as a post - hoc test . fisher s exact and fisher - freeman - halton exact tests were used for qualitative comparisons of data . the means ( m ) and standard deviations ( sd ) of ages , expressions of cox-2 and ki67 were expressed as ( m [ sd ] ) . clinicopathological findings of olep patients clinicopathological characteristics of the study group are shown in table 1 . patients ranged in age from 30 to 75 years , ( 54.33 [ 11.03 ] ) , with 19 presenting hk ( 13 ( 68.4% ) males , 6 ( 31.6% ) females ) and 11 presenting oin ( 7 ( 63.6% ) males , 4 ( 36.4% ) females ) . the mean ages of the hk and oin patients were similar ( 55.05 years vs. 53.09 [ 12.93 ] years ) ( p = 0.966 ) . the occurrence of oin was associated with a non - homogeneous clinical aspect ( p = 0.004 ) , but was also observed in lesions with a homogeneous appearance ( three oin1 and two oin2 patients ) . the homogeneous - type olep was more frequently observed in the hk group ( p = 0.004 ) . clinicopathological characteristics of the study group statistically no significant , mann whitney u test . sd = standard deviation ; hk = hyperkeratosis ; oin = oral intraepithelial neoplasia ; n = number of samples ; m = male ; f = female ; s = smoker ; ns = non - smoker ; u = using ; nu = non - user ; c1 = homogenous type ; c2 = non - homogenous type . there was no difference between groups in terms of smoking and alcohol consumption ( p = 0.156 ; p = 0.327 ; respectively ) . lesions were more often localized on the tongue for oin while buccal mucosa localization was higher for hk ( p = 0.002 ) ( table 2 ) . localization of oral leukoplakia lesions by histopathological subgroups n = number of samples ; hk = hyperkeratosis ; oin = oral intraepithelial neoplasia . immunohistochemical findings cox-2 and ki-67 expression increased relative to the degree of lesion severity in the histopathological subgroups , with the scc group having the highest numbers of cox-2 - and ki67-positive cells ( table 3 ) . the mean number of cox-2 expressing cells was lowest in n tissue samples , higher in the scc and oin than in the hk group , and higher in the scc than in the oin group ( p = 0.0001 ) . cox-2 and ki67 expressions in olep samples and controls statistically significant at the level p < 0.05 , kruskal wallis test . sd = standard deviation ; olep = oral leukoplakia ; n = normal mucosa ; hk = hyperkeratosis ; oin = oral intraepithelial neoplasia ; scc = squamous cell carcinoma . among oin subgroups ki-67 expression was detected in the nuclei of cells and in ascending order ; these were n ( 5.33% ) , hk ( 36.01% ) , oin ( 39.49% ) , and scc ( 74.66% ) . there was no significant difference between the hk and oin groups , but a difference was found between scc and oin groups ( p = 0.0001 ) ( table 3 ) . the prevalence of malignant transformations of olep is between 0.13% to 17.5% for observation periods ranging from 1 to 30 years . several factors are associated with an increased risk of malignant transformation , and the clinical appearance of olep is considered a major benchmark . the occurrence of oin is relatively low for the c1 clinical type , and higher rates of malignant transformation have been reported for the c2 type . in the present study , 5/23 ( 21.7% ) c1 and 6/7 ( 85.7% ) c2 olep cases presented oin . however , given that oin was detected in c1 cases , a biopsy is recommended as a mandatory procedure for all olep types . tobacco usage in different forms is the most common antecedent for olep lesions , with suggestions that some lesions may regress upon cessation of tobacco use . according to one report , the risk for malignant transformation among individuals with scc that had ceased using tobacco for more than 10 years was similar to that of non - smokers . the patients in the present study were predominantly smokers ( 80% ) , and two patients in the non - smokers group had ceased smoking for more than 10 years and both presented with hk . nonetheless , due to dynamic nature of olep , regression is not expected in all olep cases . paradoxically , some olep lesions in non - smokers were reported to have worse prognosis than in smokers , and women without smoking habits had a higher risk of malignant transformation among the groups examined in one study . consistent with these findings , all the oin 3 patients in the present study were non - smokers . it is suggested that the high - risk nature of lesions in non - smokers is associated with intrinsic factors such as inherited or acquired predisposition , for which a more aggressive treatment strategy is recommended . alcohol consumption is another risk factor for olep , but its most potent effects are exerted through synergy with tobacco usage , with geographical variations reportedly playing a role . in this study , a slightly higher rate of alcohol consumption was detected in oin than in hk ( 27.3% vs. 10.5% ) , although this difference was not statistically significant . the increased proliferative capacity in olep has been confirmed by a higher expression level of ki67 , which was proposed as a marker for the occurrence and severity of oin in oral mucosa . its association with lesion severity underscores ki67 expression as a prognostic factor for olep , which was suggested in the present study ; the highest ki67 expression was observed in scc , followed by oin and hk , indicating that this marker of proliferation may be a predictor of progressive malignancy . on the other hand , although there was a gradual increase in ki67 expression , no significant difference was detected between the hk and oin groups . cox-2 is an inducible enzyme whose expression is low or negative in most tissues , but a few hours after a single stimulation the enzymatic activity of cox-2 was reported to increase more than 10-fold and then return promptly back to the basal level . this expression is influenced by growth- and tumour - promoting factors , inflammatory stimuli , and oncogenes under a variety of pathophysiological conditions . cox-2 expression has been implicated in the malignancy of scc of the tongue as well as oin and cox-2 overexpression was found to be predictive of patient survival in scc . elevated levels of cox-2 were also observed in the majority of dysplastic squamous epithelia and scc , in contrast to the weak expression detected in normal esophageal tissue . another study reported progressively higher cox-2 levels in normal mucosa , oin , and scc . consistent with these results , here it was found that cox-2 expression was lowest in normal mucosa , higher in hk followed by oin , and highest in scc . nevertheless , as a limitation of the present study , the number of the study group is low ( 30 samples of olep ) and the subgroups are not equal ( 2 samples of oin3 ) . therefore , further studies are required with larger populations in order to indicate cox-2 and ki67 as prognostic markers of olep . our results suggest that cyclooxygenase-2 and ki67 expression may have a prognostic value for evaluating the malignant transformation of oral leukoplakia , and that the etiopathogenesis of oral leukoplakia should be investigated in terms of risk factors other than smoking and alcohol consumption . semih ozbayrak has worked in the field of oral medicine and dentomaxillofacial radiology in department of oral diagnosis and radiology , faculty of dentistry , marmara university , istanbul , turkey ( 1986 - 2013 ) and provided indispensable advice and guidance throughout this investigation .

abstractobjectivesoral leukoplakia is a precancerous lesion of the oral mucosa . the upregulation of ki67 and cyclooxygenase-2 has been reported in both dysplastic and non - dysplastic tissues . the aim of this clinicopathological study was to investigate the prognostic value of ki67 and cyclooxygenase-2 expression for oral leukoplakia.material and methodsa total of 50 samples were investigated and the study group consisted of 30 oral leukoplakia samples . samples of 10 intact oral mucosa and 10 squamous cell carcinoma were included as negative and positive control groups , respectively . epithelial dysplasia was defined as oral intraepithelial neoplasia ( oin ) and classified into subgroups 1 - 3 . tissue samples were assessed immunohistochemically for ki67 and cyclooxygenase-2 expression . clinicopathological correlations of oral leukoplakia patients were also investigated.resultsall oin 3 patients were non - smokers ( p < 0.05 ) , and homogeneous oral leukoplakia lesions also presented oin . both cyclooxygenase-2 and ki67 expression increased with the severity of lesions , which defined different subgroups ( p < 0.05 ) , except there was no significant difference between the hyperkeratosis and oin groups for ki67 expression.conclusionscyclooxygenase-2 and ki67 expression may have a prognostic value for the malignant transformation of oral leukoplakia .

delusional disorder is an uncommon psychiatric condition characterized by nonbizarre delusions of a single theme , in the absence of other mood or psychotic symptoms . it is differentiated from schizophrenia by the absence of bizarre delusions and impairment of functioning only in relation to the delusional belief . the lifetime prevalence rate is reported to be about 0.2% in the united states , whereas in india rates of about 1% have been reported in a psychiatric clinic population . the disorder is divided into erotomanic , grandiose , jealous , persecutory and somatic subtypes based on the content of the delusion . the most commonly reported subtypes are the persecutory subtype in western literature , whereas delusional parasitosis is most commonly reported in indian literature . although delusions of a sexual nature are not unusual in schizophrenia and affective disorder , reports of this presenting as a delusional disorder are uncommon . we report a case of a young male who presented with a single delusion regarding his sexual physiology . mr . a is a 19-year - old single engineering student , from a middle socioeconomic background . over the previous year and a half , he firmly believed that every time he assumed an upright posture , he attained penile erection . he believed that others were able to identify his physiological state by the appearance of his groin and therefore were laughing at him and making derogatory comments . he had made attempts to mask these perceived bodily changes by changing the way he dressed . secondary to these beliefs he had also become socially withdrawn , was frequently absent from class and had had significant academic decline . he also avoided situations , which required him to stand upright , such as crowded buses , elevators , and shops . he had attempted self - harm a year earlier by slashing his wrist due to the distress related to his beliefs . the patient had been on fluvoxamine and risperidone for about 7 months at the time of presentation . physical examination , including a detailed neurological and genital examination did not reveal any abnormalities . mental status examination revealed a well groomed young man with normal psychomotor activity and speech . he was distressed by the sexual problems that he perceived he had , but denied suicidal ideation . he had a fixed belief that he attained penile erection whenever in an erect posture . the degree of conviction with which the patient held his belief despite evidence to the contrary suggested it to be a delusion , upon which he was acting . a diagnosis of delusional disorder was considered in view of the single delusional theme in the absence of first rank symptoms or affective features . the management focused on establishing rapport with the patient along with eliciting and understanding the explanatory model for his beliefs . socratic questioning was used to identify negative thoughts and dysfunctional assumptions , which were reflected to the patient . a hierarchy of situations based on distress and avoidance were charted down and he was asked to expose himself to the least anxiety provoking situation . the patient was also encouraged to do some behavioral experiments in these situations to confirm or disprove his assumptions . the antidepressant medication was tapered and stopped , while the dose of risperidone was gradually increased to 4 mg / day . delusions with sexual content , although not as common as other delusions , have been reported in psychotic disorders such as schizophrenia , depression , and organic conditions . the content of these delusions include that of self - mutilation , delusional pseudo - transsexualism , bizarre sexual mechanisms , threat to genitalia , variations of erotomania , pregnancy , procreation , and homosexuality . in a qualitative review of bizarre delusions among a sample of patients with schizophrenia in india , de et al . found that delusions with sexual content included false beliefs about sexual relationship between humans , animals and/or supernatural beings ; forceful change in sexual gender or identity and threats to genitalia . while sexual delusions are encountered as one among other types of delusions in schizophrenia , it is not commonly reported in the form of a delusional disorder . in this case , organic illness was ruled out and the delusional nature of the belief was confirmed . in the absence of other psychotic symptoms , the patient reported distress secondary to the belief and its consequences , and there was no evidence of a primary mood disorder or other psychotic symptoms . delusional disorder is managed with pharmacological and nonpharmacological strategies . in this case treatment with antipsychotic agents was combined with supportive measures along with cognitive and behavioural strategies , to allay the patient 's anxiety , acknowledge his distress , explore the consequences of his beliefs and modify them . isolated delusions with a sexual theme are rare . as with any other delusional disorder , the treatment is challenging and involves both psychopharmacology and psychotherapy . given the chronic nature of this condition , treatment strategies should be tailored to the individual needs of the patients with a focus on maintaining social function and improving quality of life .

delusions with a sexual theme are rare , but when present are usually seen in patients with schizophrenia or other chronic psychotic disorders . we report a case of delusional disorder , with a single belief of a sexual theme . this report focuses on the management issues , wherein a combination of pharmacological and nonpharmacological interventions proved helpful .

the hiv epidemic , directly and indirectly , puts a high burden on human societies which can not be easily estimated due to its several complicated factors . with increasing the prevalence of hiv infection gross domestic product ( gdp ) hiv / aids is a serious health threat for prisoners in many countries and it causes major challenges for prison and public health authorities and national governments . worldwide , the levels of hiv among prisoners tend to be much higher than in the population outside . prisons are considered as an important source of transmission and spread of hiv and other blood - borne diseases ( 2 ) . over the past two decades several studies have demon strated the role of prisons in the spread of blood - borne infections such as hiv and viral hepatitis ( 38 ) . globally , around 16 million people inject drugs form whom three million are living with hiv and based on available evidences the most important reason for the rapid spread of hiv in such places is the use of shared needles and syringes among injecting drug users ( idus ) ( 9 ) . the high risk behaviors in prisons which pave the way of hiv transmission are not just limited to shared needle injection ; the prisons provide a ground for other high risk behaviors that may lead to blood - borne diseases . in numerous studies , some high risk behaviors during imprisonment some behaviors like homosexuality and tattooing are more common in prisons than normal societies yet , compared with using shared needles ; they have received less attention ( 10 ) . the common response of policy makers in countries with hiv epidemic among idus is to concentrate on public training and raising awareness to prevent using illicit drugs and high risk sexual relationships . in addition to training , harm reductions is considered as a pragmatic approach to prevent hiv . using these two approaches , i.e. training and raising awareness concurrent with harm reduction interventions , iran has been able to make a good response against hiv in general population and especially in prisons ( 11 ) . the current status of hiv / aids in iran ( based on the registered records of islamic republic of iran from the beginning ) can be demonstrated as follows : by the end of 2011 , a total of 24,290 people infected with hiv / aids had been identified from which 93.5% were male and 6.5% were female . among the total registered cases in the country since 1984 , the share of common causes of hiv infection has been as follows : shared drug injection 69.6% , sexual transmission 10.5% , mother - to - child transmission ( mtct ) 1 percent , and unknown 17.9% ( 12 ) . as it was noted , in the second half of 1990s some hiv infection epidemics in iran s prisons were reported and based on the reports by ministry of health ( moh ) and unaids the hiv epidemic was expended in prisons in these years ( 13 ) . based on the available evidences , hiv / aids has become prevalent in prisons mostly through the use of shared needles in idus ( 14 ) . it is estimated half of prisoners in iran are imprisoned due to drug - related crimes ( 15 ) . according to a study , about 11.6% of the prisoners in iran are idus ( 16 ) . harm reduction is a health - centered approach which is the main key for controlling hiv among idus ; it is aimed to reduce the harms of high risk behaviors like intravenous drug injection and to change these behaviors to less harmful methods and behaviors ( 17 ) . harm reduction programs are selected as the main strategy for controlling hiv in iran s prisons . the administration of methadone maintenance therapy ( mmt ) and the establishment of triangular clinics are two main harm reduction activities that are convincingly administered in iran s prisons . triangular clinics in prisons provide several services for prisoners including : counseling and training about hiv / aids and other stis , harm reduction and mmt services , and treatment of stis . accordingly , administration of mmt and prisoner s access to triangular clinic services had extended quickly with a high coverage during the period 1999 to 2011 . these services are presented in order to reduce the spread of hiv and other blood - borne diseases in prisons . this study was carried out to examine the prevalence of hiv and its association with harm reduction interventions in iran prisons during a 13- years period ( 19992011 ) . assessing the milestones through the establishment of sentinel sites is one of the conventional methods for monitoring hiv / aids . the data collected from sentinel sites have a special value for observing and monitoring the trends . in iran , the sentinel sites are chosen by technical committees whose members are from prison organization and moh . based on available statistics of prison organization the total number of prisons in iran which changed from 227 in 2006 to 242 prisons in 2011 ; the prisons and prisoners in each prison are selected randomly . based on conditions it is tried to establish sentinel sites in all parts of the country and provinces and in all major prisons . about 150 to 400 samples were randomly examined in each sentinel site . however , in small prisons and sometimes for other reasons the number of samples might become more or less than this number . sometimes some small jails were merged together to form a sentinel site . samples were randomly selected from the list of all prisoners in each ward or prison . the trained people selected the participants and filled up the questionnaires and took samples after counseling prisoners and taking their consent to enroll in the study . if a prisoner was reluctant , he was not enrolled and no samples were taken . the main variables which were investigated included age , gender and the possible way of transmission . in all these sentinel studies , first the study objectives for described for the participants and after taking their informed consent , the samples were taken . the samples were anonymously sent to a laboratory for elisa test and positive elisa cases were then confirmed by western blot . after collecting data , the results collected from sentinel sites were sent to the center for disease control of the moh and prison organization . this study includes all the data collected from sentinel sites established in all prisons of iran from 1999 to 2011 . in addition , the data about the major interventions conducted in this period of time including prisoners mmt and triangular clinics in prisons were collected in both absolute and cumulative forms . the collected data included the number of people under the coverage of mmt and the number of triangular clinics . data and information regarding the expansion of mmt and triangular clinics in prisons were received from the health statistics and information management department in prison organization . to analyze the data , firstly the trend of hiv prevalence in prisons and also the trend of expanding the interventions were described . then , the hiv prevalence and confidence interval of prevalence among iran prisoners were calculated for each year . variable transformation was used to describe the variables better and to depict a graph showing the logical relationship between the simultaneous decrease in prevalence of hiv and an increase in the trend of interventions . the logarithm of the number of established triangle clinics in prison and the number of prisons accessing mmt services were used to show the changes in variables . to evaluate the correlation between the prevalence and each of the administered interventions in prisons the pearson correlation coefficient test was used for the second half of the mentioned time period . based on the conducted study , a number of 551 sentinel sites were established in iran s prisons during the 13 years and in this check points 212,475 prisoners were evaluated and tested . table 1 presents the number of sentinel sites , the number of inmates who were tested , hiv prevalence , and the confidence interval for hiv prevalence in prisons of iran from 1999 to 2011 . as shown in table 1 , the maximum prevalence happened in 2002 ( 3.83% ) and the minimum prevalence in 2011 ( 1.28% ) . data in table 1 shows that the hiv prevalence in iran had an increasing trend from 1999 to 2002 , so that 3.83 percent of prisoners in iran were hiv infected in 2002 . with implementation of harm reduction and interventional programs , the prevalence of hiv in iran s prisons gradually decreased from 2005 to 2011 , so that it reached the minimum level of 1.28% in 2011 . two most important and effective interventions that have been carried out are : 1- initiation and expansion of mmt . the program only covered 100 people in 2002 while it covered 38,256 people in 2011 ; 2- setting up triangular clinics in prisons : the triangular clinics were set up in only one prison in 2001 while they were set up in 125 prisons in 2011 . hiv prevalence in prisons of iran ( 19992011 ) mmt is one of the main harm reduction activities in iran s prisons that have received a lot of investment and budget allocations . based on the data collected from mmt department in health office of prison organization ( table 2 ) , the coverage of mmt program in iran s prisons had an increasing trend from 2002 to 2011 , so that mmt program has become accessible for all provinces in iran since 2007 . based on the data presented in table 2 , mmt program was introduced only in one of the prisons in iran in 2002 while five years later in 2007 the mmt interventional program was expanded to all provinces . expanding methadone maintenance therapy ( mmt ) in prisons of iran , 1999 - 2011 another important harm reduction activity for controlling hiv / aids was the introduction and expansion of triangular clinics . these clinics were introduced to iran s prisons in 1999 ; triangular clinics had been set up in all prisons in iran by 2001 to provide main services including counseling and training , harm reduction , and hiv / sti related services . table 3 shows the trend of developing and expanding triangular clinics in iran s prisons . number of prisons and provinces which established triangular clinics ( vct services ) as shown in table 3 , the coverage of the triangular clinics services in all 30 provinces had reached 100 percent by 2006 . following the national territorial divisions , a new province ( alborz province ) based on the results of statistical tests , there is a significant correlation between increasing mmt centers in iran s prisons and reducing the hiv prevalence from 2002 [ = - 0.62 with p=0.001 ] . besides , there is a significant correlation between increasing the number of triangular clinics providing vct services and reducing the incidence of hiv in prison from 2002 [ = - 0.51 with p = 0.016 ] . graph 1 shows the relationship between the decreasing trend of hiv prevalence and the administered interventions . as shown in the fig . 1 , with increasing the interventions which reached the maximum in 2004 and 2005 the trend of hiv prevalence started decreasing . based on the results of current study the trend of hiv prevalence in iran s prisons from 1999 to 2000 can be described as follows . in the early years , i.e. 1999 to 2000 , hiv had an increasing trend ; it mostly remained stable from 2002 to 2005 and since 2005 it has started a decreasing trend . the main interventions including mmt and triangular clinics had been introduced and expanded since 2002 , and since 2006 and 2007 these services have become available in most of prisons in iran . the coverage of interventions has become stable since 2007 and it has been tried to increase the quality of services since then . the increasing trend of hiv and the maximum level of hiv prevalence had happened in iranian prisons during 2002 to 2005 when hiv was spreading in the country . during that time in our study , the maximum prevalence was 3.83% in 2002 which was 19 times more than the prevalence in general population . overall , the first cases of hiv / aids epidemics in iran were started among idus in iran s prisons . as a result , the primary spread of the disease in prisons led to the spread of hiv / aids in iran . the first alarms for the spread of hiv rose in prisons among idus , however the early responses were not up - to - date and satisfactory . in that time , based on moh protocols hiv positive prisoners were quarantined . due to this strategy and , also the lack of harm reduction programs in prisons , the increasing trend of hiv prevalence in iran s prisons which had started from the second half of 1990s lasted until the early years of 2000s ; while hiv was spreading with an alarming speed , the interventional activities were adopted with a delay ( 18 ) . after understanding the danger , the quarantining strategy was stopped also prisons started interventional activities , the rapid growth of hiv infection was dropped and from 2002 until 2005 the hiv prevalence was remained almost stable or had slight fluctuations . as it is obvious , because of the impacts of the increased coverage and the quality of harm reduction services the trend of hiv prevalence has started falling since 2005 . analysis of the results of this study shows that the two main interventions ( mmt and triangular clinics ) in line with harm reduction services first dropped the increasing trend of hiv prevalence in iran s prisons and then have made it reversed . although based on a comparison in 2008 the prevalence of hiv among iran s prisoners was eight times more than that among general population , it has decreased obviously compared with previous years . concerning the epidemic stages of hiv / aids , we can say iran is in concentrated epidemic stage , i.e. it is concentrated in idus as one of the high risk groups . it is quite obvious that the high risk group of idus in iran has had the biggest role in spreading hiv in the society and prisons . the estimations about the prevalence of drug abuse in iran present significant numbers ( 16 ) . however , the most important fact is that about half of iran s prison inmates are drug addicts from which 11.6% are idus ( 16 ) . additionally , it has been reported that the prevalence of using shared needles and syringes among idus prisoners is 47.3% ( 16 ) . one of the outcomes of this study is to present a 13-year trend of hiv epidemic in the prisons of iran . there are few number of studies focusing on the prevalence of hiv in prisons in low and middle - income countries and most of effective and useful studies and researches are conducted in high income countries ; the data in low and middle income countries are very limited and inadequate ( 19 ) . even in high income countries it is difficult to estimate the accurate number of hiv infected prisoners and the reported hiv prevalence are usually limited to only a prison or a region and can not accurately reflect the prevalence of hiv in all prisons of a country ( 19 ) . however , the data in the current study which is collected from annual data gatherings from sentinel sites in most of prisons in the country can demonstrate the real trend of hiv prevalence in iran s prisons . our result is in line with other finding in other countries which reported higher prevalence in prisons than in general populations . nevertheless , re - viewing the prevalence of hiv in prisons around the world has shown that hiv infection is a serious issue that needs further actions ( 20 ) . in terms of hiv prevalence among prisoners , in some cases our results shows higher prevalence of hiv in the country s prisons than in the general population . in a study among 623 prisoners at one of the belize central prisons , the hiv test positivity rate was 4% ( 21 ) . hiv prevalence among prisoners in austria was five times higher than the prevalence in the general population of the country ( 22 ) . hiv prevalence among prisoners in america has been reported to be five times higher than the prevalence in the general population ( 23 ) . overall , the reported prevalence rates in different prisons from different countries are diverse . in some prisons from different parts of the world , different studies have reported a various range of hiv prevalence in prisons on different countries : the hiv prevalence is reported zero among scottish male inmates and lowa prisoners ( 24 ) , 33.6% among adult prisoners in catalonia , spain ( 25 ) , and more than 50% among women in a correctional facility in new york ( 26 ) . world health organization has recommended a comprehensive package including nine interventions for idus for many countries especially low and middle income countries ; in this package four important and effective activities that can effectively reduce hiv prevalence are ( 27 ) : needle and syringe programs ( nsp)/medications - assisted therapy ( mat)/antiretroviral therapy ( art ) / hiv counseling and testing ( hct ) from the activities mentioned , nsp and mat can decline injecting behavior . hct or vct reduce the risk of risky sexual behavior and art can the risk of transmission through intravenous drug injection and also through sexual relationships . iran has complied with these guidelines and provided a good coverage of these programs , particularly in prisons , and has been able to control hiv infection in prisons . in spain , the impact of harm reduction programs , particularly nsp program , in reducing hiv infection in prisons has been proven ( 28 ) . . based on the results it can be concluded that setting up triangular clinics and methadone maintenance therapy as the hiv / aids control strategies which are implemented in iran s prisons following the who recommendations are highly efficient and they not only controlled the prevalence of hiv but also has led to its decreasing trend in prisons . it is recommended to continue and enhance these services and try to increase the quality of services in iran . in other countries that are facing concentrated epidemics among idus and have many addicts and especially idus in their prisons these experiences and strategies may be implemented to reduce and control hiv in prisons . it is recommended to conduct further studies to measure the quality of interventions . additionally , since harm reduction programs cover a large group of people in iran s prisons , it may provide a good ground for studying positive outcomes as well as deficiencies and problems of harm reduction activities to be utilized in the prisons all around the world . as one of the study limitations , the data used in this study was extracted from the data collected by hiv / aids surveillance system over a period of 13 years . the data may not have the same quality over the mentioned period ; since the data had not been intended for a research , it might have some biases . another limitation is that its response rate is not clear and it is likely the people who rejected doing the test were those who were infected with hiv . intravenous drug injection can lead to the spread of hiv / aids in prisons and societies all over the world . in regions and countries where the epidemic is highly prevalent among idus and prisoners , mmt and development of triangular clinics can be utilized to control hiv / aids epidemic quickly . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , re dundancy , etc ) have been completely observed by the authors .

abstractbackgroundhiv / aids epidemic is concentrated among injecting drug users in iran . like many other countries with hiv / aids concentrated epidemic , prisons are high risk areas for spreading hiv / aids . the aim of this paper was to study the trend of hiv / aids prevalence and related interventions administered in prisons of iran during a 13 years periodmethodsthis cross sectional study was conducted using the data collected from the sentinel sites in all prisons in the country and it also used the data about harm reduction interventions which has been implemented by iran prisons organization . to evaluate the correlation between the prevalence and each of administered interventions in prisons the correlation coefficient test was used for the second half of the mentioned time periodresultsthe prevalence of hiv / aids in prisons had increased rapidly in the early stages of epidemic , so that in 2002 the prevalence raised to 3.83% . followed by the expansion of methadone maintenance therapy and development of triangular clinics , hiv / aids prevalence in prisons declined . there was a relationship between interventions and the prevalence of hiv / aids.conclusionin regions and countries where the epidemic is highly prevalent among injecting drug users and prisoners , methadone maintenance therapy and development of triangular clinics can be utilized to control hiv / aids epidemic quickly .

congenital heart disease ( chd ) is one of the most common birth defects , with an incidence of nine out of every 1,000 live births.1,2 critical chd ( cchd ) is defined as cardiac lesions that require surgery or cardiac catheterization within the first month ( or within the first year by different definitions ) of life to prevent death or severe end - organ damage.2 although infant mortality has decreased over the past 3 decades for children with all forms of chd , many children are still diagnosed too late to avoid significant morbidity or death.35 delayed diagnosis of cchd is unfortunately all too common , with up to 25% of infants with these defects being missed in newborns when identification is based on clinical symptoms or signs of heart disease even in settings with routine prenatal sonograms.3,68 approximately 40% of these infants with missed diagnoses at birth present in cardiogenic shock at a medical facility and 5% are diagnosed at autopsy.4,5,9 studies in europe and the us have suggested that newborn screening with pulse oximetry testing prior to discharge from the nursery can decrease the number of missed diagnoses by 30%.2,10 in 2011 , pulse oximetry screening for cchd was added to the recommended uniform screening panel by the health and human services secretary.11 in the subsequent years , many states have implemented their own protocols to comply with this recommendation.1215 pulse oximetry has been the mainstay procedure for indirectly detecting hypoxemia in medically ill patients since the 1980s.16,17 the screening of cchd by pulse oximetry involves taking advantage of its ability to detect clinical and more importantly subclinical levels of hypoxemia that should raise suspicion for a cchd . however , pulse oximetry does not readily offer information about decreased stroke volume , which is another physiologic feature of several cchds that could be detectable during the neonatal transition . in this review , we highlight the relevant principles and limitations of pulse oximetry in the context of detecting cchd . the beer lambert bouguer law of physics describes the attenuation of light to the properties of materials through which the light is traveling.16 oxygenated blood absorbs red light at a wavelength of 660 nm , and deoxygenated blood absorbs light in the infrared spectrum at 940 nm.16 computation of oxygen saturation is achieved with the use of calibration algorithms , based on the amount of signals from nonpulsatile ( venous , capillary , bone , and skin ) and pulsatile arterial blood flow , in the red and infrared wavelengths mentioned earlier . a microprocessor removes the continuous signal from the nonpulsatile tissues and vessels , which leaves the pulsatile signal from the arteries to be displayed as a plethysmographic wave form on the pulse oximeter monitor.16 safe use of pulse oximetry requires knowledge of its limitations . there are multiple sources of potential artifacts , which are particularly relevant for neonates and can cause false readings . these include motion artifacts , poor perfusion and cold skin at the site of measurement , irregular rhythms , ambient light , phototherapy or electromagnetic interference , skin pigmentation and jaundice , inappropriate probe positioning ( penumbra effect ) , venous pulsation , intravenous dyes , and presence of abnormal hemoglobin molecules.1618 pulse oximeters recommended for screening for chd should report functional oxygen saturation ( referring to the hemoglobin that is capable of transporting oxygen ) , be motion tolerant , be validated for low perfusion states , and have a 2% root - mean - square accuracy.11 of note , a pulse oximeter s performance is optimized for oxygen saturations ( spo2 ) in the range of 80%100% . the development of the modern pulse oximeter is based on healthy , fit adult individuals who were exposed to different degrees of subambient oxygen with their spo2 being kept between 80% and 100% . therefore , any spo2 < 80% is extrapolated by a computer program.19,20 most new pulse oximeters are able to detect motion and label it as artifact or perform calculations quickly in a way that renders them motion tolerant . the pulse oximeter uses an algorithm to average readings over a period of time . for the most accurate measurement , the average is taken over a shorter period of time , which also increases the delay of the reading and decreases the speed of computation by the machine . for a pulse oximetry measurement to be accurate , the peripheral tissue needs an adequate pulse volume and pressure . in situations such as septic shock , where the extremities are cool and have low perfusion , the pulse oximeter may not reliably assess the oxygen saturation.19,20 competing light sources , such as other machinery , fluorescent lighting , and even cell phones , can overload the semiconductor sensor . in pediatrics , a phenomenon called the penumbra effect occurs.18 pulse oximeters may over - or under - read the spo2 in infants and children because of the small size of their fingers , or the other areas where the pulse oximeter probe is placed , and the different light paths for each wavelength through the peripheral tissue . specific probes for infants and children have been created and should be used to prevent these false measurements . finally , pulse oximetry should not be used in certain circumstances in which the hemoglobin molecule is not completely saturated with oxygen , such as with carbon monoxide poisoning or when methemoglobinemia occurs after administration of certain medications such as antimalarial drugs , nitrates , nitrites , or dyes such as methylene blue . in these instances , pulse oximetry is used in all aspects of newborn care , including resuscitation of newborns in the delivery room to routine monitoring in the operating room . a study by levesque et al21 in 2000 described the normal range of oxygen saturations in term newborns in the first days of life . these investigators evaluated normal oximetry values at sea level , from admission to the newborn nursery to discharge . they also evaluated variables such as sex , gestational age at birth , birth weight , mode of delivery , apgar scores , pre- or postductal site of measurement , and status of the infant at the time of measurement ( sleeping , quiet , and crying ) . pulse oximetry measurements were taken upon admission to the newborn nursery , at 24 hours of life , and at discharge . the overall oxygenation saturation was 97.2%1.6% ( 95% ci 97.1%97.2%).21 they compared the mean values at each time period , which showed a slight increase in oxygen saturation over time for the right hand ( preductal ) and right foot ( postductal ) . rising from statistical significance were only two variables , postnatal age and activity of the infant . postnatal age was found to be statistically significant ( + 0.17% per 24-hour interval from admission to discharge , p=0.0001 ) but not clinically relevant.21 infant s activity was statistically significant with values obtained while the infant was crying , fussy , or awake being lower than the values obtained while sleeping.21 de wahl granelli et al10,22 systematically measured the oxygen saturation in 40,000 newborns and compared the values obtained in children with cchd vs otherwise healthy newborns . in addition , these investigators showed that two of the three infants with cchd were missed by physical examination alone.22 addition of pulse oximetry screening raised the diagnosis rate to 82% . several other studies mostly from europe revealed similar findings.12,2328 these were summarized in a systematic review and meta - analysis of pulse oximetry screening for cchd in the newborn nursery , which included 13 studies with 229,421 infants.28 sensitivity of pulse oximetry was 76.5% ( 95% ci 67.783.5 ) and specificity was 99.9% ( 95% ci 99.799.9 ) for the detection of chd , with the average false - positive rate for these infants being 0.14% ( 95% ci 0.160.33).28 with the average pulse oximetry value being 97.2% during the first days of life for all newborns , pulse oximetry is an excellent tool to evaluate subclinical hypoxemia , that occurs during transitioning physiology of certain chd , such as transposition of the great arteries , truncus arteriosus communis , hypoplastic left heart syndrome , total anomalous pulmonary venous connection , tricuspid atresia , tetralogy of fallot , and pulmonary atresia . these lesions are usually associated with hypoxemia in the newborn period and can cause significant morbidity and mortality if the diagnosis is delayed . in september 2010 , the secretary s advisory committee on heritable disorders in newborns and children ( sachdnc ) considered these seven lesions as primary targets for pulse oximetry screening in the newborn period on the basis of advice from a technical expert panel.2 in 2011 , the sachdnc , in collaboration with the american academy of pediatrics , the american college of cardiology foundation , and the american heart association , convened a work group to outline implementation strategies for pulse oximetry screening in newborns for chd . after reviewing data from existing large studies in sweden and the uk,22,25 the work group proposed a screening protocol based on results of measurements from the right hand ( preductal ) and either foot ( postductal).11 according to the sachdnc protocol , an infant would have a positive ( failing ) screen if at 24 hours of life : 1 ) a pulse oximeter reading was < 90% in either the right hand or either foot . 3 ) a persistent > 3% difference in the right hand and either foot measurement on three measurements each separated by 1 hour . an infant who had 95% in either extremity with 3% difference in the pre- and postductal oxygen saturation would have a negative screen and no further work - up is needed . many states that have initiated pulse oximetry screening have adapted this protocol or a variation there of.12,13,15 kochilas et al14 demonstrated that the sachdnc protocol was the most efficient protocol with the fewest false - positive pulse oximetry screens in the newborn period . data from various studies suggest that this protocol is adequate to detect clinical and subclinical hypoxemia that is associated with the seven primary target lesions based on their almost universal association with at least mild hypoxemia in the neonatal period , when the fetal circulation transitions to postnatal circulation . the protocol should also be effective , although to a lesser degree , to detect the hypoxemia associated with five additional congenital heart lesions that are considered as secondary targets.6,9 these lesions are frequently associated with at least some degree of neonatal hypoxemia and include proximal aortic arch anomalies ( such as interrupted aortic arch or aortic atresia ) , coarctation of the aorta ( coa ) with patent ductus arteriosus , ebstein s anomaly , double outlet right ventricle , and single ventricle lesions . there are additional lesions that are possibly screenable in the neonatal period with the same protocol based on their anatomy and potential for intracardiac or ductal - level shunting . these include aortic stenosis with a patent ductus arteriosus , severe pulmonary stenosis , and complete common atrioventricular canal . finally , there is a category of cardiac lesions that will not have hypoxemia in the newborn period and can be classified as not screenable and include left - sided obstructive lesions such as coa without patent ductus arteriosus and aortic stenosis without a patent ductus arteriosus , ebstein s anomaly without interatrial shunting from right - to - left , and all other lesions that cause left - to - right shunting and valve anomalies that were not included in the previous categories29 ( table 1 ) . although not all chds cause hypoxemia , these types of lesions can still lead to serious complications if not detected early enough to avoid end - organ damage . among them , the most frequent category is comprised of some form of left - sided obstructive lesions for which additional diagnostic strategies may soon become clinically available . one of the most promising ones is the peripheral perfusion index ( ppi ) , which is based on the analysis of the pulse oximetry signal and is displayed on some newer generation pulse oximeters . more specifically , this technique uses the ratio between the pulsatile and nonpulsatile component of the pulse oximetry signal to detect changes in the relative amount of arterial perfusion in the examined site.29,30 as measured , the ppi may be useful in detecting reduction in the arterial circulation at the monitoring site and can be used to detect decreased perfusion in settings of left heart obstructive lesions either globally ( ie , aortic stenosis ) or regionally ( coa ) . important challenges for this technique remain the wide and highly skewed distribution of ppi values in the normal population and sensitivity to environmental factors such as skin temperature . preliminary work with ppi in neonates has established reference values for newborns with cutoff values of < 0.70 for possibly impaired peripheral perfusion and < 0.50 definite hypoperfusion.31 however , further studies with children with various cardiac lesions are needed before incorporating ppi in the screening process for cchd . few studies have shown the cost - effectiveness of pulse oximetry screening in the newborn nursery . two studies published by peterson et al32 estimated that routine screening of newborns would identify an additional 1,189 infants with cchd at their respective birth hospitals that would not have been diagnosed prior to discharge . in addition , they estimated that 20 infant lives would be saved each year by screening and a cost of $40,385 per life - year will be gained.32 the estimated cost for pulse oximetry screening in the newborn nurseries in new jersey was $ 14.09 per newborn , with supplies and labor dividing this cost almost equally.33 peterson et al33 extrapolated that the estimated average cost to screen all newborns in the us regardless of which level of nursery they were in was $ 13.50 per newborn . in the scientific statement from the american heart association and the american academy of pediatrics , mahle et al evaluated the statistical analysis of pulse oximetry screening with data from ten different studies . analysis on the studies with infants who were evaluated after 24 hours of age showed 18 false positives , along with seven false negatives and 51,063 true negatives . with these data , the sensitivity of pulse oximetry was 69.9% and the specificity was 99.9% , with a negative predictive value of 99.9% and a positive predictive value of 47%.2 pulse oximetry is an adequate screening tool , with few false positives and a high negative predictive value . as far as we know at the time of writing this article , there are no sufficient data available on the burden to the health care system with the increase in infant echocardiograms completed due to failed pulse oximetry screening in the nursery . each type of chd affects cardiopulmonary circulation differently , and pulse oximetry is a good screening tool to detect lesions that cause hypoxemia in the first few days of life . chd with impaired perfusion rather than oxygenation will , though , remain undetected by pulse oximetry . the addition of ppi , a derivative of the quantitative analysis of the pulsatile vs nonpulsatile signal of the pulse oximetry , is a promising technique to cover the diagnostic gaps for this population .

congenital heart disease ( chd ) is one of the most common birth defects , with an incidence of nine out of every 1,000 live births . the mortality of infants with chd has decreased over the past 3 decades , but significant morbidity and mortality continue to occur if not diagnosed shortly after birth . pulse oximetry was recommended as a screening tool to detect critical chd in 2011 by the american academy of pediatrics and the american heart association . pulse oximetry is a tool to measure oxygen saturation , and based on the presence of hypoxemia , many cardiac lesions are detected . due to its ease of application to the patient , providing results in a timely manner and without the need for calibrating the sensor probe , pulse oximetry offers many advantages as a screening tool . however , pulse oximetry has also important limitations of which physicians should be aware to be able to assess the significance of the pulse oximetry measurement for a given patient . this review aims to highlight the benefits and shortcomings of pulse oximetry within the context of screening for critical chd and suggests future avenues to cover existing gaps in current practices .

in this issue of critical care , kao and colleagues consider whether open lung biopsy ( olbx ) can assist in the management of patients with acute respiratory distress syndrome ( ards ) . clinical outcome in ards remains poor despite substantial advances in our understanding of the biology of this syndrome . although limiting transpulmonary pressure can clearly prevent worsening of ards , no other major therapeutic advances with proven benefit have occurred in this area . progress has been limited potentially due to the heterogeneous phenotypes that are known to underlie the american european consensus definition of this disease . thus , methods to improve diagnostic specificity are likely to be helpful in making progress . olbx has been used for years as a method of defining the underlying pathology in patients with lung disease . while its role has become established in the setting of interstitial lung disease , its utility and safety are more controversial in critically ill patients . proponents of olbx argue that knowledge of underlying etiology can be helpful in defining the best course of treatment . in addition , the risk of biopsy in experienced hands is fairly low if adequate precautions are taken . opponents of olbx cite the lack of specific therapies for underlying etiologies of ards and believe that defining the underlying mechanism of injury is largely academic . a similar discussion has taken place in the interstitial lung disease arena , where some advocate the demonstration of usual interstitial pneumonitis among patients with idiopathic pulmonary fibrosis , whereas others believe that a therapeutic trial of steroids in the majority of patients is justifiable until new therapeutic strategies emerge . the work by kao and colleagues supports the existing literature that open lung biopsy is fairly safe and frequently revealing in the context of ards . first , the authors corroborate prior reports that the underlying pathology in clinical ards is often a pattern other than diffuse alveolar damage or fibro - proliferation . of note , this and prior studies were retrospective analyses making the generalizability of these findings difficult to define . without knowing the total number of ards cases potentially eligible for biopsy , we have no easy way to know how common the observed abnormalities would be in an unselected ards population . second , the authors found minimal morbidity attributable to the surgical procedures that their patients underwent . these data support the existing literature that , in experienced hands , olbx can be safely performed in carefully chosen patients . the risk of bronchopleural fistula was fairly low in the present study , which may reflect the use of protective mechanical ventilation . we have recently observed that high pressures measured at the airway opening are strongly predictive of prolonged bronchopleural fistula risk following lung biopsy in ards . thus , attention to mechanical ventilator settings may be one factor that led to the low risk of this procedure . nearly 75% of patients had changes made in their therapeutic management due to findings from olbx . whether these changes were helpful to the patient is not entirely clear due to the lack of a control group however , at least 14 patients ( 11 with infections , 1 with hypersensitivity pneumonitis , and 2 with pulmonary edema ) had a disorder found for which accepted therapies exist . interestingly , the most common change in management recorded in response to olbx results was the institution of glucocorticoid therapy . the role of glucocorticoid therapy in ards has been controversial , with some smaller studies showing benefits whereas other larger studies demonstrated no important benefit . a number of critiques have emerged after the recently published new england journal of medicine trial examining the role of steroids in persistent ards , leading some to speculate that , despite the negative results of that trial , some ards patients may still benefit from anti - inflammatory therapy . in this recent study , more than 95% of patients were excluded prior to enrollment , leading to results that may not be generalizable to the overall ards population . the most common reason for exclusion was glucocorticoid therapy , yielding the possibility that the best candidates for steroid therapy ( from both an efficacy and safety perspective ) were excluded from the study . in addition , the frequent use of paralytics ( in up to 50% of steroid treated participants ) and marked hyperglycemia ( mean values in excess of 200 mg / dl ) may have contributed to avoidable complications of steroid therapy . thus , the frequent re - intubations and neuromyopathies that occurred in this recent study may have offset the potential benefits of steroid therapy . regardless , the stratification of patients likely to benefit from steroid therapy , while avoiding the potential morbidity of pharmacological therapies and other intensive care unit measures ( including mechanical ventilation ) is likely to be a successful strategy . future studies that aggressively limit the side effects of steroids and that examine treatment response stratified by olbx findings may demonstrate subgroups of patients that derive important benefit from this therapy . in the future , biomarkers that could be defined either in the serum or by bronchoalveolar lavage would be preferable to olbx to stratify the likelihood of benefit from steroid therapy . such biomarkers may help define the underlying pathobiology and so become a surrogate for olbx in assessing the steroid responsiveness of the disease . another class of biomarkers that may prove useful in the management of ards patients would be ones that provided information on the intrinsic steroid responsiveness of the patient . the search for genetic polymorphisms that predict individual responsiveness to steroid therapies is well underway in other conditions such as asthma and ulcerative colitis . both types of biomarkers would aid treatment decisions by better defining subgroups most likely to benefit from steroid therapy . thus , further work is clearly needed to determine whether individualized therapy will improve outcome in various subgroups of ards patients .

progress in the treatment of acute respiratory distress syndrome ( ards ) has been slow , perhaps in part due to the heterogeneity in the biology underlying this syndrome . open lung biopsy is a feasible approach to define various subcategories of underlying histology . in experienced hands , with careful selection of patients and close attention to details of critical care management , including mechanical ventilator settings , the procedure is safe even in patients with severe disease . however , further work is needed to define which patients , if any , experience a beneficial effect on outcome from this procedure . more research is needed on assessing efficacy of potential therapies within histologically defined subgroups . in the future , various biomarkers may be available to non - invasively classify ards patients from the standpoint of responsiveness to various therapies , such as gluco - corticoids .

intraocular pressure ( iop ) is one the most important modifiable risk factors for glaucoma progression.13 iop measurements in the ophthalmology clinic are often limited to office hours , which do not fully represent the nychthemeral iop peaks and fluctuations.4,5 previously , 24-hour iop monitoring studies have reported fluctuation as high as 8.21.4 mmhg , but many of these studies measured iop in the sitting position , overnight in a hospital environment , and over a few sampling periods , which does not truly reflect the physiological and normal setting of one s daily living , especially when the subjects are awakened at night for iop measurements.610 various studies have reported the significance of iop fluctuation on glaucoma progression.11,12 while there are studies that report otherwise,13,14 much of the existing literature has only documented inter - visit or daytime iop variability over a limited number of hours . this is at least partly due to limitations of how frequently repeated tonometric iop measurements can be taken . a contact lens - based sensor ( cls ) is nowadays available for the recording of ocular dimensional profiles for up to 24 hours.15 this device has been shown to be safe and tolerable in healthy subjects and glaucoma patients as well as to provide reproducible recording of 24-hour profiles.1618 the aim of this study was to analyze the 24-hour ocular dimensional profile in normal - tension glaucoma ( ntg ) patients on medical treatment . informed patient consent and approval by the institutional review board of the hospital authority of hong kong were obtained prior to study commencement . this was a prospective cohort study from july 2012 to june 2013 , conducted at a university hospital in hong kong . the study recruited consenting adults ( age > 18 years old ) with unilateral or bilateral ntg who were currently on topical antiglaucoma medications . ntg was defined as open angle on gonioscopy ; progressive thinning of the retinal nerve fiber layer ( rnfl ) on optical coherence tomography , with corresponding glaucomatous visual field changes on the humphrey visual field analyzer ; and an iop 21 mmhg on all clinical visits based on previous medical records . cases with previous glaucoma surgery or laser treatment , active or previous corneal disease , and subjects with only one functional eye were excluded . the sensimed triggerfish ( sensimed ag , lausanne , switzerland ) is a soft silicone cls that enables recording of the ocular dimensional profile over a 24-hour period with minimal disturbance to one s daily routines and sleep cycles . such 24-hour profiles are related to the 24-hour iop profiles.18 dimensional changes are recorded in the corneoscleral area for 30 seconds every 5 minutes over 24 hours and each recording burst represents 300 data points , the medians of which are plotted as a single graph which makes up the 24-hour ocular dimensional profile measured in sensory output units of millivolt equivalents ( mveq ) . the device was ce - marked and thus approved for clinical use in 2009 . in healthy volunteers and glaucoma patients , the cls was found to be tolerable in normal activities of daily living and during sleep . a contact lens with base curve 8.7 mm was also found to be well adapted in most eyes , although the device also exists in steeper ( 8.4 mm ) and flatter ( 9.0 mm ) base curves.1618 the cls was placed on the subject s eye by an ophthalmologist in the outpatient clinic after a slit - lamp examination of the anterior segment and goldmann applanation tonometry ( gat ) by a single investigator . for those with unilateral disease , the cls was placed on the eye with ntg . for those with bilateral disease , a random eye assignment by card shuffling was used to determine the eye for the cls placement . the subject then returned home with lubricating eyedrops and carried on his or her daily activities ( both indoor and outdoor ) , apart from showering or swimming ( as the device can not be in contact with water ) . subjects continued their same regimen of antiglaucoma eyedrops and slept in their habitual position at night . after 24 hours , the subject returned to the clinic to have the cls removed followed by a slit - lamp examination and gat . cls profile parameters were extracted following smoothing of the profile using locally weighted polynomial regression . cls variability from mean : this variable reflects variability around the mean value of all raw ( not smoothed ) cls measurements in the respective period ( 24-hour , diurnal , or nocturnal ) . diurnal / nocturnal variability : same as above but only during the awake and asleep periods , respectively , where the sleep cycle is determined from recorded sleep times in each individual s logbook and verified by the eye - blinking frequency ( present during waking ) and the presence of rhythmic ocular pulsation waves ( present during sleep ) . sleep - to - wake and wake - to - sleep slopes : calculated with a generalized linear model on raw measurements in units of mveq / hour from 1 hour before sleep or wake time to 1 hour after sleep or wake time , respectively . number of peaks : a peak is defined as a local maximum point in the smoothed curve . the calculation of the number of peaks occurs as follows : each trough is noted as the start of a peak . the pre- and post - cls gat iops were compared using the wilcoxon signed - rank test . whitney u - test : nocturnal versus diurnal mean variability from mean;wake - to - sleep versus sleep - to - wake slopes;number of nocturnal versus diurnal peaks ; and24-hour , diurnal , and nocturnal variability among prostaglandin users and nonusers . nocturnal versus diurnal mean variability from mean ; wake - to - sleep versus sleep - to - wake slopes ; number of nocturnal versus diurnal peaks ; and 24-hour , diurnal , and nocturnal variability among prostaglandin users and nonusers . fisher s exact test was used to compare the differences in the number of nocturnal peaks between those using a prostaglandin antiglaucoma medication versus those using other , non - prostaglandin antiglaucoma medications . cls variability from mean : this variable reflects variability around the mean value of all raw ( not smoothed ) cls measurements in the respective period ( 24-hour , diurnal , or nocturnal ) . diurnal / nocturnal variability : same as above but only during the awake and asleep periods , respectively , where the sleep cycle is determined from recorded sleep times in each individual s logbook and verified by the eye - blinking frequency ( present during waking ) and the presence of rhythmic ocular pulsation waves ( present during sleep ) . sleep - to - wake and wake - to - sleep slopes : calculated with a generalized linear model on raw measurements in units of mveq / hour from 1 hour before sleep or wake time to 1 hour after sleep or wake time , respectively . number of peaks : a peak is defined as a local maximum point in the smoothed curve . the calculation of the number of peaks occurs as follows : each trough is noted as the start of a peak . the pre- and post - cls gat iops were compared using the wilcoxon signed - rank test . whitney u - test : nocturnal versus diurnal mean variability from mean;wake - to - sleep versus sleep - to - wake slopes;number of nocturnal versus diurnal peaks ; and24-hour , diurnal , and nocturnal variability among prostaglandin users and nonusers . nocturnal versus diurnal mean variability from mean ; wake - to - sleep versus sleep - to - wake slopes ; number of nocturnal versus diurnal peaks ; and 24-hour , diurnal , and nocturnal variability among prostaglandin users and nonusers . fisher s exact test was used to compare the differences in the number of nocturnal peaks between those using a prostaglandin antiglaucoma medication versus those using other , non - prostaglandin antiglaucoma medications . in the 18 subjects enrolled in the study , there were seven males and eleven females . gat iops before and after the cls wear were 15.32.2 and 13.81.7 mmhg , respectively , while on the same antiglaucoma medications ( p=0.05 ) . the mean rnfl thickness was 72.99.8 m and the mean deviation and pattern standard deviation on humphrey visual field analysis were 6.34.5 decibels ( db ) and 6.14.1 db , respectively . in the 18 subjects , 38.9% ( 7/18 ) used a single prostaglandin eyedrop administered in the evening , 44.4% ( 8/18 ) used a twice - daily non - prostaglandin eyedrop , and 17.6% ( 3/17 ) used both a nocturnal prostaglandin eyedrop plus a twice - daily antiglaucoma eyedrop . the mean 24-hour variability from the mean cls signal was 75.921.5 ( range : 35.7120.9 ; 95% confidence interval [ ci ] : 62.886.7 ) mveq . the mean nocturnal variability from the mean was 52.120.3 ( range : 23.9105.1 ; 95% ci : 41.662.5 ) mveq , which was 48.9% less than the mean diurnal variability from the mean ( 77.620.6 ) ( range : 43.9118.4 ; 95% ci : 66.988.2 ) mveq ( p=0.002 ) . there were no statistically significant differences in the mean diurnal , nocturnal , or 24-hour variability between those with and without prostaglandin analog treatment ( all p>0.1 ) ( table 1 ) . the mean number of peaks during sleep and daytime was 6.42.3 and 9.32.4 , respectively . the number of peaks was 54.7% less during the nocturnal period than the diurnal period ( p=0.001 ) . there was no significant difference between the frequencies of nocturnal peaks among those using a prostaglandin antiglaucoma medication versus those using other , non - prostaglandin antiglaucoma medications ( table 2 ) . the mean sleep time of subjects was from 8.53 pm 12.6 minutes to 7.06 am 3.6 minutes . the study population had a mean positive linear slope on their cls profile from wake - to - sleep with a mean of 53.242.9 mveq / hour , signifying an increase in the ocular dimensional profile when going to sleep . similarly , the population had a mean negative linear slope from sleep - to - wake with a mean of 42.547.6 mveq / hour , signifying a decrease in the ocular dimensional profile upon waking . on comparing the two slopes , the rate of increase when going to sleep was significantly greater than the rate of decrease upon waking ( p<0.001 ) ( table 3 ) . the ocular dimensional profiles of all 18 ntg subjects were unique , with individual peaks occurring at different time intervals throughout the day and night ; no two tracings were identical . the mean ocular dimensional profile of the study population increased during sleep ( positive wake - to - sleep slope ) and decreased upon waking ( negative sleep - to - wake slope ) , with the mean rate of increase during sleep being significantly greater than the rate of decrease upon waking ( p<0.001 ) . we are inclined to agree with previous postulations , wherein the increase in nocturnal iop was thought to be related to the gravitational pull of fluids to the eye and an increase in episcleral venous pressure during the supine sleep posture.19 through the use of the 24-hour cls , we affirm that the phenomenon of increased iop with supine posturing was consistent among ntg subjects under medical treatment . other authors have also observed the persistence of posture - induced iop changes despite treatment of ntg patients with iop - lowering medication.20 similarly , a previous japanese study reported , in a population of ntg subjects , that the iop spikes recorded from the habitual positions ( sitting up during the day and supine at night ) were positively correlated to the spikes induced from a postural - change test and after a water - drinking test.21 in contrast , renard et al reported that , in 27 subjects with suspected ntg , 24-hour iop monitoring revealed that 54.5% exhibited a diurnal acrophase and 36.4% exhibited a nocturnal acrophase , while 9.1% had no nychthemeral rhythm in the absence of medical treatment.22 the existence of concomitant obstructive sleep apnea syndrome in 80% of assessed patients could have influenced the observed iop rhythm in their cohort.22 before the availability of continuous 24-hour ocular dimensional profile recording , it has been reported that , in many glaucoma patients , the iop peaks occurred outside of office hours23,24 and that two - thirds of iop peaks in untreated glaucoma patients occurred during the nocturnal period.25 in our ntg population , we noted that there were 55% less peaks occurring nocturnally than diurnally ( p=0.001 ) . the reduction in the number of peaks at night in our ntg population could be related to the use of prostaglandin antiglaucoma eyedrops , since 57% of our subjects were at least on prostaglandin antiglaucoma eyedrops nocturnally . however , it may also be simply due to the absence of physical activity , eye blinking , and saccadic movements at night , as these parameters are known to cause iop spikes and fluctuations.26 other authors have suggested that the nocturnal iop and iop spikes may be related to visual field progression in ntg subjects.21 study on the effect of medical treatment on iop fluctuations has shown that prostaglandin antiglaucoma eyedrops offer the best sustained 24-hour iop reduction , while brimonidine offers the least.27 in our study , the mean nocturnal variability was significantly lower than the mean diurnal variability by 49% ( p=0.002 ) . our findings are in agreement with a previous study by pajic et al28 reporting higher coefficients of variation in cls data during the daytime than at nighttime in ntg patients . pajic et al reported reduced variability in nocturnal cls data independent of whether or not patients were on antiglaucoma medication.28 we have not recorded cls profiles in our patients without medical treatment and therefore do not know whether the same is valid for this patient cohort ; however , it seems plausible that the lower level of activity during sleep provides a natural reduction in variability , which iop - lowering medical treatment may further influence . holl et al recorded cls profiles in primary open - angle glaucoma and ocular hypertension patients and found no difference in 24-hour , diurnal , or nocturnal standard deviation of cls values in the presence of prostaglandin analog treatment as compared to without treatment.29 the variability of diurnal versus nocturnal cls values was not evaluated . thus , in this patient cohort , it seems that , while the overall ocular dimensional profile was higher at night , the number of peaks and variability from the mean were significantly reduced at night for ntg subjects on medical treatment . it was interesting to note that the gat iop after cls wear ( 13.81.7 mmhg ) was lower ( p=0.05 ) than the iop before the cls wear ( 15.32.2 mmhg ) , although the readings were measured exactly 24 hours apart . this seemingly lower iop after the cls use was short of statistical significance and can be explained by day - to - day variations in iop . there was no sample size calculation , and the relatively small sample size of the study did not allow for evaluation of differences in iop - related pattern nor stratification by the type of treatment . furthermore , only one 24-hour measurement with the cls was performed , therefore we could not ascertain the reproducibility of the 24-hour iop profile . at present , the ocular dimensional profile is something that can not be translated into iop and therefore has no validation for use in clinical practice . additional clinical research needs to be done before we can state ( based on evidence ) that the cls can be useful in optimizing the timing of medical therapy for individual patients . nevertheless , this is one of the few publications in the literature analyzing the 24-hour ocular dimensional profile on a continuous basis in ntg subjects receiving medical treatment . continuous 24-hour ocular dimensional profiles recorded in ntg patients on medical treatment revealed that the profile increased during sleep and decreased upon waking . there was a 50% reduction in both the variability from the mean and number of peaks during sleep as compared to daytime .

purposeto analyze the 24-hour ocular dimensional profile in normal - tension glaucoma ( ntg ) patients on medical treatment.methodsconsecutive , medically treated ntg subjects were recruited from a university eye center . subjects were on a mean of 1.70.7 types of antiglaucoma medications and 56.6% were on a prostaglandin analog . a contact lens - based sensor device was worn in one eye of ntg patients to record the intraocular pressure ( iop)-related profile for 24 hours , recording the following : variability from mean over 24 hours , nocturnally and diurnally , as well as the number of peaks and troughs diurnally and nocturnally.resultsin 18 ntg subjects , the nocturnal variability around the mean contact lens - based sensor device signal was 48.9% less than the diurnal variability around the mean . the number of peaks was 54.7% less during the nocturnal period than during the diurnal period . the rate of increase in the ocular dimensional profile when going to sleep was significantly greater than the rate of decrease upon waking ( p<0.001).conclusionin medically treated ntg subjects , there was more variability in the iop - related pattern during the daytime and there were fewer peaks during sleep .

this mini - review describes the toxic effects of vanadium pentoxide inhalation principally in the workplace and associated complications with breathing and respiration . vanadium is a by - product of oil - burning furnaces when vanadium pentoxide ( mr 181.88 ) is deposited in the flues . inhalation is the principal route of entry into the body and may result acutely in severe pneumonitis with associated mucus membrane irritation and gastrointestinal disturbances . ambient vanadium pentoxide dust produces irritation of the eyes , nose and throat . over long periods , inhalation may potentiate chronic bronchitis , eczematous skin lesions , fine tremors of the extremities and greenish discoloration of the tongue . as it has a rapid renal clearance , it may be monitored in urine specimens to determine exposure to vanadium pentoxide ( american conference of governmental industrial hygienists , acgih and british education index , bei ) 50 g.g creatinine for an end - of - shift , end - of - workweek sample . most absorbed vanadium is excreted in the urine within one day after a long - term moderate exposure to vanadium dust . during its measurement vanadium oxide is sampled onto a pvc filter in a higgins and dewell cyclone for subsequent analysis using x - ray powder diffraction . the workplace exposure limit for vanadium pentoxide is according to the health and safety executive ( hse ) , 0.05 mg.m/8h . msds details airborne exposure limits of 0.5 mg.m ( ceiling ) for vanadium respirable dust and 0.1 mg.m ( ceiling ) for vanadium fumes . studies in laboratory rats have shown that one acute inhalation study available reported an lc67 of 1440 mg / m following a 1-h exposure of rats to vanadium pentoxide dust . oral studies in rats and mice demonstrate greater toxicity of vanadium as oxidation state increases . the lungs are a significant site of entry of vanadium in the case of community exposure . the distribution pattern of particles and the solubility of vanadium compounds , as well as alveolar and mucociliar clearance , are important factors that determine the rate of absorption in the respiratory tract . vanadium accumulates in the human lung with age , reaching approximately 6.5 g / g in the over-65 year 's age group . vanadium lung exposure studies in rats appear to reach a steady state in low exposure groups of 0.5 mg / m . the retention rate of vanadium in rats aged 18 months was 13 - 15% . absorbed vanadium is transported mainly in the plasma , bound to transferrin . the average value for the distribution of blood vanadium between plasma and cells in rats after an intravenous injection of 0.9 - 30 g vanadium per kg was found to be 9 : 1 . vanadium is widely distributed in body tissues ; principle organs of vanadium retention are kidneys , liver , testicles , spleen and bones . a major fraction of vanadium from cellular vanadium was found retained in nuclei . in pregnant rats bile is probably not an important pathway for excretion into the faces , but the existence of alternative routes for excretion into the gut ( salivary excretion or direct transfer across the intestinal wall ) has been suggested . when 4.5 - 9.0 mg vanadium as diammonium oxytetravanadate was fed daily to 16 elderly persons , urinary excretion , although quite variable , amounted to a mean of 5.2% of the amount ingested . a study of pre - incubation of renal brush border membrane vesicles with vanadium pentoxide demonstrated a time - dependent inhibition of citrate uptake thereof , contributing to the nephrotoxicity observed in vanadium exposure . fuel - oil ash is a significant source of exposure to boilermakers . during coal combustion , flue gases may contain dangerous levels of vanadium pentoxide . in kilns , especially with inadequate ventilation , exposure to vanadium can be critical . in industrial concerns , airborne monitoring is principally designed to detect vanadium rather than vanadium pentoxide . the us national institute of occupational safety and health and the us occupational safety and health administration have published methods that are suitable for measuring vanadium and vanadium compounds in workplace air . both are generic methods for metals and metalloids in which samples are collected by drawing air through a membrane filter mounted in a cassette - type filter holder , dissolved in acid on a hotplate and analyzed by inductively coupled plasma - atomic emission spectrometry . for both methods , the lower limit of the working range is approximately 0.005 mg / m for a 500 l air sample , although these methods are not widely available . urine testing , in preference for plasma testing , assumes that vanadium is excreted with a half - life of 15 - 40h . pre- and post - shift urine vanadium levels measured at the beginning and the end of a working week will , therefore , give a measure of daily absorption and accumulated dose from exposures over the preceding days . environmental monitoring of vanadium employs various methods for the analysis of air samples of vanadium in air , surface waters and biota . for example , flameless aas gives a detection limit of 1 ng / ml in air , corresponding to an absolute sensitivity of 0.1 ng vanadium . icp - aes has a working range of 5 - 2000 g / m for a 500-litre air sample . although there are some material safety data sheets available detailing the handling , hazards and toxicity of vanadium pentoxide , there are only two reviews listed in pubmed detailing its toxicity . the aim of this article therefore was to collate information on the consequences of occupational inhalation exposure of vanadium pentoxide on physiological function and wellbeing . an attempt to classify the like according to functionality of certain selected organ systems was decided . the criteria used in the current mini - review for selecting articles to be included were both theoretically and practically motivated and adopted from proposed criteria in the international classification of functioning , disability and health - icf . these criteria were as follows : articles were chosen only with internationally recognized impact factors greater than 0.10.articles were chosen based upon the impact of lifestyle , stress and/or environmental factor / s predisposing vanadium pentoxide exposure.criteria for selection of literature used included yes - no responses to : the appropriateness of methodology ; adequacy of subject numbers ; specificity of sex and/or age of subjects ; and statistically significant response rates to survey questionnaires . due consideration was given to a comparative effect between acute and chronic exposure to vanadium pentoxide . additionally , it was noted whether the studies occurred in laboratory animal or human subjects.the timeframe used was principally 1990 - 2007 inclusive , although articles of extreme importance from earlier decades were used where appropriate.a multi - factorial overview of the factors eschewed concerning vanadium pentoxide exposure was elucidated . it was presumed that collective articles detailing known factors of usage were not necessarily correlated with functionality and health.compilation of materials for the mini - review started with published literature or easily accessible academic research.the articles were accessible from on - line sources - pubmed and medline ( abstracts of journal articles ) ; cochrane ( reviews of clinical evidence ) ; clinical trials ( reports ) ; dissertation.com ( summaries of journal articles ) ; and occupational health and safety information services ( full - text guidance material ) . articles were chosen based upon the impact of lifestyle , stress and/or environmental factor / s predisposing vanadium pentoxide exposure . criteria for selection of literature used included yes - no responses to : the appropriateness of methodology ; adequacy of subject numbers ; specificity of sex and/or age of subjects ; and statistically significant response rates to survey questionnaires . due consideration was given to a comparative effect between acute and chronic exposure to vanadium pentoxide . additionally , it was noted whether the studies occurred in laboratory animal or human subjects . the timeframe used was principally 1990 - 2007 inclusive , although articles of extreme importance from earlier decades were used where appropriate . a multi - factorial overview of the factors eschewed concerning vanadium pentoxide exposure was elucidated . it was presumed that collective articles detailing known factors of usage were not necessarily correlated with functionality and health . compilation of materials for the mini - review started with published literature or easily accessible academic research . the articles were accessible from on - line sources - pubmed and medline ( abstracts of journal articles ) ; cochrane ( reviews of clinical evidence ) ; clinical trials ( reports ) ; dissertation.com ( summaries of journal articles ) ; and occupational health and safety information services ( full - text guidance material ) . articles were categorized according to their focus on acute or chronic exposure and toxicity , respectively [ table 1 ] . from the data elucidated in table 1 , the differences between total articles chosen in the acute exposure versus other categories , was 42.9% ( chronic exposure ) , 15.3% ( acute toxicity ) and 31.6% ( chronic toxicity ) . using similar determinations , included articles were 44.1 , 13.1 and 41.7% , respectively . the excluded articles were judged via chronic toxicity comparison with the other categories giving differences of 22.2% ( acute exposure ) , 50% ( chronic exposure ) and 44.4% ( acute toxicity ) . lungs : vanadium pentoxide is regarded as a less soluble form of vanadium and is therefore eliminated from the lungs at a slow rate . inhalation of vanadium pentoxide can injure the lungs and bronchial airways , possibly involving acute chemical pneumonotis , pulmonary edema and/or acute tracheobronchitis . clinical complications include a persistent cough , shortness of breath , bronchiolar constriction , tightness of the chest and a pseudo - asthmatic inflammation . in a study of 40 plant workers previously free of lung disease and exposed to vanadium pentoxide , 12 had bronchial hyper - reactivity and symptoms of asthma . vanadate acts directly on human bronchial smooth muscle promoting the release of ca from intracellular store via the production of inositol phosphate second messengers and inhibition of ca - atpase and causing spasms . first aid measures following inhalation include removing the patient into fresh air and applying artificial respiration if breathing has expired . oxygen is needed if breathing is labored and it is essential to seek medical attention . vanadium pentoxide dust may be a potential mutagen via induced chromosomal aberrations in man and hamsters . alveolar / bronchiolar neoplasms developed in male rats exposed to 0.5 and 2 mg.m vanadium pentoxide , with only a marginal increase thereof in female rats exposed to 0.5 mg.m . there were associated increase in inflammation , fibrosis and alveolar and bronchiolar hyperplasia / metaplasia and squamous metaplasia in both male and female rats . in an investigation of cynomolgus monkeys exposed to vanadium pentoxide dust for six hours per day , five days per week for 26 weeks , it demonstrated that airway obstruction accompanied a significant influx of inflammatory cells into alveolar tissue . in an earlier study , it was suggested that vanadium - induced pulmonary inflammatory changes involving polymorphonuclear leukocytes may play an important role in air - flow limitation . exposure to vanadium may cause a metal fume fever - like syndrome associated with neutrophilic alveolitis associated with marked neutrophilia . respiratory tract inflammation following inhalation of vanadium particles is characterized by abundant neurophilia initiated by alveolar macrophages and release of proinflammatory cytokines . short - term , repeated inhalation of occupationally relevant levels of vanadium by rats results in pulmonary immunocompetence via cytokine production and pulmonary macrophage induction . wang et al . , describes the mechanism of multiple reactive oxygen species induced by vanadium involves activation of an nadph oxidase complex and the mitochondrial electron transport chain , with hydrogen peroxide playing a major role in lung inflammation and apoptosis . there may be a pathological pattern within the lung which may be associated with the pattern and/or extent of vanadium deposition . indeed , in lung tissue excised from post - mortem investigations , the mean vanadium concentrations of 1.36 0.08 ( sd ) ( 1990s ) were higher than 1.04 0.05 in the 1960s . the free - radical redox cycling of vanadium in the rat lung involving vanadium ( v ) undergoing one - electron redox cycling in the rat lung biomembranes and re - oxidation of vanadium ( iv ) initiating lipid peroxidation , possibly contribute to pulmonary toxicity . circulatory system : chronically , exposure to airborne metals including vanadium may result in alterations in cardiac autonomic function . acute studies of vanadium pentoxide inhalation on the heart in experimental animals revealed that there was myocardial vascular congestion was observed , with focal perivascular haemorrhages . studies in humans has revealed palpitation of the heart , high incidence of extrasystoles , changes in the blood picture ( anemia , leukopenia , punctatebasophilia of the erythrocytes ) and reduced levels of cholesterol in the blood . limited studies have suggested a positive correlation between vanadium inhalation in urban air and mortality from cardiac failure , despite an absence of lifestyle determination . liver : acutely , vanadium is a potent inhibitor of many enzymes , while it stimulates adenylate cyclase . vanadium can also directly influence glucose metabolism in vitro and may play a role in its regulation . lipid peroxidation of rat liver microsomes and mitochondria was induced by sulphite and accelerated by the presence of vanadium compounds . severe acute exposure ( tens of mg / m ) is responsible for systemic effects . most frequent findings in animal experiments were in the liver , kidneys , gonads and the nervous , hematological and cardiovascular systems . chronically , histopathological changes observed in the liver following the higher level of inhalation exposure ( 27 g / m for 70 days ) included central vein congestion with scattered small hemorrhages and granular degeneration of hepatocytes . vanadium concentrations of 10 g / g dry weight ( dw ) in the liver is associated with mortality in ducks acutely exposed to sodium metavanadate . chronic exposure to increasing dietary concentrations of sodium metavanadate ( 38.5 - 2651 ppm ) over 67 days resulted in vanadium accumulation in the liver of 25.2 g / g dwt . vanadium pentoxide exposure stimulates the secretion of cytokines and chemokines by hepatocytes and associated hepatotoxicity . significant amounts of vanadate accumulate in the intermembrane space of the liver mitochondria and the detoxification mechanism of reduction of vanadate is inadequate enough to prevent damaging actions on hepatic mitochondria . in an old study , vanadium pentoxide retarded the development of vascular pathomorphology , supported cholesterol metabolism and activated oxidoreductive processes . cns : severe acute exposure to vanadium pentoxide has major patho - physioloogical manifestations on the nervous system . inhalation thereof produces a time - dependent loss of dendritic spines , necrotic - like cell death and considerable alterations of the hippocampus ca1 neurophile , all associated with spatial memory impairment . additionally , there is a decrease in the number of tyrosine hydroxylase immunreactive neurones in the substatia nigra pars compacta . within the ependymal epithelium , cilia loss , cell sloughing and cell layer detachment the damage results in disrupted permeability of the epithelium and promotes access of inflammatory mediators to the underlying neuronal tissue causing injury and neuronal death . in humans , severe chronic exposure results in general symptomatology including nervous disturbances , neurasthenic or vegetative symptoms . kidneys : severe acute exposure ( tens of mg / m ) is responsible for aberrations in renal function . vanadium concentrations of 25 g / g dwt . in the kidneys are associated with mortality in ducks acutely exposed to sodium metavanadate . chronic exposure to increasing dietary concentrations of sodium metavanadate ( 38.5 - 2651 ppm ) over 67 days resulted in vanadium accumulation in the kidneys of 13.6 g / g dw . when renal brush border membrane vesicles are exposed to vanadium pentoxide , there is a time - dependent inhibition of citrate uptake in the membrane possibly contributing to nephrotoxicity . in studies on dog and human kidney enzymes , the authors suggested that vanadium inhibits the atpase at the site activated by na and atp protects the enzyme by either binding vanadium or by competing for a mutual receptor on the enzyme . chronically in experimental animals , histopathological changes observed in the kidneys following the higher level of inhalation exposure ( 27 g / m for 70 days ) included marked granular degeneration of the epithelium of the convoluted tubules . chronically , absorbed vanadium in either pentavalent or tetravalent states is distributed mainly to the bone ( around 10 - 25% of the administered dose three days after administration ) and to a lesser extent to the kidney ( about 4% ) . distribution studies in which rats received a total of approximately 224 and 415 mg vanadium pentoxide / kg in drinking - water over a period of 1 and 2 months indicated that the vanadium content ( assessed in 13 specific tissues ) was greatest in the kidneys , spleen , tibia and testes . testicles : chronic ingestion of vanadium may have significant consequences for infertility by damaging spermatogenesis . studies in mice have demonstrated that inhalation of vanadium pentoxide results in necrosis of spermatogonium , spermatocytes and sertoli cells . vanadium accumulates in the testes and attenuates the percentage of gamma - tubulin in all analysed testicular cells , suggesting changes in microtubules used in cell division . this mini - review has contributed to a brief synthesis of the literature which is currently rather scattered in nature into a compact format . vanadium pentoxide has adverse effects on health and well - being and measures need to be taken to prevent hazardous exposure of the like . medical monitoring of workers exposed to the dust or fumes ; workplace monitoring and measurement of ambient concentrations ; dealing with contaminated attire and establishing personal hygienic procedures ; dealing with emergency spills of dust ; enforcing protocols for emergencies and hazardous waste management ; and the use of inspected respiratory and personal protective equipment , are all essential in reducing toxic exposure . vanadium pentoxide exposure ( acutely and chronically ) in both experimental animal and human studies indicates a systemic patho - physiological and pathological influence on cell metabolism and tissue function . therefore procedures need to be implemented in environments which potentially expose workers to vanadium pentoxide including influences on respiratory function and appropriate quality guidelines enforced . the lungs are likely to accumulate more vanadium particles than elsewhere particularly from polluted air . the lowest observed - adverse - effect level for acute exposure can be considered to be 60 g vanadium per m. indeed , chronic exposure emanates as slight changes in the upper respiratory tract , with irritation , coughing and injection of pharynx , to more serious effects such as chronic bronchitis and pneumonitis . persons suffering from lung problems including asthma and cystic fibrosis would need to ensure that they take adequate measures to prevent vanadium irritation of the mucosae . obviously , however , a systemic assessment via renal and liver function tests needs to be completed in order to make an accurate clinical assessment of the influence of vanadium on body function and ultimately the efficient maintenance of homeostasis . more research is required to establish and add to the limited existing knowledge on the toxicokinetic and toxicological database on vanadium pentoxide . indeed , there is limited understanding of the potential for dermal absorption and the potential long term effects as a result of sequestration in body tissues such as bone .

context : this mini - review describes the toxic effects of vanadium pentoxide inhalation principally in the workplace and associated complications with breathing and respiration . although there are some material safety data sheets available detailing the handling , hazards and toxicity of vanadium pentoxide , there are only two reviews listed in pubmed detailing its toxicity.aim:to collate information on the consequences of occupational inhalation exposure of vanadium pentoxide on physiological function and wellbeing.materials and methods : the criteria used in the current mini - review for selecting articles were adopted from proposed criteria in the international classification of functioning , disability and health . articles were classified from an acute and chronic exposure and toxicity thrust.results:the lungs are the principal route through which vanadium pentoxide enters the body . it can injure the lungs and bronchial airways possibly involving acute chemical pneumonotis , pulmonary edema and/or acute tracheobronchitis . it may adversely influence cardiac autonomic function . it stimulates the secretion of cytokines and chemokines by hepatocytes and disrupts mitochondria function . it disrupts the permeability of the epithelium and promotes access of inflammatory mediators to the underlying neuronal tissue causing injury and neuronal death . when renal brush border membrane vesicles are exposed to vanadium pentoxide , there is a time - dependent inhibition of citrate uptake and na+ k+ atpase in the membrane possibly contributing to nephrotoxicity . exposure results in necrosis of spermatogonium , spermatocytes and sertoli cells contributing to male infertility.conclusion:vanadium pentoxide certainly has adverse effects on the health and the well - being and measures need to be taken to prevent hazardous exposure of the like .

the key point of hyperbaric treatment is the elevated po2 level both in the plasma and tissues . normal alveolar po2 level is reached at 1 ata ( ata = 760 mmhg , which is the normal atmosphere pressure at the sea level ) , while higher atmosphere pressures cause an increase of the level of oxygen dissolved in the plasma . scuba ( scuba , self - contained underwater breathing apparatus ) diving was shown to induce a significant increase of the total number of leukocytes , particularly neutrophils . whereas the exact mechanisms that lead to endothelial dysfunction are still incompletely understood , hyperoxia - induced production of reactive oxygen species ( ros ) , reduction in the bioavailability of nitric oxide ( no ) and direct mechanical damage to the endothelium during decompression , are considered to play an important role ( 1 ) . recently , it has been demonstrated that a single air scuba dive induced a significant increase in the number of monocytes expressing cd15 as well as the increase in the small monocyte subpopulation highly expressing cd15s ( 2 ) . sialylated fucosylated glycans ( sialyl lewis x - type glycans or cd15s ) are expressed on circulating granulocytes and monocytes and , upon recognition by endothelial selectins , mediate initial leukocyte endothelium interactions ( 3 ) . zen et al showed directly that human leukocyte cd11b is a major membrane protein decorated with cd15s and that cd15s related moieties mediate the binding of cd11b with e - selectin ( 4 ) . the expression of atherogenic adhesion molecule cd11b was found to be decreased after high frequency and long duration exercise ( 6 ) . it has also been shown that a competitive marathon race can decrease neutrophile functions ( oxidative burst activity and phagocytic activity ) in athletes ( 7 ) . they are flask - shaped membrane invaginations formed from lipid rafts by polymerization of caveolins , which are integral membrane proteins that tightly bind cholesterol and sphingolipids . caveolae have been found to be partaking in many physiological and pathological processes involving endothelial cells , such as atherosclerosis , hemostasis , and thrombosis . caveolae of endothelial plasma membranes are rich in neutral glycosphingolipid , globotriaosylceramide , gb3cer or cd77 . excessive endothelial cd77 accumulation is associated with endothelial dysfunction ( 8) . hyperbaric oxygen treatment , a method based on 100% oxygen exposure , has a beneficial effect on renal dysfunction in sepsis caused by escherichia coli ( 9 ) . cd77 is a receptor for stxs ( stxs , shiga toxins ) produced by shigella dysenteriae type 1 and enterohemorrhagic e. coli that are most common cause of hus ( hus , hemolytic - uremic syndrome ) . uschida et al showed that specific antibodies for stxs positively stained pulmonary tissue from a patient who died of hus associated with stx - producing e. coli infection , indicating the deposition of stxs in the lung . related experiments with normal pulmonary tissue revealed apparent stx binding to both vascular endothelium and to portions of the pulmonary epithelium . in addition , cd77-positive lung carcinoma cell lines , which are derived from lung epithelium , showed reactivity to stx and a high susceptibility to stxs , as determined by mtt assay ( 10 ) . glomerular endothelial cells in humans are the primary target of the toxic effects of stxs , but why lesions in stx - associated hus preferentially localize to the renal microvasculature is still unclear ( 11 ) . whether stem cells are the source of the epithelial progenitors replacing injured and dying tubule , epithelium is currently an area of intensive investigation . the fundamental unanswered questions in this field include whether renal stem cells exist in adults , if they do , where are they located ( interstitium , tubule , cortex , medulla ) and what markers can be relied upon for the isolation and purification of these putative renal stem cell ( 12 ) . resident stem / progenitor cells of different human adult organs are known to express stem cell markers such as cd34 , cd117 and cd133 . as we know , cd34 is a sialomucin - type glycophosphoprotein , traditionally a marker of hematopoietic stem cells and was found on endothelial cells and fibroblasts as well ( 13 ) . despite its utility as a stem - cell marker , the function of cd34 has remained remarkably elusive . it is believed that cd34 promotes cell proliferation and / or blocks differentiation of progenitor cells , while other members of cd34 family stimulate the migration of hematopoietic cells , or play a role in cell morphogenesis . it is interesting to point out that members of the cd34 family can stimulate and block cell adhesion ( 14 ) . exercise and the improvement of cardiovascular health tend to promote higher levels of circulating cd34 + cells ( 15 ) . advanced age and chronic cardiovascular disease tend to decrease both the functionality and the total count of cd34 + cells ( 16 , 17 ) . in many current researches , the bone marrow - derived cd34 + cells have been evaluated as a tool to repair the endothelial damage caused by cardiovascular disease . new evidence supports both a role of transdifferentia - tion of cd34 + cells to cardiomyocytes ( 18 ) and their ability to fuse with existing cardiomyocytes ( 19 ) . in recent review , mackie and losordo showed the preclinical evidence supporting the therapeutic potential of cd34 + cells in ischemic models , and the evidence for the clinical usefulness of cd34 + cells in the treatment of human ischemic disease ( 20 ) . muller et al demonstrated that cd34 is hetero - geneously expressed by human pulmonary endothelial cells , and that expression is under influence of different physiological / pathophysiological factors , such as age or pulmonary hypertension ( 21 ) . due to the described beneficial effects of hyperbaric treatment on the one hand , and its potential proinflammatory effect on the other hand , the aim of this study was to estimate effects of hyperbaric treatment by determination of cd15s and cd11b leukocyte proinflammatory markers as well as cd77 and cd34 expression on rat renal , pulmonary and cardiac cells . experiments were performed with male sprague - dawley rats raised under controlled conditions ( temperature of 22 1c and a light schedule of 14-hr light/10-h dark ) at the split university animal facility . animals were bred and maintained according to the guide for care and use of laboratory animals and the protocol was approved by the ethics committee of the split university medical school . four weeks old rats were separated in 2 groups : the examination group ( n=9 ) which underwent the hyperbaric treatment and untreated control group ( n=5 ) . rats were exposed to hyperbaric pressure of air mixture ( 21% oxygen , 79% nitrogen ) which equals the immersion depth of 65 meters ( 7.5 ata ) , in duration of 30 min . decompression stops were 1 min at the depth of 15 m , 7 min at 12 m , 10 min at 9 m , 23 min at 6 m and 47 min at 3 m , according to us navy decompression tables ( http://www.usu.edu/scuba /navy_manual6.pdf ) . the animals were exposed to hyperbaric treatment in a comex hyperbaric chamber ( comex , marseilles , france ) . the oxygen and carbon dioxide concentrations in the chamber were controlled by servomex 570a oxygen analyzer ( servomex , houston , tx , usa ) and by infrared carbon dioxide gas analyzer ( infrared industries inc . , santa barbara , ca , usa ) . in this study , the method for the preparation of samples for flow cytometry , as well as all antibodies used , were in accordance with our previous study ( 8) . blood samples for flow cytometry were collected from jugular vein into glass vacuum tubes with edta anticoagulant , one hr after hyperbaric treatments and before sacrifice . one hundred l of whole blood was pre - treated with fcr ( fc - receptor)-blocking reagent ( miltenyi biotec gmbh , bergisch gladbach , germany ) to prevent non - specific binding and it was incubated in the dark for 30 min on ice with 0.5 g of primary anti - cd15s antibody produced in mouse ( pharmingen , san diego , ca , usa ) . after two washes in 0.1 m pbs with 0.1% sodium azide , 0.5 g of secondary fitc - conjugated , affinity chromatography - purified rabbit anti - mouse antibody ( pharmingen , san diego , ca , usa ) and 1 g of phycoerythrin ( pe)-conjugated antibody reactive to cd11b ( iq test , beckman coulter , marseille , france ) were added to cells and incubated in the dark on ice for 30 min . after red blood cell lysis with red blood cell lysis solution ( miltenyi biotec , bergisch gladbach , germany ) , 10 events were recorded on a coulter epics xl flow cytometer ( beckman coulter corporation , miami , usa ) . fluorochrome and isotype - matched controls as well as unstained cell samples were used as negative controls . after third hyperbaric treatment , rats were euthanized with prolonged exposure to diethylether and kidneys , lungs and heart were dissected from all animals . tissues were minced with scissors and incubated in a solution of 0.1 m pbs ( phosphate buffer solution ) with 0.1 % ( for kidney ) and 0.2 % ( for heart and lung ) collagenase type ia ( roche diagnostics gmbh , mannheim , germany ) in ratio : 100 mg tissue/5 ml collagenase in pbs . cell suspensions were incubated for 30 min/1 hr ( kidney / heart , lung ) at 37c , with gentle stirring . after incubation , cell suspensions were filtrated through a 40-m nylon mesh ( cell strainer ; bd biosciences , san jose , ca , usa ) and suspended at 1.0 10 cells ml in 100 l 0.1 m pbs . monoclonal anti - cd34 antibody conjugated with phycoerythrin cyanin 5 ( pc5 , beckman coulter , marseille , france ) was used for detection of cd34 positive cells . monoclonal anti - cd77 antibody conjugated with fitc ( bd pharmingen , erembodegem , belgium ) was used for detection of cd77 positive cells . isolated tissue cells were incubated in dark at 4c for 30 min with two antibodies for double cell labeling : 1 g of anti - cd34-pc5 and 1 g of anti - cd77-fitc . after two washes in 0.1 m pbs 10 events were recorded on a coulter epics xl flow cytometer ( beckman coulter corporation , miami , usa ) . fluorochrome - minus - one controls as well as unstained cell samples were measured and processed as negative controls to set the appropriate regions . total cd15s+ leukocytes were defined as a sum of % of cd11b - cd15s+ and % of cd11b+cd15s+ leukocytes and total cd11b+ leukocytes as a sum of % of cd11b+cd15s+ and % of cd11b+cd15s- cells . total cd34 + cells were defined as a sum of % of cd34+cd77- and % of cd34+cd77 + and total cd77 + cells as a sum of % of cd34-cd77 + and % of cd34+cd77 + cells . due to relatively small sample , nonparametric mann whitney u test was used to test significance of differences between control and experimental group . coefficient of correlation was calculated between variables : cd11b+ and cd15s+ leukocytes with cd34 + and cd77 + tissue cells . all of the results were considered significant at 95 % confidence level ( p < 0.05 ) and were obtained by using software statistica 12.0 ( statsoft , tulsa usa ) . blood samples for flow cytometry were collected from jugular vein into glass vacuum tubes with edta anticoagulant , one hr after hyperbaric treatments and before sacrifice . one hundred l of whole blood was pre - treated with fcr ( fc - receptor)-blocking reagent ( miltenyi biotec gmbh , bergisch gladbach , germany ) to prevent non - specific binding and it was incubated in the dark for 30 min on ice with 0.5 g of primary anti - cd15s antibody produced in mouse ( pharmingen , san diego , ca , usa ) . after two washes in 0.1 m pbs with 0.1% sodium azide , 0.5 g of secondary fitc - conjugated , affinity chromatography - purified rabbit anti - mouse antibody ( pharmingen , san diego , ca , usa ) and 1 g of phycoerythrin ( pe)-conjugated antibody reactive to cd11b ( iq test , beckman coulter , marseille , france ) were added to cells and incubated in the dark on ice for 30 min . after red blood cell lysis with red blood cell lysis solution ( miltenyi biotec , bergisch gladbach , germany ) , 10 events were recorded on a coulter epics xl flow cytometer ( beckman coulter corporation , miami , usa ) . fluorochrome and isotype - matched controls as well as unstained cell samples were used as negative controls . after third hyperbaric treatment , rats were euthanized with prolonged exposure to diethylether and kidneys , lungs and heart were dissected from all animals . tissues were minced with scissors and incubated in a solution of 0.1 m pbs ( phosphate buffer solution ) with 0.1 % ( for kidney ) and 0.2 % ( for heart and lung ) collagenase type ia ( roche diagnostics gmbh , mannheim , germany ) in ratio : 100 mg tissue/5 ml collagenase in pbs . cell suspensions were incubated for 30 min/1 hr ( kidney / heart , lung ) at 37c , with gentle stirring . after incubation , cell suspensions were filtrated through a 40-m nylon mesh ( cell strainer ; bd biosciences , san jose , ca , usa ) and suspended at 1.0 10 cells ml in 100 l 0.1 m pbs . monoclonal anti - cd34 antibody conjugated with phycoerythrin cyanin 5 ( pc5 , beckman coulter , marseille , france ) was used for detection of cd34 positive cells . monoclonal anti - cd77 antibody conjugated with fitc ( bd pharmingen , erembodegem , belgium ) was used for detection of cd77 positive cells . isolated tissue cells were incubated in dark at 4c for 30 min with two antibodies for double cell labeling : 1 g of anti - cd34-pc5 and 1 g of anti - cd77-fitc . after two washes in 0.1 m pbs , cells were resuspended in 0.3 ml of 0.1 m pbs . 10 events were recorded on a coulter epics xl flow cytometer ( beckman coulter corporation , miami , usa ) . fluorochrome - minus - one controls as well as unstained cell samples were measured and processed as negative controls to set the appropriate regions . total cd15s+ leukocytes were defined as a sum of % of cd11b - cd15s+ and % of cd11b+cd15s+ leukocytes and total cd11b+ leukocytes as a sum of % of cd11b+cd15s+ and % of cd11b+cd15s- cells . total cd34 + cells were defined as a sum of % of cd34+cd77- and % of cd34+cd77 + and total cd77 + cells as a sum of % of cd34-cd77 + and % of cd34+cd77 + cells . due to relatively small sample , nonparametric mann whitney u test was used to test significance of differences between control and experimental group . coefficient of correlation was calculated between variables : cd11b+ and cd15s+ leukocytes with cd34 + and cd77 + tissue cells . all of the results were considered significant at 95 % confidence level ( p < 0.05 ) and were obtained by using software statistica 12.0 ( statsoft , tulsa usa ) . in this study an effect of 3 repeated hyperbaric treatments on percentage of cd11b+ and cd15s+ leukocytes was investigated . the percentages of cd15s+cd11b- leukocytes were significantly increased ( from 1.71 1.11 to 23.42 2.85 , p<0.05 ) and total cd15s+ leukocytes were significantly increased ( from 4.51 2.42 to 25.68 3.22 , p<0.05 ) in group that went hyperbaric treatment after the first day . hyperbaric treatment did not change percentage of total cd11b+ leukocytes ( from 7.32 3.98 to 5.25 0.75 ) ( figure 1 ) . the percentages of different cd11b+ and cd15 + leukocyte subpopulations in control rats ( n=5 ) and rats that went hyperbaric treatment ( n=9 ) . significance is obtained by using mann whitney u test , * p<0.05 ( vs. control group ) the percentage of cd15s+cd11b- leukocytes decreased from second to third day , although not statistically significant . after strong increase of percentage of total cd15s+ leukocytes , following first and second hyperbaric treatment , this percentage slightly decreased following third treatment . furthermore , the goal of this study was to determine expression of cd77 and cd34 on renal , cardiac and pulmonary rat cells after repeated hyperbaric treatment in comparison to non - treated animals . hyperbaric treatment significantly decreased sum percentage of cd77+cd34- and cd77+cd34 + renal cells ( from 16.355.5 to 4.48 1.28 , p < 0.05 ) . the percentages of total cd34 + rat renal cells in the group exposed to hyperbaric treatment was also significantly lower compared to the control group , from 23.24 8.38 to 10.76 6.32 , p < 0.05 ( figure 2 ) . the percentages of cd77 positive and cd77 negative endothelial ( cd34 + ) cells , of cd77 positive non - endothelial cells ( cd34- ) , of total cd77 positive and of total cd34 positive cells in suspensions of total kidney cells of control rats ( n=5 ) and rats that went hyperbaric treatment ( n=9 ) . significance is obtained by using mann whitney u test , * p<0.05 ( vs. control group ) it is well known that lung epithelium is another target for stxs , and stx - mediated injury to lung epithelial cells is thought to play an important role in the pathogenesis of pulmonary involvement associated with e. coli infection ( 10 ) . based on our results , hyperbaric treatment would not have beneficial effect on lung in conditions associated with e. coli infection as percentage of total cd77 + lung cells increased in rats that went hyperbaric treatment , from 3.412.11 to 23.53 13.09 , p < 0.05 ( figure 3 ) . total cd34 + rat lung cells in the group exposed to hyperbaric treatment was significantly higher compared to the control group ( from 3.272.01 to 11.92 6.22 , p < 0.05 ) . the percentages of cd77 positive and cd77 negative endothelial ( cd34 + ) cells , of cd77 positive non - endothelial cells ( cd34- ) , of total cd77 positive and of total cd34 positive cells in suspensions of total pulmonary cells of control rats ( n=5 ) and rats that went hyperbaric treatment ( n=9 ) . significance is obtained by using mann whitney u test , * p<0.05 ( vs. control group ) the percentage of total cd34 + cells was significantly increased in cardiac tissue in group of rats that went hyperbaric treatment , from 4.983.17 to 33.79 14.69 , p < 0.05 . we found out that percentage of cd77 + cardiac tissue cells were significantly increased due to hyperbaric treatment , from 1.812.15 to 8.19 4.29 , p < 0.05 ( figure 4 ) . the percentages of cd77 positive and cd77 negative endothelial ( cd34 + ) cells , of cd77 positive non - endothelial cells ( cd34- ) , of total cd77 positive and of total cd34 positive cells in suspensions of total cardiac cells of control rats and rats that went hyperbaric treatment . significance is obtained by using mann whitney u test , * p<0.05 ( vs. control group ) the results of correlation analysis between leukocytes markers cd11b and cd15s with tissue antigens cd34 and cd77 in rats that went hyperbaric treatment are presented in table 1 . there is no statistically significant correlation between leukocytes markers and tissue antigens in rats that went hyperbaric treatment . the correlations between the proportion of different leukocytes and cellular subpopulations from the heart , lung and kidney of rats that went hyperbaric treatment correlation analysis results : r = coefficient of correlation , p= significance of correlation coefficient the expression of atherogenic adhesion molecule cd11b was found to be decreased after high frequency and long duration exercise ( 23 ) . granulocyte - endothelial cell adhesion tests indicate that cd11b , the major membrane protein decorated with cd15s ( 4 ) is decreased after hyperbaric oxygen treatment . however , our results show unchanged cd11b leukocyte expression in rat following hyperbaric treatment . the opposite results obtained in our study could be explained by the different conditions in hyperbaric air treatment versus hyperbaric oxygen treatment . several fold higher percentage of total cd15s+ than total cd11b+ leukocytes was detected in group that went hyperbaric treatment . that could be the consequence of higher affinity of anti - cd15s antibody to sialyl lewis x - type glycoepitope of cd11b glycoprotein than the affinity of anti - cd11b antibody to peptide epitope mac-1 of cd11b glycoprotein . result of significantly increased percentage of cd15s+ leukocytes after repeated hyperbaric treatment is in accordance with previously reported results and elucidated role of this protein in the acute inflammatory process ( 24 ) . edremitliolu et al showed previously that renal dysfunction in sepsis improved by the use of hyperbaric oxygen was accompanied by an increase of antioxidative defense mechanisms : the superoxide dismutase and catalase activities in the renal cortex , and an increase in the catalase activity in the renal medulla ( 9 ) . daily secretion of urine increases for 500 ml during diving with air mixture ( up to 3 - 49 ata ) , although the intake of fluids and velocity of glomerular filtration remains unchanged ( 25 ) . furthermore , it has been demonstrated that gb3 is over - expressed in proliferative endothelial cells of growing tumor relative to quiescent cells and it could be a viable alternative target for tumor immunotherapy and angiogenesis inhibition ( 26 ) . our study showed that percentage of cd77+cd34 + rat renal cells in the group exposed to hyperbaric treatment was significantly lower than in the control group , as well as the percentage of total cd77 + cells . considering the fact that cd77 molecules are located next to na / k - atpase in caveoli of kidney epithelial cells ( 27 ) , our results show the possible role of cd77 in mechanisms responsible for development of hyperbaric diuresis . in adult kidneys , antibodies against cd34 label almost all endothelial cells ( 28 ) . podocyte luminal membrane domain contains other sialomucins of the cd34 family : podocalyxin and endoglin whose function is still poorly understood . acevedo et al reported an increased expression of cd34 on renal glomerular cells of older diabetic animals which reflect involvement of cd34 in the pathogenesis of glomerular alterations related to age and diabetes ( 29 ) . in addition , putative progenitor cell mobilization is higher with 2.5 versus 2.0 ata of oxygen treatments , and all newly mobilized cells exhibit higher concentrations of an array of regulatory proteins ( 30 ) . endothelial progenitor cells and circulating angiogenic cells contribute to endothelial repair , either by integrating in injured endothelium or by secreting angiogenic growth factors ( 31 ) . the present study , in contrary , showed a clear decrease in percentage of cd34 + renal cells after repetitive hyperbaric treatment . hyperoxia - induced production of ros , reduction in the bioavailability of nitric oxide ( no ) and direct mechanical damage to the endothelium during decompression are considered to play an important role to endothelial dysfunction ( 1 ) . it is speculative that ros induced apoptosis of renal cd34 + is plausible mechanism for the observed decrease . in addition , it has been reported in rats that a decompression trauma acutely increased levels of interleukin-6 ( 32 ) and therefore we can speculate that the release of pro - inflammatory cytokines in response to hyperbaric treatment may account for apoptosis in endothelial renal cells . the percentage of total cd34 + cells in lung tissue was also increased and we can assume that hyperbaric conditions induce pulmonary endothelial angiogenesis . few recent studies showed how blood - derived cd34 + endothelial progenitor cells contribute to pulmonary angiogenesis . it has been concluded that circulating cd34 + endothelial progenitor cells , characterized by active cell division and an amplified transcriptional signature , transit into resident endothelial cells during compensatory lung growth . the authors discuss how therapeutic manipulation of these cells may be beneficial in a variety of lung diseases ( 33 ) . in this study , we used immersion depth of 65 meters , and assume that changing the hyperbaric conditions and changing depths would change results of measured antigens . exposure to special environment conditions may induce systemic physiological changes that impact on thermal homeostasis . we analysed expression of cd34 and cd77 on all cardiac cells , which includes cardiomyocytes as well . different cell - types have been used recently , including bone marrow - derived mononuclear cells and mobilized cd34 + cells , in studies that suggested a potential of cell - based therapies to reduce cardiac scar size and to improve cardiac function in patients with ischemic cardiomyopathy . recently , in experimental studies direct in vivo reprogramming of cardiac fibroblasts towards cardiomyocytes that are cd34 + has been reported , which may represent novel therapeutic approach for cardiac regeneration ( 35 ) . both myocardial ischemia and peripheral ischemia are known to stimulate endogenous cd34 + cell mobilization and upon mobilization , these cells tend to target zones of ischemia where they are thought to promote angiogenesis either through their direct incorporation into newly developing blood vessels or through their secretion of angiogenic growth factors that stimulate local peri - endothelial vascular development ( 36 , 37 ) . use of cd34 + cells for the treatment of ischemic cardiovascular disease is relatively novel . few research groups have shown that a single maximal exercise bout elicits an increase in the numbers of circulating endothelial progenitor cells in both healthy subjects and in cardiovascular patients ( 38 , 39 ) . the high vascular oxidative load of a maximal exercise bout causes a temporary decrease in endothelium - dependent vasodilatation , which is followed by a substantial improvement 12 - 24 hrs later . such an acute period of vascular stress appears to stimulate repair mechanisms , including the mobilization of endothelial progenitor cells , which could be considered as an adequate physiological response . this study is the first reporting the hyperbaric environment effect on cd34 + cardiac cells in rats . we found out a significantly increase in percentage of cd34 + cardiac cells in rats after hyperbaric treatment comparing to non - treated rats which is in accordance to previously reported repair mechanism of injured endothelium caused by hyperoxia . these findings are very interesting and open a broad range of explanations . in this study that would be cd77-cd34 + cells in kidney tissue , cd77-cd34 + cells in pulmonary tissue and cd77+cd34- cells in cardiac tissue . these cells are very interesting because they represent the cells with high ability to adjust extreme conditions and remain unchanged in hyperbaric conditions that we have used in this study . cd77 is abundant in endothelial lipid rafts ( 40 , 41 ) that are associated with transendothelial transport of nutrients and ions ( 42 ) . it has been found that excessive endothelial cd77 gycosphin- golipid accumulation leads to k ( ca ) channel dysfunction ( 43 ) . in study of rei - muini et al renal cd34+cd77- cells showed the most sensitivity to elevated calcium ( 8) . that results are significant in the view of recent finding of vascular endothelial - cadherin cleavage caused by ca influx that contribute to the dissolution of adherent junctions during endothelial cell activation and apoptosis ( 44 ) . we speculate that cd77-cd34 + cells in kidney tissue and cd77-cd34 + cells in pulmonary tissue , due to their poorer lipid raft content , succumb at higher extent to the dissolution of adherent junctions during endothelial cell activation and apoptosis provoked by ca influx . results of this study recruit cd15s analyses for the majority investigations of leukocyte proinflammatory features and present cd15s+ leukocytes as intelligent cells critical for the regulation of the inflammatory process with ability to adjust to extreme conditions . based on our findings , we also speculate that positive effects of hyperbaric oxygenation on renal dysfunction in sepsis caused by e. coli are mediated by the decreased percentage of cd77 + cells . our result of increased percentage of cd34 + pulmonary cells after hyperbaric treatment support the hypothesis that endothelial progenitor cells play a very important role in lung growth in physiological and many pathophysiological conditions . for now , we can only speculate of beneficial effects of hyperbaric treatment in promoting heart angiogenesis as well as use of hyperbaric conditions as possible therapeutic method for ischemic cardiovascular diseases treatment .

objective(s):the aim of this study was to estimate effects of hyperbaric ( hb ) treatment by determination of cd15s and cd11b leukocyte proinflammatory markers expression . in addition , this study describes changes in cd77 and cd34 expression on rat endothelial cells in renal , pulmonary and cardiac tissue following exposure to hyperbaric pressure.materials and methods : expression of cd11b and cd15s on leukocytes , as well as cd77 and cd34 expression on endothelial cells in cell suspensions of renal , pulmonary and cardiac tissue in rats after hyperbaric treatment and in control rats were determined by flow cytometry.results:hyperbaric treatment significantly increased percentage of leukocytes expressing cd15s+cd11b- ( from 1.711.11 to 23.422.85 , p<0.05 ) . hyperbaric treatment significantly decreased sum percentage of cd77+cd34- and cd77+cd34 + renal cells ( from 16.355.5 to 4.48 1.28 , p<0.05 ) . hyperbaric treatment significantly increased percentage of cd34 + pulmonary cells ( from 3.272.01 to 11.926.22 , p<0.05 ) . our study is the first reporting the hyperbaric environment influence on cd34 + heart cells in rats.conclusion:the current findings of increased percentage of leukocytes expressing endothelial selectin ligand cd15s after hyperbaric treatment , point its role in endothelial damage prevention . we found out a significantly increase in percentage of cd34 + cardiac cells as well as cd34 + pulmonary cells in rats after hb treatment which could be a part of repair mechanism of injured endothelium caused by hyperoxia .

autoimmune hepatitis ( aih ) is an immune - mediated chronic liver disease characterized by hepatocellular inflammation , necrosis , and fibrosis , which can progress to cirrhosis and fulminant hepatic failure if left untreated . aih has a female predominance occurring in all ages and races , and both the median and mean age of initial disease presentation are in the forties , similar to many other autoimmune diseases . diagnostic criteria are based on demonstration of characteristic autoantibodies , elevated immunoglobulins , and histological features of hepatitis in the absence of viral liver disease . standard treatment of aih includes corticosteroids alone or in combination with azathioprine ( aza ) that aims at the normalization of transaminase and immunoglobulin g ( igg ) levels in serum which correlate with histological disease activity . it is reported that although majority of the patients respond well to the standard therapies , about 20% of patients do not due to either intolerance or refractory disease . in treatment failure , alternative immunosuppressive and biological agents including mycophenolate mofetil ( mmf ) , tacrolimus , cyclosporine and anti tnf antibodies should be considered . the patient we report here is a 48-year old woman who was diagnosed with autoimmune hepatitis and was treated with standard therapy corticosteroids and aza . however , she could not tolerate the side effect of aza induced pancytopenia and skin rash . mmf in combination with corticosteroid was opted as second - line treatment and the patient was able to achieve remission with these treatments . a 48 year - old woman was admitted to department of hepatology due to fatigue and jaundice which lasted for approximately 10 days . she had history of heavy drinking ( 60 g of alcohol every day ) and herbal tea intake ( solomons seal tea twice a week ) for recent 6 months . on physical examination , icteric sclera was observed but there was neither hepatomegaly nor splenomegaly . upon admission , the laboratory findings were as follows : alanine aminotransferase ( alt ) level 472 iu / l , aspartate aminotransferase ( ast ) level 556 iu / l , alkaline phosphatase ( alp ) 123 iu / l , total bilirubin 3.44 mg / dl , direct bilirubin 1.91 mg / dl and prothrombin time internal normalisation ratio ( inr ) 1.05 . viral markers including hepatitis a antibody immunoglobulin m ( hav ab igm ) , hepatitis b surface antigen ( hbsag ) and hepatitis c antibody ( hcv ab ) were negative . since the patient was a middle aged woman , further assessments to rule out autoimmune hepatitis were also performed . anti - smooth muscle antibody ( sma ) and antinuclear antibody ( ana ) were positive with the ratio of 1:640 for ana and igg was increased to 1,940 mg / dl . liver biopsy was performed and the histologic findings revealed mild portal inflammation with lymphoplasmacytic , neutrophilic and eosinophilic infiltration along with minimal interface activity ( fig . 1 ) . as the histologic findings were not typical for autoimmune hepatitis along with spontaneous slow decrease in ast ( 48 iu / l ) and total bilirubin ( 0.64 mg / dl ) levels the patient was followed up as out - patient without treatment . follow up ana was positive with the ratio of 1:1,280 and igg level was further elevated to 2,420 mg / dl ( fig . 2a , b ) . based on the lab findings and fluctuation of ast and alt levels , diagnosis of autoimmune hepatitis type she was initially prescribed with prednisolone 30 mg which was tapered to 5 mg in in 4 months and was maintained in combination with aza 25 mg daily . the patient showed treatment response with decrease in serum ast and alt levels along with decrease in total igg levels after 3 months of treatment ( fig . after 3 months of maintenance treatment , aza - related side effect , pancytopenia and alopecia developed . hemoglobin level decreased to 9.6 g / dl , white blood cell count decreased to 2,150 mm/l ( absolute neutrophil count 377 mm/l ) and platelet count decreased to 82,000 mm/l ( fig . 2c ) . furthermore , hair loss occurred 2 months after treatment with aza which aggravated until the patient had to wear a wig . therefore , aza was discontinued after 5 months of treatment and was maintained on 5 mg of prednisolone daily . after discontinuation of aza , complete blood count returned to normal range within 1 month while hair growth returned to normal 2 months later . although the symptoms subsided after quitting aza , there were wax and wane in ast and alt levels after 27 months of steroid monotherapy , exacerbation of aih occurred . the steroid dose was escalated to 30 mg again in combination with 50 mg of azathioprine . unfortunately , after 20 days of combination treatment , aza - related side effect occurred again , especially severe alopecia was noted , unabling the patient to maintain on standard treatment . as remission was not achieved with first - line treatment , steroid monotherapy was maintained for another 2 months which was decreased to 15 mg during that duration and mmf 1 g per day was added thereafter . after administration of mmf , her symptoms had subsided and normalization of liver enzymes and igg level was achieved . the patient is still on 5 mg of steroid and 500 mg of mmf and is stable for 12 months after the acute exacerbation of aih . autoimmune hepatitis ( aih ) was first reported in 1951 as a fluctuating persistent hepatitis of young woman with marked elevations of serum immunoglobulins . the median and mean age of initial disease presentation are in the forties and the etiology of aih is unknown , but it carries all features of an autoimmune disease : genetic predisposition , spontaneous disease fluctuations , circulating autoantibodies , auto - reactive t cells , inflammatory infiltrations in liver , and a good response to immunosuppressive agents [ 1,5,7 - 9 ] . aih can be diagnosed when compatible clinical signs and symptoms , laboratory abnormalities ( increased serum ast or alt , and total igg ) , serological ( autoantibodies ) , and histological ( interface hepatitis , lymphocytic and lymphoplasmacytic infiltrates in portal tracts and extending in the lobule , hepatic rosette formation , or chronic hepatitis with lymphocytic infiltration ) findings are present ; and other conditions that can cause chronic hepatitis , including viral , metabolic , cholestatic , hereditary , and drug - induced diseases , have been excluded . studies reported that when aih is left untreated , as many as 40% of the patients with severe disease die within 6 months and of the remaining 40% develop cirrhosis . therefore , when clinical , laboratory or histologic features of active liver inflammation is present , immunosuppressive treatment should be initiated . standard treatment includes corticosteroids alone or in combination with aza that aims at the normalization of transaminase and igg levels in serum which correlate with histological disease activity . in adults with aih , standard treatment can be started with prednisolone ( starting with 30 mg daily and tapering down to 10 mg daily within 4 weeks ) in combination with azathioprine ( 50 mg daily or 1 - 2 mg / kg body weight ) or prednisolone alone ( starting with 40 - 60 mg daily and tapering down to 20 mg daily within 4 weeks ) . although most of the patients respond very well to immunosuppressive treatment , 20% of patients do not respond to or are intolerant to standard therapy . the overall frequency of aza - related side effect is 10% , which can be improved after dose reduction or discontinuation . aza is a non - selective immunosuppressant that acts by inhibition of several enzymes involved in purine synthesis and this contributes to side effects including bone marrow suppression , nausea , rash , alopecia , arthralgias , neoplastic and malabsorption . the frequency of cytopenia in azathioprine treated patients with autoimmune hepatitis is 46% , and the occurrence of severe hematologic abnormalities is 6% . thiopurine s - methyltransferase ( tpmt ) is part of a cascade of enzymes responsible for the metabolism of thioprine drugs including aza , 6-mercaptopurine ( 6-mp ) and 6 thioguanine ( 6-tg ) . some studies reported that activity of tpmt could be used to predict those who would respond to treatment and those who would show hematologic side effects as the patients with deficient tpmt activity are at severe risk of developing bone marrow suppression [ 15 - 17 ] . however , tpmt testing is not routinely performed as it is time consuming and not widely available in the past 15 years alternative immunosuppressive and biological agents for those who can not tolerate standard treatment were evaluated . unfortunately , the treatment options for patients who failed to respond to standard therapy is still limited . mmf , an ester pro - drug of mycophenolic acid which acts as a noncompetitive inhibitor of inosine monophosphate dehydrogenase , the rate - limiting enzyme involved in the de nevo synthesis of purines were studied as an alternative to standard treatment . according to the aasld practice guidelines , mmf or cyclosporine have had the most empiric use as alternative medications and mmf ( 2 g daily orally ) is the most promising current agent where improvement of hepatitis can be expected in 39 - 84% of patients . several studies suggested mmf as an alternative treatment for those who are either refractory or intolerant to steroid and azathioprine combination therapy . study by zachou et al . prospectively studied the efficacy and safety of mmf in treatment nave aih patients where 88% of 59 patients responded to the treatment and even allowed rapid steroid tapering with eventually withdrawal of steroid . another study by sharzehi et al . based on retrospective cohort including 90 patients showed that those who were unable to continue corticosteroid and azathioprine well tolerated mmf with 88% of patients maintaining complete remission . these studies initiated mmf at a dose of 1.5 - 2 g / day in the former while 1g / day in the latter study . the reported side effect was gastrointestinal symptoms including nausea , vomiting and diarrhea , rash and hair loss but no evidence of bone marrow suppression was observed . our patient did not experience any of the mentioned side effects after 10 months of mmf treatment . although the second - line therapy with mmf seems promising , the response rates varied according to reason for stopping aza treatment where patients with aza intolerance had higher response rates to mmf than those who had shown insufficient response to aza ( 43% vs. 25% ) . in our case , pancytopenia and alopecia occurred after 3 months of standard treatment ( corticosteroid and aza ) . unfortunately after 27 months of corticosteroid monotherapy , hepatitis flare recurred and was stabilized with addition of aza but again the same side effect , pancytopenia and alopecia developed . like other studies , alternative treatment with mmf was considered as a good option and we expect better treatment response for our patient as she had shown sufficient response to aza .

autoimmune hepatitis ( aih ) is an immune - mediated chronic liver disease characterized by hepatocellular inflammation , necrosis , and fibrosis , which can progress to cirrhosis and fulminant hepatic failure . the standard treatment for aih includes corticosteroids alone or in combination with azathioprine . although most patients achieve remission using the standard regimen , some patients do not respond due to either drug intolerance or refractory disease ; in such cases alternative immunosuppressive agents should be explored . the second - line therapies are cyclophilin inhibitors such as cyclosporine a or tacrolimus , and nowadays mycophenolate mofetil ( mmf ) is widely used if azathioprine - based therapies are not tolerated . although these are recommended as an alternative to the first - line regimen , there is insufficient evidence for the efficacy of second - line therapies , with the evidence based mainly on expert opinion . therefore , we report an aih patient receiving the standard regimen in whom remission did not occur due to side effects to azathioprine , but was successfully treated with mmf in combination with corticosteroids as an alternative to the standard regimen .

numerous publications have clearly defined the role of pkc as transforming oncogene in fibroblasts and epithelial cells . overexpression of pkc in nih3t3 fibroblasts and frc / tex cl d rat colonic epithelial cells was shown to increase cell proliferation , enhance anchorage - independent colony formation , and induce a highly tumorigenic in vivo phenotype with tumor incidence of 100% [ 1 , 2 ] . in addition , nih3t3 fibroblasts with pkc overexpression were invasive and displayed a polarized morphology with extended long cellular membrane protrusions . epidermis - specific pkc transgenic mice developed highly malignant and metastatic squamous cell carcinomas in response to 12-o - tetradecanoylphorbol-13-acetate stimulation . pkc was demonstrated to transform androgen - dependent lncap prostate cancer cells into an androgen - independent variant . moreover , transgenic mice with selective overexpression of pkc in the prostate epithelium developed prostate hyperplasia and prostate intraepithelial neoplasia . our laboratory demonstrated that inhibition of pkc in mda - mb231 cells , a highly metastatic breast cancer cell line with elevated pkc levels , was sufficient to dramatically decrease in vivo tumor growth and reduce the incidence of lung metastasis . subsequently , pkc was shown to promote an invasive and motile phenotype in hnscc through modulation of rhoa presumably through posttranslation phosphorylation . rhoa , a member of the rho gtpase family , has been implicated to be involved in the development and/or progression of numerous cancers . a recent report showed that overexpression of rhoa is sufficient to immortalize human mammary epithelial cells . moreover , mir-31 was reported to be inversely associated with metastasis through inhibition of rhoa in breast cancer patients . multivariate analysis revealed that elevated rhoa is an independent prognostic biomarker of poorer overall survival in pancreatic adenocarcinoma . high levels of rhoa correlated with venous invasion , advanced ptnm stage , and prognosis in hepatocellular carcinoma [ 13 , 14 ] . increased rhoa is associated with tumor progression in ovarian carcinoma and lymph node metastasis and overall survival in bladder carcinoma [ 15 , 16 ] . similarly , rhoa was shown to be biomarker for lymph node metastasis and overall survival in esophageal squamous cell carcinoma . rhoa , rac2 , and cdc42 were found to be elevated in premalignant dysplastic and hnscc cell lines in comparison to normal keratinocytes . furthermore , based on their immunohistochemistry analyses , rhoa was suggested to be a promising biomarker of malignancy and/or aggressiveness in head and neck squamous cell carcinoma ( hnscc ) . our previous work provided the initial evidence linking two proteins , pkc and rhoa , intimately involved in metastasis . pkc was shown to signal through rhoa to modulate cell invasion and motility in hnscc . in this study interestingly , an active atp - docked pkc conformation is not required for pkc to bind to rhoa indicating that the pkc-rhoa complex is assembled independently of the transient substrate - kinase interaction at the catalytic site of pkc. stoichiometric fret analysis with hek293 cells overexpressing mcherry - pkc and egfp - rhoa revealed that the pkc-rhoa complex is assembled in the cytoplasm and subsequently translocates to the cell membrane . our work revealed that pkc phosphorylates rhoa but , intriguingly , also has a kinase - independent action to function as a chaperone to traffic rhoa to the cell membrane . human pkc cdna was cloned into pentr / d - topo vector ( invitrogen , carlsbad , ca ) by pcr from a human cdna library ( clontech , mountain view , ca ) . the n - mcherry - tagged pkc was made by inserting pkc open reading frame into bglii / xbai site of mcherry - c1 vector ( clontech , mountain view , ca ) . mcherry - pkc/k437r mutant was generated using the quikchange lightning kit ( agilent technologies , inc . , the positive control plasmid mcherry - linker - egfp for stoichiometric fret analysis was made by inserting mcherry dna fragment into nhei / bglii sites and followed by eliminating the sequence between bamh1 and bglii sites within the multiple cloning site in vector egfp - c1 ( clontech ) , resulting in a 10 amino acid long in - frame linker sglkdppvat . hek293 cells were purchased from atcc ( rockville , md ) and cultured in dulbecco 's modified eagle 's medium supplemented with penicillin ( 100 units / ml ) , streptomycin ( 100 g / ml ) , and 10% fetal bovine serum . recombinant pkc was incubated with recombinant rhoa in kinase buffer ( 24 mm tris ( ph 7.4 ) , 0.5 mm edta , 0.5 mm egta , 10 mm -mercaptoethanol , 1 g / ml leupeptin , 1 g / ml aprotinin , and 50 g / ml pmsf ) containing pkc activators , phosphatidylserine and diacylglycerol , and [ p]atp for 30 minutes at 25c . subsequently , termination buffer consisting of 7.5 m guanidine - hcl was added to stop the reaction . rhoa was phosphorylated by pkc in vitro and then subjected to digestion by trypsin , chymotrypsin , or glu - c . following enzyme digestion the sample was acidified to 0.5% trifluoroacetic acid concentration and stored at 20c until further analyzed . the digested rhoa protein was analyzed by reverse - phase nanoscale lc - ms using a waters qtof premier mass spectrometry system . prior to analysis edta and diammonium phosphate were added to sample for a final concentration of 25 mm each , and 1125 ng of digested protein was analyzed . peptides were separated using acetonitrile / water mobile phases containing 0.1% formic acid on a waters nanoacquity uplc system employing a 300 m i d 20 mm c-18 5 m particle symmetry trap column and a 75 m i d 150 mm c-18 1.7 m beh analytical column . peptides were trapped for 15 minutes at 3 l / min followed by gradient elution using 028% acetonitrile in 40 minutes through the analytical column at 300 nl / min . esi was conducted at approximately 3.3 kv using in - house prepared spray emitters . emitters were constructed by sleeving a 7 cm piece of 20 m i d 90 od fsc into a 3 cm piece of 100 m i d 360 od fsc and gluing the junction with epoxy . the polyimide coating on the terminal end of the emitter was burned off using a microtorch , and the emitter was used with a waters nanoease esi mount . the qtof premier mass spectrometer was programmed to collect alternate scan ms data as previously described [ 19 , 20 ] . briefly , ms data collection was performed by a low collision energy acquisition of 0.8 seconds followed by a high collision energy acquisition for 0.8 seconds without quadrupole mass filtering across a 501990 m / z mass range . this was performed in an alternating fashion during a 65-minute run and termed lc - ms analysis . low collision energy acquisition records all peptide precursor mass data , while the high collision energy portion of the acquisition collected peptide fragmentation data . following the low collision energy acquisition set at 10 volts , collision energy was ramped from 10 volts to 40 volts over the 0.8 second high collision energy acquisition to accommodate peptides requiring different collision energy for fragmentation . glu - fibrinopeptide at a concentration of 200 fmol/l in 25% acetonitrile / water/0.1% formic acid was introduced as a lockspray calibrant through a second esi probe at 0.5 l / min using an auxiliary uplc pump . lockspray data was collected for 1 second every 30 seconds over a 65-minute analysis . following an lc - ms analysis , data processing was performed using waters plgs software version 2.3 build 23 using the following parameters : low - energy threshold 100 counts , high - energy threshold 10 counts , and an intensity threshold of 1000 counts . data processing combined the signal intensity of all charge states generated from a given peptides into singly charged mh values and determined the peak apex for both low - energy precursors and all fragment ions within the vicinity of the precursor . first , the data was used to search human refseq database version 17 within plgs software using the following search parameters : peptide and fragment tolerance was automatic , the minimum fragment ion matches per peptide were 3 , the minimum fragment ions per protein were 7 , the minimum peptides matches per protein were 1 , missed cleavages were 2 , the false positive rate was 4% , and modifications allowed were acetyl n - term , carbamidomethyl - c , carbamyl n - term , and phosphorylation at sty . second , low - energy precursor mh data was copied into excel and compared to mh values calculated for predicted rhoa trypsin , chymotrypsin , or glu - c protease peptides bearing up to 4 phosphate groups . experimental mh masses that matched within 0.03 da of gpmaw calculated values were evaluated manually in plgs or masslynx protein / peptide editor software . possible phosphopeptide assignment was made when the measured mass was within 0.03 da of the calculated phosphopeptide mass and greater than 3 accurate mass product ions could be assigned to a peptide sequence . confident site - specific phosphorylation also used this criteria but further required fragment ions including phosphorylated serine or threonine amino acids . , san diego , ca ) was incubated with recombinant rhoa ( cytoskeleton , denver , co ) in pkc kinase buffer for 30 minutes at 25c . the binding reaction was immunoprecipitated using agarose - conjugated anti - pkc antibody or igg ( abcam , cambridge , ma ) at 4c with gentle agitation overnight . the suspension was centrifuged at 1,000 g for 1 minute , and the agarose beads were washed three times with ice - cold pbs and resuspended in sds sample buffer . the same procedure was performed to immunoprecipitate the binding reaction containing his - tagged pkc-kinase domain ( biobasic inc . , markham , canada ) , and rhoa except agarose - conjugated anti - his antibody ( abcam ) was used . the immunoprecipitated samples were boiled in sds sample buffer , resolved by sds - page , and transferred to immobilon membrane . the membranes were incubated with anti - rhoa ( cytoskeleton ) or anti - his ( millipore , billerica , ma ) antibodies and visualized by ecl using the fast western kit ( pierce , rockford , il ) . hek293 cells were seeded on 35 mm glass - bottomed dishes one day prior to transfection with mcherry - pkc and egfp - rhoa . fluorescence microscopy experiments were performed in the center for live - cell imaging ( clci ) at the university of michigan medical school using an olympus ix70 inverted microscope ( olympus , center valley , pa ) . experiments involving live - cell imaging employed a heated stage ( harvard apparatus , inc . , holliston , ma ) in combination with hepes - buffered medium to maintain cell viability and activity for several hours of microscopic observation . illumination was provided from a 100 w halogen lamp for phase - contrast microscopy and by an x - cite 120 metal halide light source ( exfo , mississauga , canada ) for fluorescent microscopy . the microscope was equipped with 100x ( oil immersion ; uplan fl , na = 1.30 ) , 40x ( lcplanfl , na = 0.6 ) , and 10x ( cplan , na = 0.25 ) objectives . rockingham , vt ) were used for fluorescent imaging ; in particular set number 86014v2 includes filters used for gfp ( excitation 492 nm / bp18 , emission 535 nm / bp40 ) and mcherry ( excitation 572 nm / bp23 , emission 630 nm / bp60 ) . the excitation and emission filters were mounted in a lambda 10 - 3 automatic filter wheels ( sutter instrument co. , novato , ca ) allowing rapid filter switching . images were collected using a coolsnap hq2 14-bit ccd camera ( photometrics , tucson , az ) . all devices were controlled through metamorph premier v7.7 software ( molecular devices , downingtown , pa ) . quantitative analysis of the imaging data and the preparation of presentation quality images were performed using metamorph v7.7 software . quantitative stoichiometric fret analysis of the data was performed with proprietary software created by the clci staff using matlab r2009a ( the mathworks , natick , ma ) , and this fretcalc software can be obtained from the university of michigan tech transfer . the methods and algorithms used in fret stoichiometry have been previously described [ 21 , 22 ] . our laboratory reported that pkc modulates rhoa activity in hnscc presumably through posttranslation phosphorylation . in silico prediction of phosphorylation sites identified multiple serine and threonine residues that are putative pkc phosphorylation sites on rhoa suggesting that direct phosphorylation of rhoa through pkc may be a possibility . to determine if pkc can directly phosphorylate rhoa , we performed an in vitro kinase reaction and incubated recombinant pkc with rhoa in the presence of pkc activators , phosphatidylserine and diacylglycerol , and p - atp . pro - q diamond , a phosphoprotein staining reagent , confirmed rhoa as a substrate for pkc ( figure 1(b ) ) . next , we identified the phosphorylation sites on rhoa using phosphopeptide mapping with liquid chromatography - mass spectrometry / mass spectrometry ( lc - ms / ms ) . lc - ms analysis of peptides resulting from trypsin digested rhoa showed about 83% coverage , whereas the combined data from trypsin and glu - c digested rhoa showed 100% coverage of the serine and threonine residues on rhoa . thus , it is reasonable to conclude that a comprehensive phosphopeptide map of rhoa was generated using trypsin and glu - c . our results provide the first evidence that rhoa is a direct substrate for pkc phosphorylation . there is limited , although intriguing , literature demonstrating that a kinase preassembles with its substrate prior to a kinase phosphorylation event . the preassembled kinase - substrate complex not only increases specificity but also shortens the time between kinase activation and phosphorylation of the substrate [ 23 , 24 ] . to determine if pkc preassembles with rhoa without an active atp - docked pkc conformation , recombinant pkc and rhoa were incubated in atp - free in vitro kinase buffer . as shown in figure 1(c ) , pkc was able to bind to rhoa under this condition . moreover , the kinase domain of pkc was sufficient to bind to rhoa demonstrating that the rhoa docking site is within the pkc kinase domain ( figure 1(d ) ) . these results indicate that the binding between pkc and rhoa does not require an active atp - docked pkc kinase conformation , and thus , the interaction between these two proteins is more complex than a transient substrate - kinase intermediate state . there is evidence that a preassembled kinase - substrate complex not only enhances phosphorylation specificity and efficiency but also plays a role in cellular localization . to determine if pkc mediates the localization of rhoa , hek293 cells were transfected with mcherry - pkc or egfp - rhoa or cotransfected with mcherry - pkc and egfp - rhoa . subcellular localization of pkc and rhoa was visualized in living cells using fluorescence microscopy in the presence or absence of phorbol 12-myristate 13-acetate ( pma ) . activation of pkcs with pma is associated with the translocation of pkcs to the cell membrane . as expected , pkc was translocated from the cytoplasm to the cell membrane following pma stimulation in hek293 cells overexpressing mcherry - pkc ( figure 2(a ) ) . in contrast , in hek293 cells overexpressing egfp - rhoa , rhoa remained at the cytoplasm following pma treatment . as shown in figure 2(b ) , pma treatment induced rhoa to colocalize with pkc at the cell membrane in hek293 cells transfected to overexpress mcherry - pkc and egfp - rhoa . our data showed that pkc traffics rhoa to the cell membrane following a general pkc activation signal in hek293 cells . to better define the interaction between pkc and rhoa with spatiotemporal resolution , hek293 cells overexpressing mcherry - pkc and egfp - rhoa were stimulated with pma , and images collected over a 12.5 minute time course were subjected to quantitative stoichiometric fret analysis . pma treatment induced an obvious reorganization of mcherry - pkc and egfp - rhoa in the cell from the cytoplasm to the cell membrane as evidenced by comparing the ia and i d images at 0 min and 12.5 min after pma stimulation , respectively ( figure 3 ) . furthermore , pma - treatment resulted in an overall increase in ed , a measure of the fret efficiency of the interaction between mcherry - pkc and egfp - rhoa . the initial increase and peak in ed occurred in the cytoplasm followed by an elevation of the pkc-rhoa interaction at the cell membrane for the entire time course . recruitment of rhoa and the increase in fret activity was especially robust in the actively ruffling regions of the cell ( upper and bottom right corners of the cell ) . taken together , fret analysis demonstrated that in response to pma stimulation , the pkc-rhoa complex is recruited to the cell membrane over time , and furthermore , the pkc-rhoa complex may be preassembled in the cytoplasm prior to translocation to the cell membrane . our in vitro protein binding experiments indicate that an active atp - docked pkc confirmation is not required for pkc to bind to rhoa . the kinase - inactive pkc mutant ( k437r ) contains a point mutation in the atp binding pocket to prevent atp occupancy . interestingly , pkc/k437r is localized to the cell membrane in unstimulated hek293 cells overexpressing mcherry - pkc/k437r ( figure 4(a ) ) . hek293 cells cotransfected with mcherry - pkc/k437r and egfp - rhoa showed colocalization of these two proteins at the cell membrane without pma stimulation . in support of these observations , quantitative stoichiometric fret analysis confirmed the interaction between mcherry - pkc/k437r and egfp - rhoa at the cell membrane prior to pma stimulation ( figure 4(b ) ) . the fret signal at the cell membrane did not change significantly after pma treatment indicating that the pkc/k437r - rhoa molecules at that cell compartment were already in complex with each other . these results indicate that the pkc-rhoa interaction occurs in the absence of atp and thus do not require an active catalytic site on pkc. the k437r mutation appears to alter the conformation of pkc to expose the critical amino acids required to interact with rhoa . our data confirm that cell membrane localization of rhoa is mediated independently of a pkc-rhoa phosphorylation event . regulation of rhoa activity is tightly controlled in the gdp / gtp cycle through the coordinated interactions between gtpase activating proteins ( rhogaps ) , guanine dissociation inhibitors ( rhogdis ) , and guanine nucleotide exchange factors ( rhogefs ) . rhogaps deactivate rhoa by enhancing the intrinsic gtpase activity of rhoa to hydrolyze gtp to gdp . in addition to this well - described regulatory pathway , there is evidence that posttranslational phosphorylation is an alternate mechanism used to control rhoa . protein kinase a ( pka ) was reported to phosphorylate s188 of rhoa resulting in relocalization of gtp - bound rhoa from the membrane to the cytoplasm , possibly through enhanced interaction with rhogdi . protein kinase g ( pkg ) activation was demonstrated to increase rhoa stability resulting in an increase in total rhoa protein levels . furthermore , phosphorylation of s188 on rhoa protected rhoa , particularly the gtp - bound active form , from ubiquitin / proteasome - mediated degradation . in the present study , it is interesting that three different kinases , pka , pkg , and pkc , are able to phosphorylate s188 suggesting that phosphorylation of s188 may be a nondiscriminatory mechanism to enhance rhoa stability . in addition to s188 , t127 was identified as a novel rhoa phosphorylation site suggesting that pkc may sequentially phosphorylate rhoa to fine tune rhoa levels and/or activation . ongoing efforts in our laboratory will delineate the physiological significance of t127 and s188 phosphorylation on rhoa function in hnscc . we made the novel observation that recombinant pkc associates with recombinant rhoa in the absence of atp indicating that the pkc-rhoa complex is assembled without an active atp - docked pkc conformation . additionally , kinase - inactive pkc was sufficient to colocalize with rhoa at the cell membrane in live hek293 cells providing further evidence that the pkc-rhoa interaction is much more involved than as a transient kinase - substrate transition state . these observations is consistent with a published report demonstrating that the mitogen activated protein kinase ( mapk ) substrate complexes are often spatially separate from the kinase active site and the substrate phosphorylation site . the region of the kinase that binds to a substrate has only been identified in two cases , for c - jun aminoterminal kinase 2 ( jnk2 ) and c - terminal src kinase ( csk ) [ 29 , 30 ] . the substrate - docking sites for jnk2 and csk were identified to be within the kinase domain and in proximity , within 50 amino acids , to the catalytic loop of the kinase [ 29 , 30 ] . consistent with these results , the kinase domain of pkc is sufficient to bind to rhoa . our work showed that pkc binds to rhoa within the kinase domain and without the requirement of atp . the accepted model of pma - mediated activation of pkcs is that pma changes pkcs from a closed to an open conformation resulting in translocation of pkcs to the cell membrane . fret results showed that the initial response to pma is an increase in the molecular interaction between pkc and rhoa in the cytoplasm . this observation indicates that the active pkc conformation is required to expose the rhoa docking site and thus allow rhoa to complex with pkc. the interaction between pkc and rhoa showed an early peak at the cytoplasm and then decreased to basal levels for the remainder of the time course . in contrast , a gradual but prolonged increase in fret intensity was observed at the cell membrane , in particular the actively ruffling regions of the cell , over the entire time course . a plausible explanation is that , following a pkc activation signal , pkc and rhoa are assembled in the cytoplasm , and the resulting complex is subsequently trafficked to the cell membrane . it is important to point out that pma does not induce translocation of rhoa to the cell membrane without the presence of pkc. therefore , the recruitment of the pkc-rhoa complex to the cell membrane is completely dependent on the cellular localization of pkc in response to a stimulus . fluorescence microscopy showed that kinase - inactive pkc is predominantly localized to the cell membrane under basal conditions . this result suggests that the pkc/k437r is in an open conformation capable to interact with chaperone proteins involved in pkc translocation . the cellular localization of rhoa is concentrated at the cell membrane in cells cotransfected with mcherry - pkc/k437r and egfp - rhoa . similarly , fret analysis showed that the interaction between pkc/k437r and rhoa is concentrated at the cell membrane rather than at the cytoplasm in unstimulated cells . furthermore , pma did not alter the extent of the molecular interaction between pkc/k437r and rhoa at the cell membrane . fret analysis with pkc/k437r confirmed our in vitro observations and showed that pkc is able to recruit rhoa to the cell membrane without a pkc-rhoa phosphorylation event . taken together , these findings support a kinase independent role of pkc as a chaperone to traffic rhoa to the cell membrane . work from our laboratory provided the initial evidence linking two proteins , pkc and rhoa , intimately involved in metastasis . the pkc-rhoa signaling module was shown to modulate cancer cell invasion and motility . however , the molecular mechanism of pkc regulation of rhoa remains to be elucidated . in this study , our results revealed that pkc has both kinase - dependent and kinase - independent functions to regulate rhoa ; pkc directly phosphorylates rhoa and , moreover , serves as a chaperone to translocate rhoa to the cell membrane .

protein kinase c ( pkc ) signals through rhoa to modulate cell invasion and motility . in this study , the multifaceted interaction between pkc and rhoa was defined . phosphopeptide mapping revealed that pkc phosphorylates rhoa at t127 and s188 . recombinant pkc bound to recombinant rhoa in the absence of atp indicating that the association between pkc and rhoa does not require an active atp - docked pkc conformation . activation of pkc resulted in a dramatic coordinated translocation of pkc and rhoa from the cytoplasm to the cell membrane using time - lapse fluorescence microscopy . stoichiometric fret analysis revealed that the molecular interaction between pkc and rhoa is a biphasic event , an initial peak at the cytoplasm and a gradual prolonged increase at the cell membrane for the entire time - course ( 12.5 minutes ) . these results suggest that the pkc-rhoa complex is assembled in the cytoplasm and subsequently recruited to the cell membrane . kinase inactive ( k437r ) pkc is able to recruit rhoa to the cell membrane indicating that the association between pkc and rhoa is proximal to the active catalytic site and perhaps independent of a pkc-rhoa phosphorylation event . this work demonstrates , for the first time , that pkc phosphorylates and modulates the cell membrane translocation of rhoa .

genome - wide association ( gwa ) studies are now well established for discovering hypothesis - free genetic loci whose variations are associated with a phenotype [ 1 - 4 ] . downstream analysis of the study result in terms of gene sets is gaining popularity these days , as it facilitates biological interpretation of a gwa result . the korea association resource ( kare ) project has collected epidemiological and genotype data from the regional cohorts in ansung and ansan , korea . a number of gwa studies based on this kare data have been published so far [ 6 - 8 ] . we pursued re - analyses of these studies in terms of gene sets in a systematic way to warrant cross - comparisons of the traits . we mimicked the analysis conditions of the original published gwa works as much as possible , based on the de facto standard program plink . for the gene set analysis , we used gsa - snp software , an efficient java - based application that accepts a list of single nucleotide polymorphisms ( snps ) and their association p - values and outputs the gene set p - values after multiple testing correction . we applied this procedure to 49 baseline quantitative traits that were of epidemiological , anthropometric , or blood chemistry parameters . as expected , those traits that are known to share common biological mechanisms and to overlap in their population incidences indeed showed similar profiles of the significantly associated gene sets . to our surprise , some of the traits that were phenotypically uncorrelated in our study population and were seemingly unrelated to each other showed similar profiles of the significantly associated gene sets . our results may demonstrate a useful strategy of discovering pleiotropy , which refers to a phenomenon of common pathways involved in distinct phenotypes . briefly , the genotype data were measured for a total of 10,038 residents in both ansung and ansan provinces , korea , using affymetrix genome - wide human snp array 5.0 chips ( affymetrix inc . , after quality control , 352k snp genotypes for 8,842 samples were used in the subsequent gwa analyses . the epidemiological trait data for these individuals were also received from the kare project . among a total of 49 quantitative traits gwa analyses of these 49 quantitative traits were performed by linear regression under the additive genetic model , as implemented in plink . we performed gsa using the gene ontology ( go ) databases , where only gene sets having 10 - 200 members ( 2,476 biological process go terms ) were used . we applied the z - statistic method , as implemented in gsa - snp , with the default options . briefly , those snps residing inside or within 20 kb of the boundary of each gene were compiled , and the second best p - value was assigned to the gene . see kwon et al . for the rationale of using the second best p - value instead of the best p - value . the gene score was defined as the -log of the p - value assigned to the gene . the p - values for each gene set were computed under the assumption of a normal distribution of the z - statistic , followed by multiple testing correction using the false discovery rate method . when the member genes of a gene set overlapped in their genomic loci or were located in tandem within a short block of strong linkage disequilibrium , the p - values assigned to them might have been highly correlated . in such cases , the r package gosemsim was developed to compute semantic similarity among go terms , sets of go terms , gene products , and gene clusters . this package contains functions to estimate the semantic similarity of go terms based on resnik 's , lin 's , jiang and conrath 's , rel 's , and wang 's methods . here this method determines the semantic similarity of two go terms based on both the locations of these terms in the go graph and their relationships with their ancestor terms . the similarity index between the two go terms was between 0 ( the least similar ) and 1 ( identical ) . first , the highest value against all members of the other set was calculated for a given go term in one of the sets . then , all of these values were collected and averaged to provide the similarity between the two sets . the significance of the similarity index was inferred , based on the distribution of the indices from 10 random samplings . briefly , the genotype data were measured for a total of 10,038 residents in both ansung and ansan provinces , korea , using affymetrix genome - wide human snp array 5.0 chips ( affymetrix inc . , after quality control , 352k snp genotypes for 8,842 samples were used in the subsequent gwa analyses . the epidemiological trait data for these individuals were also received from the kare project . among a total of 49 quantitative traits gwa analyses of these 49 quantitative traits were performed by linear regression under the additive genetic model , as implemented in plink . we performed gsa using the gene ontology ( go ) databases , where only gene sets having 10 - 200 members ( 2,476 biological process go terms ) were used . we applied the z - statistic method , as implemented in gsa - snp , with the default options . briefly , those snps residing inside or within 20 kb of the boundary of each gene were compiled , and the second best p - value was assigned to the gene . see kwon et al . for the rationale of using the second best p - value instead of the best p - value . the gene score was defined as the -log of the p - value assigned to the gene . the p - values for each gene set were computed under the assumption of a normal distribution of the z - statistic , followed by multiple testing correction using the false discovery rate method . when the member genes of a gene set overlapped in their genomic loci or were located in tandem within a short block of strong linkage disequilibrium , the p - values assigned to them might have been highly correlated . in such cases , the r package gosemsim was developed to compute semantic similarity among go terms , sets of go terms , gene products , and gene clusters . this package contains functions to estimate the semantic similarity of go terms based on resnik 's , lin 's , jiang and conrath 's , rel 's , and wang 's methods . here , we used wang 's method for our analysis . this method determines the semantic similarity of two go terms based on both the locations of these terms in the go graph and their relationships with their ancestor terms . the similarity index between the two go terms was between 0 ( the least similar ) and 1 ( identical ) . first , the highest value against all members of the other set was calculated for a given go term in one of the sets . then , all of these values were collected and averaged to provide the similarity between the two sets . the significance of the similarity index was inferred , based on the distribution of the indices from 10 random samplings . parallel and systematic gwa studies of a number of traits using a single genetic epidemiology dataset give a unique opportunity to explore common biological pathways regulating multiple traits that do not display phenotypic correlations . in this report , we focused on the 49 baseline quantitative trait data that were demographic , anthropometric , or blood chemistry parameters . we surveyed the literature for the published gwa studies , based on the kare data , and extracted the information on the analysis conditions , such as exclusion of samples and covariates of association regression . for the gwa analyses of all 49 traits , we included area , age , and sex as covariates , and for some of the traits , additional covariates were added , based on the literature information ( table 1 ) . for example , the directions pointed by waist and body mass index ( bmi ) were similar in the pca plot ( fig . 1 ) ; using bmi as one of the covariates for the analysis of waist . on the contrary gwa analyses for all 49 traits were performed using linear regression , as implemented in plink , and the resulting snp p - values were fed into gsa - snp for gene set analysis . for each of the 49 traits , we identified biological process go terms that showed p < 0.05 after multiple testing correction ( the lists are available upon request ) . as go terms are hierarchically arranged , verbatim matches are not desirable for the comparison of a pair of gene sets . instead , one should take into consideration the number of nodes in the go tree that separate a pair of terms . for this , we used so - called semantic similarity , as implemented in the r package gosemsim . for each pair of traits , we calculated the semantic similarity of the gene sets and plotted it against the correlation coefficient between the trait values ( fig . the pairs showing semantic similarity greater than 0.8 corresponded to traits that had high correlations in the trait values . we selected 46 trait pairs that showed a semantic similarity in gene sets greater than an arbitrary cutoff of 0.75 and depicted the interaction network using cytoscape ( fig . 3 ) . the traits related to blood lipid levels , such as total cholesterol , high density lipoprotein cholesterol , low density lipoprotein cholesterol , and triglycerides ( tgs ) , formed a small network by themselves . as cholesterol and tgs are components of lipoproteins , it is not surprising to observe such a network . both hip and waist - hip ratio are connected to suprailiac skinfold ; they are all related to body fat . the most striking feature is a large network involving 20 traits . in this network , the traits related to blood glucose levels , such as glu0 , glu60 , glu120 , hba1c , and homa , form a subnetwork . in addition , the traits related to either blood pressure or liver damage also formed respective subnetworks , as expected from their high phenotypic correlations . interestingly , the ph level was connected to 7 other traits , none of which showed high phenotypic correlations with it . we examined the gene sets that were commonly shared between these traits ( table 2 ) . among them , 11 were related to neuron development and function . we surveyed the literature for putative involvement of neuronal or nerve systems in the regulation of those 8 traits ( table 3 ) . although it is presumptive , this may imply that these traits are regulated partly by common pathways that involve the neuronal system . in conclusion

gene set analysis is a powerful tool for interpreting a genome - wide association study result and is gaining popularity these days . comparison of the gene sets obtained for a variety of traits measured from a single genetic epidemiology dataset may give insights into the biological mechanisms underlying these traits . based on the previously published single nucleotide polymorphism ( snp ) genotype data on 8,842 individuals enrolled in the korea association resource project , we performed a series of systematic genome - wide association analyses for 49 quantitative traits of basic epidemiological , anthropometric , or blood chemistry parameters . each analysis result was subjected to subsequent gene set analyses based on gene ontology ( go ) terms using gene set analysis software , gsa - snp , identifying a set of go terms significantly associated to each trait ( pcorr < 0.05 ) . pairwise comparison of the traits in terms of the semantic similarity in their go sets revealed surprising cases where phenotypically uncorrelated traits showed high similarity in terms of biological pathways . for example , the ph level was related to 7 other traits that showed low phenotypic correlations with it . a literature survey implies that these traits may be regulated partly by common pathways that involve neuronal or nerve systems .

diabetes is one of the most common chronic diseases among women of reproductive age , observed in about 10% of pregnancies in the us and approximately 0.20.5% of these are in women with type 1 diabetes ( t1d ) . t1d pregnancies are associated with an increased rate of complications , including late intrauterine death or major congenital malformations , which can lead to increased fetal morbidity and mortality compared to non - diabetic pregnancies . maternal complications are also more frequent , with increased rates of preeclampsia , cesarean section and maternal mortality . poor glycemic control at the time of conception and organogenesis during the first trimester is a major cause for an increased risk of birth defects and pregnancy complications . it has been recognized that a positive correlation exists between hemoglobin a1c ( hba1c ) levels during early pregnancy and the incidence of fetal malformations . therefore , good glycemic control could lead to a reduction of congenital abnormality rates to almost non - diabetic levels . preconception counseling and strict glycemic control have improved pregnancy outcomes in women with t1d , as evident from reduced rates of congenital malformations , preterm delivery and decreased neonatal morbidity , manifested by reduced macrosomia and admissions to neonatal care units . this is further exemplified by a case study from our clinic ( table 1 ) . patients receiving prenatal care have been shown to maintain better hba1c levels , resulting in a reduction of infant mortality from 20% in the 1950s to less than 3% in the 1980s . this would not have been possible without the significant evolution in glucose monitoring methods , the introduction of insulin pumps and the development of insulin analogs.table 1.prenatal care for a pregnant t1d patient a case study.patienta 31-year - old female with t1d presented to the office for evaluation . she had just relocated and found out that she was pregnant and expressed a wish for things [ to ] go better this time.historyshe developed diabetes at age 14 and always had poor glycemic control . her diabetes was complicated by retinopathy with laser surgery , peripheral neuropathy , autonomic neuropathy in the form of hypoglycemic unawareness and diabetic cystopathy with frequent urinary tract infections and incontinence . an analysis showed an unspecified developmental defect . with her second pregnancy she developed preeclampsia at 31 weeks of gestation , requiring antihypertensive medications . this patient had never seen an endocrinologist or maternal fetal medicine specialist , as these specialists were not available where she lived . her diabetes had always been treated with two injections per day of nph and regular insulin.treatmentafter meeting with a certified diabetes educator her insulin regimen was intensified to four injections per day , with a variable amount of aspart at meals , as determined by carbohydrate counting . . the insulin regimen was adjusted multiple times , and her hba1c declined to 6.9% . following a dilated retinal exam , an ophthalmologist treated her with panretinal photocoagulation laser therapy.outcomethe patient developed preeclampsia at 36 weeks of gestation , and was treated with antihypertensives . both the mother and her neonate were discharged to home . prenatal care for a pregnant t1d patient a case study . one of the main challenges in the care for pregnant women with diabetes is the proper control of blood glucose . metabolic changes occurring as a result of the pregnancy complicate this task . during the first trimester , increased insulin sensitivity combined with the constant attempts to achieve normoglycemia through insulin therapy , raise the risk of hypoglycemia . the second and third trimesters of pregnancy are characterized by an enhanced secretion of placental hormones , growth factors and cytokines , leading to an increased insulin resistance and hyperglycemia . hyperglycemia results in the transport of increased amounts of glucose across the placenta , causing fetal hyperinsulinemia and macrosomia . macrosomia can cause maternal and fetal complications and is observed in about 2762% of infants of mothers with diabetes . careful monitoring of glucose levels and constant adjustment of insulin therapy are needed to prevent hyperglycemia during pregnancy . t1d diabetic ketoacidosis ( dka ) , common in t1d patients , develops faster during pregnancy due to decreased insulin sensitivity in the second and third trimesters . dka remains a major cause of fetal loss , affecting 13% of patients with pregestational diabetes . gestational hypertension is a common complication and a major risk factor for cardiovascular events , retinopathy and nephropathy . furthermore , rates of preeclampsia are 2- to 4-times higher in pregnant women with t1d , leading to infant complications , including poor growth and premature birth . preeclampsia can also be associated with serious maternal problems such as eclampsia and hemolysis , elevated liver enzymes , low platelet count ( hellp ) hellp syndrome , a life - threatening complication , has been linked to severe hypoglycemia attacks during pregnancy . t1d women who develop preeclampsia tend to have significantly higher hba1c values before and during pregnancy . severe hypoglycemia , a major challenge in the management of t1d , has been reported in 1944% of pregnant diabetes patients treated with intensive insulin therapy , especially in the first trimester . severe hypoglycemia is dangerous for the mother and can lead to loss of consciousness , seizures and death . repeated hypoglycemic episodes can lead to hypoglycemia unawareness , causing further loss of symptoms associated with the autonomic response to hypoglycemia . additionally , symptoms of hypoglycemia ( nausea , anxiety , etc . ) might be mistaken for normal pregnancy symptoms , increasing the danger of severe hypoglycemia . a major goal in the management of t1d during pregnancy is the prevention of hypoglycemic episodes . table 2 summarizes recommendations from the american diabetes association ( ada ) and the american congress of obstetricians and gynecologists ( acog ) for glycemic goals , glucose monitoring and prevention of severe hypoglycemia . the patient might , in fact , need to reduce the insulin dose during the first trimester in order to prevent hypoglycemic episodes . several studies suggest that the use of insulin analogs instead of human insulin may lower the risk of severe hypoglycemia in women with diabetes [ 911 ] . in addition , real - time continuous glucose monitoring ( cgm ) with set alarms for low glucose values , might be useful for pregnant women with hypoglycemia unawareness.table 2.selected ada and acog recommendations .adaacogglycemic goals pre - meal values of 3.35.5 mmol / l ( 6099 mg / dl ) . peak postprandial glucose of 5.57.2 mmol / l ( 100129 mg / dl ) . bedtime and overnight glucose of 3.35.5 mmol / l ( 6099 mg / dl ) . mean daily glucose of < 6.1 mmol / l ( < 110 mg / dl ) and hba1c < 6.0%. fasting glucose level of < 5.3 mmol / l ( < 95 mg / dl ) . pre - meal values of < 5.5 mmol / l ( < 100 mg / dl ) . 1-h postprandial levels < 7.8 mmol / l ( < 140 mg / dl ) , and 2-h postprandial values of < 6.7 mmol / l ( < 120 mg / dl ) . during the night , glucose levels should not decrease to < 3.3 mmol / l ( < 60 mg / dl ) . mean capillary glucose levels should be maintained at an average of 5.5 mmol / l ( 100 mg / dl ) ; hba1c 6.0%.glucose monitoring daily self - monitoring both before and after meals , at bedtime and occasionally at 2:00 am4:00 am . hba1c test at the initial visit during pregnancy , monthly tests until target levels < 6.0% are achieved , followed by testing every 23 months thereafter. daily self - monitoring in the fasting state , before and 1 or 2 h after each meal and before bed . in selected patients , especially those on insulin pumps , glucose determinations at 2:00 am3:00 hba1c measurement provides an indication of glycemic control over the past 23 months and should be performed during each trimester.prevention of severe hypoglycemia assess the presence of clinically diminished counter - regulatory responses to hypoglycemia and educate patients to minimize its occurrences . cgm may be a supplemental tool to self - monitoring for selected patients with t1d , especially those with hypoglycemia unawareness. patients should be questioned to determine if they can recognize when their glucose levels decrease to < 3.3 mmol / l ( < 60 mg / dl ) . patients and their families should be taught how to respond quickly and appropriately to hypoglycemia . selected ada and acog recommendations . for patients with t1d , the therapeutic insulin dose is adjusted to the patient s glucose profile . daily monitoring is essential for proper insulin dosing , as insulin requirements vary during pregnancy . ada and acog recommend self - monitoring several times throughout the day and occasionally at night in order to detect nocturnal hypoglycemia ( table 2 ) . ada and acog also recommend maintaining mean daily glucose levels between 5.2 and 6.1 mmol / l ( 95110 mg / dl ) and hba1c < 6.0% , with specific goals for preprandial , postprandial and bedtime glucose . the goal during labor is to avoid maternal hyperglycemia in order to prevent subsequent neonatal hypoglycemia ( by maintaining blood glucose levels < 6.1 mmol / l [ < 110 mg / dl ] , as assessed by hourly blood glucose readings ) . currently , the treatment of pregnant women with t1d is influenced by the fact that patients are better informed about the disease . a higher percentage of pregnancies are planned , providing an opportunity for adequate preparation of the patient in anticipation of potential complications from t1d . glucose levels are controlled through the administration of long - acting ( basal ) insulin analogs and rapid - acting ( bolus ) insulin analogs . patients follow a multiple daily injection regimen ( mdi ) that involves four , and even up to seven , insulin injections administered before meals and pre - bedtime . compared with regular human insulin , bolus insulin analogs have a more rapid onset and a shorter duration of action ( table 3 ) , resulting in a more effective reduction of postprandial hyperglycemia and avoidance of hypoglycemic events between meals .table 3.characteristics of insulin and insulin analogs .insulin or insulin analogonset of action ( minutes)time to peak concentration ( minutes)maximum duration of action ( hours)insulin regular insulin306090120512 nph insulin601202404801020bolus insulin analogs insulin lispro1015306034 insulin aspart1015405035 insulin glulisine10155535basal insulin analogs insulin glargine60120none24 insulin detemir60120none2024adapted from trujillo ai two rapid - acting insulin analogs , lispro and aspart , are currently classified as pregnancy risk category b , based on reports demonstrating fetal , perinatal and maternal outcomes similar to regular human insulin [ 1315 ] . lispro and aspart are at least as effective as regular human insulin in achieving glucose control , as evident from hba1c levels . the main benefit of insulin analogs is the reduction of severe hypoglycemic events in pregnant t1d patients . glulisine is another rapid - acting insulin analog available for use in the general diabetic population . however , there are no controlled studies addressing its safety in pregnancy , and glulisine is not recommended for pregnant women with t1d . basal insulin is required for the maintenance of glycemic control between meals . until recently , neutral protamine hagedorn ( nph ) , an intermediate - acting insulin , was the only insulin approved for use as basal therapy in pregnant t1d patients and was considered as the standard of care for diabetes in pregnancy . however , nph use can be associated with a peak in concentration 48 h post - injection ( table 3 ) and high intrasubject variability that may lead to an increased risk of hypoglycemic events between meals and at night . in recent years , glargine and detemir have become the basal insulin analogs of choice in the general t1d population . glargine shows a relatively flat action profile with a near 24-h duration ( table 3 ) . glargine also shows lower intrasubject variability compared to nph , as measured by the coefficient of variation for the 24-h glucose infusion rate glargine used in the general population leads to glycemic control that is at least comparable to that of nph , but with significantly lower risk for hypoglycemia . while there are numerous reports on the off - label use of glargine in pregnant women , there are no randomized clinical trials assessing its safety during pregnancy . therefore , insulin glargine is currently classified as pregnancy risk category c and is not approved for use in pregnant women . detemir also shows a flatter action profile with a longer duration of action than nph , approaching 24 h at clinically relevant doses . these characteristics suggest that detemir has the potential to be an improvement over nph for the control of t1d . a significant advance in the care for pregnant women with t1d was marked in 2012 with the reclassification of detemir as pregnancy risk category b , based on results from a randomized , active - controlled study by mathiesen et al . . this study evaluated the efficacy and safety of detemir in 310 pregnant t1d patients , randomized 1:1 to receive either detemir or nph in a basal - bolus regimen with aspart . treatment was initiated up to 1 year before pregnancy ( 48% ) or at 8 to 12 weeks during pregnancy ( 52% ) . additional endpoints included maternal safety . in terms of efficacy , detemir demonstrated non - inferiority to nph with respect to the primary endpoint of the study . a significant number of women in both groups ( 41% in the detemir group ; 32% in the nph group ) reached the target of hba1c 6.0% at 24 and 36 weeks of gestation . interestingly , fasting plasma glucose was significantly lower in the detemir group at 24 and 36 weeks of gestation , especially in patients initiating treatment with detemir before pregnancy . the incidence of preeclampsia was slightly higher in the detemir group , but within expected rates for pregnancies complicated by diabetes . no significant differences in early fetal death or the health of the fetus and newborn were seen with detemir . insulin premixes have proven somewhat useful for the treatment of the general population with diabetes , especially patients who need simplified dosing regimens . however , premixes are not useful for the treatment of pregnant t1d patients , as premixed formulations can not provide the required dosing flexibility during the different periods of pregnancy . currently , the treatment of pregnant women with t1d is influenced by the fact that patients are better informed about the disease . a higher percentage of pregnancies are planned , providing an opportunity for adequate preparation of the patient in anticipation of potential complications from t1d . glucose levels are controlled through the administration of long - acting ( basal ) insulin analogs and rapid - acting ( bolus ) insulin analogs . patients follow a multiple daily injection regimen ( mdi ) that involves four , and even up to seven , insulin injections administered before meals and pre - bedtime . compared with regular human insulin , bolus insulin analogs have a more rapid onset and a shorter duration of action ( table 3 ) , resulting in a more effective reduction of postprandial hyperglycemia and avoidance of hypoglycemic events between meals .table 3.characteristics of insulin and insulin analogs .insulin or insulin analogonset of action ( minutes)time to peak concentration ( minutes)maximum duration of action ( hours)insulin regular insulin306090120512 nph insulin601202404801020bolus insulin analogs insulin lispro1015306034 insulin aspart1015405035 insulin glulisine10155535basal insulin analogs insulin glargine60120none24 insulin detemir60120none2024adapted from trujillo ai two rapid - acting insulin analogs , lispro and aspart , are currently classified as pregnancy risk category b , based on reports demonstrating fetal , perinatal and maternal outcomes similar to regular human insulin [ 1315 ] . lispro and aspart are at least as effective as regular human insulin in achieving glucose control , as evident from hba1c levels . the main benefit of insulin analogs is the reduction of severe hypoglycemic events in pregnant t1d patients . glulisine is another rapid - acting insulin analog available for use in the general diabetic population . however , there are no controlled studies addressing its safety in pregnancy , and glulisine is not recommended for pregnant women with t1d . basal insulin is required for the maintenance of glycemic control between meals . until recently , neutral protamine hagedorn ( nph ) , an intermediate - acting insulin , was the only insulin approved for use as basal therapy in pregnant t1d patients and was considered as the standard of care for diabetes in pregnancy . however , nph use can be associated with a peak in concentration 48 h post - injection ( table 3 ) and high intrasubject variability that may lead to an increased risk of hypoglycemic events between meals and at night . in recent years , glargine and detemir have become the basal insulin analogs of choice in the general t1d population . glargine shows a relatively flat action profile with a near 24-h duration ( table 3 ) . glargine also shows lower intrasubject variability compared to nph , as measured by the coefficient of variation for the 24-h glucose infusion rate glargine used in the general population leads to glycemic control that is at least comparable to that of nph , but with significantly lower risk for hypoglycemia . while there are numerous reports on the off - label use of glargine in pregnant women , there are no randomized clinical trials assessing its safety during pregnancy . therefore , insulin glargine is currently classified as pregnancy risk category c and is not approved for use in pregnant women . detemir also shows a flatter action profile with a longer duration of action than nph , approaching 24 h at clinically relevant doses . these characteristics suggest that detemir has the potential to be an improvement over nph for the control of t1d . a significant advance in the care for pregnant women with t1d was marked in 2012 with the reclassification of detemir as pregnancy risk category b , based on results from a randomized , active - controlled study by mathiesen et al . . this study evaluated the efficacy and safety of detemir in 310 pregnant t1d patients , randomized 1:1 to receive either detemir or nph in a basal - bolus regimen with aspart . treatment was initiated up to 1 year before pregnancy ( 48% ) or at 8 to 12 weeks during pregnancy ( 52% ) . additional endpoints included maternal safety . in terms of efficacy , detemir demonstrated non - inferiority to nph with respect to the primary endpoint of the study . a significant number of women in both groups ( 41% in the detemir group ; 32% in the nph group ) reached the target of hba1c 6.0% at 24 and 36 weeks of gestation . interestingly , fasting plasma glucose was significantly lower in the detemir group at 24 and 36 weeks of gestation , especially in patients initiating treatment with detemir before pregnancy . the incidence of preeclampsia was slightly higher in the detemir group , but within expected rates for pregnancies complicated by diabetes . no significant differences in early fetal death or the health of the fetus and newborn were seen with detemir . insulin premixes have proven somewhat useful for the treatment of the general population with diabetes , especially patients who need simplified dosing regimens . however , premixes are not useful for the treatment of pregnant t1d patients , as premixed formulations can not provide the required dosing flexibility during the different periods of pregnancy . accurate determination of blood glucose levels is important for the proper control of diabetes . until recently , this was achieved solely by the self - monitoring of capillary blood glucose using glucose meters . the development of continuous glucose monitoring ( cgm ) devices represents an advance that can provide real - time measurements and warnings when patients face hypoglycemia . several studies have examined the benefits of cgm for the general population , but only a few studies have been performed in pregnant women with t1d . a study by yogev et al . showed that cgm use during pregnancy can detect hyperglycemic and nocturnal hypoglycemic events that might have gone unnoticed with intermittent blood glucose monitoring . a small , randomized trial performed by murphy et al . showed that cgm improved glycemic control in women with t1d and t2d , led to lower birth weight and reduced risk of macrosomia . based on these results , the american association of clinical endocrinologists ( aace ) recommended the use of cgm for all pregnant patients with t1d . a recent randomized trial investigated the intermittent use of real - time cgm during pregnancy ( study arm ) in addition to self - monitored plasma glucose levels seven times daily ( control arm ) . hba1c , self - monitored plasma glucose , severe hypoglycemia events and prevalence of large - for - gestational - age infants for women using cgm were comparable to controls . these results suggest that the intermittent use of cgm in pregnant patients with well - controlled diabetes does not further improve disease management and pregnancy outcomes . additional large controlled studies examining maternal and neonatal outcomes with cgm use are still needed to confirm its benefit . patients can choose between mdi using a syringe or insulin pen and continuous subcutaneous insulin infusion ( csii ) via an insulin pump . several observational studies have attempted to evaluate the effectiveness of insulin pumps versus mdi in pregnant women with t1d . in 2012 , the agency for healthcare research and quality ( ahrq ) published a systematic review summarizing the results of these studies . the ahrq found that hba1c values improved with either mdi or csii and there was no statistically significant difference in outcomes between the two delivery methods . because no randomized controlled trials had been performed , the strength of evidence was insufficient to show statistically significant differences in any other maternal or fetal outcomes ; therefore , the risk of bias was high . a newer , retrospective , observational study by wender - ozegowska et al . , confirmed a reduction in hba1c to similar levels with both csii and mdi use during pregnancy , although there were fewer hypoglycemic and hyperglycemic episodes in the csii group . insulin pump utilization is high ( about 40% ) in the general t1d us population due to improvement in the quality of life and observed decrease in hba1c . further studies focused on pregnant women with t1d are necessary to confirm any superiority of csii use . csii insulin delivery has drawbacks , such as higher cost of the pump and pump supplies , difficulty of use requiring the patient to be motivated and compliant and willingness to test glucose multiple times daily , that might limit its usefulness in pregnant t1d patients . in addition , there is a risk of hypoglycemia or even dka in case of a pump malfunction or infection at the infusion site . sensor - augmented pump ( sap ) therapy ( combinations of cgm and csii ) might improve the treatment of t1d patients even further . use of open - loop sap ( patient reads the cgm values and manually adjusts the pump ) in non - pregnant patients with inadequately controlled t1d results in a significant improvement of hba1c levels . the use of sap in pregnant women has been tested only on a small scale and did not show a significant benefit , except during the first trimester . however , the study was too small to be adequately powered . closed - loop sap therapy uses a control algorithm to guide insulin delivery based on real - time cgm measurements . closed - loop systems could be of great benefit to pregnant women with t1d as the algorithm should , in theory , be capable of maintaining optimal glucose levels . t1d in pregnancy is a high - risk clinical situation associated with significant chances of complications for the mother and the fetus . however , clinical practice and research have shown that pregnancy planning , preconception counseling and maintaining optimal glucose levels have a positive effect on pregnancy outcomes . the main goal in caring for the pregnant patient with t1d should be achieving near - normal blood glucose levels while minimizing the risk of hypoglycemia . the development of insulin analogs with improved safety and efficacy profiles has facilitated the achievement of normoglycemia . evidence supports the use of the bolus insulins , lispro and aspart , as the mealtime component of mdi or as used in csii . the recent reclassification of detemir to pregnancy risk category b provides pregnant t1d women with a basal insulin analog , further expanding treatment options for this patient population . evidence supports the use of insulin detemir , or nph , as the basal component of an mdi regimen . women with t1d should attend pre - pregnancy services and antenatal clinics led by professionals with endocrine and obstetrical expertise , in order to maximize the likelihood of positive pregnancy outcomes . the objective is to optimize glycemic control prior to pregnancy ( hba1c < 6.5% ) , to start folic acid supplementation ( recommended 4 mg daily ) , to alter medications unsuitable for pregnancy and to ensure that medical issues are addressed before conception and during pregnancy .

pregnancies affected by type 1 diabetes ( t1d ) carry a major risk for poor fetal , neonatal and maternal outcomes . achieving normoglycemia while minimizing the risk of hypoglycemia is a major goal in the management of t1d as this can greatly reduce the risk of complications . however , maintaining optimal glucose levels is challenging because insulin requirements are not uniform throughout the course of the pregnancy . over the past decade , there has been significant improvement in the methods for glucose monitoring and insulin administration , accompanied by an increase in the number of treatment options available to pregnant patients with t1d . through study of the scientific literature and accumulated evidence , we review advances in the management of t1d in pregnancy and offer advice on how to achieve optimal care for the patient .

the proportion of adults over the age of 65 is expected to increase over the next 40 years . an anticipated rise in the number of older adults is expected to lead to an increase in the prevalence of age - related diseases , which in turn , might result in escalating health care costs and heightened distress among family and caregivers . cognitive impairment , and more specifically alzheimer 's disease , is one of the most threatening age - related diseases , but even so - called normal age - related cognitive decline can cause agonizing distress and loss of personal identity . unfortunately , pharmaceutical treatments or preventions for cognitive impairment are only modestly effective , resulting in the search for nonpharmaceutical approaches such as intellectually stimulating activities , dietary interventions , and physical activity , for preventing or treating cognitive decline . a recent report estimated that modifiable risk factors including education , smoking , mid - life obesity , hypertension , diabetes , depression , and physical inactivity contribute significantly to the risk of alzheimer 's disease , and that a 10% to 25% reduction in these factors could prevent as many as 3 million cases worldwide . yet , despite the recognition of the importance of modifiable risk factors in the incidence and prevalence of cognitive impairment , there is often a misunderstanding of the research that has been conducted examining whether intervening on these modifiable risk factors would have any noticeable effect on brain or cognitive health . in contrast , a good deal of research has been conducted to examine the effects of physical activity and cognitive stimulation on human brain morphology and function . the aim of this review is to summarize recent research findings that examine the potential for physical activity , cardiorespiratory fitness , and exercise interventions to enhance brain health in late life . the studies reviewed here support the position that physical activity influences the endogenous pharmacology of the brain and takes advantage of the brain 's natural capacity for plasticity , well into late adulthood . physical activity increases the lifespan , reduces the risk for many cardiovascular diseases and cancers , and also reduces the risk for cognitive decline and depression in late adulthood . in short , we argue that the influence of physical activity on brain plasticity might have consequences not only for memory and other cognitive functions , but also has implications for many different psychiatric and neurologic conditions through a set of common biological pathways . first , studies using rodent models for exploring the ways in which physical activity influences the brain can control when and how much physical activity the animal receives . hence , the nature of these systematic experiments allows for causal and directional conclusions about the effects of physical activity on learning and memory , neurotransmitter systems , metabolic and growth factors , and cell proliferation . second , animal models allow for an examination of the cellular and molecular events resulting from physical activity that are simply impossible to study in humans . for these reasons , it is important to describe this literature since it provides a causal and low - level biological foundation to understand the effects observed in human neuroimaging and clinical studies . one of the earliest studies found that animals that were provided access to a running wheel in their cage tended to outperform their more sedentary counterparts on several different learning and memory tasks such as the t - maze and morris water maze . in one version of the morris water maze , rodents are made to swim in an opaque pool until they find the location of a submerged platform that sits just below the surface . by using cues located around the room , the rodent learns to navigate to the submerged platform more quickly after successive trials . in this task , both older and younger animals engaging in exercise demonstrate faster learning of the location of the submerged platform compared with rodents not engaging in exercise . importantly , performance on the morris water maze has been frequently linked to the hippocampus , a medial temporal lobe structure critical in memory formation . in fact , other studies utilizing hippocampus - sensitive tasks have also reported that exercise enhances both acquisition and rtention , suggesting that the hippocampus might be especially sensitive to the effects of exercise . there is now substantial support for robust and consistent effects of physical activity on the morphology and function of the hippocampus . for example , one of the most consistent findings in this literature is that exercise has the capacity to increase cell prolifration in the dentate gyrus of the hippocampus , even in aged animals . these studies indicate that the hippocampus remains highly modifiable throughout the lifespan and that exercise has the capacity to take advantage of the plasticity of this structure . cell proliferation in the hippocampus leads to an increased demand for nutrients to support the new neural architecture . after exercise , increased vascularization has been routinely found in several different brain regions including the cerebellum , motor cortex , hippocampus , and frontal cortex . increased proliferation of cells and capillaries in the hippocampus work in concert to enhance learning and memory in behavioral paradigms , but these effects can also be observed on the neurophysiological level . for example , exercise increases the number of synapses in the hippocampus , enhances indices of long - term memory formation , and elevates the rate of gene expression for molecules associated with learning and memory such as brain - derived neurotrophic factor ( bdnf ) and serotonin . it is clear from this literature that exercise influences the integrity of the hippocampus by influencing gene expression , cell proliferation and survival , vascularization , and synaptic plasticity . however , this literature has identified many different brain regions influenced by exercise , indicating that exercise has widespread effects . in conclusion , there are many different molecular and cellular pathways mediating the effects of exercise on cognitive and behavioral outcomes , including increased neurogenesis , angiogenesis , and the production of growth factors important in memory and cognitive function . greater amounts of physical activity and higher cardiorespiratory fitness levels are associated with better cognitive function in older adults . for example , older adult athletes outperform their more sedentary peers on many different cognitive tasks , and fitter individuals are faster and more accurate on executive functioning and memory tasks . longitudinal studies of physical activity have also found that engaging in a greater amount of physical activity earlier in life is associated with better cognitive function later in life , with larger effects for individuals engaging in more intense exercises . however , cross - sectional and longitudinal observational studies are often plagued by confounding factors that make it challenging to make causal claims about the link between physical activity and cognitive function . in other words , in the studies described above it is equally likely that individuals with better cognitive function choose to participate in more physical activities than individuals with poorer cognitive function . along these same lines , physical activity might instead be a proxy for better health habits more generally rather than being specific to physical activity per se . randomized controlled trials reduce or eliminate some of the limitations of cross - sectional and observational studies . these types of interventions in which older adults are randomized to either a moderate intensity physical activity group or to a non - active or less - active control group , routinely demonstrate that increasing physical activity for 3 to 6 months is effective at improving cognitive performance . for example , in one study , inactive older adults were randomized to either a moderate intensity physical activity group or to a stretching and toning control group for 6 months . both groups came into the laboratory 3 days per week and the exercise group participated in moderate - intensity exercises for 30 to 45 minutes per day while the stretching group participated in stretching exercises for the same amount of time . trained exercise physiologists monitored heart rates , intensity , and compliance in both groups for the duration of the exercise regimen . this study found that participation in moderate - intensity physical activity ( eg , brisk walking ) was effective at enhancing performance on tasks that measured executive functions , but was less effective at improving performance on tasks that measured other cognitive domains . in contrast , the stretching and toning group did not show significant improvements in performance over this same period . meta - analyses of physical activity interventions have confirmed that the effects of exercise on cognitive function in late life are both general and specific . general in the sense that many different cognitive domains are improved after several months of exercise , but specific in the sense that executive functions are enhanced more than other cognitive functions . first , in terms of cognitive function , the effects of exercise appear to be widespread , but most strongly associated with executive domains . this suggests that brain regions and networks that support executive functions might be more sensitive to the effects of exercise than other brain areas . the rodent literature largely supports this claim , with the largest and most consistent effects of exercise appearing in regions that support higher - level cognitive functions including the hippocampus , frontal cortex , and basal ganglia . the second key principle emerging from these studies is that the brain remains modifiable well into late adulthood , and physical activity has the capacity to take advantage of brain plasticity . brain plasticity resulting from exercise can be detected at the molecular and cellular level in rodents and at the cognitive level in humans . these two points , specificity and plasticity , provide the foundation for neuroimaging methods to examine whether physical activity , fitness , or exercise has any appreciable effect on the morphology or function of the human brain . given the principles described above , neuroimaging studies exploring these associations have hypothesized that physical activity would influence the morphology and function of the human brain and that the effects would be widespread but most consistently associated with regions that support higher - level cognitive functions such as the prefrontal cortex and hippocampus . one of the unfortunate characteristics of the brain is that it generally shrinks and atrophies with advancing age . in fact , both the prefrontal cortex and hippocampus shrink at roughly 1% to 2% annually in individuals over the age of 55 , with more precipitous rates of atrophy when individuals begin experiencing cognitive impairment . although the rate and trajectory of decline varies from region to region , the general finding is that regions that support memory and executive functions show the earliest and most rapid decline . interestingly , the loss of brain volume is mirrored by age - related changes in cognitive function with the most significant losses occurring on memory and executive tasks . yet , it is these cognitive domains and brain areas that appear the most sensitive to physical activity training . would greater amounts of physical activity or higher cardiorespiratory fitness levels have any beneficial or positive associations with the morphology of the older adult brain ? there have now been several studies finding that older adults who are more fit , more physically active , and who participate in exercise interventions have greater brain volumes than their less fit and less active counterparts . in one cross - sectional study , cardiorespiratory fitness levels were assessed in a sample of cognitively healthy older adults and voxel - based morphometry was used to assess gray matter volume . although increased age was associated with reductions in gray matter volume throughout the prefrontal , temporal , and parietal cortices , these same brain regions showed less atrophy in adults that were more fit . these results demonstrated that remaining more aerobically fit could help to preserve brain tissue that would normally atrophy with age . higher fitness levels have now been associated with greater gray matter volume in other populations , including postmenopausal women receiving hormone therapy , a higher educated older adult sample , a sample with multiple sclerosis , and older adults with mild cognitive impairment . these studies have all derived a similar conclusion from these results : individuals with a higher level of fitness have greater gray matter volume than less fit individuals , and the associations are relatively specific to brain areas that support higher - level cognition , including the prefrontal cortex . as described above , much of the animal literature has focused on the effects of exercise on hippocampal plasticity and memory functions supported by the hippocampus . this question is important since the hippocampus shrinks with advancing age and contributes to agerelated memory loss . in 165 cognitively normal older adults , cardiorespiratory fitness levels were recorded in addition to high - resolution anatomical images of the brain . the size of the hippocampus was assessed using an automated segmentation algorithm that uses a point distribution model to determine the location , size , and shape of the structure . a clear association was found between higher fitness levels and greater hippocampal volume , but importantly , greater hippocampal volume also mediated the fitness - memory association . this result suggests that greater hippocampal volume is not just a meaningless by - product of more vascularization , but rather has a meaningful impact on memory function in late life . this general association between higher fitness levels and larger hippocampal volume has now been replicated in individuals with mild cognitive impairment . cross - sectional research defines important associations between variables of interest , such as cardiorespiratory fitness levels and cortical volume . demonstrating these associations is necessary before embarking on a lengthy and expensive longitudinal randomized trial . however , there are inherent limitations to cross - sectional designs that prohibit the ability to draw conclusions about the causal nature of physical activity on brain plasticity . several studies for example , in the cardiovascular health study at the pittsburgh , pennsylvania site , 1479 ambulatory adults over the age of 65 were enrolled into a longitudinal study on the incidence of cardiovascular diseases . information about lifestyles and physical function were collected as part of this study including information on the frequency and duration of walking . approximately 9 years after the original enrollment period these same participants were recruited to participate in a brain mri study in which high - resolution brain images were collected . the brain images from 299 cognitively normal adults were selected from this sample and used in an analysis to examine whether greater amounts of self - reported walking 9 years earlier was predictive of gray matter volume later in life . the analysis of this data confirmed that greater amounts of physical activity was associated with greater gray matter volume in several different brain regions including the frontal cortex , parietal cortex , and temporal cortex including the hippocampus . interestingly , after a period of 4 more years , 116 of these 299 adults were diagnosed with either mild cognitive impairment or dementia , but greater graymatter volume associated with physical activity was associated with a two - fold reduced risk of developing cognitive impairment . this study demonstrated for the first time the link between participation in physical activityearlier in life , greater gray matter volume , and the reduced risk for cognitive impairment later in life . this study and others demonstrate that the effects of physical activity on brain plasticity might endure and influence the risk for cognitive impairment over a span of several years . randomized interventions have also reported that assigning sedentary older adults to engage in more physical activity results in an increase in graymatter volume in several different brain areas . for example , colcombe et al randomized a group of cognitively normal adults to either a moderate - intensity walking exercise program or to a stretching and toning control group . similar to the study described above , this study required participants to report to the laboratory three times per week for a period of 6 months . high - resolution brain mri scans were collected both before and after the intervention period . interestingly , the walking exercise group showed a significant increase in the volume of prefrontal and temporal brain areas along with an increase in the volume of the frontal white matter tracts especially the genu of the corpus callosum . another randomized intervention of physical activity examined whether participation in 1 year of a structured exercise regimen would increase the volume of the hippocampus in older adults . in this study , 120 cognitively normal older adults participated in a similar exercise design as that described previously . high - resolution brain scans were collected before the intervention , after 6 months , and then at completion of the 1-year trial . although the thalamus and caudate nucleus did not show significant changes in volume resulting from exercise , there was an effect of exercise on the size of the hippocampus . whereas the stretching and toning control group displayed about a 1.4% decline in the size of the hippocampus the exercising group showed an increase of about 2% over this same 1-year period . this study demonstrated that the volume of the hippocampus remains modifiable into late adulthood , and participation in 1 year of consistent and moderate intensity exercise was sufficient for increasing the size of the structure . furthermore , the changes in hippocampal volume for the exercising group were correlated with improvements in memory performance suggesting an important link between changes in volume induced by exercise and memory enhancement . in fact , more recent studies have found that the volumetric differences observed as a function of cardiorespiratory fitness mediate improvements in memory and executive function , again supporting the claim that these volumetric effects are not meaningless by - products , but important factors in promoting better cognitive function . this discussion summarizes the relatively well - established scientific literature using cross - sectional , longitudinal , observational , and randomized controlled trials examining the effect of physical activity or cardiorespiratory fitness on regional gray matter volume . these studies have consistently reported that higher fitness levels are associated with larger brain volumes , and that participation in only modest amounts of physical activity is sufficient for increasing gray matter volume in select brain regions . in addition , these results are in line with the animal literature and human cognitive literature described in preceding sections demonstrating the brain plasticity and specificity of the effects of greater amounts of physical activity . volumetric data has proven useful in identifying how physical activity could alter the morphology of the adult brain . however , other neuroimaging methods including functional magnetic resonance imaging ( fmri ) and resting state connectivity ( rs ) mri approaches allow for an investigation of the effects of physical activity on brain network dynamics . in one of the earliest studies to examine this , colcombe et al employed a task measuring selective attention and executive control in a two - part experiment . in the first experiment , higher cardiorespiratory fitness levels were associated with better performance on the task and this was paralleled by increases in fmri activity in the dorsolateral prefrontal and parietal brain regions . the second experiment was a randomized exercise intervention in which adults were assigned to either receive a structured exercise regimen for 6 months or to a stretching and toning control group for the same amount of time . the participants performed the same selective attention task as the participants in the first experiment . the results from the randomized trial were strikingly similar to the results from the crosssectional study . that is , after 6 months of the intervention , the exercise group showed increased activity in the dorsolateral prefrontal cortex and parietal cortex and decreased activity in areas that support conflict monitoring such as the anterior cingulate cortex . these results are important because they demonstrate that in addition to volumetric changes resulting from exercise there are also significant changes in task - evoked brain function . hence , the brain processes task demands more efficiently after only 6 months of exercise . although there are only several published studies using fmri paradigms , each of these studies has found increased fmri activity in prefrontal regions including during a semantic memory task , the digit symbol substitution task , and the stroop task as a function of either higher cardiorespiratory fitness levels or greater physical activity levels . yet , each of these studies also recognizes the complex nature of cognitive function and the necessity of understanding the networks of regions that support cognition and how physical activity exerts its effects on these networks . hence , it is important to identify not only which brain areas are associated with physical activity , but also to understand how the communication between regions is influenced by physical activity . could the functional connectedness of the network improve after several months of exercise and would these effects mediate improvements in memory and executive function ? regions of interest can be used as seeds to examine whether regions that are functionally connected with the seed region vary as a function of some variable of interest ( eg , cardiorespiratory fitness levels ) . using a seed - based approach to examine functional connectivity , voss et al found that older adults that had higher cardiorespiratory fitness levels had greater connectivity in the so - called default mode network . further , they found that increased connectivity mediated the fitness related enhancements of executive control . since the default mode network is reduced in older adults with mild cognitive impairment and dementia , increased functional connectivity indicates that physical activity might reduce the risk of impairment by elevating the cohesiveness of the default mode network . in fact , results from two randomized interventions indicate that the functional connectivity of these networks can be modified after several months of physical activity . the studies described above focus on three forms of brain health and integrity in late life : morphology , task - evoked functional dynamics , and connectivity . for each of these measures , cross - sectional , observational , and randomized interventions indicate that physical activity is capable of modifying age - related losses and that physical activity - induced changes in brain integrity and function mediate improvements in cognition . in summary , the human neuroimaging literature on physical activity indicates that the brain remains modifiable into late adulthood , the effects are distributed throughout the brain , but are most robust in the prefrontal and medial temporal lobe regions . the cochrane collaboration performed a systematic review of the effects of exercise on depression in adults of mixed ages . they identified 32 trials ( 1858 participants ) that fulfilled their inclusion criteria , of which 30 ( 1101 participants ) provided data for meta - analyses . based on these 30 trials , the authors concluded that exercise seems to improve depressive symptoms in individuals with depression when compared with no treatment or a control intervention . in comparison to no treatment , exercise had a moderate effect size ( standardized mean difference [ smd ] -0.67 , 95% confidence ( ci ) -0.90 to -0.43 ) . there were no significant differences when comparing the effects of exercise with cognitive therapy or antidepressant treatment . when the authors limited the analyses to the four high - quality trials ( 326 participants ) , the pooled smd was -0.31 ( 95% ci -0.63 to 0.01 ) indicating a small effect in favor of exercise . among the 32 trials identified that fulfilled the inclusion criteria , 8 studies were focused on or included adults older than 60 years six of the studies involved aerobic exercise and two studies progressive resistance training . of the 6 studies that involved aerobic exercise , various exercise and comparator interventions blumenthal and colleagues ( 1999 ) studied community volunteers with major depressive disorder ( mdd ) ( n=156 ) mean ( sd ) age of 57 ( 6.5 ) randomized to aerobic exercise ( group walking or jogging 3 times per week ) , antidepressant pharmacologic treatment ( sertraline ) , or the combination . they found that all treatment groups had statistically significant improvement in depression scores , although participants receiving medication alone had the fastest initial response . after 16 weeks of treatment , exercise was equally effective in reducing depression among older adults with mdd . a limitation to this study was the absence of a placebo or control intervention . in a follow - up study , blumenthal and colleagues examined community - dwelling older adults with mdd ( n=202 ) , mean ( sd ) age 52 ( 8) , randomly assigned to home - based exercise , supervised exercise in a group setting , sertraline , or placebo for 16 weeks . while there was a high placebo response rate , the efficacy of exercise was comparable to antidepressant pharmacotherapy , and both were better than placebo . brenes and colleagues studied 37 older adults with a mean ( sd ) age of 73.5 ( 7.8 ) with minor depression , randomized to exercise , antidepressant pharmacotherapy ( sertraline ) , or usual care over 16 weeks . in the 32 participants who completed the study , they found trends for exercise and sertraline to be superior to usual care in improving emotional and physical functioning . mather and colleagues examined whether exercise is effective as an adjunct to antidepressant pharmacotherapy in older adults . eighty - six older adults with depression ( mean age 65 ) were randomly assigned to attend exercise classes or health education talks for 10 weeks . at 10 weeks , a significantly higher proportion of the exercise group ( 55% versus 33% ) experienced a greater than 30% decline in depressive symptoms as measured with the hamilton rating scale for depression . mcneil and colleagues ( 1991 ) randomly assigned 30 community dwelling , moderately depressed older adults with a mean ( sd ) age of 72.5 ( 6.9 ) to 1 of 3 interventions : experimenter - accompanied exercise ( walking ) , social contact control condition , and a wait - list control . they found that exercise and social contact both resulted in reductions in the beck depression inventory . lastly , williams and tappen examined the effects of exercise training for depressed older adults with alzheimer 's disease . subjects were randomly assigned to 16 weeks of comprehensive exercise , supervised walking , or social conversation . they found that all three groups had a reduction in depressive symptoms , with exercise showing a slightly greater benefit . two studies found antidepressant effects of progressive resistance training in older adults with depression . singh and colleagues studied the effects of progressive resistance training ( prt ) on depressed adults 60 years and older with a mean ( sd ) age of 71.3 ( 1.2 ) . over 10 weeks compared with an attention - control group , prt was associated with an improvement in the measures of depressive symptoms , quality of life , social functioning , and strength . in a follow - up study , singh and colleagues found that higher - intensity prt was more effective than low - intensity prt on depression in older adults . these studies support the argument that exercise has antidepressant effects in older adults , yet the mechanism of action remains unclear . the studies are careful to note the potential for the antidepressant effects of expectation and attention in research participation as well as for socialization when engaging in group exercises . further , investigators have also suggested the effects of increased self - efficacy , a sense of mastery , positive thoughts , distraction from negative thoughts , and enhanced self - concept . however , biological mechanisms related to overall brain health are also likely related to the mood elevating properties of exercise . these mechanisms , described earlier , include enhanced gray matter volume in prefrontal cortex and hippocampal brain areas , elevated functioning of brain circuits involved in mood and emotional function such as subregions of the frontal cortex and medial temporal lobe , and improvements in functional connectivity of the default - mode network . in addition , it is also likely that exercise is having a pleiotropic effect on molecular systems related to the hypothalamic - pituitary - adrenocortical axis , dopaminergic , noradrenergic , serotonergic neurotransmission , immune function , and bdnf ( figure 1 ) . however , these biological mechanisms of exercise have not yet been carefully studied in older adults with depression . the role that changes in morphology and function could have on mitigating depressive symptoms remains speculative at this time . in this review we have briefly summarized the expansive and ever - growing literature on the effects of physical activity on brain health and plasticity . we can conclude from this overview that physical activity has consistent and robust effects on the brain , which mediate improvements in cognitive performance and reduce the risk for neuropsychiatric disorders . the beauty of this research is that the effects appear consistent across species and populations indicating an exceptional level of translation that is rare to find in other disciplines . the research in this area has demonstrated that the effects of physical activity on brain plasticity in late life has a remarkable degree of specificity , such that some brain areas appear to be more commonly or easily influenced by physical activity than other areas one explanation might be that the hippocampus , frontal cortex , and neighboring areas are more inherently plastic than other brain areas and that the degree of specificity is simply a characteristic of the brain regions examined rather than anything specific to the capabilities of physical activity per se . however , an alternative explanation is that these brain areas contain some molecular or cellular process that is influenced by participation in physical activity . for example , bdnf has been described as one possible molecular pathway by which exercise improves cognitive function , but bdnf levels are found in different concentrations throughout the brain with higher levels in the hippocampus and cerebellum than in other areas . a third possible explanation could be that the brain areas that show the most amount of atrophy with age , including the frontal cortex and hippocampus , are the most sensitive to the effects of physical activity . thus , the specificity of physical activity on the frontal cortex and hippocampus might be related to the atrophying nature of these areas . according to this reasoning , since these brain areas are shrinking with age , there is more room for them to grow with an intervention like physical activity . therefore , the specificity of physical activity has to do with relatively little variation in the size and function of other brain regions with advancing age . whatever the explanation for specificity , the effects appear to be both robust and consistent across samples and populations . this indicates that these effects are unlikely to be confounded by a particular sample characteristic ( eg , gender ) or comorbidity ( eg , depression ) and more likely reflects an adaptive biological importance of physical activity to enhance and maintain the body 's organs , including the brain . despite the well - established literature linking physical activity to brain health and plasticity in late life , first , although a number of studies described above have found effects with moderate intensity exercise for several months , the exact dose - response nature of the link between physical activity and mood , cognition , or brain health remains unknown . in other words , there is a very poor understanding of how much physical activity is necessary to observe effects . second , individuals stop exercising for a variety of different reasons including injuries , illness , and personal issues ( eg , mourning ) . because of this it is important to examine whether the effects of a physically active lifestyle are retained or lost after some period of inactivity . unfortunately we have a very poor understanding of the retention of the effects of physical activity . third , we have a very poor understanding of the types of exercises that might be most useful to promote a healthier brain . it is conceivable that competitive sports like tennis offer additional benefits beyond noncompetitive sports because of their dependence on physical coordination , cognitive effort , and social interaction . in sum , although we have a solid understanding of the potential for physical activity to enhance cognitive and brain health in late life there remain many unanswered questions for future research to pursue .

the human brain shrinks with advancing age , but recent research suggests that it is also capable of remarkable plasticity , even in late life . in this review we summarize the research linking greater amounts of physical activity to less cortical atrophy , better brain function , and enhanced cognitive function , and argue that physical activity takes advantage of the brain 's natural capacity for plasticity . further , although the effects of physical activity on the brain are relatively widespread , there is also some specificity , such that prefrontal and hippocampal areas appear to be more influenced than other areas of the brain . the specificity of these effects , we argue , provides a biological basis for understanding the capacity for physical activity to influence neurocognitive and neuropsychiatric disorders such as depression . we conclude that physical activity is a promising intervention that can influence the endogenous pharmacology of the brain to enhance cognitive and emotional function in late adulthood .

it is rare for an acute myocardial infarction ( ami ) to occur without angiographic evidence of atherosclerosis . possible mechanisms for such an event include coronary artery spasm , coronary embolism from an intracardiac or paradoxical ( venous ) source , thrombosis caused by hypercoagulable states , and inflammation in response to specific infectious agents.1 ) paclitaxel has been associated with acute myocardial infarction.2 ) we report a case of coronary artery thrombosis associated with paclitaxel in advanced ovarian malignancy . a 63-year - old woman was diagnosed with ovarian cancer and peritoneal carcinomatosis . a large left ovarian mass and omental cake with a large volume of ascites were noted on pelvic computed tomography ( ct ) , and through positron emission tomography ( pet ) , f - fluorodeoxyglucose ( f - fdg ) uptake was noted in the left ovarian mass and omental cake . the serum ca-125 level was markedly elevated ( 4,290 u / ml ; normal , < 35 u / ml ) . the patient had a history of hypertension , but no history of recent infectious disease , drug use , or smoking . first , paclitaxel was administered intravenously over 3 hours at 175 mg / m , and after 48 hours , the administration of carboplatin was planned . however , the day after we administered the paclitaxel , the patient complained of typical angina . an electrocardiogram ( ecg ) showed st segment elevation in the v2 - 5 leads ( fig . the cardiac troponin t and creatine kinase - mb ( ck - mb ) levels were elevated at 1.03 ng / ml ( normal , < 0.01 ng / ml ) and 80 u / l ( normal , < 24 u / l ) , respectively . an echocardiogram demonstrated mid - anterior , septal , and apical akinesia , consistent with infarction in the left anterior descending ( lad ) territory . emergency coronary angiography revealed a filling defect in the left main coronary artery and total occlusion in the distal left anterior descending coronary artery with no luminal irregularity or narrowing . after we guided the catheter into the left main ostium , an additional cine view revealed that the filling defect in the left main had disappeared and the distal portion of the obtuse marginal branch of the left circumflex artery was now totally occluded . intravascular ultrasonography ( ivus ) showed no significant plaque burden or atheromatous rupture from the proximal left anterior descending artery to the left main coronary ostium . we made an unsuccessful attempt with balloon angioplasty to restore coronary blood flow ( fig . a thrombophilia work - up revealed normal or negative values for antithrombin iii , protein c , protein s , lupus anticoagulant antibody , factor viii , anti - phospholipid igg , factor 5 leiden , homocysteine , c3 , and c4 . treatment with tirofiban , clopidogrel , and aspirin was planned , and a follow - up electrocardiogram was obtained ( fig . eighteen days after the index procedure , a follow - up echocardiogram and coronary angiogram were performed . the echocardiogram showed much improvement of the previous akinesia , except at the tip of the apex of the left ventricle . the coronary angiogram showed that the occlusion of the distal obtuse marginal branch and distal left anterior descending artery had cleared ( fig . the patient is being followed in our outpatient department and has had no further cardiac symptoms . an acute myocardial infarction ( ami ) without angiographic evidence of atherosclerosis is uncommon ; possible mechanisms include 1 ) coronary artery spasm , 2 ) coronary embolism from an intracardiac or paradoxical ( venous ) source , 3 ) thrombosis caused by certain hypercoagulable states , and 4 ) inflammation in response to specific infectious agents , such as chlamydia pneumoniae , cytomegalovirus , and helicobacter pylori.1 ) coronary thrombosis may follow blood disorders causing hypercoagulability , oral contraceptives or estrogen - replacement therapy , endothelial dysfunction , or cigarette smoking , as well as an excess of lipoprotein(a ) [ lp(a ) ] and type-1 plasminogen activator inhibitor ( pai-1).1 ) our patient had no history of recent infection , drug use , or smoking . furthermore , there was no specific finding in the thrombophilia work - up . in the setting of malignancy , there are a few reported cases involving myocardial infarctions caused by tumor emboli , direct malignant infiltration , and non - bacterial thrombotic endocarditis ( nbte).3 ) however , an extensive search of the literature found only one report of in situ coronary thrombosis associated with malignancy in the absence of other procoagulant conditions.3 ) according to a recent report , malignancy itself usually does not cause coronary artery thrombosis without other hypercoagulable states.1 ) however , paclitaxel use has been associated with acute myocardial infarction.2)5 ) in our case , the coronary angiogram and ivus showed a smooth wall without a significant stenotic lesion or plaque burden in the left main coronary artery . in the follow - up coronary angiogram , because the lesion in the culprit vessel disappeared , we presumed that the lesion was not a tumor embolus , but a thrombus . in addition , no intracardiac shunt was seen on the echocardiogram , and the regional wall motion abnormality of the left ventricle was consistent with the coronary territory . acute myocardial infarction can be caused by a coronary thrombus in association with a myocardial bridge and slow coronary flow.6 ) however , the coronary angiogram of our case did not show a myocardial bridge or slow coronary flow . except for the malignancy , the patient showed no evidence of thrombophilia based on the thrombophilia work - up , and as mentioned above , malignancy does not usually cause coronary artery thrombosis . therefore , in this case , we considered paclitaxel to be the probable cause of the myocardial infarction due to spontaneous formation of a thrombus in the left main coronary artery . it has been seen that paclitaxel can disturb cardiac rhythm and cause cardiac ischemia and myocardial infarction.2)4 ) myocardial infarction associated with paclitaxel therapy has been reported in some patients.2)5 ) in one of these patients , a 70% lesion with a fresh thrombus in the infarct - related artery was documented at autopsy.2 ) to date , the pathogenesis of myocardial infarction associated with paclitaxel is not known . however , this case raises the possibility that paclitaxel can induce coronary artery thrombosis and cause myocardial infarction . additionally , we recommend that clinicians take extra care in ruling out myocardial infarction if chest pain occurs during paclitaxel administration .

a 63-year - old woman was diagnosed with ovarian cancer and peritoneal carcinomatosis . the day after paclitaxel was administered , an acute myocardial infarction occurred . emergency coronary angiography revealed a filling defect in the left main coronary artery and total occlusion in the distal left anterior descending coronary artery , with no luminal irregularity or narrowing . intravascular ultrasonography showed no significant plaque in the left main coronary artery . a thrombophilia work - up was negative , and the patient was treated with tirofiban , clopidogrel , and aspirin . the follow - up coronary angiogram showed that the occlusion of the distal obtuse marginal branch and distal left anterior descending artery had cleared . paclitaxel has been associated with acute myocardial infarction . however , the pathogenesis of myocardial infarction associated with paclitaxel is not known . this case raises the possibility that paclitaxel can induce coronary artery thrombosis , resulting in myocardial infarction .

facioscapulohumeral muscular dystrophy ( fshd ) is a common inherited muscular dystrophy presented clinically with slowly progressive weakness and wasting of facial and limb muscles and rare bulbar muscle involvement . we present herein a known case of fshd presented with recent onset of severe bulbar symptoms and was found to have myasthenia gravis ( mg ) based on electrodiagnostic study , elevated level of acetylcholine receptor antibody and dramatic improvement with choline esterase inhibitor agents . clinical presentation , electrodiagnostic and pathologic findings of this patient are described . a 70-year - old man presented to our department with complaint of 15-day history of progressive difficulty in chewing and dysartheria . he had a 50-year history of slowly progressive asymmetrical weakness of proximal upper limb muscles . examinations revealed reduction in forces of bilateral orbicularis oculi muscles , weakness and wasting of bilateral triceps muscles especially on right side and bilateral winging of scapula more prominent on right side . the legs and pelvic girdle muscles had normal forces . edrophonium test was performed and dysartheria and chewing difficulty showed dramatic improvement but had no effect on limb weakness . muscle biopsy showed myopathic changes with invariability in muscle fiber size , intramuscular infiltration of chronic inflammatory cells , mostly lymphocytes , few hyaline fibers and prominent fat infiltration . our patient 's bulbar symptoms showed dramatic improvement following administration of choline - esterase inhibitor agents . a 70-year - old man presented to our department with complaint of 15-day history of progressive difficulty in chewing and dysartheria . he had a 50-year history of slowly progressive asymmetrical weakness of proximal upper limb muscles . examinations revealed reduction in forces of bilateral orbicularis oculi muscles , weakness and wasting of bilateral triceps muscles especially on right side and bilateral winging of scapula more prominent on right side . the legs and pelvic girdle muscles had normal forces . edrophonium test was performed and dysartheria and chewing difficulty showed dramatic improvement but had no effect on limb weakness . muscle biopsy showed myopathic changes with invariability in muscle fiber size , intramuscular infiltration of chronic inflammatory cells , mostly lymphocytes , few hyaline fibers and prominent fat infiltration . our patient 's bulbar symptoms showed dramatic improvement following administration of choline - esterase inhibitor agents . it presents clinically with slowly progressive weakness and wasting of facial and shoulder girdle muscles and sometimes involvement of lower extremities . the clinical severity is wide ranging from asymptomatic individuals to wheel - chair dependent patients . any unusual changes in course of disease or development of unusual symptoms should raise the possibility of concomitant disease . sansone et al . reported a 69-year - old known case of fshd who presented with sudden deterioration of limb weakness and development of bulbar symptoms and was found to have mg based on repetitive nerve stimulation , elevated level of acetylcholine receptor - binding antibody and dramatic improvement following immunomodulator administration . reported a 50-year - old man with a 35 year history of fshd who presented with acute progressive weakness of lower extremities three weeks prior to admission . the patient was found to have mg based on decrement response on repetitive nerve stimulation , elevated level of acetylcholine receptor - binding antibody and improvement after thymectomy and administration of corticosteroid . in another report , mcgonigal et al . presented a 56-year old newly diagnosed myasthenic patient who found to have 40-year history of progressive foot drop and although our case is a rare coexistence of fshd and mg , low prevalence of both diseases , may raise the possibility of the presence of other etiologies . theoretically , it is related to breaking of immune tolerance to achrs as a result of muscle fiber degeneration . patients with genetic myopathies may occasionally develop antibodies to achr . while these antibodies may not have pathogenic effects , their production is likely to be a consequence of sensitization to achr secondary to muscle fiber damage , rather than through an immune process in thymus . muscle histopathological examination in some cases of fshd shows inflammatory changes , disproportionate to muscle fiber necrosis but the presence of mononuclear infiltration does not affect disease progression and the patients do not benefit from prednisone treatment . to the best of our knowledge , there are limited reports of concomitant occurrence of mg and fshd in literatures . although the association of mg with fshd in our patient could be an incidental finding , it may raise the possibility of innate immune response , i.e. autoinflammation in development of achr antibodies in genetic myopathies or it may suggest immune mechanisms in pathogenesis of fshd . moreover , our experience may warrant concomitant neuromuscular disorder in patients with unusual symptoms of fshd .

facioscapulohumeral muscular dystrophy ( fshd ) is a common inherited muscular dystrophy presented clinically with slowly progressive weakness and wasting of facial and limb muscles and rare bulbar muscle involvement . we present herein a 70-year - old man who was a known case of fshd with complaint of 15-day history of progressive difficulty in chewing and dysarthria and was found to have myasthenia gravis . related literatures have been also reviewed .

population ageing is a global phenomenon . in the mid-21st century , the number of older persons was 202 million which consisted of 8% in the whole population , but it reached about 841 million which is 4 times higher than that in 1950 . fukuoka et al . ( 2016 ) predicted that the number of the older persons will triple by 2,050 to attain 2 billion , reaching 21% of world population . south korea is one of the great examples of the phenomenon . this country has shown the fastest growing rate of the ageing population in the world . for instance , while other advanced countries such as france , the united states , and japan have taken 115 yr , 73 yr and 24 yr , respectively , korea has taken 18 yr to enter the aged society ( ahn et al . , 2014 ) . in addition , the proportion of population who are over 65 yr in korea will be reached to be nearly 37% by 2050 ( choi et al . , 2016 ) . the dramatic increase of the numbers of older persons in the population of korea has brought about a variety of social issues such as physical and mental health , social relationship , and financial problem . of those issues , most elderly people face various and serious health problems which can hugely affect their lives ( spar and la rue , 2002 ) . indeed , health problems in the elderly can cause enormous economic damage at the level of the government and can lead to the huge losses of their autonomy and independence at the level of the individual . therefore , health is the most important issue not only for the elderly , but for the government . campos ( 2011 ) argues that it is difficult to define or discuss health without mention of wellness because the two terms are closely interwoven . in the words , the definition of health includes wellness which implies a sense of welling in all aspects of life . ( 2006 ) define wellness as : a lifelong process that at any given time produces a positive state of personal well - being , of feeling good about yourself ; of optimal physical , psychological , and social functioning ; and the control and minimization of both internal and external risk factors for both diseases and negative health conditions . it suggests that what you believe , feel and do have an influence on your health . in the same vein , hoeger and hoeger ( 2007 ) assert that wellness implies a constant and deliberate effort to stay healthy and achieve the highest potential for well - being . based on both definitions , kim ( 2000 ) classifies wellness into five dimensions : ( a ) physical wellness can be defined as the ability to carry out daily tasks through physical activity and proper nutrition ; ( b ) social wellness can be the ability to build healthy , nurturing and supportive relationships and to foster a strong connection with others ; ( c ) spiritual wellness can be characterized as a guiding sense of meaning or value in life ; ( d ) intellectual wellness can be the ability to learn knowledge and skills and apply them to daily tasks ; and ( e ) emotional wellness can be defined as the ability to handle emotions and express them appropriately and comfortably . the improvement of wellness for the elderly may play an important role in increasing overall quality of life ( liao and brunner , 2016 ) . for the elderly , however , aging may lead to gradual loss of physical , mental , social and intellectual functions and in turn sport and physical activity has been recognized as an important agent in improving wellness in the elderly ( kim and lee , 2011 ; stephenson et al . , 2007 ) . considering the positive effects of physical activities in wellness for the elderly , in this study researcher introduces a new form of exercise known as pilates developed by joseph pilates in the early 20th century that contributes to improving the balance , muscle strength and coordination . pilates emphasizes the mind - body connection and it is also getting popular in korea . moreover , it is not necessary to have the open space to practice it ( mokhtari et al . the exercise can be performed on a mat or with equipments such as the reformer , cadillac , and chair ( roh , 2015 ) . to date , previous research has focused on its positive role for youth and adults ( cromwell et al . , 2007 ; johnson et al . , 2007 ) . however , there has been little research on how a pilates exercise affects on the elderly s wellness . therefore , the purpose of this study is to examine the effect of a 12-week pilates intervention on wellness of the elderly . the participants of this research were sampled from the elderly ( aging over 65 yr old ) who participated in continuing education centers located in incheon metropolitan city . researcher explained the purpose of the study and 93 elderly agreed to participate in pilates exercise in the beginning of this study , but 5 participants dropped out due to personal reasons such as health issue ( 4 ) and the lack of time ( 1 ) . as a result , a total of 88 participants ( 63 females : 68.574.43 yr , 26 males : 68.84.69 yr ) completed a 12-week pilates intervention for this research . all participants received a pilates exercise training , 3 sessions of 50 min per week for a duration of 12 weeks . pilates exercises which were used in this study were based on the programs that were used in previous studies ( kaesler et al . the exercises were performed into two parts . for the first six weeks , pilates on the mats was performed and the second part was performed with bands for the rest six weeks . this questionnaire was composed of 23 items ; 4 items in background information and 19 items in wellness . before and after performing the exercises , all participants completed a questionnaire to measure the efficiency of pilates exercises on wellness . wellness scale was developed by kim ( 2000 ) with 19 questions consisted of five subvariables such as physical ( 5 items ) , social ( 4 items ) , spiritual ( 3 items ) , intellectual ( 3 items ) , and emotional wellness ( 4 items ) . the responses to all items were made by the likert scale with 1 point in not at all and 5 point in strongly agree . to test the validity of the questionnaire , a meeting of a panel of experts was held with 3 professors in a realm of socio - psychology . a principle component analysis was conducted to minimize the number of factors and varimax rotation was used as a rotation method . the reliability coefficient ranged from 0.708 to 0.847 which was judged to be very reliable . 20.0 ( ibm co. , armonk , ny , usa ) was used to analyze all data collected in this study . first , an exploratory factor analysis and a reliability analysis were conducted to verify the validity and reliability of the questionnaire . second , the paired t - test was conducted to verify the difference between pre- and posttest . the significance level of ( ) the participants of this research were sampled from the elderly ( aging over 65 yr old ) who participated in continuing education centers located in incheon metropolitan city . researcher explained the purpose of the study and 93 elderly agreed to participate in pilates exercise in the beginning of this study , but 5 participants dropped out due to personal reasons such as health issue ( 4 ) and the lack of time ( 1 ) . as a result , a total of 88 participants ( 63 females : 68.574.43 yr , 26 males : 68.84.69 yr ) completed a 12-week pilates intervention for this research . all participants received a pilates exercise training , 3 sessions of 50 min per week for a duration of 12 weeks . pilates exercises which were used in this study were based on the programs that were used in previous studies ( kaesler et al . for the first six weeks , pilates on the mats was performed and the second part was performed with bands for the rest six weeks . this questionnaire was composed of 23 items ; 4 items in background information and 19 items in wellness . before and after performing the exercises , all participants completed a questionnaire to measure the efficiency of pilates exercises on wellness . wellness scale was developed by kim ( 2000 ) with 19 questions consisted of five subvariables such as physical ( 5 items ) , social ( 4 items ) , spiritual ( 3 items ) , intellectual ( 3 items ) , and emotional wellness ( 4 items ) . the responses to all items were made by the likert scale with 1 point in not at all and 5 point in strongly agree . to test the validity of the questionnaire , a meeting of a panel of experts was held with 3 professors in a realm of socio - psychology . a principle component analysis was conducted to minimize the number of factors and varimax rotation was used as a rotation method . a reliability coefficient which represents internal consistency the reliability coefficient ranged from 0.708 to 0.847 which was judged to be very reliable . 20.0 ( ibm co. , armonk , ny , usa ) was used to analyze all data collected in this study . first , an exploratory factor analysis and a reliability analysis were conducted to verify the validity and reliability of the questionnaire . second , the paired t - test was conducted to verify the difference between pre- and posttest . the significance level of ( ) the collected data went through descriptive statistics such as mean and standard deviation and paired t - test was used to determine whether the mean difference between pre- and posttest . there were statistically significant differences in physical ( t=2.762 , p<0.01 ) , social ( t=3.362 , p<0.001 ) , spiritual ( t=2.307 , p<0.05 ) and emotional wellness ( t=2.489 , p<0.05 ) for the elderly between pre- and post - pilates intervention . this research examined the effect of a 12-week pilates exercise on wellness in elderly women . findings of the study revealed that pilates exercises might be a useful tool for helping older persons to improve various dimensions of wellness . in other words , pilates exercisesprogram for 12 weeks significantly improved elderly s wellness such as physical , social , spiritual and emotional wellness . after reviewing the literature , it was found that the pilates exercise contributes to improving physical wellness in the elderly ( hall et al . , 1999 ; ( 2015 ) , which studied on the effects of pilates exercise training on physical fitness and welling in the elderly , argue that pilates exercise can be considered a proper physical activity for the elderly . consequently , this exercise increases physical fitness and in turn it improves overall quality of life . previous studies also have shown that pilates exercise reinforces emotional wellness in older persons ( siqueira rodrigues et al . , 2010 ) . 2015 ) investigated the effect of 12-week pilates exercises of older adults who completed for duration of 12 weeks . the results revealed that pilates exercises improve aspects of the health - related quality of life of older adults . in addition , kim and lee ( 2011 ) investigated the effect of leisure sports on wellness in the elderly . older persons who spent more time in active exercises build a better relationship with others and have interpersonal relation skills . the more they participated in physical activities , the more they are socially healthy . in this study , therefore , pilates exercises may play an important role in improving overall wellness in the elderly and in turn it may affects older persons overall health and wellbeing . this research focuses primarily on the effect of a 12-week pilates intervention on wellness in the elderly . in other words , therefore , future research should be designed with a control group such as other exercise group or nonexercise group .

the purpose of this study is to examine the efficiency of 12-week pilates exercises on wellness in the elderly . before pilates exercises training , the 88 elderly ( 63 females , 25 males ) were given and completed a wellness scale . then , the elderly participated in pilates exercises and completed the same scale afterwards . results of paired t - test showed that participants in 12-week pilates exercises experienced significant improvement in physical ( t=2.762 , p<0.01 ) , social ( t=3.362 , p<0.001 ) , spiritual ( t=2.307 , p<0.05 ) , and emotional wellness ( t=2.489 , p<0.05 ) . consequently , pilates exercises helped improve wellness of the elderly .

angiomyxomas are benign , locally infiltrative mesenchymal neoplasms with a predilection for the female pelvis and perineum in their reproductive age group . these tumours often reach too large dimensions before becoming clinically symptomatic and they usually tend to recur after excision . accurate preoperative diagnosis should alert the surgeon to the need for wide excision , which is essential for prevention of local recurrence . this is easily done with robotic assistance due to its advantages like three dimentional vision and advanced degree of freedom within the pelvic cavity . we report here a similar case presenting as a retrovesical tumor in a male patient , which was excised with robotic assistance . a 62-years - old male presented to us with mild obstructive lower urinary tract symptoms ( luts ) since last 1 year , with a history of acute retention of urine 3 month back with failed catheter free trial . he underwent holmium laser enucleation of prostate ( holep ) elsewhere with histopathology reporting as benign prostatic hyperplasia . patient failed to void after catheter removal and on further evaluation he was found to have pelvic mass . digital rectal examination revealed a cystic mass simulating benign prostatic hyperplasia ( grade 3 ) . magnetic resonance imaging ( mri ) pelvis revealed a well - marginated lesion within the prostate gland resulting into significant prostatomegaly with no extra prostatic extension [ figure 1 ] . transrectal biopsy was done , which was inconclusive with no identifiable prostatic tissue . in view of discrepancy between mri report and biopsy report we performed cystoscopy which showed a hump in the prostatic urethra extending into the trigone , with prostatic lobes not visible ( because of previous holep ) . tumor was ~6 cm 4 cm 2.5 cm in size [ figure 2 ] . we were not able to separate the mass from bladder due to difficulty in entering into proper plane . hence we opened bladder deliberately and resected from within the bladder , closed cystostomy and drained bladder . histo - pathological examination [ figure 3 ] revealed moderately cellular tumor composed of sheets of spindle to stellate shaped cells with vascular channels in between . on immunohistochemistry cells were positive for desmin , focal positivity with smooth muscle antibody ( sma ) , s100 and ki-67 . magnetic resonance imaging showing a well - marginated lesion within the prostate gland resulting into significant prostatomegaly , with no extra prostatic extension . also gross specimen of the tumor with gelatinous appearance and size of ~6 cm 4 cm 2.5 cm . histopathology revealed moderately cellular tumor composed of sheets of spindle to stellate shaped cells with vascular channels in between . on immunohistochemistry cells were positive for desmin , focal positivity with smooth muscle antibody , s100 and ki-67 . aggressive angiomyxoma was first described in 1983 by steeper and rosai , and fewer than 150 cases have been reported in the world medical literature . the recurrence rate is high , and often extensive resections are performed with considerable morbidity . in men , the tumour involves analogous sites including the scrotum and inguinal area and usually appears at an older age . there might be a relation with hormonal status that might explain a female to male ratio of slightly more than 6:1 . these lesions are characterized as soft , non - encapsulated tumours with finger - like projections infiltrating the surrounding soft - tissues . the tumour grows slowly and is benign as suggested by the histology and by the fact that it shows no tendency to metastasize . the low attenuation at unenhanced computed tomography ( ct ) and high signal intensity at t2-weighted mri are consistent with a myxoid matrix , high water content within the mass , or both . the enhancement of t1-weighted mri after administration of gadolinium is related to the vascularity of aggressive angiomyxoma . there is no evidence of gross fat within the mass , which distinguishes this tumor from other fat - containing tumors that also occur in the pelvis of women . surgery is usually the first line of treatment ( open , laparoscopic or robotic assisted ) , radical surgery with wide margins and long - term follow - up is advised . hormonal suppression seems to be a plausible treatment option because these tumours occur predominantly in premenopausal women of reproductive age , may grow rapidly during pregnancy and have been shown to express immunohistochemical positivity for oestrogen and progesterone receptors . their surgery is challenging because of the infiltration and the difficult dissection . in the past , most authors advocated wide excision along with genito - urinary and digestive tract resections if necessary . most recently robotic assisted laparoscopic excision has been promising , as seen in our case . male angiomyxoma , athough a rare benign tumour , should be considered in the diferential diagnosis of pelvic mass in a male patient presenting with severe obstructive luts , and robotic assisted excision should be utilised wherever available .

angiomyxoma is a rare tumour found predominantly in pelvis of young females . less than 150 cases have been reported , more than 90% in females and only few cases in males . its surgical excision is a big challenge and usually leads to recurrence due to incomplete excision . we report a case of retrovesical angiomyxoma in an elderly male . the aim of this report is to highlight the rarity of this disease , especially in males , and robotic assisted excision as an evolving option of treatment .

despite better knowledge of the neurobiology of pain , progress of pharmacology and techniques of pain treatment , consensus and guidance of experts , inadequate control and underestimation of pain more often is the rule rather than the exception ( 1 ) . approximately 30 - 40% of patients with cancer have pain at the time of setting the diagnosis . in the advanced stage of the disease 75 - 90% of patients suffer pain , despite data from the institution of palliative medicine around the world that 95% of cancer pain can be effectively controlled ( 2 ) . in 40 - 50% of cases the pain was rated as medium - severe to severe , whereby in 70% of cases occurring in the form of nociceptive cancer pain wherein the cancerous cells released endothelin , prostaglandins and tumor necrosis factor alpha ( tnf ) , proteolytic enzymes and other algogene substances . compression and nerve injury or cancer pain due to infiltration of bone nerve are the cause of the neuropathic cancer pain ( 3 ) . mild ( weak ) opioid analgesics are intended for the treatment of moderate pain and are used in case of treatment failure with non - opioid analgesics or if the initial pain intensity was 4 to 6 by the ias , either alone or in combination with non - opioid , with or without other analgesics . tramadol is mild opioid analgesic with effects on the central nervous system , acting as a non - selective pure agonist of , and opioid receptors with higher affinity for the receptor . by inhibiting the reuptake of norepinephrine and is used in the treatment of moderately severe pain , and can suppress the cough , while in wide range of analgesic doses not suppress respiration . depending on the method of application to date has been proven the involvement of paracetamol in five different analgesic mechanisms : ( a ) inhibition of isoenzymes of cyclooxygenase ( cox ) in the cns without interaction with the binding sites ; ( b ) activation of serotonin bulbospinal time periods ; ( c ) activation of nitric oxide ( no ) activation path ; ( d ) activation or modulation of endogenous opioid periods , and ( e ) increase the tone of the endogenous cannabinoid ( 5 ) . metabolism of paracetamol releases n - acetyl - p - benzoquinone imine ( napqi ) , which if it is not detoxified , binds to hepatocytes leading to cell necrosis . this binding is cause poisoning and liver weakness in case of paracetamol overdose ( 6 ) . also proven is link between hypertension and paracetamol ( 7 , 8) , which is probably caused by an significant amount of sodium which each paracetamol tablet contain . due to the frequent occurrence of mixed nociceptive - neuropathic pain , one analgesic may not be efficient enough to cover all of the causal mechanisms of pain . combined analgesics may be more effective because they can offer a wider range of relieving pain , activation of analgesic process and reduce the negative effects ( 9 ) . the effect of analgesics combination may be higher , lower or the same as the intended total extent of the impact . this effect can be calculated mathematically , based on the concept of equal dose , which is defined as the dose of each drug that contributes to the total extent of the effect when each is used separately . the combined use of tramadol and paracetamol in one product , taking into account the pharmacokinetic and pharmacodynamic criteria can improve the benefit : risk ratio , increase efficiency by synergistic mechanisms , improve the tolerability of the drug ( lower individual dose ) and patient compliance ( 11 ) . combining tramadol and paracetamol is achieved a synergistic analgesia by three different mechanisms of action : binding of the -opioid receptors ; activation of the descending pain control pathways ; inhibition of cox-3 . the combination ensures rapid onset of action , longer efficacy , better efficiency then individual components and a good safety profile . it can be administered alone or can be added to nsaids in patients with inadequate analgesia care must be taken that tramadol may increase the risk of convulsive spasms due to a decrease of convulsive threshold and lead to serotonin syndrome in combination with other selective serotonin reuptake inhibitors ( antidepressants ) ( 12 ) . paracetamol as the second component of the fixed combination in therapeutic doses has just few side effects , while the maximum recommended dose for adults ( 4 grams per day ) is associated with cases of hepatotocicity ( 13 , 14 ) . palliative stage of the disease involves interruption of targeted oncology treatments and the limited lifespan of the patient with the dominant aim of improving the quality of life , regardless of the duration of life ( 15 ) . pain of medium severe intensity is dominant symptom in patients with advanced stages of cancer . progression of the disease in these patients requires frequent evaluation of symptoms of pain and adjustment of therapeutic doses of weak opioids or switch to strong opioid analgesics . the goal of the research was to determine the efficacy of a fixed combination tramadol and acetaminophen in the treatment of pain in patients with the advanced stage of cancer . a prospective study was conducted at the center for palliative care , university clinical center tuzla , bosnia and herzegovina , from january 1 to december 31 2013 . study entered 369 patients who were due to pain intensity 4 - 8 ( medium severe to severe pain ) on the numeric rating scale ( nrs ) , treated with a fixed combination of tramadol and acetaminophen ( 37.5 mg and 325 mg ) in the initial dose 3x1 tablets for pain intensity 4 , up to 4x2 tablets for pain intensity 7 and 8 . every day ( 10 days ) pain intensity was recorded and if the previous day was patient had two or more episodes of pain , the dose of fixed combination tramadol and paracetamol was increased to a maximum of 8 tablets daily . during the first 10 days of study 16 patients patients excluded from the study during the first ten days of treatment . * of the total respondents , 369 patients the study ended 353 patients , with mean age of 65.3412.15 years ( 24 - 92 years ) , 211 ( 59.77% ) males and 142 ( 40.23% ) females . from the baseline 102 patients ( 28.89% ) had verified metastatic changes in bones while 251 patients ( 71.11% ) had no bone metastases ( p<0.0001 ) . in the study was 33.43% of patients with tumors of the gastrointestinal system , 25.22% with lung tumor , while the tumors of other organs account for less than 10% , with varying percentages of bone metastases ( table 2 ) . tumor localization . * from total of 353 patients ; * * from total of 102 patients ; o * * * = other tumors of bones and connective tissue , unknown localization , non cancer pain ; & esophagus , stomach , intestines ; liver , gallbladder , pancreas from total sample 158 ( 44.76% ) patients were in the palliative stage of cancer disease in period less than 12 months , and 195 or 55.24% of the patients in the period after 12 months ( p=0.067 ) ( table 3 ) . time from ph * diagnosis until psd * * from total of 353 patients ; * ph = histopathological diagnosis ; psd * * = palliative stage of the disease in 13 ( 3.68% ) of patients palliative stage of the disease is verified in less than three months , with 126 ( 35.69% ) in the period up to 36 months , while in 48 ( 13:59% ) patients specific oncological treatment lasted up to 72 months and in 21 ( 5.96% ) cases for more than six years . all patients were previously informed about the aims and nature of research , and they provided their approval with written informed consent to participate in the study . statistical analysis was performed by biomedical software medcalc for windows version 9.4.2.0 . for testing the repeated measurements of dependent samples , depending on the distribution of variables the statistical hypotheses were tested at the level of significance of =0.05 or the difference between samples was considered significant if p<0.05 . a ) the duration of treatment with a fixed combination tramadol and acetaminophen the average duration of treatment with a fixed combination tramadol and paracetamol for all 353 patients was 57 days ( from the shortest treatment duration of 13 to the longest of 330 days ) . most common duration of treatment was between 31 - 100 days ( in 225 patients or 63.74% ) , while 2 patients ( 0.57% ) had treatment duration was longer than 300 days ( table 4 ) . duration of treatment with a fixed combination tramadol and acetaminophen . * total 353 patients ; * * transfer to morphine ; * * * fixed combination used until death in patients with bone metastases , the average duration of treatment with a fixed combination tramadol and acetaminophen was 69 days ( 14 - 330 ) , and in patients without bone metastases , the median duration of treatment was 52 days ( 13 - 278 ) , which is significantly lower than compared to patients with bone metastases ( p=0.0047 ) . in our study , disease progression and higher pain intensity was sign for transfer to strong opiates in 57 ( 16.15% ) patients , while until the end of life the pain was adequately treated with a fixed combination tramadol and acetaminophen in 51 patients ( 14.45% ) ( table 4 ) . b ) analysis of the pain intensity by days of treatment for all patients the average pain score in all patients for 10 days of treatment was 2.121:34 where there was a statistically significant difference ( p=0.0001 ) compared to the total intensity of pain in patients with metastatic changes in bones ( 2.261.47 ) compared to patients without bone metastasis ( 2.061.27 ) . on the first day of treatment the average intensity of pain in all patients was 5.541.18 , significantly more ( p<0.0001 ) compared to the pain intensity on the tenth day of treatment 1.50.53 ( table 5 ) . average pain intensity by days of treatment among all patients . measured outside of pain breakthrough ; * median , wilcoxon test ; * * paired samples t - test comparing the average values of pain intensity by days of treatment of patients with and without bone metastases , on the day of admission the pain intensity was significantly higher ( p<0.0001 ) in patients with bone metastases [ median 6.00 ( 4.00 to 8.00 ) ] versus patients without bone metastases [ median 5.00 ( 4.00 to 8.00 ) ] ( table 6 ) . comparison of average pain intensity of patients with and without bone metastases . presented as median ; * mann - whitney test ( independent samples ) significantly greater pain intensity was also observed in patients with bone metastases on fifth , sixth and eighth days of treatment with a fixed combination of tramadol and paracetamol compared to patients without bone metastases ( figure 1 ) . mean pain intensity by days of treatment of patients with and without bone metastases analysis of the optimal dose of fixed combination tramadol and paracetamol as the base of analgesics in the treatment of moderate pain the average dose of the fixed combination tramadol and paracetamol ( 1 tablet = 37.5 mg and 325 mg ) for all 353 patients for 10 days of treatment was 4.81.8 tablets ( 180 mg of tramadol and 1560 mg of paracetamol ) . the average dose of fixed combination tramadol and paracetamol ( for both groups of patients ) was higher with each subsequent day of treatment of 4.171 - 53 tablets ( 156.4 mg tramadol and 1355.3 mg paracetamol ) on first to 5.62 1.95 tablets ( 210.8 mg tramadol and 1826.5 mg paracetamol ) on the tenth day of treatment ( table 7 ) . mean number of tablets for fixed combination tramadol and acetaminophen * by days of treatment . * 1 tablet of fixed combination = tramadol 37.5 mg and paracetamol 325 mg in all patients with confirmed bone metastasis mean dose of fixed combination tramadol and acetaminophen was statistically significantly higher ( p<0.0001 ) compared to patients without bone metastasis [ 5.421.83 ( 203.25 mg tramadol and paracetamol 1761.5 mg ) in patients with metastases versus 4.59 1.79 ( 172.13 mg of tramadol and paracetamol 1491.8 mg ) in patients without bone metastases ] ( table 8) . comparison of mean dose of fixed combination tramadol and paracetamol by days of treatment in the groups with and without bone metastases . * mann - whitney test ( independent samples ) on the tenth day of treatment in the group of patients without bone metastases average dose of tramadol in fixed combination tramadol and paracetamol was 200.25 mg of tramadol , while on the same day in a group of patients with bone metastases average dose of tramadol was significantly higher ( p<0.0001 ) and amounted to 236.3 mg of tramadol ( figure 2 ) . the average dose of tramadol in a fixed combination tramadol and paracetamol by groups and days of treatment in the group of patients without bone metastases , on the tenth day of treatment , the average dose of paracetamol in a fixed combination tramadol and paracetamol was 1735.5 mg of paracetamol , while on the same day in a group of patients with bone metastases average dose of paracetamol were statistically significantly higher ( p<0.0001 ) and amounted to 2047.5 mg of paracetamol ( figure 3 ) . the average dose of paracetamol in a fixed combination tramadol and paracetamol by groups and days of treatment from a total of 353 patients surveyed , during the first 10 days of treatment , side effects of mild to moderately high intensity ( corrected with additional targeted therapy and did not jeopardize the continuation of treatment with a fixed combination tramadol and paracetamol ) occurred in 103 patients ( 29.18% ) ( table 9 ) . the frequency of side effects in the treatment of pain with a fixed combination of tramadol and paracetamol . * from 103 patients with side effects ; * * from total of 353 patients nausea that was present in 39.8% and vomiting with 34.9% were the dominant side effects in the treatment of pain with a fixed combination tramadol and acetaminophen , while the dizziness was observed in 8 ( 7.77% ) and somnolence in 2 ( 1.94% ) patients ( table 9 ) . a study published in 2011 on the efficacy and safety of a fixed combination tramadol and acetaminophen in the treatment of medium to severe pain ( 16 ) states a significant analgesic efficacy of this combination with a reduction in average pain intensity from an initial 6.1 to 3.1 , with 64.8% of patients described significant pain relief . data from the same study indicate that 90.5% of patients have a high degree of satisfaction with treatment and 78.7% of patients assessed the general situation as much better . of the surveyed 2663 patients with an average age of 73.66.6 years , 119 ( 4.5% ) reported at least one side effect in form of as known and foreseeable ones . similar results were also confirmed by our research , while in our research at the start of the study ( the first day of treatment ) average pain intensity in all patients was 5.541.18 which was significantly higher ( p<0.0001 ) compared to the pain intensity on the tenth day of treatment 1.500:53 . already after 24 hours of treatment by a fixed dose of tramadol and acetaminophen , the average pain intensity of all patients was significantly lower p<0.0001 [ 5.00 ( 4.00 to 8.00 ) on the first day compared to the average pain intensity 2.00 ( 1.00 to 7.00 ) on the second day of treatment ] which indicates the rapid onset of the drug action . review paper , published in 2008 ( 17 ) , the efficiency of a fixed combination tramadol and acetaminophen in the treatment of mild to moderate pain included 15 studies . nine studies ( double - blind trials with a treatment duration of 1 - 10 days ) includes a total of 2537 patients with chronic degenerative diseases ( with the emergence of pain ) after trauma or postoperatively , showed that the most common average dose of fixed combination tramadol and paracetamol ( 37.5 mg and 325 mg ) was from 4.34.5 tablets . in six studies in which the duration of treatment was 4 - 13 weeks for the bone muscle pain , it was followed 1890 patients , and the mean daily dose of fixed combination tramadol and acetaminophen ( 37.5 mg and 325 mg ) was 3.54.2 tablets daily . in our study an average dose of fixed combination tramadol and paracetamol for all 353 patients during 10 days of treatment was 4.8 1.8 tablets ( 180 mg of tramadol and paracetamol 1560 mg ) . the average dose of fixed combination tramadol and paracetamol was higher with each subsequent day of treatment with 4.171.53 tablets ( 156.4 mg of tramadol and 1355.3 mg of paracetamol ) on the first to 5.6 1.95 tablets ( 210.8 mg of tramadol and paracetamol 1826.5 ) on the tenth day of treatment . in a study by ajay et al . ( 18 ) a total of 204 patients with moderate to severe pain of muscle marrow origin was treated with a combination of phentermine ( 50 mg ) and diclofenac sodium ( 75 mg ) ( group a ) and a fixed combination of tramadol and acetaminophen ( 37.5 and 325 mg ) ( group b ) . the intensity of pain with the use of a fixed combination tramadol and paracetamol after 5 days of treatment ( measured by vas scale ) is reduced from an average of 74 on the first day to 36.72 on the fifth day of treatment . however a combination of phentermine ( 50 mg ) and diclofenac sodium ( 75 mg ) showed better efficacy in the treatment of pain , wherein the average intensity of pain on the first day was 70.74 and 20.74 of the fifth , which is statistically better ( p = 0.0001 ) compared to treatment than with fixed combination of tramadol and paracetamol . similar results on the efficacy of a fixed combination tramadol and paracetamol in the treatment of pain in a group of patients with bone metastases ( muscle bone pain ) shows our research . in our study , the average pain intensity in patients with bone metastases ( muscle bone pain ) on the first day of treatment was 6.07841.1831 , on the fifth day significantly lower 1.94120.6265 ( p<0.001 ) and on the tenth day of treatment 1.58820.5691 ( p<0.001 ) which supports the analgesic efficacy of a fixed combination tramadol and paracetamol . this claim is confirmed by a study carried out on 336 patients with chronic back pain ( 19 ) where the initial pain intensity was 67.8 ; immediately after the start of treatment was reduced to 47.4 and after 3 months of treatment at even 1.8 . in this study followed side effects of which the most common were nausea ( 12.0% ) , dizziness ( 10.8% ) and constipation ( 10.2% ) . the average daily dose of tramadol and paracetamol was 4.2 tablets ( 158 mg of tramadol and 1369 mg of paracetamol ) . our findings show that the side effects , during the treatment of pain with a fixed combination tramadol and paracetamol were registered in 103 patients or 29.18% , with the dominance of nausea and vomiting . ( 20 ) reported frequency of side effects in 35.88% of patients in the treatment of pain with a fixed combination of tramadol and acetaminophen , wherein the dominant was vomiting ( 27.35% ) and nausea ( 25.88% ) , but much less common headache ( 5.88% ) , dizziness ( 3.82% ) and somnolence ( 1.47% ) . ( 21 ) vomiting occurred in 28.8% , nausea in 25.8% , dizziness in 15.9% and somnolence in 9.1% of patients with pain treated with fixed combination tramadol and paracetamol . limitations of the research there are a small number of studies in which was compared the use of fixed - dose drug treatment of the moderate to severe cancer pain , and lot more research on the treatment of some forms of non - carcinoma pain , especially skeletal and muscle . this study did not presented , nor the frequency nor the ways of cropping breakthrough of pain in our patients . duration of life and other disorders that accompany the advanced carcinoma limit the accuracy of research . fixed combination of tramadol and acetaminophen can be used as an effective combination in the treatment of chronic cancer pain , with frequent dose evaluation and mild side effects .

goal : the goal of the research was to determine the efficacy of a fixed combination of tramadol and paracetamol ( acetaminophen ) in the treatment of pain of patients with the advanced stage of cancer.material and methods : a prospective study was conducted at the center for palliative care , university clinical center tuzla , bosnia and herzegovina , from january 1st to december 31st 2013 . a total of 353 patients who were treated with a fixed combination of tramadol and acetaminophen ( 37.5 mg and 325 mg ) at the initial dosage 3x1 tablet ( 112.5 mg tramadol and 975 mg acetaminophen ) for pain intensity 4 , up to 4x2 tablets ( 300 mg of tramadol and 2600 mg paracetamol ) for pain intensity 7 and 8 . if the patient during previous day has two or more pain episodes that required a rescue dose of tramadol , increased was the dose of fixed combination tramadol and acetaminophen to a maximum of 8 tablets daily ( 300 mg of tramadol and 2600 mg paracetamol ) . statistical analysis was performed by biomedical software medcalc for windows version 9.4.2.0 . the difference was considered significant for p<0.05.results : the average duration of treatment with a fixed combination tramadol and acetaminophen was 57 days ( 13 - 330 days ) . already after 24 hours of treatment the average pain score was significantly lower ( p<0.0001 ) compared to the admission day [ 5.00 ( 4:00 to 8:00 ) during the first days versus 2.00 ( 1:00 to 7:00 ) during the second day of treatment ] . the average dose of the fixed combination tramadol and acetaminophen tablets was 4.8 1.8 ( 180 mg of tramadol and 1560 mg paracetamol ) . side effects , in the treatment of pain with a fixed combination tramadol and acetaminophen , were found in 29.18% of patients , with a predominance of nausea and vomiting.conclusion:fixed combination of tramadol and acetaminophen can be used as an effective combination in the treatment of chronic cancer pain , with frequent dose evaluation and mild side effects .

recently , serratia , pseudomonas / providencia , indole - positive proteus / acinetobacter / morganella , citrobacter , enterobacter and hafnia group of organisms ( spice ) were described to cause peritoneal dialysis ( pd)-related peritonitis with a particularly high morbidity and mortality . peritonitis caused by citrobacter is relatively uncommon and citrobacter freundii is the most common species involved . we report a case of pd - related peritonitis caused by c. freundii , which was successfully treated with double antibiotic coverage . a 76-year - old male with end stage renal disease due to type ii diabetes mellitus on pd for 6 months presented to the emergency room with abdominal pain and bloody peritoneal dialysate for 1 day . he was on regular maintenance automated pd using a cycler and reported no history of breakdown of aseptic technique or contamination during the catheter care . upon examination , he was hypotensive with a blood pressure of 98/54 mm hg but afebrile and the catheter exit site was benign . a dialysate cell count and culture was obtained and the patient was started on empirical intravenous broad - spectrum antibiotic coverage with vancomycin and aztreonam ( he was allergic to penicillin ) . pd was continued during the hospital stay with the addition of 500 units of unfractionated heparin per liter of dialysate . his dialysate white blood cell count was > 3700 with 92% neutrophils and c. freundii was isolated upon its culture . a computed tomography scan of the abdomen showed no evidence of intestinal perforation , appendicitis or diverticulitis . subsequently , his clinical condition stabilized with subsiding abdominal pain clearing of dialysate in 2 days . his antibiotic coverage was switched to oral ciprofloxacin along with intraperitoneal gentamycin , requiring an additional daytime manual exchange with 6-h dwell time in order to provide sustained antibiotic exposure to the infected peritoneal membrane , which is not possible with the cycler - assisted pd exchanges . the antibiotics were continued for a total duration of 14 days , and he was discharged in a stable condition . peritonitis caused by the members of the family enterobacteriaceae is an important cause of mortality and morbidity in pd patients and accounts for up to 12% of all peritonitis episodes in some series . citrobacter species , a part of this family , were not commonly associated with peritonitis until recently , when they were described among the spice organisms causing severe peritonitis . most commonly , c. freundii has been associated with urinary tract infections , superficial wound infections and bacteremia especially in elderly , immunocompromised and hospitalized patients . it colonizes the gastrointestinal tract of humans and other animals and its translocation to the blood stream in dialysis patients especially in the setting of abnormal bowel habits is implicated in the development of peritonitis . our patient had a particularly severe peritonitis with hemodynamic instability , and prompt use of intravenous broad spectrum antibiotics was life - saving . we encountered a bacterial strain that was resistant to ampicillin ; a commonly described property of c. freundii and ascribed to the ampc gene , which provides high - level resistance to ampicillin and first generation cephalosporins . indeed , the last published guidelines of the international society of pd in 2010 recommend following the sensitivity patterns in case of spice organisms and consider using double antibiotic coverage for 23 weeks . earlier literature reports a high incidence of mortality and morbidity from catheter losses from pd - related peritonitis caused by c. freundii . prompt institution of broad antimicrobial coverage in unstable patients and following the culture sensitivity pattern reduces mortality and catheter losses from peritonitis caused by c. freundii .

serratia , pseudomonas / providencia , indole - positive proteus / acinetobacter / morganella , citrobacter , enterobacter and hafnia group of organisms cause peritoneal dialysis ( pd)-related peritonitis with high morbidity and mortality . peritonitis caused by citrobacter freundii is uncommon , and it may lead to catheter removal despite antimicrobial treatment . we describe a case of pd - related peritonitis caused by c. freundii , which was successfully treated with double antibiotic coverage .

congenital causes of intestinal obstruction include duodenal atresia , malrotation , duodenal obstruction from ladd bands , other congenital bands , superior mesentery artery syndrome , enteric duplications as well as several other entities . congenital anomalous bands resulting in proximal jejunal obstruction are a rare entity that should be considered in the differential in patients with clinical signs of obstruction and no prior history of abdominal surgery . we present a case of an 8 year - old girl with a nine - month history of intermittent vomiting and no history of prior surgery and review the embryology and radiologic findings of this entity using different imaging modalities . an 8 year - old girl with a past medical history of constipation presented with a history of vomiting for nine months . the vomiting was intermittent , non - bloody , at times bilious , and occasionally contained food particles . an abdominal ultrasound was performed which demonstrated debris within a dilated proximal duodenum . the superior mesenteric artery ( sma ) and superior mesenteric vein ( smv ) were visualized with the sma lying to the left of the smv with normal anatomic alignment [ figure 1 ] . ( a ) ultrasound of mid abdomen shows superior mesentery vein ( arrow ) and superior mesentery artery to the left ( b ) the doppler flow study confirms arterial flow in the superior mesentery artery ( arrowhead ) and the venous flow in the uncompressed superior mesenteric vein ( arrow ) . a standard barium single contrast upper gastrointestinal ( ugi ) series was performed with the contrast entering the antrum and duodenal bulb . the proximal duodenum and descending duodenum were markedly dilated in caliber with apparent tapering of the third part of the duodenum . there was an abrupt cutoff with no contrast extending beyond approximately the mid abdomen [ figure 2 ] . delayed images were obtained while the patient was supine with contrast never extending beyond the third portion of the duodenum [ figure 3 ] . single contrast upper gastrointestinal series shows on a single view plain radiograph the contrast abruptly cutting off approximately at the mid abdomen ( arrow ) . single contrast upper gastrointestinal series shows on delayed images with patient laying supine , contrast never extending beyond third portion of duodenum with persistent cutoff ( arrow ) . contrast is seen in antrum of stomach ( star ) , proximal duodenum , and descending duodenum . patient was subsequently placed prone for several minutes with eventual slight transit of contrast [ figure 4 ] . thirty minute delayed prone images demonstrated contrast in the proximal small bowel , however proximal duodenum remained markedly dilated and contrast / debris filled [ figure 5 ] . additionally delayed overhead images demonstrated contrast extending to the distal small bowel after patient had been upright for greater than 30 minutes [ figure 6 ] . markedly dilated proximal duodenum with abrupt cutoff in the third portion of the duodenum raised concern for a questionable mass like positionally dependent extrinsic compression of the third portion of the duodenum . delayed prone images demonstrated contrast in the proximal small bowel with persistent dilatation of the proximal duodenum . additional delayed image following several minutes of prone position demonstrates a small amount of contrast progressing to the jejunum ( arrow ) . delayed abdominal radiograph following the upper gastrointestinal series after patient had been upright for greater than 30mins demonstrates further progression of contrast into the jejunum and ileum ( star ) . distal most extent of contrast near the cecum ( arrow ) . a subsequent computed tomography ( ct ) of the abdomen and pelvis the duodenum was distended with the third part of the duodenum tented downward [ figure 7 ] . the duodenal / jejunal junction was severely narrowed and coursed distally anterior to the right common femoral artery below the bifurcation [ figure 7 ] . computed tomography ( ct ) of the abdomen and pelvis shows dilated fluid filled duodenum ( asterisk , a ) . duodenum tented medially ( black arrow , b ) and downward ( white arrow , c , black arrow , e ) . duodenum severely narrowed as it crosses anterior to right femoral vein below the bifurcation ( white arrow , d ) . the patient was taken for an exploratory laparotomy and found to have dense vascularized bands without intestinal malrotation . upon entering the abdomen , . further exploration in the abdomen revealed the proximal jejunum tethered by dense vascularized bands running from approximately five inches distal to the ligament of treitz down into the pelvis . the cecum was incidentally noted to be folded back on itself and adherent to this tented portion of the jejunum . after these adhesions were ligated , the bowel was examined and no other anatomical abnormalities were discovered . the patient experienced a normal post - operative course with subsequent complete resolution of symptoms . the congenital causes of intestinal obstruction in infants and children are intestinal atresia and stenosis , congenital bands , remnants of embryologic structures such as vitelline arteries or veins , omphalomesenteric ducts or a mesourachus . in addition intestinal obstructions caused by other anomalous congenital bands have only been described sporadically in the literature and are otherwise rare.[57 ] an example of anomalous congenital bands is ladd bands . they arise from the cecum and extend to the sub - hepatic region , posterior peritoneum or abdominal wall . ladd bands result in compression of the 2 or 3 duodenal portions , which lead to intestinal obstruction . however , the location of these bands is different from embryonic remnants such as vitelline vessels or omphalomesenteric ducts . akgur et al . , cited a few series of cases to suggest that these bands are the result of a mesenteric developmental anomaly . mesenteric anomalies have not been well documented aside from cases of malrotation and anomalous intestinal fixation . in our patient , upper gastrointestinal ( ugi ) barium examination showed a dilated duodenum near the ligament of treitz with sharp obstruction . most duodenal obstructions by external compression are caused by abnormal duodenal rotation with internal herniation or ladd bands . in our patient our case is particularly rare as abnormal dense vascularized bands were seen distal to the ligament of treitz , which is not characteristic of ladd bands . this resulted in dilatation of the proximal jejunum which was not readily identified on the ugi barium examination . though imaging demonstrated a high grade obstruction , the patient 's symptoms were chronic and mild . furthermore prone positioning partially alleviated the degree of obstruction presumably by altering the position of the anomalous bands and relieving the obstruction . finding an anomalous band tethering the proximal jejunum to the pelvis and adhering the jejunum and cecum is unique and unlike previously described congenital peritoneal bands . as no previous operation had been performed on this patient and operative findings did not show any other abnormal post inflammatory adhesions between the small and large intestines , the etiology of these bands was determined to be congenital . , discovered a band running from the antimesenteric wall of the proximal jejunum just distal to the treitz 's ligament to the root of the mesentery . the anomalous congenital band in that case was considered to be the remnant of ventral mesentery that failed to resorb completely . in both our case and the case described by liu et al . external compression of the proximal jejunum by an anomalous band should be included in the differential diagnosis of obstruction of the distal duodenum or duodeno - jejunal junction for patients without previous history of surgery , especially when ugi barium examination shows normal duodenal rotation and duodeno - jejunal fixation .

congenital anomalous bands at the proximal jejunum resulting in obstruction have been described sporadically in the literature and are otherwise rare . we present a case of an 8 year - old girl with a nine - month history of intermittent vomiting and no history of prior surgery . the imaging workup includes an abdominal ultrasound , a single contrast upper gastrointestinal series , and a dual contrast computed tomography of the abdomen and pelvis . surgical intervention revealed the presence of dense bands at the proximal jejunum without evidence of malrotation . our report reviews the embryology and radiologic findings of this entity using different imaging modalities .

hepatocellular carcinoma ( hcc ) is the most common primary malignant tumor of the liver and the second leading cause of cancer - related death in the world . almost 80% of hcc cases are associated with cirrhosis due to chronic hepatitis b or c virus infection . however , hccs that are very large in size and mass mostly develop in non - cirrhotic livers . surgical resection is the only potentially curative treatment for patients with adequate liver functional reserve . we present the case of a patient with an extensive hcc , who clinically presented with thoracic pain due to an extrahepatic metastasis . a 33-year - old male presented to an ambulant orthopedic surgeon with left thoracic pain for six months . the patient s history offered no trauma , no alcoholism or smoking as well as no drug abuse or intake of steroid hormones . clinical examination revealed selective pressure pain over the fifth rib near the left mammilla . a gadoxetic acid - enhanced mri was performed and revealed a giant inhomogeneous tumor originating from the left liver lobe with compression of surrounding organs ( fig . liver biopsy revealed a hepatocellular adenoma ( hca ) with conspicuous cytoplasmic yellow - brown granular pigments ( fig . tumor cells showed nuclear -catenin expression and overexpression of glutamine synthetase , leading to the diagnosis of hca with -catenin activation . although in biopsy tissue transition to hcc was not evident , progression to hcc was suspected due to the big tumor size . furthermore , a single - photon emission computed tomography ( spect ) showed suspect tumor in the left fifth rib ( fig . 1b ) , and a ct - guided puncture revealed hcc metastasis , verifying the suspicion of malignant progression . a moderate increase of transaminases with alanine aminotransferase ( alt ) of 0.92 katal / l ( normal : 0.220.77 ) and aspartate aminotransferase ( ast ) of 1.0 katal / l ( normal : < 0.59 ) was assessed by blood sample . the tumor markers alpha - fetoprotein ( afp ) , cancer embryonic antigen ( cea ) and carbohydrate antigen 19 - 9 ( ca19 - 9 ) were all within normal limits , whereas carbohydrate antigen 125 ( ca125 ) was moderately increased with 24.8 u / ml ( normal : < 20 ) . preoperative ct volumetric measurement revealed a right liver lobe volume of 1367 cubic centimeter by using the summation - of - area method.fig . 1(a ) gadoxetic acid - enhanced mri axial t2-weighted showed large inhomogeneous abdominal mass and continuation with the parenchyma of left hepatic lobe ( arrows ) . ( b ) single - photon emission computed tomography ( spect ) showed metastasis of fifth left rib ( arrow).fig . 1 ( a ) gadoxetic acid - enhanced mri axial t2-weighted showed large inhomogeneous abdominal mass and continuation with the parenchyma of left hepatic lobe ( arrows ) . ( b ) single - photon emission computed tomography ( spect ) showed metastasis of fifth left rib ( arrow ) . the huge tumor did not invade surrounding organs and hepatic cirrhosis or peritoneal metastasis was not observed ( fig . after cholecystectomy and complete mobilization of the left liver , the left portal vein and left hepatic artery were ligated and divided . liver transection of left liver including segment i and partial segment iv was performed by using endo gia 60-mm vascular with tri - staple technology ( covidien , mansfield , massachusetts , usa ) , whereas larger vessels and biliary tracts were overstitched ( fig . the resection surface was sealed with fibrin sealant patch ( tachosil , takeda , osaka , japan ) to avoid bleeding . the intraoperative course was uneventful , the tumor capsule was not disrupted and there was no need of blood transfusion . the giant tumor mass was found to be 34 24 24 cm in size and 7.2 kg in weight . macroscopic examination showed a multinodular and multicoloured tumor with yellow - green as well as dark pigmented areas ( fig . histological evaluation revealed a well - differentiated hcc with trabecular growth pattern , invasion of portal vein branches and tumor - free resection margins . tumor cells of the macroscopically dark coloured areas in histology contained brown cytoplasmic pigments ( data not shown ) , just as observed in the cells of the hca . as a two - stage surgical procedure , partial en bloc resection of the left fifth rib was performed 4 weeks after hepatectomy . the defect of the thoracic wall was repaired by using peri - guard repair patch ( synovis life technologies , saint paul , minnesota , usa ) , a biological tissue prepared from bovine pericardium . in summary , this case was classified as a pt3a pn0 pm1 stage iv , according to the 7th edition of the uicc tnm staging system for hcc.fig . ( b ) image of intraoperative situs after left hemihepatectomy showed prominent feeding vessel originating from the left gastric artery ( arrow).fig . 3(a , b ) multinodular and multicoloured appearance of the tumor with yellow - green areas , caused by bile production , and dark pigmented areas . ( c ) yellow - green appearance of the bone metastasis due to bile deposition.fig . 4upper line : ( a ) hepatocellular adenoma with cytoplasmic granular pigments , ( b ) nuclear -catenin expression , ( c ) conserved reticulin fiber meshwork and ( d ) very low proliferative activity . lower line : ( e ) hepatocellular carcinoma with trabecular growth pattern , low nuclear atypia and bile plugs ( arrows ) , ( f ) showing regular membraneous -catenin expression , ( g ) fiber - destructive growth and ( h ) medium proliferative activity . a , e : hematoxylin & eosin ; b , f : -catenin immunohistochemistry ; c , g : gomori silver staining ; d , h : ki67 immunohistochemistry.fig . ( b ) image of intraoperative situs after left hemihepatectomy showed prominent feeding vessel originating from the left gastric artery ( arrow ) . ( a , b ) multinodular and multicoloured appearance of the tumor with yellow - green areas , caused by bile production , and dark pigmented areas . ( c ) yellow - green appearance of the bone metastasis due to bile deposition . upper line : ( a ) hepatocellular adenoma with cytoplasmic granular pigments , ( b ) nuclear -catenin expression , ( c ) conserved reticulin fiber meshwork and ( d ) very low proliferative activity . lower line : ( e ) hepatocellular carcinoma with trabecular growth pattern , low nuclear atypia and bile plugs ( arrows ) , ( f ) showing regular membraneous -catenin expression , ( g ) fiber - destructive growth and ( h ) medium proliferative activity . a , e : hematoxylin & eosin ; b , f : -catenin immunohistochemistry ; c , g : gomori silver staining ; d , h : ki67 immunohistochemistry . the post - operative period was uneventful and the patient was discharged home one week after the second operation . a follow - up surveillance according to the recent guidelines of the european association for the study of the liver ( easl ) was initiated . a 33-year - old male presented to an ambulant orthopedic surgeon with left thoracic pain for six months . the patient s history offered no trauma , no alcoholism or smoking as well as no drug abuse or intake of steroid hormones . clinical examination revealed selective pressure pain over the fifth rib near the left mammilla . a gadoxetic acid - enhanced mri was performed and revealed a giant inhomogeneous tumor originating from the left liver lobe with compression of surrounding organs ( fig . liver biopsy revealed a hepatocellular adenoma ( hca ) with conspicuous cytoplasmic yellow - brown granular pigments ( fig . tumor cells showed nuclear -catenin expression and overexpression of glutamine synthetase , leading to the diagnosis of hca with -catenin activation . although in biopsy tissue transition to hcc was not evident , progression to hcc was suspected due to the big tumor size . furthermore , a single - photon emission computed tomography ( spect ) showed suspect tumor in the left fifth rib ( fig . 1b ) , and a ct - guided puncture revealed hcc metastasis , verifying the suspicion of malignant progression . a moderate increase of transaminases with alanine aminotransferase ( alt ) of 0.92 katal / l ( normal : 0.220.77 ) and aspartate aminotransferase ( ast ) of 1.0 katal / l ( normal : < 0.59 ) was assessed by blood sample . the tumor markers alpha - fetoprotein ( afp ) , cancer embryonic antigen ( cea ) and carbohydrate antigen 19 - 9 ( ca19 - 9 ) were all within normal limits , whereas carbohydrate antigen 125 ( ca125 ) was moderately increased with 24.8 u / ml ( normal : < 20 ) . preoperative ct volumetric measurement revealed a right liver lobe volume of 1367 cubic centimeter by using the summation - of - area method.fig . 1(a ) gadoxetic acid - enhanced mri axial t2-weighted showed large inhomogeneous abdominal mass and continuation with the parenchyma of left hepatic lobe ( arrows ) . ( b ) single - photon emission computed tomography ( spect ) showed metastasis of fifth left rib ( arrow).fig . 1 ( a ) gadoxetic acid - enhanced mri axial t2-weighted showed large inhomogeneous abdominal mass and continuation with the parenchyma of left hepatic lobe ( arrows ) . ( b ) single - photon emission computed tomography ( spect ) showed metastasis of fifth left rib ( arrow ) . the huge tumor did not invade surrounding organs and hepatic cirrhosis or peritoneal metastasis was not observed ( fig . after cholecystectomy and complete mobilization of the left liver , the left portal vein and left hepatic artery were ligated and divided . liver transection of left liver including segment i and partial segment iv was performed by using endo gia 60-mm vascular with tri - staple technology ( covidien , mansfield , massachusetts , usa ) , whereas larger vessels and biliary tracts were overstitched ( fig . the resection surface was sealed with fibrin sealant patch ( tachosil , takeda , osaka , japan ) to avoid bleeding . the intraoperative course was uneventful , the tumor capsule was not disrupted and there was no need of blood transfusion . the giant tumor mass was found to be 34 24 24 cm in size and 7.2 kg in weight . macroscopic examination showed a multinodular and multicoloured tumor with yellow - green as well as dark pigmented areas ( fig . histological evaluation revealed a well - differentiated hcc with trabecular growth pattern , invasion of portal vein branches and tumor - free resection margins . tumor cells of the macroscopically dark coloured areas in histology contained brown cytoplasmic pigments ( data not shown ) , just as observed in the cells of the hca . as a two - stage surgical procedure , partial en bloc resection of the left fifth rib was performed 4 weeks after hepatectomy . the defect of the thoracic wall was repaired by using peri - guard repair patch ( synovis life technologies , saint paul , minnesota , usa ) , a biological tissue prepared from bovine pericardium . in summary , this case was classified as a pt3a pn0 pm1 stage iv , according to the 7th edition of the uicc tnm staging system for hcc.fig . ( b ) image of intraoperative situs after left hemihepatectomy showed prominent feeding vessel originating from the left gastric artery ( arrow).fig . 3(a , b ) multinodular and multicoloured appearance of the tumor with yellow - green areas , caused by bile production , and dark pigmented areas . ( c ) yellow - green appearance of the bone metastasis due to bile deposition.fig . 4upper line : ( a ) hepatocellular adenoma with cytoplasmic granular pigments , ( b ) nuclear -catenin expression , ( c ) conserved reticulin fiber meshwork and ( d ) very low proliferative activity . lower line : ( e ) hepatocellular carcinoma with trabecular growth pattern , low nuclear atypia and bile plugs ( arrows ) , ( f ) showing regular membraneous -catenin expression , ( g ) fiber - destructive growth and ( h ) medium proliferative activity . a , e : hematoxylin & eosin ; b , f : -catenin immunohistochemistry ; c , g : gomori silver staining ; d , h : ki67 immunohistochemistry.fig . 4 ( a ) in situ appearance of the hepatocellular carcinoma mass . ( b ) image of intraoperative situs after left hemihepatectomy showed prominent feeding vessel originating from the left gastric artery ( arrow ) . ( a , b ) multinodular and multicoloured appearance of the tumor with yellow - green areas , caused by bile production , and dark pigmented areas . ( c ) yellow - green appearance of the bone metastasis due to bile deposition . upper line : ( a ) hepatocellular adenoma with cytoplasmic granular pigments , ( b ) nuclear -catenin expression , ( c ) conserved reticulin fiber meshwork and ( d ) very low proliferative activity . lower line : ( e ) hepatocellular carcinoma with trabecular growth pattern , low nuclear atypia and bile plugs ( arrows ) , ( f ) showing regular membraneous -catenin expression , ( g ) fiber - destructive growth and ( h ) medium proliferative activity . a , e : hematoxylin & eosin ; b , f : -catenin immunohistochemistry ; c , g : gomori silver staining ; d , h : ki67 immunohistochemistry . the post - operative period was uneventful and the patient was discharged home one week after the second operation . a follow - up surveillance according to the recent guidelines of the european association for the study of the liver ( easl ) was initiated . giant hepatocellular carcinomas have a diameter over 10 cm , whereas a diameter over 20 cm is extremely rare . interestingly , very large hccs mostly develop in non - cirrhotic livers . at time of diagnosis an extrahepatic spread occurs in only about 515% of patients and mainly in advanced - stage primary tumors over 5 cm . the most common sites of hcc metastases are lung ( 49% ) , abdominal organs ( 24% ) and bone ( 1316% ) . skeletal metastases appear as expansive soft tissue masses with bone destruction and mainly involved sites are the vertebrae , pelvis , ribs , skull , humerus and sternum . in the presented case the progression from a hca with -catenin activation to hcc was documented . molecular characterization of hcas has been practiced for few years now , resulting in an improved risk stratification of the heterogenous entity of hcas . these -catenin activated hcas are often associated with male sex and administration of androgenic hormones and have an increased risk of malignant transformation . in this case it is suggested that these pigments constitute lipofuscin deposits and several reports indicate an increased risk of malignancy in pigmented hcas , . the pigments were also found in the hcc cells , but , unexpectedly , the nuclear -catenin activation of the hca was not preserved in the hcc cells . however , pigmentation of hcas besides molecular characterization could serve as additional hint in evaluation of malignant potential of hcas . currently , surgical resection is the only curative treatment with the best long - term survival . preoperative liver function as a key parameter and the skill and experience of the surgeon significantly affect the success of resection in complicated hcc . recurrence is the major challenge , as it occurs in approximately 70% of patients within 5 years after hepatic resection . predictive factors of recurrence are disruption of tumor capsule , daughter nodules , positive surgical resection margins and blood transfusion . according to the literature , we recommend a therapy specific to the patient on a case - by - case basis . to our knowledge , this is the first case report of a two - staged surgical resection of a giant hcc with skeletal metastasis in a young adult . bone metastasis of a hepatocellular carcinoma ( hcc ) is a very rare cause of thoracic pain . hepatocelluar adenomas ( hca ) with an activating mutation of -catenin , which occurs in up to 15% of cases , have a high risk of malignant transformation . molecular characterization and morphological feature of pigmentation are useful tools for risk assessment of hcas and hepatobiliary surgery with metastasis resection is the only curative treatment and can be safe and effective even in patients with giant hccs , as our case report shows . written informed consent was obtained from the patient for publication of this case report and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request . sebastian lnse : study concept , data collection , literature research and writing the manuscript .

highlightshepatocellular carcinoma ( hcc ) is an extremely rare finding in young adult.giant hccs are larger than 10 cm in diameter and mostly develop in non - cirrhotic livers.pigmented hepatocellular adenoma ( hca ) with beta - catenin activation have an increased risk for malignant transformation.surgical resection is the only curative treatment with best long - term outcome.molecular classification of hcas is a useful tool for risk assessment of malignant transformation .

the influence of diet on human health has been studied for a long time . in the fourth century bc , hippocrates already stated : let food be your medicine and medicine be your food . this theory was again recalled in the nineteenth century thanks to ludwig feuerbach who wrote man is what he eats . today recent studies have shown that our diet is an important factor which could contribute not only to the development but also to the inhibition of chronic diseases , including osteoporosis , diabetes , cancer , atherosclerosis , cardiovascular disease , neurodegenerative diseases and obesity ( virmani et al . 2006 , 2013 ; joseph et al . 2009 ; lillycrop and burdge 2012 ) . it is possible due to nutritional factors , which may induce epigenetic changes also via direct influence on gene expression ( alam et al . 2012 ) . in the late twentieth century , nancy fogg - johnson and alex meroli created a new term which combines two fields of science : nutrition and genetics , named nutrigenomics . the aim of nutrigenomics is to study how various food ingredients affect the expression of specific genes and therefore provide tools to understand and control the worldwide epidemic of specific chronic diseases . it has been proven that these diseases more often arise from dysfunctional biological networks , instead of single common gene mutation ( liu et al . 2010 ; ferguson et al . 2007a , b ; astley 2007 ) . dietary interventions may induce changes in the metabolic and inflammatory state by modulating the expression of important genes involved in the chronic disorders ( lottenberg et al . this particularly applies to biologically active substances which have a protective influence on the body . for example , recent studies have shown that polyunsaturated fatty acids ( pufa ) downregulate atp - binding cassette transporter a-1 ( abca-1 ) , which results in reductions in hdl - c concentrations . pufa suppress the liver x receptor / retinoid x receptor ( lxr / rxr ) gene responsible for abca-1 synthesis , which is a transporter involved in the hdl formation ( uehara et al . furthermore , pufa modulate expression of several genes involved in oxidative processes ( such as ppar- ) , while impairing the sterol - regulatory element binding proteins ( srebps ) involved in lipogenesis ( hannah et al . a different study demonstrated that diet enriched with anti - inflammatory mixture containing resveratrol , green tea extract , -tocopherol , vitamin c , omega-3 polyunsaturated fatty acids and tomato extract affected genes involved in inflammatory processes , oxidative stress and metabolism ( bakker et al . also various dietary components including omega-3 fatty acids , plant flavonoids and carotenoids have been demonstrated to modulate gene expression , by decreasing inos and cox-2 gene expression induced by gliadin in raw 264.7 macrophages stimulated with ifn-. therefore , these compounds could preserve intestinal barrier integrity , play a protective role against toxicity of gliadin peptides and have a role in nutritional therapy of , for example , celiac disease ( ferretti et al . 2012 ; de stefano et al . 2007 ) . taking the latest data from the fields of nutrigenomics into consideration , the aim of the present study was to evaluate the influence of long - term ( 14 months ) use of biologically active substances - enriched diet ( base - diet ) containing the mixture of polyphenolic compounds , -carotene , probiotics and n-3 and n-6 polyunsaturated fatty acids on transcriptomic profile of rats liver . however , in the present study we did not want to investigate the mechanisms of action of the individual components , as these are already known . the main emphasis has been placed on the possible cumulative action of these compounds in the situation when they were added simultaneously as ingredients of semi - synthetic diet . since 14-month period in case of rats is more than half of their life s span , the obtained results could be of great value . experiment was carried out on thirty - six 8-week - old male sprague dawley rats ( charles river laboratories , germany ) . the environment was regulated at 22 0.5 c , air humidity of 50 % on a 12 h/12 h l / d photoperiod throughout the entire experiment . the body weight and animals were divided into two groups : a control group ( n = 18 ) and an experimental group ( n = 18 ) . rats from both groups were receiving for 14 months semi - synthetic diets ( control and base - diet ) formulated according to the nutritional requirements for laboratory animals ( nrc 1995 ) and are described in table 1 . application of the semi - synthetic diet allowed the elimination of the additional impact of biologically active compounds contained in commercially available diets . base - diet was additionally enriched with the following biologically active compounds : 6 % of salmon fat replacing lard ( to increase the level of unsaturated fatty acids ) , 8 % of hydrolysed water extract from small - leaved linden ( tiliacordata ) inflorescence ( as a source of antioxidant compounds ) , 8 % of puree from giant pumpkin ( curcubitamacima ) ( the source of beta - carotene ) and 1 % of two strains of bacteria with documented probiotic activity : lactobacillusacidophilus la-5 and bifidobacteriumanimals ssp . exact composition of macronutrients , micronutrients and vitamins mixtures included in the experimental diets is presented in table 2.table 1composition of diets used for 14-month - long feeding of ratscontrol diet ( g / kg diet)base - diet ( g / kg diet)rapeseed oil10.020.0salmon fat0.060.0lard90.020.0hydrolysed water extract from linden ( tilia cordata ) inflorescence0.080.0puree from pumpkin ( cucurbita maxima)0.080.0probiotic ( la5/bb12)0.01.0mixture of macronutrients36.336.3mixture of micronutrients0.50.5mixture of vitamins10.010.0 l - methionine2.22.2casein200.0200.0wheat starch482.0465.0potato starch10.010.0water144.00.0saline15.015.0table 2composition of the mixtures of macronutrients , micronutrients and vitamins used in control and base - diet fed to rats for 14 monthsmacronutrients mixture composition ( g / kg of mix ) cahpo4 2h2o27.89 k2hpo4 2.43 nacl0.92 k2so4 2.04 caco3 0.63 na2hpo4 12h2o1.61 mgo0.75micronutrients mixture composition ( g / kg of mix ) c3h4(oh)(coo)3fe x 3h2o3.76 zn(ch3coo)2 2h2o0.79 mnco3 2.34 cu(ch3coo)2 h2o0.5 kj0.004 c3h4(oh)(cooh)3 ad 100 gvitamins mixture composition ( mg / kg of mix ) vitamin a0.69 vitamin d3 0.5 vitamin e98.2 para - aminobenzoic acid100.0 inositol100.0 niacin40.0 ca - pantothenate40.0 vitamin b2 8.0 vitamin b1 5.0 vitamin b6 5.0 composition of diets used for 14-month - long feeding of rats composition of the mixtures of macronutrients , micronutrients and vitamins used in control and base - diet fed to rats for 14 months the content of biologically active substances in feed was measured as follows . the fatty acid content was determined both in the raw ingredients and in the feed samples using gas chromatography ( table 3 ) . quantitative analysis of the total polyphenolic compounds in the hydrolysed water extract from small - leaved linden inflorescence was made using the method with folin reagent ( 1 n ) in the presence of na2co3 ( 20 % ) . the analysis of beta - carotene and other carotenoids content was performed using high - performance liquid chromatography coupled with electrochemical detection ( hplc ecd).table 3the fatty acid profiles in control and base - dietsfatty acidscontrol dietbase - dietsaturated ( % ) 32.7017.24monounsaturated ( % ) 32.4430.75polyunsaturated ( % ) 10.4318.3220:5 n-3 ( % ) 0.022.1022:6 n-3 ( % ) 0.023.60sum of n-3 fatty acids ( % ) 2.909.02sum of n-6 fatty acids ( % ) 7.549.42 the fatty acid profiles in control and base - diets after 3 and 14 months of experiment , animals from each experimental group ( n = 9 ) were euthanized by exsanguination under general anaesthesia with the isoflurane . liver samples were frozen with liquid nitrogen immediately after collection and stored at 80 c until extraction . total rna was extracted with rneasy lipid tissue mini kit ( qiagen , germany ) following the manufacturer s recommended protocol . subsequently , potential genomic dna contamination was eliminated using deoxyribonuclease i amplification grade ( sigma , usa ) and rneasyminelute cleanup kit ( qiagen , germany ) . rna quantity and quality was measured using nanodrop 2000 ( nanodrop technologies , usa ) and bioanalyzer ( agilent technologies , usa ) . to ensure optimal data quality , only rna samples with rin number 8.8 the analysis of gene expression profile was performed using sureprint g3 rat gene expression microarray , 8 60 k ( agilent technologies , usa ) . the low input quick amp labeling kits ( agilent , usa ) was used to amplify and label target rna to generate complementary rna ( crna ) for oligo microarrays used in gene expression profiling . experiment was performed using a common reference design , where the common reference was rna from 10-week - old healthy rats not participating in the experiment , housed for 2 weeks in the same room with experimental rats . on each two - colour microarray , 300 ng of crna from the control rats ( labelled by cy3 ) and 300 ng of crna from the rats fed with base - diet ( labelled by cy5 ) were hybridized . microarray hybridization was performed with the gene expression hybridization kit ( agilent technologies , usa ) , according to the manufacturer s protocols . rna spike in kit ( agilent technologies , usa ) was used as an internal control . in total , 24 microarrays , one for each animal , were done . the final analysis was carried out on 22 microarrays , which passed through the agilent feature extraction s and the gene spring s control ( one microarrays from the control group after 3 months of experiment and one from the experimental group after 3 months of experiment were rejected due to insufficient quality ) . data were extracted and background was subtracted using the standard procedures contained in the agilent feature extraction ( fe ) software version 10.7.3.1 . the statistical analysis was performed using gene spring 12 software ( agilent , usa ) . the samples underwent quality control and the results showed that each sample had similar qc metric profile . the next step was filtering probe sets by flags to remove poor - quality probes ( absent flags ) . the statistical significance of the differences was evaluated using one - way anova and tukey s hsd post hoc test ( p < 0.05 ) . a multiple testing correction was performed using benjamini and hochberg false discovery rate ( fdr ) < 5 % . microarray data were deposited at the gene expression omnibus data repository under the number gse51657 according to the miame requirements . to identify the list of signalling pathways , the microarray data were analysed using pathway studio 6.0 ( ariadne genomics ) . to verify microarray results , the expressions of three randomly selected genes ( gpx1 , irf7 and prodh ) were measured using real - time pcr method . primers were designed using primer - blast software ( ncbi database ) and then checked for secondary structures using oligo calculator ( free on - line access ) . the secondary structures of the amplicon were examined using m - fold web server ( free on - line access ) . as a house keeping gene actb were used ( huang et al . the sequences of the primers are listed in table 4.table 4primer sequences for real - time pcr verification of microarray resultsgene s namenm numbersense primer ( 53)antisense primer ( 53)tested genes gpx1nm_030826.2cctaaggcattcctggtatcccatctgaggggatttttct irf7nm_001033691.1gtctagcaccaatagtctctacaaggtccactagagatgaca prodhnm_001135778.1cacaggtgccttaactatgttctaactccttcatcctgcacaacreference gene actbnm_031144.3cccacactgtgcccatctataagggtgtaaaacgcagctc primer sequences for real - time pcr verification of microarray results cdna was synthesized using enhanced avian hs rt - pcr kit ( sigma - aldrich , st . all analyses were performed on individual samples of total rna using a brilliant iii ultra - fast sybr green qpcr master mix kit ( agilent technologies , usa ) following the manufacturer s protocol . each sample was tested 3 times in a stratagene mx3005p quantitative pcr instrument for rt - pcr . the relative expression of the target gene was calculated according to the following formula:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\delta \vardelta { \text{ct } } = \delta { \text{ct}}\left ( { \text{sample } } \right ) - \delta { \text{ct}}\left ( { \text{normal } } \right)$$\end{document}where ct is the difference in ct between the targeted gene and housekeeping controls by minimizing the average ct of the controls . the fold - change calculated as : 2 ( livak and schmittgen 2001 ) . experiment was carried out on thirty - six 8-week - old male sprague dawley rats ( charles river laboratories , germany ) . the environment was regulated at 22 0.5 c , air humidity of 50 % on a 12 h/12 h l / d photoperiod throughout the entire experiment . the body weight and animals were divided into two groups : a control group ( n = 18 ) and an experimental group ( n = 18 ) . rats from both groups were receiving for 14 months semi - synthetic diets ( control and base - diet ) formulated according to the nutritional requirements for laboratory animals ( nrc 1995 ) and are described in table 1 . application of the semi - synthetic diet allowed the elimination of the additional impact of biologically active compounds contained in commercially available diets . base - diet was additionally enriched with the following biologically active compounds : 6 % of salmon fat replacing lard ( to increase the level of unsaturated fatty acids ) , 8 % of hydrolysed water extract from small - leaved linden ( tiliacordata ) inflorescence ( as a source of antioxidant compounds ) , 8 % of puree from giant pumpkin ( curcubitamacima ) ( the source of beta - carotene ) and 1 % of two strains of bacteria with documented probiotic activity : lactobacillusacidophilus la-5 and bifidobacteriumanimals ssp . exact composition of macronutrients , micronutrients and vitamins mixtures included in the experimental diets is presented in table 2.table 1composition of diets used for 14-month - long feeding of ratscontrol diet ( g / kg diet)base - diet ( g / kg diet)rapeseed oil10.020.0salmon fat0.060.0lard90.020.0hydrolysed water extract from linden ( tilia cordata ) inflorescence0.080.0puree from pumpkin ( cucurbita maxima)0.080.0probiotic ( la5/bb12)0.01.0mixture of macronutrients36.336.3mixture of micronutrients0.50.5mixture of vitamins10.010.0 l - methionine2.22.2casein200.0200.0wheat starch482.0465.0potato starch10.010.0water144.00.0saline15.015.0table 2composition of the mixtures of macronutrients , micronutrients and vitamins used in control and base - diet fed to rats for 14 monthsmacronutrients mixture composition ( g / kg of mix ) cahpo4 2h2o27.89 k2hpo4 2.43 nacl0.92 k2so4 2.04 caco3 0.63 na2hpo4 12h2o1.61 mgo0.75micronutrients mixture composition ( g / kg of mix ) c3h4(oh)(coo)3fe x 3h2o3.76 zn(ch3coo)2 2h2o0.79 mnco3 2.34 cu(ch3coo)2 h2o0.5 kj0.004 c3h4(oh)(cooh)3 ad 100 gvitamins mixture composition ( mg / kg of mix ) vitamin a0.69 vitamin d3 0.5 vitamin e98.2 para - aminobenzoic acid100.0 inositol100.0 niacin40.0 ca - pantothenate40.0 vitamin b2 8.0 vitamin b1 5.0 vitamin b6 5.0 composition of diets used for 14-month - long feeding of rats composition of the mixtures of macronutrients , micronutrients and vitamins used in control and base - diet fed to rats for 14 months the content of biologically active substances in feed was measured as follows . the fatty acid content was determined both in the raw ingredients and in the feed samples using gas chromatography ( table 3 ) . quantitative analysis of the total polyphenolic compounds in the hydrolysed water extract from small - leaved linden inflorescence was made using the method with folin reagent ( 1 n ) in the presence of na2co3 ( 20 % ) . the analysis of beta - carotene and other carotenoids content was performed using high - performance liquid chromatography coupled with electrochemical detection ( hplc ecd).table 3the fatty acid profiles in control and base - dietsfatty acidscontrol dietbase - dietsaturated ( % ) 32.7017.24monounsaturated ( % ) 32.4430.75polyunsaturated ( % ) 10.4318.3220:5 n-3 ( % ) 0.022.1022:6 n-3 ( % ) 0.023.60sum of n-3 fatty acids ( % ) 2.909.02sum of n-6 fatty acids ( % ) 7.549.42 the fatty acid profiles in control and base - diets after 3 and 14 months of experiment , animals from each experimental group ( n = 9 ) were euthanized by exsanguination under general anaesthesia with the isoflurane . liver samples were frozen with liquid nitrogen immediately after collection and stored at 80 c until extraction . total rna was extracted with rneasy lipid tissue mini kit ( qiagen , germany ) following the manufacturer s recommended protocol . subsequently , potential genomic dna contamination was eliminated using deoxyribonuclease i amplification grade ( sigma , usa ) and rneasyminelute cleanup kit ( qiagen , germany ) . rna quantity and quality was measured using nanodrop 2000 ( nanodrop technologies , usa ) and bioanalyzer ( agilent technologies , usa ) . to ensure optimal data quality , only rna samples with rin number 8.8 the analysis of gene expression profile was performed using sureprint g3 rat gene expression microarray , 8 60 k ( agilent technologies , usa ) . the low input quick amp labeling kits ( agilent , usa ) was used to amplify and label target rna to generate complementary rna ( crna ) for oligo microarrays used in gene expression profiling . experiment was performed using a common reference design , where the common reference was rna from 10-week - old healthy rats not participating in the experiment , housed for 2 weeks in the same room with experimental rats . on each two - colour microarray , 300 ng of crna from the control rats ( labelled by cy3 ) and 300 ng of crna from the rats fed with base - diet ( labelled by cy5 ) were hybridized . microarray hybridization was performed with the gene expression hybridization kit ( agilent technologies , usa ) , according to the manufacturer s protocols . rna spike in kit ( agilent technologies , usa ) was used as an internal control . in total , 24 microarrays , one for each animal , were done . the final analysis was carried out on 22 microarrays , which passed through the agilent feature extraction s and the gene spring s control ( one microarrays from the control group after 3 months of experiment and one from the experimental group after 3 months of experiment were rejected due to insufficient quality ) . data were extracted and background was subtracted using the standard procedures contained in the agilent feature extraction ( fe ) software version 10.7.3.1 . the statistical analysis was performed using gene spring 12 software ( agilent , usa ) . the samples underwent quality control and the results showed that each sample had similar qc metric profile . the next step was filtering probe sets by flags to remove poor - quality probes ( absent flags ) . the statistical significance of the differences was evaluated using one - way anova and tukey s hsd post hoc test ( p < 0.05 ) . a multiple testing correction was performed using benjamini and hochberg false discovery rate ( fdr ) < 5 % . microarray data were deposited at the gene expression omnibus data repository under the number gse51657 according to the miame requirements . to identify the list of signalling pathways to verify microarray results , the expressions of three randomly selected genes ( gpx1 , irf7 and prodh ) were measured using real - time pcr method . the sequences of these genes were obtained from ensembl database . primers were designed using primer - blast software ( ncbi database ) and then checked for secondary structures using oligo calculator ( free on - line access ) . the secondary structures of the amplicon were examined using m - fold web server ( free on - line access ) . as a house keeping gene actb were used ( huang et al . 2013 ; wang et al . 2013 ) . the sequences of the primers are listed in table 4.table 4primer sequences for real - time pcr verification of microarray resultsgene s namenm numbersense primer ( 53)antisense primer ( 53)tested genes gpx1nm_030826.2cctaaggcattcctggtatcccatctgaggggatttttct irf7nm_001033691.1gtctagcaccaatagtctctacaaggtccactagagatgaca prodhnm_001135778.1cacaggtgccttaactatgttctaactccttcatcctgcacaacreference gene actbnm_031144.3cccacactgtgcccatctataagggtgtaaaacgcagctc primer sequences for real - time pcr verification of microarray results cdna was synthesized using enhanced avian hs rt - pcr kit ( sigma - aldrich , st . all analyses were performed on individual samples of total rna using a brilliant iii ultra - fast sybr green qpcr master mix kit ( agilent technologies , usa ) following the manufacturer s protocol . each sample was tested 3 times in a stratagene mx3005p quantitative pcr instrument for rt - pcr . the relative expression of the target gene was calculated according to the following formula:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\delta \vardelta { \text{ct } } = \delta { \text{ct}}\left ( { \text{sample } } \right ) - \delta { \text{ct}}\left ( { \text{normal } } \right)$$\end{document}where ct is the difference in ct between the targeted gene and housekeeping controls by minimizing the average ct of the controls . the fold - change calculated as : 2 ( livak and schmittgen 2001 ) . there was no difference in initial body weight and liver to body weight ratio among all experimental groups . over the course of the 14-month study , all animals gained body weight in a time - dependent manner , regardless the treatment ( figs . 1 , 2 ) . there was also no difference in the amount of diet eaten between control and experimental rats ( fig . earlier published data showed that there were no statistically significant differences between control and base - diet groups in blood morphology parameters as well as biochemical liver function parameters ( oszkiel et al . cd 3rats from control group after 3 months of experiment ; bd 3rats from base group after 3 months of experiment ; cd 14rats from control group after 14 months of experiment ; bd 14rats from base group after 14 months of experimentfig . 2liver to body weight ratio ( % ) . cd 3rats from control group after 3 months of experiment ; bd 3rats from base group after 3 months of experiment ; cd 14rats from control group after 14 months of experiment ; bd 14rats from base group after 14 months of experimentfig . cd rats from control group ; bd rats from base group weight of rats participating in the experiment . cd 3rats from control group after 3 months of experiment ; bd 3rats from base group after 3 months of experiment ; cd 14rats from control group after 14 months of experiment ; bd 14rats from base group after 14 months of experiment liver to body weight ratio ( % ) . cd 3rats from control group after 3 months of experiment ; bd 3rats from base group after 3 months of experiment ; cd 14rats from control group after 14 months of experiment ; bd 14rats from base group after 14 months of experiment average food consumption [ g ] of rats participating in the experiment . cd rats from control group ; bd rats from base group the consecutive steps of microarray data analysis have been presented in fig . analysis started from identification of all differentially expressed ( de ) genes in whole experiment and was conducted using anova in gene spring software . in total , n = 3,017 de genes were identified . then , using tukey s hsd post hoc test the lists of differentially expressed genes between experimental groups were identified ( table 5 ) . this analysis revealed n = 218 differentially expressed genes between control and base groups after 3 months of feeding , and n = 1,262 differentially expressed genes between control and base after 14 months of feeding . these two sets of differentially expressed genes were considered as diet - induced genes since the differences in expression resulted only from the diet fed to the animals.fig . 4the analysis diagram of the data obtained in the experimenttable 5the number of differentially regulated genes between each experimental group ( total number of differentially regulated genes n = 3,017)group name cd 3bd 3cd 14bd 14cd 33,0172182822,264bd 33,0171422,255cd 143,0171,262bd 14 3,017 cd 3rats from control group after 3 months of experiment ; bd 3rats from base group after 3 months of experiment ; cd 14rats from control group after 14 months of experiment ; bd 14rats from base group after 14 months of experiment the analysis diagram of the data obtained in the experiment the number of differentially regulated genes between each experimental group ( total number of differentially regulated genes n = 3,017 ) cd 3rats from control group after 3 months of experiment ; bd 3rats from base group after 3 months of experiment ; cd 14rats from control group after 14 months of experiment ; bd 14rats from base group after 14 months of experiment each of the two data sets was analysed using pathway studio 6.0 ( ariadne genomics ) software in order to identify statistically significant ariadne cell signalling pathways in which differentially expressed genes were involved ( based on gene ontology ) . after 3 months of base - diet feeding , three ariadne cell signalling pathways were significantly regulated ( p value < 0.05 ) ( table 6 ) . after 14 months of base - diet feeding , five ariadne cell signalling pathways were significantly regulated ( p value < 0.05 ) ( table 7 ) . there were two signalling pathways which were regulated both after 3 and 14 months of base - diet administration , namely guanylate cyclase pathway and gonadotrope cell activation pathway.table 6the list of ariadne cell signalling pathways significantly regulated in rats liver after 3 months of base - diet feedingnametypetotal entitiesexpanded # of entitiesoverlappercent overlapoverlapping entities p valuemast cell activationpathway6455891shc4 , gipc1 , cyp4a11 , mapk12 , hip1 , elk1 , ppp3cb , cyp2b6 , dhrs40.02204guanylate cyclase pathwaypathway361 , 219151slc23a3 , vasp , gipc1 , slc5a5 , trpv5 , slc28a2 , slc24a4 , prkaca , dnmt3a , hip1 , anp32a , dcx , sptbn1 , eml2 , nrm0.0308gonadotrope cell activationpathway71728101shc4 , gipc1 , cyp4a11 , prkaca , mapk12 , hip1 , elk1 , ppp3cb , cyp2b6 , dhrs40.04255table 7the list of ariadne cell signalling pathways significantly regulated in rats liver after 14 months of base - diet feedingnametypetotal entitiesexpanded # of entitiesoverlappercent overlapoverlapping entities p valuegap junction regulationpathway51661365nrg1 , pmch , ccl20 , erbb2 , prkg1 , drd2 , agrp , galp , penk , hrh1 , cga , cnr1 , fgf19 , npy5r , ffar1 , cckbr , oprl1 , oprk1 , ucn3 , fgf5 , mc2r , htr2c , npsr1 , rln1 , prkg2 , fgf22 , nrg2 , vgf , sstr1 , grm3 , pth2r , grm7 , gjb3 , rasgrf2 , shc3 , gpr1390.00019melanogenesispathway50694324nrg1 , pmch , ccl20 , erbb2 , drd2 , cyp1b1 , agrp , wnt10b , galp , penk , fgf19 , npy5r , oprl1 , ucn3 , fgf5 , mc2r , lrp5 , dct , rln1 , tyrp1 , wnt11 , ndp , fgf22 , nrg2 , vgf , sstr1 , wnt16 , grm3 , grm7 , shc3 , dzip3 , ech10.00682guanylate cyclase pathwaypathway361 , 219494gabrg3 , krt82 , aif1l , krt26 , glra4 , rims2 , slc12a5 , slc26a4 , p2rx2 , kcnd2 , kcnj6 , clcn1 , atp12a , scn2a , nos1 , prkg1 , trpm5 , trpv3 , trpm3 , nppc , ank2 , trpa1 , mybpc3 , scn10a , slc1a1 , slc1a2 , slc34a3 , kalrn , slc28a3 , scn3a , prkg2 , suv39h1 , suv39h2 , gria1 , disc1 , trpc7 , kcnj13 , krt34 , tube1 , kcnip1 , espn , kcnc2 , gabra2 , capza3 , kcne1l , krt31 , atp1a4 , slc6a15 , tekt30.01162gonadotrope cell activationpathway71728324rims2 , nrg1 , pmch , erbb2 , galp , penk , cga , fgf19 , ucn3 , fgf5 , catsper4 , pou1f1 , npsr1 , rln1 , ehf , fgf22 , nrg2 , pou4f1 , vgf , arhgef7 , pth2r , cacna1b , lhx4 , rasgrf2 , shc3 , cacna2d4 , lhx6 , ppp3r2 , etv2 , cacng3 , pou6f2 , cacnb10.01346apoptosis regulationpathway69624264nxph2 , il4 , p2rx2 , trpv3 , trpm3 , tgfb2 , trpa1 , il21 , ntrk2 , il6st , catsper4 , tnfrsf18 , tnfsf18 , il9r , il5ra , cntfr , cacna1b , trpc7 , omg , il1f5 , cacna2d4 , ppp3r2 , ifna16 , il28ra , cacng3 , cacnb10.04523 the list of ariadne cell signalling pathways significantly regulated in rats liver after 3 months of base - diet feeding the list of ariadne cell signalling pathways significantly regulated in rats liver after 14 months of base - diet feeding obtained microarray results were also validated using real - time pcr on randomly selected three genes . as shown in fig . 5 , gene expression for gpx1 , irf7 , prodh matched the expression obtained from microarray analysis.fig . 5expression of gpx1 , irf1 and prodh genes in livers of control rats and rats fed with base - diet measured using dna microarrays and real - time pcr ( normalized vs. actb ) expression of gpx1 , irf1 and prodh genes in livers of control rats and rats fed with base - diet measured using dna microarrays and real - time pcr ( normalized vs. actb ) in the present study , we investigated the influence of biologically active substances - enriched diet ( base - diet ) fed for a long period of time ( 14 months ) on the transcriptome of rat liver . it means that two factors could influence the results the experimental diet and age of rats . based on the numbers of genes regulated in individual comparisons ( adult vs. older ; control diet vs. base - diet ) , we could conclude that age factor was responsible for the regulation of higher number of genes ( number of differentially regulated genes between adult and old base - diet fed rats was n = 2,255 ) than the diet factor ( number of differentially regulated genes between control and base - diet fed rats was n = 218 after 3 months of experiment and n = 1,262 after 14 months of experiment ) ( see table 5 ) . our previous study has shown that base - diet , which was enriched with the mixture of polyphenols , beta - carotene , probiotics and polyunsaturated fatty acid , prevented from hepatic and systemic oxidative damage and was able to attenuate the development of some senile features in adult and old rats ( oszkiel et al . the gsh / gssg ratio has increased , gsh - px and gssg - r activities decreased , and sod activity decreased when compared to control animals . these results suggest that base - diet positively influenced some parameters of antioxidant defence within the body . because of that we investigated whether differentially regulated genes were involved in antioxidant activity . analyses performed in pathway studio software show relations between proteins encoded by genes involved in antioxidant activity and proteins encoded by genes differentially regulated in livers of rats fed with base - diet ( figs . 6 , 7 ) . it is clearly visible that in older rats the number of differentially regulated genes involved in antioxidant activity is significantly higher when compared to adult rats.fig . 6interactions between proteins involved in antioxidant activity ( blue ) and proteins encoded by differentially regulated genes ( red ) in livers of rats after 3 months of base - diet feedingfig . 7interactions between proteins involved in antioxidant activity ( blue ) and proteins encoded by differentially regulated genes ( red ) in livers of rats after 14 months of base - diet feeding interactions between proteins involved in antioxidant activity ( blue ) and proteins encoded by differentially regulated genes ( red ) in livers of rats after 3 months of base - diet feeding interactions between proteins involved in antioxidant activity ( blue ) and proteins encoded by differentially regulated genes ( red ) in livers of rats after 14 months of base - diet feeding as expected , we were able to identify differentially expressed genes between control and base - diet both in adult ( after 3 months of feeding ) and older rats ( after 14 months of feeding ) . significant difference in the expression of these genes resulted in significant regulation of a few signalling pathways ( three in the case of adult rats and five in the case of older rats ) . two of these pathways were the same in adult and older rats , so we concluded that these two were purely dependent on the diet . base - diet significantly influenced the expression of gonadotrope cell activation pathway and guanylate cyclase pathway . it regulates the activity of the basophilic cells of the anterior pituitary gland specialized in secreting follicle - stimulating hormone ( fsh ) or luteinizing hormone ( lh ) . fsh and lh are released by a trophic peptide hormone gonadotropin - releasing hormone ( gnrh ) . lh causes ovulation and formation of the corpus luteum in the ovary , stimulates production of oestrogen and progesterone by the ovary and stimulates testosterone production by the testis ( guyton and hall 2006 ; okamura et al . previous studies reported that reproductive activity can be directly influenced by nutrients , including the biologically active compounds . among such compounds chen et al . ( 2010 ) indicate that genistein and resveratrol can increase the ovarian follicular reserve and prolong the ovarian lifespan in rats . ( 2005 ) proved that the extract of rumex steudelii ( ethiopian plant which roots contain phytosterols and polyphenols ) prolonged significantly the oestrus cycle and the dioestrous phase . 2001 ; zhang et al . 2006 ; colitti and stefanon 2006 ; sgorlon et al . 2006 ; colitti et al . 2007 ) . -carotene is not only a retinol precursor , but also fulfils similarly function to vitamin e. it is a free radical scavenger , acting especially on singlet oxygen , and thus it is a potent antioxidant , similarly to other carotenoids . moreover , many gene products linked to reproduction can be modulated by the product of retinol oxidation retinoic acid . therefore , it is considered that an optimal intake of -carotene has a positive effect on fertility ( schweigert et al . recent study has shown a direct relationship between -carotene concentration at ovarian level and size and progesterone secretion by corpora lutea . it is suggested that -carotene may have a positive effect on luteogenesis and luteal activity ( haliloglu et al . 2002 ; arellano - rodriguez et al . 2009 ) . study carried out on cows shows that fat supplementation is associated with increased dominant follicle diameter , greater progesterone concentrations , modulation of prostaglandin synthesis and improved oocyte and embryo quality . 1998 ; lucy et al . 1993 ; mattos et al . 2002 ) . however , there is some evidence that diet affects the reproductive system also on the transcriptome level . majority of the studies focusing on transcriptional regulation of gnrh genes concerned gnrh - i ; however , recently also a study concerning gnhr - ii has been published ( lee et al . 2008 ) . in our study , gnrh - i and gnrh - ii genes , which are expressed mostly in the brain , were not directly regulated . however , we identified 38 genes involved in indirect regulation of gnrh - i and gnrh - ii expression ( figs . 8 , 9 ) . the expression of some genes involved in regulation of gnrh can be modulated by food interventions . plant polyphenols can alter the expression levels of oestrous cycle genes encoding pghs-2 ( upregulation ) , sod2 and foxo3 ( downregulation ) ( colitti et al . -carotene is a precursor ( inactive form ) of vitamin a. it is currently believed that vitamin a regulates gene transcription also by retinol - binding proteins ( rbp ) . expression of the rbp genes is dependent on progesterone , which is dominant ovarian steroid hormone , known to be involved in the regulation of gonadotropin secretion . progesterone regulates the gnrh - i gene through a feedback mechanism ( van arnum 1998 ; berry et al . . moreover , it has been demonstrated that unsaturated fatty acids may influence reproduction directly interfering with basal and gnrh - dependent gonadotrope activity ( garrel et al . diet enriched with fish oil rich in 20:5 and 22:6 n-3 fatty acids modulate the hepatic expression of genes influencing reproductive performance : srebf1 , ascl1 and fabp1 ( hutchinson et al . dietary n-3 fatty acids also increase the progesterone receptor ( pr ) mrna and oestrogen receptor - alpha ( er-1 ) expression ( bilby et al . additionally , free fatty acids might directly modulate pituitary gonadotropin production by upregulating lhb mrna expression and suppressing fshb mrna expression ( sharma et al . none of the above - mentioned genes have been directly regulated in our experiment ; however , a significant part of differentially expressed genes in the livers of base - diet fed rats was involved in regulation of all above - mentioned food - interventions - related proteins ( figs . 8interactions between gnrh - i and gnrh - ii ( blue ) and proteins encoded by differentially regulated genes ( red ) in livers of rats after 3 months of base - diet feedingfig . 9interactions between gnrh - i and gnrh - ii ( blue ) and proteins encoded by differentially regulated genes ( red ) in livers of rats after 14 months of base - diet feedingfig . involved in reproductive system regulation ( green ) and proteins encoded by differentially regulated genes ( red ) in livers of rats after 3 months of base - diet feedingfig . 11interactions between food interventions - related proteins involved in reproductive system regulation ( green ) and proteins encoded by differentially regulated genes ( red ) in livers of rats after 14 months of base - diet feeding interactions between gnrh - i and gnrh - ii ( blue ) and proteins encoded by differentially regulated genes ( red ) in livers of rats after 3 months of base - diet feeding interactions between gnrh - i and gnrh - ii ( blue ) and proteins encoded by differentially regulated genes ( red ) in livers of rats after 14 months of base - diet feeding interactions between food interventions - related proteins involved in reproductive system regulation ( green ) and proteins encoded by differentially regulated genes ( red ) in livers of rats after 3 months of base - diet feeding interactions between food interventions - related proteins involved in reproductive system regulation ( green ) and proteins encoded by differentially regulated genes ( red ) in livers of rats after 14 months of base - diet feeding however , there are some latest data indicating that gonadotrope cell activation pathway gene could be expressed not only in reproductive tissues ( millar 2005 ) . so far , the only well - known pathway connected with gnrh action was associated with fertility regulation in the hypothalamic pituitary gonadal axis . however , current research showed also that expression of genes involved in regulation of gonadotrope cell activation pathway was observed in other cells such as embryonic stem cell , adult brain , skeletal muscle , myocardium tissues , breast cancer stem cells , prostate cancer cell lines , pancreatic ductal adenocarcinoma , liver , kidney , thyroid cancer cells , mammary gland , prostate cancer , bone matrix and neuroblastoma cells ( ames et al . 2013 ; jones et al . 2007 ; kim et al . 2014 ; li et al . 2013 ; ma et al . 2014 ; polovlkova et al . 2009 ; singer et al . 2012 ; turco et al . 2012 ; zhang et al . moreover , the latest studies demonstrate that gnrh are associated with regulation of proliferation , angiogenesis and inflammatory response , which are important in the pathogenesis of diseases associated with aging ( pincas et al . there are also some data about the negative relation between gnrh receptors and growth factors , which play a part in aging processes related to activity of stem cells , tissue regeneration , protein homeostasis and regulation of inflammatory processes leading to the age - related diseases ( cheung and wong 2008 ) . so far , there are only few reports about the influence of gnrh on the aging process and aging - associated diseases . ( 2013 ) showed that silencing of the gene encoding the gnrh receptor resulted in prolongation of c. elegans life . in addition , zhang et al . ( 2013 ) pointed out the relationship between the pituitary gnrh and immunoaging . the second pathway which was influenced by base - diet guanylyl cyclase , in response to calcium levels , synthesizes 3,5-cyclic guanosine monophosphate ( cgmp ) from guanosine triphosphate ( gtp ) . cgmp is associated with processes , such as phototransduction , circadian entrainment , olfactory transduction , vascular smooth muscle contraction , gap junction , long - term depression , salivary secretion , borderline and spontaneous hypertension , platelet activation and learning ability ( cornilescu et al . 2007 ; golombek et al . 2003 ; wang et al . 2013 ; dismuke et al . 2013 ; dam et al . 2014 ; mao et al . 2013 ; kameritsch et al . 2012 ; robinson et al . however , none of these processes were earlier described as related to the liver functions and the metabolism of biologically active compounds . some data suggest a direct link between guanylate cyclase pathway and gonadotrope cell activation , since there is a link between cgmp and genes involved in reproduction regulations , especially prkg1 and nos1 . it has been demonstrated that cgmp analogues stimulate gnrh release , while a cgmp - dependent protein kinase ( prkg1 ) inhibitor conversely blocks nitric oxide - induced gnrh release . therefore , nitric oxide may regulate the heme - containing signalling enzyme , guanylate cyclase , and thereby elevate the second messenger cgmp and facilitate gnrh secretion . additionally , an effect of nitric oxide on the heme - containing enzyme should also be taken into account . cyclooxygenase controls production of prostaglandins , known stimulators of gnrh secretion ( brann and mahesh 1997 ) . taken together , the present study showed that long - term ( 3 and 14 months ) rats feeding with base - diet ( diet enriches with polyphenolic compounds , -carotene , probiotics and n-3 and n-6 polyunsaturated fatty acids ) can affect liver genes expression . on transcriptomic level , the diet exerted its activity by modulating the expression of genes involved particularly in the gonadotrope cell activation pathway and guanylate cyclase pathway , as well as in mast cell activation , gap junction regulation , melanogenesis and apoptosis . the results indicating the strong influence of base - diet on genes involved in the gonadotrope cell activation pathway may suggest the impact of base - diet on reproduction system at the transcriptome level . base - diet especially strongly affects genes involved in regulation of gnrh which is responsible for the release of fsh and lh . this effect is stronger with the age of animals and the length of diet use . the reproductive - cell cycle theory assumes that the hormones that regulate reproduction , mainly lh and fsh , act in an antagonistic pleiotrophic manner to control aging through cell cycle signalling ( atwood and bowen 2011 ) . it means that the improvement of functioning of reproductive system may slow down the rate of senescence , thereby decelerating the rate of aging , and thus the lifespan . it allows us to draw the conclusion that the long - term use of biologically active substances - enriched diet can positively affect the reproductive system , and thus , as a consequence may delay the aging process . however , according to the latest scientific reports , the gonadotrope cell activation pathway plays a part not only in reproduction system , but also in regulation of the aging process . therefore , the results indicating the strong influence of base - diet on genes involved in the gonadotrope cell activation pathway may also suggest the strong impact of base - diet on the aging process by the regulation of gnrh - dependent cells . these results indicate that it is highly probable that base - diet can modify the signalling pathways which control the aging process by changing the expression of genes involved in gonadotrope cell activation and as a result delay the flow of the aging process .

according to the hippocrates theorem let food be your medicine and medicine be your food , dietary interventions may induce changes in the metabolic and inflammatory state by modulating the expression of important genes involved in the chronic disorders . the aim of the present study was to evaluate the influence of long - term ( 14 months ) use of biologically active substances - enriched diet ( base - diet ) on transcriptomic profile of rats liver . the experiment was conducted on 36 sprague dawley rats divided into two experimental groups ( fed with control or base - diet , both n = 18 ) . control diet was a semi - synthetic diet formulated according to the nutritional requirements for laboratory animals . the base - diet was enriched with a mixture of polyphenolic compounds , -carotene , probiotics , and n-3 and n-6 polyunsaturated fatty acids . in total , n = 3,017 differentially expressed ( de ) genes were identified , including n = 218 de genes between control and base groups after 3 months of feeding and n = 1,262 after 14 months . base - diet influenced the expression of genes involved particularly in the gonadotrope cell activation pathway and guanylate cyclase pathway , as well as in mast cell activation , gap junction regulation , melanogenesis and apoptosis . especially genes involved in regulation of gnrh were strongly affected by base - diet . this effect was stronger with the age of animals and the length of diet use . it may suggest a link between the diet , reproductive system function and aging .

there is no doubt that dog is the most favorite pet animal throughout the world . further , due to its physiological similarity with human being , it has turned out to be an ideal model for studying human diseases like diabetes and cancer . therefore , a better understanding about the normal physiological events of dogs might have paramount significance for clinicians , researchers , and pet owners . however , in many cases it is very difficult to have an accurate age estimation of a dog . this is because : ( i ) dog owners fail to keep the birth record of their pets , and it is not possible in stray dogs , ( ii ) dogs like any other companion animal is sold and resold more than once during their lifetime ; hence , change of ownership may cause loss of data regarding age , ( iii ) normal available techniques are not very accurate and/or affordable , and ( iv ) very less information is available about age - related biomarkers in dogs . in a dog , denture wear , loss of elasticity of skin , rough hair coat , and so on are the common external appearances in old age . during this period , hematological alterations like anemia , lowered pcv ( packed cell volume ) , and so on and biochemical changes like decreased serum protein , increased cholesterol , and bun ( blood urea nitrogen ) level , and so on are evident which can be correlated with dysfunction of different organs like liver , kidney , heart , spleen , nervous , and musculoskeletal system , and so on . many disease conditions and/or diseases are also common in geriatric dogs like glaucoma , arthritis , skin disease , arteriosclerosis , prostrate hyperplasia , brown pigmentation of internal organs , and so on . however , all these age - related alterations are not very specific for age determination . importantly , most of these only indicate about the presence or absence of old age . they do not give an idea about the intermediate stages of age progression from young to old age . therefore , efforts should be made to identify novel age - related biomarkers . in many organs , somatic cells undergo a state of permanent growth arrest and altered function after a finite number of divisions , and this is known as replicative senescence . the process of replicative senescence was being established by using the human cells , which showed limited number of doublings before arrest of cell cycle . senescent cells are resistant to apoptosis for a long period of time but are metabolically active . there is also evidence that senescent cells can accumulate in renewable tissues with age and at sites showing age - related pathologies like osteoarthritis and atherosclerosis . by only looking at cell morphology , senescent cells can not be distinguished from quiescent or terminally differentiated cells in tissues . various studies have confirmed that senescent - associated gal ( sa-gal ) is same as normal lysosomal gal . however ; in senescence , overproduction of this protein increases the overall activity of this enzyme . the normal lysosomal gal is active at ph 4 , but sa-gal activity can be easily detected at ph 6 . this might be due to presence of high concentration of sa-gal enzymes in senescent cells . on the basis of this observation that at a higher ph , sa-gal activity can be detected , various protocols have been adapted to detect sa-gal activity in tissues and cell cultures . particularly , the chromogenic substrate 5-bromo-4-chloro-3-indolyl -d - galactosidase ( x - gal ) has been extensively used to detect the sa-gal activity in vivo . gal cleaves x - gal and produce an insoluble blue compound , which is detectable in situ . the x - gal staining is a very useful assay to design a reliable protocol for the identification of senescent cells quickly with simple sectioning and staining procedure . importantly , an increase in sa-gal activity detected in human skin tissues correlated with the old age . we were able to detect sa-gal activity successfully in skin samples obtained through rapid necropsy of dead dogs . gluteraldehyde , 50% solution , reagent grade and magnesium chloride ; anhydrous ; high purity grade was obtained from amresco ( solon , ohio , usa ) . potassium ferrocyanide ( extrapure analytical reagent ) , potassium ferricyanide , and egta ( ethylene glycol tetraacetic acid ) were obtained from sisco research lab pvt ltd ( mumbai , india ) . the fixative solution was prepared with gluteraldehyde ( 0.50% ) , egta ( 1.25 mm ; ph 6 or 7.3 ) , mgcl2 ( 2.00 mm ) and 1 phosphate buffered saline ( pbs ) ( ph 6 or 7.3 ) . the wash buffer was made up with mgcl2 ( 2 mm ) , np-40 ( 0.02% ) and 1 pbs . and the x - gal stain was prepared with x - gal ( 0.6 mg / ml ) , k ferrocyanide ( 4 mm ) , k ferricyanide ( 4 mm ) , and wash buffer . all the tissue samples used in this study were collected during necropsy of dogs that have died just 10 - 15 min before the necropsy procedure . particularly , we collected sample from those dogs whose exact birth record was available with the owner . we also restricted us in collecting and using samples from dogs that have died not due to any chronic disease . most of the samples were collected from dogs that encountered accident and presented at the college of veterinary science and animal husbandry , orissa for treatment , but later on succumbed to death . these cases were referred to the department of veterinary pathology for postmortem / necropsy . in this way , we were able to collect samples from three dogs ( two old and one young ) . further tissue storage and processing was done at the institute of life sciences , bhubaneswar . as samples were collected from dead animals and used in a nonprofitable research study however , before collecting the samples , we took the prior consent of the corresponding owners . previous studies have shown that storage of snap frozen tissues might reduce the activity of sa-gal activity . therefore , the snap frozen tissues were processed on the same day for the x - gal staining . out of curiosity , we also kept one fragment of the snap frozen tissue in -80c and 7 days later processed for further sectioning and staining as described below . tissues were taken out of liquid nitrogen or -80c and immediately embedded in tissue freezing medium ( leica microsystems nussloch gmbh ) . tissue sections of 7 - 15 micron thickness were made by using cryomicrotome ( leica cm1850 ) . after sectioning , tissues were fixed over the charged slides . until beginning of the staining procedure , for the x - gal staining procedure all the working solutions were made fresh from corresponding stocks . this was followed by incubation of slides with x - gal staining solution for more than 12 h in 37c incubator . two beakers containing water were kept inside the incubator for maintaining the humidity and protecting from drying of staining solution ( x - gal ) . last , slides were mounted with aqueous mounting solution ( vectamount aq ; vector laboratories , inc . ; a consecutive frozen slide was stained using h and e. all slides were observed under leica dm500 light microscope and representative photographs were taken . gluteraldehyde , 50% solution , reagent grade and magnesium chloride ; anhydrous ; high purity grade was obtained from amresco ( solon , ohio , usa ) . potassium ferrocyanide ( extrapure analytical reagent ) , potassium ferricyanide , and egta ( ethylene glycol tetraacetic acid ) were obtained from sisco research lab pvt ltd ( mumbai , india ) . the fixative solution was prepared with gluteraldehyde ( 0.50% ) , egta ( 1.25 mm ; ph 6 or 7.3 ) , mgcl2 ( 2.00 mm ) and 1 phosphate buffered saline ( pbs ) ( ph 6 or 7.3 ) . the wash buffer was made up with mgcl2 ( 2 mm ) , np-40 ( 0.02% ) and 1 pbs . and the x - gal stain was prepared with x - gal ( 0.6 mg / ml ) , k ferrocyanide ( 4 mm ) , k ferricyanide ( 4 mm ) , and wash buffer . all the tissue samples used in this study were collected during necropsy of dogs that have died just 10 - 15 min before the necropsy procedure . particularly , we collected sample from those dogs whose exact birth record was available with the owner . we also restricted us in collecting and using samples from dogs that have died not due to any chronic disease . most of the samples were collected from dogs that encountered accident and presented at the college of veterinary science and animal husbandry , orissa for treatment , but later on succumbed to death . these cases were referred to the department of veterinary pathology for postmortem / necropsy . in this way , we were able to collect samples from three dogs ( two old and one young ) . further tissue storage and processing was done at the institute of life sciences , bhubaneswar . as samples were collected from dead animals and used in a nonprofitable research study , we did not seek any animal ethical committee approval . however , before collecting the samples , we took the prior consent of the corresponding owners . previous studies have shown that storage of snap frozen tissues might reduce the activity of sa-gal activity . therefore , the snap frozen tissues were processed on the same day for the x - gal staining . out of curiosity , we also kept one fragment of the snap frozen tissue in -80c and 7 days later processed for further sectioning and staining as described below . tissues were taken out of liquid nitrogen or -80c and immediately embedded in tissue freezing medium ( leica microsystems nussloch gmbh ) . tissue sections of 7 - 15 micron thickness were made by using cryomicrotome ( leica cm1850 ) . after sectioning , tissues were fixed over the charged slides . until beginning of the staining procedure , slides with the tissue were kept on ice . for the x - gal staining procedure initially , slides were placed in fixative for 30 min at 4c . then slides were rinsed with wash buffer for 4 5 min . this was followed by incubation of slides with x - gal staining solution for more than 12 h in 37c incubator . two beakers containing water were kept inside the incubator for maintaining the humidity and protecting from drying of staining solution ( x - gal ) . last , slides were mounted with aqueous mounting solution ( vectamount aq ; vector laboratories , inc . ; a consecutive frozen slide was stained using h and e. all slides were observed under leica dm500 light microscope and representative photographs were taken . as discussed above , the key to distinguish a lysosomal gal activity from sa-gal activity is staining at different ph - range ( 4 or more than 6 ) . in the current study , we noticed x - gal staining both at ph 6 and ph 7.3 . as reported earlier , we observed a reduction of sa-gal activity after freezing of tissues in -80c . however , even after 5 - 6 days of storage in -80c , we were able to detect x - gal staining ; though of lower intensity . this observation is not in accordance with a previously reported statement that even overnight storage of tissue samples at -80c can destroy the enzyme activity . the staining was detectable after minimum of 10 h incubation and staining intensity went on increasing with an increase in incubation time . staining was mostly noticed at the inner epithelial layers of hair follicles and sebaceous glands [ figure 1a and b ] . further , the x - gal staining intensity was more intense at ph 6.0 than ph 7.3 [ figure 2a and b ] . overall , the number of hair follicles positive for x - gal was more at ph 6.0 than ph 7.3 . we did not have enough samples to make a comparison of x - gal positive cells ( % ) in young and old age animals ; however , in the tissue of only one young dog available with us , we did not see any staining even after 20 h of incubation ( data not shown ) . histology of a dog skin tissue stained with h and e or x - gal ( a ) h and e stained dog skin tissue shows presence of various cellular components of epidermis and dermis . arrows ( yellow ) indicate follicular epithelia cells ( compound follicle ) , stars indicate stromal cells , and triangle indicates epithelial cells of a sebaceous gland . for h and e staining , frozen skin sample of a greatdane dog ( ~5 years old ) was cryosectioned and processed by usual h and e staining procedure . ( b ) x - gal stain of a corresponding tissue shows clear x - gal staining ( red arrow ) in the region of follicular epithelium and sebaceous gland . the tissue was from the same dog and processed for x - gal staining at ph 7.3 . note : tissue used in this experiment was preserved at -80c for 5 days after its snap freezing in liquid nitrogen x - gal staining at different ph ( a ) gross appearance of canine skin tissues stained with x - gal . all the staining regents were adjusted to ph 6 or 7.3 . cryosectioned skin tissues were stained for x - gal at different ph , and after overnight ( 12 h ) staining , photos of those slides were taken by normal digital camera . staining at ph 6 produced more intense color ( blue ) than at ph 7.3 . ( b ) microscopic images of tissues stained at different ph of staining solutions . more intense x - gal staining ( blue ) was observed at ph 6 than ph 7.3 knowledge about the age of a dog might have multiple uses in clinic and research . currently , available techniques for the detection of a dog 's age are not very reliable . the measurement of gal activity has been proposed to be a marker for the estimation of a human age . however , not much effort has been made to detect the expression of this protein in other species like dog . to best of our knowledge , the current study is the first report regarding possible detection of endogenous gal activity in dog skin tissue . detection of gal activity in skin tissues obtained through rapid necropsy showed the feasibility of detecting this molecule 's activity from just died and most potentially from live animal 's skin . further , detection of x - gal staining efficiently in the epidermis of skin suggests requirement of a small amount of superficial skin for carrying out this analysis . x - gal staining of canine tissues might be instrumental in estimating the proper age of a dog it has also potential use in forensic science including wildlife forensic , where age estimation is warranted . for better use of this technique , an extensive analysis is required to get the actual idea about sa-gal activity in different age , sex , and breed of dogs . we also believe that skin tissues from different regions of the same animal might have different number of senescent cells ; therefore , a more in - depth study is required before the adaptation of x - gal staining as a marker for old age of dogs . lac - z , the bacterial gal , has been widely used as a reporter gene in many animal models including dogs . in most of the gene therapy studies in dog , lac - z has a similarity with endogenous gal of other species ; therefore , an idea about expression level of endogenous gal expression / activity in different organs of this animal , might help to carry out x - gal staining in a more careful fashion and proper interpretation of the results . in various literatures , most of the protocols recommend ph 7.3/7.4 for lac - z staining ; however , at this ph we were also able to detect endogenous -gal activity . therefore , during lac - z staining of canine tissues , tissue from the control animals should be used to avoid confusion of background staining . furthermore , detection of senescent cells through x - gal staining in canine tissues will help in checking the coexistence and functional significance of these cells in different chronic diseases like cancer . taken together , we believe that our current report has shown the possibility of carrying out x - gal staining with canine tissues and has created an opportunity to exploit this technique for several clinical and research studies . on the basis of the current study , following conclusions are made : sa-gal activity in dog is detectable through x - gal staining in situ;use of x - gal staining reagents with higher ph ( 7.3 ) might help in detecting more specifically senescent cells than previously suggested ph ( 6);x - gal staining is possible with tissues collected immediately after death;storage of tissues at -80c reduce sa-gal activity ; however , x - gal staining is still feasible in those frozen tissues;x - gal staining of dog skin tissue has the potential to be explored as a marker of senescence or old age . sa-gal activity in dog is detectable through x - gal staining in situ ; use of x - gal staining reagents with higher ph ( 7.3 ) might help in detecting more specifically senescent cells than previously suggested ph ( 6 ) ; x - gal staining is possible with tissues collected immediately after death ; storage of tissues at -80c reduce sa-gal activity ; however , x - gal staining is still feasible in those frozen tissues ; x - gal staining of dog skin tissue has the potential to be explored as a marker of senescence or old age .

background : estimation of -galactosidase ( gal ) activity in human cells and tissues indicate its possible use as a marker of senescence.objectives:this study was done to detect senescence - associated gal ( sa-gal ) activity in canine skin tissue by using its substrate 5-bromo-4-chloro-3-indolyl -d - galactosidase ( x - gal).materials and methods : skin samples were collected through rapid necropsy process . the x - gal staining was done by altering different factors of the staining procedure like ph of the reagents and incubation time . further , effect of tissue preservation procedure was also evaluated.results:typical x - gal staining was detected in old dogs skin samples and it was detectable both at ph 6 and ph 7.3 . the cells present in the inner lining of the hair follicles and sebaceous glands are the major cells that have high sa-gal activity . the x - gal staining intensity was more prominent in tissues preserved in liquid nitrogen at -196c than in -80c freezer . prolonged incubation period increased the intensity of staining.conclusions:this study indicates possibility of x - gal staining in canine tissues and opens an avenue for further in - depth studies that might be useful for different research and clinical studies like determination of dog 's approximate age .

non - specific odontogenic infections are among the most frequent disorders of bacterial origin that affect individuals during the course of their life . before antibiotic treatment was available , the mortality rate of these disorders was 1040% , but the discovery of antibiotics led to a significant improvement of this rate . however , the last 1015 years have witnessed a rebound of severe odontogenic infections caused by highly aggressive antibiotic - resistant bacteria . the main cause indicated by the literature for the development of bacteria resistant to antibiotic therapy is the incorrect or inefficient administration of antibiotics . currently , a number of antibiotics for inflammatory dental pulp disorders or established abscesses are administered . the efficiency of these antibiotics is extremely limited because of the circulation disorders present in the inflammatory focus and , in addition , there is a high risk for inducing adverse reactions and antibiotic resistance of the bacteria involved in the development of the septic process . for this reason , we believe that it is extremely important to evaluate the way in which antibiotics are administered and their efficiency on the bacterial flora involved in the development of odontogenic suppurations , in the absence of surgery . the aim of this study is to prospectively determine the type of antibiotics used by patients with odontogenic head and neck soft tissue infections , from the point of view of their efficiency on the bacterial flora involved in the development of the septic process . the study included 10 randomly selected patients with suppurations of odontogenic origin who presented to the clinic of oral and maxillofacial surgery cluj - napoca in the period january 2014 july 2014 . the patient selection criteria were : perimaxillary soft tissue infections of odontogenic origin , disease duration of at least 5 days , antibiotic treatment duration of at least 4 days , known type and mode of administration of antibiotic medication , antibiotic treatment prescribed by the family doctor or the dentist , patient treated under continuous hospitalization , patient from which biological samples were taken for bacteriological examination and antibiogram determination , no other systemic pathology types with a possible influence on the immune response , adult patient having signed an informed consent for participation in the study . the variables monitored for each patient were : general data ( age , sex ) , location of infection , time from onset to presentation , type of antibiotic treatment and route of administration used , bacteriological examination and antibiogram result , postoperative evolution . after the emergency admission of the patients , surgery was performed under locoregional anesthesia . after the asepsis and antisepsis of the operative field , biological samples were collected in a closed environment and were subsequently sent for bacteriological examination and antibiogram determination . the results obtained were centralized in the study data base . for the development of contingency tables , microsoft excel software was used , and the statistical interpretation of the results was performed using microsoft excel . of the patients included in the study , 6 were males and 4 were females . the mean age of the patients was 35.4 years , with a minimum age of 22 years and a maximum age of 49 years . the mean age of female patients was 28.75 years and that of male patients 39.83 years . regarding the location of the septic process in perimaxillary soft tissues , the majority of the infections were located in the submandibular gland area , followed by those located in the genial region ( figs . 1 , 2 ) . in the case of the patients included in the study , a time period between 5 and 12 days , with a mean of 7.4 days , lapsed from the onset of the septic process to the presentation for specialized treatment . during this time period , all patients used antibiotic treatment , with a mean of 1.2 antibiotic types ; 8 of the 10 patients had one antibiotic type , and 2 patients had 2 antibiotic types . 3 ) , and the most frequent route of administration was the oral route , only in two cases the antibiotics being administered by intravenous route . the bacteriological result obtained from the purulent secretion samples collected from the septic focus evidenced microbial polymorphism ( tab . i ) . in half of the patients included in the study , the identified bacterial flora had no sensitivity to the antibiotics 4 ) , and in one patient in whom several bacterial strains were detected , some of these were sensitive to the antibiotic administered to the patient . after the incision and the drainage of the suppuration were performed , along with the change of the antibiotic scheme according to the antibiogram , the patients postoperative evolution was favorable . the objectives of the study were reached and the main types of antibiotics administered to patients with odontogenic septic processes complicated by perimaxillary suppurations were determined . it can be seen that the majority of the patients included in the study were young adults , which is confirmed by other literature studies . authors analyzing extensive groups of patients evidence the fact that odontogenic infections mainly affect patients in the third decade of life , which is confirmed in this study only by female patients , male patients having a more advanced age , but without a significant difference . of the patients included in the study , however , it can not be concluded based on the presented data that the male sex is more frequently affected by cervical inflammatory disorders of odontogenic origin , because the patient inclusion criteria were very restrictive and the number of patients included in the study was limited . most authors opine that there is a higher incidence of odontogenic infections among male patients , but the differences between the two sexes are extremely varied . regarding the antibiotics prescribed to the patients included in the present study , it can be seen that more than half of the patients received amoxicillin treatment with or without beta - lactamase inhibitors . the majority of the patients took the antibiotic without beta - lactamase inhibitors , which is contrary to literature studies , which show that the main antibiotic administered for odontogenic infections is amoxicillin with beta - lactamase inhibitors . the administration of an effective antibiotic in odontogenic infections is particularly important in the attempt to limit the septic process . when the antibiotic has no effect on the main bacterial strains involved in the development of the infection and only eliminates less aggressive pathogens , the premises for extremely severe and very difficult to control infections are created . bacteriological examination evidenced the presence of a varied bacterial flora , but in the majority of the cases , a single bacterial strain in each patient was obvious . the presence of a single bacterial strain in each patient is surprising , given the fact that at the level of the infected dental pulp or periodontal space , the main sources of bacterial flora for odontogenic suppurations , an increased number of bacterial species are concomitantly identified . thus , it is possible that the early administration of bacterial therapy may select the majority of the bacterial species sensitive to the administered antibiotic and a single bacterial species may remain in the septic focus . this hypothesis is also supported by the antibiogram result , which evidenced no sensitivity of the identified bacteria to the administered antibiotic . another possible cause of the identification of a single bacterial strain might be the technical limitations of microbiology laboratories or the way of collecting biological samples , which pose difficulties in identifying some bacterial strains , particularly anaerobic ones . the fact that most of the administered antibiotics were not active on the identified bacterial flora is an alarm signal . the lack of efficiency of the antibiotic on the main bacterial strains involved in the development of the septic process implicitly leads to an increase of the difficulty of treatment of these infections . some authors indicate the use of antibiotics as a single treatment , in the absence of a preliminary bacteriological examination , as the main factor favoring the development of severe odontogenic infections such as necrotizing fasciitis . the exhaustion of the action of common antibiotics on the bacteria involved in the development of common cervical infections leads the practitioner to use niche antibiotics that should not be used under normal conditions . a limitation of this study is the fact that it does not take into account possible cases of patients with odontogenic infections who received antibiotic treatment alone and who had a favorable evolution . these cases can not be monitored in such studies because these patients do not ask for specialized help . most common antibiotics used as a single therapy for the treatment of cervical infections of odontogenic origin have a limited action , and the association of antibiotic treatment with surgery is recommended . the administration of antibiotics according to the bacteriological examination and antibiogram , associated with surgery , led to a favorable evolution of the patients included in this study .

background and aims.odontogenic infections are among the main types of disorders located in the cephalic extremity . the aim of this study was to determine the efficiency of empirically administered antibiotics on the bacterial strains identified at the infection sites.patients and method.the study included 10 randomly selected patients with odontogenic cervical soft tissue infections , who received antibiotic treatment prescribed by the family doctor or the dentist . the bacterial flora involved in the development of the septic process , the type of antibiotic administered to the patient and the sensitivity of the identified bacterial flora to the administered antibiotic were determined.results.in the 10 selected patients , 14 bacterial strains were detected ; 7 patients had a single bacterial strain , and 3 patients had two or three types of bacteria . of the administered antibiotics , amoxicillin was the most widely used ( 33.3% of the cases ) , followed by amoxicillin with beta - lactamase inhibitors ( 25% of the cases ) . in half of the patients , there was no sensitivity of the bacteria detected in the septic focus to the empirically administered antibiotic , and in 10% of the cases , partial sensitivity was evidenced.conclusions.empirical administration of antibiotics without the association of surgery did not prove to be effective in the treatment of cervical infections of odontogenic origin .

whereas the management of localized renal cell carcinoma ( rcc ) has evolved toward minimally invasive and nephron - sparing surgery , the treatment of endophytic renal tumors has remained problematic . these tumors typically require precise intracorporeal suturing and complex reconstruction , with the added time constraints imposed by renal ischemia . even open partial nephrectomy is acknowledged to be technically demanding in this situation , with increased complication rates compared with procedures for tumors in peripheral locations . in addition , serial studies of laparoscopic partial nephrectomy ( lpn ) report higher postoperative complication rates , which result in more ischemic time and longer hospital stays for endophytic tumors [ 2 - 4 ] . with the increasing application of minimally invasive surgery , several energy - based tissue ablation technologies including cryoablation and radiofrequency ablation are being investigated . in these procedures , tissue is destroyed in situ , thereby avoiding the complications induced by renal ischemia and surgical excision . although energy - based ablation may injure the collecting system , clinical and preclinical studies on cryoablation have demonstrated the ability of this technique to manage tumors located almost within the collecting system without compromising the integrity of the underlying structure [ 5 - 7 ] . in addition , the laparoscopic approach allows the surgeon to position the cryoprobe by using intraoperative ultrasonography more precisely and to move adjacent organs away from the ablation site . if the surgical and oncological outcomes support the feasibility and efficacy of laparoscopic cryoablation ( lrc ) for endophytic renal tumors , and safety can be maintained during the surgical procedure , this method may provide an alternative nephron - sparing surgery for selected patients . to determine this , we evaluated the intermediate - term outcome of lrc in patients with endophytic rcc . from june 2005 to may 2009 , lrc was performed on 45 renal tumors in 39 patients at our institution . indications for lrc included the presence of a localized , solid enhancing renal mass smaller than 4 cm in a patient at high risk for partial nephrectomy or older than 70 years of age . high operative risk in our institution was defined as an american society of anesthesiology ( asa ) physical status score of over 3 . among these inclusion criteria for lrc , absolute indications included bilateral tumors and a patient with a solitary kidney or renal insufficiency . a patient with normal contralateral renal function but poor operability was defined as an elective indication . all patients underwent a preoperative radiologic evaluation with contrast - enhanced computed tomography ( ct ) or magnetic resonance imaging ( mri ) in the case of renal insufficiency to delineate the parameters of the renal lesion , including location , size , depth , and position relative to hilar vessels and the collecting system . all patients who underwent lrc in our institution were registered prospectively in a specific database that included all important information about tumor and patient characteristics including operative time , blood loss , hospital stay , pathology findings , and occurrence of complications . this allowed us to collect and analyze the data of the patients retrospectively , depending on the location of the tumor and pathologic findings . three attending urologists reviewed the preoperative imaging studies for each patient to categorize the renal mass depending on tumor position . an endophytic location of a tumor in this study was defined as less than 40% of the lesion extending off the surface of the kidney ( fig . 1 ) , as originally described by finley et al . among all patients who underwent lrc , 15 tumors from 14 patients who were confirmed as having rcc by intraoperative needle biopsy and patients were initially evaluated at 1 month and 3 months , then every 3 months during the first year . follow - up evaluations involved a medical history update , physical examination , blood pressure measurement , contrast - enhanced ct or mri , chest radiography , measurement of serum electrolytes , liver function tests , and renal function tests . a lack of enhancement on ct or mri along with stable or decreased tumor size were considered signs of successful treatment . recurrence was defined as increasing tumor size or lack of tumor shrinkage , with image enhancement . all lrc procedures were conducted by a single surgeon with use of nearly identical technique . for the laparoscopic procedure , a standard technique using three ports was performed . in general , tumors anterior to a horizontal line within the coronal plane through the renal hilum were approached transperitoneally , and tumors posterior to this line were approached retroperitoneally . real - time intraoperative ultrasonography ( ious : aloka dynaview ii , americanlab , miami , fl , usa ) was used in all cases to identify the lesion and to determine the degree of the ice ball extension . the kidney was mobilized and the gerota 's fascia was opened to facilitate identification of the tumor . up to two needle biopsies were taken from the tumor before the insertion of a cryoprobe . then 1.47 mm cryoprobes ( icerod , oncura , plymouth meeting , pa , usa ) were inserted , each of which induced a -40 isothermal lesion 14.5x34 mm in diameter and radiating from the ablation probe . before insertion into the kidney , the proper number and positions of the cryoprobes temperature probes were then inserted into the deep margins of the tumor . in all cases , a double - freeze cycle was applied , with an intervening thawing process . at the base of a lesion in proximity to the collecting system , the extent of the ice ball was identified by ious as a complete loss of echogenic lesion in the circumferential area of the base . hemostasis was achieved by filling the probe tract with fibrin glue ( baxter , deerfield , il ) and surgicel ( johnson & johnson , irvine , ca , usa ) after the second thaw allowed the safe removal of the cryoprobe . all data were analyzed with the statistical package for the social sciences , version 13 ( spss inc , usa ) . statistical comparison of pre- and postoperative values was performed with paired t - tests , with differences considered statistically significant if p<0.05 . from june 2005 to may 2009 , lrc was performed on 45 renal tumors in 39 patients at our institution . indications for lrc included the presence of a localized , solid enhancing renal mass smaller than 4 cm in a patient at high risk for partial nephrectomy or older than 70 years of age . high operative risk in our institution was defined as an american society of anesthesiology ( asa ) physical status score of over 3 . among these inclusion criteria for lrc , absolute indications included bilateral tumors and a patient with a solitary kidney or renal insufficiency . a patient with normal contralateral renal function but poor operability was defined as an elective indication . all patients underwent a preoperative radiologic evaluation with contrast - enhanced computed tomography ( ct ) or magnetic resonance imaging ( mri ) in the case of renal insufficiency to delineate the parameters of the renal lesion , including location , size , depth , and position relative to hilar vessels and the collecting system . all patients who underwent lrc in our institution were registered prospectively in a specific database that included all important information about tumor and patient characteristics including operative time , blood loss , hospital stay , pathology findings , and occurrence of complications . this allowed us to collect and analyze the data of the patients retrospectively , depending on the location of the tumor and pathologic findings . three attending urologists reviewed the preoperative imaging studies for each patient to categorize the renal mass depending on tumor position . an endophytic location of a tumor in this study was defined as less than 40% of the lesion extending off the surface of the kidney ( fig . 1 ) , as originally described by finley et al . among all patients who underwent lrc , 15 tumors from 14 patients who were confirmed as having rcc by intraoperative needle biopsy and patients were initially evaluated at 1 month and 3 months , then every 3 months during the first year . follow - up evaluations involved a medical history update , physical examination , blood pressure measurement , contrast - enhanced ct or mri , chest radiography , measurement of serum electrolytes , liver function tests , and renal function tests . a lack of enhancement on ct or mri along with stable or decreased tumor size were considered signs of successful treatment . recurrence was defined as increasing tumor size or lack of tumor shrinkage , with image enhancement . all lrc procedures were conducted by a single surgeon with use of nearly identical technique . for the laparoscopic procedure , a standard technique using three ports was performed . in general , tumors anterior to a horizontal line within the coronal plane through the renal hilum were approached transperitoneally , and tumors posterior to this line were approached retroperitoneally . real - time intraoperative ultrasonography ( ious : aloka dynaview ii , americanlab , miami , fl , usa ) was used in all cases to identify the lesion and to determine the degree of the ice ball extension . the kidney was mobilized and the gerota 's fascia was opened to facilitate identification of the tumor . the fat overlying the tumor was placed aside and later retrieved for pathology examination . up to two needle biopsies were taken from the tumor before the insertion of a cryoprobe . then 1.47 mm cryoprobes ( icerod , oncura , plymouth meeting , pa , usa ) were inserted , each of which induced a -40 isothermal lesion 14.5x34 mm in diameter and radiating from the ablation probe . before insertion into the kidney , the proper number and positions of the cryoprobes temperature probes were then inserted into the deep margins of the tumor . in all cases , a double - freeze cycle was applied , with an intervening thawing process . at the base of a lesion in proximity to the collecting system , the extent of the ice ball was identified by ious as a complete loss of echogenic lesion in the circumferential area of the base . hemostasis was achieved by filling the probe tract with fibrin glue ( baxter , deerfield , il ) and surgicel ( johnson & johnson , irvine , ca , usa ) after the second thaw allowed the safe removal of the cryoprobe . all data were analyzed with the statistical package for the social sciences , version 13 ( spss inc , usa ) . statistical comparison of pre- and postoperative values was performed with paired t - tests , with differences considered statistically significant if p<0.05 . among 45 renal tumors treated with lrc in our institution , 17 ( 37.8% ) were defined as endophytic tumors . among them , 15 tumors from 14 patients were confirmed as rccs and were exclusively enrolled in this series . five tumors were centrally located , which was defined as being completely surrounded by normal parenchyma , with no visual clue regarding the location of the tumor on laparoscopy . one patient had a hilar tumor , which was defined as a tumor positioned medially within 5 mm of the renal artery or vein . the mean ( range ) age of the 14 enrolled patients was 61.4 years ( range , 43 - 75 years ) old . four patients ( 28.6% ) were over 70 years old , and their mean age was 72.8 years ( range , 70 - 75 years ) old with a mean asa physical status score of 2.3 ( range , 1 - 3 ) . the mean asa physical status score of the whole patient group was 2.9 ( range , 1 - 4 ) , and 85.7% ( 12/14 ) of patients had an asa physical status score over 3 . the indications for nephron - sparing surgery included a bilateral tumor in 2 patients , solitary kidney tumors in 3 patients , and chronic renal failure in 1 patient . the mean tumor size was 2.8 cm ( range , 1.7 - 3.7 cm ) and the mean operating time was 169.7 minutes ( range , 110 - 220 minutes ) . the mean time of the first freeze cycle was 7.9 minutes , and the mean of the second freeze cycle was 7.4 minutes . in the case of five central tumors , more fat tissue overlying the kidney was removed to achieve an adequate image for monitoring the position of the cryoprobe tip . in the case of a hilar tumor , the major renal vessels , ureter , and renal pelvis were displaced from the ice ball with vascular loops , and rolled gauze was placed into the renal hilum . in all patients , multiple cryoprobes were used , and the mean number of cryoprobes needed was 3.2 ( range , 2 - 5 ) . the mean blood loss , measured as the amount in the suction device , was 99.5 ml ( range , 40 - 150 ml ) . no major complications , including open surgical conversion and nephrectomy due to bleeding , occurred in any patient . the serum creatinine and hemoglobin levels checked 7 days after surgery showed no significant differences compared with preoperative levels . the average preoperative and postoperative creatinine levels were 1.31 mg / dl and 1.43 mg / dl , respectively ( p=0.13 ) . the average preoperative and postoperative hemoglobin levels were 13.94 g / dl and 13.21 g / dl , respectively ( p=0.57 ) . one patient who had a previous subtotal gastrectomy for early gastric adenocarcinoma needed a postoperative transfusion due to a low preoperative baseline hemoglobin level ( 8.4 g / dl ) . the mean hospital stay was 4.1 days ( range , 3 - 8 days ) , and during this stay , no one experienced clinical signs or symptoms of collecting system injuries , including flank pain , fever , and leukocytosis . in the pathologic examination , all of the patients showed common clear cell carcinoma , rcc , except for two patients with papillary type 1 . the mean follow - up was 32.6 months ( range , 12 - 51 months ) . follow - up imaging studies revealed no evidence of hydronephrosis , and all patients remained asymptomatic . a 2.2 cm sized central tumor was in direct contact with the collecting system , as shown by the enhancing portion in the deep peripheral area of the cryoablated site in an initial follow - up ct taken 1 month after lrc . due to his high anesthesiologic risk from myocardial infarction , which required vascular stenting 3 times , and the anterior location of the tumor , which disturbs deployment of the probes for other minimally invasive ablative techniques including radiofrequency ablation , this patient is currently under active surveillance . follow - up images showed no increase in the enhancing lesion or distant metastasis for 24 months after the initial lrc . except for this patient , all other patients have remained free of recurrence or metastasis as shown by the periodic radiologic workups . the mean size of these properly treated lesions was 2.750.72 cm , 2.960.42 cm , 2.710.26 cm , 2.430.19 cm , 2.240.21 cm , 1.260.31 cm , and 1.080.34 cm before surgery , and at 1 month , 3 months , 6 months , 9 months , 12 months , and 24 months , respectively ( fig . 2 , 3 ) . because small renal tumors emerge incidentally during imaging for various indications , questions persist about the best way to treat endophytic tumors with a minimally invasive technique . although 3- , 5- , and 10-year - old data encourage the use of renal cryoablation , especially for tumors in peripheral locations [ 14 - 16 ] , extending these findings to endophytic tumors is still under debate . because of the proximity to the renal vasculature and the collecting system , the cryoablation of an intraparenchymal endophytic tumor can potentially be disturbed by natural heat sinks , including the blood and urine . actually , wright et al reported two cases of treatment failure , both in endophytic tumors ( i.e. , completely intrarenal lesions ) , among 35 lrc lesions during an 18-month follow - up . in the multivariate analysis in their study , in contrast to this , hurby et al reported the successful treatment by lrc in all 11 patients with tumors located within 5 mm of the renal vasculature during 11.3 months of follow - up . considering the technical difficulty of lpn in endophytic and hilar lesions , nisbet et al formulated an algorithm on the basis of published series outcomes that recommended lrc for endophytic and lpn for exophytic and mesophytic lesions . our results provide additional evidence for the efficacy of lrc for the treatment of endophytic tumors . with intermediate - term follow - up , whereas 1 among 15 rcc lesions was managed improperly with lrc , the other lesions have remained free of recurrence or metastasis . although we studied a small number of patients , the treatment failure rate of 6.7% in our series agrees with the positive margin rate of 1 - 7.4% in partial nephrectomy . this result provides us with technical clues for successful ablation in cases of endophytic lesions . we usually planned the position of the cryoprobe tip on the basis of the preoperative imaging , including ct or mri . in our series , the skin insertion site of each probe , the depth of insertion of the cryoprobe into the tumor in the operative filed , and the number of cryoprobes were decided on preoperatively on the basis of the shape , location , and diameter of the tumor . the ious image is also valuable , especially in guiding the location of the cryoprobe for endophytic tumors , because laparoscopic visual cues alone do not permit precise localization of cryoprobe tips , leaving ious as the only mode of real - time imaging . however , the image during freezing is distorted by several factors , including artifacts at the leading edge of the ice ball and inability to monitor the periphery of the mass , as noted by badger et al . in our lrc experience with endophytic tumors , the capacity of ious to monitor ice ball expansion is limited , especially for endophytic intraparenchymal tumors , because the collecting system itself behaves as an anechoic lesion . to inflict lethal freezing injury throughout the tumor volume while sparing normal healthy tissues , the targeted lesion should be located within the lethal area of cryoablation , and a temperature below -40 is usually required to effectively destroy malignant renal tissue . unfortunately , no tool currently available can precisely define the three - dimensional configuration of this critical isothermal surface during cryoablation . thus , we surmise that the use of multiple cryoprobes is more practical than focusing on the accuracy of the cryoprobe itself for conducting lrc for an endophytic lesion . hypothetically , this approach might increase freezing efficiency by extending the coldest isothermal line , as compared with a single probe , and the distribution of the probes across the tumor might also compensate for an asymmetric tumor shape . particularly for an intraparenchymal tumor , the use of multiple cryoprobes may have the additional advantage of evading the natural heat sink effect , a barrier intrinsic in low - temperature - based ablation . one challenge a surgeon faces in a partial nephrectomy , whether open or laparoscopic , on a patient with an endophytic renal tumor is reconstruction of the collecting system . cryoablation averts this challenge , but not the risk of injury to the collecting system , with resultant urine leakage , particularly for endophytic and deep lesions . however , recent reports on renal cryoablation support the tolerance of the collecting system to the radiographic ice ball formed in the procedure . targeted renal pelvic cryoablation resulted in no urinary extravasations from a total of 15 lesions in a swine model . in a clinical setting , six patients with intraparenchymal tumors who were treated by percutaneous cryoablation revealed no clinical evidence of ureteral sequelae . in a comparison of 11 lrc and 12 lpn procedures for hilar tumors that were defined as located within 5 mm of the renal vasculature , the lrc group experienced no complications , whereas the complication rate of the lpn group was 50% , with urine leakage being the most significant complication . similarly , in our series of 14 patients with endophytic tumors , none showed clinical or radiological evidence of collecting system injury during the minimum follow - up of 28 months . these studies together support the safety of the cryoablative ice ball for the underlying structure of the kidney . we still recognize several limitation of this series , including this being the experience of a single institution for a relatively small number of cases . the noncomparative , retrospective study design may also limit the application of our findings . obviously , to establish the effectiveness of a new technique , prospective studies must be conducted to compare the new technique with conventional methods . however , it deserves notice that our patient criteria for lrc included high risk for anesthesia with severe co - morbidity or relatively old age , leaving lrc as the last surgical treatment option . still , the application of cryoablation to renal tumors is currently in the investigational stage , despite the promising reported clinical outcomes . therefore , although our data showed the intermediate - term oncologic efficacy of lrc , longer follow - up with larger scale series is still needed before ablative technologies can be established as a valid alternative option for the treatment of renal tumors and before their indication can be expanded to endophytic renal tumors . in this series with an intermediate - term follow - up , lrc for small endophytic tumors showed acceptable oncological and surgical outcomes without adverse effects in the collecting system . these results also emphasize that careful preoperative design of the layout of the cryoprobes and the use of multiple cryoprobes should be given special consideration , especially in endophytic cases . however , further studies with longer term follow - up and larger patient groups are needed to establish the position of ablative technologies in the treatment of renal tumors and to extend their application to renal tumors in endophytic locations .

purposeto evaluate the efficacy and safety of laparoscopic renal cryoablation ( lrc ) of small endophytic renal cell carcinoma , for which surgical treatment is technically difficult.materials and methodswe enrolled patients with endophytic tumors from a prospectively collected database of 45 renal tumors in 39 patients who had undergone lrc from june 2005 to may 2009 . an endophytic tumor was defined as less than 40% of the lesion extending off the surface of the kidney . we evaluated surgical and oncological outcomes.resultsamong the treated tumors , 17 tumors ( 37.8% ) were defined as endophytic tumors and 15 tumors from 14 patients were confirmed as renal cell carcinoma ( rcc ) in the pathologic examination of the tissue biopsy that was conducted at the time of lrc . the mean american society of anesthesiologists ( asa ) score of the whole patient group was 2.9 ( range , 1 - 4 ) , and 85.7% ( 12/14 ) of the patients had an asa physical status score over 3 . the mean tumor size was 2.8 cm ( range , 1.7 - 3.7 cm ) . the layout of the cryoprobe was carefully planned preoperatively on the basis of radiologic evaluation in all tumors . multiple cryoprobes ( mean , 3.2 ; range , 2 - 5 ) were used . no major complications , including open surgical conversion and nephrectomy due to bleeding , occurred . no patient experienced clinical symptoms of collecting system injuries . during the mean follow - up of 32.6 months ( range , 12 - 51 months ) , radiologic evidence of tumor recurrence was found in one patient ( 6.7% for rcc ) . with the exception of this patient , all other patients have remained free of recurrence or metastasis , as determined by periodic radiologic workups.conclusionsin this series of patients with intermediate - term follow - up , lrc for endophytic renal cell carcinoma showed acceptable oncological and surgical outcomes without sequelae in the collecting system .

parkinson disease ( pd ) is a progressive neurodegenerative disorder with widely heterogeneous manifestations , including motor , nonmotor and neuropsychiatric symptoms . it affect~1% of the people older than 60 years.13 the major pathologic feature of pd is the loss of dopaminergic neurons in substantia nigra pars compacta and , consequently , basal ganglia.4,5 sex differences in prevalence , clinical presentations and severity of pd have been reported in some previous studies.69 although the exact sources of these differences in pd are unknown , sex hormones , genetic factors and variations in dopaminergic pathways have been proposed as possible underlying reasons.1014 identifying sexual variations influences prevention , therapeutic strategies and understanding of sex - related neurobiological differences.15,16 exploration of sexual dimorphism in neurologic diseases such as pd has been recently announced as a research need.3 while studies are unanimous about the higher prevalence of pd among men , there are conflicting data regarding sex differences in clinical manifestations , progression and treatment outcome.1723 motor presentations ( ie , tremor and dyskinesia ) , psychological manifestations ( especially depression ) , sleep behavior disorders and cognitive impairment have been reported as potential aspects of sexual dimorphism in pd.1723 however , data are still controversial , inconclusive and even conflicting in some aspects . as an example , a recent randomized clinical trial did not find any sex differences in daily activities and main motor features.24 in addition to lack of comprehensive data , these controversies can be partly due to interrelationship and confounding effects of clinical and demographic variables.3 some clinical features that were previously reported to be sex related failed to show any difference between males and females with pd when controlled for other demographic and clinical variables . for instance , cognitive impairment was reported to be more common in men;9 however , the difference was much less pronounced when the effect of age , level of education and disease severity were taken into account.23 in another large study , univariate analysis showed that daily activity was more impaired in females , but multivariate analysis revealed no significant sex difference.24 having collected comprehensive data on different pd- related and general features , we aimed to further investigate sexual dimorphism in pd . our objective was to determine independent differences in clinical manifestations and subtypes , psychosocial functioning , quality of life ( qol ) and its domains between males and females with idiopathic parkinson s disease ( ipd ) using a powerful statistical approach . our a priori research hypothesis was that females with pd experienced more severe nonmotor manifestations , which would also influence their qol and psychosocial functioning more prominently than males . this study was conducted on 157 consecutive patients with ipd from an outpatient referral movement disorders clinic in tehran , iran , between october 2011 and december 2012 . this was a collaborative project between iran university of medical sciences ( tehran , iran ) and karolinska institute ( stockholm , sweden ) . the study protocol was approved by the ethics committee of the neurology department at firoozgar clinical research development center ( fcrdc ; affiliated to iran university of medical sciences ) . prior to the launch of the study , all patients were informed about the aims and procedures . all participants provided their verbal informed consent to participate in this study . since the project was designed as an observational research , verbal form of consent was approved by the aforementioned ethics committee . participation in this study was voluntary , and the patients were free to withdraw from the project whenever they decided . furthermore , the identity of research participants was protected , since the data files were anonymous and all names were omitted . recruited patients fulfilled the following inclusion criteria : diagnosis of ipd based on the uk brain bank criteria,25 which was assessed by the same neurologist who was specialized in movement disorders for all participants ; current age of 30 years or older and motor disability in the mild - to - severe range but not in the advanced stages that needs wheelchair or hospitalization according to the hoehn and yahr ( h&y ) criteria ( stage < 5).26 patients with moderate to severe dementia were excluded from the study , as were those with atypical parkinsonism , including multiple system atrophy ( msa ) , progressive supranuclear palsy ( psp ) and vascular or drug - induced parkinsonism . data collection was performed through face - to - face interviews with eligible patients by a trained group of medical interns by means of validated questionnaires and checklists . patients were also examined for clinical assessments and diagnosis by one neurologist specialized in movement disorders . the demographic checklist consisted of baseline variables ( age and sex ) , educational status , history of smoking , comorbidities , duration of pd ( time passed from diagnosis ) and history of levodopa administration . total comorbidity burden was calculated by summing up the number of chronic comorbid conditions in each participant , including depression , hypertension , interstitial heart disease ( ihd ) , diabetes , stroke / transient ischemic attack ( tia ) and osteoporosis . data were collected based on participants self - reports and their medical records at the referral center . clinical characteristics of pd were assessed using the following scales and/or definitions : motor severity : unified parkinson s disease rating scale ( updrs ) subscales i iv , dyskinesia score ( sum of updrs part iv items 3234 ) , fluctuation score ( sum of updrs part iv items 3639 ) , h&y staging and schwab and england activities of daily living ( adl);motor subtypes : postural instability gait difficulty ( pigd ) score ( sum of updrs part iii items concerning rise , gait and postural instability ) and freezing speech swallowing ( foss ) score ( sum of updrs part ii items on freezing , speech and swallowing);predominance of core manifestations : proportion of updrs part iii on motor scores accounted for tremor ( items 2021 ) , rigidity ( item 22 ) , bradykinesia ( items 2326 and 31 ) and gait ( items 2730 ) in percentage;asymmetry index : absolute differences in updrs between sides divided by the total updrs part iii items 2026;axial / limb ratio : sum of updrs part iii items 18 , 19 , 22 and 2730 divided by the sum of updrs part iii items 2026;other motor symptoms : presence of falls and freezing andnonmotor manifestations : the hospital anxiety and depression scale ( hads ) questionnaire to measure anxiety and depression,27 fatigue severity scale ( fss ) to investigate fatigue,28 the mini - nutritional assessment ( mna ) questionnaire together with anthropometric measurements for nutritional status,29 persian - translated and validated version of the scales for outcomes in parkinson s disease psychosocial ( scopa - ps ) questionnaire30 to assess psychosocial functioning and validated persian version of the 39-item pd questionnaire ( pdq-39)31 to evaluate health - related quality of life ( hrqol ) . all clinical assessments were done when the patients were in the on state . motor severity : unified parkinson s disease rating scale ( updrs ) subscales i iv , dyskinesia score ( sum of updrs part iv items 3234 ) , fluctuation score ( sum of updrs part iv items 3639 ) , h&y staging and schwab and england activities of daily living ( adl ) ; motor subtypes : postural instability part iii items concerning rise , gait and postural instability ) and freezing speech swallowing ( foss ) score ( sum of updrs part ii items on freezing , speech and swallowing ) ; predominance of core manifestations : proportion of updrs part iii on motor scores accounted for tremor ( items 2021 ) , rigidity ( item 22 ) , bradykinesia ( items 2326 and 31 ) and gait ( items 2730 ) in percentage ; asymmetry index : absolute differences in updrs between sides divided by the total updrs part iii items 18 , 19 , 22 and 2730 divided by the sum of updrs part iii items 2026 ; other motor symptoms : presence of falls and freezing and nonmotor manifestations : the hospital anxiety and depression scale ( hads ) questionnaire to measure anxiety and depression,27 fatigue severity scale ( fss ) to investigate fatigue,28 the mini - nutritional assessment ( mna ) questionnaire together with anthropometric measurements for nutritional status,29 persian - translated and validated version of the scales for outcomes in parkinson s disease psychosocial ( scopa - ps ) questionnaire30 to assess psychosocial functioning and validated persian version of the 39-item pd questionnaire ( pdq-39)31 to evaluate health - related quality of life ( hrqol ) . all clinical assessments were done when the patients were in the on state . statistical descriptions and univariate and multivariate regression analyses were performed using the ibm spss statistics for windows , version 23 ( ibm corporation , armonk , ny , usa ) . mean ( standard deviation [ sd ] ) and frequency percentages were used to describe numerical and categorical variables , respectively . smirnov test was applied to check the normality assumption for continuous variables . since the normality of distribution was met , we used parametric tests for between - group comparisons . univariate comparisons between males and females were performed using either independent samples t - test , chi - square test or fisher s exact test where appropriate . we used multivariate linear regression model to adjust the between - group differences in some numeric variables of interest for the baseline differences in disease duration and level of education . a two - tailed p - value of < 0.05 was considered as the threshold to show statistical significant differences . in order to evaluate the strength of each variable to discriminate male and female patients with pd , we applied orthogonal partial least squares discriminant analysis ( opls - da ) method using simca software , version 14.1 ( mks umetrics ab , ume , sweden ) . unit variance ( uv ) scaling was used to transform crude data prior to the opls - da modeling . the opls - da method divides the systematic variation in the x - block consisting of a comprehensive list of demographic and pd - related features to separate males and females with pd into two model parts . one part models the co - variation between x and y , and another part expresses the x - variation that is not related to y and is shown by the orthogonal component(s ) . this method results in a better class resolution for a discriminant problem such as the case in our study . furthermore , the opls - da method made it possible to compare the strength of different variables with various measurement units and scales to discriminate males and females with pd by means of values of standardized loading , their standard error ( se ) and 95% confidence interval ( ci ) . we visualized findings from the opls - da method by three different plots with the following parameters : score scatter plot : to show the performance of the entire opls - da model to separate males and females where t1 refers to the score of each participant from the main discriminant component in the x - block ( horizontal axis ) , while t2 shows the score of each participant from the y - orthogonal component ( vertical axis);loadings bars : this is a one - dimensional plot representing loading value ( p1 ) of each feature to discriminate males and females based on the main discriminant component of the opls - da model;loadings scatter plot : in this plot , p1 refers to the loading values of each feature from the main discriminant component to discriminate males and females ( horizontal axis ) and p2 represents the loadings of each variable from the y - orthogonal component for the differences between features that are not related to sex ( vertical axis ) . score scatter plot : to show the performance of the entire opls - da model to separate males and females where t1 refers to the score of each participant from the main discriminant component in the x - block ( horizontal axis ) , while t2 shows the score of each participant from the y - orthogonal component ( vertical axis ) ; loadings bars : this is a one - dimensional plot representing loading value ( p1 ) of each feature to discriminate males and females based on the main discriminant component of the opls - da model ; loadings scatter plot : in this plot , p1 refers to the loading values of each feature from the main discriminant component to discriminate males and females ( horizontal axis ) and p2 represents the loadings of each variable from the y - orthogonal component for the differences between features that are not related to sex ( vertical axis ) . this study was conducted on 157 consecutive patients with ipd from an outpatient referral movement disorders clinic in tehran , iran , between october 2011 and december 2012 . this was a collaborative project between iran university of medical sciences ( tehran , iran ) and karolinska institute ( stockholm , sweden ) . the study protocol was approved by the ethics committee of the neurology department at firoozgar clinical research development center ( fcrdc ; affiliated to iran university of medical sciences ) . prior to the launch of the study , all patients were informed about the aims and procedures . all participants provided their verbal informed consent to participate in this study . since the project was designed as an observational research , verbal form of consent was approved by the aforementioned ethics committee . participation in this study was voluntary , and the patients were free to withdraw from the project whenever they decided . furthermore , the identity of research participants was protected , since the data files were anonymous and all names were omitted . recruited patients fulfilled the following inclusion criteria : diagnosis of ipd based on the uk brain bank criteria,25 which was assessed by the same neurologist who was specialized in movement disorders for all participants ; current age of 30 years or older and motor disability in the mild - to - severe range but not in the advanced stages that needs wheelchair or hospitalization according to the hoehn and yahr ( h&y ) criteria ( stage < 5).26 patients with moderate to severe dementia were excluded from the study , as were those with atypical parkinsonism , including multiple system atrophy ( msa ) , progressive supranuclear palsy ( psp ) and vascular or drug - induced parkinsonism . data collection was performed through face - to - face interviews with eligible patients by a trained group of medical interns by means of validated questionnaires and checklists . patients were also examined for clinical assessments and diagnosis by one neurologist specialized in movement disorders . the demographic checklist consisted of baseline variables ( age and sex ) , educational status , history of smoking , comorbidities , duration of pd ( time passed from diagnosis ) and history of levodopa administration . total comorbidity burden was calculated by summing up the number of chronic comorbid conditions in each participant , including depression , hypertension , interstitial heart disease ( ihd ) , diabetes , stroke / transient ischemic attack ( tia ) and osteoporosis . data were collected based on participants self - reports and their medical records at the referral center . clinical characteristics of pd were assessed using the following scales and/or definitions : motor severity : unified parkinson s disease rating scale ( updrs ) subscales i iv , dyskinesia score ( sum of updrs part iv items 3234 ) , fluctuation score ( sum of updrs part iv items 3639 ) , h&y staging and schwab and england activities of daily living ( adl);motor subtypes : postural instability gait difficulty ( pigd ) score ( sum of updrs part iii items concerning rise , gait and postural instability ) and freezing speech swallowing ( foss ) score ( sum of updrs part ii items on freezing , speech and swallowing);predominance of core manifestations : proportion of updrs part iii on motor scores accounted for tremor ( items 2021 ) , rigidity ( item 22 ) , bradykinesia ( items 2326 and 31 ) and gait ( items 2730 ) in percentage;asymmetry index : absolute differences in updrs between sides divided by the total updrs part iii items 2026;axial / limb ratio : sum of updrs part iii items 18 , 19 , 22 and 2730 divided by the sum of updrs part iii items 2026;other motor symptoms : presence of falls and freezing andnonmotor manifestations : the hospital anxiety and depression scale ( hads ) questionnaire to measure anxiety and depression,27 fatigue severity scale ( fss ) to investigate fatigue,28 the mini - nutritional assessment ( mna ) questionnaire together with anthropometric measurements for nutritional status,29 persian - translated and validated version of the scales for outcomes in parkinson s disease psychosocial ( scopa - ps ) questionnaire30 to assess psychosocial functioning and validated persian version of the 39-item pd questionnaire ( pdq-39)31 to evaluate health - related quality of life ( hrqol ) . all clinical assessments were done when the patients were in the on state . motor severity : unified parkinson s disease rating scale ( updrs ) subscales i iv , dyskinesia score ( sum of updrs part iv items 3234 ) , fluctuation score ( sum of updrs part iv items 3639 ) , h&y staging and schwab and england activities of daily living ( adl ) ; motor subtypes : postural instability part iii items concerning rise , gait and postural instability ) and freezing speech swallowing ( foss ) score ( sum of updrs part ii items on freezing , speech and swallowing ) ; predominance of core manifestations : proportion of updrs part iii on motor scores accounted for tremor ( items 2021 ) , rigidity ( item 22 ) , bradykinesia ( items 2326 and 31 ) and gait ( items 2730 ) in percentage ; asymmetry index : absolute differences in updrs between sides divided by the total updrs part iii items 2026 ; axial / limb ratio : sum of updrs part iii items 18 , 19 , 22 and 2730 divided by the sum of updrs part iii items 2026 ; other motor symptoms : presence of falls and freezing and nonmotor manifestations : the hospital anxiety and depression scale ( hads ) questionnaire to measure anxiety and depression,27 fatigue severity scale ( fss ) to investigate fatigue,28 the mini - nutritional assessment ( mna ) questionnaire together with anthropometric measurements for nutritional status,29 persian - translated and validated version of the scales for outcomes in parkinson s disease psychosocial ( scopa - ps ) questionnaire30 to assess psychosocial functioning and validated persian version of the 39-item pd questionnaire ( pdq-39)31 to evaluate health - related quality of life ( hrqol ) . all clinical assessments were done when the patients were in the on state . statistical descriptions and univariate and multivariate regression analyses were performed using the ibm spss statistics for windows , version 23 ( ibm corporation , armonk , ny , usa ) . mean ( standard deviation [ sd ] ) and frequency percentages were used to describe numerical and categorical variables , respectively . smirnov test was applied to check the normality assumption for continuous variables . since the normality of distribution was met , we used parametric tests for between - group comparisons . univariate comparisons between males and females were performed using either independent samples t - test , chi - square test or fisher s exact test where appropriate . we used multivariate linear regression model to adjust the between - group differences in some numeric variables of interest for the baseline differences in disease duration and level of education . a two - tailed p - value of < 0.05 was considered as the threshold to show statistical significant differences . in order to evaluate the strength of each variable to discriminate male and female patients with pd , we applied orthogonal partial least squares discriminant analysis ( opls - da ) method using simca software , version 14.1 ( mks umetrics ab , ume , sweden ) . unit variance ( uv ) scaling was used to transform crude data prior to the opls - da modeling . the opls - da method divides the systematic variation in the x - block consisting of a comprehensive list of demographic and pd - related features to separate males and females with pd into two model parts . one part models the co - variation between x and y , and another part expresses the x - variation that is not related to y and is shown by the orthogonal component(s ) . this method results in a better class resolution for a discriminant problem such as the case in our study . furthermore , the opls - da method made it possible to compare the strength of different variables with various measurement units and scales to discriminate males and females with pd by means of values of standardized loading , their standard error ( se ) and 95% confidence interval ( ci ) . we visualized findings from the opls - da method by three different plots with the following parameters : score scatter plot : to show the performance of the entire opls - da model to separate males and females where t1 refers to the score of each participant from the main discriminant component in the x - block ( horizontal axis ) , while t2 shows the score of each participant from the y - orthogonal component ( vertical axis);loadings bars : this is a one - dimensional plot representing loading value ( p1 ) of each feature to discriminate males and females based on the main discriminant component of the opls - da model;loadings scatter plot : in this plot , p1 refers to the loading values of each feature from the main discriminant component to discriminate males and females ( horizontal axis ) and p2 represents the loadings of each variable from the y - orthogonal component for the differences between features that are not related to sex ( vertical axis ) . score scatter plot : to show the performance of the entire opls - da model to separate males and females where t1 refers to the score of each participant from the main discriminant component in the x - block ( horizontal axis ) , while t2 shows the score of each participant from the y - orthogonal component ( vertical axis ) ; loadings bars : this is a one - dimensional plot representing loading value ( p1 ) of each feature to discriminate males and females based on the main discriminant component of the opls - da model ; loadings scatter plot : in this plot , p1 refers to the loading values of each feature from the main discriminant component to discriminate males and females ( horizontal axis ) and p2 represents the loadings of each variable from the y - orthogonal component for the differences between features that are not related to sex ( vertical axis ) . overall , 157 individuals consisting of 108 males and 49 females with pd were recruited in our study . table 1 summarizes the results for univariate comparison of the demography , motor severity and medications , motor subtypes , nonmotor features and qol indicators between the two subgroups . the age at pd onset did not significantly differ between males and females ( 55.2 [ sd = 11.6 ] year vs 53.4 [ sd = 12.4 ] year , p=0.384 ) , however , disease duration was longer in females at the time of recruitment ( 6.1 [ sd = 4.9 ] year vs 8.2 [ sd = 5.7 ] year , p=0.023 ) . univariate differences in motor features such as total updrs and freezing score disappeared after adjustment for baseline difference . among nonmotor features , anxiety , depression , fatigue and psychosocial functioning were all significantly more severe in female pd patients ( table 1 ) . after statistical adjustment for the baseline differences in disease duration and level of education , female individuals still showed significantly higher score in anxiety ( mean difference = 2.2 [ 95% ci : 0.54.0 ] , p=0.011 ) and borderline higher score in depression ( mean difference = 1.3 [ 95% ci : 0.22.7 ] , p=0.079 ) . furthermore , female pd patients had significantly worse nutritional status and higher parkinson s disease summary index ( pdsi ) , both of which remained statistically significant after multivariate adjustment ( mean difference for mna score = 1.5 [ 95% ci : 2.5 to 0.4 ] , p=0.009 ; mean difference for pdsi score = 6.9 [ 95% ci : 1.911.8 ] , p=0.006 ) . among different domains of qol , females were significantly worse in mobility ( 40.8 [ sd = 27.4 ] vs 22.5 [ sd = 24.0 ] , p<0.001 ) , emotional well - being ( 39.4 [ sd = 24.4 ] vs 23.5 [ sd = 21.7 ] , p<0.001 ) , social support ( 20.1 [ sd = 25.9 ] vs 7.5 [ sd = 15.9 ] , p<0.001 ) and bodily discomfort ( 33.0 [ sd = 25.3 ] vs 17.2 [ sd = 20.1 ] , p<0.001 ) . all of these differences were still significant even after multivariate adjustment for the baseline differences in disease duration and level of education between males and females , resulting in the mean difference of 11.9 ( 95% ci : 3.520.3 , p=0.006 ) in mobility , 12.5 ( 95% ci : 4.720.3 , p=0.002 ) in emotional well - being and 11.0 ( 95% ci : 0.921.5 , p=0.001 ) and 14.2 ( 95% ci : 6.421.9 , p<0.001 ) in bodily discomfort domain of qol . the opls - da model that fitted the best to our dataset had the overall cross - validated predictive r value of 0.33 . the score scatter plot in figure 1 shows the performance of this model to discriminate males and females with pd . the corresponding loading value of each variable in the opls - da model and its 95% ci are shown in figure 2 , and the loadings scatter plot is illustrated in figure 3 . based on the absolute loading value for each variable in the opls - da model , emotional well - being ( mean = 0.22 , se = 0.14 ) , bodily discomfort ( mean = 0.18 , se = 0.13 ) , social support ( mean = 0.17 , se = 0.19 ) , mobility ( mean = 0.17 , se = 0.04 ) and communication ( mean = 0.12 , se = 0.15 ) domains of qol , together with anxiety ( mean = 0.18 , se = 0.10 ) , depression ( mean = 0.17 , se = 0.08 ) and psychosocial functioning ( mean = 0.16 , se = 0.11 ) , were the strongest features with higher values in favor of females to discriminate the two sexes in pd population ( figures 2 and 3 ) . nutritional status ( mean = 0.13 , se = 0.07 ) , schwab and england adl score ( mean = 0.06 , se = 0.13 ) , and orthostasis ( mean = 0.06 , se = 0.05 ) were also found to be strong discriminators in the model , nevertheless , with higher values in favor of the male pd patients . the age at pd onset did not significantly differ between males and females ( 55.2 [ sd = 11.6 ] year vs 53.4 [ sd = 12.4 ] year , p=0.384 ) , however , disease duration was longer in females at the time of recruitment ( 6.1 [ sd = 4.9 ] year vs 8.2 [ sd = 5.7 ] year , p=0.023 ) . univariate differences in motor features such as total updrs and freezing score disappeared after adjustment for baseline difference . among nonmotor features , anxiety , depression , fatigue and psychosocial functioning were all significantly more severe in female pd patients ( table 1 ) . after statistical adjustment for the baseline differences in disease duration and level of education , female individuals still showed significantly higher score in anxiety ( mean difference = 2.2 [ 95% ci : 0.54.0 ] , p=0.011 ) and borderline higher score in depression ( mean difference = 1.3 [ 95% ci : 0.22.7 ] , p=0.079 ) . furthermore , female pd patients had significantly worse nutritional status and higher parkinson s disease summary index ( pdsi ) , both of which remained statistically significant after multivariate adjustment ( mean difference for mna score = 1.5 [ 95% ci : 2.5 to 0.4 ] , p=0.009 ; mean difference for pdsi score = 6.9 [ 95% ci : 1.911.8 ] , p=0.006 ) . among different domains of qol , females were significantly worse in mobility ( 40.8 [ sd = 27.4 ] vs 22.5 [ sd = 24.0 ] , p<0.001 ) , emotional well - being ( 39.4 [ sd = 24.4 ] vs 23.5 [ sd = 21.7 ] , p<0.001 ) , social support ( 20.1 [ sd = 25.9 ] vs 7.5 [ sd = 15.9 ] , p<0.001 ) and bodily discomfort ( 33.0 [ sd = 25.3 ] vs 17.2 [ sd = 20.1 ] , p<0.001 ) . all of these differences were still significant even after multivariate adjustment for the baseline differences in disease duration and level of education between males and females , resulting in the mean difference of 11.9 ( 95% ci : 3.520.3 , p=0.006 ) in mobility , 12.5 ( 95% ci : 4.720.3 , p=0.002 ) in emotional well - being and 11.0 ( 95% ci : 0.921.5 , p=0.001 ) and 14.2 ( 95% ci : 6.421.9 , p<0.001 ) in bodily discomfort domain of qol . the opls - da model that fitted the best to our dataset had the overall cross - validated predictive r value of 0.33 . the score scatter plot in figure 1 shows the performance of this model to discriminate males and females with pd . the corresponding loading value of each variable in the opls - da model and its 95% ci are shown in figure 2 , and the loadings scatter plot is illustrated in figure 3 . based on the absolute loading value for each variable in the opls - da model , emotional well - being ( mean = 0.22 , se = 0.14 ) , bodily discomfort ( mean = 0.18 , se = 0.13 ) , social support ( mean = 0.17 , se = 0.19 ) , mobility ( mean = 0.17 , se = 0.04 ) and communication ( mean = 0.12 , se = 0.15 ) domains of qol , together with anxiety ( mean = 0.18 , se = 0.10 ) , depression ( mean = 0.17 , se = 0.08 ) and psychosocial functioning ( mean = 0.16 , se = 0.11 ) , were the strongest features with higher values in favor of females to discriminate the two sexes in pd population ( figures 2 and 3 ) . nutritional status ( mean = 0.13 , se = 0.07 ) , schwab and england adl score ( mean = 0.06 , se = 0.13 ) , and orthostasis ( mean = 0.06 , se = 0.05 ) were also found to be strong discriminators in the model , nevertheless , with higher values in favor of the male pd patients . our study is one of the few attempts to comprehensively investigate sexual dimorphism in pd . we applied powerful multivariate statistical methods to explore independent sex differences in clinical manifestations , hrqol and psychosocial functioning of people with pd . in general , females with pd were significantly worse in psychological features such as anxiety and depression , nutritional status and specific domains of qol , namely , mobility , emotional well - being , social support and bodily discomfort . studies have suggested that emotional symptoms of pd , especially depression , are more common and more severe in females than in males.3234 however , these findings were not approved by a large prospective study , which found no difference in the prevalence or severity of depression evaluated by beck depression inventory ( bdi ) between females and males.24 in our study , females with pd tended to be more affected from psychological symptoms . we found that the scores for anxiety , psychosocial functioning and emotional well - being were all higher among females demonstrating a worse status . conflicting results can be , in part , explained by ethnic , cultural and environmental differences as well as the use of different depression scales . in some cultures and environments , women are more prone to be stigmatized by disabling conditions,35,36 which make them more vulnerable to emotional and psychosocial adverse effects of pd . social and physical well - being , measured separately or as parts of qol questionnaires , are important contributors of patient s qol.37,38 in our study , physical discomfort , including mobility , fatigue and bodily discomfort , was more severe among female participants . this finding is confirmed by previous studies of pd populations,17,34,39 as well as those of general population showing more severe physical discomfort in healthy older women compared to males of the same age group.4042 our results showed that despite the lack of statistically significant difference in social stigma , females displayed worse communication and psychosocial functioning . these sex - related differences can be the consequences of more severe emotional disturbance , physical discomfort , and poorer social supports in females compared to males with pd . in our study , self - reported cognitive impairment was higher in female participants based on the cognition dimension of pdq-39 . in contrast , some studies have suggested that cognitive decline in pd is more severe among males.18,23 nonetheless , as different dimensions of cognitive performance have been shown to be sex related in healthy elderly adults ( for instance , males have better visuospatial ability , while females perform better on face and verbal recognition and semantic fluency tests4345 ) , different dimensions of cognitive performance must be investigated in order to clarify sexual dimorphism of cognition in pd . tremor and dyskinesia are reported to occur more frequently in females,8,18,33 whereas gait disturbance is more common in males.19 however , in line to one prospective study that had also adjusted the differences for the confounding effects of demographics and clinical covariates,24 we also could not find sex - related differences in motor symptoms . sleep quality is the other symptom of pd , which is believed to be sex related , but still remained a controversial issue . rapid eye movement ( rem ) sleep behavior disorder ( rbd ) was reported as a male - related symptom in pd;33,4648 some other sleep disturbances were found to be more severe among females.34,49 we did not find any difference in sleep disturbance between males and females using the nonmotor items of the updrs . a more thorough assessment with a valid and specific tool such as polysomnography is required to investigate sexual dimorphism in sleep disorders in people with pd . the comprehensive list of pd - related features and general aspects of daily life is the most important strength of our study . previous studies have investigated sexual dimorphism in manifestations of pd with rather small sample size not being controlled for the potential confounders.3,50 in our study , we evaluated a large list of variables ( some of which were considered for sexual dimorphism in pd for the first time ) and applied a strong multivariate statistical approach , opls - da , to take into account all potential confounding interactions this study was designed as a cross - sectional research that restricts any causal inferences and going beyond associations . there are other aspects of sexual dimorphism in pd that need to be addressed in future research , namely , course of progression and mortality . there is a potential risk for selection bias since all recruited patients were from an outpatient neurology clinic where the majority of patients had mild - to - moderate ipd . as a result , our findings may not be generalized to all people with pd , particularly those with end - stage disease . considering time restriction for data collection spent in each participant , we ought to rely on the items from updrs for some variables , which might not be sensitive enough to show between - group differences on this summary scale . therefore , more sensitive gold - standard tools might potentially show different results for such features . our rather small sample size in comparison with few large previous studies should also be noted . augustine et al24 reported that studies with smaller sample sizes were more likely to report sex differences in different clinical features . we should also add the uneven number of males and females in our study as another limitation ; however , it could be expected for pd that affects men more frequently.51 yet the comprehensive list of variables and appropriate multivariate statistical methods of the present study overcame these issues and strengthened our findings . this study provides a comprehensive understanding of sexual dimorphism in different motor and nonmotor features of pd and various domains of daily life by using sophisticated statistical analysis to evaluate the independent differences between males and females . after controlling for potential confounders , anxiety , depression , mobility , emotional well - being , social support , on the other hand , male pd patients had better nutritional status ( though with rather small effect size for difference ) and adl but also more severe orthostasis . conclusively concordance of depression , anxiety and overall psychosocial burden in being more severe in women is in favor of the presence of a considerable sex dimorphism in neuropsychiatric symptoms , which in turn suggest its clinical importance . qol and psychosocial consequences of pd between males and females should be addressed for developing a more personalized caring approach . these aspects of sexual dimorphism in pd also enlighten the features that are more likely to be affected in each sex and should be specifically targeted when managing male and female individuals with pd . as for clinical implication , clinicians should consider sex differences in the evaluation and management of patients with pd . for example , they should be aware of the higher risk of psychological manifestations in women and therefore should screen them accurately in a timely manner and , if necessary , refer them to a psychologist in the early stages of these manifestations . sex - specific symptoms highlight the importance of sex - specific treatments ; hence , future studies should investigate the effects of specific interventions for females . moreover , educational interventions are also needed in order to improve social support for women with pd and reduce their extra psychosocial burden .

introductionsex - related differences in clinical manifestations and consequences of parkinson s disease ( pd ) have been poorly explored . better understanding of sexual dimorphism in neurologic diseases such as pd has been announced as a research priority . the aim of our study was to determine independent sex differences in clinical manifestations and subtypes , psychosocial functioning , quality of life ( qol ) and its domains between male and female individuals with pd.patients and methodsa comprehensive list of demographics , motor symptoms and subtypes , nonmotor features , health - related quality of life ( hrqol ) , psychosocial functioning and general aspects of daily life was assessed in 157 individuals ( 108 males and 49 females ) with idiopathic pd . in order to control for potential confounding variables , we applied orthogonal partial least squares discriminant analysis ( opls - da ) to explore the strength of each feature to discriminate male and female patients with pd.resultswhile no sex difference was found in the total unified parkinson s disease rating scale ( updrs ) score and cumulative daily dose of levodopa , females had significantly more severe anxiety ( mean difference = 2.2 [ 95% confidence interval , ci : 0.54.0 ] , p=0.011 ) , worse nutritional status ( 23.8 [ standard deviation , sd = 4.2 ] vs 25.8 [ sd = 2.6 ] , p=0.003 ) and poorer qol ( 28.3 [ sd = 15.7 ] vs 17.9 [ sd = 14.2 ] , p<0.001 ) . based on multivariate discriminant analysis , emotional well - being , bodily discomfort , social support , mobility and communication domains of hrqol , together with anxiety , depression and psychosocial functioning , were the strongest features with more severe / worse status in females after adjustment for potential statistical confounders.conclusionour study provides a comprehensive understanding of sexual dimorphism in pd . anxiety , depression , specific domains of hrqol ( mobility , emotional well - being , social support and bodily discomfort ) and psychosocial functioning were significantly worse in female individuals with pd . sexual dimorphism in pd highlights the features that are more likely to be affected in each sex and should be specifically targeted when managing male and female individuals with pd .

the new proposal for classification of focal cortical dysplasia ( fcd ) recognizes a particular type , iiid fcd , associated with an epileptogenic lesion acquired in early life ( i.e. , traumatic injury , ischemic injury or encephalitis ) . fcd group associated with certain other epileptogenic lesions ( in particular , hippocampal sclerosis , tumors and vascular malformations ) . histopathologically , type iiid fcd consists of altered cortical architecture and cytoarchitectural composition , occurring adjacent to the principal early - life lesion . there is not yet much information regarding the prevalence of these cortical dysplastic changes among patients with these kinds of early - life lesions , and imaging pathologic correlations are only at the beginning ; nevertheless , it could be inferred that such an association is probably high . epileptic seizures secondary to early - life brain injuries often follow a protracted and drug - resistant course . given the destructive nature and involvement of multiple brain regions by initial injury , many of these patients are not considered suitable for epilepsy surgery . others with well - lateralized hemispheric lesions undergo extensive procedures ( hemispherectomy / hemispherotomy ) which , although associated with successful postsurgical seizure control , may induce new or aggravate previously existing neurological deficits . this work aims to denote that a ) selected cases with converging semiological , electrophysiological and structural / functional imaging evidence of localized ictal onsets may show favorable postsurgical results to focal - tailored resections and b ) accompanying mesio - temporal pathology ipsilateral to the gross lesion may not contribute to seizure generation . patient 1 was a 10-yr - old boy originally diagnosed with left hemispheric atrophy and an ipsilateral parietotemporooccipital porencephalic cyst . he developed right - sided upper extremity hemiparesis , mild left superior quadrantanopia , and drug - resistant seizures ( for history , presurgical evaluations and treatment details , see the supplementary data ) . recent mri verified the presence of left hemispheric atrophy and large left - sided parietotemporooccipital porencephalic cyst and revealed an ipsilaterally malformed hippocampusmedial temporal region with increased flair signal ( fig . an ipsilateral multilobar , parieto - occipital resection , sparing the mesial temporal structures , rendered the patient seizure free ( fig . patient 2 was a 25-yr - old man with lifelong history of intractable seizures secondary to serious posterior left head trauma sustained at the age of 4 months . magnetic resonance imaging ( mri ) presented posterior left hemispheric atrophy , a prominent area of tissue loss and gliotic lesion over the lateral temporoparietal region and ipsilateral hippocampal atrophy plus temporal horn enlargement ( fig . 2a ) . surgical treatment involved extensive resection of the lateral temporo - parieto - occipital area , including the principal gliotic region and the lateral - inferior occipital region , sparing the medial temporal area ( fig . patient 1 was a 10-yr - old boy originally diagnosed with left hemispheric atrophy and an ipsilateral parietotemporooccipital porencephalic cyst . he developed right - sided upper extremity hemiparesis , mild left superior quadrantanopia , and drug - resistant seizures ( for history , presurgical evaluations and treatment details , see the supplementary data ) . recent mri verified the presence of left hemispheric atrophy and large left - sided parietotemporooccipital porencephalic cyst and revealed an ipsilaterally malformed hippocampusmedial temporal region with increased flair signal ( fig . an ipsilateral multilobar , parieto - occipital resection , sparing the mesial temporal structures , rendered the patient seizure free ( fig . patient 2 was a 25-yr - old man with lifelong history of intractable seizures secondary to serious posterior left head trauma sustained at the age of 4 months . magnetic resonance imaging ( mri ) presented posterior left hemispheric atrophy , a prominent area of tissue loss and gliotic lesion over the lateral temporoparietal region and ipsilateral hippocampal atrophy plus temporal horn enlargement ( fig . 2a ) . surgical treatment involved extensive resection of the lateral temporo - parieto - occipital area , including the principal gliotic region and the lateral - inferior occipital region , sparing the medial temporal area ( fig . given the recent introduction of the new classification scheme for fcd , it is not surprising that there is not yet much information regarding the incidence of iiid fcd among patients with epilepsy with early - life - acquired lesions and corresponding surgical outcomes . it is very likely that this type of pathology eluded detection in previous years , the neuropathologic focus being the principal lesion . . reported on a series of 25 children having suffered pre- or peri - natal ( mostly ischemic ) injury , all with a broad spectrum of accompanying cortical dysplastic changes , mostly type i fcd ( which apparently conforms to type iiid current classification ) . slightly more than half of these patients were offered lobar and multilobar resections with class i engel outcomes achieved in 50% of them . there was a high incidence of extensive and not well - localized interictal and ictal eeg abnormalities in this series , suggesting the presence of large and diffuse epileptogenic zones . a subgroup of eight cases had had an early - life - acquired anoxic ischemic or inflammatory lesion . all eight patients underwent multilobar resections with class i engel outcomes achieved in only 25% of them . in contrast to the abovementioned studies , iida et al . reported engel class i outcomes in 6/8 patients with congenital porencephalic cysts undergoing focal cortical resections guided by acute intraoperative ecog . most of these patients had semiological evidence plus well - localized and lesion - concordant surface eeg findings in the presurgical work - up , implicating discrete cortical areas for ictal genesis . an interesting feature in both our cases was the mri presence of additional medial temporal pathology on the side of operation . this could be compatible with medial temporal sclerosis in patient 2 , while patient 1 presented more complex features of hippocampal parahippocampal region white gray matter blurring , increased t2/flair signal and malformed / abnormally rotated hippocampus . these findings should raise the possibility of medial temporal ictal onsets , given literature data suggesting such a relationship in patients with congenital extratemporal porencephalic cysts and medial temporal sclerosis [ 79 ] . however , neither semiology nor surface eeg localization supported such a hypothesis . a subtemporal strip placed in patient 2 demonstrated only late involvement of the mediobasal temporal region during seizures . in addition , both patients enjoy excellent seizure control , 30 months and 18 months postoperatively , without having resected medial temporal structures . among 29 patients with pre- or peri - natal hypoxia and low - grade fcd , all of these patients underwent extensive resections ( mostly hemispherectomies ) including medial temporal structures , so it is difficult to deduce the epileptogenic potential the lesioned medial temporal region might possess . among 24 patients with congenital extratemporal porencephaly , burneo et al . reported 9 with additional medial temporal sclerosis ; an incidence very close to that of krsek 's study . five of these patients had ipsilateral temporal lobe ictal onsets and achieved class i engel outcomes following temporal lobectomy . however , 3 others had extratemporal ictal onsets , based on video - eeg findings . ho et al . reported evidence of medial temporal atrophy / sclerosis , based on mri hippocampal and amygdalar volumetry in 21 out of 22 cases with congenital porencephaly . in contrast , reported ictal onsets localized in the vicinity of congenital extratemporal porencephalic cysts with excellent results ( engel class i ) following tailored resections . . concerning neuropathologic classification , the recent proposal does not offer a specific subcategory among type iii fcd for cases with the constellation of fcd , early - life injury and medial temporal sclerosis , or any other medial temporal malformative lesion , if present distant to the principal early - life lesion and neighboring dysplasia . our findings , along with literature data , suggest that the organization of the epileptogenic substrate in type iiid fcd probably varies along a spectrum including on the one side cases with extensive ictal onset zones and non - satisfactory outcomes following focal resections and on the other side cases with well - localized ictal onsets and engel class i outcomes following tailored resections , even though mri may suggest more extensive and complex pathology . within such complex imaging lesions , the epileptogenic potential is not necessarily uniformly distributed , and abnormal areas ( such as the hippocampal - medial temporal region ) may actually not contribute to ictogenesis , while in other cases be an essential component of it . the real challenge in presurgical evaluation is , therefore , to carefully determine which part , if any , of the whole abnormality is critical for seizure onsets . our experience suggests that stereotyped focal - onset seizure semiology along with concordant localized interictal / ictal eeg and functional data is essential for identifying such candidates .

focal cortical dysplasia ( fcd ) type iiid is a newly proposed type associated with early - life brain insults . such patients are often considered unsuitable for resective epilepsy surgery , given the usually wide extent of the lesion and the poor correlation of mri to the epileptogenic pathology . two patients with intractable epilepsy , early - life ischemic / traumatic injury and mri findings of extensive unilateral cystic - gliotic and ipsilateral medial temporal sclerotic - malformative lesions were subjected to presurgical evaluation revealing well - localized neocortical ictal onsets . they underwent tailored neocortical resections sparing medial temporal areas and achieved engel class i postsurgical outcomes . histopathology was consistent with type iiid focal cortical dysplasia . successful outcomes with tailored resections may be achieved in cases with this subtype of focal cortical dysplasia , in the presence of converging and well - localized semiological , eeg and functional imaging data , even on a background of complex and extensive mri abnormalities . medial temporal pathology , although often present in this setting , is not necessarily the site of ictal onsets , and its resection may not be always mandatory for a favorable outcome .

drug discovery is a complex and expensive endeavor that usually requires seven major steps : disease selection , target hypothesis , lead compound identification ( screening ) , lead optimization , pre - clinical trial , clinical trial and pharmacogenomic optimization . among the various techniques used to facilitate the drug discovery process , virtual or in silico ligand screening ( vls ) based on the structure of known ligands or on the structure of the receptor is becoming a method of choice ( 111 ) , as seen in several recent studies [ reviewed in ( 1216 ) ] . it has been suggested that these libraries of purchasable small organic compounds should be filtered [ adme / tox ( absorption , distribution , metabolism , excretion and toxicity ) filtering ] in an attempt to work with databases of molecules with acceptable physical properties and chemical functionalities , at least consistent with known drug profiles ( 1727 ) . common filtering protocols can be variations of lipinski 's rule - of - five ( or ro5 , potential for oral bioavailability ) ( 25 ) : molecular weight ( mw ) ( poor absorption is observed if mw is more than 500 ) , computed log p ( p = octanol / water partition coefficient ) ( should not be more than 5 ) , h - bond donors ( should not be more than 5 ) and h - bond acceptors ( should not be more than 10 ) . filters can also include a limit on the number of rotatable bonds , on the polar surface area ( a value correlated to the number of h - bond donors and acceptors ) among others , or can remove compounds containing specific chemical substructures associated with poor chemical stability or toxicity and sometimes attempt to predict drug metabolism ( e.g. cytochrome - mediated metabolism , pgp efflux ) ( 2832 ) . the selected molecules after applying lipinski 's ro5 or related filters based on physicochemical properties or investigation of chemical functionalities are erroneously called drug - like while in fact , many organic compounds conform to the above listed rules but they are by no means drug - like ( 33 ) . in fact , these rules define only some necessary conditions for a drug candidate ( such as likely solubility , bio - availability ) but not sufficient ones . different levels of filtering could be applied in agreement with the aims of the project . for instance , soft filtering protocols are usually appropriate for cancer projects while , for some other studies , only small and rigid compounds / fragments ( low mw , few rotatable bonds ) are needed ( e.g. fragment - based lead discovery projects or fraganomics ) ( 34 ) . only few online adme / tox tools are available , they can usually evaluate one compound at a time ( table 1 ) while commercial packages are in general expensive [ see review ( 35 ) ] . compound libraries can be found online , but they are usually not free nor filtered ( table 2 ) ( 36 ) . only recently , a free 3d database of compounds ready for vls projects has been reported , zinc : ( 37 ) . it is also possible to perform adme / tox computations via zinc and in this case they are carried out by the program filter ( openeye scientific software , a program to remove undesirable molecules based on physicochemical properties and about 100 rules to eliminate unstable / reactive / dye chemical groups as well as to desalt the molecules ) . for the time being , the users of zinc can only apply default thresholds for the various computed properties . because adme / tox calculations are usually not available online , we have created faf - drugs , a tool to perform physicochemical filtering . also , in order to make vls experiments easier to perform to a broad community of users , we have interfaced several additional utilities ( such as binding site prediction , openbabel ) and processed five major compound collections . we use frowns ( developed by brian kelley ) , a chemoinformatics toolkit ( ) written in python and c++ to parse / read smiles ( see explanations about the format at ) or sdf files ( see format at molecular design limited ) . we have implemented an algorithm in python that make use of frowns features to compute properties known to be important for filtering databases and that utilizes xtool ( 38 ) to compute log p - values . because salts and counterions are often present in compound collections we recommend users to first apply the desalt utility that removes most salts and counterions prior to faf - drugs calculations . then , our program computes the following molecular properties : ( i ) molecular weight ( part of lipinski 's ro5)(ii ) hydrogen bond donors and acceptors ( part of lipinski 's ro5 ) ( i ) molecular weight ( part of lipinski 's ro5 ) ( ii ) hydrogen bond donors and acceptors ( part of lipinski 's ro5 ) defined as the number of hydrogen bond acceptors ( sum of n + o ) and hydrogen bond donors ( sum of oh + nh ) . ( iii ) number of rigid bonds(iv ) number of rings(v ) size of the rings(vi ) number of rotatable bond ( iii ) number of rigid bonds ( v ) size of the rings ( vi ) number of rotatable bond defined as any single non - ring bond , bounded to non - terminal heavy atom ( 29 ) . the amide c - n bonds are not considered because of their high rotational energy barrier . ( vii ) number of carbon atoms , number of heteroatoms and ratio.(viii ) number of atom with a net charge(ix ) sum of formal charges(x ) the topological polar surface area ( tpsa ) ( vii ) number of carbon atoms , number of heteroatoms and ratio . ( viii ) number of atom with a net charge ( ix ) sum of formal charges ( x ) the topological polar surface area ( tpsa ) the method described in ( 30 ) has been implemented . briefly , the molecular polar surface area ( psa ) ( i.e. surface belonging to polar atoms ) is a descriptor that was shown to correlate well with passive molecular transport through membranes . the calculation of psa , however , is rather time - consuming because of the necessity to generate a reasonable 3d molecular geometry and the calculation of the surface itself . a new approach for the calculation of the psa was developed by erlt et al . this approach was called topological polar surface area , it provides results that are practically identical with the 3d psa while the computation speed is 23 orders of magnitude faster . ( xi ) computation of xlogp ( p = calculated octanol / water partition coefficient ) ( part of lipinski 's ro5 ) ( xi ) computation of xlogp ( p = calculated octanol / water partition coefficient ) ( part of lipinski 's ro5 ) we use the xscore package ( ) to compute xlogp as described in ( 38 ) . this method gives log p - values by summing the contributions of component atoms while making use of correction factors . about 90 atom types are used to classify carbon , nitrogen , oxygen , sulfur , phosphorus and halogen atoms , and 10 correction factors are used for some special substructures . the contributions of each atom type and correction factor were derived by multivariate regression analysis of about 1850 organic compounds with known experimental log p - values . in faf - drugs , the format for the input files has , for the time being , to be sdf , smiles or cansmiles while the compounds have to be in mol2 format for xlogp computations . few compounds are found to have ambiguous atom types and in this case the log p is not computed . ( please see definitions about log p at : ) ( xii ) atom check molecules with some specific atoms can be filtered - out ( for instance molecules containing h , c , n , o , f , s , p , cl , br , i atoms are kept when using default parameters ) . we use frowns ( developed by brian kelley ) , a chemoinformatics toolkit ( ) written in python and c++ to parse / read smiles ( see explanations about the format at ) or sdf files ( see format at molecular design limited ) . we have implemented an algorithm in python that make use of frowns features to compute properties known to be important for filtering databases and that utilizes xtool ( 38 ) to compute log p - values . because salts and counterions are often present in compound collections we recommend users to first apply the desalt utility that removes most salts and counterions prior to faf - drugs calculations . then , our program computes the following molecular properties : ( i ) molecular weight ( part of lipinski 's ro5)(ii ) hydrogen bond donors and acceptors ( part of lipinski 's ro5 ) ( i ) molecular weight ( part of lipinski 's ro5 ) ( ii ) hydrogen bond donors and acceptors ( part of lipinski 's ro5 ) defined as the number of hydrogen bond acceptors ( sum of n + o ) and hydrogen bond donors ( sum of oh + nh ) . ( iii ) number of rigid bonds(iv ) number of rings(v ) size of the rings(vi ) number of rotatable bond ( iii ) number of rigid bonds ( v ) size of the rings ( vi ) number of rotatable bond defined as any single non - ring bond , bounded to non - terminal heavy atom ( 29 ) . the amide c - n bonds are not considered because of their high rotational energy barrier . ( vii ) number of carbon atoms , number of heteroatoms and ratio.(viii ) number of atom with a net charge(ix ) sum of formal charges(x ) the topological polar surface area ( tpsa ) ( vii ) number of carbon atoms , number of heteroatoms and ratio . ( viii ) number of atom with a net charge ( ix ) sum of formal charges ( x ) the topological polar surface area ( tpsa ) the method described in ( 30 ) has been implemented . briefly , the molecular polar surface area ( psa ) ( i.e. surface belonging to polar atoms ) is a descriptor that was shown to correlate well with passive molecular transport through membranes . the calculation of psa , however , is rather time - consuming because of the necessity to generate a reasonable 3d molecular geometry and the calculation of the surface itself . a new approach for the calculation of the psa was developed by erlt et al . this approach was called topological polar surface area , it provides results that are practically identical with the 3d psa while the computation speed is 23 orders of magnitude faster . ( xi ) computation of xlogp ( p = calculated octanol / water partition coefficient ) ( part of lipinski 's ro5 ) ( xi ) computation of xlogp ( p = calculated octanol / water partition coefficient ) ( part of lipinski 's ro5 ) we use the xscore package ( ) to compute xlogp as described in ( 38 ) . this method gives log p - values by summing the contributions of component atoms while making use of correction factors . about 90 atom types are used to classify carbon , nitrogen , oxygen , sulfur , phosphorus and halogen atoms , and 10 correction factors are used for some special substructures . the contributions of each atom type and correction factor were derived by multivariate regression analysis of about 1850 organic compounds with known experimental log p - values . in faf - drugs , the format for the input files has , for the time being , to be sdf , smiles or cansmiles while the compounds have to be in mol2 format for xlogp computations . few compounds are found to have ambiguous atom types and in this case the log p is not computed . ( please see definitions about log p at : ) ( xii ) atom check molecules with some specific atoms can be filtered - out ( for instance molecules containing h , c , n , o , f , s , p , cl , br , i atoms are kept when using default parameters ) . online adme / tox tools are usually not freely available , for this reason , we have developed faf - drugs . this latter stands for free adme / tox filtering and drug - like compound collections . our service can be used to filter collections available online as well as virtual libraries . different levels of filtering have been reported in the literature , depending on the stage of the project , on the target and the disease types . for example , simple physicochemical property filtering could be used when searching for new hits on a new target while more complex adme / tox models ( 39 ) [ see for example a list of chemical groups incompatible with final drug development ( 36,40 ) ] could be applied at a later stage . we chose to implement only simple physicochemical rules because they address the filtering process using widely understood molecular properties . to start faf - drugs filtering , users can either write a molecule in smiles or 2d/3d sdf format directly in the web interface window or browse and upload a compound library . salts and counterions are often present in compound collections and should be removed prior to adme / tox calculations . if salts and counterions are present , we suggest users to run first our desalt utility . at present , the input formats for faf - drugs calculations are cansmiles , smiles or sdf ( please check our web site for explanations about the required formats ) but openbabel ( or online at rpbs ) can be used for file format conversion prior to the filtering step ( figure 1a ) . then users can decide about the upper and lower limits of each investigated properties ( adjustable thresholds ) such as , to tailor the compound selection to a specific project . we also propose default parameters that are commonly used in the field ( 25,26,29,32,41 ) . users obtain two files with molecules that pass and do not pass the filters in cansmiles format together with the original ( if available ) compound i d provided by the chemical vendors . all computed properties ( e.g. mw , tpsa , xlogp ) are also returned in a third file . in order to test our program , we performed computations on 50 080 molecules extracted from the chembridge compound collection ( diversity set ) with faf - drugs and filter ( version 1.0.2 , openeye scientific software ) with the same parameters with the same threshold values ( mw , tpsa ) . both , filter and faf - drugs compute tpsa using the approach of erlt et al . a total of 49 334 passed the filters with faf - drugs and 49 032 with filter . small differences could be due to the fact that some rules are implemented slightly differently , for instance tpsa or log p calculations or definition of flexible bond . our tests on a linux machine ( dell precision 650 , 3ghz , 2 gb sdram ) show that the standalone version of faf - drugs is able to process the above 50 080 molecules in about 20 min while equivalent computations on the same computer with filter ( openeye ) took about 10 min . faf - drugs implementation is python - based and is not presently optimized for speed . with regard to server implementation , similar computations took about 30 min , but it can be longer ( about 3 h ) depending on the server load . we also compared faf - drugs with other online tools : molinspiration ( ) that allows evaluation of few physicochemical properties ( one molecule at a time can be processed , they have implemented their own tools to calculate log p while they follow the erlt et al . approach to compute polar surface ) , and the log p calculators provided by syracuse research corporation ( see table 1 ) and by tetko and tanchuck , alogps 2.1 ( 42 ) . the method for log p prediction developed at molinspiration ( milogp ) is based on group contributions . these have been obtained by fitting calculated log p with experimental log p. alogps uses a neural network approach to predict logp while syracuse research corporation tool ( logkow ) estimates log p using an atom / fragment contribution method . over 100 diverse molecules were tested and in all cases we computed very similar values . to illustrate our calculations , to further assess faf - drugs calculations , we compared over 100 computed log p - values [ via our implementation of xlogp ) with experimental log p ( obtained via syracuse research corporation and via the edetox database ( ) ] . the computed values are in good agreement with the experimental data , indicating that our implementation of xlogp is appropriate and that this approach gives very good results ( figure 2 ) . taken together , the above data suggest that our adme / tox program is robust . once users obtain the cansmiles output , they can decide about adjusting the filters and run additional computations or use 1d/2d to 3d conversion programs such as corina ( ) , omega ( openeye scientific software ) , converter ( accelrys ) and start a vls project . for the time being , to protect our server from intensive use , we suggest scientists to upload files with less than 30 000 molecules . in the present version of the service , computations for several tens of thousands of compounds remain time consuming ( e.g. several hours depending on the number of jobs in the queue ) but work is in progress to improve this point . for this reason and in order to save cpu time and disk space , we also provide five filtered compound collections ( figure 1a ) . a rational approach to increase the efficiency of finding new drugs and reduce the r&d cost is to reduce the attrition rate in the costly downstream stages ( e.g. clinical trials ) . several important methods toward this goal have been developed , involving early computations of adme / tox properties . we have developed faf - drugs to help modelers and biologists to embark into drug discovery projects . users can filter their own compound libraries and adapt the thresholds to a specific project . other tools pertaining to the field of drug design / compound collections are also available at our web site . ( a ) schema of the faf - drugs service . compound collections in smiles , cansmiles or sdf format are needed as input . users obtain two output files , one with molecules that pass the filters and the other with compounds that do not pass the filters . a third file with all the computed properties several other utilities are available at faf - drugs , these involve online xlogp calculations ( 38 ) computed with xtool , online openbabel for file format conversion and implementation of the java molecular editor from dr p. ertl ( novartis pharma ag , basel , switzerland ) to draw molecules and obtain the corresponding smiles string . in addition , at faf - drugs , users can find five adme / tox filtered compound collections ready for vls computations . three levels of filtering were applied ( see our web site for further details ) in order to better suit the needs of potential users . the openeye 's omega program was used to generate 3d models , either single conformation or up to 50 conformations , for each molecule that passed the adme / tox filters . other utilities consist of a test set that contains six protein targets ( pdb format ) and about 10 corresponding ligands ( mol2 format , see information about the format at ) to facilitate evaluation of docking / scoring methods and an interface to pass ( 43 ) , a program that predicts binding pocket at the surface of a receptor . many additional tools pertaining to the field of structural bioinformatics are also available at rpbs such as protein electrostatic computations , loop search , solvent accessibility prediction four molecules with different physicochemical properties were selected in order to compare faf - drugs calculations with other online tools . example of free online adme / tox tools some online compound collections comparison of faf - drugs with several online tools faf - drugs computes several descriptors , such as molecular weight ( mw ) , hydrogen bond donors ( hd ) , hydrogen bond acceptors ( ha ) , number of rotatable bonds ( rot_bond ) , tpsa and log p ( see text ) . similar / identical results were obtained via the molinspiration website and by faf - drugs . experimental log p - values and cas registry numbers were found in the edetox database ( ) and at the ( syracuse research corporation ) server .

in silico screening based on the structures of the ligands or of the receptors has become an essential tool to facilitate the drug discovery process but compound collections are needed to carry out such in silico experiments . it has been recognized that absorption , distribution , metabolism , excretion and toxicity ( adme / tox ) are key properties that need to be considered early on , even during the database preparation stage . faf - drugs is an online service based on frowns ( a chemoinformatics toolkit ) that allows users to process their own compound collections via simple adme / tox filtering rules such as molecular weight , polar surface area , logp or number of rotatable bonds . smiles ( simplified molecular input line entry system ) , cansmiles ( canonical smiles ) or sdf ( structure data file ) files are required as input and molecules that pass or do not pass the filters are sent back in cansmiles format . this service should thus help scientists engaging in drug discovery campaigns . other utilities and several compound collections suitable for in silico screening are available at our site . faf - drugs can be accessed at .

acute dorsolateral striatum slices were prepared from p58p87 hemizygous bacterial artificial chromosome ( bac ) d2 dopamine receptor - egfp ( d2-egfp ) or d1 dopamine receptor - tdtomato ( d1-tdtomato ) mice , males and females in the c57bl/6 background . in accordance with northwestern university animal studies committee , mice were deeply anesthetized with ketamine and xylazine , perfused intracardially with ice - cold modified artificial cerebrospinal fluid ( acsf ) ( in mm ) : 125 nacl , 7 glucose , 25 nahco3 , 2.5 kcl , 1.25 nah2po4 , equilibrated with 95% oxygen , 5% co2 plus 0.5 mm cacl2 , 2 mm mgcl2 , 2 mm ascorbic acid . coronal slices , 250 m , were cut in the above modified acsf , then incubated at 32c for 30 min in the above modified acsf containing 2 mm cacl2 , 1 mm mgcl2 , 5 mm l - glutathione and 1 m pyruvate and subsequently stored at room temperature . except when noted , drugs were obtained from sigma , tocris , or invitrogen . slices were perfused at 23 ml per minute with oxygenated modified acsf containing 2 mm cacl2 and 1 mm mgcl2 at 25c . for all experiments , 20 m gabazine and 2 m cgp55845 were added to the perfusion to block gabaa and gabab receptors , respectively . spns restricted to the dorsolateral striatum were identified using infrared differential interference contrast on an upright olympus microscope and a cooled ccd camera ( coolsnap hq ) controlled with metamorph software . in bac d1-tdtomato mice , indirect pathway spns in these mice were identified by the lack of fluorescence in the soma , possessing spines ( visualized with the aid of an alexa fluor hydrazide fluorescent dye ) , and passive membrane properties of spns . in bac d2-egfp mice , direct pathway spns in these mice were identified by the lack of fluorescence , possessing spines ( visualized with the aid of an alexa fluor hydrazide fluorescent dye ) , and passive membrane properties of spns . dual simultaneous somatic whole - cell recordings were made with borosilicate patch pipettes having open tip resistances of 34.5 mohms . the intracellular pipette solution contained ( in mm ) : 115 cesium methylsulfonate , 5 hepes , 5 tetraethyammonium - cl , 2 qx-314 , 0.25 egta , 2 mg - atp , 0.5 na - gtp , 10 sodium phosphocreatine , and 100200 m alexa fluor 488 or 568 hydrazide , ph 7.3 and osmolarity 290 . after dual somatic recordings were established for a randomly selected dspn and ispn pair , no more than 70 m apart , with similar depths from the slice surface ( cell body of each pair had no more than 10 m depth difference between each other ) , the cells were allowed to dialyze with the internal solution for 710 mins . epscs were occluded with bath application of 100 m d-(-)-2-amino-5-phosphonopentanoic acid ( apv ) and 20 m 6-cyano-7-nitroquinoxaline-2,3-dione ( cnqx ) or 1 m tetrodotoxin . data were acquired at 100 khz , filtered at 10 khz using an 8-pole bessel filter , and digitized using a digidata 1440 16-bit a / d converter . somatic access resistance < 25 mohms was monitored and cells with unstable access resistance ( > 30% change ) were discarded . cells were held at 80 mv , not corrected for liquid junction potential ( calculated to be approximately 11 mv ) . stereotaxic guided surgeries were performed on the above mice anesthetized with ketamine and xylazine mixture or isoflurane . after positioning the head to obtain a flat skull between bregma and lamda , a small hole was bored with a micro drill bit , and a glass pipette was slowly inserted at the following coordinates . dorsolateral striatum injection coordinates ( relative to bregma ) were : 2.0 mm posterior , 3.5 mm lateral , and 3.5 mm ventral ; with the manipulator tiled 48 from the z - axis and 72 from the y - axis . pons injection coordinates ( relative to lambda ) were : 2.0 and 2.5 mm posterior , 0.5 mm lateral , and 5.56.5 mm ventral ; with the manipulator tilted 12 from the z - axis , and the nose bar adjusted to 30 from x - y plane . motor cortex injection coordinates ( relative to bregma ) were : 1.6 mm anterior , 1.2 mm lateral and 0.75 mm ventral . to minimize diffusion , over the course of 1 minute the following volumes were slowly injected : 0.2 l of a recombinant rabies virus carrying a channelrhodopsin-2-venus expression construct ( rrabies - chr2-vn ) for pons , 0.1 l rrabies - chr2-vn for striatum , and 0.1 l of an adeno - associated virus carrying a chr2-venus expression construct ( aav2/9-chr2-vn , supplied by u. penn vector core ; addgene 20071 ) for motor cortex . successful targeting produced fluorescence within the pontine nuclei , dorsolateral striatum , or motor cortex , as well as appropriate placement of fluorescent neurons within the cortex . to activate channelrhodopsin containing axons within the dorsolateral striatum , 473 nm light was generated with a crystalaser ( safety protocols for class iiib laser ) , intensity - modulated with a conoptics pockels cell , expanded with concave lens ( thorlabs ) , passed through an adjustable iris , and 5 objective lens ( 0.15 na ) to produce a 700 m diameter column of light at the slice surface . blue light pulses ( 3 ms ) were triggered with a digidata interface that gated a fast uniblitz shutter . light power was calibrated with a fast photo - diode ( thorlabs ) at the laser and sample . light intensity used for maximal activation was approximately 25 mw , and 5 mw for submaximal activation ( producing at minimum a 20% decrease in epsc amplitude compared to the epsc amplitude at 25 mw ) . the amplitudes of epscs were averaged from at least 3 trials ( up to 10 trials ) , with an intersweep interval of 1 minute . images were acquired on an upright olympus or zeiss microscope , qimaging or photometrics camera and with ephus , metamorph , or qcature software . images were adjusted in nih imagej or adobe photoshop for brightness , contrast , and pseudocoloring . axon pclamp data files was imported into igor ( wavemetrics ) and custom written routines were used to analyze the data . pilot studies to determine the variability of outcome measures and the effective size were used to estimate the number of observations necessary to test the null hypothesis . all graphically representations display the ranks of observations within a group using boxplots , illustrating the median ( thick line ) , interquartile range , and minimum / maximum range whiskers . reponses smaller than 34 times the root mean square of the baseline noise average were displayed as 0.1 on the log scale plots , for graphical reasons . data points falling outside of the following range were not included in the analysis : ( the interquartile range multiplied by 3 and then subtracted from the lower quartile value ) and ( the interquartile range multiplied by 3 and then added to the upper quartile value ) . epsc peak amplitudes greater than 2 na were not included in the data set due to changes in voltage control . distribution - free statistical analysis were performed in graphpad prism or originpro , using the nonparametric wilcoxon matched - pairs signed rank two - tailed test or a wilcoxon signed - rank test comparing the ratio medians to 1 . statistical significance ( p < 0.05 ) acute dorsolateral striatum slices were prepared from p58p87 hemizygous bacterial artificial chromosome ( bac ) d2 dopamine receptor - egfp ( d2-egfp ) or d1 dopamine receptor - tdtomato ( d1-tdtomato ) mice , males and females in the c57bl/6 background . in accordance with northwestern university animal studies committee , mice were deeply anesthetized with ketamine and xylazine , perfused intracardially with ice - cold modified artificial cerebrospinal fluid ( acsf ) ( in mm ) : 125 nacl , 7 glucose , 25 nahco3 , 2.5 kcl , 1.25 nah2po4 , equilibrated with 95% oxygen , 5% co2 plus 0.5 mm cacl2 , 2 mm mgcl2 , 2 mm ascorbic acid . coronal slices , 250 m , were cut in the above modified acsf , then incubated at 32c for 30 min in the above modified acsf containing 2 mm cacl2 , 1 mm mgcl2 , 5 mm l - glutathione and 1 m pyruvate and subsequently stored at room temperature . except when noted , drugs were obtained from sigma , tocris , or invitrogen . slices were perfused at 23 ml per minute with oxygenated modified acsf containing 2 mm cacl2 and 1 mm mgcl2 at 25c . for all experiments , 20 m gabazine and 2 m cgp55845 were added to the perfusion to block gabaa and gabab receptors , respectively . spns restricted to the dorsolateral striatum were identified using infrared differential interference contrast on an upright olympus microscope and a cooled ccd camera ( coolsnap hq ) controlled with metamorph software . in bac d1-tdtomato mice , indirect pathway spns in these mice were identified by the lack of fluorescence in the soma , possessing spines ( visualized with the aid of an alexa fluor hydrazide fluorescent dye ) , and passive membrane properties of spns . in bac d2-egfp mice , direct pathway spns in these mice were identified by the lack of fluorescence , possessing spines ( visualized with the aid of an alexa fluor hydrazide fluorescent dye ) , and passive membrane properties of spns . dual simultaneous somatic whole - cell recordings were made with borosilicate patch pipettes having open tip resistances of 34.5 mohms . the intracellular pipette solution contained ( in mm ) : 115 cesium methylsulfonate , 5 hepes , 5 tetraethyammonium - cl , 2 qx-314 , 0.25 egta , 2 mg - atp , 0.5 na - gtp , 10 sodium phosphocreatine , and 100200 m alexa fluor 488 or 568 hydrazide , ph 7.3 and osmolarity 290 . after dual somatic recordings were established for a randomly selected dspn and ispn pair , no more than 70 m apart , with similar depths from the slice surface ( cell body of each pair had no more than 10 m depth difference between each other ) , the cells were allowed to dialyze with the internal solution for 710 mins . epscs were occluded with bath application of 100 m d-(-)-2-amino-5-phosphonopentanoic acid ( apv ) and 20 m 6-cyano-7-nitroquinoxaline-2,3-dione ( cnqx ) or 1 m tetrodotoxin . data were acquired at 100 khz , filtered at 10 khz using an 8-pole bessel filter , and digitized using a digidata 1440 16-bit a / d converter . somatic access resistance < 25 mohms was monitored and cells with unstable access resistance ( > 30% change ) were discarded . cells were held at 80 mv , not corrected for liquid junction potential ( calculated to be approximately 11 mv ) . stereotaxic guided surgeries were performed on the above mice anesthetized with ketamine and xylazine mixture or isoflurane . after positioning the head to obtain a flat skull between bregma and lamda , a small hole was bored with a micro drill bit , and a glass pipette was slowly inserted at the following coordinates . dorsolateral striatum injection coordinates ( relative to bregma ) were : 2.0 mm posterior , 3.5 mm lateral , and 3.5 mm ventral ; with the manipulator tiled 48 from the z - axis and 72 from the y - axis . pons injection coordinates ( relative to lambda ) were : 2.0 and 2.5 mm posterior , 0.5 mm lateral , and 5.56.5 mm ventral ; with the manipulator tilted 12 from the z - axis , and the nose bar adjusted to 30 from x - y plane . motor cortex injection coordinates ( relative to bregma ) were : 1.6 mm anterior , 1.2 mm lateral and 0.75 mm ventral . to minimize diffusion , over the course of 1 minute the following volumes were slowly injected : 0.2 l of a recombinant rabies virus carrying a channelrhodopsin-2-venus expression construct ( rrabies - chr2-vn ) for pons , 0.1 l rrabies - chr2-vn for striatum , and 0.1 l of an adeno - associated virus carrying a chr2-venus expression construct ( aav2/9-chr2-vn , supplied by u. penn vector core ; addgene 20071 ) for motor cortex . successful targeting produced fluorescence within the pontine nuclei , dorsolateral striatum , or motor cortex , as well as appropriate placement of fluorescent neurons within the cortex . to activate channelrhodopsin containing axons within the dorsolateral striatum , 473 nm light was generated with a crystalaser ( safety protocols for class iiib laser ) , intensity - modulated with a conoptics pockels cell , expanded with concave lens ( thorlabs ) , passed through an adjustable iris , and 5 objective lens ( 0.15 na ) to produce a 700 m diameter column of light at the slice surface . blue light pulses ( 3 ms ) were triggered with a digidata interface that gated a fast uniblitz shutter . light power was calibrated with a fast photo - diode ( thorlabs ) at the laser and sample . light intensity used for maximal activation was approximately 25 mw , and 5 mw for submaximal activation ( producing at minimum a 20% decrease in epsc amplitude compared to the epsc amplitude at 25 mw ) . the amplitudes of epscs were averaged from at least 3 trials ( up to 10 trials ) , with an intersweep interval of 1 minute . images were acquired on an upright olympus or zeiss microscope , qimaging or photometrics camera and with ephus , metamorph , or qcature software . images were adjusted in nih imagej or adobe photoshop for brightness , contrast , and pseudocoloring . axon pclamp data files was imported into igor ( wavemetrics ) and custom written routines were used to analyze the data . pilot studies to determine the variability of outcome measures and the effective size were used to estimate the number of observations necessary to test the null hypothesis . all graphically representations display the ranks of observations within a group using boxplots , illustrating the median ( thick line ) , interquartile range , and minimum / maximum range whiskers . reponses smaller than 34 times the root mean square of the baseline noise average were displayed as 0.1 on the log scale plots , for graphical reasons . data points falling outside of the following range were not included in the analysis : ( the interquartile range multiplied by 3 and then subtracted from the lower quartile value ) and ( the interquartile range multiplied by 3 and then added to the upper quartile value ) . epsc peak amplitudes greater than 2 na were not included in the data set due to changes in voltage control . distribution - free statistical analysis were performed in graphpad prism or originpro , using the nonparametric wilcoxon matched - pairs signed rank two - tailed test or a wilcoxon signed - rank test comparing the ratio medians to 1 .

anatomical studies have led to the assertion that intratelencephalic ( it ) and pyramidal tract ( pt ) cortical neurons innervate different striatal projection neurons . to test this hypothesis , the responses of mouse striatal neurons to optogenetic activation of it and pt axons were measured . contrary to expectation , direct and indirect pathway striatal spiny projection neurons ( spns ) responded to both it and pt activation , arguing that these cortical networks innervate both striatal projection neurons .

bacteria of the genus actinomyces are gram - positive bacilli which generally colonize mouth , colon and vagina . , if actinomycosis occurs , it often presents as an indolent , slowly progressive infection characterized by abscess formation , which can progress across tissue boundaries , can present with mass like features which simulate malignancy , can develop into a sinus tract and/or develop clinically into a refractory or relapsing infection after a short course of therapy . a 43-year old woman with no significant medical history presented with complaints of an unilateral slowly growing painful mass in the left breast . mammography ( fig . 1 ) and ultrasonography were conducted and showed a small abscess - like density retroareolarly.fig . . 1 mammography of the left breast showing a confined density in the retroareolar area . species identification was performed using matrix - assisted laser desorption ionization - time - of - flight mass spectrometry ( maldi - tof ms ; bruker ) . susceptibility testing for a. neuii was performed using e - tests ( biomerieux ) . at the time that culture findings became available , therefore , the cultured actinomyces was considered as skin commensals and a wait and see policy was installed . after several months , the patient returned to the outward clinic with complaints of pain in the breast . psychical examination of the breast showed mild erythema and ultrasonography showed a minimal increase of the lesion . the abscess was surgically drained and new purulent fluid from the abscess was sent to the laboratory . the material was processed as described above . in contrast to initial culture findings , determination by the maldi - tof ms showed peptostreptococcus magnus ( score value 2.056 ) . after four days there was also growth observed in the brewer thioglycollate medium . the isolate was shown to be susceptible to penicillin , amoxicillin , clindamycin , meropenem and vancomycin . histopathological examination of the obtained tissue showed abscess formation in an infection with a sinus tract . subsequently , the patient was treated for six weeks of intravenous penicillin followed by six months of oral amoxicillin successfully . secondly , a 73-year old woman with a history of bilateral breast cancer was seen at with severe pain and swelling of the left breast ten days after her ablation which was complicated by a large hamatoma treated conservatively . gram strain showed many leukocytes , some gram - positive cocci and many gram - positive rods . determination using maldi - tof ms identified a staphylococcus aureus after 2 days there were colonies visible on the anaerobically incubated schaedler agar . determination by the maldi - tof ms revealed an a. neuii susceptibility testing was performed using e - tests . unfortunately , patient returned four days after discharge with a relapse of the hematoma which was surgically evacuated . a month later at the outward clinic she showed full recovery.fig . other isolates that have been identified as pathogens causing primary breast actinomycosis include actinomyces viscosus , actinomyces turincensis and actinomyces radingae . it differs from the other actinomyces species because of its aerobic growth and its microscopic morphology without branching . we were able to retrieve only three former cases of a. neuii causing primary actinomycosis . in the first case , treatment with antibacterials was unsuccessful and the lesion had to be surgically removed . in the second case , patient was successfully treated with amoxicillin for 21 days . in the third case , actinomycosis , regardless of species , should be treated with high doses of antibacterials for a prolonged period of time although therapy needs to be individualized . current guidelines recommend high dose of penicillin intravenously for two to six weeks , followed by oral therapy with penicillin or amoxicillin for 6 to 12 months . alternative antibacterial treatments include doxycycline , erythromycin or clindamycin . if actinomycosis presents with well - defined abscess then surgical drainage followed by long - term antibacterial therapy is indicated . we describe this combination of treatment in our cases . in the first case initial cultures showed islolated a. neuii . because signs of infection had decreased this finding was interpreted as skin flora and not as a pathogen . therefore medical treatment was considered unnecessary . in retrospect , if antibacterial therapy had been given at first presentation recurrence of the infection might have been prevented . actinomyces species morphologically resemble diphtheroids and could be dismissed as skin commensals , even when isolated from an abscess sample . in both of our presented cases we found different organisms in the culture additional to a. neuii . in the first case we found p. magnus and in the second case s. aureus was present . although a. neuii infection is known for its chronicity , the influence of these mixed organisms on the severity of infections remains unclear . further research on the effect of mixed organism on the severity of an a. neuii infection is required .

actinomycosis is a slowly progressive infection caused by anaerobic bacteria , primarily from the genus actinomyces . primary actinomycosis of the breast is rare and presents as a mass like density which can mimic malignancy . mammography , ultrasonography and histopathologic examination is required for diagnosis . treatment should consist of high doses of antibacterials for a prolonged period of time and possibly surgical drainage . primary actinomycosis infections are commonly caused by a. israelii . actinomyces neuii is a less common cause of classical actinomycosis . we present two cases of primary actinomycosis of the breast in two female patients caused by a. neuii .

one disability that can sufficient to interfere with activities of daily living is non - syndromic hearing loss ( nshl ) ( 1 , 2 ) . people with even mild nshl have problems hearing speech when there is background noise and identifying the sounds sources ( 3 , 4 ) . nshl is the most common sensory deficit in humans , with an incidence of about 1 in 1,000 newborns . the prevalence increases during childhood , reaching a rate of 2.7 per 1,000 children before the age of 5 years and 3.5 per 1,000 adolescents . two thirds of people with nshl worldwide live in developing countries ( 5 , 6 ) . the transmembrane channel - like 1 ( tmc1 ) gene is considered a member of a gene family predicted to encode transmembrane proteins ( 7 , 8) . mutations in the tmc1 gene have been associated with profound prelingual deafness ( dfnb7/b11 ) and progressive postlingual hearing loss ( dfna36 ) ; thy have been reported in different populations ( 9 ) . the dfna36 and dfnb7/b11 loci are located on chromosome 9q13 - q21 ( 7 ) . tmc1 and tmc2 are members of a gene family predicted to encode transmembrane proteins and are located on p13 of chromosome 20 . the tmc1 gene encodes a sodium sensor and may function as ion transport channel or pump . tmc1 mrna is specifically expressed in neurosensory hair cells of the inner ear , and it is required for normal function of cochlear hair cells , although the molecular and cellular functions of the tmc1 protein are unknown ( 8) . since no report has yet determined the frequency of tmc1 gene mutations in the iranian population , the present study was performed to screen and identify the mutations of this gene associated with nshl using polymerase chain reaction single - stranded conformation polymorphism ( pcr - sscp ) and heteroduplex analysis ( ha ) . this experimental study was conducted at the cellular and molecular research center of shahrekord university of medical sciences from february 2011 to january 2012 . in the present study , we investigated the mutations of the tmc1 gene , locus dfnb7/11 , in a cohort of 100 patients with nshl in iran . the 890 blood samples of families with iranian origin was obtained in ethylene diamine tetra - acetic acid ( edta)-containing tubes ( sarstedt ) from 10 provinces of iran , namely semnan , sistan & baloochestan , fars , khozestan , kohgilooye va boyer ahmad , kordestan , chaharmahal & bakhtiari , booshehr , golestan , and gilan . finally , 100 patients ( one proband from each family ) were selected ( table 1 ) . nshl informational questionnaires were filled out for all families . in previous work , these patients had no mutations in the cx26 gene ( 10 ) . known environmental risk factors such as head trauma and use of ototoxic drugs could affect the study , so families with the possibility of exposure to these factors were excluded from the research . total genomic dna was extracted from peripheral blood samples of patients using the phenol and chloroform standard procedure ( 11 ) . the quality of extracted genomic dna was quantified by nano - drop 1000 spectrophotometer ( thermo scientific inc . , wilmington , de , usa ) at a wavelength of 260/280 nm according to the method described by sambrook and russell ( 12 ) for gene amplification of exons 7 and 13 of the tmc1 gene by pcr , two sets of overlapping primers were designed due to their length using the gene runner software version 3.0 ( hastings software , inc . , hastings , ny ) , and primer sequences were blasted in the national center for biotechnology information s ( ncbi s ) genbank . the details of the designed primers are shown in table 2 . mutant primers created by site - directed mutagenesis ( sdm ) as positive control , tmc1-m ( tmc1 mutant primer ) . site - directed mutagenesis ( sdm ) after gene amplification using the designed specific primers with changes in one nucleotide was used to generate positive control samples . standard pcr optimization was carried out in a total volume of 50 l reaction in 0.5 ml tubes for each amplicon in a gradient palm cycler ( corbett research , australia ) . the pcr reaction consisted of 0.2 pm of each primer , 2.5 mm mgcl2 , 200 m dntps mix , 5 m of 10 x pcr buffer ( 200 mm tris - hcl [ ph 8.4 ] , 500 mm kcl ) , 1 unit of taq dna polymerase ( all fermentas , germany ) , and 100 ng of template dna . pcr temperature programs involved an initial denaturation at 94c for 5 minutes followed by 32 cycles consisting of 50 seconds of denaturation at 94c , 50 seconds of annealing at 57.5c ( exon 7 ) or 60c ( exon 13 ) , 40 seconds of extension at 72c , and a final extension at 72c for 5 minutes . the pcr amplification products ( 2 l / lane ) were loaded on 8% polyacrylamide gel ( 29:1 acrylamide : bis - acrylamide ) electrophoresis ( page ) in 1 x tbe buffer ( 10.8 g of tris - base 89 mm , 5.5 g of boric acid 2 mm , edta ( ph = 8.0 ) 4 ml of 0.5 m edta ( ph = 8.0 ) , combined all components in sufficient h2o and were stirred to dissolve ) at 85 v for 30 minutes , and the gels were stained using the silver nitrate staining method . for sscp , microtubes containing pcr products were mixed with an equal volume of formamide loading dye , heated to 96c for 15 minutes , and chilled on ice for 5 minutes before loading on the polyacrylamide gel . the electrophoresis tank was filled by tbe buffer 0.6 x , and tbe 1 x was used in the gel ; electrophoresis was performed with 2.5 - 5% glycerol at 20 w at 4c for 6 - 8 hours . first , 3 l of edta ( 0.5 m ) was added to 2 l of pcr products . then , the pcr products were heated at 95c for 3 minutes and slowly cooled to 37c over 40 minutes . after mixing with 6 x triple dye loading buffer at a volume ratio of 1:5 , the pcr products were loaded on page with 10% urea and electrophoresis were performed at 320 v at 10 - 12c for 6 - 8 hours ( table 3 ) . finally , the heteroduplex fragments were visualized using standard silver nitrate staining . the samples containing shift bands on the sscp gel and after ha were subjected to direct dna sequencing of exons 7 and 13 of the tmc1 gene in an abi 3730xl automated sequencer ( applied biosystems ) by macrogen inc . for this study , the regional research ethical committee of shahrekord university of medical sciences ( grant number 91 - 3 - 2 , january 2011 ) approved the protocol and informed consent forms . informed consent was obtained from all hearing loss patients before enrollment in the study based on the declaration of helsinki ( doh ) . all data were collected in the statistical program for the social sciences software ( spss , inc . , the mean difference between groups was calculated using a t test . in this study , a p value of 0.05 was considered statistically significant . this experimental study was conducted at the cellular and molecular research center of shahrekord university of medical sciences from february 2011 to january 2012 . in the present study , we investigated the mutations of the tmc1 gene , locus dfnb7/11 , in a cohort of 100 patients with nshl in iran . the 890 blood samples of families with iranian origin was obtained in ethylene diamine tetra - acetic acid ( edta)-containing tubes ( sarstedt ) from 10 provinces of iran , namely semnan , sistan & baloochestan , fars , khozestan , kohgilooye va boyer ahmad , kordestan , chaharmahal & bakhtiari , booshehr , golestan , and gilan . finally , 100 patients ( one proband from each family ) were selected ( table 1 ) . nshl informational questionnaires were filled out for all families . in previous work , these patients had no mutations in the cx26 gene ( 10 ) . known environmental risk factors such as head trauma and use of ototoxic drugs could affect the study , so families with the possibility of exposure to these factors were excluded from the research . total genomic dna was extracted from peripheral blood samples of patients using the phenol and chloroform standard procedure ( 11 ) . the quality of extracted genomic dna was quantified by nano - drop 1000 spectrophotometer ( thermo scientific inc . , wilmington , de , usa ) at a wavelength of 260/280 nm according to the method described by sambrook and russell ( 12 ) for gene amplification of exons 7 and 13 of the tmc1 gene by pcr , two sets of overlapping primers were designed due to their length using the gene runner software version 3.0 ( hastings software , inc . , hastings , ny ) , and primer sequences were blasted in the national center for biotechnology information s ( ncbi s ) genbank . the details of the designed primers are shown in table 2 . mutant primers created by site - directed mutagenesis ( sdm ) as positive control , tmc1-m ( tmc1 mutant primer ) . site - directed mutagenesis ( sdm ) after gene amplification using the designed specific primers with changes in one nucleotide was used to generate positive control samples . standard pcr optimization was carried out in a total volume of 50 l reaction in 0.5 ml tubes for each amplicon in a gradient palm cycler ( corbett research , australia ) . the pcr reaction consisted of 0.2 pm of each primer , 2.5 mm mgcl2 , 200 m dntps mix , 5 m of 10 x pcr buffer ( 200 mm tris - hcl [ ph 8.4 ] , 500 mm kcl ) , 1 unit of taq dna polymerase ( all fermentas , germany ) , and 100 ng of template dna . pcr temperature programs involved an initial denaturation at 94c for 5 minutes followed by 32 cycles consisting of 50 seconds of denaturation at 94c , 50 seconds of annealing at 57.5c ( exon 7 ) or 60c ( exon 13 ) , 40 seconds of extension at 72c , and a final extension at 72c for 5 minutes . the pcr amplification products ( 2 l / lane ) were loaded on 8% polyacrylamide gel ( 29:1 acrylamide : bis - acrylamide ) electrophoresis ( page ) in 1 x tbe buffer ( 10.8 g of tris - base 89 mm , 5.5 g of boric acid 2 mm , edta ( ph = 8.0 ) 4 ml of 0.5 m edta ( ph = 8.0 ) , combined all components in sufficient h2o and were stirred to dissolve ) at 85 v for 30 minutes , and the gels were stained using the silver nitrate staining method . for sscp , microtubes containing pcr products were mixed with an equal volume of formamide loading dye , heated to 96c for 15 minutes , and chilled on ice for 5 minutes before loading on the polyacrylamide gel . the electrophoresis tank was filled by tbe buffer 0.6 x , and tbe 1 x was used in the gel ; electrophoresis was performed with 2.5 - 5% glycerol at 20 w at 4c for 6 - 8 hours . first , 3 l of edta ( 0.5 m ) was added to 2 l of pcr products . then , the pcr products were heated at 95c for 3 minutes and slowly cooled to 37c over 40 minutes . after mixing with 6 x triple dye loading buffer at a volume ratio of 1:5 , the pcr products were loaded on page with 10% urea and electrophoresis were performed at 320 v at 10 - 12c for 6 - 8 hours ( table 3 ) . the samples containing shift bands on the sscp gel and after ha were subjected to direct dna sequencing of exons 7 and 13 of the tmc1 gene in an abi 3730xl automated sequencer ( applied biosystems ) by macrogen inc . for this study , the regional research ethical committee of shahrekord university of medical sciences ( grant number 91 - 3 - 2 , january 2011 ) approved the protocol and informed consent forms . informed consent was obtained from all hearing loss patients before enrollment in the study based on the declaration of helsinki ( doh ) . all data were collected in the statistical program for the social sciences software ( spss , inc . , the mean difference between groups was calculated using a t test . in this study , in this study , blood samples of 100 patients with hearing loss ( mean age 16.5 2.01 years , 49.2% men and 50.8% women , 74.15% married ) were collected from 10 provinces in iran . the connexin 26 gene is responsible for a large proportion of deafness ( about 14.6% ) , and these patients had no mutations in this gene ( 10 , 13 ) . extracted dna with a 260/280 nm absorbance ratio of 1.8 - 2 was subjected to gene amplification . exons 7 and 13 of the tmc1 gene were amplified using the pcr technique with specific and mutated oligonucleotide primers . after page , fragments with a length of 187 and 250 bp were revealed for exons 7 and 13 , respectively , of the tmc1 gene . pcr products were used for sscp and ha for investigation of mutations in the sequences . neither pcr - sscp nor ha showed mutations in exons 7 and 13 of the tmc1 gene ( figures 1 and 2 ) . line m is a 100 bp dna ladder ( fermentas , germany ) , line 5 is a sample amplified by mutant primers with typical shift ( positive control ) , and lines 2 - 4 and 6 - 13 are deafness patients samples . all specimens have the same template bands without shifts in the sscp bands and after ha . line m is a 100 bp dna ladder ( fermentas , germany ) , line 1 is positive control , line 3 is a suspected sample containing different bands compared to other samples , and lines 2 and 4 - 15 are samples from deaf patients . in the present study , to increase the accuracy of the sscp reaction , ha and mutant control ( positive control created by sdm ) were performed . only a number of suspected fragments in exon 7 showed a different banding pattern , but after sequencing , the mutations were not confirmed ( figure 3 ) . in various human populations , different dominant ( e.g. , coch , dfna5 , and pou4f3 ) and recessive genes ( e.g. , gjb2 and slc26a4 ) have been reported as the cause of hearing loss worldwide ( 7 , 9 , 14 - 16 ) . the tmc1 gene is an autosomal recessive gene and a common cause of hearing loss in many countries , such as india , pakistan , algeria , iraq , lebanon , sudan , tunisia , and turkey ( 15 , 17 - 19 ) . the prevalence of non - syndromic hearing impairment due to tmc1 in the pakistani population is 4.4% , and one study has indicated that the tmc1 protein might have an important function in the k channels of the inner hair cells ( 16 ) . 2002 ) detected a 1.6 kb genomic deletion encompassing exon 14 of tmc1 in a recessive deafness mouse mutant , which lacks auditory responses and has hair - cell degeneration ( 7 ) . in the present study , the association of exons 7 and 13 mutations of tmc1 gene locus dfnb7/11 in deaf patients after gene amplification , neither sscp nor ha showed mutations in exons 7 and 13 of this gene related to hearing loss in these patients . only a suspected sample in exon 7 had a different banding pattern , but after sequencing , mutations in this exon were not identified . the strength of this study was the number of samples , as 890 blood samples were provided ; however , due to a lack of financial resources , we chose two exons of this gene . via the molecular analysis of the tmc1 gene in korean patients , one study showed that this gene was not the cause of nshl in the korean population ( 20 ) . in our study , as in the research in korea , a relation between the tmc1 gene and nshl in the iranian population was not observed . ( 2005 ) investigated four novel tmc1 ( dfnb7/dfnb11 ) mutations in turkish patients with congenital autosomal recessive nshl ( arnshl ) , and they indicated that tmc1 mutations account for at least 6% ( 4/65 ) of arnshl cases in gjb2-negative turkish families from the northeast and east of turkey ; however , in our study , mutation in exons 7 and 13 of tmc1 gene was not observed ( 14 ) . in another study in sudan , it was shown that tmc1 mutations contribute to deafness ; this confirmed and extended previous reports on the role of tmc1 in recessive non - syndromic deafness ( 20 , 21 ) . meanwhile , in the present study on the iranian population , no significant relation between exon 7 and 13 mutations of the tmc1 gene were observed . in pakistan , 2007 ) identified 10 new families segregating dfnb7/b11 deafness and tmc1 mutations , including three novel alleles ; moreover , they identified a c.100c > t mutation in exon 7 ( 16 ) . 2008 ) identified four new mutations in the tmc1 gene and suggested an additional deafness gene at loci dfna36 and dfnb7/11 in 51 familial of turkish patients with autosomal recessive hearing loss ; these results implied the presence of mutations outside the coding region of this gene , or alternatively , at least one additional deafness - causing gene in this region ( 9 ) . another study in turkey reported five novel mutations in the tmc1 gene related to arnshl ( 19 ) . in comparison with the other populations discussed , in a review study in iran by mahdieh et al . the frequencies and distributions of nshl included gjb2 , gjb6 ( large deletion ) , tecta , slc26a4 , and pejvk mutations . the researchers indicated that mutations in gjb2 , slc26 , tecta , and pjvk genes have an important role in deafness in iran , and a screening test should be generated for better intervention and diagnostic programs ( 22 ) . the study of hildebrand et al . in iranian families showed that two families are related to locus dfnb7/11 , and one of them had a c.776 + 1 g > a mutation in exon 7 ( 23 ) . in 2014 , lin et al . identified novel compound heterozygous mutant alleles of tmc1 responsible for arnshl in a tibetan chinese family ( 24 ) ; meanwhile , in the present work , we did not observe a relation with mutations of exons 7 and 13 of the tmc1 gene in iranian nshl . the findings of the current study indicate that mutations in exons 7 and 13 of tmc1 gene are not related to hearing loss in the iranian population . therefore , the tmc1 gene may not related to nshl , but further studies investigating related mutations in other parts of this gene in iranian population are necessary and could help in the genetic counseling of patients and design of practical strategies for the management of auditory disorder .

background : non - syndromic hearing loss ( nshl ) is the most common birth defect and occurs in approximately 1/1,000 newborns . nshl is a heterogeneous trait and can arise due to both genetic and environmental factors . mutations of the transmembrane channel - like 1 ( tmc1 ) gene cause non - syndromic deafness in humans and mice.objectives:the aim of the present study was to investigate the association of tmc1 gene mutations of the locus dfnb7/11 in exons 7 and 13 in a cohort of 100 patients with hearing loss in iran using polymerase chain reaction single - stranded conformation polymorphism ( pcr - sscp ) , heteroduplex analysis ( ha ) , and dna sequencing.patients and methods : in this experimental study , the blood samples of 100 nshl patients were collected from 10 provinces in iran . these patients had a mean age of 16.5 2.01 years and 74.15% of their parents had consanguinity . dna was extracted from specimens and mutations of exons 7 and 13 of the tmc1 gene were investigated using pcr - sscp . all samples were checked via ha reaction and suspected specimens with shift bands were subjected to dna sequencing for investigation of any gene variation.results:in this study , no mutation was found in the two exons of tmc1 gene . it was concluded from these results that mutations of the tmc1 gene s special exons 7 and 13 have a low contribution in patients and are not great of clinical importance in these iranian provinces.conclusions:more studies are needed to investigate the relationship between other parts of this gene with hearing loss in different populations through the country . more research could clarify the role of this gene and its relation with deafness and provide essential information for the prevention and management of auditory disorders caused by genetic factors in the iranian population .

a sustained research activity has been devoted to lanthanide complexes , because of their successful application as diagnostic tools in biomedical analysis as mri contrast agents [ 1 , 2 ] . they have been used even as effective catalysts for the hydrolytic cleavage of phosphate ester bonds . 4(4h)-quinazolines have been tested successfully against cancer and hiv virus [ 5 , 6 ] . the synthetic analogues of quinazolines have been found to exhibit antimalarial , anti - inflammatory , and anticancer activity . apart from the above , 2,3-disubstituted quinazoline-4-(3h)-ones have been reported for their wide variety of pharmacological activity [ 12 , 13 ] . the title ligand hmpbaq possesses multiple coordinating sites such as phenolic oxygen , carbonyl oxygen , nitrogen of the benzoyl amino group , and nitrogen of the quinazoline ring . we have observed its tridentating behavior with transition metal ions . in continuation of our work on quinazolines , here we report the conformational changes in the ligand on coordination with lanthanides and the relative antimicrobial activity . hydrazine hydrate , methyl 2-aminobenzoate , and o - vanillin were procured from rankem , merck , and himedia , respectively . the lanthanide nitrates were obtained by heating lanthanide oxides ( 99.9% ) ( indian rare earths limited , mumbai , india ) with dilute nitric acid ( 50% ) and evaporating the excessive acid . synthesesthe ligand hmpbaq was synthesized as in our earlier report ( see scheme 1 ) . a solution of ln(no3)3 ( 1 mmol ) and hmpbaq 0.838 gm ( 2 mmol ) was refluxed in ethanol ( 25 ml ) for 2 - 3 hours . the ph of the solution was then raised to 6.5 by the addition of sodium acetate and refluxed further for an hour . the precipitate obtained after concentrating the solution was filtered off , washed with water , and dried in air ( yield : 90% , mp > 245 c ) . the ligand hmpbaq was synthesized as in our earlier report ( see scheme 1 ) . a solution of ln(no3)3 ( 1 mmol ) and hmpbaq 0.838 gm ( 2 mmol ) was refluxed in ethanol ( 25 ml ) for 2 - 3 hours . the ph of the solution was then raised to 6.5 by the addition of sodium acetate and refluxed further for an hour . the precipitate obtained after concentrating the solution was filtered off , washed with water , and dried in air ( yield : 90% , mp > 245 c ) . elemental analysis was performed on a carlo erba strumentazione ( milan , italy ) chn analyzer . ir spectra were obtained on a nicolet 170 sx ft - ir spectrometer using kbr pellets , in the range 4004000 cm . h- and c nmr spectra were monitored on a jeol - amx-400 nmr spectrometer , using dmso - d6 as the solvent . tg / dta were recorded on a perkinelmer ( mass , usa ) ( pyris diamond ) analyzer in n2 atmosphere at a heating rate of 10c . mass spectra of the ligand and complex were recorded on a thermofinnigan 1020-automated gcms and jeol sx 102/da-6000 mass spectrometer / data system using argon and xenon ( 6 kv , 10 ma ) as the fab gas , respectively . epr spectra of the gd(iii ) and tb(iii ) complexes were monitored on a varian e-4x band spectrometer . the metal contents were determined by complexometric titrations with edta using xylene orange as an indicator . the antibacterial activity of the ligand , metal salts , and the corresponding complexes were assayed simultaneously against pseudomonas aeruginosa ( pa ) , bacillus cirroflagellosus ( bc ) , by cup - plate method . nutrient broth was prepared by dissolving peptone ( 0.5% ) , yeast extract ( 0.15% ) , beef extract ( 0.15% ) , sodium chloride ( 0.36% ) , and monopotassium phosphate ( 0.13% ) in distilled water ( 100 ml ) . the ph of the solution was adjusted to 7.2 by adding sodium hydroxide solution ( 4% ) and the resulting solution was autoclaved for 20 minutes at 15 psi . one day prior to the experiment , the cultures of pseudomonas aeruginosa and bacillus cirroflagellosus were inoculated in nutrient broth ( inoculation medium ) and incubated overnight at 37c . nutrient agar medium was prepared by dissolving peptone ( 1% ) , yeast extract ( 0.6% ) , beef extract ( 0.5% ) , and sodium chloride ( 0.5% ) in distilled water . the ph of the solution was adjusted to 7.2 by adding 4% aqueous sodium hydroxide solution . agar ( 2.4% ) was then added and the whole solution was autoclaved for 20 minutes at 15 psi . each test sample ( 1 mg ) was dissolved in dmso ( 1 ml ) , and 0.1 ml of this solution ( 10 g ) was used for testing . inoculation medium containing 24-hours grown culture was added aseptically to the nutrient medium and mixed thoroughly to get the uniform distribution . this solution was poured ( 25 ml in each dish ) into petri dishes and then allowed to attain room temperature . thereafter , punching the set of agar with a sterile cork borer and scooping out the punched part made the cups the test samples and the standard were tested at a concentration of 10 g . the plates were allowed to stand for an hour in order to facilitate the diffusion of the drug solution . the antifungal activity of the ligand and the corresponding metal complexes were tested against the pathogenic fungi aspergillus niger ( an ) and penicillium notatum ( pn ) by cup - plate method . nutrient agar medium was prepared by the same method as explained under evaluation of antibacterial activity . one and half day prior to the experiment , the fungal cultures of aspergillus niger and penicillium notatum prepared in the inoculation medium were incubated at 37c for 36 hours . the fungal medium was prepared by dissolving peptone ( 0.5% ) , sodium chloride ( 0.36% ) , monopotassium phosphate ( 0.13% ) , and glucose ( 2% ) in distilled water ( 100 ml ) . the ph of the solution was adjusted to 7.2 by adding sodium hydroxide solution ( 4% ) and the resulting solution was autoclaved for 20 minutes at 15 psi . one and half day , grown cultures were added aseptically to this medium and mixed thoroughly to get uniform distribution . the solutions of the test samples and standard were evaluated for antifungal activity by cup - plate method at a concentration of 10 g . the zone of inhibition was measured in millimeter for the particular test sample with each organism at 48 hours interval . the analytical data ( see table 1 ) indicate that the complexes have 1 : 2 ( metal : ligand ) stoichiometry and can be represented by the general formula [ la(mpbaq)2(h2o)2]no3 . they are soluble in dmso and dmf , sparingly soluble in ethanol and methanol , but insoluble in benzene , ether , and chloroform . the molar conductance data ( see table 1 ) of the complexes in dmso at 10 m is in the range of 44.0049.00 ohmcmmol , which indicates 1 : 1 electrolytic nature of the complexes . the diagnostic ir frequencies of the ligand hmpbaq and its complexes are compiled in table 2 . in the spectrum of the hmpbaq , the strong band observed at 1653 cm is assigned to (c = o ) of the quinazoline ring . the appearance of this band at a lower wave number is due to the existence of strong intermolecular hydrogen bonding between the oxygen of c = o and the hydrogen of the 2-[2-hydroxy-3-methoxy phenyl ) group , as observed in its crystal structure . the two nonequivalent phenolic oh groups are observed at 34602940 cm as a strong unresolved broad band . a medium intensity band at 3280 cm is assigned to (nh ) of the quinazoline ring . in the spectra of all the complexes , the (c = o ) has shifted to lower wave numbers indicating the involvement of carbonyl oxygen in coordination . the band due to (c = n ) has shifted to lower energy ( 16161572 cm ) , indicating coordination through benzyl amine nitrogen . the band due to phenolic oh groups was not observed in the spectra of the complexes , it might have been obscured by a broad band due to water . however , the coordination through only one or both of the phenolic oxygen / s was further confirmed by h nmr spectral studies . strong band at 1381 cm in the spectra of all the complexes indicates the presence of ionic nitrate . the presence of coordinated water molecules is suggested by the appearance of characteristic rocking frequency at 825 cm . h nmr spectra of the hmpbaq and its la(iii ) complex were recorded in dmso - d6 and the data along with the assignments are displayed in table 3 . the h nmr spectrum of hmpbaq exhibits two sharp peaks at 11.31 and 9.42 ppm , corresponding to o(2)h ( d2o exchangeable ) and o(4)h ( d2o exchangeable ) , respectively . two singlets and one doublet at 8.43 , 7.43 , and 7.81 ppm are due to c(21)h , n(3)h ( d2o exchangeable ) and c(13)h , respectively . n(3)h and c(13)h , being cis to one another , coupled together and this coupling results in the splitting of c(13)h signal . four triplets [ c(17)h , c(16)h , c(10)h , and c(4)h ] and six doublets [ c(18)h , c(15)h , c(11)h , c(9)h , c(5)h , and c(3)h ] have merged to give a multiplet at 7.316.6 ppm corresponding to ten aromatic protons . the resonance due to o(3)c(22)h3 and o(5)c(23)h3 appeared at 3.85 ppm . in the spectrum of la(iii ) complex , the resonance due to o(4)h has appeared at the same position as in the ligand ( 9.40 ppm ) indicating the noninvolvement of o(4)h in the coordination . the singlet at 11.31 ppm in the ligand spectrum ascribed to o(2)h group is not observed in la(iii ) complex . the other signals [ c(21)h , n(3)h , c(13)h , c(17)h , c(16)h , c(10)h , c(4)h , c(18)h , c(15)h , c(11)h , c(9)h , c(5)h , c(3)h , o(3)c(22)h3 , and o(5)c(23)h3 ] in la(iii ) complex did not show any considerable shift . the effective magnetic moments ( see table 1 ) of all the complexes indicate that they are paramagnetic in nature except la(iii ) and y(iii ) which are diamagnetic . the values obtained are similar to the van vleck and frank and hund 's values except in case of sm(iii ) and eu(iii ) where slightly higher values were obtained . this is due to low j - j separation , which leads to thermal population of higher energy levels . the values obtained are similar to those of typical lanthanide ions and indicate the noninvolvement of 4f electrons in bonding due to their very effective shielding by the 5s 5p octet . the energy level of the lowest excited state is very high with no contribution from orbital angular momentum and the anisotropic effect . value of 1.99 ( at room temperature ) and 2.04 ( at liquid nitrogen temperature ) compared to the free - ion value of tetracynoethylene ( 2.00277 ) with broad resonance lines was obtained . the g values being almost the same and similar line widths indicate that the line widths are independent of temperature . further , the complete absence of zero - field hyperfine splitting and the presence of broad bands indicate that the gd(iii ) ion is located in a rather disordered environment caused by strain . these strains d - strain for the zero field splitting distribution ) arise due to random hydrogen bonds between water molecules and the complex leading to distortions , which lead to broad resonance epr lines [ 19 , 20 ] . the electronic spectral data of the two representative complexes are given in table 4 . the free ligand shows an intense band at 32786 cmand two weak bands at 28328 and 38610 cm of which the first two are assigned to the n * and the latter to the * transitions , respectively . the electronic spectra of the complexes are dominated by ligand bands , with a slight shift to higher or lower energy levels . this slight shift was attributed to the effects of crystal field upon the interelectronic repulsion between the 4f electrons . the bonding parameter ( b ) , sinha 's covalence parameter ( ) , nephelauxetic parameter ( ) , and angular covalence ( ) have been calculated according to literature procedure [ 22 , 23 ] . values being less than unity and positive value of b and indicate metal - ligand covalent bonding . according to karraker , the shape of the hypersensitive transition reflects the environment of the metal ion . on comparison of the spectra with that of known compounds the tg / dta study of la(iii ) and pr(iii ) complexes was carried out as the representative . in case of la(iii ) complex , the initial weight loss of 11.24% ( cal . the next weight loss in the temperature range of 250350c is due to the loss of one ionic nitrate molecule ( obs . a further weight loss in the range of 350800c corresponds to two ligand molecules ( obs . 69.00% ; cal . 69.89% ) . finally , the most stable oxide was formed , on further heating up to 1000c . the percentage of metal obtained is in confirmation with the analytical values for the metal content . in case of pr(iii ) , the thermogram exhibits a loss of 3.00% ( cal . a loss of 10.00% ( cal . 10.35% ) between 240260c is due to the removal of one ionic nitrate molecule . a further weight loss of 69.00% ( cal . the mass spectrum of hmpbaq shows the formation of molecular ion peak at m / z = 419 and corresponds to the total molecular weight of the ligand . the fab mass spectra of [ sm(mpbaq)2(h2o)2]no3 and [ eu(mpbaq)2(h2o)2]no3 show the molecular ion peaks at m / z = 1084 and 1086 , respectively , supporting the composition of the complexes . the results of the antibacterial and antifungal studies are given in table 5 . the ligand hmpbaq was less active against pn , pa , and bc except against an where it has shown moderate activity . all the complexes , except la(iii ) , pr(iii ) , and nd(iii ) complexes , show moderate activity against bc . it was observed that , compared to the ligand and metal salts , the complexes exhibited enhanced antibacterial activity , which is due to the synergistic effect that increases the lipophilicity of the complexes . chelation decreases the polarity of the metal ion , which further leads to the enhancement of complex 's lipophilicity . since the microorganism cell is surrounded by a lipid membrane which favors the passage of lipid soluble materials , increased lipophilicities allows the penetration of complex into and through the membrane and deactivates the active enzyme sites of the microorganisms based on the above data , structure i is proposed for the lanthanide(iii ) complexes having the general formula [ ln(mpbaq)2(h2o)2]no3 , where ln = la(iii ) , pr(iii ) , nd(iii ) , sm(iii ) , eu(iii ) , gd(iii ) , tb(iii ) , dy(iii ) , and y(iii ) . in the present complexes , due to rotation about the n n bond , the ligand changes its conformation to facilitate the coordination in onn fashion as in the case of cd(ii ) complex as reported earlier . the antibacterial activity of the ligand is enhanced on complexation , whereas no distinct change is observed in case of antifungal activity .

new lanthanide(iii ) complexes with 2-[2-hydroxy-3-methoxyphenyl]-3-[hydroxyl-3-methoxybenzylamino]-1,2-dihydroquin- azoline-4(3h)-one ( hmpbaq ) have been synthesized and characterized by elemental analysis , conductance measurements , magnetic susceptibilities , spectroscopic ( ir , nmr , uv , epr ) , and thermal studies . molar conductance studies indicate 1 : 1 electrolytic behavior for these complexes . ir spectra indicate that hmpbaq acts as a tridentate ligand coordinating through carbonyl oxygen , benzyl amine nitrogen , and deprotonated phenolic oxygen . tg and dta studies of la(iii ) and pr(iii ) complexes indicate the presence of two coordinated water molecules . based on these studies , the complexes have been formulated as [ la(mpbaq)2(h2o)2]no3 , where ln = la(iii ) , pr(iii ) , nd(iii ) , sm(iii ) , eu(iii ) , gd(iii ) , th(iii ) , dy(iii ) , and y(iii ) . the ligand , lanthanide(iii ) salts , and the corresponding complexes have been simultaneously screened for their antibacterial and antifungal activities and compared with the drugs in use .

as an abrupt or rapid decline in renal filtration function , acute kidney injury ( aki ) is a common condition associated with significant morbidity and mortality . in critically ill patients , those with aki usually present a worse clinical outcome than their non - aki counterparts . although regarded as the standard indicators of kidney function loss , serum creatinine ( scr ) level and urine output are recognized as having limitations . on the one hand , scr can not accurately reflect the glomerular filtration rate ( gfr ) in a patient with unsteady state , and urine output is easily affected by water intake and the primary water load of the body . on the other hand , scr and urine output have limited sensitivity and specificity , and a delayed response to kidney impairment . all these factors suggest that scr and urine output are not appropriate markers in the early detection of aki . thus , an accurate and timely biomarker to predict aki onset or progression after renal insult is urgently needed . interleukin-18 ( il-18 ) , a member of the il-1 family of cytokines , is synthesized as an inactive 23-kda precursor by several tissues including monocytes , macrophages , and proximal tubular epithelial cells , and is processed into an active 18.3 kda cytokine by caspase-1 . it has been demonstrated in some animal studies as a mediator of renal ischemia reperfusion injury , inducing acute tubular necrosis , and neutrophil and monocyte infiltration of the renal parenchyma . more recently , numerous clinical studies have focused on the diagnostic accuracy of il-18 level in predicting aki [ 57 ] . with the evidence accumulating , contradictory results have raised concerns about the predictive value of aki across various settings . thus , we performed a systematic review and meta - analysis to investigate the diagnostic accuracy of il-18 level for predicting aki . since there is no clear consensus about the appropriate cutoff level of il-18 to predict aki and different thresholds have been reported by different studies , the summary receiver operating characteristic ( sroc ) curve was delineated for the meta - analysis . a computer - based search was performed in medline , embase , cochrane library , ovid , and springerlink databases , from inception until november 15 , 2013 , to identify potentially relevant articles . the search strategy consisted of terms related to aki ( acute kidney injury and acute renal failure ) combined with the term 18/il-18 . to ensure all articles were located , a secondary search of the articles already retrieved was undertaken , reviewing their reference lists . the preferred reporting items for systematic reviews and meta - analysis ( prisma ) guidelines for the conduct of meta - analyses were followed . the titles and abstracts were examined independently by two of the authors ( x. l. and j. y. ) to ascertain their relevance and inclusion for further analysis . inclusion criteria were that studies investigated the diagnostic accuracy of urinary il-18 to predict aki and had data which could be extracted into a 2 2 table or complete data which could be obtained from the corresponding author by e - mail . the following variables were recorded or recalculated : study population , sample size , age , sex , baseline il-18 level , cutoff value for urine il-18 , aki definition , number of patients who developed aki , timing of obtaining the specimen , specificity , sensitivity , and area under the roc curve ( auroc ) with 95 % confidence interval ( ci ) . two reviewers independently excluded articles on the basis of the title and abstract following a custom - made standardized table . the true - positive , true - negative , false - positive , and false - negative results of each included study were quantified . quality assessment was performed using the quality assessment of diagnostic accuracy studies ( quadas ) tool and independently by the authors ( x. l. and j. y. ) . the meta - analysis was conducted using sroc curve as described by rosman and the computation was performed using meta - disc1.4 . if multiple cutoff points were adopted in any study , the cutoff point ( test threshold ) , sensitivity and specificity in this analysis were selected according to the youden index . random effects models ( fem or rem ) were used on the basis of heterogeneity . we performed subgroup analysis to explore the remarkable heterogeneity in the light of different clinical settings . a computer - based search was performed in medline , embase , cochrane library , ovid , and springerlink databases , from inception until november 15 , 2013 , to identify potentially relevant articles . the search strategy consisted of terms related to aki ( acute kidney injury and acute renal failure ) combined with the term 18/il-18 . to ensure all articles were located , a secondary search of the articles already retrieved was undertaken , reviewing their reference lists . the preferred reporting items for systematic reviews and meta - analysis ( prisma ) guidelines for the conduct of meta - analyses were followed . the titles and abstracts were examined independently by two of the authors ( x. l. and j. y. ) to ascertain their relevance and inclusion for further analysis . inclusion criteria were that studies investigated the diagnostic accuracy of urinary il-18 to predict aki and had data which could be extracted into a 2 2 table or complete data which could be obtained from the corresponding author by e - mail . the following variables were recorded or recalculated : study population , sample size , age , sex , baseline il-18 level , cutoff value for urine il-18 , aki definition , number of patients who developed aki , timing of obtaining the specimen , specificity , sensitivity , and area under the roc curve ( auroc ) with 95 % confidence interval ( ci ) . two reviewers independently excluded articles on the basis of the title and abstract following a custom - made standardized table . the true - positive , true - negative , false - positive , and false - negative results of each included study were quantified . quality assessment was performed using the quality assessment of diagnostic accuracy studies ( quadas ) tool and independently by the authors ( x. l. and j. y. ) . the meta - analysis was conducted using sroc curve as described by rosman and the computation was performed using meta - disc1.4 . if multiple cutoff points were adopted in any study , the cutoff point ( test threshold ) , sensitivity and specificity in this analysis were selected according to the youden index . random effects models ( fem or rem ) were used on the basis of heterogeneity . we performed subgroup analysis to explore the remarkable heterogeneity in the light of different clinical settings . of 179 primary articles searched , 156 were excluded on the basis of abstract and/or title because they were laboratory studies , genetic studies , review / comment articles , animal studies , or irrelevant to the current analysis ; 3 were excluded because non - english articles . of the 20 remaining articles , 5 studies with accurate diagnostic values of il-18 missing and 3 studies lacking effective data ( though we had contacted the corresponding authors to request the missing information ) were excluded . as a result , 11 studies [ 6 , 7 , 1119 ] met the inclusion criteria and were selected for the analysis ( fig . 1flowchart representing study selection for systematic review of urine il-18 as a diagnostic marker for aki . il interleukin , aki acute kidney injury flowchart representing study selection for systematic review of urine il-18 as a diagnostic marker for aki . il interleukin , aki acute kidney injury characteristics of the included trials are shown in table 1 . two come from china [ 6 , 11 ] , seven from the usa [ 7 , 13 , 14 , 1619 ] , one from taiwan , china , and one from australia . most studies were conducted on critical patients , including those with cardiac surgery ( cardiopulmonary bypass ) and transplantation , as well as various intensive care patients . five studies [ 6 , 11 , 13 , 17 , 18 ] focused on pediatric patients . eight studies defined aki using acute kidney injury network ( akin ) and/or risk , injury , failure , loss and end - stage renal disease ( rifle ) criteria , two [ 11 , 17 ] using modified pediatric rifle , and one using scr level which , however , rose to 50 % of baseline in the first 72 h. ten studies harnessed urine il-18 concentration as the cutoff value and two [ 11 , 15 ] the ratio of urine il-18 to urine - creatinine concentration.table 1characteristics of included studiesstudy ( first author + year)country of originstudy populationmean age ( years)men ( % ) sample sizenumber ( % ) of akimean baseline il-18 ( pg / ml)definition of akiil-18 assaysample storage ( c)zheng et al . chinachildren with chd or undergoing cpb surgerynon - aki 11.4 ( 2.247.0)aki 5.9 ( 0.644.5 ) 39 ( 67.2)5829 ( 50)non - aki 7.9 ( 3.823.1)aki 17.6 ( 7.241.5)scr 0.3 mg / dl or 50 % baseline , urine 0.5 ml / kg/6 h akin criteriaelisa80sirota et al . 6.827 ( 67.5)407 ( 17.5)aki 0 ( 018.57)non - aki 0 ( 0200.10)scr 50 % baseline , rifle and akin criteriaelisa80li et al . chinanon - septic critically ill neonates34.1 3.2 34 ( 54.8)6211 ( 17.7)/scr > 1.5 mg / dl on the first 3 days of life , after the first 3 days of life , a 25 % decrease in eccl . taiwan , chinaccu patients66 1113 ( 75)15043 ( 28.7)71 5akin criteriaelisa80parikh et al . usapediatric patients with congenital cardiac lesions surgery3.8 4.5171 ( 55)31153 ( 17.0)/receipt of acute dialysis during the entire hospital stay or scr double baseline . usacardiac surgery adults at high risk for aki71 10826 ( 68)121960 ( 4.9)/receipt of acute dialysis during the entire hospital stay or scr double baseline . australiaicu admission60 17367 ( 70.2)523147 ( 28.1)73 340 scr 0.3 mg / dl or 50 % baselineakin48 or rifle 24 criteriaelisa80liangos et al . usapatients undergoing on - pump cardiac surgery68 1174 ( 72)10313 ( 12.6)/scr 50 % baseline in the first 72 h following termination of cpbelisa80washburn et al . usapicu children who received mechanical ventilation6.5 6.473 ( 53)137103 ( 75.2)179.0 337.9paediatric modified rifleelisa80parikh et al . 5.330 ( 54.5)5520 ( 36.4)1.65 1.01scr 50 % baselineelisa80parikh et al . usaards and ali patient50.2 17.072 ( 52.2)13852 ( 37.7)aki 104 ( 0955)control 0 ( 0173)scr 50 % baselineelisa80 aki acute kidney injury , akin acute kidney injury network , elisa enzyme - linked immunosorbent assay , chd congenital heart disease , cpb cardiopulmonary bypass , scr serum creatinine , rifle risk , injury , failure , loss and end - stage renal disease , eccl estimated cr clearance , ccu coronary care unit , icu intensive care unit , picu pediatric intensive care unit , ards acute respiratory distress syndrome , ali acute lung injury months ; gestational age , weeks ; ( pg / ml)/mmol / l cr characteristics of included studies aki acute kidney injury , akin acute kidney injury network , elisa enzyme - linked immunosorbent assay , chd congenital heart disease , cpb cardiopulmonary bypass , scr serum creatinine , rifle risk , injury , failure , loss and end - stage renal disease , eccl estimated cr clearance , ccu coronary care unit , icu intensive care unit , picu pediatric intensive care unit , ards acute respiratory distress syndrome , ali acute lung injury months ; gestational age , weeks ; ( pg / ml)/mmol / l cr table 2 lists the methodological quality assessment of the included 11 studies . ten studies enrolled single or multicenter consecutive patients prospectively , one was retrospective and prospective in design . the study by chen et al . did not define inclusion and exclusion criteria clearly . the reference standards used in the afore - mentioned studies were creatinine based , which currently is the most widely used standard for evaluating kidney function . the conditions of follow - up were reported in the 10 prospective cohort studies ; there were no selective losses in them . overall , the quality of the studies was suboptimal , without sufficient information to assess all the bias , and uninterpretable , indeterminate or intermediate index test results were not reported . the quality assessment was performed independently by the authors ( x. l. and j. y.).table 2quality assessment of individual studiesstudystudy designspectrum bias eligibility criteria clearly definedappropriate reference standarddifferential verification bias index test and reference standard sufficiently describedselective loss during followup important confounders identifiedzheng et al . prospective studynoyesyesyesyesnoyes this item is labeled no if the spectrum of patients was representative of patients who received the test in practice , otherwise it is labeled yes this item is labeled no when all patients received the same reference standard , otherwise it is labeled yes this item is labeled yes if patients who were lost to follow - up differed systematically from those who remained , otherwise it is labeled no this item is not applicable if the study was retrospective in design quality assessment of individual studies this item is labeled no if the spectrum of patients was representative of patients who received the test in practice , otherwise it is labeled yes this item is labeled no when all patients received the same reference standard , otherwise it is labeled yes if patients who were lost to follow - up differed systematically from those who remained , otherwise it is labeled no this item is not applicable if the study was retrospective in design as the respective number of true - positive , false - positive , true - negative , and false - negative results was not provided by the studies , these indexes were calculated from available sensitivity , specificity , and sample size values . results are reported in table 3 which enumerates specimen obtaining times and aki predictive times of each study . cutoff and auroc values are also included in the table . as can be seen , cutoff values for urine il-18 varied across studies.table 3sensitivity and specificity of individual studies for urine il-18 to predict akistudytime of obtaining specimentpfpfntncutoff value ( pg / ml)sensitivity ( % ) specificity ( % ) auroc ( 95 % ci)assess time ( h)zheng et al . 0 , 4 , 6 , 12 , and 24 h after the initiation of cpb28111184996.6062.100.835 ( 0.7290.940)4sirota1 et al admission50839729336 34780.62 ( 0.560.67)0liangos et al . 2 h post - cardiopulmonary bypass10313599275660.66 ( 0.490.83)2washburn et al . 2 pm each day39764277538780.54 ( 0.310.77)24551048247553710.61 ( 0.43 0.78)48parikh et al . every 2 h for the first 12 h and then once every 12 h5115345025970.61410210335050940.75121248312060890.7324parikh et al . days 0 , 1 , and 3382914572574660.73124 il interleukin , aki acute kidney injury , auroc area under the receiver operating characteristic curve , ci confidence interval , cpb cardiopulmonary bypass , fn false - negative , fp false - positive , tn true - negative , tp true - positive pg / mg ucr ( pg / ml)/mmol / l cr sensitivity and specificity of individual studies for urine il-18 to predict aki il interleukin , aki acute kidney injury , auroc area under the receiver operating characteristic curve , ci confidence interval , cpb cardiopulmonary bypass , fn false - negative , fp false - positive , tn true - negative , tp true - positive the distribution of accurate estimator in sroc curve floor plan and the spearman correlation coefficient ( r = 0.764 , p = 0.006 ) of logarithmic sensitivity and logarithm ( 1-specificity ) showed that there was a threshold effect in different studies ( fig . 2 ; table 4).fig . 2the distribution of accurate estimator in sroc curve floor plan . sroc summary receiver operating characteristictable 4analysis of diagnostic thresholdspearman correlation coefficient : 0.764 , p value = 0.006logit ( tpr ) vs. logit ( fpr)moses model ( d = a + bs)weighted regression ( inverse variance)varcoeff.std . errort p valuea1.7910.2547.0610.0001b(1)0.2240.1571.4280.1870tau - squared estimate = 0.1904 ( convergence is achieved after 6 iterations)restricted maximum likelihood estimation ( reml)no . studies = 11 add 1/2 to all cells of the studies with zero the distribution of accurate estimator in sroc curve floor plan . sroc summary receiver operating characteristic analysis of diagnostic threshold tau - squared estimate = 0.1904 ( convergence is achieved after 6 iterations ) restricted maximum likelihood estimation ( reml ) no . studies = 11 add 1/2 to all cells of the studies with zero figure 3 shows the forest plots and pooled estimates of sensitivity , specificity and diagnostic odds ratios ( ors ) respectively . we found a diagnostic or of 5.11 ( 95 % ci 3.228.12 ) for urine il-18 level to predict aki ( cochran - q = 28.19 , p = 0.0017 ) with a sensitivity and specificity respectively of 0.51 ( heterogeneity chi - squared 84.53 , p < 0.001 ) and 0.79 ( heterogeneity chi - squared 62.84 , p < as there was no statistically significant between b and 0 ( p = 0.1870 ) , the mantel haenszel model was utilized to draw the fitting curve of sroc ( fig . the pooled auroc was 0.77 ( 95 % ci 0.710.83 , q = 0.71).fig . 3forest plots and pooled estimates of a diagnostic odds ratio ( or ) , b sensitivity , and c specificityfig . 4the fitting curve of sroc forest plots and pooled estimates of a diagnostic odds ratio ( or ) , b sensitivity , and c specificity the fitting curve of sroc subgroup analysis ( table 5 ) showed that urine il-18 level in pediatric patients ( < 18 years ) was more effective in predicting aki , with a diagnostic or of 7.510 ( 95 % ci 2.98818.875 ) compared to 4.652 ( 2.7107.987 ) for the adult group ( p = 0.334 ) ; the early aki predictive time ( < 12 h ) subgroup displayed the highest diagnostic or of 8.176 ( 95 % ci 2.19130.507 ) among the three subgroups ( < 12 , 24 and 48 h , p = 0.037 ) . the pooled estimate diagnostic or of the admission subgroup was 3.81 ( 95 % ci 2.086.99 ) and that of the subgroup for other times 7.16 ( 3.6214.18 ) . there were no significant differences between the two ( p = 0.388 ) . there were significant differences ( p = 0.008 ) between cardiac surgery patients and patients in intensive care unit or coronary care unit patients in the subgroup analysis , with diagnostic ors of 5.28 ( 3.597.76 ) and 5.31 ( 2.5910.87 ) , respectively.table 5pooled diagnostic accuracy of il-18 in various settingssubgroup factorssubgroup criteriareference numbersq valuep valuei ( % ) hierarchical summary or ( 95 % ci)p value for between subgroupsage<18 years510.230.03760.97.51 ( 2.9918.88)0.33418 years615.540.00867.84.32 ( 2.487.51)predictive time12 h518.270.00178.18.18 ( 2.1930.51)0.03724 h44.480.21433.05.07 ( 2.589.96)48 h55.040.28320.74.95 ( 3.397.24)obtaining specimenadmission413.40.00477.63.81 ( 2.086.99)0.388other times710.380.10942.47.16 ( 3.6214.18)patientscardiac surgery40.590.900.015.28 ( 3.5937.762)0.008other patients723.280.00174.25.31 ( 2.5910.87 ) or odds ratio , ci confidence interval pooled diagnostic accuracy of il-18 in various settings or odds ratio , ci confidence interval of 179 primary articles searched , 156 were excluded on the basis of abstract and/or title because they were laboratory studies , genetic studies , review / comment articles , animal studies , or irrelevant to the current analysis ; 3 were excluded because non - english articles . of the 20 remaining articles , 5 studies with accurate diagnostic values of il-18 missing and 3 studies lacking effective data ( though we had contacted the corresponding authors to request the missing information ) were excluded . as a result , 11 studies [ 6 , 7 , 1119 ] met the inclusion criteria and were selected for the analysis ( fig . 1flowchart representing study selection for systematic review of urine il-18 as a diagnostic marker for aki . il interleukin , aki acute kidney injury flowchart representing study selection for systematic review of urine il-18 as a diagnostic marker for aki . il interleukin , aki acute kidney injury characteristics of the included trials are shown in table 1 . two come from china [ 6 , 11 ] , seven from the usa [ 7 , 13 , 14 , 1619 ] , one from taiwan , china , and one from australia . most studies were conducted on critical patients , including those with cardiac surgery ( cardiopulmonary bypass ) and transplantation , as well as various intensive care patients . five studies [ 6 , 11 , 13 , 17 , 18 ] focused on pediatric patients . eight studies defined aki using acute kidney injury network ( akin ) and/or risk , injury , failure , loss and end - stage renal disease ( rifle ) criteria , two [ 11 , 17 ] using modified pediatric rifle , and one using scr level which , however , rose to 50 % of baseline in the first 72 h. ten studies harnessed urine il-18 concentration as the cutoff value and two [ 11 , 15 ] the ratio of urine il-18 to urine - creatinine concentration.table 1characteristics of included studiesstudy ( first author + year)country of originstudy populationmean age ( years)men ( % ) sample sizenumber ( % ) of akimean baseline il-18 ( pg / ml)definition of akiil-18 assaysample storage ( c)zheng et al . chinachildren with chd or undergoing cpb surgerynon - aki 11.4 ( 2.247.0)aki 5.9 ( 0.644.5 ) 39 ( 67.2)5829 ( 50)non - aki 7.9 ( 3.823.1)aki 17.6 ( 7.241.5)scr 0.3 mg / dl or 50 % baseline , urine 0.5 ml / kg/6 h akin criteriaelisa80sirota et al . 6.827 ( 67.5)407 ( 17.5)aki 0 ( 018.57)non - aki 0 ( 0200.10)scr 50 % baseline , rifle and akin criteriaelisa80li et al . chinanon - septic critically ill neonates34.1 3.2 34 ( 54.8)6211 ( 17.7)/scr > 1.5 mg / dl on the first 3 days of life , after the first 3 days of life , a 25 % decrease in eccl . taiwan , chinaccu patients66 1113 ( 75)15043 ( 28.7)71 5akin criteriaelisa80parikh et al . usapediatric patients with congenital cardiac lesions surgery3.8 4.5171 ( 55)31153 ( 17.0)/receipt of acute dialysis during the entire hospital stay or scr double baseline . usacardiac surgery adults at high risk for aki71 10826 ( 68)121960 ( 4.9)/receipt of acute dialysis during the entire hospital stay or scr double baseline . australiaicu admission60 17367 ( 70.2)523147 ( 28.1)73 340 scr 0.3 mg / dl or 50 % baselineakin48 or rifle 24 criteriaelisa80liangos et al . usapatients undergoing on - pump cardiac surgery68 1174 ( 72)10313 ( 12.6)/scr 50 % baseline in the first 72 h following termination of cpbelisa80washburn et al . usapicu children who received mechanical ventilation6.5 6.473 ( 53)137103 ( 75.2)179.0 337.9paediatric modified rifleelisa80parikh et al . 5.330 ( 54.5)5520 ( 36.4)1.65 1.01scr 50 % baselineelisa80parikh et al . usaards and ali patient50.2 17.072 ( 52.2)13852 ( 37.7)aki 104 ( 0955)control 0 ( 0173)scr 50 % baselineelisa80 aki acute kidney injury , akin acute kidney injury network , elisa enzyme - linked immunosorbent assay , chd congenital heart disease , cpb cardiopulmonary bypass , scr serum creatinine , rifle risk , injury , failure , loss and end - stage renal disease , eccl estimated cr clearance , ccu coronary care unit , icu intensive care unit , picu pediatric intensive care unit , ards acute respiratory distress syndrome , ali acute lung injury months ; gestational age , weeks ; ( pg / ml)/mmol / l cr characteristics of included studies aki acute kidney injury , akin acute kidney injury network , elisa enzyme - linked immunosorbent assay , chd congenital heart disease , cpb cardiopulmonary bypass , scr serum creatinine , rifle risk , injury , failure , loss and end - stage renal disease , eccl estimated cr clearance , ccu coronary care unit , icu intensive care unit , picu pediatric intensive care unit , ards acute respiratory distress syndrome , ali acute lung injury months ; gestational age , weeks ; ( pg / ml)/mmol / l cr ten studies enrolled single or multicenter consecutive patients prospectively , one was retrospective and prospective in design . the study by chen et al . did not define inclusion and exclusion criteria clearly . the reference standards used in the afore - mentioned studies were creatinine based , which currently is the most widely used standard for evaluating kidney function . the conditions of follow - up were reported in the 10 prospective cohort studies ; there were no selective losses in them . overall , the quality of the studies was suboptimal , without sufficient information to assess all the bias , and uninterpretable , indeterminate or intermediate index test results were not reported . the quality assessment was performed independently by the authors ( x. l. and j. y.).table 2quality assessment of individual studiesstudystudy designspectrum bias eligibility criteria clearly definedappropriate reference standarddifferential verification bias index test and reference standard sufficiently describedselective loss during followup important confounders identifiedzheng et al . prospective studynoyesyesyesyesnoyes this item is labeled no if the spectrum of patients was representative of patients who received the test in practice , otherwise it is labeled yes this item is labeled no when all patients received the same reference standard , otherwise it is labeled yes this item is labeled yes if patients who were lost to follow - up differed systematically from those who remained , otherwise it is labeled no this item is not applicable if the study was retrospective in design quality assessment of individual studies this item is labeled no if the spectrum of patients was representative of patients who received the test in practice , otherwise it is labeled yes this item is labeled no when all patients received the same reference standard , otherwise it is labeled yes if patients who were lost to follow - up differed systematically from those who remained , otherwise it is labeled no this item is not applicable if the study was retrospective in design as the respective number of true - positive , false - positive , true - negative , and false - negative results was not provided by the studies , these indexes were calculated from available sensitivity , specificity , and sample size values . results are reported in table 3 which enumerates specimen obtaining times and aki predictive times of each study . cutoff and auroc values are also included in the table . as can be seen , cutoff values for urine il-18 varied across studies.table 3sensitivity and specificity of individual studies for urine il-18 to predict akistudytime of obtaining specimentpfpfntncutoff value ( pg / ml)sensitivity ( % ) specificity ( % ) auroc ( 95 % ci)assess time ( h)zheng et al . 0 , 4 , 6 , 12 , and 24 h after the initiation of cpb28111184996.6062.100.835 ( 0.7290.940)4sirota1 et al . 24 h after orthotopic liver transplantation57226/72790.74924li et al . 48 h admitted744471,800 64920.72 ( 0.520.93)48chen et al . admission50839729336 34780.62 ( 0.560.67)0liangos et al . 2 h post - cardiopulmonary bypass10313599275660.66 ( 0.490.83)2washburn et al . 2 pm each day39764277538780.54 ( 0.310.77)24551048247553710.61 ( 0.43 0.78)48parikh et al . every 2 h for the first 12 h and then once every 12 h5115345025970.61410210335050940.75121248312060890.7324parikh et al . days 0 , 1 , and 3382914572574660.73124 il interleukin , aki acute kidney injury , auroc area under the receiver operating characteristic curve , ci confidence interval , cpb cardiopulmonary bypass , fn false - negative , fp false - positive , tn true - negative , tp true - positive pg / mg ucr ( pg / ml)/mmol / l cr sensitivity and specificity of individual studies for urine il-18 to predict aki il interleukin , aki acute kidney injury , auroc area under the receiver operating characteristic curve , ci confidence interval , cpb cardiopulmonary bypass , fn false - negative , fp false - positive , tn true - negative , tp true - positive the distribution of accurate estimator in sroc curve floor plan and the spearman correlation coefficient ( r = 0.764 , p = 0.006 ) of logarithmic sensitivity and logarithm ( 1-specificity ) showed that there was a threshold effect in different studies ( fig . 2 ; table 4).fig . sroc summary receiver operating characteristictable 4analysis of diagnostic thresholdspearman correlation coefficient : 0.764 , p value = 0.006logit ( tpr ) vs. logit ( fpr)moses model ( d = a + bs)weighted regression ( inverse variance)varcoeff.std . errort p valuea1.7910.2547.0610.0001b(1)0.2240.1571.4280.1870tau - squared estimate = 0.1904 ( convergence is achieved after 6 iterations)restricted maximum likelihood estimation ( reml)no . studies = 11 add 1/2 to all cells of the studies with zero the distribution of accurate estimator in sroc curve floor plan . sroc summary receiver operating characteristic analysis of diagnostic threshold tau - squared estimate = 0.1904 ( convergence is achieved after 6 iterations ) restricted maximum likelihood estimation ( reml ) no . studies = 11 add 1/2 to all cells of the studies with zero figure 3 shows the forest plots and pooled estimates of sensitivity , specificity and diagnostic odds ratios ( ors ) respectively . we found a diagnostic or of 5.11 ( 95 % ci 3.228.12 ) for urine il-18 level to predict aki ( cochran - q = 28.19 , p = 0.0017 ) with a sensitivity and specificity respectively of 0.51 ( heterogeneity chi - squared 84.53 , p < 0.001 ) and 0.79 ( heterogeneity chi - squared 62.84 , p < as there was no statistically significant between b and 0 ( p = 0.1870 ) , the mantel haenszel model was utilized to draw the fitting curve of sroc ( fig . the pooled auroc was 0.77 ( 95 % ci 0.710.83 , q = 0.71).fig . 3forest plots and pooled estimates of a diagnostic odds ratio ( or ) , b sensitivity , and c specificityfig . 4the fitting curve of sroc forest plots and pooled estimates of a diagnostic odds ratio ( or ) , b sensitivity , and c specificity the fitting curve of sroc subgroup analysis ( table 5 ) showed that urine il-18 level in pediatric patients ( < 18 years ) was more effective in predicting aki , with a diagnostic or of 7.510 ( 95 % ci 2.98818.875 ) compared to 4.652 ( 2.7107.987 ) for the adult group ( p = 0.334 ) ; the early aki predictive time ( < 12 h ) subgroup displayed the highest diagnostic or of 8.176 ( 95 % ci 2.19130.507 ) among the three subgroups ( < 12 , 24 and 48 h , p = 0.037 ) . the pooled estimate diagnostic or of the admission subgroup was 3.81 ( 95 % ci 2.086.99 ) and that of the subgroup for other times 7.16 ( 3.6214.18 ) . there were no significant differences between the two ( p = 0.388 ) . there were significant differences ( p = 0.008 ) between cardiac surgery patients and patients in intensive care unit or coronary care unit patients in the subgroup analysis , with diagnostic ors of 5.28 ( 3.597.76 ) and 5.31 ( 2.5910.87 ) , respectively.table 5pooled diagnostic accuracy of il-18 in various settingssubgroup factorssubgroup criteriareference numbersq valuep valuei ( % ) hierarchical summary or ( 95 % ci)p value for between subgroupsage<18 years510.230.03760.97.51 ( 2.9918.88)0.33418 years615.540.00867.84.32 ( 2.487.51)predictive time12 h518.270.00178.18.18 ( 2.1930.51)0.03724 h44.480.21433.05.07 ( 2.589.96)48 h55.040.28320.74.95 ( 3.397.24)obtaining specimenadmission413.40.00477.63.81 ( 2.086.99)0.388other times710.380.10942.47.16 ( 3.6214.18)patientscardiac surgery40.590.900.015.28 ( 3.5937.762)0.008other patients723.280.00174.25.31 ( 2.5910.87 ) or odds ratio , ci confidence interval pooled diagnostic accuracy of il-18 in various settings or odds ratio , ci confidence interval the current study presents a meta - analysis of urine il-18 for predicting aki development via the sroc analysis approach , both overall and across a range of subgroups . the finding derived is consistent with previous studies , which lends more force to the use of urine il-18 as a marker of aki in clinical practice . the results of this meta - analysis indicate that urine il-18 had a pooled diagnostic or of 5.11 and the estimated area under the curve ( auc ) of the mean roc plot was 0.77 ( q = 0.71 ) , with a high heterogeneity in pooled sensitivity and specificity . this suggests that urine il-18 has a higher chance of early detecting an aki compared to scr , but the application of this biomarker in the diagnosis of aki should be limited to a certain range in the light of limitations intrinsic to such studies . since pooled results may increase statistical power and lead to more precise estimates of a treatment effect and the pooled random or fixed effect models reflect the between - study variance , this may shed light on larger populations . due to the presence of a threshold effect , we used sroc curve fitting , the area under roc and q index , to merge the data . in the studies included , cutoff values were expressed in two types , urinary concentration or ratio of urine il-18 and creatinine concentration , and identified as varying across studies ( 11.25125 pg / ml ) . such differences can be explained by : ( 1 ) use of different reagents in these studies though the assay methods were enzyme - linked immunosorbent assay ( elisa ) ; and ( 2 ) differences in clinical settings and study population . therefore , it might be necessary for each center using urine il-18 level for early aki diagnosis to define a specific reference range and cutoff value for each clinical setting . in addition , a significant non - threshold effect heterogeneity exists across these studies . since these studies were based on different institutions across the world , heterogeneity was inevitable concerning differences in aki definitions , aki settings , times for obtaining specimen , and experimental groups admitted to assess the predictive value of urine il-18 . we attempted to use meta - regression to explore the sources of heterogeneity , but failed . so subgroup analysis was performed and proved that urine il-18 level in pediatric patients and the early aki predictive time group ( < 12 h ) was more effective in predicting aki , which might principally account for the heterogeneity . nevertheless , as the kidney undergoes growth and maturation in neonates who manifest different physiological states due to the abrupt changes at birth , many risk factors are correlated with aki and the timing of kidney injury remains unknown . the metabolic capacity and compensatory ability of neonates and children are also different from those of adults . subgroup analysis of age should be more specific if more clinical trials are conducted . regarding aki definition , akin , rifle , akin and/or rifle , and modified pediatric rifle criteria the pooled diagnostic or of aki within 12 h was greater than that of 24 or 48 h in subgroup analysis . this is useful in clinical processing since preventive strategies can be formulated if aki can be predicted in advance . using scr level as the gold standard of diagnosis of aki is another limitation of such studies because scr is not an ideal marker of early loss of glomerular filtration or kidney injury . however , its use in routine clinical practice is restrained because it is invasive , time - consuming and radioactive . cross - sectional studies indicate that urinary il-18 levels are markedly elevated in patients with acute tubular necrosis compared with healthy controls and a variety of other renal pathologies , including urinary tract infection , chronic renal insufficiency , and pre - renal azotemia . therefore , the pathophysiology of il-18 still remains incompletely understood and the true role of il-18 may be as a mediator of specific injury subtypes rather than as a marker of injury . though il-18 can be induced in the proximal tubule after aki , and released into urine after cleavage by caspase-1 [ 25 , 26 ] , it can also be derived from lung injury and myocardial ischemia , etc . the cost of a single creatinine test is less than a dollar , while that of il-18 is five times higher . in the course of aki , biochemical indices need to be monitored and detected many times ; given the modest clinical value of il-18 and its high cost , serum creatinine concentration and change might still be a good indicator rather than il-18 . in conclusion , this meta - analysis included more than 2,700 patients from 11 studies . the diagnostic accuracy for aki tends to be more effective in pediatric patients and early aki predictive time . to improve the diagnostic value of urine il-18 , more appropriately designed investigations ( e.g. with randomized design and eliminating potential confounders )

backgroundinterleukin-18 ( il-18 ) mediates ischemic acute tubular necrosis ; it has been proved as a rapid , reliable , and affordable test marker for the early detection of acute kidney injury ( aki ) , but its predictive accuracy varies greatly.methodsmedline and embase , cochrane library , ovid , and springerlink ( from inception to november 15 , 2013 ) were searched for relevant studies ( in english ) investigating diagnostic accuracy of urine il-18 to predict aki in various clinical settings . the text index was increasing or increased urine il-18 level and the main outcome was the development of aki , which was primarily based on serum creatinine level [ using risk , injury , failure , loss and end - stage renal disease ( rifle ) , acute kidney injury network , or modified pediatric rifle criteria in pediatric patients ] . pooled estimates of diagnostic odds ratio ( or ) , sensitivity and specificity were calculated . summary receiver operating characteristic curves were used to calculate the measures of accuracy and q point value ( q * ) . remarkable heterogeneity was explored further by subgroup analysis based on the different clinical settings.resultswe analyzed data from 11 studies of 3 countries covering 2,796 patients . these studies were marked by limitations of threshold and non - threshold effect heterogeneity . across all settings , the diagnostic or for urine il-18 level to predict aki was 5.11 [ 95 % confidence interval ( ci ) 3.228.12 ] , with sensitivity and specificity respectively at 0.51 and 0.79 . the area under the roc curve of urine il-18 level to predict aki was 0.77 ( 95 % ci 0.710.83 ) . subgroup analysis showed that urine il-18 level in pediatric patients ( < 18 years ) and early aki predictive time ( < 12 h ) were more effective in predicting aki , with diagnostic ors of 7.51 ( 2.9918.88 ) , 8.18 ( 2.1930.51 ) , respectively.conclusionurine il-18 holds promise as a biomarker in the prediction of aki but has only moderate diagnostic value .

the process of odontogenesis is under the control of homeobox ( hox ) genes ; a number of different mesenchymal regulatory molecules and their receptors . hox genes are classified as muscle segment ( msx1 and msx2 ) , distal - less ( dlx ) , orthodontical , goosecoid , paired box gene 9 ( pax9 ) and sonic hedgehog ( shh ) . msx1 and msx2 genes are responsible for the developmental position and further development of tooth buds , respectively . pax9 is a transcription factor required for tooth morphogenesis and plays a role in the establishment of the inductive capacity of the tooth mesenchyme as it is necessary for the mesenchymal expression of bone morphogenetic protein ( bmp4 ) , msx1 and lef1 genes . tumor necrosis factor , fibroblast growth factor , bmp , shh and wnt pathways are involved in signaling pathways of organogenesis on the 9 to 11 embryonic days to initiate tooth epithelium . any mutation in these genes and any disruption of regulatory molecules may result in the anomaly of dental characteristics . hypodontia , oligodontia and anodontia are the terms used to describe the numerical values of tooth agenesis . hypodontia is the absence of 1 - 6 teeth ( excluding third molars ) , whereas oligodontia refers to the absence of more than 6 teeth ( excluding third molars ) and anodontia is the complete absence of teeth . hypodontia is frequently accompanied with cleft - lip or palate , reduction in tooth size , short root anomaly , malformation of other teeth , impaction , maxillary canine and first premolar transposition , delayed formation or eruption of other teeth , microdontia , taurodontism , enamel hypoplasia and altered craniofacial growth . sometimes , it is caused by environmental factors such as ; infection , different kinds of trauma in the apical area of dentoalveolar process , chemical substances or drugs , radiation therapy or disturbances in the jaw innervations , but in the majority of cases , hypodontia is impacted by genetics . autosomal dominant inheritance with incomplete penetrance and variable expressivity was first proposed by burzynski and escobar . for a genetic linkage study on hypodontia , arte et al . , evaluated 214 family members in three generations and concluded that incisor - premolar agenesis is transmitted by autosomal dominant genes with small upper incisors , ectopic canines , taurodontism and rotated premolars as accompanying anomalies . a familial autosomal dominant hypodontia was demonstrated to be caused by a point mutation in the msx1 gene . vastardis et al . , using a linkage analysis in a family with second premolar and third molar agenesis , defined a locus on the chromosome 4p16 as the site of the msx1 . sequence analysis revealed arg31-to - pro missense mutation in the msx1 homeodomain for all of the affected subjects . arg31-to - pro mutation is known to influence the msx1 interactions , which are critical in the normal development of human teeth . this finding supported the result of an animal study , which showed a knockout mutation of msx1 gene leading to the inhibition of dental development ; however , when the premolar agenesis was accompanied with a lateral incisor , the influence of msx1 and msx2 genes could not be proved . another gene , causing tooth agenesis is pax9 in chromosome 14 ( 14q21-q13 ) . in hypodontia cases , a frameshift mutation and a nonsense termination mutation of the same gene have been observed in oligodontia . according to das et al . , this situation suggests that hypodontia and oligodontia are not fundamentally different or at least can be caused by different mutations in the same gene . the frameshift mutation of pax9 gene located on chromosome 14 was identified as responsible for autosomal dominant oligodontia in a large family for four generations . in some of the affected members , maxillary and mandibular second premolars and mandibular central incisors were absent in addition to the lack of permanent molars ; although , a normal primary dentition was present . in 2001 , nieminen et al . , identified an a - to - t transversion of the pax9 gene in a family with autosomal dominant oligodontia . they reported that all the second and third permanent molars , maxillary lateral incisors and in some cases all of the first permanent molars and several second premolars were missing , in addition to deciduous second molar agenesis . a year later , frazier - bower et al . concluded that the molar oligodontia is due to allelic heterogeneity in pax9 , which is an important regulator of molar teeth development . in 2003 , lamni showed a distinct phenotype with canine agenesis , which is quite rare , in a family segregating autosomal dominant oligodontia . in recent studies , different transition , insertion and transversion mutations in pax9 gene were reported , providing more comprehensive explanations for the pathogenic mechanisms of the interactions between mutations and tooth agenesis . in addition to pax9 and msx1 genes , contribution of a regulatory molecule in the mesenchyme , called transforming growth factor alpha , might play a role in isolated dental agenesis . furthermore , axin2 is a negative regulator of canonical wnt signaling and mutations of this gene can cause tooth agenesis associated with colorectal cancer . another mode of inheritance for hypodontia associated with other dental anomalies such as dental malformations , enamel hypoplasia and eruption failure is the autosomal recessive inheritance , with polygenic inheritance also suggested . studies showed that tooth agenesis could be manifested as an isolated feature or as a part of a syndrome . tooth agenesis was associated with a large number of syndromes , which indicating that the development of teeth and certain organs are under the control of the same molecular mechanisms . hypodontia is a major component of ectodermal dysplasia , oral - facial digital syndromes with oral - facial clefting . ectodermal dysplasia is characterized by small , misshapen and missing teeth , delayed eruption , prominent lip , maxillary hypoplasia , sparse hair and hypohidrotic skin . this disorder is inherited as an x - linked trait , though the autosomal recessive form has also been reported . oral - facial digital syndrome type 1 has symptoms such as hypodontia of lower incisors , facial asymmetry , hypertelorism , micrognathia , supernumerary frenulum and thickened alveolar ridges . oral - facial clefting is affected by chromosome 6p24 , 2p13 , 19q13 and 4q and the prevalence of hypodontia increases with cleft severity . the upper lateral incisor is the most frequently affected tooth in the cleft area both in primary and in permanent dentitions . in syndromic cleft lip and palate ( clp ) like pierre - robin sequence 50% hypodontia and van der woude syndrome 70% hypodontia prevalence is associated with other disorders . the genetic basis of hyperdontia has been extensively explained in the literature . in 1932 , brook reported a greater occurrence of supernumerary teeth in the close relatives of effected individuals , compared with the general population . it was also reported that the supernumerary and impacted teeth occupied the same location in the identical twins and in their parents . although there is no difference in the sex distribution for the primary dentition , supernumeraries occur more frequently in the permanent dentition of males . supernumerary teeth may occur in isolation or as part of a syndrome , such as in clp , cleidocranial dysplasia and gardner 's syndrome and less commonly in fabry anderson 's syndrome , chondroectodermal dysplasia , ehlers - danlos syndrome and tricho - rhino - phalangeal syndrome . supernumerary and impacted teeth , retarded eruption of primary and permanent dentition , aplasia or hypoplasia of clavicles and other skeletal anomalies are the features of this disorder exhibiting autosomal dominant inheritance . hypodontia , oligodontia and anodontia are the terms used to describe the numerical values of tooth agenesis . hypodontia is the absence of 1 - 6 teeth ( excluding third molars ) , whereas oligodontia refers to the absence of more than 6 teeth ( excluding third molars ) and anodontia is the complete absence of teeth . hypodontia is frequently accompanied with cleft - lip or palate , reduction in tooth size , short root anomaly , malformation of other teeth , impaction , maxillary canine and first premolar transposition , delayed formation or eruption of other teeth , microdontia , taurodontism , enamel hypoplasia and altered craniofacial growth . sometimes , it is caused by environmental factors such as ; infection , different kinds of trauma in the apical area of dentoalveolar process , chemical substances or drugs , radiation therapy or disturbances in the jaw innervations , but in the majority of cases , hypodontia is impacted by genetics . autosomal dominant inheritance with incomplete penetrance and variable expressivity was first proposed by burzynski and escobar . for a genetic linkage study on hypodontia , arte et al . , evaluated 214 family members in three generations and concluded that incisor - premolar agenesis is transmitted by autosomal dominant genes with small upper incisors , ectopic canines , taurodontism and rotated premolars as accompanying anomalies . a familial autosomal dominant hypodontia was demonstrated to be caused by a point mutation in the msx1 gene . vastardis et al . , using a linkage analysis in a family with second premolar and third molar agenesis , defined a locus on the chromosome 4p16 as the site of the msx1 . sequence analysis revealed arg31-to - pro missense mutation in the msx1 homeodomain for all of the affected subjects . arg31-to - pro mutation is known to influence the msx1 interactions , which are critical in the normal development of human teeth . this finding supported the result of an animal study , which showed a knockout mutation of msx1 gene leading to the inhibition of dental development ; however , when the premolar agenesis was accompanied with a lateral incisor , the influence of msx1 and msx2 genes could not be proved . another gene , causing tooth agenesis is pax9 in chromosome 14 ( 14q21-q13 ) . in hypodontia cases , a frameshift mutation and a nonsense termination mutation of the same gene have been observed in oligodontia . according to das et al . , this situation suggests that hypodontia and oligodontia are not fundamentally different or at least can be caused by different mutations in the same gene . the frameshift mutation of pax9 gene located on chromosome 14 was identified as responsible for autosomal dominant oligodontia in a large family for four generations . in some of the affected members , maxillary and mandibular second premolars and mandibular central incisors were absent in addition to the lack of permanent molars ; although , a normal primary dentition was present . in 2001 , nieminen et al . , identified an a - to - t transversion of the pax9 gene in a family with autosomal dominant oligodontia . they reported that all the second and third permanent molars , maxillary lateral incisors and in some cases all of the first permanent molars and several second premolars were missing , in addition to deciduous second molar agenesis . a year later , frazier - bower et al . concluded that the molar oligodontia is due to allelic heterogeneity in pax9 , which is an important regulator of molar teeth development . in 2003 , lamni showed a distinct phenotype with canine agenesis , which is quite rare , in a family segregating autosomal dominant oligodontia . in recent studies , different transition , insertion and transversion mutations in pax9 gene were reported , providing more comprehensive explanations for the pathogenic mechanisms of the interactions between mutations and tooth agenesis . in addition to pax9 and msx1 genes , contribution of a regulatory molecule in the mesenchyme , called transforming growth factor alpha , might play a role in isolated dental agenesis . furthermore , axin2 is a negative regulator of canonical wnt signaling and mutations of this gene can cause tooth agenesis associated with colorectal cancer . another mode of inheritance for hypodontia associated with other dental anomalies such as dental malformations , enamel hypoplasia and eruption failure is the autosomal recessive inheritance , with polygenic inheritance also suggested . studies showed that tooth agenesis could be manifested as an isolated feature or as a part of a syndrome . tooth agenesis was associated with a large number of syndromes , which indicating that the development of teeth and certain organs are under the control of the same molecular mechanisms . hypodontia is a major component of ectodermal dysplasia , oral - facial digital syndromes with oral - facial clefting . ectodermal dysplasia is characterized by small , misshapen and missing teeth , delayed eruption , prominent lip , maxillary hypoplasia , sparse hair and hypohidrotic skin . this disorder is inherited as an x - linked trait , though the autosomal recessive form has also been reported . oral - facial digital syndrome type 1 has symptoms such as hypodontia of lower incisors , facial asymmetry , hypertelorism , micrognathia , supernumerary frenulum and thickened alveolar ridges . oral - facial clefting is affected by chromosome 6p24 , 2p13 , 19q13 and 4q and the prevalence of hypodontia increases with cleft severity . the upper lateral incisor is the most frequently affected tooth in the cleft area both in primary and in permanent dentitions . in syndromic cleft lip and palate ( clp ) like pierre - robin sequence 50% hypodontia and van der woude syndrome 70% hypodontia prevalence is associated with other disorders . the genetic basis of hyperdontia has been extensively explained in the literature . in 1932 , brook reported a greater occurrence of supernumerary teeth in the close relatives of effected individuals , compared with the general population . it was also reported that the supernumerary and impacted teeth occupied the same location in the identical twins and in their parents . although there is no difference in the sex distribution for the primary dentition , supernumeraries occur more frequently in the permanent dentition of males . supernumerary teeth may occur in isolation or as part of a syndrome , such as in clp , cleidocranial dysplasia and gardner 's syndrome and less commonly in fabry anderson 's syndrome , chondroectodermal dysplasia , ehlers - danlos syndrome and tricho - rhino - phalangeal syndrome . supernumerary and impacted teeth , retarded eruption of primary and permanent dentition , aplasia or hypoplasia of clavicles and other skeletal anomalies are the features of this disorder exhibiting autosomal dominant inheritance . the structural anomalies of teeth are caused by the disturbances at the level of enamel and dentin during tooth development . amelogenesis imperfecta as one of these disorders , is characterized by discolored teeth and anterior open bite and exhibits x - linked , autosomal dominant and recessive inheritance caused by mutation of five different genes ; amelogenin amel , enamelin enam , matrix metalloproteinase- 20 mmp20 , kallikrein - related peptidase 4 klk4 and family with sequence similarity 83 , member h fam83h . there are three types of amelogenesis imperfecta ; as hypoplastic ; with thin , normally calcified enamel , hypocalcified ; with less mineralized , but normal thickness enamel and hipomaturation with enamel structure that has the same radiodensity of dentin and which is easily dislodged from dentin . in a study of 50 patients with hypoplastic amelogenesis imperfecta , anterior openbite occurred in 24% of the cases and severe vertical discrepancy was observed in almost all of them . furthermore , it was shown that this specific malocclusion with autosomal recessive inheritance was caused by the mutation in the enamelin gene , which is the largest protein in the enamel matrix of developing teeth . when hypoplastic teeth coexist with an anterior openbite , the orthodontists should investigate the genetic background for any existing condition . type i is syndromic form of dgi which is inherited with osteogenesis imperfecta and the genes encoding collagen , type i , alpha 1 , ( col1a1 ) and col1a2 . radiographically , the teeth have short , constricted roots and dentin hypertrophy leading to pulpal obliteration either before or just after eruption . expressivity is variable even within an individual , with some teeth showing total pulpal obliteration while in others the dentin appears normal . the other two forms seem to result from mutations in the gene dentin sialophosphoprotein , encoding dentin phosphoprotein and dentin sialoprotein . bulbous crown are typical features of dgi type ii , with hypotrophy in dentine structure . dentin dysplasia ( dd ) , which has radicular and coronal subtypes is another structural anomaly and has the same genetic disorder with dgi , except dd type i ( radicular type ) . the importance of the genetic factors controlling tooth size and morphology has been shown by twin studies . some authors reported that tooth crown dimensions , especially buccolingually and mesiodistally were genetically determined . it has been suggested that there is an association between oversized teeth and supernumerary teeth . similarly , the existence of peg shaped or strongly mesiodistally reduced lateral incisors may be the result of a variation in the expression of hypodontia . the displacement of canines in a palatinal direction is a positional dental anomaly and can generally happen even if there is adequate place in the dental arch . there is an association between the malpositions of certain teeth , such as palatally displaced canines , mandibular lateral incisor - canine transposition and maxillary canine - first premolar transpositions and tooth agenesis . similar for tooth agenesis , the positional anomalies of canines have been shown to affect some family members and thought to be under strong genetic control . some authors suggested that the ectopic canines exhibit a multifactorial inheritance pattern with high phenotypic variance and low penetrance . reported that palatally displaced and frequently impacted canines and mandibular lateral incisor - canine transposition were related to congenitally missing third molars in the posterior orofacial area . similarly , an association between the maxillary canine - first premolar transposition and maxillary lateral incisor agenesis in the anterior orofacial area may exist . furthermore , the agenesis of the lower second premolar , which is located in an intermediate zone is related to all the positional anomalies of canines . the anteroposterior morphogenetic field concept , proposed by butler in 1939 , supports the current molecular investigations such as the determination of the interaction between a single gene and site specific orofacial expressivity . hox genes , which play a role in oral and dental development are known to show site specific anteroposterior expression patterns . msx1 , regulator gene in the third molar and lower second premolar agenesis , may be responsible for posterior site development . in addition to the other posterior area genes , which are dlx-1 , dlx-2 and barx-1 , pax9 also control the development of all of the molars . furthermore , neubser et al . , reported that there is an association between pax9 transcription factor and repositioning of tooth buds on the mesenchymal level . this theory might give a clue to researchers about the genetic mechanisms of dental positional anomalies such as palatally displaced canines or different kind of transpositions . it appears that tooth agenesis , tooth size and position anomalies , which are often seen together , are the components of a complex , genetically controlled dental condition . dental malpositions such as rotations , eruption failures and ankylosis are among other anomalies complicating this dental condition . the etiology of dental anomalies is partly environmental and partly genetic . because of the polygenic nature of dental characteristics , it is very challenging to identify one single defective gene responsible for a specific dental anomaly . further studies are required and the rapid progress in the field of genetics may help the clinicians to more accurately discern the environmental and genetic factors contributing to the development of dental anomalies . currently , the orthodontist , probably the first to diagnose hereditary dental anomalies and malocclusion of an individual , will remain responsible for the detection of any additional defects in the same patient in order to provide the best treatment . the clinician should always keep in mind that some of those dental anomalies can coexist with certain syndromes and other family members might also have been affected . whenever it seems necessary , a genetic consultation should be added as part of the orthodontic treatment . finally , this interdisciplinary approach may help to reveal any risk of recurrence in subsequent generations .

the interruption of odontogenesis by any etiological factor may result in dental anomalies . apart from the environmental factors , the impact of genetics in dental anomalies was found to be a factor in different levels . many authors had questioned a common genetic defect resulting in different phenotypic conditions such as absent , malformed , malposed or ectopic teeth . because the multidisciplinary treatment of these dental anomalies such as hypodontia , impaction etc . , involves orthodontic intervention , orthodontists must be aware of the etiology and possible correlative conditions with dental anomalies .

werner syndrome ( ws ) is a rare autosomal recessive disease associated with premature age - related phenotypes such as cancer , osteoporosis , diabetes mellitus and early graying of the hair ( review ) . the gene responsible for ws ( wrn ) is one of a five human recq helicases including blm , recql1 , recql4 , and recq5 . like ws , the absence of blm and recql4 gives rise to the clinically distinct diseases , bloom 's syndrome ( bs ) and rothmund - thomson syndrome , respectively . although a variety of different wrn mutations have been discovered , many result in a truncated nonfunctional wrn ( summarized in ) . cells from ws patients depict an aging phenotype including reduced proliferation associated with an increase in s - phase and early passage senescence [ 3 , 4 ] . furthermore , ws cells show increased levels of genomic instability thought be caused from increased levels of illegitimate recombination . these observations lead us to investigate the role of wrn in vivo . for this study we used a wrn mouse model with a deleted helicase domain in combination with the well - established murine pink - eyed unstable ( p ) mouse model that can be used to determine changes in the spontaneous frequency of somatic homologous recombination ( hr ) events [ 68 ] . though rare , this particular wrn mutation has been found in a small population of ws patients [ 9 , 10 ] and is therefore relevant to the human disease . the p assay is based on an hr - mediated deletion of one copy of a 70 kb dna duplication that encompasses exons 618 of the p gene . the exact deletion of one copy of the repeated region will restore the function of this pigmentation gene , and this can be observed as somatic events in pigmented tissues such as the fur and the retinal pigment epithelium ( rpe ) [ 8 , 12 ] . the further development of the p eye spot assay which identifies p reversion events on a monolayer of clear rpe cells has proven to be significantly more sensitive and informative than the fur spot assay . studies in yeast using a similar duplication / deletion assay to the p reversion assay have identified several possible mechanisms of hr that may mediate this type of deletion event . these include intrachromatid exchange , one - sided strand invasion , unequal sister chromatid exchange ( sce ) , sister chromatid conversion , and single - strand annealing ( ssa ) . excluding ssa , each of these hr mechanisms is considered rad51-dependent . rad51-dependent hr is considered a high fidelity dna repair mechanism that is frequently associated with dna replication ( review ) . for example , replication forks can stall or collapse when the replication machinery encounters dna damage like a single strand break , and hr is capable of repairing the damaged dna template and restoring the replication fork . recently reported that in the absence of parp1 , somatic hr events , measured by the p system , are highly elevated and that a majority of these events were large clonally expanded cells . these authors went on to suggest that these clonally expanded populations of cells are the result of an hr - mediated deletion that occurred during replication , probably in a rad51-dependent mechanism ( as compared to ssa ) . wrn helicase mutant ( wrn ) mice on an fvb strain background were obtained from dr . p. leder , and c57bl/6j and c57bl/6j p/ mice were obtained from the jackson laboratory ( bar harbor , me ) . in order to obtain congenic c57bl/6j p / wrn mice ( hereafter called wrn ) , wrn mice were backcrossed 5 times to c57bl/6j followed by two additional crosses to c57bl/6j p mice . control ( wrn ) and experimental ( wrn ) animals result from crossing wrnmice together . genotypes for the wrn allele were determined by a pcr amplification protocol obtained from aya leder , harvard medical school , ma consisting of the following 3 primers : ( 1 ) 5-gtttcctctatcatctgtaacagg-3 , ( 2 ) 5-gcgaaggagcaaagctgctat-3 and ( 3 ) 5-agtgagacatgtatgactacc-3 and the thermo profile : 1 cycle of 94c for 5 min ; 30 cycles of 94c for 30 s , 60c for 30 s , and 72c for 1 min ; 1 cycle of 72c for 3 min . amplicon size for the wt pcr product is 350 bp and wrn mutant 450 bp . when necessary , genomic dna was isolated from fixed rpe using the qiagen dneasy blood and tissue kit according to manufacture 's recommendations . harvesting of the eye and dissection of the rpe were carried out as previously described in . rpe whole mounts were visualized and imaged using a zeiss lumar v.12 stereomicroscope , zeiss axiovision mrm camera , and zeiss axiovision 4.6 software ( thornwood , ny ) . p reversion events were identified on the transparent monolayer of the rpe as pigmented cells or eye spots . total number of eye spots and number of cells making up that eye spot were recorded for each rpe according to the criteria set forth by bishop et al . in . additionally , the relative distance from the optic nerve of each eye spot was recorded . this was done by using the measurement tool in adobe photoshop , by first measuring from the center of the optic nerve to the proximal edge of the eye spot and then from the center of the optic nerve to the edge of the rpe . these include tests for normality ( shapiro - wilk test ) , equal variances ( fmax test ) , two group comparisons ( mann - whitney test ) , and contingency tables ( fisher 's exact test ) . the frequency of spontaneous hr for mice with helicase domain - deficient wrn protein was previously reported as being increased 2-fold using the p fur spot assay . though the p fur spot assay can be considered a faithful assay for measuring hr frequency in vivo , the peye spot assay affords many advantages , including being more sensitive to changes in hr frequency and can reveal information about the timing of events during development , developmental patterning , and even information about whether the hr events are associated with replication . therefore , we set out to recapitulate the fur spot study and to determine whether we might be able to reveal any additional phenotypes associated with the wrn hr events . surprisingly , when we compared the number of eye spots per rpe in wrn versus wrn ( table 1 and figure 2(a ) ) , we were unable to detect a significant increase in the overall frequency of hr events ( p = .35 , mann - whitney test ) ( figure 2(b ) ) . the nonparametric mann whitney test was used because our data was found to be not normal ( data not shown ) with unequal variances using a fmax test ( p < .0001 ) . of interest , the variance within the wrn rpe was larger than expected due to three rpes with higher than usual numbers of reversion events . to determine whether the lack of difference in hr frequency between wrnand wrn was due to the wild - type rpe with elevated hr frequency , we compared the frequency of eye spots of our wrn wild - type rpes with an independent wild - type data set that was recently reported by our laboratory . no statistical difference in p reversion frequency was observed between these two groups of wild - type rpe ( data not shown ) . we therefore combined these wild - type datasets , compared their combined p reversion eyespot frequency with wrn , and still did not observe any statistical difference between genotypes ( figure 2(b ) ) . therefore , it appears that wrn helicase activity is not required for hr , and no additional hr events are instigated by the wrn mutation . we classify eye spots as having either single ( 1 cell ) or multi - cell ( 2 cells ) events . due to the edge - biased proliferation of the rpe and the apparent position shift between single - cell and multi - cell eye spots , we speculate that multi - cell ( clonally expanded ) p reversion events are associated with dna replication ( discussed below ) . approximately 60% of eye spots are normally single cell events . even though we did not observe an overall difference in hr frequency , we wanted to see if wrn helicase activity affected the clonal expansion of p reversion events . here we found no significant difference between single versus multi - cell eye spots when comparing wrn versus wrn rpe ( p = .39 , fisher 's exact test figure ( 3 ) ) . these data indicate that the helicase activity of wrn does not affect clonal expansion of mouse rpe cells following hr . the mouse rpe develops radially outward from the optic nerve with an edge - biased pattern of proliferation . the rpe begins to form in the developing eye cup at ~8.5 dpc and continues through the first week of postnatal development [ 20 , 21 ] . much like the age of a tree that can be determined using its concentric rings , the retrospective mapping of an eye spot onto an rpe suggests when during development a p reversion event occurred . previously we have reported mutant genotypes that affected either the timing of p reversion events during rpe development or the pattern of rpe development by examining eye spot patterns [ 6 , 18 ] . in order to determine if wrn helicase function has a role in hr at a specific point during murine development , each rpe was divided into 10 concentric rings where the inner most ring contains the optic nerve depicting the beginning of rpe development ( 0.0 - 0.1 ) to the outer most ring at the edge of the rpe ( 0.9 - 1.0 ) . at each interval , the pattern of positional distribution was similar for both wrn and wrn for all eye spots ( p = .22 , chi - square test , figure 4 ) . of note , the positional analysis of the eye spots measures the distance from the center of the optic nerve to the most proximal cell of an eye spot , irrespective of the number of cells that constitutes the eye spot . these results suggest that the effect of the wrn helicase mutation on hr does not alter the timing or distribution of p reversion events during mouse rpe . in summary , mice expressing a helicase - deficient wrn allele did not have an increase in the frequency of spontaneous hr . our results differ substantially from earlier work done using this same mouse model with the less sensitive p fur spot assay which observed at least a 2-fold increase in p reversion events . in our experience we have never observed a discrepancy in p reversion frequency between the neural crest - derived melanocyte - dependent fur spot assay and the neural epithelium - derived rpe - based eye spot assay . however , it should be noted that we have not examined the frequency of p fur spots in our c57bl6/j congenic animals , and it is formally possible that the difference may be due to difference in strain background . our result also differs from a more recent report using the p eye spot assay with the expression of a transgenic dominant negative human wrn allele . this latter report observed a 30% increase in eye spots ( from an average of 6 to 8 eye spots per rpe in wild - type and wrn impaired , resp . ) , a relatively slight , though significant increase for the p eye spot assay , that could be simply explained by sample size ; yamamoto et al . alternately , the difference could be due to a difference in using a mouse helicase deficient wrn mutant mouse and a mouse model that expressed a transgenic dominant negative allele of human wrn . the p fur spot assay is reliant upon detecting large clonal expansions of melanocytes following p reversion that are visible in the fur ( at least 1 mm ) . in contrast , the p eye spot assay can detect both single cell and clonally expanded ( multi - cell ) reversion events . additionally , the p eye spot assay can be used to determine any differences in the timing of hr events during embryonic development . in this study we found that the helicase activity of mouse wrn does not affect the frequency of single versus multi - cell events and nor does it affect the timing of spontaneous hr events during mouse embryonic development . although ws cells are described as having genomic instability , there is some discrepancy as to the role wrn plays in hr . in support of wrn as a suppressor of illegitimate hr , ws patients exhibit variegated chromosomal translocations , elevated recombination levels between microhomology plasmids , approximate 2-fold increase of rad51 focus formation , and sensitivity to agents that lead to replication stress [ 5 , 2628 ] . additionally , wrn is known to associate with proteins tied to replication machinery like rpa [ 2932 ] , pcna [ 3335 ] , pol [ 36 , 37 ] , and rad52 . in contrast though , ws cells do not have elevated amounts of sce which are the hallmark of bs . more recent studies have begun to show that recq helicases ( e.g. , wrn ) promote hr via mechanisms like dna resection . following double - strand breaks ( dsbs ) , the helicase domain of sgs1 ( yeast recq orthologue of wrn ) is required for resection of dna ends to produce single strand dna substrates for rad51 [ 40 , 41 ] . additionally , the helicase function of sgs1 is required for normal kinetics of hr at the mat locus , and yeast mutants for sgs1 and exo1 nuclease exhibit sensitivity to dna damaging at similar levels to rad52 mutants ( which are diminished for hr repair ) . these same authors subsequently went on to demonstrate that the recq helicase blm also has some dna resection functions following camptothecin - induced dsbs and that blm function of dsb resection is in parallel with an exo1-dependent pathway . a separate study investigated the role of wrn following exposure to chromium(vi ) , an agent known to induce dsbs , and found that chromium(vi ) treated human cells depleted of wrn and ws cells had delayed or absent rad51 focus formation . this study again suggests that wrn is important for promoting hr , potentially in early steps of this process ( e.g. , initiation via resection ) following dna damage . unlike the other human recq helicase members , wrn also has exonuclease activity , so understanding which enzymatic function of wrn is involved in promoting hr is valuable to our knowledge of this protein , as well as insightful to the syndrome . as it pertains to this study , we found that the helicase function of wrn is neither necessary for , nor suppresses spontaneous hr . with regard to other recq helicases , we recently found hr to be significantly elevated in the absence of blm using the p eye spot assay ( data not shown ) . considering the lack of effect observed in our study , and only a mild suppressive effect in the yamamoto et al . study compared to a deficiency in blm ( data not shown ) , it would appear that wrn only plays a minor role in suppressing hr , possibly the result of redundancy amongst the different recq family members . together , these studies give insight into the potential differences between two of the known five human recq helicases and suggest that future studies are warranted to better understanding the functions of wrn ( and blm ) in hr .

werner syndrome is a rare disorder that manifests as premature aging and age - related diseases . wrn is the gene mutated in ws , and is one of five human recq helicase family members . ws cells exhibit genomic instability and altered proliferation , and in vitro studies suggest that wrn has a role in suppressing homologous recombination . however , more recent studies propose that other recq helicases ( including wrn ) promote early events of homologous recombination . to study the role of wrn helicase on spontaneous homologous recombination , we obtained a mouse with a deleted wrn helicase domain and combined it with the in vivo pink - eyed unstable homologous recombination system . in this paper , we demonstrate that wrn helicase is not necessary for suppressing homologous recombination in vivo contrary to previous reports using a similar mouse model .

stroke is a disease that causes sudden local neurological deficit symptoms due to a cerebrovascular accident1 . stroke may decrease postural control and balance ability due to sensory disability , motor disturbance , muscular weakness , and asymmetric postures resulting from central nervous system damage2 . reduced postural control and balance ability decreases overall physical function , making independent activities of daily living difficult for stroke patients , and increases the risk of falls . therefore , improving stroke patients balance ability is an important therapeutic objective3 . with regard to this issue , a recent cross - sectional study revealed that stroke patients trunk control ability was correlated with balance , gait , and functional abilities4 . exercises intended to improve stroke patients trunk control have been extensively studied in recent years . verheyden et al.2 reported that a group of stroke patients that performed trunk exercises on plinths showed better improvement in trunk control than a group that received only conventional physical therapy . pereira et al.5 conducted trunk flexion and extension , and compared trunk muscle activities measured by semg on the affected and unaffected sides of stroke patients . karthikbabu et al.6 studied the effect of exercise using swiss balls on the improvement of trunk muscles . although many exercise programs for trunk control have been implemented , there are few programs that can improve subjects balance while maintaining their interest . after the first horse riding studies were performed with patients with neurological damage , hippotherapy was used only to treat children with neurological disorders , mainly cerebral palsy , to improve their postural control and promote their normal development and functional recovery7 , 8 . the horse s gait is repetitive and rhythmic , and causes the center of gravity to move in anterior - posterior , lateral , and upward - downward directions . since the patterns of these movements are similar to those of the movements of the trunk and pelvis during human gait , such exercise is expected to make the subjects feel as if they were walking9 . hippotherapy is effective in terms of psychological motivation because it arouses subjects interest in participating in the therapy9 , 10 , and helps in the recovery of many physical functions . hippotherapy increases the range of joint motion , strengthens muscles , and improves muscle tone , postural control , and balance and equilibrium ability . improvements in postural control and balance ability are achieved through stimulation of the upper motor neurons through proprioceptive sensory stimulation inputs11 , 12 . despite these therapeutic effects , no studies have been conducted on the changes in muscles related to stroke patients stability and balance after hippotherapy . in this study , the improvement in stroke patients trunk control and changes in abdominal muscle thicknesses after horse riding simulation training were examined . the purpose of this study was explained to patients diagnosed with stroke at d general hospital in busan , south korea . patients willing to participate in the study were recruited , and those who satisfied the selection criteria were randomly assigned to a control or experimental group ( 15 patients per group ) . subject selection criteria were as follows : patients with hemiplegia and no previous experience with hippotherapy who could follow verbal instructions , sit and walk independently ( regardless of the use of walking aids ) , and had no restriction in the range of joint motion . then , the experimental group performed horse riding simulation training , while the control group performed trunk exercises using swiss balls . training was performed for 30 min per session , three sessions per week for a total of eight weeks10 . subjects general characteristic ( n = 30)groupcontrol group(n = 15)experimental group(n = 15)age ( years)56.57.555.16.1height ( cm)163.38.2165.18.5weight ( kg)63.58.565.49.8sex ( male / female)8 / 77 / 8cause of brain damage(cerebral hemorrhage /cerebral infarction)8 / 76 / 9affected side ( right / left)9 / 610 / 5data are mean sd . all subjects agreed in writing to participate in this study after receiving a detailed explanation of the experimental procedure , and possible side effects of the intervention . the experiment was conducted after receiving approval from the human subjects research ethics committee of dong - eui medical center ( demcirb-2013 - 1001 ) . the horse riding simulator ( eu6441 core muscle trainer ; panasonic , japan ) used is designed to simulate the effects of horse riding exercises in an indoor environment using three - directional movements ( anterior - posterior , lateral , upward - downward ) , and has three different programs and nine levels of exercise intensity . a therapist and an assistant monitored each subject during horse riding training . a balance ability measuring and training system ( an analysis system with biofeedback , ap1153 ; biorescue , france ) was used to evaluate subjects balance ability . static balance ability ( center of pressure [ cop ] path length and cop travel speed ) was measured while subjects stood for 60 s with their eyes open . the subjects were prevented from seeing the monitor to avoid visual feedback , and the position of the feet was maintained during repeated measurements to eliminate errors resulting from changes in foot positions . all tests were performed three times , and average values were calculated . ultrasonic imaging equipment ( sonoace x4 ; medison , korea ) subjects were instructed to bend their knees to 90 and to maintain a comfortable posture in a supine position . linear probes were positioned on both sides , midway between the bottom of the rib cage and the top of the iliac crest . the thicknesses of the external oblique , internal oblique , and transversus abdominis muscles were measured three times and their average values were calculated . the paired t - test was conducted to compare the results before and after the intervention within each group and the independent t - test was used to compare the exercise and control groups before and after the experiment . the experimental but not the control group showed statistically significant differences ( p<0.01 ) between the cop path lengths of before and after the intervention . the differences between the two groups were not significant before the experiment , but were statistically significant ( p<0.05 ) after the intervention ( table 2table 2 . changes in static balance following horse riding simulation traininggrouppre - testpost- testcenter of pressure path length ( cm)control14.55.914.45.8experimental15.95.112.24.3 center of pressure travel speed ( mm / s)control0.70.30.70.2experimental0.70.30.60.2 different superscripts within the same columns indicate significant differences ( p<0.05 ) ) . different superscripts within the same columns indicate significant differences ( p<0.05 ) the experimental , but not the control group , showed statistically significant differences ( p<0.05 ) between the speeds of the cop travel of before and after the intervention . there was no significant difference between the control and the experimental group before the experiment , but the speed of cop travel decreased more in the experimental group than in the control group after the experiment , and this difference was statistically significant ( p<0.05 ; table 2 ) . changes in abdominal muscle thicknesses after training were observed in the experimental group . before training , tra and io did not show any significant differences between the affected and unaffected sides . in contrast , eo showed significant differences : 5.71.6 mm on the unaffected side and 4.71.4 mm on the affected side ( p<0.05 ) . after eight weeks of training , tra , io , and eo on the unaffected side did not show any changes compared to before the training . tra and io on the affected side did not show any changes after training , but the eo thickness significantly increased from 4.71.4 mm to 5.21.6 mm . total abdominal muscle thickness differed significantly before training between the affected and unaffected sides ( 13.52.7 mm and 14.33.0 mm , respectively ) . after eight weeks of training , both sides showed slight increases , with final values of 14.12.9 mm on the affected side and 14.35.8 mm on the unaffected side , but these differences were not statistically significant ( p>0.05 ; table 3table 3 . changes in abdominal muscle thickness following horse riding simulation training ( experimental group ; n = 15)sidepre - testpost - testtraa2.50.82.70.9na2.50.62.60.6ioa6.30.156.31.6na6.00.166.11.8eoa4.71.4 5.21.6na5.71.65.71.4totala13.52.7 14.12.9na14.33.014.35.8a , affected side ; na , non - affected side ; abdominal muscle thicknesses unit : mm . different superscripts within the same columns indicate significant differences ( p<0.05 ) ) . a , affected side ; na , non - affected side ; abdominal muscle thicknesses unit : mm . this study examined the effects of horse riding simulation training on the improvement of balance ability ( which is an important issue for stroke patients ) , and the changes in abdominal muscle thicknesses of stroke patients . the distance and speed of center of gravity movements were measured using a biorescue system , and changes in abdominal muscle thicknesses were observed by ultrasonography . the cop path lengths of before and after the intervention were similar in the control group ( p>0.05 ) , but significantly decreased in the experimental group after horse riding training . the changes in the speed of cop travel showed that body sway remarkably decreased in the experimental group after training in comparison with the control group . these changes presumably occurred because the trunks of the subjects became more stable as a result of horse riding simulation training , reducing body sway and shaking . regarding abdominal muscle thicknesses , eo was thinner before training on the affected side than on the unaffected side , resulting in a difference in total abdominal muscle thickness on the affected and unaffected sides . this is consistent with the results of the study by english et al.14 , which measured the abdominal muscles of stroke patients ( 65 years old or older ) at rest . although the mean age of the subjects in our present study was somewhat lower ( 55.16.1 years ) , similar results were obtained . even though eo is mainly mobilized during trunk rotation movements , pereria et al.5 reported that eo was activated when stroke patients performed exercises that involved lifting of both legs , and this reportedly occurred to compensate for the inactivity of the rectus abdominis . similarly , in our present study the eo muscle may have activated more to compensate for the weakness of the rectus abdominal muscles on the affected side of the stroke patients . another reason for higher eo activation on the affected side could be that it is located closer to the surface layer than tra and io , which would affect thickness changes because horse riding simulation exercises induce multi - directional movements . although diverse balance training programs for stroke patients have been reported , therapeutic approaches using horse riding have rarely been studied with stroke patients as subjects . some studies have been conducted with persons with neurological disorders , in particular children with cerebral palsy7 , 8 . therefore , comparison of our present results with those of previous studies was difficult . future studies of horse riding simulation may lead to an improvement in stroke patients balance ability . horse riding simulation training can be fun and interesting for patients , which may increase their motivation to actively participate in exercise program and thus enhance the improvement of neurologic functions9 , 10 . second , ultrasonic measurement was conducted in a steady state in a supine position . third , since the damaged sites and symptoms differed among subjects , standard subjects could not be selected . therefore , in future studies , the effects of hippotherapy on stroke patients should be examined with a more efficient control and the selection of a wide range of subjects . additional information should be provided by comparison ( during ultrasonic measurement ) of the degrees of contraction on the affected and unaffected sides . in conclusion , horse riding simulation training may reduce the distance and speed of the center of gravity movements of stroke patients and reduce the asymmetry of the abdominal muscles . to improve stroke patients balance ability , diverse uses of horse riding simulation training should be considered .

[ purpose ] the purpose of this study was to assess the effects of horse riding simulation training on changes in balance ability and abdominal muscle thicknesses of stroke patients . [ subjects ] thirty stroke patients with hemiplegia were recruited , and they were randomly assigned to a control or experimental group . [ methods ] the experimental group performed horse riding simulation training , whereas the control group performed trunk exercises for 8 weeks . balance ability was measured using a biorescue system . the thicknesses of subjects external oblique , internal oblique , and transversus abdominis muscles were measured by ultrasonic imaging . [ results ] in the experimental group , balance ability was significantly improved after training . similarly , the thickness of the abdominal muscles on the affected side changed after training in the experimental group , whereas the control group showed no statistically significant changes . [ conclusion ] we suggest that horse riding simulation training is more effective than trunk exercises at reducing the center of pressure path length and travel speed and improving the asymmetry of the abdominal muscles of stroke patients .

despite decreasing incidence and recent improvements in treatment concepts gastric cancer remains one of the most common cancer entities worldwide with highest incidence rates in eastern asian countries such as korea and japan . however , in order to define prognostic factors or to decide for adjuvant treatment concepts , prediction of postoperative survival is considered to be of utmost importance . the most commonly used tool is the tnm classification , edited by the union international contre le cancer ( uicc ) and american joint commission on cancer ( ajcc ) . in 2010 , as an alternative , nomograms were proposed to provide more accurate survival prediction because not only factors involving tumor extension to locoregional lymph nodes and distant organs but also predictive factors such as number of dissected lymph nodes , tumor size , lymphatic vessel infiltration ( lvi ) , and tumor location represent prognostic factors in gastric cancer surgery . one of the first nomograms was developed in the us and cross - validated in 2 european institutions . among them was a cohort from the department of surgery of the technische universitaet muenchen ( tum ) . in contrast , the nomogram did not prove to be applicable in eastern asian ( korean ) patients due to possibly different treatment strategies , tumor location , or ethnic differences . in consequence further general applicability of the korean nomograms was considered questionable due to the high specialization of the reporting centers , which developed the nomograms . therefore , eom et al developed a nomogram based on multicentric data ( 8 institutions ) with a korean cross - validation study . this nomogram was constructed using a multivariate cox proportion hazard regression model of potential survival - related factors . here , a line is drawn according to any of the clinicopathologic factors to an axis indicating specific score values . after adding the respective values , the sum value displays the probability of 5-year survival by connecting the score value with the 5-year survival axis . it was demonstrated that survival prediction was accurate not only in specialized centers but also in general hospitals . however , the authors concluded that validation in western patients is deemed to be useful considering general applicability of the tool . in order to obtain comparable results , we report of a validation study for the multicenter korean nomogram in gastric cancer patients having undergone primary curative oncologic surgery at the department of surgery of the tum . the prospectively documented gastric cancer database was reviewed for patients having undergone gastric cancer surgery with curative intent between 1982 and 2008 at the surgical department of the tum . data were obtained from the medical records and transferred to the institutional database as soon as the patients were discharged from inpatient hospital care . exclusion criteria were : metastatic disease , neoadjuvant / perioperative chemotherapy , extension to the distal esophagus , gastric stump cancer , hospital mortality within 30 days , loss of follow - up within a 60-month period and residual cancer after surgery ( r1/r2 ) . the dataset consisted of patients age , sex , tumor size , location ( upper , middle , lower third ) , histological type ( differentiated type : papillary , well - differentiated , and moderately differentiated tubular adenocarcinoma ; undifferentiated type : poorly differentiated tubular adenocarcinoma , signet ring cell carcinoma , mucinous adenocarcinoma , and undifferentiated adenocarcinomas ) , lymphovascular invasion , pt- , pn- , and uicc - stage , extent of lymph node dissection and follow - up period with survival status . lymph node dissection was categorized as d1 plus or d2 as defined by the japanese treatment guidelines . t- and n - stages were evaluated according to the 7th ajcc / uicc tumor - node - metastasis ( tnm ) classification . patients were followed up after surgery regularly according to institutional guidelines including physical examinations , laboratory tests ( cea ) , endoscopy , and computed tomography ( ct ) . the examinations were scheduled every 6 months for the first 3 years and annually for the next 2 years . follow - up time was determined from the day of surgery to the last follow - up date . the control group consisted of the patients having been included in the multicenter korean nomogram development set published before . intergroup comparisons were analyzed by -testing , continuous variables are presented as mean standard deviation . t tests or wilcoxon tests were used whenever appropriate . risk calculation according to the proposed nomogram ( figure 1 ) was performed for every patient . the hazard ratio and corresponding 95% confidence interval [ ci ] ) for each of the potential risk factors was estimated by a cox proportional hazard regression model . the korean patient group was used as the development set , and the german patient group as the validation set . all of the statistical analyses with respect to the model 's performance were performed in the german patients cohort . the previously developed model was validated in the german cohort with respect to its discrimination ability using c - statistics and its calibration ability using hosmer the discriminative power depends on the ability of a model to correctly distinguish between nonevents and events , which can be quantified by calculating the c - statistic developed for the respective survival model . the c - statistic is a measure that is analogous to the receiver operating characteristic ( roc ) curve , which indicates the probability that a model produces higher risks for those who develop events compared with those who do not develop events . h - l chi - square statistic measures how closely the predicted probabilities agree numerically with the actual outcomes . this chi - square statistic was calculated by categorizing the data into 5 groups ( quintiles ) based on the predicted probabilities that are generated by the model in ascending order . for each quintile , the average predicted probabilities were compared to the event rate estimated by the kaplan meier method . the statistical analysis was carried out in analogy to the korean validation cohort in the eom paper . all of the results were interpreted by a specialist in biostatistics ( bh nam ) . this analysis was approved by the local institutional review board ( ethikkommission der fakultaet fr medizin der technischen universitaet muenchen ) . a total of 2771 patients underwent surgery for gastric cancer at tum between 1982 and 2008 . among these patients , 659 patients with neoadjuvant / perioperative chemotherapy , 33 with neoadjuvant chemoradiation , 84 with r1-resection , 257 with r2-resection , 291 patients with metastatic disease , 307 with adenocarcinoma of the esophagogastric junction ( aeg ) , 19 carcinomas of the gastric remnant , 42 patients with in - hospital mortality , 75 patients without resection ( open&close ) , and 96 patients with a follow - up of < 60 months were excluded from the analysis . finally 908 patients were enrolled in this validation analysis . the control cohort consisted of 1579 patients and apart from ajcc / uicc stages , the tum cohort was different in almost all analyzed parameters compared to korean patients . tum patients were significantly older ( p < 0.0001 ) and the amount of female patients was considerably higher ( p < 0.001 ) . tumor size tended to be smaller in german patients ( p < 0.0001 ) and tumors tended to be located in the more proximal parts of the stomach ( p < 0.0001 ) . tumors were more undifferentiated compared to korean patients and lvi was less frequent in german patients ( p < 0.0001 , respectively ) . t - stages were more advanced in the tum cohort ( p < 0.0001 ) , whereas lymph node metastases were diagnosed more frequently in koreans ( p < 0.0001 ) . the extent of lymph node dissection was significantly different : almost all the korean patients received a d2 dissection whereas in contrast d1 + dissection was performed more frequently in the german cohort ( p < 0.0001 ) . therefore , the amount of patients with < 15 retrieved lymph nodes is significantly higher compared to the korean - multicenter cohort ( p < 0.0001 ) . demographic and clinicopathological characteristics of the knds and tum cohorts median overall follow - up was 64.7 months ( 1218 ) , 74 ( 8214 months ) for survivors and 25.9 ( 1218 ) months for deceased patients in the german cohort . median follow - up was significantly longer compared to the korean cohort ( 52 [ 1105 ] months overall , 57 [ 1105 ] months for survivors , 18 [ 1100 ] months for nonsurvivors , p < 0.0001 ) . during the follow - up period 398 patients ( 43.8% ) died ( 351/1579 [ 23.4% ] in the korean cohort , p < 0.0001 ) . in the univariate model age ( older than 70 years ) , tumor size ( above 5 cm ) , location in the upper third and tumor - involvement of the whole stomach , undifferentiated histology , lvi , pt- , pn - stage , and d1 + dissection were significantly related to survival . multivariate regression analysis revealed age ( older than 70 years ) , tumor extension to the complete stomach , presence of lvi , pt- and pn - stage to be significantly related to overall survival . the prognostic factors were almost comparable in the korean cohort . in korean patients tumor size > 10 cm was related to worse overall survival exclusively and pn1-stage was not predictive for os in contrast to the tum cohort . risk factors for overall survival comparing korean and german patients ( cox proportional hazards regression model ) the validation of the korean nomogram in the tum cohort was performed by evaluating the performance of the model with respect to its discrimination and calibration abilities . the h - l chi - square statistic was 2.16 , and the calibration plot ( predicted and actual events [ deaths ] ) according to the respective quintiles is presented in figure 2 ( p = 0.989 ) . the ratios between expected and observed risks for each quintile range from 84% to 107% of the predicted value . each stage was significantly different from each other ( group 1 vs group 2 : p < 0.0001 ; group 2 vs group 3 : p = 0.0018 ; group 3 vs group 4 : p = 0.015 ; group 4 vs group 5 : p < 0.0001 ) . calibration plot of predicted and actual events ( deaths ) according to the quintiles in the hosmer lemeshow statistic . h - l type = 2.162 ( p = 0.989 ) . c - index = 0.761 ( 95% ci 0.7350.787 ) . the observed and expected event probabilities and their respective ratios ( o / e ) meier survival plots according to the respective quintiles in the german validation cohort ( p < 0.0001 ) . group 1 vs group 2 : p < 0.0001 ; group 2 vs group 3 : p = 0.0018 ; group 3 vs group 4 : p = 0.015 ; group 4 vs group 5 : p < 0.0001 . a total of 2771 patients underwent surgery for gastric cancer at tum between 1982 and 2008 . among these patients , 659 patients with neoadjuvant / perioperative chemotherapy , 33 with neoadjuvant chemoradiation , 84 with r1-resection , 257 with r2-resection , 291 patients with metastatic disease , 307 with adenocarcinoma of the esophagogastric junction ( aeg ) , 19 carcinomas of the gastric remnant , 42 patients with in - hospital mortality , 75 patients without resection ( open&close ) , and 96 patients with a follow - up of < 60 months were excluded from the analysis . finally 908 patients were enrolled in this validation analysis . the control cohort consisted of 1579 patients and apart from ajcc / uicc stages , the tum cohort was different in almost all analyzed parameters compared to korean patients . tum patients were significantly older ( p < 0.0001 ) and the amount of female patients was considerably higher ( p < 0.001 ) . tumor size tended to be smaller in german patients ( p < 0.0001 ) and tumors tended to be located in the more proximal parts of the stomach ( p < 0.0001 ) . tumors were more undifferentiated compared to korean patients and lvi was less frequent in german patients ( p < 0.0001 , respectively ) . t - stages were more advanced in the tum cohort ( p < 0.0001 ) , whereas lymph node metastases were diagnosed more frequently in koreans ( p < 0.0001 ) . the extent of lymph node dissection was significantly different : almost all the korean patients received a d2 dissection whereas in contrast d1 + dissection was performed more frequently in the german cohort ( p < 0.0001 ) . therefore , the amount of patients with < 15 retrieved lymph nodes is significantly higher compared to the korean - multicenter cohort ( p < 0.0001 ) . demographic and clinicopathological characteristics of the knds and tum cohorts median overall follow - up was 64.7 months ( 1218 ) , 74 ( 8214 months ) for survivors and 25.9 ( 1218 ) months for deceased patients in the german cohort . median follow - up was significantly longer compared to the korean cohort ( 52 [ 1105 ] months overall , 57 [ 1105 ] months for survivors , 18 [ 1100 ] months for nonsurvivors , p < 0.0001 ) . during the follow - up period 398 patients ( 43.8% ) died ( 351/1579 [ 23.4% ] in the korean cohort , p < 0.0001 ) . in the univariate model age ( older than 70 years ) , tumor size ( above 5 cm ) , location in the upper third and tumor - involvement of the whole stomach , undifferentiated histology , lvi , pt- , pn - stage , and d1 + dissection were significantly related to survival . multivariate regression analysis revealed age ( older than 70 years ) , tumor extension to the complete stomach , presence of lvi , pt- and pn - stage to be significantly related to overall survival . the prognostic factors were almost comparable in the korean cohort . in korean patients tumor size > 10 cm was related to worse overall survival exclusively and pn1-stage was not predictive for os in contrast to the tum cohort . risk factors for overall survival comparing korean and german patients ( cox proportional hazards regression model ) the validation of the korean nomogram in the tum cohort was performed by evaluating the performance of the model with respect to its discrimination and calibration abilities . the h - l chi - square statistic was 2.16 , and the calibration plot ( predicted and actual events [ deaths ] ) according to the respective quintiles is presented in figure 2 ( p = 0.989 ) . the ratios between expected and observed risks for each quintile range from 84% to 107% of the predicted value . each stage was significantly different from each other ( group 1 vs group 2 : p < 0.0001 ; group 2 vs group 3 : p = 0.0018 ; group 3 vs group 4 : p = 0.015 ; group 4 vs group 5 : p < 0.0001 ) . calibration plot of predicted and actual events ( deaths ) according to the quintiles in the hosmer lemeshow statistic . h - l type = 2.162 ( p = 0.989 ) . c - index = 0.761 ( 95% ci 0.7350.787 ) . the observed and expected event probabilities and their respective ratios ( o / e ) meier survival plots according to the respective quintiles in the german validation cohort ( p < 0.0001 ) . group 1 vs group 2 : p < 0.0001 ; group 2 vs group 3 : p = 0.0018 ; group 3 vs group 4 : p = 0.015 ; group 4 vs group 5 : p < 0.0001 . despite decreasing incidence gastric cancer remains 1 of the most common malignancies worldwide with a special focus on eastern asia ( korea , japan , and china ) . therefore , uniform staging methods are of utmost importance to compare treatment outcomes and treatment results from randomized controlled trials between different parts of the world . the most commonly used staging system is the tnm system proposed by the uicc / ajcc . however , several authors demonstrated before that survival probabilities may vary within the respective uicc / ajcc stages and that survival predictability has not necessarily improved after revision of the sixth edition . furthermore predictive factors such as tumor location , tumor size , extent of lymph node dissection , and presence of lvi are not covered by classical tnm staging . therefore , more uniform staging methods are required omitting those possible drawbacks . a conceivable option to resolve this issue the best known nomogram was developed at the memorial sloan kettering cancer center in the united states and validated in cohorts across the world with different outcomes . validation studies in germany and the netherlands revealed its applicability in the western hemisphere whereas the mskcc - nomogram failed to adequately predict survival in korean patients . the snuh - nomogram was externally validated not only in korea itself but also in japan , whereas the seoul - st mary 's nomogram was only validated internally . they only incorporated patients having undergone open surgery and d2-lymphadenctomy by very specialized surgeons with high caseload . the nomograms were criticized not to be applicable to stage adopted lymph node dissection ( d1 + ) in early gastric cancer patients concluding that previous nomograms are not suited for more than half of the gastric cancer patients in korea . due to that criticism the korean multicenter data incorporated data from 8 different institutions with different case load and also reduced lymphadenectomy cases ( d1 + gastrectomy due to egc ) . the authors concluded that their multicenter - nomogram was suitable for survival prediction in specialized and local hospitals in korea . similar to the developers of the snuh - nomogram the authors concluded that despite successful external validation within korea and japan , a confirmation of the results in a western patient cohort was required in order to obtain general applicability . comparison between the korean and the german group revealed marked differences in baseline characteristics except for the distribution of uicc stages . it is well known that korean patients are significantly younger at the time of diagnosis and treatment compared to western patients . the amount of patients older than 70 years was twice as high in the german cohort . additionally a preponderance of proximal tumor locations was noted and is congruent with other studies . these facts may basically be related to and explained by the existence of a national screening program in korea , which is accessible from the age of 40 and inexistent in germany , where egd is only performed in case of symptoms or positive family history . however , distribution of the ajcc / uicc stages was not different between the 2 groups . nonsurprisingly the amount of patients having undergone d2-dissection is significantly higher in the korean cohort and represented by the significantly higher number of harvested lymph nodes . d2-dissection has only been implemented in europe as a standard of care since publication of the long - term results of the dutch trial . nonetheless the authors of the nomogram emphasized the applicability of the nomogram also for patients not having undergone d2-dissection due to more limited disease stages . interestingly the type of lymph - node dissection did not have any significant correlation to overall survival in both of the analyzed cohorts . analysis of prognostic factors revealed the same predictors of overall survival as in the korean cohort with the following exceptions : tumor size > 10 cm was not related to os in the german cohort . tumor involvement of the whole stomach was exclusively related to os in the tum patients which , however , implies a tumor size > 10 cm . interestingly , limited metastasis to 1 or 2 lymph nodes was an independent predictor of os only in the german patient cohort . this may be explained by a more aggressive tumor phenotype which may be represented by more advanced pt - stages . finally , comparative analysis of the predictive abilities of the korean nomogram in the german patient cohort demonstrated its validity . c - statistics were used as goodness - of - fit measure to discriminate expected and actual events . c - values of 0.7 to 0.8 generally indicate moderately good discrimination and excellent discriminative ability is indicated by values over 0.8 . the c - index of 0.76 may be interpreted as an acceptable value for predictability of the nomogram in western patients . the nomogram is considered to be more accurate the higher the value of the c - index is . the lower value in the german cohort thus means a decreased predictability compared to the korean validation set . this may be represented by ethnic and biologic differences , which are not considered in the statistical model . however , goodness - of - fit analysis by h - l chi - square statistic revealed no statistical difference in the german validation . this result indicates that the predictive ability of the nomogram does not significantly differ from the observed os . further , stage distribution according to the predicted quintiles revealed a homogenous distribution of the survival curves with statistically significant differences over all stages . this staging system might be an additional tool to the conventional tnm - staging for survival prediction . this stands in marked contrast to the popular mskcc - nomogram , which failed to predict survival in comparison between korean and us patients . reasons for this may be that the mskcc - nomogram incorporated slightly different parameters like lauren histotype and a differentiation between positive and negative lymph nodes . not only the lauren histotype but also stage distribution was significantly different between korean and us patients . further the amount of patients with a number of < 15 retrieved lymph nodes was 22% in the mskcc cohort compared with 6% in this analysis . however , the construction- and validation - datasets are based on a single - center cohort with patients having undergone d2-dissection only . this does not reflect surgical reality in these days as more stage - adopted resection is performed in korea ( ie , d1 + dissection for early gastric cancer ) . finally the snuh - nomogram was only validated in a specialized japanese single - center cohort . despite its similarities with the snuh - nomogram this multicenter nomogram is not only applicable in specialized korean centers but also in general hospitals and maybe in western ( european ) collectives . the predictability of the korean multicenter - nomogram in the tum cohort also reflects the necessity to treat patients in specialized institutions , especially in western countries . this again stirs up the debate if centralization to specialized hospitals for specific types of cancers improves oncologic outcomes . from the authors point of view further , patients having undergone neoadjuvant / perioperative chemotherapy were excluded from this analysis which may have led to a selection bias . the reason for excluding these patients was that neoadjuvant regimens in the reported period ( 19822008 ) were not standardized and applied on an irregular basis . chemotherapy at that time was applied to technically irresectable patients who would not have met the inclusion criteria for this analysis . since neoadjuvant chemotherapy has become a standard of treatment in europe these results will have to be reanalyzed in the future . further the general applicability of the nomogram in german community hospitals may not be guaranteed due to the specialization of the tum in gastric cancer treatment and a centralization effect . conclusively this validation analysis of a korean multicenter nomogram for survival - prediction after curative gastric cancer surgery demonstrated its applicability in a specialized western treatment center for gastric cancer . further study is needed to obtain data on generalized applicability in western gastric cancer patients .

abstractseveral nomograms for survival prediction after curative gastric cancer surgery have been published over the recent years . previous validation studies failed to prove applicability of eastern asian nomograms in western patients . here we present data on a validation analysis of a newly developed korean nomogram in a german patient cohort.among a total of 2771 patients having been treated in the department of surgery of the technische universitaet muenchen from 1982 to 2008 , 908 patients were eligible to undergo this analysis . patients were treated according to japanese gastric cancer guidelines and followed up on a regular basis for at least 60 months postoperatively . baseline characteristics were compared using 2-testing . survival analyses were computed with the kaplan meier method and multivariate regression analysis models . the c - statistics and hosmer lemeshow chi - square statistics were computed for comparisons of the nomogram 's predictive ability.all baseline characteristics were significantly different ( p < 0.0001 ) between korean and german patients except union internationale contre le cancer - stages ( p = 0.427 ) . multivariate regression analysis revealed the same predictive factors for overall survival in the german and korean cohorts , respectively , with the exception of tumor size > 10 cm and an exclusive correlation of whole stomach spread and pn1-stage for german patients only . the c - index was 0.76 , representing an adequate value for predictability of the korea nomogram in german patients . the hosmer lemeshow statistic implied applicability of the nomogram in the tum - cohort.a newly developed multicenter korean nomogram for survival prediction after curative gastric cancer surgery may be applicable for estimating survival prognosis in western ( european ) patients .

aside from non - melanoma skin cancer , prostate cancer ( pc ) is the most common cancer in men in the united states and europe , with a rapid increasing incidence in the last two decades . radiotherapy is one of the most important curative options in treating localized pc . for high - risk pc , standard dose ( 70 gy ) plus long - term anti - androgen therapy became the gold standard after the publication of eortc 22863 and rtog 92 - 02 trial results . furthermore , pollack et al . shown that dose escalation ( 78 gy ) was a key point for biochemical control . many studies have confirmed positive effect of dose escalation on disease local control using radiation therapy [ 58 ] . however , dose escalation delivered through 3d external beam radiation therapy ( ebrt ) was associated with a higher rate of gastro - intestinal ( gi ) and genito - urinary ( gu ) toxicities . using intensity modulated radiation therapy ( imrt ) , zelefsky et al . shown that a total dose of 81 gy could be delivered to the prostate increasing the rate of biochemical control without increasing the rate of gu and gi toxicities . intensity - modulated radiation therapy for pc is generally performed through 8 to 9 consecutive weeks ; nevertheless , due to the low / ratio of the prostatic tissue , clinical research was directed toward hypofractionation concept . randomized trials comparing standard radiation dose ( 2 gy / f , 1.8 gy / f ) versus soft hypofractionated regimen ( 2.5 gy / f to 3 gy / f ) using ebrt confirmed that the two regimens were equivalent in terms of acute and late toxicity [ 11 , 12 ] . high - dose rate ( hdr ) brachytherapy boost following ebrt delivering a total dose of 46 gy to the pelvis or prostatic fossa , represents a smart technique to not only increase the dose to the prostate , but also significantly reduce the number of round trips to the radiation facility . in february 2009 , we integrated the hdr brachytherapy boost program in pc treatment . we report the results in terms of acute gu and gi toxicity observed between these three different regimens . between february 2009 and july 2013 , 216 consecutive patients underwent a hdr brachytherapy boost for pc . over the study period , two different treatment planning systems ( tps ) were used : plato ( nucletron bv , veenendaal , the netherlands ) from february 2009 to may 2012 , and oncentra brachy ( nucletron , an elekta company , elekta ab , stockholm , sweden ) from june 2012 until now . in order to avoid any comparative bias , we analysed the first 124 patients treated with the same tps ( plato ) . from 02/2009 to 01/2010 , 30 patients ( group 1 = g1 ; 24% ) were treated with 3 6 gy over 2 days . in order to make this procedure more comfortable for the patient and less time - consuming for the medical staff , from 01/2010 to 01/2011 , 52 patients ( group 2 = g2 ; 42% ) received 2 fractions of 9 gy over 2 days , while from 01/2011 to 05/2012 , 42 patients ( group 3 = g3 ; 34% ) were treated with a single fraction of 14 gy . this observational study retrospectively analysed the acute gu and gi toxicities occurred during the first 6 months after the implant in the 3 treatment groups . all the patients underwent imaging studies , including magnetic resonance , computed tomography , and bone scan . appropriate patient selection was performed according to the american brachytherapy society ( abs ) consensus guidelines for hdr prostate brachytherapy . patients were treated with a first course of ebrt , delivering 46 gy in 23 fractions . the dose was delivered to the icru point using high - energy x - photons ( > 10 mv ) . according to the calculated risk of lymph node involvement , the clinical target volume ( ctv ) was the whole pelvis or the prostatic fossa ( prostate and seminal vesicles ) for high- ( 15% ) and low - risk ( < 15% ) of lymph node involvement , respectively . the planning target volume ( ptv ) was defined as a 1 cm margin around the ctv in all directions , and reduced to 5 mm at the prostate rectal interface . short and long - term androgen deprivation therapy ( adt ) was proposed to intermediate and high - risk patients , respectively . this procedure was performed under general anaesthesia . using transrectal ultrasound ( trus ) guidance , 15 to 17 catheters ( sharp needles ; nucletron , an elekta company , elekta ab , stockholm , sweden ) were implanted transperineally and periurethrally through a dedicated template . after recovery , post - implant planning ct - scan was directly performed in the radiation oncology department for treatment planning purposes . ctv ( prostate ) and organs at risk ( oar urethra and rectum ) were outlined . the prostatic portion of the urethra was outlined plus a 10 mm additional margin above the base and below the apex , while the rectum was outlined from the anorectal junction to the rectosigmoid junction . brachytherapy boost delivered 3 6 gy , 2 9 gy , and 1 14 gy for g1 , g2 , and g3 , respectively . considering / 1.5 gy for prostatic tissue , eqd2 ( equivalent dose at 2 gy / fraction ) were 39 gy , 54 gy , and 62 gy for g1 , g2 , and g3 , respectively . dose constraints for prostate were v100 ( ctv receiving 100% of the prescribed dose ) > 95% , v150 < 35% , and v200 < 15% , d90 ( dose delivered to 90% of ctv ) > 105% , and d100% > 80% . dose constraints used for oars relied on the brachytherapy regimen groups . because of the slight dose escalation between g1/g2 ( eqd21.5 39 gy , 54 gy ) and g3 ( eqd21.5 62 gy ) , more restrictive dose constraints were considered for g3 patients . consequently , for g1/g2 , vu125 ( percentage of the urethra volume receiving 125% of the prescribed dose ) and vr100 ( percentage of the rectum volume receiving 100% of the prescribed dose ) should be less than 1% , while for g3 patients , vu115 ( percentage of the urethra volume receiving 115% of the prescribed dose ) and vr90 ( percentage of the rectum volume receiving 90% of the prescribed dose ) should be less than 1% ( fig . dose - volume adaptation was manually achieved using graphical optimization ( plato , nucletron bv , veenendaal , the netherlands ) by dwell location and time variation . patients treated with multiple fractions after a single insertion were re - scanned before each fraction , followed by re - optimization with regard to the risk of catheter migration . the first fraction was given post - operatively ( at day 0 ) , while the following fractions were given at day 1 ( with at least 6 hours interval between the 2 and 3 fraction for g1 ) . dose distribution obtained after planning using plato ( nucletron bv , veenendaal , the netherlands ) on sagittal ( a ) and transversal ( b ) view patients were followed at 1 month after the implant , then every 6 months with an assessment of serum prostate specific antigen level ( psa ) , physical examination , patient symptom assessment , and digital rectal examination in case of rising psa . acute gu and gi toxicities were scored according to the common terminology criteria for adverse event ( ctcae v3.0 ) . for gu complications , we analysed stricture / stenosis , frequency / urgency , retention , incontinence , cystitis and bladder spasms while for gi complications we analysed haemorrhoids , anal incontinence , and proctitis . because a longer follow - up is needed to assess sexual toxicity , and due to the high number of patients who received adt , this complication was not assessed . biochemical failure was defined as psa nadir plus 2 ng / ml . data were entered and stored on an access file , and then transferred into r.2.14.1 software for statistical analysis . test or fisher 's exact test was used for category comparison . student test or anova or non - parametric kruskal - wallis was performed to test variables expressed as categories versus continuous variables . if this test was significant , we used the test of tukey or nemenyi test to compare these categories . we also showed the median survival and confidence intervals at 95% of the studied population ( kaplan - meier method ) . tests of significance were two - sided , and considered significant when the p value was 0.05 or less . between february 2009 and july 2013 , 216 consecutive patients underwent a hdr brachytherapy boost for pc . over the study period , two different treatment planning systems ( tps ) were used : plato ( nucletron bv , veenendaal , the netherlands ) from february 2009 to may 2012 , and oncentra brachy ( nucletron , an elekta company , elekta ab , stockholm , sweden ) from june 2012 until now . in order to avoid any comparative bias , we analysed the first 124 patients treated with the same tps ( plato ) . from 02/2009 to 01/2010 , 30 patients ( group 1 = g1 ; 24% ) were treated with 3 6 gy over 2 days . in order to make this procedure more comfortable for the patient and less time - consuming for the medical staff , from 01/2010 to 01/2011 , 52 patients ( group 2 = g2 ; 42% ) received 2 fractions of 9 gy over 2 days , while from 01/2011 to 05/2012 , 42 patients ( group 3 = g3 ; 34% ) were treated with a single fraction of 14 gy . this observational study retrospectively analysed the acute gu and gi toxicities occurred during the first 6 months after the implant in the 3 treatment groups . all the patients underwent imaging studies , including magnetic resonance , computed tomography , and bone scan . appropriate patient selection was performed according to the american brachytherapy society ( abs ) consensus guidelines for hdr prostate brachytherapy . patients were treated with a first course of ebrt , delivering 46 gy in 23 fractions . the dose was delivered to the icru point using high - energy x - photons ( > 10 mv ) . according to the calculated risk of lymph node involvement , the clinical target volume ( ctv ) was the whole pelvis or the prostatic fossa ( prostate and seminal vesicles ) for high- ( 15% ) and low - risk ( < 15% ) of lymph node involvement , respectively . the planning target volume ( ptv ) was defined as a 1 cm margin around the ctv in all directions , and reduced to 5 mm at the prostate rectal interface . short and long - term androgen deprivation therapy ( adt ) was proposed to intermediate and high - risk patients , respectively . this procedure was performed under general anaesthesia . using transrectal ultrasound ( trus ) guidance , 15 to 17 catheters ( sharp needles ; nucletron , an elekta company , elekta ab , stockholm , sweden ) were implanted transperineally and periurethrally through a dedicated template . after recovery , post - implant planning ct - scan was directly performed in the radiation oncology department for treatment planning purposes . ctv ( prostate ) and organs at risk ( oar urethra and rectum ) were outlined . the prostatic portion of the urethra was outlined plus a 10 mm additional margin above the base and below the apex , while the rectum was outlined from the anorectal junction to the rectosigmoid junction . brachytherapy boost delivered 3 6 gy , 2 9 gy , and 1 14 gy for g1 , g2 , and g3 , respectively . considering / 1.5 gy for prostatic tissue , eqd2 ( equivalent dose at 2 gy / fraction ) were 39 gy , 54 gy , and 62 gy for g1 , g2 , and g3 , respectively . dose constraints for prostate were v100 ( ctv receiving 100% of the prescribed dose ) > 95% , v150 < 35% , and v200 < 15% , d90 ( dose delivered to 90% of ctv ) > 105% , and d100% > 80% . dose constraints used for oars relied on the brachytherapy regimen groups . because of the slight dose escalation between g1/g2 ( eqd21.5 39 gy , 54 gy ) and g3 ( eqd21.5 62 gy ) , more restrictive dose constraints were considered for g3 patients . consequently , for g1/g2 , vu125 ( percentage of the urethra volume receiving 125% of the prescribed dose ) and vr100 ( percentage of the rectum volume receiving 100% of the prescribed dose ) should be less than 1% , while for g3 patients , vu115 ( percentage of the urethra volume receiving 115% of the prescribed dose ) and vr90 ( percentage of the rectum volume receiving 90% of the prescribed dose ) should be less than 1% ( fig . dose - volume adaptation was manually achieved using graphical optimization ( plato , nucletron bv , veenendaal , the netherlands ) by dwell location and time variation . patients treated with multiple fractions after a single insertion were re - scanned before each fraction , followed by re - optimization with regard to the risk of catheter migration . the first fraction was given post - operatively ( at day 0 ) , while the following fractions were given at day 1 ( with at least 6 hours interval between the 2 and 3 fraction for g1 ) . dose distribution obtained after planning using plato ( nucletron bv , veenendaal , the netherlands ) on sagittal ( a ) and transversal ( b ) view patients were followed at 1 month after the implant , then every 6 months with an assessment of serum prostate specific antigen level ( psa ) , physical examination , patient symptom assessment , and digital rectal examination in case of rising psa . acute gu and gi toxicities were scored according to the common terminology criteria for adverse event ( ctcae v3.0 ) . for gu complications , we analysed stricture / stenosis , frequency / urgency , retention , incontinence , cystitis and bladder spasms while for gi complications we analysed haemorrhoids , anal incontinence , and proctitis . because a longer follow - up is needed to assess sexual toxicity , and due to the high number of patients who received adt , this complication was not assessed . data were entered and stored on an access file , and then transferred into r.2.14.1 software for statistical analysis . test or fisher 's exact test was used for category comparison . student test or anova or non - parametric kruskal - wallis was performed to test variables expressed as categories versus continuous variables . if this test was significant , we used the test of tukey or nemenyi test to compare these categories . we also showed the median survival and confidence intervals at 95% of the studied population ( kaplan - meier method ) . tests of significance were two - sided , and considered significant when the p value was 0.05 or less . patient and treatment characteristics are reported in table 1 . regarding patient ( age , risk group factors ) and treatment ( ebrt , adt ) data , the majority of the patients were classified as high ( 73.4% ) or intermediate ( 19.3% ) risk regarding to d'amico classification . sixty - five percent of the patients ( 81 patients ) received whole pelvic ebrt while 80% ( 99 cases ) underwent adt . the median time interval between ebrt and hdr brachytherapy boost was 14 days ( ranged 0 - 43 ) . patient characteristics according to the treatment group n number of patients , ebrt external beam radiation therapy , adt androgen deprivation therapy , int rt / brachy time interval between the end of ebrt and high - dose rate brachytherapy expressed in days dosimetric data are reported in table 2 . because no significant dosimetric differences were noticed between g1/g2 patients regarding 1 , 2 and 3 post - implant ct - scan ( data not shown ) , the 1 ct - scan was used for dosimetric comparisons between the 3 treatment groups . median ctv were equivalent in 3 groups ( 36 , 33 , and 32 cc for g1 , g2 , and g3 , respectively , p = 0.088 ) . d90 for g3 ( 105% ) was significantly decreased compared to the d90 calculated for g1 ( 114% ) , and g2 ( 111% ) ( p < 0.001 ) as well as v100 ( 97 , 96 , and 95% for g1 , g2 , and g3 , respectively ; p = 0.013 ) , while v150 and v200 significantly decreased from g1 to g3 ( v150 : 45 , 36 , and 27% for g1 , g2 , and g3 , respectively ; p < 0.001 and v200 : 16 , 12 , and 9 for g1 , g2 , and g3 , respectively p < 0.001 ) . dose homogeneity index ( dhi ) for g3 ( 69% ) was significantly better compared to dhi noticed for g1 ( 54% ) and g2 ( 61% ) ( p < 0.001 ) . for oars ( urethra and rectum ) , dosimetric results were significantly improved in g3 compare to g1 and g2 ( p < 0.001 ) ( table 2 ) . assuming 3 gy for urethra and rectum , eqd2 of the dose delivered by the boost to oars significantly decreased from g1 to g3 for both urethra ( d10u : 52 , 47 , and 46 gy for g1 , g2 , and g3 , respectively ; p < 0.001 ) and rectum ( d2r : 28 , 27 , and 26 gy for g1 , g2 , and g3 , respectively ; p < 0.001 ) ( table 2 ) . dosimetric data and equivalent doses at 2 gy for ctv ( eqd2 / 1.5 gy ) and organs at risk ( eqd2 / 3 gy ) according to the treatment group ctv clinical target volume ( prostate ) , d90 dose delivered to 90% of ctv expressed in percentage and in eqd2 with /1.5 gy , d100 dose delivered to 100% of ctv expressed in percentage and in equivalence of the dose at 2 gy per fraction ( eqd2 ) with / 1.5 gy , v100 ctv receiving 100% of the prescribed dose expressed in percentage and in cubic centimetres , v150 ctv receiving 150% of the prescribed dose expressed in percentage and in cubic centimetres , v200 ctv receiving 200% of the prescribed dose expressed in percentage and in cubic centimetres , dhi dose homogeneity index , d0.1u dose delivered to 0.1 cc of the urethral volume expressed in percentage of the prescribed dose and in eqd2 with / 3 gy , d1u dose delivered to 1 cc of the urethral volume expressed in percentage of the prescribed dose and in eqd2 with / 3 gy , d10u dose delivered to 10% of urethral volume expressed in percentage of the prescribed dose and in eqd2 with / 3 gy , d30u dose delivered to 30% of urethral volume expressed in percentage of the prescribed dose and in eqd2 with / 3 gy , d01r dose delivered to 0.1 cc of the rectal volume expressed in percentage of the prescribed dose and in eqd2 with / 3 gy , d1r dose delivered to 1 cc of the rectal volume expressed in percentage of the prescribed dose and in eqd2 with / 3 gy , d2r dose delivered to 2 cc of the rectal volume expressed in percentage of the prescribed dose and in eqd2 with / 3 gy the median follow - up was 25 months ( ranged 8 - 46.9 ) . genito - urinary and gi complication grades for each treatment group were summarized in table 3 . the rates of acute gi and gu toxicities observed at 1 and 6 months after hdr brachytherapy boost were mainly grade 1 with few grade 2 ( gu : 5% at 1 month ; gi : 1% at 6 months ) . no grade 3 toxicity was observed in the whole population , while one patient in group 1 developed grade 4 gu toxicity consisting in a post - operative septic syndrome treated in intensive - care unit during 14 days . analysis of genito - urinary ( gu ) and gastro - intestinal ( gi ) complications observed at 1 and 6 months after hdrb boost regarding to the complication grade ( ctcv3.0 ) and the different fractionation schemes percentages of complication among patients who developed gu and/or gi complications gu genito - urinary complications , gi gastro - intestinal complications , fract . schemes fractionation schemes regarding the acute gu and gi toxicities occurred in the 3 treatment groups , no significant differences were observed at 1 and 6 months after the hdr brachytherapy boost between g1 , g2 , and g3 treatment groups ( table 3 ) . patient and treatment characteristics are reported in table 1 . regarding patient ( age , risk group factors ) and treatment ( ebrt , adt ) data , the majority of the patients were classified as high ( 73.4% ) or intermediate ( 19.3% ) risk regarding to d'amico classification . sixty - five percent of the patients ( 81 patients ) received whole pelvic ebrt while 80% ( 99 cases ) underwent adt . the median time interval between ebrt and hdr brachytherapy boost was 14 days ( ranged 0 - 43 ) . patient characteristics according to the treatment group n number of patients , ebrt external beam radiation therapy , adt androgen deprivation therapy , int rt / brachy time interval between the end of ebrt and high - dose rate brachytherapy expressed in days dosimetric data are reported in table 2 . because no significant dosimetric differences were noticed between g1/g2 patients regarding 1 , 2 and 3 post - implant ct - scan ( data not shown ) , the 1 ct - scan was used for dosimetric comparisons between the 3 treatment groups . median ctv were equivalent in 3 groups ( 36 , 33 , and 32 cc for g1 , g2 , and g3 , respectively , p = 0.088 ) . d90 for g3 ( 105% ) was significantly decreased compared to the d90 calculated for g1 ( 114% ) , and g2 ( 111% ) ( p < 0.001 ) as well as v100 ( 97 , 96 , and 95% for g1 , g2 , and g3 , respectively ; p = 0.013 ) , while v150 and v200 significantly decreased from g1 to g3 ( v150 : 45 , 36 , and 27% for g1 , g2 , and g3 , respectively ; p < 0.001 and v200 : 16 , 12 , and 9 for g1 , g2 , and g3 , respectively p < 0.001 ) . dose homogeneity index ( dhi ) for g3 ( 69% ) was significantly better compared to dhi noticed for g1 ( 54% ) and g2 ( 61% ) ( p < 0.001 ) . for oars ( urethra and rectum ) , dosimetric results were significantly improved in g3 compare to g1 and g2 ( p < 0.001 ) ( table 2 ) . assuming 3 gy for urethra and rectum , eqd2 of the dose delivered by the boost to oars significantly decreased from g1 to g3 for both urethra ( d10u : 52 , 47 , and 46 gy for g1 , g2 , and g3 , respectively ; p < 0.001 ) and rectum ( d2r : 28 , 27 , and 26 gy for g1 , g2 , and g3 , respectively ; p < 0.001 ) ( table 2 ) . dosimetric data and equivalent doses at 2 gy for ctv ( eqd2 / 1.5 gy ) and organs at risk ( eqd2 / 3 gy ) according to the treatment group ctv clinical target volume ( prostate ) , d90 dose delivered to 90% of ctv expressed in percentage and in eqd2 with /1.5 gy , d100 dose delivered to 100% of ctv expressed in percentage and in equivalence of the dose at 2 gy per fraction ( eqd2 ) with / 1.5 gy , v100 ctv receiving 100% of the prescribed dose expressed in percentage and in cubic centimetres , v150 ctv receiving 150% of the prescribed dose expressed in percentage and in cubic centimetres , v200 ctv receiving 200% of the prescribed dose expressed in percentage and in cubic centimetres , dhi dose homogeneity index , d0.1u dose delivered to 0.1 cc of the urethral volume expressed in percentage of the prescribed dose and in eqd2 with / 3 gy , d1u dose delivered to 1 cc of the urethral volume expressed in percentage of the prescribed dose and in eqd2 with / 3 gy , d10u dose delivered to 10% of urethral volume expressed in percentage of the prescribed dose and in eqd2 with / 3 gy , d30u dose delivered to 30% of urethral volume expressed in percentage of the prescribed dose and in eqd2 with / 3 gy , d01r dose delivered to 0.1 cc of the rectal volume expressed in percentage of the prescribed dose and in eqd2 with / 3 gy , d1r dose delivered to 1 cc of the rectal volume expressed in percentage of the prescribed dose and in eqd2 with / 3 gy , d2r dose delivered to 2 cc of the rectal volume expressed in percentage of the prescribed dose and in eqd2 with / 3 gy genito - urinary and gi complication grades for each treatment group were summarized in table 3 . the rates of acute gi and gu toxicities observed at 1 and 6 months after hdr brachytherapy boost were mainly grade 1 with few grade 2 ( gu : 5% at 1 month ; gi : 1% at 6 months ) . no grade 3 toxicity was observed in the whole population , while one patient in group 1 developed grade 4 gu toxicity consisting in a post - operative septic syndrome treated in intensive - care unit during 14 days . analysis of genito - urinary ( gu ) and gastro - intestinal ( gi ) complications observed at 1 and 6 months after hdrb boost regarding to the complication grade ( ctcv3.0 ) and the different fractionation schemes percentages of complication among patients who developed gu and/or gi complications gu genito - urinary complications , gi gastro - intestinal complications , fract . the acute gu and gi toxicities occurred in the 3 treatment groups , no significant differences were observed at 1 and 6 months after the hdr brachytherapy boost between g1 , g2 , and g3 treatment groups ( table 3 ) . dose escalation for prostate cancer radiation treatment represents a key point in order to improve biochemical control . according to the meta - analysis published by viani et al . , high - dose radiotherapy was superior to conventional dose radiotherapy in preventing biochemical failure in all risk groups , suggesting that high - dose radiotherapy should be offered to all patients regardless of their risk status . the low / ratio indicates that prostate tumours are more sensitive to high radiation doses per fraction than most other malignancies . therefore , many investigators have directed their efforts to deliver hypofractionated ebrt . in this field , the use of brachytherapy boost in addition to pelvic ebrt up to 46 gy represents a smart and attractive option [ 22 , 23 ] . indeed , brachytherapy allows an intrinsic dose escalation due to the overdose volumes generated by the interstitial position of the radioactive source within the prostatic tissues , and lead to a biological advantage over external beam radiation boost technique . brachytherapy boost has not only a potential advantage on clinical outcome , but also allows to make the treatment more acceptable for the patient due to less transportations to the medical insurance for reimbursement , and for the medical staff dealing with a less time consuming procedure . in this field , hdrb appears to give at least equivalent clinical outcomes compared to low - dose rate brachytherapy . a matched - pair analysis comparing prostate cancer ebrt + hdr vs. ebrt alone demonstrated a significant advantage in 5-year biochemical control in favour to the combination modality . two randomized trials have confirmed the superiority of the combination therapy using either low or high - dose rate iridium sources in terms of biochemical control with at least similar late gu and gi toxicity with a potential advantage for acute rectal complications . however , these studies used as conventional ebrt arm a total dose around 70 gy which is now considered as a low dose regarding biochemical control probability . nevertheless , even in case of very high - dose delivered to the prostate ( 86.4 gy ) using a imrt technique , deutsch et al . showed in a retrospective comparative analysis between ebrt vs. brachytherapy boost that the biochemical control remained significantly better in the brachytherapy group ( 3 7 gy ) . whatever , it remains difficult to compare ebrt with brachytherapy boost techniques , because the dose delivered by brachytherapy will be always higher compare to the same prescribed dose delivered by ebrt ( overdose volumes ) . this fact introduces an initial bias , which complicates the comparison between the two boost techniques . taking all together , currently , there is no standard fractionation scheme , and numerous protocols have been tested with various numbers of fractions ( ranged from 1 to 5 ) and dose per fraction ( ranged from 4.75 to 15 gy ) . it appears more comfortable for both patient and medical staff to reduce as far as possible the number of brachytherapy fractions respecting a similar biological effect , and clinical outcome in terms of toxicity and efficacy . in this filed , we started our brachytherapy boost program using 3 fractions in 2 days ( 3 6 gy ) , while one fraction of 14 gy became our standard protocol allowing to implant the needles , treat the patient and remove all the materials in the same day ( one day procedure ) . according to acute gi and gu toxicities , hoskin et al . reported in a phase iii randomised trial that hdrb boost technique could significantly reduce gi toxicity with equivalent gu complication rates compared to those observed with ebrt . regarding acute gi and gu toxicities , we reported mainly grade 1 complications and especially no significant differences between the 3 fractionations schemes . furthermore , the dose distribution improved according to the learning curve , although the dose constraints for oars were more restrictive . our results in terms of eqd2 for urethra and rectum ( boost eqd2 + ebrt 46 gy ) respect the recently published gec - estro recommendations , which propose for urethra d0.1cc and d10 120 gy eqd2 with d30 105 gy eqd2 , and for rectum d2cc 75 gy eqd2 . currently , the right fractionation remains under debate , but following strict implantation rules , there is a strong rational to propose a prostate cancer hdrb boost using a single fraction , providing similar results in terms of acute toxicity , and more comfortable procedure for patient and less time consuming for medical staff . however , longer follow - up is needed to confirm that single fraction of hdrb used as boost will give consistent results in terms of clinical outcome . the right fractionation remains under discussion , but prostate cancer hdrb boost using a single fraction ( providing similar results in terms of acute toxicity ) is more comfortable for the patient , less time consuming for the medical staff .

purposeto analyse early toxicity of high - dose - rate brachytherapy ( hdrb ) boost for prostate cancer using 3 fractionation schemes.material and methodsfrom february 2009 to may 2012 , after the first course of external beam radiation therapy ( ebrt 46 gy/23 f ) , 124 patients underwent hdrb boost for low ( 7% ) , intermediate ( 19% ) , and high - risk ( 73% ) prostate cancers . from february to december 2009 , group 1 ( g1 ) = 18 gy/3 f/2 d ( 24% ) ; from january 2010 to april 2011 , group 2 ( g2 ) = 18 gy/2 f/2 d ( 42% ) , and from may to september 2011 , group 3 ( g3 ) = 14 gy/1 f/1 d ( 34% ) . planning and ct - scan was performed before each fraction . dose constraints for g1/g2 were v100 rectum = 0 and v125 urethra = 0 , while for g3 v90 rectum = 0 and v115 urethra = 0 . genito - urinary ( gu ) and gastro - intestinal ( gi ) acute toxicities were assessed at 1 month ( for the 3 fractionation schemes ) and 6 months ( for 18 gy/3 f and 18 gy/2 f ) after the boost ( ctcv3.0).resultsmedian follow - up was 25 months ( 8 - 46.9 ) , median age was 71 years ( 50 - 82 ) , and median ctv was 31 cc ( 16 - 71 ) . the grades of acute gi and gu toxicities at 1 and 6 months after hdrb were mainly grade 1 with few grade 2 ( gu : 5% at 1 month ; gi : 1% at 6 months ) . one patient developed g4 sepsis toxicity 2 days after hdrb and recovered without after - effects . no significant differences were observed at 1 and 6 months after the hdrb between treatment groups.conclusionsthe right fractionation remains under discussion , but prostate cancer hdrb boost using a single fraction ( providing similar results in terms of acute toxicity ) is more comfortable for the patient , and less time consuming for the medical staff .

gallbladder cancers ( gbcs ) are highly aggressive cancers with the highest mortality rate among gastrointestinal cancers . the highest prevalence rates of gbc have been observed in american indian , chilean , and japanese women [ 1 , 2 ] . early diagnosis of gbc is generally impossible due to a lack of specific signs or symptoms . over 90% of gbc patients are diagnosed at an advanced , inoperable stage with serious invasion and metastasis to other organs . a majority of gbcs encountered in the clinic are adenocarcinomas ( ac , 9095% ) , while rare subtypes such as squamous cell / adenosquamous carcinoma ( sc / asc ) , mucinous carcinoma , signet ring cell carcinoma , and undifferentiated carcinoma are hardly ever encountered [ 2 , 5 ] . at present , cholecystectomy is only viable for early stage gbc [ 68 ] , while patients with unresectable or metastatic gbc have extremely poor prognosis and few treatment options . generally , palliative chemotherapy and radiation therapy offer limited benefits to patients with gbc . therefore , there is an urgent need to identify biological markers for the diagnosis , prognosis , and target therapy of gallbladder cancers . numerous studies have observed elevated levels of oxidative stress during tumor growth , which is characterized by an increase in reactive oxygen species ( ros ) . ros serve as secondary messenger molecules to increase tumor cell proliferation , genetic mutations , and instability , which lead to subsequent invasion , angiogenesis , and drug resistance in cancer cells . most importantly , cancer cells can develop mechanisms to evade high ros - induced apoptosis [ 10 , 11 ] . the elevation of oxidative stress levels in tumor cells is generally thought to be associated with two factors : the increased generation of ros and the decreased capacity of the cell to eliminate ros . enhanced release of o2 and/or h2o2 from the mitochondria and activation of nadph oxidase ( nox ) systems increase cellular ros levels [ 13 , 14 ] . the increase in ros can also be caused by the suppression of antioxidant enzymes , such as mnsod and gpx . thus , the differential expression of antioxidant enzymes in cancer can serve as biomarkers of tumor initiation and/or progression . tumor suppressive roles of the superoxide dismutase ( sod ) family of proteins have been observed in a variety of cancers . glutathione peroxidase ( gpx ) has been revealed to modulate the tumor suppressive effect of mnsod in various tumor cells . a number of studies have demonstrated that gpx3 expression is downregulated in a variety of cancers . for example , gpx3 is strongly downregulated in prostate cancer , thyroid cancer , colorectal cancer , gastric cancer , and breast cancer [ 15 , 16 ] . intriguingly , a previous study has revealed that gpx3 expression is higher in clear cell epithelial ovarian carcinoma tissues compared to control tissues . since gpx3 is always highly expressed in healthy tissues , it has been suggested to be a tumor suppressor in many tumors . aldehyde dehydrogenases ( aldhs ) are a family of enzymes that metabolize both endogenous and exogenous aldehydes to carboxylic acids as well as other reactive compounds . for example , aldh1a1 and aldh3a1 function as ocular antioxidants that play unique roles in the defense of the eye against uv radiation and in the downstream effects of oxidative stress . some aldh isoforms function in retinoic acid ( ra ) signaling via ra production by oxidizing all - trans - retinal and 9-cis - retinal . recently , aldh1 activity has been employed as a marker of stem - like cells in many cancers , such as cervical and breast cancer . moreover , aldh1 activity was demonstrated to be significantly higher in metastatic breast tumor cells that escaped chemotherapy . furthermore , high activity of aldh1 is associated with poor prognosis in breast , bladder , and prostate cancer patients [ 24 , 25 ] . however , most aldh prognostic data is based on using aldh1a1 expression levels as an indicator for cancer patients ' outcome [ 26 , 27 ] . these studies also yielded varied results , and the correlation of aldh1a1 with prognosis may be dependent on cancer type . in contrast , aldh1a3 , but not aldh1a1 , has been shown to correlate consistently with tumor grade and metastasis of breast cancer patients , suggesting that aldh1a3 may be a better marker in some tumors than aldh1a1 . the association of other aldh subtypes with tumor progression and prognosis has not been established . our preliminary study using microarray assay showed a 24-fold increase in aldh1a3 level and 23-fold decrease in gpx3 in gbc - sd cells compared to normal gbc epithelial cells ( data not shown ) . in this study , the expression of aldh1a3 and gpx3 in surgically resected specimens , including ac and sc / asc , was examined by immunohistochemistry . the correlation of aldh1a3 and gpx3 expressions with the clinicopathological characteristics and prognosis of ac and sc / asc was comparatively evaluated . a total of 46 squamous cell / adenosquamous carcinomas ( sc / asc ) from gbc patients that underwent surgical resection or biopsy were collected from january 1995 to december 2009 . the percentage of sc / asc in various gallbladder cancers is 4.34% ( 46/1060 gbcs ) . 80 adenocarcinomas ( ac ) samples for patients that underwent surgical resection or biopsy were collected from january 2005 to december 2009 . a gallbladder cancer sample was diagnosed as sc when most malignant cells are squamous cells and less than 10% are adenocarcinoma cells . a gallbladder cancer sample was diagnosed as asc when the tumor contains both squamous cells and adenocarcinoma cells , but the tumor must contain at least 10% adenocarcinoma or squamous cell carcinoma cells . among the 46 sc / asc patients , 19 patients were male and 27 patients were female with an age variation from 35 to 82 ( 55.8 9.6 ) years . among the 80 ac patients , 26 patients were male and 54 patients were female with an age variation from 33 to 80 ( 53.8 9.9 ) years . the differentiation ( refer to squamous cells ) of the 46 sc / ascs includes 16 well - differentiated , 24 moderately differentiated , and 6 poorly differentiated carcinomas . among the 80 acs , 27 were well differentiated , 25 were moderately differentiated , and 28 were poorly differentiated . among the 46 sc / asc patients , invasion of gallbladder , surrounding tissues and organs , was found in 30 patients , while 29 patients had regional lymph node metastasis . among the 80 ac patients , invasion of gallbladder surrounding tissues and organs was found in 49 patients , while 50 patients had regional lymph node metastasis . surgery included radical resection for 14 sc / ascs and 26 acs , palliative surgery for 18 sc / ascs and 28 acs , and no operation for 14 sc / ascs and 26 acs with only biopsy . the 2-year survival information of 80 ac and 46 sc / asc patients was obtained through letters and phone calls . this study was preapproved by the ethics committee for human research , central south university . four - micrometer - thick sections were cut from routinely paraffin - embedded tissues of ac and sc / asc . staining was conducted with the peroxidase - based envision detection kit ( dako laboratories , ca , usa ) by following the user manual and the rabbit anti - aldh1a3 ( abgent company , california , usa ) and rabbit anti - gpx3 ( novus biologicals , littleton , usa ) antibodies which specifically stain human aldh1a3 and human gpx3 . briefly , the sections were deparaffinized and then incubated with 3% h2o2 for 15 minutes . after being soaked with phosphate - buffered saline ( pbs ) for 3 5 minutes , the sections were incubated with primary antibody for 1 hr at room temperature . after rinsing sections with pbs for 3 times , solution a was added , and the sections were incubated for 30 minutes . the substrate dab was added followed by hematoxylin counterstaining . the slides were dehydrated with different concentrations ( 70%100% ) of alcohol and soaked in xylene for 3 5 minutes . the positive control was the positive biopsy provided by beijing zhongshan biotechnology company ( beijing , china ) , while the negative control was designed by replacing the primary antibody with 5% fetal bovine serum . by considering that heterogeneity of staining pattern exists , the percentage of positive cells was calculated from 500 tumor cells in 10 random fields . the staining strength was graded as previously described : a score of 1 was given for no positive staining or a uncertainly weak staining ; a score of 2 was given for weak to moderate staining ; a score of 3 was given for moderate to strong staining . for gpx3 , cases with both positive cells 25% and scores 2 were considered positive . a few cases with 10% to 25% positive cells and 3 scores in staining cases with both positive cells 10% and scores 2 were considered positive . the slides were systematically scanned , and 7 - 8 representative digital images were acquired from each slide . digital images were quantified by image analysis with adobe photoshop , version 7.0 ( adobe systems , san jose , ca ) , and the extent of staining was assessed as the percentage of positively stained area per field under 100 magnification . data was analyzed using the statistical package for the social sciences version 13.0 ( spss 13.0 ) . the interrelationship of aldh1a3 or gpx3 expressions with histological or clinical factors was analyzed using , fisher 's exact test , or student 's t - test . kaplan - meier and time series tests ( log - rank test ) were used for univariate survival analysis . cox proportional hazards model was used for multivariate analysis and to determine the 95% confidence interval . the percentage of cases with age older than 45 years and tumor mass > 3 cm was significantly higher in sc / ascs than in acs ( p < 0.05 ) . the percentage of cases with poorly differentiated tumor was significantly lower in sc / ascs than in acs . no significant differences in other clinicopathological characteristics were observed between sc / asc and ac patients . envision immunohistochemistry revealed that aldh1a3 and gpx3 positive reaction was mainly localized in the cytoplasm of tumor cells in sc / asc ( figure 1 ) and ac ( figure 2 ) , but a small amount of inflammatory reaction cells and fibroblasts was also stained . western blot with aldh1a3 antibody showed one main band of 56 kda and a weak band of 22 kda , while western blot with gpx3 antibody showed one band of 25 kda ( data not shown ) . no significant difference in the percentage of cases with positive aldh1a3 and gpx3 expressions was observed between sc / asc and ac patients ( data not shown ) . as shown in table 1 and figure 3(a ) , the percentage of cases with positive aldh1a3 expression was significantly higher in tumor tissues from sc / asc patients with high tnm stage and lymph node metastasis compared to tumor tissues from cases with low tnm stage and no lymph metastasis ( p < 0.05 or p < 0.01 ) . the gpx3 expression was significantly lower in cases with higher tnm stage , lymph node metastasis , and invasion ( p < 0.05 or p < 0.01 ) . aldh1a3 and gpx3 exhibited no significant association with other clinicopathological characteristics of sc / asc . the percentage of cases with positive aldh1a3 expression and negative gpx3 expression in ac tumors was significantly higher in cases with poor differentiation , large tumor mass , high tnm stage with lymph node metastasis , and invasion to the gallbladder surrounding tissues and organs compared to the cases with well - differentiated tumor , small tumor mass , lower tnm stage , no lymph metastasis , and no invasion ( p < 0.05 , p < 0.01 , or p < 0.001 ) ( table 1 , figure 3(b ) ) . survival information of 46 sc / asc patients was obtained through letters and phone calls . the followup time was 2 years , and patients that survived longer than 2 years were included in the analysis as censored cases . thirty - three of the 46 sc / asc patients survived less than 1 year and 13 patients survived over 1 year ( 4 cases survived longer than 2 years ) with an average survival time of 10.07 0.78 months . fifty - seven of the 80 ac patients survived less than 1 year and 23 patients survived over 1 year ( 9 cases survived longer than 2 years ) with an average survival time of 10.34 0.63 months . the kaplan - meier survival analysis in sc / asc patients revealed that the differentiation , tumor size , tnm stage , lymph node metastasis , and invasion ( p < the average survival time of aldh1a3 positive patients was significantly lower than patients with negative aldh1a3 expression ( p = 0.005 ) , but the average survival time of gpx3 positive patients was significantly higher than patients with negative gpx3 expression ( p = 0.002 ) ( table 2 , figure 4 ) . cox multivariate analysis showed that the differentiation , tumor size ( 3 cm ) , tnm stage , invasion , and operative procedure as well as aldh1a3-positive expression or gpx3-negative expression were negatively correlated with postoperative survival , suggesting that aldh1a3 positivity is a risk factor and gpx3 has a strong impact on prognosis of scs / ascs ( table 3 ) . the kaplan - meier survival analysis in ac patients revealed that the differentiation , tumor size , tnm stage , lymph node metastasis , invasion , and operative procedure ( p < 0.001 ) were significantly associated with the average survival time ( table 2 ) . the average survival time of aldh1a3-positive ac patients was significantly lower than patients with negative aldh1a3 expression ( p < 0.001 ) , but the average survival time of gpx3 positive patients was significantly higher than patients with negative gpx3 expression ( p < 0.001 ) ( table 2 , figure 5 ) . cox multivariate analysis showed that the differentiation , tumor size ( 3 cm ) , tnm stage , lymph node metastasis , invasion , and operative procedure as well as aldh1a3-positive expression or gpx3-negative expression were negatively correlated with poor survival of ac patients ( table 3 ) . the clinical and pathological characteristics of squamous cell / adenosquamous carcinomas ( sc / asc ) of the gallbladder have not yet been widely recognized because these subtypes are rather rare . moreover , no study so far has systemically compared the clinical , pathological , and molecular differences between the rare sc / asc subtype and the common ac subtype of gallbladder cancers ( gbc ) . in this study , no significant differences in differentiation , metastasis , invasion , tnm stage , and prognosis were observed between these two subtypes . the clinicopathological presentations of sc / asc did not seem to be different from ordinary ac though more sc / asc patients exhibited larger tumor mass ( > 3 cm ) than ac patients . this suggested that squamous differentiation is as aggressive as glandular differentiation in the gallbladder , which is inconsistent with previous observations [ 31 , 32 ] . importantly , we found no differences in aldh1a3 and gpx3 expressions between sc / asc and ac patients , suggesting that they may have similar biological characteristics . numerous studies have observed an increase in oxidative stress during tumor growth , including gbc . therefore , the expression of aldh1a3 and gpx3 , two oxygen stress - related molecules , was investigated in this study . previous studies have demonstrated that gpx3 is downregulated in a variety of tumors , such as prostate cancer , thyroid cancer , colorectal cancer , gastric cancer , and breast cancer [ 15 , 16 , 18 ] . however , the predictive role of gpx3 in the prognosis of these cancer patients has not been observed . moreover , no molecular markers related to the aggressive biological characteristics or prognosis of sc / asc have currently been identified . in this study , we demonstrated that loss of gpx3 expression was significantly associated with metastasis , invasion , tnm stage , and poor prognosis in both sc / asc and ac patients . these observed correlations may possibly indicate that gpx3 is a tumor suppressor in gallbladder cancers . increases in reactive oxygen species levels have been associated with tumor cell proliferation , genetic instability , and subsequent increases in invasion , angiogenesis , and drug resistance [ 9 , 10 ] . although this study provided no evidence on whether the expression and/or activity of other antioxidant enzymes were decreased and whether the suppression of these enzymes plays a key role in the increased ros levels in gbcs , the observed decrease in gpx3 expression suggested its involvement in oxidative stress . aldehyde dehydrogenases are known to modulate several cell functions , including proliferation , differentiation , and survival , as well as cellular response to oxidative stress . in addition , cancer cell - acquired drug resistance has been demonstrated to be associated with the transcriptional activation of aldh1 expression . in contrast , aldh1a1 and aldh3a1 have been demonstrated to function as ocular antioxidants . in this study , positive aldh1a3 expression in ac patients was associated with poor differentiation , large tumor size , high tnm stage , lymph node metastasis , and invasion . in sc / asc patients , positive aldh1a3 expression was also associated with high tnm stage , invasion , and lymph node metastasis . this suggests that aldh1a3 in gbc plays a role in the proliferation , differentiation , and survival of tumor cells . in addition , both the ac and sc / asc patients with positive aldh1a3 expression exhibited poor survival . recently , aldh1 activity has been employed successfully as a stem cell marker in various cancers . in addition , aldh activity detected in tumor cells may actually be an indication of stem cells , because they are resistant to various chemotherapeutic drugs and linked to poor prognosis [ 2225 ] . we acknowledge that although positive aldh1a3 expression or negative gpx3 expression significantly correlated the shorter survival in both sc / asc and ac patients , their regression coefficients or relative risk showed that the impact of positive aldh1a3 expression or negative gpx3 expression on survival was small when compared with differences in tumor size , invasion , and differentiation . therefore , aldh1a3/gpx3 may be more effective as markers for proliferation and differentiation of gallbladder carcinoma than as tools for predicting overall survival . however , the real role of aldh1a3/gpx3 on tumor growth and metastasis of gallbladder cancer should be investigated further in animal models using inhibitory agents of aldh1 , such as sirna and/or overexpression of gpx3 gene . the data from this study also raised questions on why do sc / asc and ac share very similar gene expression profiles for aldh1a3 and gpx3 , and why the expression profiles of aldh1a3 and gpx3 , both molecules associated with oxidative stress , are closely related to tnm staging and metastasis . in conclusion , the lowered expression of gpx3 and elevated expression of aldh1a3 in ac and sc / asc subtypes of gbc are important biological markers for the metastasis , invasion , and maybe prognosis of gallbladder cancer .

background . gallbladder cancers ( gbcs ) are highly aggressive cancers with high mortality . however , biological markers for the progression and prognosis of gbc are currently unavailable in the clinic . objective . to identify biomarkers for predicting gbc metastasis and prognosis . methods . we examined aldh1a3 and gpx3 expressions in 46 squamous cell / adenosquamous carcinomas ( sc / asc ) and 80 adenocarcinomas ( ac ) by using immunohistochemistry . results . positive aldh1a3 and negative gpx3 expressions were significantly associated with lymph node metastasis and invasion of sc / ascs and acs . univariate kaplan - meier analysis showed that either positive aldh1a3 ( p < 0.001 ) or negative gpx3 ( p < 0.001 ) expression significantly correlated with decreased overall survival in both sc / asc and ac patients . multivariate cox regression analysis showed that positive aldh1a3 expression or negative gpx3 expression was an independent poor - prognostic predictor in both sc / asc and ac patients . conclusions . our study suggested that positive aldh1a3 and negative gpx3 expressions are closely associated with clinical pathological behaviors and poor prognosis of gallbladder cancer .

methicillin - resistant staphylococcus aureus ( mrsa ) is recognized as one of the most common pathogens of both nosocomial and community - acquired infections worldwide . as a feature distinct from methicillin - susceptible s. aureus ( mssa ) , mrsa has a transmissible genome element , staphylococcal cassette chromosome mec ( sccmec ) , inserted in a specific site of the chromosome . the sccmec in mrsa has been differentiated into at least 12 genetic types ( i xii ) , , among which types i iii have been traditionally associated with hospital - acquired mrsa ( ha - mrsa ) , while type iv and v have been commonly found in community - acquired mrsa ( ca - mrsa ) . however , in recent years , ca - mrsa with the dominant sccmec types ( iv and v ) has been brought to healthcare settings causing nosocomial infections , , , which makes distinction between ha- and ca - mrsa more difficult in terms of sccmec type . the pathogenesis of many ca - mrsa strains have been attributed to the production of panton - valentine leukocidin ( pvl ) , a two - component toxin encoded by two genes , lukf - pv and luk - s - pv , which are carried on lysogenic bacteriophages , . accordingly , pvl - positive s. aureus is associated with severe symptoms in a wide spectrum of infections including skin and soft tissue infections and necrotizing pneumonia , . prevalence of ca - mrsa harbouring pvl genes has been increasing recently in hospitalized patients as well as healthy individuals in the community , . distribution and spread of mrsa clones on a global scale have been revealed by genetic classifications with multilocus sequence typing and sccmec typing , . several ha - mrsa clones including st5-mrsa - sccmec ii ( st5-ii , ny / japan clone ) and st22-iv ( emrsa-15 ) are known as pandemic clones predominating in east asia / north america and europe , respectively . in contrast , various clones have been documented for ca - mrsa which are distributed locally or predominate in a region , often associated with international spread . globally predominant ca - mrsa includes five clones , i.e. st1 ( usa400 clone ) , st8 ( usa300 clone ) , st30 ( south west pacific clone ) , st59 ( taiwan clone ) and st80 ( european clone ) , among which st8 and st30 are considered pandemic as a result of its distribution to every continent . in asia , two pandemic ha - mrsa clones with st5 and st239 are disseminating , whereas various ca - mrsa clones including those with st8 , st30 , st59 , st72 and st772 have been reported . in nepal , the prevalence of mrsa from clinical specimens in hospitals has been described to be 2669% in several studies via antimicrobial susceptibility testing , , , , , although the rate varies depending on the types of infections or specimens examined . a recent study revealed a high prevalence of pvl genes in nosocomial isolates of mrsa and mssa ( 26% and 52% respectively ) . however , in nepal , there have been no studies conducted on genotypes ( st and sccmec types ) of clinical mrsa isolates , particularly pvl - positive isolates . we found high prevalence of pvl in mrsa and mssa , as well as the presence of pvl - positive st772 mrsa - v ( bengal bay clone ) . a deletion variant of elastin binding protein gene was first identified in st22 s. aureus isolates and its origin was analysed . from august 2012 to october 2012 , about 200 s. aureus isolates were collected from two general hospitals ( approximately 100 isolates each ) with more than 500 beds in kathmandu , nepal . the main specimen of the isolates was pus ( n = 84 ) , followed by urine ( n = 12 ) , sputum and blood ( n = 2 each ) . a single isolate from each individual patient was subjected to study . bacterial isolation and species identification were performed by conventional microbiological methods , and the presence of nuclease gene was confirmed by multiplex pcr . individual bacterial strains were stored in microbank ( pro - lab diagnostics , richmond hill , on , canada ) at 80c and recovered when they were analysed . staphylococcal 16s rrna , nuc , meca , pvl gene ( luks - pv / lukf - pv ) and acme - arca ( arginine deiminase gene ) were detected for all isolates by multiplex pcr assay as described by zhang et al . . minimum inhibitory concentrations against 18 antimicrobial agents based on the broth microdilution test were measured by using dry plate eiken dp32 ( eiken chemical , tokyo , japan ) . breakpoints defined in the clinical laboratory standards institute guidelines were used to distinguish between resistant and susceptible strains for most of drugs examined . staphylocoagulase genotype ( coa type ) of s. aureus isolates was determined by multiplex pcr using previously published primers and conditions . for the strains for which the coa types were not determined for i x by the multiplex pcr , partial coa sequences ( d1 , d2 and the central regions ) were determined as described previously , to assign the coa genotype by sequence identity via blast search ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) . for selected isolates , sequence type ( st ) was determined according to the scheme of multilocus sequence typing , and agr group was classified as described previously . presence of genes encoding enterotoxins and other toxins , adhesins , other proteins related to virulence and antimicrobial resistance genes was analysed by multiplex or uniplex pcr using primers described previously , . the sequence of the gene encoding elastin binding protein ( ebps ) was determined by pcr and direct sequencing , as described previously . multiple alignment of ebps sequences determined in the present study and those retrieved from the genbank database was performed by the multalin interface ( http://multalin.toulouse.inra.fr/multalin/ ) . the lalign program ( european bioinformatics institute ; http://www.ebi.ac.uk/tools/psa/lalign/nucleotide.html ) a phylogenetic tree of ebps was constructed by the neighbour - joining method by mega 5.01 software , statistically supported by bootstrapping with 1000 replicates . full - length ebps sequences of strains np173 , np177 and np199 determined in the present study were deposited in the genbank database under accession numbers kt951674kt951676 respectively . among the 100 s. aureus clinical isolates examined , 32 isolates were mrsa which had sccmec type v ( n = 20 , 62.5% ) or type iv ( n = 2 , 6.3% ) ( table 1 ) , while sccmec type was not identified for ten isolates . pvl genes were detected in 78% ( 25/32 ) of mrsa and 71% ( 48/68 ) of mssa isolates . the most common coagulase genotypes of pvl - positive mssa and mrsa were iva and via , respectively . genetic characteristics were analysed for 17 isolates as representatives of pvl - positive mrsa ( seven isolates ) , pvl - positive mssa ( six isolates ) , pvl - negative mrsa ( three isolates ) and a pvl - negative mssa isolate ( table 2 ) . the pvl - positive mrsa isolates belonged to st1 , st22 , st88 or st772 . the st772 was identified into mrsa with sccmec v , coa - via and agr - ii ( one pvl - negative and four pvl - positive isolates ) , as well as two pvl - positive mssa . mrsa isolates with or without pvl were mostly resistant to ampicillin , gentamicin and levofloxacin , and had generally more drug resistance genes than pvl - positive mssa , although some meca - positive isolates ( mrsa ) were susceptible to oxacillin ( supplementary table s1 ) . although luke - lukd and haemolysin genes were detected in most isolates examined , st772 isolates ( mrsa and mssa ) and st22 mrsa had more enterotoxin genes than st1 and st88 mrsa and st30 mssa isolates ( table 2 ) . in the present study , we first demonstrated the presence of st772-mrsa - v and st22-mrsa - iv in nepal . st772 and st22 have been reported as epidemic clones associated with infections in both community and healthcare settings in india , , , . st772 mssa was originally reported in bangladesh ; thereafter , st772-mrsa - v was identified in india , followed by transmission to east / southeast asia , australia , new zealand , the middle east and europe . this clone is colloquially referred to as the bengal bay clone , and it is mostly pvl positive and relatively multiresistant compared to other ca - mrsa . in addition to the increasing prevalence of st772-mrsa - v in india , detection of this clone outside india has been related to travel history to or from india , , . because of its adjacent location , it is conceivable that st772-mrsa - v in india might have been readily transmitted to nepal , or it may have been originally endemic in nepal as well as india . although the elastin binding protein ( ebps ) gene ( ebps ) was detected in all the isolates examined by pcr with primers described previously , pcr products that were shorter than the expected size ( 652 bp ) were found in four st22 isolates ( data not shown ) , among which three isolates ( np173 , np177 and np199 ; pvl - positive mrsa , pvl - negative mrsa and pvl - positive mssa respectively ) were further analysed for their ebps gene sequences . these ebps genes were revealed to be a variant ( ebps - v ) with an internal deletion of 180 bp encoding a 60 aa sequence . by blast search , sequences similar to ebps - v were identified in strain 71a_s11 ( st22 ) , 93b_s9 and y12 ( st121 ) and 6850 ( st50 ) . alignment of the deduced amino acid sequences of the ebps - v identified in the present study with those of other representative s. aureus strains is shown in fig . 1 . the deleted portion ( 60 aa ) of ebps - v in st22 nepalese strains , corresponding to aa 199258 of ebps from strain col , was identical to those found in strains 71a_s11 , 93b_s9 , y12 and 6850 ( genbank accession nos . phylogenetic analysis of the ebps from various s. aureus strains , including ebps - v , revealed the presence of three major lineages ( i , ii and iii ) ( fig . 2 ) . lineage ii contained the st22 cluster , which consisted of ebps - v from nepalese strains and intact ebps in st22 strains as emrsa-15 . nucleotide sequence identity of intact ebps within the same lineage was more than 98.8% , while it was 95.298% between different lineages ( supplementary table s2 ) . ebps - v of st22 nepalese strains showed > 99% identity with each other , but slightly lower identity was found in st121 strains ( 95.695.7% ) . the variant of ebps with a 180 bp deletion was first reported for isolates from orthopaedic infections in italy , although their st was not identified . thereafter we identified a similar ebps variant ( ebps - v ) in st121 mssa isolates in myanmar as well as in st121 isolates in bangladesh and japan . the present study elucidated that ebps - v of st22 and st121 belong to different lineages , suggesting that the 180 bp deletion event in ebps might have occurred in st22 s. aureus and st121 s. aureus independently . ebps , one of the adhesins that binds to host cellular matrix factors involved in biofilm formation , is produced by most mrsa examined so far , , . ebps is a cell - surface molecule and mediates binding of bacterial cell to soluble elastin peptides and tropoelastin , , with its n - terminal region ( aa 1434 ) a ligand - binding domain exposed on the surface of the cell and two ( h1 and h3 ) among the three putative hydrophobic domains spanning the cell membrane . although the functional and structural changes caused by the deletion in st22 isolates are unknown , the n - terminal region must be exposed on the surface of cell for the normal function of ebps - v ; accordingly , the h2 region is necessary to span the membrane instead of the deleted h1 region ( fig . 1 , supplementary fig . s1 ) . in that case , only the form of the cytoplasmic portion of ebps - v may be different from that of ebps , which may be possible to cause any functional difference . it was notable in the present study that all the st22 s. aureus , including mrsa and mssa , harboured ebps - v , while intact ebps was also found in other previously reported st22 strains including emrsa-15 . in contrast , all the st121 s. aureus analysed to date harboured ebps - v , , . the st121 clone is known to be a common cause of skin and soft tissue infection disseminating globally , mostly meca negative but pvl positive , exhibiting higher virulence . although the association of ebps - v with the enhanced virulence of the st121 clone is not known , if the presence of ebps - v affects phenotypic trait of st22 s. aureus ( e.g. virulence or fitness advantage to environment ) , it is possible that the proportions of st22 isolates with ebps and ebps - v may change over time epidemiologically . further studies thus may be necessary to monitor the prevalence of st22 s. aureus with ebps - v .

genetic characteristics were analysed for recent clinical isolates of methicillin - resistant and -susceptible staphylococcus aureus ( mrsa and mssa respectively ) in kathmandu , nepal . mrsa isolates harbouring panton - valentine leukocidin ( pvl ) genes were classified into st1 , st22 and st88 with sccmec - iv and st772 with sccmec - v ( bengal bay clone ) , while pvl - positive mssa into st22 , st30 and st772 . st22 isolates ( pvl - positive mrsa and mssa , pvl - negative mrsa ) possessed a variant of elastin binding protein gene ( ebps ) with an internal deletion of 180 bp , which was similar to that reported for st121 s. aureus previously outside nepal . phylogenetic analysis indicated that the ebps variant in st22 might have occurred independently of st121 strains . this is the first report of st772 pvl - positive mrsa in nepal and detection of the deletion variant of ebps in st22 s. aureus .

the traditional medical practitioner or traditional healer can be defined as someone who is recognized by the community in which he lives as competent to provide health care by using vegetable , animal and mineral substances and certain other methods based on the social , cultural and religious backgrounds as well as the prevailing knowledge , attitudes and beliefs regarding physical , mental and social well - being and the causation of disease and disability in the community . traditional healers used different medicinal formulas from various natural substances ( animal , mineral and vegetable ) . they have extensive knowledge on the use of plants and herbs for medicinal and nutritional purposes . the mishings are an ethnic group inhabiting the districts of dhemaji , north lakhimpur , sonitpur , tinsukia , dibrugarh , sibsagar , jorhat and golaghat of assam . a few live in and around pasighat of east siang district of arunachal pradesh . they are the second largest tribal group in north - east india , followed by the bodos . their chief festival is ali - aye - ligang , in the month of february , which marks the beginning of the sowing season . moreover , due to their affinity towards living close to river banks brings about malaria and water - borne diseases and they developed traditional healing practices to protect themselves from different diseases and traditional healing practices of those days are still preferred by the people of this community in this modern era . details of medicinal plants used in india were reported and records on folk medicines used by mishing tribes is lesser known.[36 ] however , tribal communities in arunachal pradesh , resembling mishings i.e. adi , apatani and nyishi also use locally available herbs for treatment of ailments.[712 ] traditional healing practices amongst mishing tribes is the method to treat ailments by using herbs in form of fresh drug , crushed juice , decoction of drug part and powdered medicine for oral intake and paste for local application on skin diseases and wounds . they use locally available medicinal herbs , cultivated drugs from different habitat as well as cultivating depleting medicinal plants , they have also faith on divines and worships for cure of ailments . the study reveals detailed documentation of healing practices used by traditional healers for their community health with full faith and confidence . malaria and jaundice being the prominent diseases in north east india are widely treated by traditional healers and 68 herbs have been recorded treating malaria and about 88 for treating jaundice . in folk medicine or ethno medicinal studies , the most reliable method is one involving field survey . during various field survey in forest areas and adjoining villages , villagers were consulted about their primary method of treatment during illness . after getting information about the persons involved in local healing practices authors made attempt to come in contact with these healers with an idea of exchange of knowledge gathered from established system of herbal medicine like ayurveda and local herbs used in other adjoining community . during course of interaction knowledge about single and easily accessible compound drugs used in ayurveda and easily available in the area it involves meeting with the herbalists and experts in the field for getting first hand information . practitioner of herbal medicines who are experts in treating in general different ailments and who are also expert in different methods of treatment were consulted for getting some first hand data . in the present study the work is restricted to some herbal - medical practitioners within different mishing groups inhabiting in assam and arunachal pradesh . the herbalists consulted were convinced about the importance of documentation of ethnic knowledge about the medicinal plants used in various curative purposes . it requires tactful handling and persuasion to bring out the information from the herbal practitioners . during course of study traditional informers on healing practices were interviewed under which in total 7 healers from dhemaji and north lakhimpur districts and 4 from foothills of east siang district were interacted some of which are mr u. c. kardong , mr lakhidhar payeng , mr khogen kardong , mrs maloti naro and other associated with the above practitioners . these traditional healers belong to 4 villages in north lakhimpur and 3 in dhemaji district of assam and one village in east siang district of arunachal pradesh . the detail information about the plants and part used in the treatment of different ailments were collected . plant specimens were collected for identification and herbarium preparation . while most of the plants are commonly occurring plants known to most of the people , some of the plants were identified consulting the herbarium specimen in the botanical survey of india ( bsi ) , itanagar . the herbarium specimens are preserved in the herbarium of ayurveda regional research institute , itanagar for authentication and future reference . mishing community is one of the major tribal communities which are distributed from arunachal pradesh to plains of assam and bifurcated from time to time due to their migration from hills of arunacha pradesh to plains of assam . during this migration they developed their knowledge by acquiring from other nearby communities and used herbs available in and around their villages for various treatments of ailments [ table 1 ] . as per information given on system it was found that long back the responsible persons in the villages was village head called gaon burha in arunachal mishing but during these interactions more than 3 persons belonging to same or different family are involved in healing practices by developing some cultivation of herbs used in their practices and not naturally occurring in the nearby areas just like aloe barbadensis , barleria cristata , glycyrrhiza glabra etc . under healing practices of mishing community general herbalist , bone setters , ojhas related with bhoot badha , dondai using mantra tantra etc . some common type of treatment like cuts and wound , sprain and skin diseases where external application is involved is practiced by all those who get affected immediately . use of certain herbs like centella asiatia , houttuyinia cordata , phyllanthus emblica and terminalia citrina is in common practice as protective medicine and is commonly sold in vegetable shops . folk medicines used by mishing community of north east india types of traditional healers amongst mishing tribes presently all traditional healers of this community are not performing the same functions , nor do they all fall into the same category . . they have their own methods of diagnosis and their own particular medicine . by interviewing it was found that there are different types of traditional healers on basis of there expertise in north east india . traditional medical practitioners treat all age groups and all problems , using and administering medicines that are readily available and affordable . their treatment is comprehensive and has curative , protective and preventive elements , and can be either natural or ritual or both , depending on the cause of the disease . it includes among others , ritual sacrifice to appease the ancestors , ritual and magical strengthening of people and possessions , steaming , purification ( e.g. ritual washing , or the use of emetics and purgatives ) , sniffing of substances , cuts , wearing charms and piercing . the ethno medicinal information regarding treatment of different diseases collected in course of field study is presented here in tabular form for easy reference . the study shows that malaria , jaundice and female menstruation problems are the prominent diseases in this community as most of the traditional healers are prescribed medicine for these treatments . in this study , 55 medicinal plants encountered from different parts of the mishing inhabitant area used by this community in their daily ailment from various diseases . different parts of the medicinal plant species were used for curing different diseases and mostly leaves ( 36.84% ) were used followed by stem ( 14.03% ) , root ( 10.52% ) and bark ( 7.02% ) . asteraceae ( 5 species ) , apocynaceae ( 4 species ) and 3 each in euphorbiaceae , malvaceae and acanthaceae were found . some of the plants can be categorized as highly prioritized medicinal plants as they are of immense value in curing various diseases but are in the low niche . these plants are widely used under traditional healing practices but due to multiple use they are depleting from their habitat viz . eventually , these species are now on the freeway towards extinction due to over exploitation , road construction , encroachment of habitat by the immigrants of the neighbouring community . local inhabitants adapted cultivating some of the locally available herbs like acorus calamus , alstonia scholaris , centella asiatica , leucas indica , nymphea stellata , tabernemontana divaricata and some others from habitats of different climatic condition like aloe barbadensis , glycyrrhiza glabra which meet out the requirement of drugs for daily requirement . some of the prominent herbs of the area are ageratum conyzoides , clerodendrum infortunatum , leucas indica , sida acuta , solanum viarum , etc . which are commonly available in the habitat and are used for meeting out requirement of drug for treating ailments few commonly observed trees and shrubs are alstonia scholaris , costus speciosus ficus racemosa , oroxylum indicum , plumaria alba , ricinus communis , etc . most of the plant products after formulation are used orally , whereas for skin disease and bone facture medicines are not prescribed for oral consumption . it was found that in most of the cases the plant products are prepared with combination of some other plants or some other products . the plants uses in mixture all may not contain the properties to relief from particular disease but some might be reduced side effect on treatment . mishing community is one of the major tribal communities which are distributed from arunachal pradesh to plains of assam and bifurcated from time to time due to their migration from hills of arunacha pradesh to plains of assam . during this migration they developed their knowledge by acquiring from other nearby communities and used herbs available in and around their villages for various treatments of ailments [ table 1 ] . as per information given on system it was found that long back the responsible persons in the villages was village head called gaon burha in arunachal mishing but during these interactions more than 3 persons belonging to same or different family are involved in healing practices by developing some cultivation of herbs used in their practices and not naturally occurring in the nearby areas just like aloe barbadensis , barleria cristata , glycyrrhiza glabra etc . under healing practices of mishing community general herbalist , bone setters , ojhas related with bhoot badha , dondai using mantra tantra etc . some common type of treatment like cuts and wound , sprain and skin diseases where external application is involved is practiced by all those who get affected immediately . use of certain herbs like centella asiatia , houttuyinia cordata , phyllanthus emblica and terminalia citrina is in common practice as protective medicine and is commonly sold in vegetable shops . folk medicines used by mishing community of north east india types of traditional healers amongst mishing tribes presently all traditional healers of this community are not performing the same functions , nor do they all fall into the same category . . they have their own methods of diagnosis and their own particular medicine . by interviewing it was found that there are different types of traditional healers on basis of there expertise in north east india . traditional medical practitioners treat all age groups and all problems , using and administering medicines that are readily available and affordable . their treatment is comprehensive and has curative , protective and preventive elements , and can be either natural or ritual or both , depending on the cause of the disease . it includes among others , ritual sacrifice to appease the ancestors , ritual and magical strengthening of people and possessions , steaming , purification ( e.g. ritual washing , or the use of emetics and purgatives ) , sniffing of substances , cuts , wearing charms and piercing . the ethno medicinal information regarding treatment of different diseases collected in course of field study is presented here in tabular form for easy reference . the study shows that malaria , jaundice and female menstruation problems are the prominent diseases in this community as most of the traditional healers are prescribed medicine for these treatments . in this study , 55 medicinal plants encountered from different parts of the mishing inhabitant area used by this community in their daily ailment from various diseases . different parts of the medicinal plant species were used for curing different diseases and mostly leaves ( 36.84% ) were used followed by stem ( 14.03% ) , root ( 10.52% ) and bark ( 7.02% ) . asteraceae ( 5 species ) , apocynaceae ( 4 species ) and 3 each in euphorbiaceae , malvaceae and acanthaceae were found . some of the plants can be categorized as highly prioritized medicinal plants as they are of immense value in curing various diseases but are in the low niche . these plants are widely used under traditional healing practices but due to multiple use they are depleting from their habitat viz . eventually , these species are now on the freeway towards extinction due to over exploitation , road construction , encroachment of habitat by the immigrants of the neighbouring community . local inhabitants adapted cultivating some of the locally available herbs like acorus calamus , alstonia scholaris , centella asiatica , leucas indica , nymphea stellata , tabernemontana divaricata and some others from habitats of different climatic condition like aloe barbadensis , glycyrrhiza glabra which meet out the requirement of drugs for daily requirement . some of the prominent herbs of the area are ageratum conyzoides , clerodendrum infortunatum , leucas indica , sida acuta , solanum viarum , etc . which are commonly available in the habitat and are used for meeting out requirement of drug for treating ailments few commonly observed trees and shrubs are alstonia scholaris , costus speciosus ficus racemosa , oroxylum indicum , plumaria alba , ricinus communis , etc . most of the plant products after formulation are used orally , whereas for skin disease and bone facture medicines are not prescribed for oral consumption . it was found that in most of the cases the plant products are prepared with combination of some other plants or some other products . the plants uses in mixture all may not contain the properties to relief from particular disease but some might be reduced side effect on treatment . the traditional healing practices in mishing tribes of arunachal pradesh and assam was insufficiently documented and authors made efforts to document the healing practices used by mishing community with details of methodology and doses . to cope up with the objectives authors made interaction with villagers in different villages in dhemaji and north lakhimpur districts of assam and foot hills of east siang district of arunachal pradesh to know about genuine and reliable traditional healers in the area and came in contact with 11 traditional healers who are engaged in herbal treatment . during course of interaction 55 different herbs and their parts were found using in various treatments . these herbs were belonging to herbs , shrubs and tree either from locally available sources or adapted through cultivation in their small herbal gardens . prevalent diseases treated by the mishing healers are jaundice , malaria , menstrual disorders , joint pains skin diseases etc . prior to this certain other plants used by mishing tribes of assam were described . however , most of the plants involved in traditional practice described in this paper are different and if some of the plants are reported in these communications they are for other diseases . the description of all above mentioned plants are on the basis of ethno medicinal knowledge . plants are used by mishing community in different places on the basis of availability of those plants and the proper knowledge about efficacy of those plants against the particular disease . for safe uses of different medicinal plants , we need randomised clinical trials for some of the manual therapies and further research is need to ascertain the efficacy and safety of several other practices and medicinal plants . we have to develop a proper study about the traditional medicine and the ratio of curative measurement applied to different patients on the use of those plants . the study on such types of documentation is of great importance for north eastern institute of folk medicine in the sense that the institute will get sufficient information on traditional healers and mode administration of medicine for treating ailments on one hand and sufficient tool for proving authenticity of drugs used in healing practice through pharmacology , phytochemistry and other pharmaceutical constants . similarly services of these traditional healers are of great importance to public as they are rendering their services to public in very remote places where people are really in need of health services . these traditional healers need to be involved in all sorts of trainings to youngsters as well as refreshing their knowledge with healers of other communities . though they are acquiring and correlating their knowledge with established records and information available with other communities . involving cultivating and using aloe barbadensis and glycyrrhiza glabra is the example and availability of drugs from other climatic zones in the crude drugs markets of major markets in assam strengthen the concept of exchanging knowledge with other communities . the role of government for the existence of this system of medicine should be : 1 . to give due recognition to their contribution and involvement ; 2 . to delineate the specific scope , limit and role of traditional healers in public health promotion ; 3 . to undertake research and development activities ; 4 . to provide orientation and support to folk - healers ; 5 . to monitor and

assam and arunachal pradesh have very rich tradition of herbal medicines used in the treatment of various ailments . tribal communities practice different types of traditional healing practices . enough documentation is available on the healing practices in other tribal communities except mishing community of assam and foot hill of east siang district of arunachal pradesh hence the attempt was made for the same . a survey on folk medicinal plants and folk healers of mishing tribe was conducted in few places of lakhimpur and dhemaji district of assam and east siang district of arunachal pradesh , where this ethnic group is living since time immemorial . all information was collected based on interview and field studies with local healers within the community . the identification of medicinal plants collected with help of indigenous healers was done . such medicines have been shown to have significant healing power , either in their natural state or as the source of new products processed by them . this study is mainly concentrated with plants used to cure diseases and to enquire about different healing systems . detail note on the method of preparation of precise dose , the part / parts of plants used and method of application is given .

to date , kaposi sarcoma has not been mentioned among the adverse effects of triptolide / tripdiolide , ethyl acetate extracts or polyglycosides of the chinese herbal remedy tripterygium wilfordii hook f. she underwent treatment with corticosteroids , methotrexate and gold sodium thiosulfate , and was chronically taking ketoprofen . at the age of 59 years she started to take a powder ( 2 g / day ) from a chinese physician for treatment of rheumatoid arthritis . this powder was supplied to her regularly for 10 years . at the age of 69 years , multiple soft , violaceous to dark - red patches , plaques , nodules and blisters of varying sizes appeared on a background of severely edematous skin on her legs , and later on her arms . triptolide ( 235 g/1 g ) and tripdiolide were found in the chinese powder by the use of liquid chromatography electrospray ionization mass spectrometry . this case indicates a possible association between triptolide / tripdiolide chronic intake and development of human herpesvirus 8-associated kaposi sarcoma . triptolide / tripdiolide could contribute to development of kaposi sarcoma by reactivation of latent human herpesvirus 8 , permitted by immunosuppression induced by triptolide . our aim is to show a case of disseminated cutaneous kaposi sarcoma ( ks ) , occurring during a long - term usage of a powder containing triptolide / tripdiolide , for treatment of rheumatoid arthritis ( ra ) . triptolide and tripdiolide , compounds originally purified from tripterygium wilfordii hook f and used for centuries in traditional chinese medicine to treat ra [ 24 ] , could contribute to development of ks by reactivation of latent human herpes virus 8 ( hhv8 ) , permitted by triptolide - induced immunosuppression . to date , ks has not been mentioned among adverse effects of triptolide , ethyl acetate extracts or polyglycosides of the chinese herbal remedy tripterygium wilfordii hook f[4,69 ] , although dermal reactions including different kinds of rush with the tendency to develop erosion and scarring were described with incidence of 55.5% during 12 weeks of treatment with polyglycosides of tripterygium wilfordii hook f. a patient was diagnosed to have ra when she was 29 years old . since 55 year of age the patient was regularly controlled by a nephrologist due to infections of the urinary tract resulting in chronic tubulo - interstitial nephritis , and due to possible ra influence on kidneys . echocardiography was normal , proteinuria was not present , and glomerular filtration rate was over 60 ml / min/1.73 m body surface area . a cyst ( diameter 20 mm ) was shown in the left kidney , not confirmed in further evaluations . high sensitivity c - reactive protein ( hscrp ) was 4.2 mg / l ( normal value < 5 mg / l ) . medication with chloroquine diphosphate was added to ketoprofen ( table 1 ) , but did not influence ankle edema and joint pain . serum perinuclear antineutrophil cytoplasmic antibodies were negative . since 69 years of age , leg edema was worse and she stopped working in her profession ( a pharmacist ) . doppler ultrasonography of leg vessels again did not reveal abnormalities , proteinuria was not present , and renal function was normal . six months later , multiple soft , violaceous to dark - red patches , plaques , nodules and blisters of varying sizes started to appear on a background of edematous skin on her legs . ambulatory laboratory data of the blood revealed hemoglobin level of 5.87 mmol / l ( normal range 7.449.92 g / l for women ) , total protein of 55.2 g / l ( normal range 3550 g / l ) and creatinine of 144 mol / l . proteinuria was not present . although there was no infection of the urinary tract and renal function was deteriorated no more then before appearance of skin changes , she was admitted to the nephrologic ward to determine her health problem . at the admission , severe skin lesions on the edematous background were present on the patient s legs ( figure 1 ) and incipient skin changes on her arms . rheumatoid factor ( rf ) was 2,310 iu / ml ( normal range < 14 iu / ml ) , but decreased to 566 iu after introduction of treatment with corticosteroids . functional class iii / iv of ra was classified according to steinbrocker et al . . g / l ) and lymphocytes constituted 22% of all leukocytes ( normal range 2044% ) . lymphocyte subset percentage was abnormal : cd3 84.0% ( normal range 6776% ) , cd3+dr+ 43.0% ( normal range 815% ) , cd4 32% ( normal range 3846% ) , cd8 52% ( normal range 3140% ) , cd19 2% ( normal range 1116% ) , nk 6% ( normal range 1019% ) . the histological examination of 2 biopsy specimens of the leg lesions showed a mixed proliferation of irregular slit - like vascular channels associated with pleomorphic spindle cells , a low - grade lymphocytic inflammatory infiltrate and extravasated erythrocytes consistent with a diagnosis of ks ( figure 2 ) . immunophenotypic analysis showed cell markers f viii+ , ck ae1/ae3 , cd34 + and cd31 + ( figure 3 ) , demonstrating the endothelial nature of the proliferating tumor cells . expression of the proliferative antigen ki-67 was shown in 20% ( specimen 1 ) and in 30% ( specimen 2 ) of cell nuclei ; p53 immunoreactivity was found in less than 5% of cell nuclei . hh8 latent nuclear antigen protein was detected in biopsy specimens by immunohistochemistry ( figure 4 ) . knowing the diagnosis of hh8 ks , a patient s spouse confessed that at the age of 59 years she started to take a chinese powder of unknown composition and continued it until the current hospitalization . she evaluated this powder as a good pain reliever and was convinced that it would help her to avoid severe ra signs and symptoms . according to the patient s spouse , she used to take 1 dose of powder a day , and sporadically took 2 doses per day . for brief intervals she would stop taking the powder . he calculated that his wife had taken approximately 300 doses per year . during hospitalization in the nephrologic ward , administration of the powder the patient was transferred to the oncological ward and treatments with paclitaxel ( sindaxel , sindan , romania ) were initiated according to earlier promising reports . sixteen weeks after withdrawal of the chinese powder and after 12 weeks of paclitaxel administration ( 6 doses of paclitaxel were given ) the patient s condition improved and the skin lesions diminished significantly , presenting postinflammatory hyperpigmentation and crust ( figure 5 ) . at the 10 month of treatment with paclitaxel , she died at the age of 71.3 years due to sepsis complicating perforation of the sigmoid diverticulum . we obtained a sample of the powder from the patient s spouse and performed an analysis . qualitative examination was done using liquid chromatography electrospray ionization mass spectrometry ( lc / esi - ms ) system . the presence of triptolide m / z=359 ( m - h ) and tripdiolide m / z=375 ( m - h ) , 2 major active components of trypterigium wilfordii hook f , was confirmed . the content of triptolide in 1 g of the analyzed sample , determined by hplc quantitative analysis , was 235 g . we obtained a sample of the powder from the patient s spouse and performed an analysis . qualitative examination was done using liquid chromatography electrospray ionization mass spectrometry ( lc / esi - ms ) system . the presence of triptolide m / z=359 ( m - h ) and tripdiolide m / z=375 ( m - h ) , 2 major active components of trypterigium wilfordii hook f , was confirmed . the content of triptolide in 1 g of the analyzed sample , determined by hplc quantitative analysis , was 235 g . a question arises how triptolide / tripdiolide , taken in the high daily dose for years , could influence the patient s health status . triptolide is a small molecule known to act as an anti - inflammatory and anti - cancer compound . aa amyloidosis , present in 4.44% of early ra patients , was shown to be inhibited in mice by experimental treatment with triptolide . thus , progression of ra seemed to be slower than usually observed , independently of triptolide / tripdiolide administration . however , only while receiving triptolide / tripdiolide was she almost free from joint pain . the most important point to determine is the possible association of ks with triptolide / tripdiolide medication . ks is a multifocal angioproliferative neoplasm of the skin ( mainly affecting the skin of the limbs ) and mucosa , frequently seen in immunosuppressed patients , also due to ra . regardless of their source or clinical subtype , have been found to be infected with hhv8 . hhv8 latent transcripts , such as latency - associated nuclear antigen , viral cyclin , viral flip and viral - encoded micrornas , drive cell proliferation and prevent apoptosis , whereas hhv8 lytic proteins such as viral g protein - coupled receptor , k1 and virally encoded cytokines ( viral interleukin-6 and viral chemokines ) contribute to the angioproliferative and inflammatory ks lesions through a mechanism called paracrine neoplasia . in patients infected with hiv , expression of the proliferative antigen ki-67 , shown in our patient in 2030% of cell nuclei , does not correlate with skin and organ lesions or early- and late - stage ks lesions , but is valuable in ks diagnosis . decreasing cd4 cells , triptolide could contribute to development of ks by reactivation of latent hhv8 , permitted by triptolide - induced immunosuppression . on the other hand , triptolide is an anti - cancer compound and ks is not mentioned among the adverse effects of triptolide , ethyl acetate extracts or polyglycosides of the chinese herbal remedy tripterygium wilfordii hook f[4,69 ] . moreover , ks lesions are attributed to the release of angiogenic molecules , most notably vascular endothelial growth factor ( vegf ) and angiopoietin - like 4 . it was recently found that the antitumor action of triptolide is partly via inhibition of tumor angiogenesis by blocking 2 endothelial receptor - mediated signalling pathways , and triptolide can be a promising antiangiogenic agent . thus , triptolide as an immunosuppressant could contribute to development of ks , but also could potentially be helpful by vegf inhibition although we can not definitively answer the question of whether triptolide/ tripdiolide contributed to development of ks in our patient , we also can not exclude such a possibility . the case of our patient indicates an association between triptolide / tripdiolide chronic intake and development of hhv8 ks . triptolide/ tripdiolide could contribute to development of ks by reactivation of latent hhv8 , permitted by immunosuppression induced by triptolide . we believe that this case will help other physicians to be vigilant for a possible association between ks and medication with chinese remedies containing triptolide .

summarybackgroundto date , kaposi sarcoma has not been mentioned among the adverse effects of triptolide / tripdiolide , ethyl acetate extracts or polyglycosides of the chinese herbal remedy tripterygium wilfordii hook f.case reporta patient was diagnosed with rheumatoid arthritis at the age of 29 years . she underwent treatment with corticosteroids , methotrexate and gold sodium thiosulfate , and was chronically taking ketoprofen . at the age of 59 years she started to take a powder ( 2 g / day ) from a chinese physician for treatment of rheumatoid arthritis . this powder was supplied to her regularly for 10 years . at the age of 69 years , multiple soft , violaceous to dark - red patches , plaques , nodules and blisters of varying sizes appeared on a background of severely edematous skin on her legs , and later on her arms . biopsy specimens of the leg lesions were diagnostic for human herpesvirus 8-associated kaposi sarcoma . triptolide ( 235 g/1 g ) and tripdiolide were found in the chinese powder by the use of liquid chromatography electrospray ionization mass spectrometry . administration of the powder was stopped and medication with paclitaxel was introduced . general condition of the patient improved and skin lesions diminished significantly.conclusionsthis case indicates a possible association between triptolide / tripdiolide chronic intake and development of human herpesvirus 8-associated kaposi sarcoma . triptolide / tripdiolide could contribute to development of kaposi sarcoma by reactivation of latent human herpesvirus 8 , permitted by immunosuppression induced by triptolide .

lung cancer is the most deadly cancer disease with an estimated 27% of all cancer deaths , . a large part of patients with lung cancer undergoes radiotherapy . tracking tumor motion poses a significant challenge for precise dose delivery in lung cancer radiotherapy , due to respiratory motion of up to 3.5 cm for primary lung tumors . if the patient s breathing motion is not correctly predicted , tumor miss might occur , or sensitive normal tissue might be undesirably exposed resulting in unwanted treatment toxicity . advanced technologies of radiotherapy , intensity modulated radiotherapy and image guided radiotherapy , may offer the potential of precise radiation dose delivery for moving objects . however , they still need an additional function to predict the precise position of the tumor against subtle variations in real - time , . radiation dose is typically delivered in 3 to 5 fractions over 5 to 12 days for early stage lung cancer using stereotactic radiotherapy or 30 to 33 fractions over 6 to 7 weeks for more advanced disease with each fraction lasting between 10 and 45 minutes . the patient s breathing motions during these fractions are broadly divided into two categories : 1 ) intra - fractional and 2 ) inter - fractional variations . intra - fraction motion indicates changes where the patient is undergoing the radiation therapy , which turns up on a time scale of seconds to minutes , , . each individual shows different breathing patterns . on the other hand , inter - fractional variation is typically shown in a time scale of minutes to hours or a day - to - day level , , . inter - fractional motion is distinguishable from intra - fractional movement because the inter - fractional variation covers even baseline shifts and weight gain or loss , . however , most studies of breathing prediction so far have focused on respiratory motions within the single treatment session , i.e. , intra - fractional variation . recently , several studies have pointed out the difference between intra - fractional and inter - fractional movements and have discussed the importance of inter - fractional variation in radiation treatment or related imaging techniques . table 1 summarizes the comparison between intra- and inter - fractional movements.table 1comparison between intra- and inter - fractional variations.variation typeintra - fractioninter - fractiontime of occurrenceduring a single fraction , between different fractions , , , time scaleseconds to minutes hours or day - to - day level , , motion coverageinternal organ motion , breathing , swallowing , position changes of patients , patient weight gain / loss , internal organ motion , breathing , swallowing , prediction methods for intra - fractional variation have been addressed in many studies , , , , , as illustrated in table 2 . however , inter - fractional variation has not been actively studied as much as intra - fractional motion yet despite its necessity in radiotherapy , , , . intra- and inter - fractional variation of breathing motion can raise many challenges for respiratory prediction thirdly , the novel method should be able to handle any unpredictable breathing variation.table 2previous prediction methods for intra- and inter - fractional variations.methoddescriptiondrawbackvariationmargin-based compensated locational changes of the tumor in a primitive way , adding extra margins high possibility of over / under - dose since the margin is determined by motion range of the tumor without knowing its variationintra-/inter - fractionlinear predictive model ( lp ) , estimated the future state based on functions comprised of linear combination of input data , proper coefficients , and constants inferior prediction accuracy for breathing signals with a long latency poor performance improvement by its exclusive usage assumption that the nonlinear respiratory movement is linearintra-/inter - fractionadaptive filter ( af ) , , , , combined modified lps and additional filters that adjust coefficients of lps no guarantee of its superb performance in most cases because it highly depends on adaptation intervalsintra - fractionkalman filter ( kf ) , , , efficient recurrent filter which has been utilized in various forms : kalman constant velocity , kalman constant acceleration , an interacting multiple model , and hybrid implementation based on the extended kf ( hekf) only adaptable to linear or nearly linear estimation high computation complexity of kf - based models combined with other prediction toolsintra - fractionartificial neural network ( nn)-based , , , , , , , , , , showed outstanding accuracy for irregular patterns and abrupt changes, extended approaches : back propagation nn , feed - forward nn , recursive nn , wavelet nn , customized prediction with multiple patient interactions using nn ( cnn ) , and hekf long calculation time for prediction parameters and resultsintra - fractioncubic model estimated respiratory variance by using a third - order polynomial equation same drawback of low accuracy as lp because the cubic model is also one of the mathematic approaches like lpinter - fractionstochastic fluence map optimization ( fmo ) model extended deterministic fmo model , which assumes that a patient is static solved observed problems by employing convex penalty functions and numerous scenarios to characterize inter - fractional uncertainties unpredictable method for other disregarded scenariosinter - fraction in this paper , we propose a new prediction approach for intra- and inter - fraction variations , called intra- and inter - fractional variation prediction using fuzzy deep learning ( iifdl ) . the proposed iifdl clusters the respiratory movements based on breathing similarities and estimates patients breathing motion using the proposed fuzzy deep learning ( fdl ) . to reduce the computation time , first , this is the first analytical study for modeling multiple patients breathing data based on both intra- and inter - fractional variations . secondly , the proposed method has a clinical impact for enhanced adjustment of margin size because it achieves high prediction accuracy for respiratory motion , even for inter - fractional variation . thirdly , this study shows the clinical possibility of real - time prediction by largely shortening computing time . furthermore , the training process can be shortened , by training breathing signals with similar patterns together in the proposed iifdl . the proposed fdl is a combination of fuzzy logic and a nn with more than two hidden layers , i.e. deep learning network . due to the nn architecture of fdl , it has a self - learning feature , setting network parameters by training itself according to input and desired output values . fdl also has a fuzzy logic feature of reasoning capability for uncertainty . in fdl , a few fuzzy parameters , i.e. prediction parameters of fdl , determine weight values between nodes in the network , and weight values are considered as the prediction parameters in other methods . consequently , the number of prediction parameters is much less than that of other mutated nn methods and parametric nonlinear models . this reduces the computation time substantially and makes suitable for to real - time and nonlinear estimation . 1 exemplifies a simple architecture of fdl , including layer 1 through layer 4 in the hidden layers . the functions of four hidden layers can be summarized as follows : layer 1 provides membership functions which are determined by a membership function ( mf ) parameter set \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m=$ \end{document } { \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{i,1}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{i,2}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{i,3}$ \end{document } } , layer 2 applies a t - norm operation , layer 3 computes linear regression functions by normalized weights and a linear regression ( lr ) parameter set \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r=$ \end{document } { \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r_{i,1}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r_{i,2}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r_{i,3}$ \end{document } } , and layer 4 finally yields an output of fdl \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f$ \end{document } by summing outcomes according to all fuzzy if - then rules . figure 1.fdl architecture including layer 1 through layer 4 in the hidden layers : layer 1 provides membership functions , layer 2 applies a t - norm operation , layer 3 computes linear regression functions , and layer 4 finally yields an output of fdl according to all fuzzy if - then rules . fdl architecture including layer 1 through layer 4 in the hidden layers : layer 1 provides membership functions , layer 2 applies a t - norm operation , layer 3 computes linear regression functions , and layer 4 finally yields an output of fdl according to all fuzzy if - then rules . for the training algorithm of fdl , we use the hybrid learning algorithm which is a combination of a gradient descent back - propagation algorithm and a least squares estimate algorithm . the mf parameter and the lr parameter are identified by this training algorithm . in fig . 1 , the number of fuzzy if - then rules is equivalent to that of nodes in layer 2 and 3 , which are given as follows : rule1:if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{1}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{1}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{2}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{1}$ \end{document } , then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{1 } = r_{\mathrm { 1,1}}i_{1 } + r_{\mathrm { 1,2}}i_{2}+r_{\mathrm { 1,3}}$ \end{document},rule2:if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{1}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{2}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{2}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{2}$ \end{document } , then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{2 } = r_{\mathrm { 2,1}}i_{1 } + r_{\mathrm { 2,2}}i_{2}+r_{\mathrm { 2,3}}$ \end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{1}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{2}$ \end{document } are inputs of fdl , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{i}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{i}$ \end{document } are fuzzy sets , which are linguistic labels . if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{1}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{1}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{2}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{1}$ \end{document } , then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{1 } = r_{\mathrm { 1,1}}i_{1 } + r_{\mathrm { 1,2}}i_{2}+r_{\mathrm { 1,3}}$ \end{document } , if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{1}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{2}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{2}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{2}$ \end{document } , then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{2 } = r_{\mathrm { 2,1}}i_{1 } + r_{\mathrm { 2,2}}i_{2}+r_{\mathrm { 2,3}}$ \end{document } the output \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ o_{\mathrm { 1},i}$ \end{document } in layer 1 is described as follows:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } o_{1,i } \!=\!\begin{cases } { \mu _ { a_{i } } \left ( { { i_{1 } } } \right ) = 1 / { \left [ { { 1+\left | { { { \left ( { { i - m_{i,3 } } } \right ) } / { m_{i,1 } } } } \right |^{2m_{i,2 } } } } \right ] } , } \\ \quad \qquad \qquad \qquad \qquad \qquad { 1\le i\le 2 } \\ { \mu _ { b_{i-2 } } \left ( { { i_{2 } } } \right ) = 1 / { \left [ { { 1+\left | { { { \left ( { { i - m_{i,3 } } } \right ) } / { m_{i,1 } } } } \right |^{2m_{i,2 } } } } \right ] } , } \\ \quad \qquad \qquad \qquad \qquad \qquad { 3\le i\le 4 } \\ \end{cases}\quad \end{equation*}\end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mu _ { ai}(i_{1})$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mu _ { bi\mathrm { -2}}(i_{2})$ \end{document } are mfs of inputs for each fuzzy set of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{i}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{i}$ \end{document}. also , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{i,1}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{i,2}$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{i,3}$ \end{document } are the mf parameters chosen by the training algorithm . the functions of layer 2 multiply all the values coming from layer 1 , as follows:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } o_{2,i } = { w}_{i } = \mu _ { a_{i } } \left ( { { i_{1 } } } \right ) \cdot \mu _ { b_{i } } \left ( { { i_{2 } } } \right ) \!,\quad 1\le i\le 2 \end{equation*}\end{document } where multiplication acts as the t - norm operator in the fuzzy system , and the output indicates the firing strength for the rule . in layer 3 , the linear regression function is applied to a ratio of the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i$ \end{document}th rule s firing strength to the summation of all rules firing strengths , and its result can be calculated by \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } o_{3,i } = \frac { w_{i}}{\sum \limits _ { j } { w_{j}}}\left ( { { r_{i,1 } i_{1 } + r_{i,2 } i_{2 } + r_{i,3 } } } \right ) \!,\quad 1\le i\le 2 \end{equation*}\end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r_{i,1}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r_{i,2}$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r_{i,3}$ \end{document } are the lr parameters , derived from the training algorithm . the output of layer 4 is aggregate of ( 3 ) as follows:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } o_{4,1 } = f=\sum \limits _ { i } { \frac { w_{i}}{\sum \limits _ { j } { w_{j}}}f_{i } } = \frac { \sum \limits _ { i } { w_{i } f_{i}}}{\sum \limits _ { i } { w_{i}}}. \end{equation*}\end{document } the output of fdl is computed by its weights and regression functions as ( 4 ) . the proposed iifdl is designed to reduce the computational complexity of prediction for multipatients breathing motion , which occurs during the single treatment session and between treatment sessions . to achieve this , the proposed iifdl clusters multiple patients based on their breathing feature similarities and trains their respiratory signals for each group . , a summary of its whole process is given as follows : 1)patient clustering : patients breathing feature metrics are computed from the respiratory signals , and then patients are clustered according to their breathing feature similarities.2)prediction using fdl : for each patient group , the training procedure of the hybrid learning algorithm is conducted , and then breathing signals with intra - fractional variation or inter - fractional variation are predicted using fdl . patient clustering : patients breathing feature metrics are computed from the respiratory signals , and then patients are clustered according to their breathing feature similarities . prediction using fdl : for each patient group , the training procedure of the hybrid learning algorithm is conducted , and then breathing signals with intra - fractional variation or inter - fractional variation are predicted using fdl . we describe the specific clustering procedure in subsection \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a$ \end{document } first , and we explain fdl for intra- and inter - fractional variation prediction in subsection \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b$ \end{document}. from patients respiratory signals , we extract breathing features as clustering criteria : autocorrelation maximum ( amv ) , acceleration variance ( acc ) , velocity variance ( vel ) , breathing frequency ( brf ) , maximum fourier transform power ( ftp ) , principal component analysis coefficient ( pca ) , standard deviation of time series data ( std ) , and maximum likelihood estimates ( mle ) . table 3 summarizes features extracted from the signals and their formula . in table 3 , amv is an indicator of the breathing stability , and acc , vel , and std are directly relevant to respiratory signals , , . in addition , we use the typical vector - oriented features pca and mleas well as other breathing characteristics such as brf and ftp , , . there are two improvements in the proposed patient clustering : the removal of unnecessary breathing feature metrics , and the use of clustering criteria with vector forms.table 3features extracted from the signals.pformulaused form in iifdlused form in amv\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \max \left ( { { \frac { 1}{2t}\int _ { -t}^{t } { x\left ( { t } \right ) x\left ( { { t-\tau } } \right ) d\tau } } } \right ) $ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ t$ \end{document } : period of observations)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{amv } $ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 1\times 3 $ \end{document } vector)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \vert p_{amv } \vert $ \end{document } ( scalar)acc\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ var\left ( { { \delta x \mathord { \left / { { \vphantom { \delta x { \delta t^{2 } } } } } \right . } { \delta t^{2 } } } } \right ) $ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ x$ \end{document } : observed respiratory data)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{acc } $ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 1\times 3 $ \end{document } vector)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \vert p_{acc } \vert $ \end{document } ( scalar)vel\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ var\left ( { { \delta x \mathord { \left / { { \vphantom { \delta x { \delta t } } } } \right . } { \delta t } } } \right ) $ \end{document}\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{vel}$ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 1\times 3 $ \end{document } vector)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \vert p_{vel } \vert $ \end{document } ( scalar)brf\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \frac { 1}{n\left ( { i } \right ) } \sum \limits _ { i } { \left ( { { \frac { 1}{bc_{i } } } } \right ) } $ \end{document } ( n(\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i$ \end{document } ) : number of breathing cycles , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ bc_i:~i$ \end{document}th breathing cycle range)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{brf}$ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 1\times 1 $ \end{document } vector)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{brf}$ \end{document}ftp\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \max \left ( { { \sum \limits _ { n=1}^{n } { x\left ( { n } \right ) e^{-\frac { j2\pi } { n}\left ( { { k-1 } } \right ) \left ( { { n-1 } } \right ) } } } } \right ) $ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n$ \end{document } : number of breathing signal samples , 1 k n)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{ftp}$ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 1\times 3 $ \end{document } vector)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \vert p_{ftp } \vert $ \end{document } ( scalar)pcaprincomp\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \left ( { { { \mathbf{z } } } } \right ) $ \end{document } ( princomp(\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \cdot ) $ \end{document } : pca function , z : data matrix ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n\times m$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m=3 $ \end{document}))\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{pca}$ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 3\times 3 $ \end{document } vector)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \vert p_{pca } \vert $ \end{document } ( scalar)std\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \sqrt { \frac { 1}{n}\sum \limits _ { i=1}^{n } { \left ( { { x_{i } -{x } ' } } \right ) ^{2 } } } $ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ x_{i}$ \end{document } : ith breathing signal sample , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ x$ \end{document} : average of breathing signal samples)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{std}$ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 1\times 3 $ \end{document } vector)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \vert p_{std } \vert $ \end{document } ( scalar)mle\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \arg \max \limits _ { \theta \in \theta } \hat { l}\left ( { { \theta \left | { { x_{1 } , ... , x_{n } } } \right . } } \right ) , \hat { l}\left ( { { \theta \left | { x } \right . } } \right ) = \frac { 1}{n}\sum \limits _ { i=1}^{n } { \ln f\left ( { { x_{i } \left | { \theta } \right . } } \right ) } $ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f(\cdot \vert \theta ) $ \end{document } : normal distribution)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{mle}$ \end{document } ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 1\times 3 $ \end{document } vector)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \vert p_{mle } \vert $ \end{document } ( scalar ) firstly , previous studies in , , , , , and chose two additional feature metrics , i.e. autocorrelation delay time ( adt ) and multiple linear regression coefficients ( mlr ) , in addition to those eight in table 3 for respiratory pattern analysis . however , adt depends on the length of breathing signal samples , rather than the individual respiration characteristics . the use of mlr assumes that breathing signals are linear , fixed values , and homoscedasticity . secondly , the existing study clustered patients based on the magnitude values of their respiratory feature vectors . however , the proposed method uses breathing feature vectors for patient clustering , not their magnitude values . for example , the proposed iifdl analyzes the similarities among patients pca by comparing each component of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 3\times 3 $ \end{document } vector \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{pca}$ \end{document } , but the previous method in calculates the similarities based on the scalar value of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \vert p_{pca}\vert $ \end{document}. accordingly , the previous method clusters patients as the same group when the breathing signals have the approximate magnitude of the breathing feature vector , even though they do not show the similar breathing features . thus , the proposed iifdl compares each component of breathing feature vectors , so that it can provide better clustering of breathing signals than existing methods . as shown in fig . 2 , respiratory signals are randomly selected from multiple patients and used for the breathing feature extraction . let us define \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \textbf{p}=$ \end{document}{\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{amv}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{acc}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{vel}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{brf}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{ftp}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{pca}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{std}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p_{mle}$ \end{document } } as a feature selection metrics set , x as an arbitrary feature combination vector based on p , and y as an optimal feature combination vector . the total number of possible xs in the given data is 247 ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \sigma _ { i\,\mathrm { 8}}\text{c}_{i}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } xs , y is selected using a criterion function \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j(\cdot ) $ \end{document } , which is determined by within - class scatter \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ s_{w}$ \end{document } and between - class scatter \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ s_{b}$ \end{document } values . the within - class scatter \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ s_{w}$ \end{document } is defined as follows : \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } s_{w } \!=\!{\begin{array}{*{20}c } { \sum \limits _ { i=1}^{c } { \sum \limits _ { \textrm { x}\in c_{i } } \!{\left ( { { \textrm { x}-m_{i } } } \right ) \left ( { { \textrm { x}-m_{i } } } \right ) ^{t } } } , } & \quad { m_{i } \!=\!\dfrac { 1}{n_{i}}\sum \limits _ { \textrm { x}\in c_{i } } \textrm { x } } \\ \end{array}}\qquad \end{equation*}\end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c$ \end{document } is the number of classes less than the total number of patients \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{i}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{i}$ \end{document } indicate the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i$ \end{document}th class and its mean , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ n_{i}$ \end{document } is the number of patients of class \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i$ \end{document}. the between - class scatter \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ s_{b}$ \end{document } is defined as:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } s_{b } = \!{\begin{array}{*{20}c } { \sum \limits _ { i=1}^{c } { n_{i } \left ( { { m_{i } -m } } \right ) \left ( { { m_{i } -m } } \right ) ^{t } } , } & \quad { m=\dfrac { 1}{n}\sum \limits _ { \textrm { x } } \textrm { x } } \\ \end{array}}\qquad \end{equation*}\end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m$ \end{document } is the mean of all feature combination vectors . with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ s_{w}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ s_{b}$ \end{document } , the criterion function \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j(\cdot ) $ \end{document } is given as follows:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } j\left ( { { \textrm { x},\;c } } \right ) = \frac { s_{b}}{s_{w } } \end{equation*}\end{document } this implies that the larger \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j(\cdot ) $ \end{document } allows , with low in - class and high inter - class dispersion , the more obvious distinction between classes . after criterion function values are calculated for all xs and all possible numbers of clusters \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c$ \end{document } , y can be decided with the following condition:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } \upsilon = \left \ { { { \textrm { x}\left | { { \max \;j\left ( { { \textrm { x},\;c } } \right ) \;and\;c < n } } \right . } } \right \ } \end{equation*}\end{document } after choosing y by ( 8) , the final number of clusters \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{final}$ \end{document } is set , and patients are clustered as \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{final}$ \end{document } classes depending on selected principal features of y. after multiple patients are clustered , we can train patients data for each group . for intra - fractional variation , fdl trains parameters based on input data in a single session and fdl predicts breathing motion by training the fdl network for multiple datasets of previous sessions . here , datasets of inter - fractional variation already include the patient s intra - fractional variation , as described in section i. training datasets consist of the initial data and the target data . we train the datasets with the hybrid learning algorithm . during the training procedure , two prediction parameter sets of fdl , i.e. , mf parameter set \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m$ \end{document } and lr parameter set r , are obtained and applied to the proposed fdl . for estimating intra- and inter - fractional variation from the cyberknife data , fdl has a similar structure to fig . 1 , the input datasets consist of three - dimensional ( 3d ) coordinates for each channel . thus , we designed the proposed prediction method to have three fdls for each \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ x$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ y$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ z$ \end{document } coordinate , so that we can obtain all 3d coordinates of the estimated breathing signal . the total number of nodes in layer 2 and 3 is 27 , based on the number of fuzzy if - then rules , which are given as follows : rule1:if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{1}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{1}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{2}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{1 } $ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{3}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{1}$ \end{document } , then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{1 } = r_{\mathrm { 1,1}}i_{1 } + r_{\mathrm { 1,2}}i_{2 } + r_{\mathrm { 1,3}}i_{3}+r_{\mathrm { 1,4}}$ \end{document},rule27:if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{1}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{3}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{2}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{3 } $ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{3}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{3}$ \end{document } , then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{27 } = r_{\mathrm { 27,1}}i_{1 } + r_{\mathrm { 27,2}}i_{2 } + r_{\mathrm { 27,3}}i_{3}+r_{\mathrm { 27,4}}$ \end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{1}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{2}$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{3}$ \end{document } correspond to inputs from three channels of cyberknife machine , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{i}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{i}$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{i}$ \end{document } are fuzzy sets . if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{1}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{1}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{2}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{1 } $ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{3}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{1}$ \end{document } , then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{1 } = r_{\mathrm { 1,1}}i_{1 } + r_{\mathrm { 1,2}}i_{2 } + r_{\mathrm { 1,3}}i_{3}+r_{\mathrm { 1,4}}$ \end{document } , if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{1}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a_{3}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{2}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b_{3 } $ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ i_{3}$ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{3}$ \end{document } , then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ f_{27 } = r_{\mathrm { 27,1}}i_{1 } + r_{\mathrm { 27,2}}i_{2 } + r_{\mathrm { 27,3}}i_{3}+r_{\mathrm { 27,4}}$ \end{document } the output \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ o_{\mathrm { 1},i}$ \end{document } in layer 1 is computed as follows:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } o_{1,i } = \begin{cases } { \mu _ { a_{i } } \left ( { { i_{1 } } } \right ) = 1 / { \left [ { { 1+\left | { { { \left ( { { i - m_{i,3 } } } \right ) } / { m_{i,1 } } } } \right |^{2m_{i,2 } } } } \right ] } , } \\ \qquad \qquad \qquad \qquad \qquad \qquad \qquad { 1\le i\le 3 } \\ { \mu _ { b_{i-3 } } \left ( { { i_{2 } } } \right ) = 1 / { \left [ { { 1+\left | { { { \left ( { { i - m_{i,3 } } } \right ) } / { m_{i,1 } } } } \right |^{2m_{i,2 } } } } \right ] } , } \\ { \mu _ { c_{i-6 } } \left ( { { i_{3 } } } \right ) = 1 / { \left [ { { 1+\left | { { { \left ( { { i - m_{i,3 } } } \right ) } / { m_{i,1 } } } } \right |^{2m_{i,2 } } } } \right ] } , } \\ \qquad \qquad \qquad \qquad \qquad \qquad \qquad { 7\le i\le 9 } \\ \end{cases}\quad \end{equation*}\end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mu _ { ai}(\cdot ) $ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mu _ { bi\mathrm { -3}}(\cdot ) $ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mu _ { ci\mathrm { -6}}(\cdot ) $ \end{document } are three kinds of the membership functions , which are calculated using the mf parameter set \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m=$ \end{document}{\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{i,1}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{i,2}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ m_{i,3}$ \end{document}}. in layer 2 and 3 , outputs \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ o_{\mathrm { 2},i}$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ o_{\mathrm { 3},i}$ \end{document } are defined as the following ( 10 ) and ( 11 ) , respectively:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{align } o_{2,i}=&{w}_{i } = \mu _ { a_{k } } \left ( { { i_{1 } } } \right ) \mu _ { b_{l } } \left ( { { i_{2 } } } \right ) \mu _ { c_{m } } \left ( { { i_{3 } } } \right ) , ~~ 1\le i\le 27 \\ o_{3,i}=&\frac { w_{i}}{\sum \limits _ { j } { w_{j}}}\left ( { { r_{i,1 } i_{1 } \!+\!r_{i,2 } i_{2 } \!+\!r_{i,3 } i_{3 } + r_{i,4 } } } \right ) , ~~ 1\le i\le 27\qquad \notag \\ { } \end{align } \end{document } where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r_{i,1}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r_{i,2}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r_{i,3}$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r_{i,4}$ \end{document } are the lr parameter set \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ r$ \end{document}. the output of layer 4 is as follows:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation * } o_{4,1 } = f=\sum \limits _ { i } { \frac { w_{i}}{\sum \limits _ { j } { w_{j}}}f_{i } } = \frac { \sum \limits _ { i } { w_{i } f_{i}}}{\sum \limits _ { i } { w_{i } } } \end{equation*}\end{document } the equation ( 12 ) produces a single coordinate of the predicted respiratory signal , i.e. , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ x$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ y$ \end{document } , or \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ z$ \end{document } estimation . as mentioned above , the proposed iifdl uses three fdls for \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ x$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ y$ \end{document } , and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ z$ \end{document } coordinates , so that we can derive estimated 3d coordinates of breathing signals from those fdls . we describe the experimental data for intra- and inter - fraction motion , in subsection \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ a$ \end{document}. the experimental result of patient clustering based on breathing features are presented in subsection \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ b$ \end{document } , and we evaluate the prediction performance of the proposed iifdl in subsection \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c$ \end{document}. breathing data of 130 patients were collected in georgetown university medical center using the cyberknife synchrony ( accuray inc . the collected data contained no personally identifiable information , and the research study was approved by the georgetown university irb . during data acquisition , three sensors were attached around a target position on the patient s body . individual patient s database contains datasets recorded through three channels by led sensors and cameras . each database contains a record time , 3d coordinates , and rotation data of three channels . the intra - fractional variation dataset had 130 databases , and the inter - fractional variation dataset consisted of 32 databases with at least 1-hour time difference in - between . each database contains a record time , 3d coordinates , and rotation data of three channels . the intra - fractional variation dataset had 130 databases , and the inter - fractional variation dataset consisted of 32 databases with at least 1-hour time difference in - between . sampling frequencies for patients variation data were 5.20 , 8.67 , and 26hz , corresponding to the measurement intervals , 192.30 , 115.38 , and 38.46ms . each database contains calibrated datasets of a record time , 3d coordinates , and rotational data of three channels . during the training procedure , we randomly extracted 1000 samples for each patient . the obtained samples regarding the measurement intervals were about 0.63min for 38.46ms , 1.92min for 115.38ms , and 3.2min for 192.30ms . table 4 shows experimental data of intra- and inter - fractional variation . in the intra - fractional variation dataset , all of 130 databases were used , and training and test data were randomly selected within 1-hour time range . in the inter - fractional variation dataset , however , we selected 32 databases . training and test data were selected with at least 1-hour time difference in - between them for the inter - fractional variation dataset . this time scale is not on the day - to - day level as the standard definition of the inter - fractional variation , but it meets the inter - fractional time scale condition of . actual inter - fractional motion data might be larger than data we chose because changes occurred in fractions on different days such as weight gain or loss were not contained in experimental data.table 4experimental data.data typeintra - fractional variationinter - fractional variationpatient # 13032measurement intervals ( ms)38.46 , 115.38 , and 192.30inputsestimated tumor locationoutputsnext tumor position in the current fractiontraining dataprevious tumor location data in the current fractiontumor location data in the previous fractionstest datacurrent tumor location data in the current fractioncurrent tumor location data in the current fraction we present the patient clustering results with the calculated criterion function values \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document}. fig . 4(a ) shows criterion function values \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } regarding the number of clusters , where we represented the proposed iifdl as a red line with a \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \vartriangle $ \end{document} maker , and the alternate cnn as a blue dotted line with a \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \blacktriangledown $ \end{document} marker . 4(b ) and 4(c ) show criterion function values \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } of iifdl and cnn with regard to the possible breathing feature combination . figure 4.criterion function values \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } of the proposed iifdl and cnn : ( a ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } of iifdl and cnn according to the number of clusters , ( b ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } of iifdl according to the breathing feature combination , and ( c ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } of cnn according to the breathing feature combination . in iifdl , the number of cluster \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{final}$ \end{document } was 11 and the optimal breathing feature combination y was chosen as brf and mle by ( 8) . in cnn , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{final}$ \end{document } was 12 and its y was a combination of acc , vel , and pca . criterion function values \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } of the proposed iifdl and cnn : ( a ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } of iifdl and cnn according to the number of clusters , ( b ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } of iifdl according to the breathing feature combination , and ( c ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } of cnn according to the breathing feature combination . in iifdl , the number of cluster \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{final}$ \end{document } was 11 and the optimal breathing feature combination y was chosen as brf and mle by ( 8) . in cnn , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{final}$ \end{document } was 12 and its y was a combination of acc , vel , and pca . the proposed iifdl selected the number of cluster \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{final}$ \end{document } as 11 with the maximum \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } of 5.825 as shown in fig . the optimal breathing feature combination y was chosen with brfand mle by ( 8) as shown in fig . the alternate cnn selected the number of cluster \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ c_{final}$ \end{document } as 12 , and its y was chosen with acc , vel , and pca as shown in fig . the reason of their different clustering results is that iifdl uses respiratory feature vectors , whereas cnn uses the magnitude values of respiratory feature vectors . considered all possible 247 combinations from 8 features ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \sigma _ { i}~_{8}\text{c}_{i}$ \end{document } , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 1 < i \le 8 $ \end{document } ) , the combination chosen by cnn had a local maximum value of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document } , as shown in fig . thus , the combination of acc , vel , and pca can not be ythat has the maximum \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ j$ \end{document}. therefore , cyberknife patient databases were grouped into 11 classes using the proposed iifdl , and the clustering results for intra- and inter - fractional variation data are presented in table 5.table 5patient database clustering.class number1234567891011total # of data - basesintra - fractional variation183522726192118130inter - fractional variation1110156n / a2n / a1532 in table 5 , 130 databases of the intra - fractional variation and 32 databases of the inter - fractional variation were grouped into 11 and 9 classes , respectively . each class showed the similar breathing features regardless of the variation type . in the intra - fractional variation , some classes ( e.g. class 1 , 4 , 7 , 9 , and 10 ) have only one or two patients . they are most likely considered as the irregular respiratory signals , due to their less feature similarities with other patients breathing signals . class 2 and 8 for the inter - fractional variation also have highly few patients , but we do not consider these classes as the irregular breathing signals . it is difficult to judge the scarcity of class 2 and 8 based on the few number of intra - fractional variation databases , also these two classes were already considered as regular breathing groups for the intra - fractional variation . in this subsection , we compare the prediction performance of the proposed iifdl with existing methods . especially , previous methods for the inter - fractional movement are mathematical models depending on predefined scenarios of patients variation , without the self - learning feature . the prediction performance of these methods is susceptible to how many potential scenarios were considered . in other words , there is a practical limitation to get decent performance results in the experiment with those mathematical models . accordingly , we chose the existing methods for intra - fractional prediction , cnn and hekf , as the comparison targets , and we applied the selected methods to the case of the inter - fractional variation . the predictors used in cnn and hekf are nn and a combination of nn and kf , respectively , as mentioned in section i. thus , these methods have the self - learning feature . furthermore , cnn is the prediction approach designed for multiple patients motion like the proposed iifdl . we evaluate the prediction performance of iifdl using by the following three criteria : root - mean - square error ( rmse ) , overshoot , and prediction time . 5 shows prediction results of two databases by iifdl , cnn , and hekf , with 115.38ms interval as a median of [ 38.46 , 192.30ms ] . 5 ( a ) and 5 ( b ) present the prediction results of the intra - and inter - fractional variation datasets . here , a horizontal axis is the time index extracted from cyberknife data . a black line is a measurement , a red line with a \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \vartriangle $ \end{document} marker illustrates predicted values by the proposed iifdl , a blue dotted line with a \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \blacktriangledown $ \end{document} marker is the estimated results of cnn , and an orange dotted line with a \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \blacktriangleright $ \end{document} marker represents the estimation results of hekf . also , two green dotted lines are upper and lower boundaries of target data , respectively . figure 5.prediction results for ( a ) intra- and ( b ) inter - fractional variation by iifdl , cnn , and hekf : ( a ) db47 and ( b ) db121 with 115.38ms interval . the estimated values of the proposed iifdl were closer to the target values , i.e. measurements , than those of cnn and hekf . prediction results for ( a ) intra- and ( b ) inter - fractional variation by iifdl , cnn , and hekf : ( a ) db47 and ( b ) db121 with 115.38ms interval . the estimated values of the proposed iifdl were closer to the target values , i.e. measurements , than those of cnn and hekf . 5 , the estimated points of the proposed method iifdl were closer to the target values than those of cnn and hekf . in fig . 5 , many points of cnn were distributed near or out of the boundaries , and most of the points of hekf were out of the range between upper and lower boundaries . however , the predicted values of iifdl were within the boundaries in most cases . the rmse comparison of the intra - fractional variation of each patients class showed that the proposed iifdl , cnn , and hekf had the similar rmse values overall , and iifdl outperformed cnn and hekf particularly in class 4 considered as irregular breathing signals . for the inter - fractional variation of each patients class , the experimental result also validated that the proposed iifdl is less vulnerable to the breathing irregularity . in table 6 , we summarized the average rmse and standard deviation values of iifdl , cnn , and hekf for each different measurement interval . based on those results , we also derived improvement rate of iifdl , determined by the following formula : ( rmse average of cnn / hekf - rmse average of iifdl)/rmse average of cnn / hekf \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \ast ~100 $ \end{document}%.table 6rmse comparison.variationintra-fractional variationinter - fractional variationmeasurement interval ( ms)38.46115.38192.30average38.46115.38192.30averageiifdl ( mm)0.190.210.290.410.510.750.330.460.120.280.280.730.732.060.381.02imp . rate ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ = $ \end{document } ( average of cnn / hekf - average of iifdl ) / average of cnn / hekf * 100% . . rate ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ = $ \end{document } ( average of cnn / hekf - average of iifdl ) / average of cnn / hekf * 100% . for given the measurement intervals of the intra - fractional variation in table 6 , the rmse results presented that all the average rmse and standard deviation values of iifdl were lower than those of cnn and hekf , except the interval of 192.30ms . although iifdl was worse than hekf in comparison on the average rmse result for the time interval of 192.30ms , the average rmse of iifdl was 0.03 mm larger than that of hekf , which is a relatively small difference . with decreased time interval from 192.30 to 38.46ms , the proposed iifdl had the more improvement rate from 11.81 to 90.54% for cnn and 6.86 to 54.36% for hekf . in the total results , the proposed method had the standard deviation of 0.46 mm , whereas cnn and hekf had fluctuating rmse values with the standard deviation of 6.16 mm and 0.92 mm . in comparison to the existing methods , the proposed iifdl improved 38.27% and 21.69% of the average rmse values , for each cnn and hekf , in the experiment of the intra - fractional variation . as show in table 6 , the experimental results for the inter - fractional variation represent that all rmse values of iifdl were lower than those of cnn and hekf . the proposed iifdl improved rmse more when the time interval was smaller , which is the same as the experimental results of the intra - factional variation . the proposed iifdl with the overall standard deviation of 1.02 mm showed higher error stability than cnn and hekf with the overall standard deviation of 3.86 mm and 3.53 mm . moreover , iifdl enhanced 59.02% and 60.44% of rmse in comparison to cnn and hekf as shown in table 6 . therefore , we can expect that the proposed method contributes to the radiotherapy by providing higher prediction accuracy and error stability . the prediction overshoot rate is also one of the criteria that enable to assess prediction accuracy of rmse , and it can be defined as a ratio of the estimated points are out of the boundary ranges to the total ones , here the range was determined by the 95% prediction interval of target data . 6 presents the overshoot results by iifdl , cnn , and hekf for the intra - fractional variation . the measurement interval was 115.38ms , which is a middle interval of [ 38.46 , 192.30ms ] . a horizontal axis is the patient database number , and a red , blue , and orange bar indicate the overshoot value of iifdl , cnn , and hekf , respectively . the measurement interval is 115.38ms , which is a middle interval [ 38.46 , 192.30ms ] . the proposed iifdl had less variation of the error values only up to 9.1% , but cnn and hekf showed occasionally huge overshoot results almost 100% . the measurement interval is 115.38ms , which is a middle interval [ 38.46 , 192.30ms ] . the proposed iifdl had less variation of the error values only up to 9.1% , but cnn and hekf showed occasionally huge overshoot results almost 100% . 6 , the proposed iifdl had less variation of the error values only up to 9.1% , but cnn and hekf showed occasionally huge overshoot results almost 100% . in the same vein with the experiment of rmse , the proposed method improved overshoot performance with higher stability in databases we utilized . in fig . 7 , we show the overshoot results of iifdl , cnn , and hekf for the inter - fractional variation to demonstrate the stability of the proposed iifdl . the measurement interval is 115.38ms , which is a middle interval [ 38.46 , 192.30ms ] . however , cnn and hekf had large overshoot results up to 100% and wider variance of the overshoot rates than the proposed iifdl . the measurement interval is 115.38ms , which is a middle interval [ 38.46 , 192.30ms ] . however , cnn and hekf had large overshoot results up to 100% and wider variance of the overshoot rates than the proposed iifdl . there was no overshoot value in class 10 . as the experimental results of intra - fractional variation , cnn and hekf had wider variance of the overshoot rates than the proposed iifdl . 7 , the existing methods , cnn and hekf had large overshoot results up to 100% . however , the maximum overshoot value of the proposed iifdl was 8.4% . in table 7 , we summarized average overshoot rates and their standard deviation values of iifdl , cnn , and hekf for each measurement interval.table 7overshoot comparison.variationintra-fractional variation ( % ) inter - fractional variation ( % ) measurement interval ( ms)38.46115.38192.30average38.46115.38192.30averageiifdl4.652.443.902.123.692.294.082.284.202.533.722.333.552.273.822.38imp . rate over cnn 57.9763.7479.0066.9085.6783.6171.8180.37imp . rate ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ = $ \end{document } ( average of cnn / hekf - average of iifdl ) / average of cnn / hekf * 100% . improvement rate ( imp . rate ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ = $ \end{document } ( average of cnn / hekf - average of iifdl ) / average of cnn / hekf * 100% . as shown in table 7 , all average overshoot rates of the proposed iifdl are considerably lower than those of cnn and hekf , in both experimental results for the intra- and inter - fractional variation . furthermore , standard deviation values of the overshoot rate had remarkable differences in between iifdl and two other methods . for the intra - fractional variation , the total standard deviation values of iifdl , cnn , and hekf were 2.28% , 26.78% , and 28.26% , respectively . overall results for the intra - fractional variation showed that the proposed method improves the overshoot percentage by 66.90% for cnn and 74.96% for hekf . for the inter - fractional variation , also , iifdl markedly reduced not only the average overshoot percentage but also the standard deviation . the overall improvement rates of iifdl was 80.37% for cnn and 86.17% for hekf in the experiment for the inter - fractional variation . to evaluate and compare effects on the computational complexity by the proposed iifdl , we measured average cpu time of each prediction method using a pc with intel core i7 3.07 ghz and 16.0 gb ram . table 8 compares the computing time of iifdl , cnn , and hekf for each measurement interval used in the experiment , where time difference represents the difference of the computing time between the previous methods and iifdl.table 8computing time comparison.variationintra-fractional variation ( ms)inter - fractional variation ( ms)measurement interval ( ms)38.46115.38192.30average38.46115.38192.30averageiifdl1.324.911.615.061.705.071.545.011.324.911.615.061.705.071.545.01time diff . from cnn 252.60250.99254.74252.78253.16249.94251.32251.47time diff from hekf 251.76251.47252.82252.02250.72253.36249.85251.31atime difference ( time diff . ) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ = $ \end{document } computing time average of cnn / hekf - computing time average of iifdl . \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ = $ \end{document } computing time average of cnn / hekf - computing time average of iifdl . in the experimental results for the intra - fractional variation of table 8 , iifdl had the average computing time of 1.54ms and the standard deviation of 5.01ms , for all databases and intervals . the average computing time and the standard deviation were 254.32ms and 11.68ms for cnn and 253.56ms and 10.74ms for hekf . thus , the total average of the time difference reduced by iifdl was 252.78ms for cnn and 252.02ms for hekf . for the inter - fractional variation , the average computing time of the proposed iifdl was 1.54ms and its standard deviation was 5.01ms throughput all databases and measurement intervals . the average computing time and its standards deviation were 253.01ms and 9.17ms for cnn , and 252.85ms and 6.17ms for hekf . in the experiment for the inter - fractional variation , the total average of the time difference reduced by iifdl was 251.47ms for cnn and 251.31ms for hekf . as we mentioned in section ii , the proposed fdl , requires less prediction parameters than cnn and hekf . accordingly , the proposed iifdl could reduce the computing time immensely as shown in the experimental results in table 8 . moreover , iifdl and cnn train the multiple breathing signals simultaneously based on the respiratory feature similarities . for instance , there were 35 intra - fractional variation databases of patients in class 2 , and hekf needed to train the respiratory signals 35 times more than iifdl and cnn , to acquire the prediction results . thus , the proposed iifdl is expected to improve the prediction speed maintaining the prediction accuracy during the treatment session in the clinical perspective . table 9 compares the two kinds of variation regarding rmse , overshoot , and computing time.table 9experimental result comparison of intra- and inter - fractional variations.variationintra-fractional variationinter - fractional variationrmseiifdl average ( mm)0.330.38cnn average ( mm)0.970.98hekf average ( mm)0.421.01improvement rate ( cnn ( % ) /hekf ( % ) ) 38.27/21.6959.02/60.44overshootiifdl average ( % ) 4.083.82cnn average ( % ) 13.1421.54hekf average ( % ) 16.6229.89improvement rate ( cnn ( % ) /hekf ( % ) ) 66.90/74.9680.37/86.17computing time ( ms)iifdl average1.541.54cnn average254.32253.01hekf average253.56252.85time difference ( cnn / hekf)252.78/252.02251.47/251.31 for rmse and overshoot of the previous methods cnn and hekf , results of the inter - fraction variation were worse than those of the intra - fractional variation as shown in table 9 . this is because the respiration variability for the inter - fraction is larger than that for the intra - fraction . on the other hand , iifdl showed similar rmse and overshoot results for both intra- and inter - fractional variation . due to the reasoning capability of iifdl for uncertainty , the proposed iifdl achieved the similar level of the prediction results with the intra - fractional variation in the experiment for the inter - fractional variation . the proposed iifdl reduced it less than 2ms , which were over 250ms in the previous methods , cnn and hekf . additionally , this implies that iifdl can be used in real - time applications as the proposed method can estimate the next respiratory signal before it comes . specifically , the next breathing signal will come with the interval of 38.46ms to 192.30ms , and iifdl can calculate the estimated value within 2ms on average that is before termination of the time interval . we provide more comparison with other previous methods , , , , , in table 10 , to verify the accuracy performance of iifdl . the previous methods in table 10 were referred to in section i. as shown in table 10 , the proposed iifdl had the lowest error results among 9 methods . however , comparability is limited as experiments were not conducted in the identical environment . table 10error comparison with previous methods.methodiifdlcnn hekf af , siso af / miso af kf , nn , lp cubic intra - fractional variation ( mm)0.330.920.58<2.01.58 / 1.71<2.5<2.51.2n / ainter - fractional variation ( mm)0.380.981.01n / an / an / an / a4.64.7 in a curative setting , high radiation doses need to be delivered with high precision , and safety margines need to be added to the target to ensure sufficient dose coverage . however , safety margins and resulting side effects of radiotherapy compromise the ability to deliver tumoricidal treatment doses . as a result , local tumor reccurences occur in 30% of conventionally fractionated treatments and less than 10% of stereotactic applications . respiratory tumor motion range and consistency vary with patient , within one fraction and between repeated fractions with change in tumor motion range > 3 mm in 20% of fractions . in addition to addressing intra - fractional variation , this paper also investigated prediction for inter - fractional variation that might be larger than intra - fractional variation and therefore more challenging to address . compared to currently applied population - averaged margins between 3 and 10 mm in motion - inclusive treatment , margins can be significantly reduced according to the residual prediction error for the individual patient using motion - tracking and iifdl . the proposed iifdl can contribute to treatment planning to improve delivery accuracy , by adjusting the treatment field position according to the predicted intra- and inter - fractional variation . based on the experimental results above , we have validated that the proposed iifdl can estimate the next breathing signal before the next incoming signal arrives . therefore , iifdl is expected to achieve real time prediction in a stream computing environment if the prediction system tolerates measurement delay of respiratory signal . future studies may seek to identify correlations between tumor location in the lung , as well as patient - related parameters and comorbidities and predicted intra- and inter - fractional variation to even further improve prediction accuracy . in addition , further study can be conducted on prediction with other machine learning methods to improve prediction accuracy of tumor motion , which have not been introduced yet for estimating intra- and inter - fractional variation , such as support vector machines , . based on this algorithm , we also proposed the specific estimation method for intra- and inter - fractional variation of multiple patients , called iifdl . our approach has three main contributions to prediction of patients motion during a single treatment session and between different fractional sessions . first , the proposed method is the first study on the modeling of both intra- and inter - fractional variation for multiple patients respiratory data , collected from the cyberknife facility . second , the proposed iifdl might enhance tumor tracking techniques due to its high prediction accuracy . third , the proposed fdl , the predictor used in iifdl , has a much shorter computation time than other methods , so that the proposed iifdl shows the optimistic perspective on real - time prediction . the experimental results validated that the rmse value of the proposed iifdl was improved by 38.27% of cnn and 21.69% of hekf for the intra - fractional variation . for the inter - fractional variation , iifdr improved the average rmse values by 59.02% for cnn and 60.44% for hekf . the iifdl also improved the prediction overshoot by 66.90% for cnn and 74.96% for hekf for the intra - fractional variation . in a case of the inter - fractional variation , for the average computing time , the previous methods spent over 250ms for computation , but the proposed iifdl consumed less than 2ms . the outcomes of rmse and prediction overshoot demonstrate that the proposed method has more of a superb prediction performance than existing approaches . particularly , computation time results showed that iifdl can be considered as a suitable tool for real - time estimation .

tumor movements should be accurately predicted to improve delivery accuracy and reduce unnecessary radiation exposure to healthy tissue during radiotherapy . the tumor movements pertaining to respiration are divided into intra - fractional variation occurring in a single treatment session and inter - fractional variation arising between different sessions . most studies of patients respiration movements deal with intra - fractional variation . previous studies on inter - fractional variation are hardly mathematized and can not predict movements well due to inconstant variation . moreover , the computation time of the prediction should be reduced . to overcome these limitations , we propose a new predictor for intra- and inter - fractional data variation , called intra- and inter - fraction fuzzy deep learning ( iifdl ) , where fdl , equipped with breathing clustering , predicts the movement accurately and decreases the computation time . through the experimental results , we validated that the iifdl improved root - mean - square error ( rmse ) by 29.98% and prediction overshoot by 70.93% , compared with existing methods . the results also showed that the iifdl enhanced the average rmse and overshoot by 59.73% and 83.27% , respectively . in addition , the average computation time of iifdl was 1.54 ms for both intra- and inter - fractional variation , which was much smaller than the existing methods . therefore , the proposed iifdl might achieve real - time estimation as well as better tracking techniques in radiotherapy .

dengue infection causes various clinical symptoms ranging from mild fever to severe hemorrhagic fever and dengue shock syndrome [ 13 ] . the virus uses host cell ribosomes to translate its genomic rna to full - length precursor polyprotein . subsequently , the host cell furin and dengue ns2b - ns3 serine protease ( ns2b - ns3pro ) cleave viral polyprotein at various regions to produce structural and nonstructural viral proteins [ 46 ] . the ns3 protein is one of the viral non - structural proteins that possess enzymatic activities . the n - terminal of this protein contains 180 amino acid residues that represent ns3 protease [ 7 , 8 ] , while c - terminal region contains amino acid residues that represent rna helicase and rna - stimulated ntpase [ 9 , 10 ] . the activity of ns2b - ns3pro depends on the interaction with its cofactor ns2b to form a ns2b - ns3pro complex . it has been found that the disruption of ns2b - ns3pro functions inhibits viral replication . therefore , ns2b - ns3pro is considered as a potential target for the design of antiviral drugs . at present , a legitimate vaccine or treatment to prevent or to cure this disease is unavailable . these facts emphasize the need for a better understanding of the mechanism of viral infection and propagation in the host cell to combat this disease . recently , computational studies indicated that cationic cyclic peptides have potential inhibition towards dengue ns2b - ns3pro [ 15 , 16 ] . protegrin-1 ( pg-1 , rggrlcycrrrfcvcvgr ) is an eighteen amino acids cationic cyclic peptide with high content of basic residues and two disulphide bonds . the peptide is originally isolated from porcine white blood cells and considered as an antibiotic agent against a broad range of microorganisms [ 17 , 18 ] . the formation of two disulphide bonds between cysteine residues endows pg-1 with a stabile -hairpin secondary structure that is crucial for antimicrobial activity [ 19 , 20 ] . therefore , removal of these two disulphide bonds is found to noticeably reduce the antimicrobial activity of pg-1 . the peptide is able to penetrate and disrupt the cell membrane by homodimerization [ 22 , 23 ] . the mechanism of this activity depends on the secondary structure and the cationic nature of pg-1 molecules which are essential to generate pores in the cell membrane of microorganism [ 2427 ] . in this study , our objective was to examine the efficacy of pg-1 as cationic cyclic peptide to inhibit dengue serine protease and subsequently reduce viral replication in host cells . the linear peptides were prepared by automated peptide synthesis using symphony parallel synthesizer ( protein technologies , tucson , az , usa ) by standard solid - phase peptide synthesis . the lyophilized peptide was dissolved in 20% dmso solution in a round bottom flask and stirred on a magnetic stirrer to produce a peptide concentration of 1.1 mm . the formation of the first disulphide bond was completed within 24 hrs . the solution was then lyophilized to proceed for second disulfide formation . the lyophilized peptide with the first disulphide bond was dissolved in acetic acid water ( 4 : 1 ) so that the peptide concentration was 1.2 mm and iodine ( 10 equivalents ) was added in one portion . the reactions were stirred at 25c for 60 min and then quenched by diluting with water and extracting with ccl4 to remove excess iodine . purification of crude cyclised peptide was accomplished by rp - hplc ( agilent 1200 series ) . the identity of the purified peptide with 98% purity was confirmed by lc - ms ( shimadzu lc / ms 2020 , single quad ) . to produce single chain protease nsb2- ( g4-t - g4)-ns3 , the ns2b fragments were amplified individually by pcr using the primer pairs ns2b - f ( 5-atactgaggatcc gccgatttggaactg-3 ) and ns2blinker - r ( acctactaggtacctcctccacccagtgtctgttcttc ) . the ns2b - ns3 was amplified by ns3linker - f ( 5-atctataggtaccggcggtggaggtgctggagtattgtgg-3 ) and ns3-r ( 5-agcataagcttaagcttcaattttct-3 ) . the linker sequence was added to ns2blinker - r and ns3linker - f primers which included the site for kpni restriction enzyme ( all restriction sites are underlined ) . the pcr product of ns2b fragment was digested with bamhi and kpni while ns2b fragment was digested with kpni and hindiii . purified fragments were cloned into pqe30 plasmid downstream of 6his tag . the escherichia coli x - the recombinant e. coli was inoculated in luria - bertani liquid medium ( 1% tryptone , 1% nacl , 0.5% yeast extract , w / v , ph 7.0 ) supplemented with 100 mg / l ampicillin and cultured overnight at 37c . in brief , 10 ml of overnight grown culture was added to 1000 ml of medium and incubated with shaking at 37c until the optical density at 600 nm reached 0.5 . subsequently , isopropylthio--d - galactoside ( iptg ) was then added to a final concentration of 0.5 mm and the bacteria were cultured for an additional 5 hrs at 37c in a shaking incubator to induce protein expression . finally , bacterial cells were harvested by centrifugation at 4000 rpm for 15 min at 4c . the recombinant ns3pro was produced as soluble proteins and , therefore , the purification had been performed by his gravitrap flow precharged ni sepharose 6 fast column ( amersham biosciences , usa ) according to the manufacturer 's instructions . in brief , the column was normalized with phosphate buffer ( 20 mm sodium phosphate buffer and 500 mm nacl , ph 7.4 ) . the sample was loaded into the column and the column was washed with binding buffer ( phosphate buffer containing 20 mm imidazole , ph 7.4 ) . the recombinant protein was eluted with elution buffer ( phosphate buffer containing 200 mm imidazole , ph 7.4 ) . the bioassay used in this study was modified from the method published by kiat and coworkers . these reaction mixtures consisted of 100 m fluorogenic peptide substrate ( boc - gly - arg - arg - mca ) , 2 m ns2b - ns3pro complex , with or without pg-1 of varying concentrations , buffered at ph 8.5 with 200 mm tris - hcl . the pg-1 was initially prepared in tris - hcl buffer and assayed at five different concentrations . subsequently , the substrate was added and the mixture was further incubated at the same temperature for 30 minutes . triplicates were performed for all measurements and the readings were taken using tecan infinite m200 pro fluorescence spectrophotometer . substrate cleavage was optimized at the emission at 440 nm upon excitation at 350 nm . the readings were then used for calculating km values of peptide substrate and ic50 values of peptide inhibitors using nonlinear regression models in graphpad prism 5.01 software . the mk2 cell lines were seeded at 1 10 cells per well in triplicate at optimal conditions ( 37c , 5% co2 in humidified incubator ) in 96 well plates . pg-1 was diluted to serial concentrations 2.5 , 12.5 , 25 , 50 , 100 and 200 m with dmem media supplemented with 2% fbs . the cell culture was analyzed at 24 , 48 and 72 hours using nonradioactive cell proliferation assay ( promega , usa ) according to the manufacture protocol . the mk2 cell lines were grown in a 24-well tissue culture plate ( 1 10 cells / well ) , incubated 24 hrs under optimal conditions ( 37c and 5% co2 ) . denv-2 was added to the wells ( moi of 2 ) followed by incubation for 1 hr with gentle shaking every 10 min for optimal virus to cell contact . the virus supernatant was removed , and the cells were washed twice with fresh serum free dmem media to remove residual virus . new complete dmem media containing 2.5 , 7.5 and 12.5 m of pg-1 were added and the cultures were incubated for 24 , 48 and 72 hrs . afterwards , cellular supernatants were collected and stored at 80c for viral quantification by real - time pcr . for quantification of denv-2 copies , the standard curve was generated by 10-fold serial dilution of known copies of denv-2 rna . viral rna was extracted from culture supernatant using qiamp viral rna minikit ( qiagen , germany ) according to the manufacturer 's instructions . a fragment located at the 5utr region of the virus genome one - step rt - pcr using sybr green master kit ( qiagen , germany ) was used to conduct absolute quantification using abi7300 machine from applied biosystems ( foster city , ca ) . the pcr programme included 1 cycle of 50c for 2 min , 1 cycle of 95c for 10 min , and 40 cycles of 95c for 15 sec and 60c for 1 min . results were analyzed using sequence detection software version 1.3 ( applied biosystems , foster city , ca , usa ) . all the assays were done in triplicates and the statistical analyses were performed using graphpad prism version 5.01 ( graphpad software , san diego , ca ) . the recombinant ns2b - ns3pro was produced as a soluble protein in e. coli and purified by nickel column ( figure 1(a ) ) . further purification was applied using gel affinity chromatography to achieve more than 95% of enzyme purity ( figure 1(b ) ) . the activity of purified enzyme had been assessed at 37c by catalyzing the fluorogenic peptide substrate t - butyloxycarbonylglycyl - l - arginyl - l - arginyl - l-4-methylcoumaryl-7-amide ( boc - gly - arg - arg - mca ) . the pg-1 peptide was added to the protease reaction at different concentrations and the inhibition profile was plotted as shown in figure 2 . it was observed that the inhibition potential increased with pg-1 concentration and the highest inhibition ( 95.7% ) with low concentrations of pg-1 was at 40 m . the kinetic assay study indicated that pg-1 competitively inhibited ns2b - ns3pro activity ( alpha value 3.14 ) with ki value 5.85 m ( table 1 ) . intriguingly , the maximum enzyme velocity decreased threefold when pg-1 concentration was 20 m ( figure 3 ) . previous studies have shown that various types of natural and chemical compounds were able to inhibit dengue ns2b - ns3pro activity . for example , some of plant natural compounds , such as chalcones , have shown good inhibition potential against the dengue protease ( ki value 2125 m ) . the synthesized peptidic -keto - amide compound inhibited dengue ns2b - ns3pro with ki value of 47 m . most recent study indicated that the retrotripeptides with an arylcyanoacrylamide group as n - terminal cap exhibited high inhibition potential against dengue protease with ki value of 4.6 m . most recent study showed that the inhibition potential of some chemical compounds towards ns2b - ns3pro measured by ic50 was 15.4 , 20.4 , and 27.0 m . cytotoxicity and compound stability can be considered as major limitations of the practical application of protease inhibitors . in this study , to test pg-1 toxicity , mk2 cell lines were incubated with increasing concentrations of pg-1 for 24 , 48 , and 72 hrs . the pg-1 peptide showed toxic effect against mk2 cell lines at concentrations greater than 12.5 m ( figure 4 ) . other studies indicated that pg-1 was also toxic to 293a cell lines ( human embryonic kidney cells ) at 50 g / ml ( 25 m ) and more than 50% of human red blood cells lyses were observed at 80 g / ml ( 40 m ) . therefore , three concentrations at nontoxic range were used to test pg-1 stability and ability to reduce dengue viral replication in mk2 cell lines . the results showed that the viral copy number significantly ( p < 0.001 ) reduced with increasing concentrations of pg-1 ( figure 5(a ) ) . furthermore , the highest inhibition percentage was observed when the pg-1 concentration was 12.5 m at 24 , 48 and 72 hrs ( figure 5(b ) ) . however , the low concentrations exhibited less inhibition percentage at 48 and 72 hrs as compared with 24 hrs , indicating that the pg-1 stability declined with longer incubation in culture media ( figures 5(a ) and 5(b ) ) . similarly , it has been showed that at low doses ( 4 g / ml ) , pg-1 has significant in vitro antimicrobial activity with low in vivo toxicity ( up to 8 mg / kg i.v . this may be accounted by its short half - life in vivo as its level in mice plasma that was injected with 4 mg / ml i.v although pg-1 showed significant inhibition profile towards dengue virus in this study and to human immunodeficiency virus 1 ( hiv1 ) in another study , the peptide instability should be considered as a major concern . the results in this study may give a clear picture that would then help in engineering new sequence of peptides to retain the antiviral activity against dengue while increasing its stability and eliminating the toxic characteristics of pg-1 .

dengue diseases have an economic as well as social burden worldwide . in this study , the antiviral activity of protegrin-1 ( pg-1 , rggrlcycrrrfcvcvgr ) peptide towards dengue ns2b - ns3pro and viral replication in rhesus monkey kidney ( mk2 ) cells was investigated . the peptide pg-1 was synthesized by solid - phase peptide synthesis , and disulphide bonds formation followed by peptide purification was confirmed by lc - ms and rphplc . dengue ns2b - ns3pro was produced as a single - chain recombinant protein in e. coli . the ns2b - ns3pro assay was carried out by measuring the florescence emission of catalyzed substrate . real - time pcr was used to evaluate the inhibition potential of pg-1 towards dengue serotype-2 ( denv-2 ) replication in mk2 cells . the results showed that pg-1 inhibited dengue ns2b - ns3pro at ic50 of 11.7 m . the graded concentrations of pg-1 at nontoxic range were able to reduce viral replication significantly ( p < 0.001 ) at 24 , 48 , and 72 hrs after viral infection . however , the percentage of inhibition was significantly ( p < 0.01 ) higher at 24 hrs compared to 48 and 72 hrs . these data show promising therapeutic potential of pg-1 against dengue infection , hence it warrants further analysis and improvement of the peptide features as a prospective starting point for consideration in designing attractive dengue virus inhibitors .

their marbling has been increased over many decades to meet domestic consumer preferences . in both countries , highly marbled beef is greatly prized for traditional meat cooking methods such as sukiyaki for japanese and gogigui for korean . because of these demands , the use of heifers and steers instead of bulls , intensive feeding system , and genetic ability of wagyu and hanwoo cattle have resulted in greater fat deposition in these breeds compared to european breeds . as intramuscular fat ( imf ) improves beef quality at least in juiciness and flavor ( hornsterin and wasserman , 1987 ; wheeler et al . , 1994 ) it is assessed in abattoirs by meat graders in various countries , including usa , australia , japan , and korea . like other kinds of foods , meat has three functions : 1 ) it provides nutrition ; 2 ) it provides deliciousness ; and 3 ) it prevents disease . although beef has these three functions , the main food in both japan and korea is boiled rice while beef is a side dish . therefore , these two countries have developed the quality of beef rather than its quantity . this is quite different from foreign countries where meat is consumed as a main dish . in japanese and korean cuisine , soft and delicious beef with imf and a good red color in the past , fat was not given a good image in its role towards human health , although fat is an important energy resource for human . recently , fat has been reported to have fewer adverse effects on health than carbohydrates , especially simple carbohydrates . in fact , meat has played a crucial role in human evolution of a healthy and well balanced diet ( pereira and vicente , 2013 ) . furthermore , meat plays a pivotal role in nutritious diets . high quality marbled beef not only has excellent eating quality , but also contains a lot of beneficial fatty acids ( troy et al . , 2016 ) . in this regard , the current paper reviews the characteristics and health benefit of highly marbled beef from wagyu and hanwoo cattle . it has well known that wagyu cattle have high potential of accumulating imf and producing highly marbled beef . hanwoo cattle are also known for their high imf for marbled beef similar to wagyu beef . highly marbled wagyu loin contains more than 40% of imf , sometimes more than 60% ( horii et al . , 2009 ) , while quality grade 1 hanwoo , the highest quality grade , has approximately 28% of imf in longissimus thoracis muscle ( hwang and joo , 2016 ) . wagyu cattle include four types of japanese cattle : the black , brown , short horn , and polled breeds . numerous studies have investigated the meat quality , quantity , and muscle physiology of crossbreed wagyu ( japanese black cattle ) in foreign countries ( cafe et al . , 2006 ; cafe et al . , 2009 ; greenwood et al . , 2006 ; greenwood et al . , 2009 ; may et al . , 1993 ) . they are identified by different coat color : brown ( major hanwoo ) , black face ( heukwoo ) , black ( jeju heukwoo ) , and tiger color ( chickso ) ( jo et al . , 2012 ) . in this review , wagyu and hanwoo are used to describe the japanese black breed and the brown coat color hanwoo , respectively . all four types of wagyu cattle have played important roles locally and in the history of mixed farming . they also played important roles in the synergies between cattle and crops , especially rice . farmers gradually began to replace the role of cattle as draft animals and started to use industrial fertilizers approximately 50 years ago . in recent years , japanese wagyu cattle have been raised more specifically for beef production . the famous brand name wagyu not only includes the japanese black cattle produced in japan , but also includes animals or even cross - bred japanese black cattle produced in foreign countries such as australia and the united states . similarly , the utilization of hanwoo cattle as an edible meat had been minimal for long time . full - scale production of hanwoo as meat - type cattle has started since the 1970s . because hanwoo cattle have maintained stable traits through pure breeding , the current blood lineage is very valuable . it is mainly spread in the korean peninsula ( kim and lee , 2000 ) . recently , hanwoo beef has been reported to have highly marbled imf similar to wagyu beef . especially , hanwoo beef has relatively thin muscle fiber and minimal content of connective tissues ( kim et al . , 1994 ) . it has less subcutaneous fat depth with greater ossification scores and marbling scores than those of australian angus ( cho et al . , 2005 ) . in 2013 , a total of 2.64 million heads of cattle were fed for beef production in japan . approximately 1.71 million heads were japanese black cattle ( maff , 2013 ) , and approximately 873,400 were holstein cattle . , the number of farmers producing beef was 613,000 , but 86.5% of these farmers fed less than 50 heads of cattle . the mean body weight and carcass weight of beef at slaughter ( 26 - 30 mon of age ) were 725 kg and 470 kg , respectively . high performance marbled beef production has caused japanese black cattle to comprise the greatest share of japan s wagyu cattle population ( albrecht et al . , 2011 ; recently , the imf percentage of beef from japanese black cattle has an average value of greater than 30% ( albrecht et al . , 2011 ; horii et al . , the total number of slaughter cattle was 1,007,000 , including 883,593 hanwoo cattle , 66,485 holstein cows , and 56,923 holstein heifers and bulls ( kape , 2015 ) . the number of cattle farming households was 99,858 , including 89,403 hanwoo farmers ( kape , 2015 ) . during the last decade , the number of households raising hanwoo cattle has drastically decreased from 186,000 households in 2006 to 89,403 households in 2015 ( kape , 2016 ) . the average live and carcass weights of hanwoo cattle at slaughter ( 26 - 30 mon of age ) were 719 kg and 430 kg , respectively ( kape , 2015 ) . wagyu carcasses are evaluated by accredited graders from the japan meat grading association ( jmga ) in accordance with beef carcass grading standards . first established in 1988 , the present grading system assigns both yield grade ( a , b , and c ) and meat quality grade ( 1 , 2 , 3 , 4 , and 5 ) ( jmga , 2014 ) . in korea , all cattle carcasses should be evaluated by korean carcass grading system . established in 1992 , the korean carcass grading system presently has three levels of yield grade ( yg ) for meat amount ( a , b , and c ) and five levels of meat quality grade ( qg ) ( 1 , 1 , 1 , 2 , and 3 ) ( kape , 2016 ) . for beef quality grading in japan , all cattle carcasses are graded at the 6 to 7 rib section at least one hour after ribbing . the following four items are independently evaluated : beef marbling ; meat color and brightness ; meat firmness and texture ; and fat color , luster , and quality . meat quality grade of the carcass is then assigned according to the lowest grade of these four items . korean beef quality grading is also estimated based on several factors , including marbling score , meat color , fat color , firmness and texture of lean meat , and maturity of the exposed loin muscle at the 13 rib interface . this means that marbling score is the most dominating determinant in korea because korean consumers have an extraordinary preference for high marbled meats . in 1988 , wagyu marbling levels were assigned by the beef marbling standard ( bms ) using a plastic model made from silicone resin . this standard was calculated based on the circumference and area percentage of marbling particles in the rib eye section ( longissimus thoracis ) . in october 2008 , a new marbling standard using carcass photographs replaced the 1988 standard . in march 2014 , an even newer marbling standard 1 ) . graders now determine the bms number ( 1 to 12 ) by comparing the actual carcass marbling to the standard photograph of marbling . during this process , any larger inclusions of fat at the periphery of the rib eye are not considered as marbling according to the japanese grading system . the bms of korean carcass grading system has been changed by the addition of marbling number . in 1992 , when the carcass grading system was established for the first time in korea , the bms had only 5 numbers ( 1 to 5 ) with 3 qg ( 1 , 2 , and 3 ) . however , in 1997 , new qg 1 was added with new bms no . 6 and no . furthermore , in 2004 , another new qg 1 was added with new bms no . 8 and no . hanwoo beef with qg 1 or 1 is considered as a premium class of beef in korea . of hanwoo cattle slaughtered in 2015 , 10.0% were qg 1 , 26.4% were qg 1 , and 31.4% were qg 1 ( kape , 2016 ) . the plentiful marbling of wagyu and hanwoo beef has attracted attention . in both japan and korea , the value of cattle carcasses is determined by a qg which considers marbling as a decisive determinant . since the liberalization of beef importation , marbling has been greatly emphasized to differentiate domestic beef from imported beef ( hirooka , 2014 ; hwang et al . , 2010 ) . the high content of imf can improve the texture and juiciness of hanwoo beef and thereby its acceptability ( jung et al . , 2016 ) . korean consumers prefer qg 1 or 1 beef because of its high imf content ( kim et al . , 1999 ) . 2015 ) have demonstrated that an increase in crude fat content ( range 23.8 - 48.6% ) can increase the tenderness , juiciness , and fattiness . however , they also reported that an increase in crude fat content can reduce the crude protein content and slightly reduce the content of umami components such as nucleic acid and glutamic acid . it is well known that imf content varies depending on feeding time , finishing diet , and breed type . to produce high qg beef , great attention has been paid to more accumulation of imf in wagyu and hanwoo muscle . one of good strategy to increase imf content in beef muscle is to extend slaughtering age . although the marbling score is increased and reached a plateau at about 24 mon of age ( choi et al . , 2002 ) , the slaughtering age of hanwoo has been extended to increase the bms score ( jo et al . , 2012 ) . in korea , the marketing age of hanwoo has been extended to an average of 31 mon with weight of 719 kg to fatten the cattle ( kape , 2015 ) . however , average daily gain is decreased due to increased slaughtering weight ( paek et al . , 1993 ) . recently , cattle in china are fed for unusually long periods of time before slaughter as wagyu and hanwoo . this might have contributed to their high imf and oleic acid contents ( smith , 2016 ; tanaka , 1985 ) . it is clear that imf increases with feeding time for grain - fed and pasture - fed cattle . however , the rate of imf increase in grain - fed cattle is faster than that in pasture - fed cattle ( smith et al . , 2009 ) . it has been reported that wagyu fed on a high - concentration diet have higher expression of adipogenic transcription factors in the subcutaneous and intramuscular adipocytes than those fed on a high - rough - age diet ( yamada and nakanishi , 2012 ) . the imf content and the numbers of preadipocytes and adipocytes are reported to be higher in wagyu than those in angus ( duarte et al . , 2013 ) . ( 2009 ) have reported that the imf contents in the longissimus muscle of wagyu , german angus , belgain blue , and holstein friesian are 23.3% , 4.4% . the wagyu and european cattle breeds did not differ in their mechanisms of postnatal fat accretion . however , they differed in their efficiency of accretion of imf ( gotoh et al . , 2009 ) . for every 1% increase of imf in the longissimus muscle , the increase amounts of subcutaneous adipose tissue in wagyu , holstein friesian , german angus , and belgain blue were 3.0 , 4.3 , 7.9 , and 10.7 kg , respectively ( gotoh et al . , 2009 ) . although imf content is the most dominating determinant of beef quality , the imf content is not the only parameter that decides the quality grade of beef carcass . marbling is called shimo - furi in japanese and sang - gang in korean . it literally means frosting . in japan , marbling with a fine appearance resembling frost is highly valued , but coarse marbling is not ( motoyama et al . , recently , korea also began to discriminate between fine and coarse marbling in hanwoo beef . this marbling quality contributes to the tenderness of beef because imf deposits are found mainly between muscle fiber bundles , resulting in the disorganization of perimysium connective tissue ( nishimura , 2015 ; sasaki et al . , 2012 ) . therefore , the sensory of tenderness could be qualitatively affected by histological difference in marbling due to difference in tissue disorganization extent . there are several types of fatty acids : 1 ) monounsaturated fatty acids ( mufa ) , 2 ) polyunsaturated fatty acids ( pufa ) , and 3 ) saturated fatty acid ( sfa ) . pufa such as linoleic acid , -linolenic acid ( n-3 ) , -linolenic acid ( n-6 ) , arachidonic acid , and so on contain many important compounds such as essential fatty acids . the fatty acid that has the highest amount in beef is oleic acid ( c18:1n-9 ) . it has been reported that fatty acid compositions are different depending on breeds ( smith et al . , 2006 the fatty acid compositions in highly marbled wagyu and hanwoo are considerably different from those in other cattle breeds . highly marbled wagyu beef has a higher percentage of mufa within fat compared with other breeds ( yang et al . , 1999a ) . ( 2006 ) have investigated oleic acid concentrations in the subcutaneous adipose tissues of wagyu , hanwoo , australian crossbred , angus ( corn - fed ) , angus ( hay - fed ) , and angus ( weaned ) and found that they are 52.9% , 47.3% , 39.8% , 39.8% , 34.6% , and 32.9% , respectively . a higher percentage of mufa will lead to a lower fat - melting point which contributes to the softness of beef fat and favorable beef flavor . it may decrease the circulating concentration of ldl cholesterol in consumers ( melton et al . , 1982 ; rudel et al . , 1995 ; smith , 1994 ) . therefore , fatty acid compositions of beef have recently become important in the beef industry , especially in highly marbled wagyu and hanwoo cattle ( 1995 ) have investigated the effect of breed type ( including japanese black ) and sex on fatty acid compositions of subcutaneous and intramuscular lipids in finishing steers and heifers of pure japanese black and holstein as well as crossbred japanese black , holstein , japanese brown , and charolais . they have reported that the japanese black is genetically predisposed to producing carcass lipids containing higher concentrations of mufa than holstein , japanese brown , or charolais steers ( zembayashi et al . , 1995 ) . 1992 ) have also concluded that beef from purebred wagyu cattle raised in japan is rich in mufa . ( 2011 ) have compared intramuscular fatty acid composition of longissimus muscle in 26-month - old japanese black steers and holstein steers reared and fattened using a standard fattening system ( table 1 ) . in the longissimus muscle of japanese black steers , a higher percentage of unsaturated fatty acid was found than that in holstein steers ( gotoh et al . , 2014 ) 2011 ) have also compared the imf content and fatty acid compositions of 21 major skeletal muscles using the same animals . muscles from the japanese black cattle contained a greater proportion of numerous fatty acids , particularly mufa such as c16:1 , c18:1 , and c20:1 compared to fatty acids in holstein cattle . in japanese black cattle , the proportion of sfa including c18:0 was much lower compared to that in holstein cattle . sfa : saturated fatty acids , mufa : monosaturated fatty acids , pufa : polysaturated fatty acids . 2005 ) have investigated the fatty acid compositions of hanwoo and australian angus beef and found a significant difference in fatty acid compositions between these two cattle breeds ( table 2 ) . especially , angus beef had significantly higher n-3 pufa while hanwoo beef contained greater n-6 pufa in three different muscles ( cho et al . , 2005 ) . the difference in fatty acid composition might be attributed to the influence of different diets , forage , and grain feeding , although fatty acid profile in ruminants is not a direct reflection of the dietary fatty acid composition due to hydrogenation by rumen microorganism ( enser et al . , 1998 ) . sfa : saturated fatty acids , usfa : unsaturated fatty acids , mufa : monosaturated fatty acids , pufa : polysaturated fatty acids . f - ratio statistic : * if p<0.05 , * * if p<0.01 , * * * if p<0.001 . therefore , it can be easily anticipated that hanwoo beef has a fatty acid profile similar to that of high concentratefed animals ( jo et al . , 2012 ) . recently , hwang and joo ( 2016 ) have evaluated the fatty acid profile of ten muscles from high marbled ( qg 1 ) and low marbled ( qg 2 ) hanwoo carcass and found significant differences in fat content and fatty acid composition among 10 muscles and between high and low marbled hanwoo beef . in particular , high marbled hanwoo muscles had significantly higher proportion of mufa due to higher oleic acid ( c18:1 ) proportion , while low marbled hanwoo muscles had higher proportion of sfa due to higher proportion of stearic acid ( c18:0 ) ( hwang and joo , 2016 ) . stearoyl - coa desaturase ( scd ) was first identified and reported as one of the genes associated with beef fatty acid composition ( taniguchi et al . , the composition of fatty acids stored in fat depots reflects the earlier action of scd on substrates such as stearic acid and palmitic acid ( kim and ntambi , 1999 ) . 1999b ) have reported interesting correlations between scd enzyme activity and fatty acid composition in bovine adipose tissue . although the adipogenic mechanism is extremely complicated , several genes have been identified and confirmed as either associated with or responsible for the fatty acid composition in wagyu cattle ( gotoh et al . , 2014 ) . it is generally accepted that the concentration of oleic acid in beef adipose tissue is dependent on scd expression and activity . wagyu cattle are genetically disposed to produce more oleic acid ( smith et al . , 2006 ) . very high heritability has been reported for oleic acid in wagyu cattle ( nogi et al . , 2011 ) . higher levels of concentrated feed in the later fattening period can lead to higher mufa concentration in the subcutaneous adipose tissues of wagyu steer ( kimura et al . , interest in beef fat and fatty acids has been increasing , especially in highly marbled beef such as wagyu and hanwoo because fatty acids composition in the diet have impact on human health . consumption of fat and cholesterol has been reported to be linked to cardiovascular disease , obesity , and cancer ( micha et al . , 2010 ; consequently , reduction of total fatty acid intake and replacement of sfa with pufa have been recommended . ulbricht and southgate ( 1991 ) have demonstrated that stearic acid has no effect on plasma cholesterol level and that oleic acid can lower serum cholesterol similar to pufa . furthermore , pavan and duckett ( 2013 ) have suggested that a higher proportion of oleic acid in beef is desirable because the consumption of high - oleic acid ground beef can increase hdl - cholesterol concentration ( gilmore et al . , 2011 ) . according to smith ( 2016 ) , the amount of fat consumed in a typical portion of beef will not increase risk factors for cardiovascular disease . clinical trials have demonstrated that ground beef containing elevated oleic acid can increase the concentration of hdl - cholesterol or at least has no negative effect on the concentration of hdl - cholesterol . in earlier research on oleic acid , the major mufa in beef , grundy et al . ( 1988 ) have found that it can lower ldl - cholesterol without affecting beneficial hdl - cholesterol . ( 2014 ) have reported that mufa can normalize or improve lipid metabolism and maintain the balance in cardiac muscle . these have implied that mufa have little effect on total cholesterol and that they are heart - healthy dietary fat that can lower ldl - cholesterol and increase hdl - cholesterol ( lahey et al . , 2014 ) . this effect is repeatable when natural foods are used to supplement diets with oleic acid . in this regard , smith ( 2016 ) have concluded that beef cattle should be raised under production conditions to increase the concentration of oleic acid in their edible tissue , i.e. , by grain feeding over extended periods of time . it is obvious that consumer in the world has an overwhelmingly negative attitude toward animal fats , especially saturated fat in meat for the last several decades ( ngapo and dransfield , 2006 ; williams and droulez , 2010 ) . according to higgs ( 2000 ) , the per capita decline in beef consumption in the us and other western countries has been attributed in large part to animal fat phobia . consumers have been warned to reduce saturated fat in their diet and to avoid meat cuts containing high fat content . these health recommendations are obviously in conflict with the health of highly marbled wagyu and hanwoo beef . many research studies have shown that the imf of wagyu and hanwoo beef contains a lot of mufa that could prevent arteriosclerosis . researches have also demonstrated that high - oleic acid ground beef may reduce risk factors for cardiovascular disease ( adams et al . thus , although some consumers in japan and korea consider highly marbled wagyu and hanwoo beef as being unhealthy , there is no scientific evidence to indicate that beef that is high in oleic acid will increase risk factors for diseases ( smith , 2016 ) . consequently , the role of animal fats in the diet should be re - evaluated because scientists around the globe increasingly doubt the validity of the so called diet - heart hypothesis it is now generally accepted that diets with low fat , high carbohydrate failed to curb obesity ( drewnowski , 2015 ) . on the other hand , more recent functional medicine research studies have suggested that the intake of fat has positive effect on human health ( saito , 2016 ) . it is essential to consume fats containing good quality fatty acids while reducing the consumption of food high in simple carbohydrates . excessive intake of simple carbohydrates is detrimental to health because they have negative effects on the body ( yu et al . , 2013 ) . in this regard , inclusion of high fat foods with superior sensory properties in a balanced diet such as highly marbled wagyu and hanwoo beef is likely to gain wider acceptance as a well - being food in the near future . in japan and korea , highly marbled wagyu and hanwoo cattle are greatly prized for traditional meat cooking methods . many researches have shown that wagyu and hanwoo cattle have high potential of accumulating imf and producing highly marbled beef . the beef quality grading system in both countries is primarily determined by marbling score with bms and additionally adjusted by other carcass traits . literature suggests that imf content varies on the basis of feeding time , finishing diet , and breed type . great attention has been paid to more accumulation of imf to produce high quality grade beef . the rate of imf increase in grain - fed cattle is faster than that in pasture - fed cattle . highly marbled wagyu and hanwoo beef have higher proportions of mufa due to higher concentrations of oleic acid . they are heart - healthy dietary fat because they can lower ldl - cholesterol while increasing hdl - cholesterol . clinical trials have also indicated that highly marbled beef does not increase ldl - cholesterol and that beef high in oleic acid can consistently increase hdl - cholesterol . finally , literatures have concluded that high - oleic acid beef such as wagyu and hanwoo beef may reduce risk factors for cardiovascular diseases .

this review addresses the characteristics and health benefit of highly marbled wagyu and hanwoo beef . marbling of wagyu and hanwoo beef has been increased in japan and korea to meet domestic consumer preferences . wagyu and hanwoo cattle have high potential of accumulating intramuscular fat ( imf ) and producing highly marbled beef . the imf content varies depending on the feeding of time , finishing diet , and breed type . imf increases when feeding time is increased . the rate of imf increase in grain - fed cattle is faster than that in pasture - fed cattle . fatty acid composition are also different depending on breeds . highly marbled wagyu and hanwoo beef have higher proportions of monounsaturated fatty acid ( mufa ) due to higher concentrations of oleic acid . mufas have little effect on total cholesterol . they are heart - healthy dietary fat because they can lower low - density lipoprotein ( ldl)-cholesterol while increasing high - density lipoprotein ( hdl)-cholesterol . clinical trials have indicated that highly marbled beef does not increase ldl - cholesterol . this review also emphasizes that high oleic acid beef such as wagyu and hanwoo beef might be able to reduce risk factors for cardiovascular disease .

tuberculosis ( tb ) caused by mycobacterium tuberculosis ( m. tb ) continues to be a significant global health problem , affecting millions of people worldwide [ 1 , 2 ] . it is a prevalent infectious disease in china , with 250,000 deaths from tb annually and 6 million active tb patients at present . the global incidence of tb is raising due to coinfection with the human immunodeficiency virus ( hiv ) and the emergence of multidrug - resistant ( mdr ) m. tb strains [ 5 , 6 ] . according to the report of world health organization ( who ) , m. tb will cause 1 billion new cases and about 35 million deaths worldwide by 2020 . therefore , effective treatment and control strategies are urgently needed to counteract the global threat of tb . the current vaccine against tb , m. bovis bacilli - calmette - gurin ( bcg ) , is a live attenuated vaccine which has been widely used throughout the world for many decades . bcg protects children efficiently against miliary and meningeal tb , but protective efficiency against pulmonary tb in adults has been found to vary highly from 0% to 80% . much effort has been devoted to improving bcg efficacy by genetic engineering technology because of its strong immunostimulatory properties and proven safety for human use [ 9 , 10 ] . recombinant bcg ( rbcg ) expressing different immunodominant antigens of m. tb , such as secreted antigens ( ag85b , ag85c , esat-6 , etc . ) or latency associated antigens ( -crystallin , rv2659c , rv3407 and rv1733c , etc . ) , have been tested as candidate vaccines against tb and are demonstrated to have an enhanced ability to induce th1 immune response and protection against m. tb challenge in animal models [ 11 , 12 ] . also , it is definitely no doubt that doses of antigens could subtly influence the magnitude of host immune response as well as protection efficacy , no matter antigen is administered in the form of rbcg , protein , dna , or rna . we have previously reported the construction of a m. tb fura gene operator / promoter ( pfura)-based differential expression system , from which it is feasible to express target antigens of interest in a modular fashion . m. tb chimeric antigen ag856a2 , which is coded by a recombinant ag85a gene with 2 copies of esat-6 gene inserted at the acc i site of ag85a ( see figure s1 in supplementary material available online at http://dx.doi.org/10.1155/2014/196124 ) , shows improved immunogenicity in mice when it is inoculated intramuscularly as a dna vaccine . for the current study , we selected two rbcg strains overexpressing the same chimeric antigen ag856a2 at the maximum difference : rbcg186 and rbcg486 overexpressing the fusion protein under control of the wild - type or the optimized double - mutated fura promoters , respectively . we tested their efficacy as vaccines in c57bl/6 mice , comparing immune response and protection against m. tb challenge . the results showed that mice vaccinated with rbcg186 or rbcg486 generally induced higher antigen - specific effector and memory immune responses , as well as protective efficacies compared to mice vaccinated with the parent bcg strain . however , the two rbcg strains between themselves , which expressed the chimeric antigen ag856a2 at different levels , induced different antigen - specific ifn- production and comparable number of m. tb - specific cd4 t cells expressing il-2 . and the protective efficacies imposed by the two rbcg strains displayed no significant differences although higher protection was observed in rbcg486 vaccinated mice than that in rbcg186 vaccinated mice . female specific pathogen - free ( spf ) c57bl/6 mice aged 68 wks were purchased from shanghai slac laboratory animal co. , ltd . ( shanghai , china ) and kept under spf conditions with food and water ad libitum until challenge . infected mice were maintained in a biosafety level 3 ( bsl-3 ) biocontainment animal facility . all animal experiment protocols were approved by chinese science academy committee on care and use of laboratory animals and were performed according to the guidelines of the laboratory animal ethical board of shanghai public health clinical center . bcg and its derivative recombinant strains were grown in liquid middlebrook 7h9 broth ( bd difco , usa ) supplemented with 10% oleic acid - albumin - dextrose - catalase enrichment ( oadc , bd difco , usa ) , 0.2% glycerol , and 0.05% tween 80 . cultures in the exponential phase were frozen and stored at 80c . when required , kanamycin was added at a final concentration of 50 or 20 g / ml for e. coli or mycobacteria , respectively . two rbcg strains overexpressing m. tb chimeric immunodominant antigen ag856a2 at different levels were constructed as previously described . briefly , the ag856a2 coding gene , which is a recombinant ag85a gene with 2 copies of esat-6 gene inserted in its acc i site , was amplified from the plasmid template of dna vaccine hg856a and then cloned into mycobacterial differential expression vectors pmfa11 and pmfa41 under control of the prototypical and double - mutated ( mutations : initial codon change from gtg to aug and 6 bp substitution at upstream at - rich region ) fura promoter , respectively . the resulting constructs were electroporated into bcg - danish competent cells and selected on middlebrook 7h11 agar with kanamycin . the rbcg transformants were grown to midexponential phase in complete middlebrook 7h9 broth and then verified the recombinant protein expression by routine western - blotting assay . mice were vaccinated subcutaneously ( s.c . ) with 2 10 colony - forming units ( cfu ) of bcg or rbcgs in 100 l saline . eight weeks after vaccination , groups of 6 mice were either sacrificed for assessment of antigen - specific t cell responses in splenocytes or exposed to an aerosol of virulent m. tb h37rv strain to deposit an inhaled dose of 100200 cfu per lung by an inhalation exposure system ( glas - col , usa ) . ifn- elispot assay kit ( bd biosciences , usa ) was used as described by the manufacturer . plates were coated with anti - ifn- mab overnight at 4c and then blocked with rpmi 1640 medium containing 10% fetal bovine serum ( fbs ) for 1 h at room temperature . splenocytes ( 2.5 10 cells / well ) from immunized mice were isolated , plated , and cultured with 10 g / ml ppd ( statens serum institute , denmark ) or 2 g / ml recombinant ag85a , 6 g / ml recombinant esat-6 to provide stimulation at 37c , 5% co2 for 20 h. after washing the plates with pbs - t20 ( 1 pbs , ph 7.4 , 0.05% tween 20 ) , biotinylated anti - ifn- was added for 2 h at room temperature . streptavidin - hrp was added for 45 min , and the color was developed with 3-amino-9-ethylcarbazole ( aec ) substrate ( bd biosciences ) . an immunospot analyzer ( cellular technology , usa ) was used to count the spots . splenocytes ( 2 10 cells / well ) isolated at 8 weeks after immunization were plated in 96-well plates and stimulated with 10 g / ml ppd for 14 h in the presence of 1 g / ml anti - cd28 ( bd biosciences ) and subsequently incubated for an additional 5 h at 37c following the addition of 0.5 l / ml monensin / golgistop ( bd biosciences ) . following overnight incubation at 4c , the cells were washed in facs buffer ( pbs containing 0.1% sodium azide and 1% fbs ) and subsequently stained for 30 min at 4c for surface markers with mabs as indicated using anti - cd3-pacific blue , anti - cd8-fitc , and anti - cd44-v500 ( all from bd biosciences ) . cells were then washed in facs buffer , fixed , permeabilized using the cytofix / cytoperm kit ( bd biosciences ) according to the manufacturer 's instructions and stained intracellularly for 30 min at 4c using anti - ifn--apc - cy7 , anti - tnf--percp - cy5.5 , and anti - il-2-apc mabs ( all from bd biosciences ) . cells were subsequently washed , resuspended in facs buffer , and then analyzed by multiparameter flow cytometry using a bd facsaria flow cytometer ( bd biosciences ) . for each sample , at least 300,000 events were collected and responses were analyzed using flowjo software ( tree star , usa ) . five weeks after infection , mice were sacrificed and the mycobacterial burden was determined by plating homogenates of lung , excluding right postcaval lobe , and entire spleen onto middlebrook 7h11 agar plates supplemented with 10% oadc enrichment and a 4-antibiotic mixture ( 40 u / ml polymycin b , 4 g / ml amphotericin , 50 g / ml carbenicillin , 2 g / ml trimethoprim ) that prevents growth of contaminating microorganisms . plates were incubated at 37c for 3 weeks in semisealed plastic bags and then cfu were counted and expressed as log10 cfu per organ . then , the embedded lung lobes were sectioned in thickness of 5 m , stained with haematoxylin and eosin ( h & e ) and photographed using a olympus ckx41 microscope ( olympus , japan ) fitted with an olympus dp20 camera connected to a computer . the image pro plus program ( media cybernetics , usa ) was utilized to objectively assess the level of inflammation present in each image . the mean percent of area inflamed was quantified averaging from three to five lung sections of each of the different groups of mice . the antibodies were rabbit polyclonal anti - mouse tnf- ( abcam , uk ) , rabbit polyclonal ifn- antibodies ( invitrogen , usa ) , and rabbit polyclonal anti - mouse inos antibody ( cayman chemical , usa ) . all sections were examined by light microscopy , and the expression of tnf- , ifn- , or inos was semiquantified by intensity of positive signal using image pro plus software . immune responses , protective efficacies , and histopathological staining were tested by one - way anova followed by tukey 's multiple comparison tests of the means . we have previously developed a novel mycobacterial differential expression system ( pmfa series ) based on the m. tb fura gene operator / promoter ( pfura ) or its derivatives . ag856a2 was cloned into two of these plasmids , pmfa11 and pmfa41 , which drives low and high gene expression under the control of the wild - type and modified fura promoters , respectively . by transformation of bcg , we obtained two strains , rbcg186 and rbcg486 , which drove correspondingly low and high expression of chimeric immunodominant antigen ag856a2 ( figure 1 , upper panel ) . quantification of the band intensities of western - blot indicated that rbcg486 roughly expressed > 3-fold of ag856a2 than rbcg186 did ( figure 1 , lower panel ) . eight weeks after vaccination , elispot assay of splenocytes showed that more cells in the rbcg486-vaccinated mice expressed ag85a - specific ifn- compared to those of rbcg186- and bcg - vaccinated mice ( figure 2 , left panel ) . also , significantly elevated numbers of splenocytes expressed esat-6-specific ifn- in both rbcg186- and rbcg486-vaccinated mice compared to that of bcg - vaccinated mice ( figure 2 , middle panel ) . additionally , esat-6-specific ifn- was induced at much higher level in rbcg486-vaccinated mice compared to rbcg186 group ( figure 2 , middle panel ) . a similar pattern of ppd - specific ifn- responses as ag85a - specific response was also observed but the difference was not statistically significant , regarding to the comparisons of rbcg486-vaccinated mice and other immunized groups ( figure 2 , right panel ) . we used flow cytometry to measure the capacity of m. tb - specific cd4 t cells from spleens of vaccinated mice producing cytokines ifn- , tnf- , and il-2 at single cell level after stimulation in vitro with ppd . the cytokine - producing cd3cd4 cells were classified into seven subpopulations based on their production of ifn- , tnf- , and il-2 in any combination ( figure 3(a ) ) . significantly increased frequencies of ppd - specific il-2 cd4 t cells were identified in rbcg - vaccinated mice , whereas increased frequencies of ifn- cells were identified in bcg - vaccinated mice even though statistically insignificant ( figure 3(a ) ) . the pie chart of this data clarified the dominance of il-2 cd4 t cells in rbcg - vaccinated mice , while ifn- cd4 t cells dominated the responses of bcg - vaccinated mice ( figure 3(b ) ) . rbcg and bcg - vaccination did not differ in their ability to induce m. tb - specific cd4 t cells producing other combinations of cytokines ( p > 0.05 ) . in accordance , we also observed higher integrated mean fluorescence intensities ( imfi = % frequency mfi ) of il-2 in il-2-producing cd4 t cells , even though it is statistically insignificant ( figure 3(c ) ) . in general , rbcg induced higher antigen - specific cytokine responses as compared to bcg ( figures 2 and 3 ) , and rbcg486 induced higher antigen - specific ifn- response ( figure 2 ) and comparable frequency of m. tb - specific cd4 t cells expressing il-2 ( figure 3 ) . then , we further compared the protective efficacies of rbcg486 , rbcg186 , and bcg against m. tb - challenge . as shown in figure 4(a ) , 5 weeks after challenge all vaccinated mice had a significantly reduced bacillary load in lungs , when compared to the saline - treated mice . vaccination with bcg and rbcg186 resulted in a comparable reduction in bacillary load ( figure 4 ) . however , even though rbcg486 vaccination induced a significantly greater protection when compared to the bcg - vaccinated mice , it showed no difference of protection when compared to the rbcg186-vaccinated mice ( figure 4(a ) ) . the bacillary loads in spleens shared the similar pattern as those in lungs , with rbcg486-vaccinated mice having far fewer bacilli when compared to the saline - treated or bcg - vaccinated mice and having comparable bacilli compared to the rbcg186-vaccinated mice ( figure 4(b ) ) . five weeks after challenge , m. tb infection caused severe pathology changes in saline - treated mice , with about 24.3% of the tissue showing extensive multifocal granulomatous infiltration , characterized by numerous foamy macrophages surrounded by inflammatory cells ( figure 5 ) . however , all the vaccinated groups of mice had significantly reduced pulmonary granulomatous consolidation compared to the unvaccinated mice ( i.e. , 13.42% consolidation in bcg - vaccinated group , 7.24% in rbcg186-vaccinated group , and 4.87% in rbcg486-vaccinated group ) . the rbcg - vaccinated mice showed the mildest pathology , and all of the mice in these two groups had mainly well - preserved alveolar spaces with only a few scattered areas of diffused infiltration ( figure 5 ) . immunohistochemical staining of the lung tissues showed the presence of tnf- , ifn- , and inos in all groups of infected mice and staining was strongest in the granulomatous lesions compared to that in the nongranulomatous areas . five weeks after infection , a very high level of tnf- was observed in the lungs of saline - treated mice ( figure 6(a ) ) ; tnf- staining was extensive in necrotic areas within the advanced coalescent granulomas . vaccination with bcg resulted in the reduced amounts of tnf- expression , even though statistically insignificant . in contrast , rbcg - vaccinated mice , especially rbcg486-vaccinated mice , showed only a little weak staining for tnf- and this was restricted primarily to the granuloma core ( figure 6(a ) ) . similar patterns of ifn- and inos staining were also observed except that there was relatively much weaker staining in the lungs of ( r)bcg - vaccinated mice compared to the saline - treated mice ( figures 6(b ) and 6(c ) ) . similar pattern of tnf- , ifn- , and inos staining was also observed in the infected spleens of vaccinated mice , with the highest staining in saline - treated mice , moderate staining in bcg - vaccinated mice , and the lowest staining in rbcg - vaccinated mice ( figure s2 ) . during the past decades , great efforts have been focused on modifications of the current bcg vaccine to develop new anti - tb vaccine candidates . some modified rbcg strains , such as rbcg30 and rbcgurec::hly , have been demonstrated to yield improved protection against m. tb infection in experimental animal model compared to the existing bcg vaccine and have entered into clinical trial . nevertheless , it is promising to keep on optimization of bcg protective immune if two points are being issued . one is the fact that the best immunodominant antigen for tb should be precisely defined . another is that the expression levels of such antigens should be optimal enough to elicit effective immune responses . here , we constructed two rbcg strains overexpressing immunodominant chimeric antigen ag856a2 at varying levels depending upon the strengths of the different fura promoters and then compared the cellular immune response and protection in mice induced by these two rbcg strains . one way to improve bcg efficacy is to overexpress mycobacterial immunodominant antigens to induce optimal host immune responses in the life cycle of bcg within host [ 12 , 19 ] . this kind of strategy reflects that the doses of antigens are one of pivotal factors influencing the protective efficacies of vaccines . demonstrated that protective efficiency of tb subunit vaccines is highly dependent on the antigen dose . they vaccinated mice with different doses of fusion protein ag85b - tb10.4 which were emulsified in adjuvant ic31 , and the higher immune response and protective efficacy were only observed when the antigen was administered in proper doses , and decreasing or increasing of the antigen dose would dramatically dwarf the protection efficacies of the antigens . in our study , the cognate antigen ag856a2 in rbcg186 and rbcg486 was expressed under the control of promoters pfura and pfurama ( figure s1 ) . these two promoters , by their nature , were verified to have varied promoter activities , with pfura the lower one and pfurama the higher one , and were consequently used to develop the rbcg strains overexpressing chimeric antigen ag856a2 at different levels , with lower expression in rbcg186 and higher expression in rbcg486 ( figure 1 ) . and different ag856a2 antigen loading in rbcgs resulted in differential host immune responses , with the higher antigen - specific effector immune response in the rbcg486-vaccinated mice as validated through in vitro ifn- elispot assay ( figure 2 ) . however , we did not observe the significant differences in the qualities of m. tb - specific cd4 t cells coexpressing ifn- , tnf- , and il-2 ( figure 3 ) , nor the protection efficacies and lung inflammations , between the two groups of rbcgs - vaccinated mice ( figures 4 and 5 ) . interestingly , subtly higher percent of polyfunctional cd4 t cells ( ifn-il-2tnf- ) was observed in bcg - vaccinated mice compared to other groups of mice ( figure 3(a ) ) ; however , the protective efficacy elicited by bcg vaccination is not that effective as rbcgs ( figure 4 ) . this contradictory result could be explained with the fact that the lower imfi values of ifn- , il-2 , and tnf- in bcg - vaccinated mice were observed ( see the case of il-2 in figure 3(c ) as representative ) . mfi provides one measure of the quality of the immune response since the cells that are more actively producing cytokine stain more brightly , thus the lower imfi values of cytokines reflected poor quality although mildly higher frequency of polyfunctional cd4 t cells was seen in bcg - vaccinated mice , and this further emphasizes that not only the magnitude but also the quality of vaccine - induced t cells responses are critical to guide development of effective immunization strategies . in addition , higher il-2 secretion , both in the levels of percentage and imfi , were seen in the rbcg486-vaccinated mice than that of bcg group ; this data support our recent findings that il-2 production in the spleens of vaccinated mice after vaccination can predict vaccine efficacy ( kang h , et al . immunology , 2014 ; in press ) . the same explanation might also be used to account for the fact that although the saline - treated mice showed high numbers of cells producing tnf- , the imfi is relative low ( data not shown ) . the quality of t cell response has significant effect on the establishment of protective memory . as with the phenotypic heterogeneous nature of t cells thus , in addition to monitoring exclusively the ifn- response after vaccination , researchers have been focusing on the coexpression of more cytokines at single cell level through flow cytometry technique [ 24 , 25 ] . the rbcg186 or rbcg486 , at least at the time we tested , induced much higher frequencies of il-2 cd4 t cells responding to ppd stimulation in splenocytes compared to the saline - treated or bcg - vaccinated mice after vaccination , which was further confirmed by higher il-2 production when cytokine concentration was measured as imfi value ( figure 3 ) . although il-2 has little direct effector function , it has the ability to expand effector functions of other t cells . in the linear model of differentiation for cd4 th1 cells , il-2 cd4 t cells belong to memory cells and have the potential to differentiate into ifn--producing cells after recalling by the relevant antigens . thus , rbcg186 and rbcg486 , because of the incorporation of chimeric antigen ag856a2 , enhance the memory capacity of host to m. tb pathogen . however , we did not detect any differences of cd4 t cells between rbcg186-vaccinated and rbcg486-vaccinated mice . this may attribute to the short vaccination time window we chose , or the real differences lies in other functions of t cells which is beyond the scope of the t cell functions currently tested and may need to be further exploited in the future . those relevant th1 cytokines ( e.g. , tnf- and ifn- ) , in a larger extent , function through activation of macrophages . tnf- and ifn- synergistically inhibit the growth of m. tb in macrophages through stimulating the production of reactive nitrogen intermediates ( rnis ) [ 27 , 28 ] . as for rnis , inos is the vital enzyme involved for the production of rnis [ 29 , 30 ] . tnf- , ifn- , and inos give proper containment of m. tb in the early stage . at later stage of infection when inhibition or killing of m. tb is well established , their levels of expression will go down to a reasonable value ; otherwise immune - pathological response would happen . rbcgs , especially rbcg486 , induced enhanced protection against m. tb infection in this study ( figure 4 ) . consistent with the protective efficacy , the inflammation responses in the infected lungs alleviated greatly in rbcgs - vaccinated mice after infection ( figure 5 ) . when measuring the expression levels of inflammatory molecules , the rbcgs - vaccinated mice also displayed reduced levels of expression which were in accordance with the remissive granulomatous inflammation ( figures 5 and 6 ) .

one approach for improving bcg efficacy is to utilize bcg as vehicle to develop recombinant bcg ( rbcg ) strains overexpressing mycobacterium tuberculosis ( m. tb ) antigens . also expression level of a candidate antigen should impact the final t cell responses conferred by rbcg . in this study , based on our previously constructed differential expression system , we developed two rbcg strains overexpressing m. tb chimeric antigen ag856a2 ( coding a recombinant ag85a with 2 copies of esat-6 inserted at acc i site of ag85a ) at differential levels under the control of the subtly modified fura promoters . these two rbcg strains were used to vaccinate c57bl/6 mice and exploit dose of incorporated antigen in rbcg to optimize immune response and protective efficiency against m. tb challenge in mouse model . the results showed that rbcg strains overexpressing ag856a2 at differential levels induced different antigen - specific ifn- production and comparable number of m. tb - specific cd4 t cells expressing il-2 . m. tb challenge experiment showed that rbcg strains afforded enhanced but comparable immune protection characterized by reduced bacillary load , lung pathology , and inflammation . these results suggested that the dose of antigens incorporated in rbcg can impact t cell immune responses but imposed no significantly differential protective efficacies .

ocular inflammation is common after ophthalmic surgery , particularly after surgical removal of cataracts combined with intraocular lens ( iol ) implantation . this inflammatory response includes the metabolism of arachidonic acid to prostaglandins and leukotrienes and the recruitment of neutrophils and macrophages to the site of surgical trauma . this process eventually manifests as a mild iritis , corneal edema , and increased cells and proteins ( flare ) in the anterior chamber of the eye , accompanied by hyperalgesia . while recent advances in surgical techniques ( smaller incisions ) , more efficient phacoemulsifiers , and improved viscoelastics have improved cataract surgery outcomes , postoperative inflammation and pain remain a major source of discomfort for patients . if left untreated , postoperative inflammation can lead to suboptimal vision results or complications such as cystoid macular edema ( cme ) [ 1 , 36 ] . as surgical techniques have improved , ocular inflammation following cataract surgery is managed by topical anti - inflammatory drugs such as non - steroidal anti - inflammatory drugs ( nsaids ) and/or corticosteroids . both are effective in resolving postoperative inflammation and pain , increasing patient comfort , and decreasing the risk of complications [ 1 , 711 ] . they inhibit phospholipase a2 in the inflammatory cascade , which converts membrane phospholipids to arachidonic acid , thereby inhibiting the cyclooxygenase and lipoxygenase pathways and the formation of all eicosanoids . corticosteroids suppress both the early ( capillary dilation , increased vascular permeability , recruitment of leukocytes ) and late ( deposition of fibrin , proliferation of inflammatory cells and chemokines ) phases of inflammation [ 1316 ] . however , they are also associated with side - effects , including steroid - induced intraocular pressure ( iop ) elevation , lowered resistance to infection , risk of cataract formation , and decreased wound healing [ 1620 ] . of these , increased iop is the most significant side - effect for the post - cataract patient , and is thought to be due to structural and biochemical changes in the trabecular meshwork causing increased resistance to aqueous humor outflow . steroid - induced iop elevation has been reported to occur in 1836 % of patients , termed steroid responders , [ 15 , 22 ] with risk factors including a history of glaucoma , a familial predisposition toward glaucoma , or high myopia [ 22 , 23 ] . older corticosteroids , such as prednisolone and dexamethasone , are associated with a greater impact on iop compared to newer corticosteroids . recent research indicates that nsaids may have a synergistic effect with corticosteroids , particularly for the prevention of cme . in most instances , it is therefore vital for ophthalmic surgeons to be able to provide patients with a corticosteroid option that offers high efficacy yet does not result in an increase of iop to clinically significant levels . loteprednol etabonate is a novel corticosteroid produced by retrometabolic design . in retrometabolic drug design , an inactive and nontoxic metabolite of a reference compound is utilized as a starting point for conversion to a therapeutically active , metabolically labile compound . loteprednol etabonate was designed starting with cortienic acid , an inactive metabolite of prednisolone . structurally , loteprednol etabonate differs from prednisolone in that the ketone at the carbon-20 ( c-20 ) position is replaced with a chloromethyl ester and the 17-hydroxyl group is replaced with a carbonate moiety ( fig . 1 ) . after exerting its effects , loteprednol etabonate is rapidly metabolized by tissue esterases to cortienic acid etabonate and then to cortienic acid , thereby limiting any potential adverse effects associated with its use . preclinical studies demonstrated that loteprednol etabonate is highly lipophilic and has strong binding affinity to glucocorticoid receptors . indeed , its lipophilicity was found to be 10 times greater while its binding affinity to the glucocorticoid receptor was found to be 4.3 times greater than that of dexamethasone [ 27 , 28 ] . approved in the united states in 1998 for the treatment and prevention of various steroid - responsive ocular inflammatory conditions as well as for the treatment of postoperative ocular inflammation , loteprednol etabonate has since received marketing approval in various countries across europe , latin america , the middle east , north africa , and asia.fig . 1loteprednol etabonate ( i ) and its inactive metabolites , cortienic acid etabonate ( ii ) and cortienic acid ( iii ) loteprednol etabonate ( i ) and its inactive metabolites , cortienic acid etabonate ( ii ) and cortienic acid ( iii ) the objective of this paper was to review the available published clinical data on loteprednol etabonate suspension 0.5 % in the treatment of postoperative inflammation and pain , and to assess its efficacy and safety along with that of other corticosteroids formally studied and approved for the treatment of postoperative inflammation , namely , difluprednate and rimexolone . publications on loteprednol etabonate were identified through medline searches ( 1950 onwards ) using the terms loteprednol , postoperative pain , inflammation , cataract , and cataract surgery . in order to identify publications about other corticosteroids currently used in postoperative pain and inflammation , the terms rimexolone , difluprednate , prednisolone , dexamethasone , fluorometholone , cataract , cataract surgery , postoperative , and postsurgical inflammation were also searched . only ophthalmic studies were included , and validity was assessed based on dosage form ( topical only ) , indications for use , study endpoints , and year of publishing . the search was limited to english language , peer - reviewed primary studies and any reviews published in the last 5 years . additional references were obtained by searching reference lists of identified articles . as no direct head - to - head studies comparing loteprednol etabonate to rimexolone or to difluprednate were found , insights on comparative safety and efficacy of loteprednol etabonate , rimexolone , and difluprednate were drawn from vehicle - controlled studies or from studies in which these newer corticosteroids were compared to older corticosteroids such as dexamethasone and/or prednisolone acetate . the efficacy and safety of loteprednol etabonate ophthalmic suspension 0.5 % for the treatment of postoperative inflammation has been demonstrated by several studies over the last decade ( table 1 ) . a double - masked , vehicle - controlled evaluation of the efficacy and safety of loteprednol etabonate for postoperative inflammation after cataract removal with iop implantation was conducted in 1998 by the loteprednol etabonate postoperative study group . in this study , 203 patients with an anterior chamber inflammation ( aci ) severity 3 ( 09 scale ) on the day following cataract surgery were randomized to either loteprednol etabonate or vehicle administered four times daily in the operated eye for 14 days . resolution of aci , defined as 5 cells and none - to - trace flare , was observed in 55 % of patients in the loteprednol etabonate group and 28 % of patients in the vehicle group ( 27 % difference , p < the rate for individual signs of cell and flare as well as supportive signs and symptoms of chemosis , erythema , bulbar injection , ciliary flush , pain , photophobia , tearing and discomfort , all favored the loteprednol etabonate group ( p < 0.05 ) . from a safety perspective , both treatment groups exhibited a mean decrease in iop ( 12 mmhg ) when compared with baseline . no patients in the loteprednol etabonate group versus a single patient in the vehicle group exhibited a clinically significant increase in iop ( 10 mmhg ) . stewart et al . conducted an identical study to evaluate the efficacy and safety of loteprednol etabonate in controlling aci . in this study , 227 post - cataract patients with aci severity 3 ( 09 scale ) on the day following surgery were randomized to loteprednol etabonate or vehicle . resolution of aci at the final visit was observed in 64 % of patients in the loteprednol etabonate and 29 % of patients in the vehicle groups ( 35 % difference , p < 0.001 ) . again , the resolution rate for cells and flare individually as well as supportive signs and symptoms of chemosis , erythema , bulbar injection , ciliary flush , pain , photophobia , tearing , and discomfort all favored the loteprednol etabonate group ( p < 0.05 ) . as in the first study , mean iop decreased in both treatment groups relative to baseline by 12 mmhg . a clinically significant increase in iop ( 10 mmhg ) was observed in three patients in the loteprednol etabonate group . comstock and usner further explored the efficacy of loteprednol etabonate in resolving pain and discomfort in these studies . the treatment effect for pain and discomfort was 31 and 43 % , respectively , for the first study and 24 and 30 % , respectively , for the second study . analysis of pooled data indicated that the proportion of at - risk patients with resolution of pain at the final visit was 84 % for the loteprednol etabonate group and 56 % for the placebo group ( p < 0.05 ) . similarly , resolution of discomfort at the final visit was 79 % for the loteprednol etabonate group and 42 % for the placebo group ( p < 0.05).table 1studies demonstrating the efficacy and safety of loteprednol etabonate ( le ) 0.5 % for postoperative inflammationstudy parametersstewart et al . stewart comparatorvehiclevehicle1 % ( pa)fluorometholone acetate 0.1 % ( fa)no . of patients2032272030treatment duration ( weeks)2242patients with resolution of aci at final visit ( % ) le group64le group55le group60le group60vehicle29vehicle28pa group50fa group100mean iop at final visitmean decrease in iop of 12 mmhg for both treatment groupsmean decrease in iop of 12 mmhg for both treatment groupsle group12 3 mmhgnot reportedpa group16 1 mmhgclinically significant increases in iop ( 10 mmhg)n = 3 for loteprednol etabonate ; n = 0 for vehiclen = 0 for loteprednol etabonate ; n = 1 for vehiclenot reportednot reportedaci anterior chamber inflammation , iop intraocular pressure , le loteprednol etabonate , pa prednisolone acetate , fa fluorometholone acetateresolution of aci defined as anterior chamber cell count < 5 and flare grade 0 ( none ) studies demonstrating the efficacy and safety of loteprednol etabonate ( le ) 0.5 % for postoperative inflammation aci anterior chamber inflammation , iop intraocular pressure , le loteprednol etabonate , pa prednisolone acetate , fa fluorometholone acetate resolution of aci defined as anterior chamber cell count < 5 and flare grade 0 ( none ) three small prospective studies further compared the efficacy and/or safety of loteprednol etabonate with that of other corticosteroids . stewart compared the efficacy and safety of loteprednol etabonate 0.5 % and fluorometholone acetate 0.1 % in the treatment of postoperative inflammation . a total of 30 post - cataract patients were enrolled in this randomized , double - masked , parallel - group study . all patients instilled a single drop of the assigned study medication four times daily for 14 days . at the final visit , no statistically significant differences in flare , anterior segment cell , or conjunctival hyperemia were observed between the two treatment groups . compared the efficacy and safety of loteprednol etabonate and prednisolone acetate 1 % , in the treatment of postoperative inflammation following cataract surgery . twenty patients were randomly assigned to loteprednol etabonate or prednisolone , instilled four times daily for the first week , tapering to once daily by week 4 , in this randomized double - masked study . patients from both groups achieved a similar resolution of postoperative inflammation ( conjunctival hyperemia , corneal edema , aqueous cells , flare ) , with 60 % of patients in the loteprednol etabonate group and 50 % of patients in the prednisolone group achieving significant resolution of inflammation by the final visit . despite the study s small sample size , treatment with loteprednol etabonate had less effect on iop elevation than prednisolone . the mean ( sd ) iop on the final visit was 12 ( 3 ) mmhg in the loteprednol etabonate group compared with 16 ( 1 ) mmhg in the prednisolone group . oban and kocak also compared the safety of loteprednol etabonate 0.5 % and prednisolone acetate 1 % in 40 patients after uncomplicated phacoemulsification surgery . treatments were administered five times daily from the first day postoperatively , and patients were evaluated at 1 day , 1 week , and 1 month thereafter . at all postoperative visits , the mean iop was lower in the loteprednol etabonate group than in the prednisolone group . the authors concluded that loteprednol etabonate 0.5 % use after cataract surgery is associated with a smaller increase in iop than prednisolone use . as indicated above , in most instances , topical corticosteroids are used in combination with nsaids for the treatment of pain and postoperative inflammation . compared the use of loteprednol etabonate 0.5 % alone , loteprednol etabonate 0.5 % in combination with indomethacin 0.1 % , and dexamethasone disodium phosphate 0.15 % in the treatment of postoperative inflammation following uncomplicated cataract surgery . patients were divided into three groups , the first of which included 79 patients administered indomethacin 0.1 % from 3 days before to 2 weeks after surgery and loteprednol etabonate for 4 weeks after surgery . the second and third groups comprised 81 patients treated with loteprednol etabonate 0.5 % for 4 weeks and 78 patients treated with dexamethasone for 4 weeks , respectively . all three therapeutic regimens were effective in preventing postoperative ocular inflammation at postoperative weeks 1 and 4 with very mild aci and very low corneal fluorescein staining in all 3 groups . two cases of iop elevation ( both in the dexamethasone group ) and three cases of cme ( loteprednol etabonate group = 1 , and dexamethasone group = 2 ) were observed . the authors concluded that there was better control of iop and prevention of cme in the combination group but that larger confirmatory studies were needed . the above studies establish the efficacy and/or safety of loteprednol etabonate 0.5 % for the treatment of postoperative inflammation in prospective , randomized , double - masked studies . additional published studies provide insight into the safety of long - term treatment with loteprednol etabonate and safety of loteprednol etabonate in steroid responders . howes et al . studied the systemic pharmacokinetics , systemic effects , and iop effects of loteprednol etabonate 0.5 % after chronic ocular administration in a double - masked study . healthy individuals aged 1944 years were randomized to receive either loteprednol etabonate ( n = 10 ) or vehicle ( n = 4 ) instilled in each eye every 2 h while awake ( 8 times a day ) on days 0 and 1 and four times daily on days 2 through to 42 . blood samples were collected at 0 , 15 , 30 , 60 , and 120 min after the first and eighth doses on day 0 and after the fourth dose on day 42 , and once on days 7 , 14 , and 28 . plasma levels of loteprednol etabonate and cortienic acid etabonate were below the level of quantitation ( 1 ng / ml ) in all samples collected , while cortisol levels were all within normal range indicating a lack of hypothalamic pituitary adrenal axis suppression . none of the patients exhibited a clinically significant increase in iop ( 10 mmhg ) over the 6 week study period . compared the effects of a combination of loteprednol etabonate and tobramycin ( le / t ) with that of dexamethasone and tobramycin ( dm / t ) on iop in healthy volunteers over a 4 week treatment period . a total of 306 volunteers were randomized to receive either le / t or dm / t administered every 4 h for 28 days . clinically significant increases in iop ( 10 mmhg ) were observed in three ( 1.95 % ) subjects treated with le / t compared with 11 ( 7.48 % ) subjects treated with dm / t ( p = 0.028 ) . assessed the long - term safety of loteprednol etabonate across all development studies of loteprednol etabonate ( 0.2 and 0.5 % suspension ) in a large retrospective analysis . these development studies included the use of loteprednol etabonate for postoperative inflammation as well as other ocular inflammatory conditions ( seasonal allergic conjunctivitis , giant papillary conjunctivitis , and uveitis ) . the proportion of patients exhibiting clinically significant increases in iop ( 10 mmhg ) was 0.5 , 1.7 , and 6.7 % with vehicle , loteprednol etabonate , and prednisolone acetate 1 % ( used as a comparator in some studies ) , respectively . excluding patients that continued to wear contact lenses ( allowed in giant papillary conjunctivitis studies ) , the proportions of patients showing clinically significant increases in iop were 1.0 , 0.6 , and 6.7 % for vehicle , loteprednol etabonate , and prednisolone acetate 1 % , respectively . in studies with loteprednol etabonate 0.5 % , the proportion of patients with a clinically significant increase in iop was 2.1 % if patients wearing contact lenses were included and 0.8 % if these patients were excluded . in addition to the above studies on the safety of loteprednol etabonate with long - term use , two studies in steroid responders support the relative lack of impact of loteprednol etabonate on iop . in a retrospective review , holland et al . evaluated data from 30 post - penetrating keratoplasty and post - keratolimbal allograft patients who , after experiencing increased iop to 21 mmhg , were switched from prednisolone acetate 1 % to loteprednol etabonate 0.5 % . results showed a mean ( se ) reduction of iop from 31.1 ( 1.13 ) mmhg on prednisolone acetate to 18.2 ( 1.37 ) mmhg on loteprednol etabonate ( p < 0.001 ) and no allograft rejection . bartlett and colleagues examined the safety of loteprednol etabonate in a crossover study in 19 known steroid responders . subjects received either loteprednol etabonate or prednisolone acetate 1.0 % for 42 days followed by a washout period of 14 days prior to being crossed over to the other treatment . during treatment with loteprednol etabonate , iops were within the normal range , with a mean iop elevation of 4.1 mmhg over the 42 day period ( ns vs baseline ) . in contrast , the subjects iops were significantly greater compared to baseline during treatment with prednisolone acetate ; mean iop elevations of 5.9 , 7.7 , and 9.0 mmhg were observed by days 14 , 28 , and 42 , respectively ( p < 0.05 for all ) . taken together , the available clinical efficacy and safety studies of loteprednol etabonate 0.5 % for the treatment of postoperative inflammation , combined with safety studies on the long - term use of loteprednol etabonate or use of loteprednol etabonate in steroid responders suggest that loteprednol etabonate is a potent and safe topical corticosteroid with a low propensity to increase iop relative to older corticosteroids such as prednisolone acetate or dexamethasone . rimexolone is a c-20 ketone steroid similar to prednisolone with the 17-hydroxyl group replaced with a methyl group and an additional methyl group at the c16 position . while it has been granted regulatory approval in the united states , rimexolone has not received approval in all countries in the european union . bron et al . assessed the safety and efficacy of rimexolone 1 % ophthalmic suspension compared with placebo for reducing postoperative inflammation after cataract surgery and iol implantation . in this study , 182 post - cataract patients were randomized to rimexolone 1 % or placebo instilled four times daily for 14 days postoperatively . as was the case in studies with loteprednol etabonate , inclusion criteria included a grade 3 ( 09 scale ) for the sum of cells and flare combined on the day following cataract surgery . by the final visit , the proportion of patients with resolution of inflammation ( 5 cells and none - to - trace flare ) was 59.7 and 27.6 % for the rimexolone and placebo group , respectively ( 32 % difference ; p < 0.0001 ) . supportive measures of ocular discomfort , corneal edema , bulbar conjunctival erythema , anterior vitreous reaction and the physician s impression all favored treatment with rimexolone ( p < 0.05 ) . the authors reported no perceptible change in iop in either group at any visit but indicated that the study was not designed to show differences in iop . in this study , 197 patients with combined cell and flare severity 3 for cells and flare combined ( 09 scale ) 24 h after cataract surgery were randomized to rimexolone 1 % or placebo four times daily for 14 days . , 59.7 % of patients in the rimexolone group compared to 32.1 % of patients in the placebo group had their inflammation resolved by the final visit ( 27.6 % difference , p < 0.001 ) . secondary measures of bulbar conjunctival erythema , and the physician s follow - up impression also favored rimexolone treatment compared to placebo treatment ( p < 0.05 ) although there was no between - group difference in the presence of ciliary flush or anterior vitreous reaction . mean iop decreased relative to baseline ( postoperative day 1 ) in both treatment groups , although two patients in each treatment group experienced a clinically significant increase in iop ( 10 mmhg ) . based on the treatment effects noted in these studies , the clinical efficacy observed with rimexolone appears similar to that observed in vehicle - controlled studies with loteprednol etabonate . several published studies compared the clinical efficacy and safety of rimexolone 1 % to prednisolone acetate 1 % . compared the efficacy of rimexolone to prednisolone , administered four times daily for 15 days postoperatively for the treatment of postoperative ocular inflammation in 80 post - cataract patients ( baseline inflammation severity not specified ) . both treatments were effective in reducing postoperative inflammation , with no between - group differences in anterior chamber cell count or flare severity at any postoperative visit ( days 1 , 3 , 8 , 15 , 18 ) . however , conjunctival hyperemia was worse in the rimexolone group on days 1 and 3 ( p < 0.05 ) , while corneal edema was worse in the prednisolone group on day 8 ( p < 0.05 ) . there were also no between - group differences in iop , with mean ( sd ) final visit iops of 12.96 ( 3.2 ) mmhg and 11.65 ( 2.86 ) mmhg , respectively . also evaluated the anti - inflammatory efficacy of rimexolone with that of prednisolone acetate 1 % , both administered four times daily for 15 days , in patients ( n = 48 ) undergoing cataract extraction by phacoemulsification . there was no difference between treatment groups in mean inflammation scores ( aqueous cell , flare , and conjunctival hyperemia individually ) at postoperative follow - up visits except for cells at postoperative day 3 which were lower in the prednisolone group . although mean iop decreased in both groups relative to postoperative day 1 , a significant difference between treatments was found at postoperative day 3 , with mean ( sd ) iops of 10.9 ( 1.3 ) mmhg and 11.9 ( 1.9 ) mmhg in the rimexolone and prednisolone groups , respectively . there were no differences between treatments in mean iop at days 7 or 15 . furthermore , hirneiss et al . compared the clinical efficacy and safety of rimexolone with that of prednisolone and ketorolac tromethamine in 45 patients after cataract extraction . there was no difference between treatments in control of aqueous cells , but prednisolone was more effective than rimexolone in controlling flare and conjunctival hyperemia . notably , one patient from the prednisolone group was discontinued for a marked early increase in iop . finally , leibowitz et al . studied the iop - increasing potential of rimexolone 1.0 % with that of fluorometholone alcohol 0.1 % in a double - masked , two - way crossover study of 45 otherwise healthy steroid responders . following verification of steroid responder status with either dexamethasone or prednisolone acetate , subjects were randomized to either rimexolone or fluorometholone administered every 2 h for 2 days followed by four times daily for 40 days . on completion of the 6 week study duration or on exhibiting an increase in iop of 10 mmhg , the study treatment was stopped ; subjects completed a 1 month washout and then received the alternate treatment for another 6 weeks . there was no significant difference between rimexolone and fluorometholone in the number of subjects demonstrating an increase in iop of 10 mmhg or in the number of weeks required to achieve a 10 mmhg increase . rimexolone treatment resulted in a mean increase in iop of 7.5 mmhg in patients previously observed to have a mean increase of 11.8 mmhg with dexamethasone ( p = 0.001 ) , and a mean increase of 6.2 mmhg in patients previously observed to have a mean increase of 12.1 mmhg with prednisolone acetate ( p < 0.001 ) . as noted above , a similar cross - over study with loteprednol etabonate resulted in a mean iop elevation of 4.1 mmhg over a six - week period ( ns vs baseline ) compared to 9.0 mmhg for prednisolone acetate ( p < 0.05 vs baseline ) . table 2 compares the efficacy and safety parameters evaluated in the above - mentioned studies on rimexolone.table 2studies demonstrating the efficacy and safety of rimexolone 1 % for postoperative inflammationstudy parametersbron et al . comparatorplaceboplacebopapapa and ketorolacno . of patients182197804845treatment duration ( weeks)2up to 2224patients with resolution of aci at final visit ( % ) rimexolone60 % rimexolone60 % not reportednot reportednot reportedvehicle28 % placebo32 % mean iop at final visitno perceptible changes in iopmean decrease in iop in both treatment groups compared to baselinerimexolone13.0 3.2 mmhgrimexolone11.6 1.4 mmhgrimexolone13.25 mmhgpa group14.60 mmhgpa group11.7 2.9 mmhgpa group10.8 1.3 mmhgketorolac group13.73 mmhgclinically significant increases in iop ( 10 mmhg)not reportedn = 2 for rimexolone;not reportednot reportednot reportedn = 2 for placeboaci anterior chamber inflammation , iop intraocular pressure , pa prednisolone acetateresolution of aci defined as anterior chamber cell count < 5 and flare grade 0 ( none)the study did not report the percentages of patients with resolution of aci ; instead , mean cell and flare at study visits were reported studies demonstrating the efficacy and safety of rimexolone 1 % for postoperative inflammation aci anterior chamber inflammation , iop intraocular pressure , pa prednisolone acetate resolution of aci defined as anterior chamber cell count < 5 and flare grade 0 ( none ) the study did not report the percentages of patients with resolution of aci ; instead , mean cell and flare at study visits were reported in summary , vehicle - controlled studies with rimexolone suggested similar treatment effects compared to loteprednol etabonate for the control of postoperative inflammation with minimal iop impact . however , contrary to comparative studies with loteprednol etabonate , studies comparing rimexolone with prednisolone acetate suggest rimexolone s clinical efficacy may not be as robust as that of prednisolone . difluprednate ophthalmic emulsion , 0.05 % , has also been approved for postoperative anti - inflammatory use in the united states . like loteprednol etabonate , difluprednate is a derivative of prednisolone . structural modifications include the addition of fluorine atoms at both the c-6 and c-9 positions , a butyrate ester at the c-17 position and acetate ester at the c-21 position ( fig . 2 ) . however , difluprednate retains the c-20 ketone moiety of prednisolone . evaluated the safety and efficacy of difluprednate 0.05 % versus placebo for postoperative inflammation in two identical double - masked , placebo - controlled studies . patients ( n = 438 ) with anterior chamber cell grade 2 one day after ocular surgery were randomized to difluprednate twice daily , difluprednate four times daily or placebo ( n = 110 in each study ) for 14 days followed by a 14 day tapering period . primary assessment included the resolution of anterior chamber cells , proportion of patients with clinical response , and absence of pain / discomfort . for comparative purposes , only the proportion of patients with clinical response ( defined as 5 cells and no flare ) is summarized here . by day 15 , clinical response was observed in 72.7 % of patients receiving difluprednate twice daily and 71.0 % of patients receiving difluprednate four times daily compared to approximately 27 % of patients receiving placebo ( difference ~45 % , p < 0.0001 vs placebo ) . proportions for pain - free patients and secondary measures of photophobia , chemosis , corneal edema , and conjunctival injection were all significantly better in the difluprednate groups compared to placebo groups . in terms of safety , mean iop remained within normal range in all treatment groups ; however , three patients ( 3 % ) in each of the difluprednate treatment groups experienced clinically significant increases in iop compared with two patients ( 1 % ) in the placebo group . studied the clinical efficacy of difluprednate administered twice daily for managing ocular inflammation and pain following cataract surgery . patients ( n = 121 ) were randomized to receive either difluprednate or placebo twice daily for 16 days ; this was followed by a 14 day tapering period . this study differed from previous studies in that dosing was initiated 24 h before ocular surgery . resolution of cells ( 5 cells ) and grade 0 flare was observed in 74.7 % of difluprednate patients compared to 42.5 % of placebo patients ( difference = 32 % ; p = 0.0006 ) . significant differences were also observed between the two groups in the proportions of patients that were free of ocular pain and discomfort ( difference = 34.6 % ; p = 0.0004 ) . as in the study by korenfeld three subjects ( 3.7 % ) in the difluprednate group had a clinically significant increase in iop ( 10 mmhg ) . further details of the above - mentioned trials are provided in table 3.fig . 2structures of loteprednol etabonate ( a ) , rimexolone ( b ) and difluprednate ( c)table 3studies demonstrating the efficacy and safety of difluprednate for postoperative inflammationstudy parameterskorenfeld et al . duration15 days16 day treatment periodpatients with a clinical response ( % ) difluprednate bid72.7difluprednate74.7 % difluprednate qid71placebo42.5mean iop at final visitno significant changes from baseline for the difluprednate group reportednot reportedclinically significant increases in iop ( 10 mmhg)n = 3 for difluprednate bid;n = 3 for difluprednaten = 3 for difluprednate qid;n = 2 for placeboaci anterior chamber inflammation , bid twice daily , qid 4 times daily , iop intraocular pressurethe treatment period was followed by a 2 week tapering period before treatment was stoppedclinical response defined as anterior chamber cell count < 5 and flare grade 0prior to commencement of dose - tapering structures of loteprednol etabonate ( a ) , rimexolone ( b ) and difluprednate ( c ) studies demonstrating the efficacy and safety of difluprednate for postoperative inflammation aci anterior chamber inflammation , bid twice daily , qid 4 times daily , iop intraocular pressure the treatment period was followed by a 2 week tapering period before treatment was stopped clinical response defined as anterior chamber cell count < 5 and flare grade 0 prior to commencement of dose - tapering in summary , while the above placebo - controlled studies suggest difluprednate has a similar treatment effect to loteprednol etabonate , the impact of difluprednate on iop may be greater . indeed , cable reported significant elevations of iop in patients undergoing uncomplicated cataract surgery administered difluprednate twice daily following surgery . in this retrospective chart review of 100 consecutive patients , all patients had a history of open - angle glaucoma , but were not known steroids responders , and the average increase in iop was 17.8 mmhg . the iop increases were managed by the discontinuation of difluprednate , and the administration of topical glaucoma medication if required . in contrast , iop of 10 mmhg was seen on average in 1.4 % of loteprednol etabonate treated patients in vehicle - controlled clinical studies and as few as 1.7 % of long - term users of loteprednol etabonate [ 35 , 46 ] . figure 3 compares the resolution of cells and flare in clinical studies of loteprednol etabonate 0.5 % , rimexolone 1 % , and difluprednate 0.5 % for postoperative inflammation following uncomplicated cataract surgery , based on vehicle - controlled studies.fig . 3resolution of cells and flare in clinical studies of loteprednol etabonate 0.5 % , rimexolone 1 % , and difluprednate 0.5 % for postoperative inflammation following uncomplicated cataract surgery . resolution of cells and flare was defined as 5 cells and none - to - trace flare in loteprednol etabonate and rimexolone studies and < 5 cells and no flare in difluprednate studies resolution of cells and flare in clinical studies of loteprednol etabonate 0.5 % , rimexolone 1 % , and difluprednate 0.5 % for postoperative inflammation following uncomplicated cataract surgery . resolution of cells and flare was defined as 5 cells and none - to - trace flare in loteprednol etabonate and rimexolone studies and < 5 cells and no flare in difluprednate studies as evidenced by a comprehensive review of the data from published studies , loteprednol etabonate is effective in resolving anterior chamber cells and flare as well as in reducing postoperative pain and discomfort . based on the available data , loteprednol etabonate offers efficacy similar to older corticosteroids such as prednisolone acetate , with a much - reduced effect on iop , thereby presenting an improved safety profile as compared to these older compounds . extensive searches through the available literature have demonstrated a lack of direct head - to - head studies comparing loteprednol etabonate to other newer corticosteroids ( such as rimexolone and difluprednate ) formally approved for this indication . in order to address this gap , we compared the relative safety and efficacy of loteprednol etabonate with these newer corticosteroids across vehicle - controlled studies and by examining data from studies in which these compounds were compared to older corticosteroids . based on our results , loteprednol etabonate provides similar efficacy to rimexolone and difluprednate by offering similar rates of resolution of ocular inflammation . the use of loteprednol etabonate , however , seems to be associated with fewer clinically significant increases in iop ( 10 mmhg ) , thereby reducing the risk of corticosteroid - induced ocular hypertension and eventual corticosteroid - induced glaucoma . while these results provide significant insights into the effects of these newer corticosteroids , high quality , active - controlled , randomized clinical trials between these compounds are needed to assess their comparative safety and efficacy .

topical corticosteroids are routinely used as postoperative ocular anti - inflammatory drugs ; however , adverse effects such as increased intraocular pressure ( iop ) are observed with their use . while older corticosteroids such as dexamethasone and prednisolone acetate offer good anti - inflammatory efficacy , clinically significant increases in iop ( 10 mmhg ) are often associated with their use . loteprednol etabonate , a novel c-20 ester - based corticosteroid , was retrometabolically designed to offer potent anti - inflammatory efficacy but with decreased impact on iop . after exerting its therapeutic effects on the site of action , loteprednol etabonate is rapidly converted to inactive metabolites , resulting in fewer adverse effects . randomized controlled studies have demonstrated the clinical efficacy and safety of loteprednol etabonate ophthalmic suspension 0.5 % for the treatment of postoperative inflammation in post - cataract patients with few patients , if any , exhibiting clinically significant increases ( 10 mmhg ) in iop . furthermore , safety studies demonstrated a minimal effect of loteprednol etabonate on iop with long - term use or in steroid responders with a much lower propensity to increase iop relative to prednisolone acetate or dexamethasone . the anti - inflammatory treatment effect of loteprednol etabonate appears to be similar to that of rimexolone and difluprednate with less impact on iop compared to difluprednate , although confirmatory comparative studies are needed . the available clinical data suggest that loteprednol etabonate is an efficacious and safe corticosteroid for the treatment of postoperative inflammation .

cerebral inflammation plays an important role in the pathogenesis of secondary brain injury following traumatic brain injury ( tbi ) [ 1 , 2 ] . proinflammatory nuclear factor kappa b ( nf-b ) signaling pathway has been well documented in previous studies of our laboratory [ 3 , 4 ] . increased levels of inflammatory agents with the injured brain , including tumor necrosis factor- ( tnf- ) , interleukin-1 ( il-1 ) , interleukin-6 ( il-6 ) , and intercellular adhesion molecule 1 ( icam-1 ) , are believed to contribute to the cerebral damage . their mediator nf-b activation enhances the transcription of proinflammatory cytokines , and the cytokines are known to in turn activate nf-b . the positive feedback is believed to serve to amplify inflammatory signals and exacerbate brain injury after tbi . recent researches have demonstrated that nuclear factor erythroid 2-related factor 2 ( nrf2 ) , a key transcription factor that regulates the cellular antioxidant response , plays a broader role in modulating acute inflammatory response [ 8 , 9 ] . under basal conditions , nrf2 is sequestered in the cytoplasm by the cytosolic regulatory protein keap1 . in conditions of oxidative or xenobiotic stress , nrf2 translocates from the cytoplasm to the nucleus , and sequentially binds to a promoter sequence called the antioxidant response element ( are ) , resulting in a cytoprotective response which is characterized by upregulation of a group of antioxidant enzymes and decreased sensitivity to oxidative damage [ 1012 ] . these antioxidant enzymes have also been shown to protect cells against acute inflammatory response . numerous studies have reported that nrf2 plays a critical role in counteracting inflammation in a variety of experimental models . nrf2 protects against allergen - mediated airway inflammation , cigarette smoke - induced emphysema , dextran sulfate sodium ( dss)-mediated colitis , inflammation - mediated colonic tumorigenesis , and inflammatory responses during skin wound healing . furthermore , nrf2 has also been reported as a crucial regulator of the innate immune response and survival during experimental sepsis . in one of our previous studies therefore , it may be reasonable to postulate that nrf2 plays an important role in limiting the cerebral inflammatory response after tbi . in our study , we evaluated the influence of nrf2 genotype on the cerebral upregulation of nf-b activity , proinflammatory cytokine , and icam-1 after tbi . our experiments were conformed to guide for the care and use of laboratory animals from national institutes of health and approved by the animal care and use committee of nanjing university . thomas w. kensler ( johns hopkins university , baltimore , md , usa ) . homozygous wild - type nrf2 ( + /+ ) and nrf2 ( /)-deficient mice were generated from inbred heterozygous nrf2 ( + / ) mice . genotypes of nrf2 ( + /+ ) and nrf2 ( / ) mice were confirmed by pcr amplification of genomic dna isolated from the blood . pcr amplification was carried out by using three different primers , 5-tggacgggactattgaaggctg-3 ( sense for both genotypes ) , 5-cgccttttcagtagatggagg-3 ( antisense for wild - type ) , and 5-gcggattgaccgtaatgggatagg-3 ( antisense for lacz ) . age- and weight - matched adult male mice ( 68 weeks , 2832 g ) were separated into four groups ( n = 10 per group ) : group i , sham wild - type ( nrf2 + /+ ) ; group ii , injured wild - type ( nrf2 + /+ ) ; group iii , sham - deficient ( nrf2 / ) ; group iv , injured - deficient ( nrf2 / ) . the mice of sham and injured groups were subjected to identical anesthetic alone or experimental tbi , respectively . five mice in each group were sacrificed for electrophoretic mobility shift assay ( emsa ) and enzyme - linked immunosorbent assay ( elisa ) analysis and the others were for immunohistochemistry study . the mouse model of tbi was employed as described with recent minor modification . the mice were anesthetized by intraperitoneal injection with sodium pentobarbital ( 50 mg / kg ) . a round , flat , and 6 mm diameter teflon impounder was centered between the ears and eyes . tbi was induced by a 100 g weight dropped from a 12 cm height along a stainless steel string , which translated into 1200 g / cm . brain injury - induced apnea was then treated for 3 minutes with 100% oxygen administration and chest compression to stimulate the respiration . this model is generally associated with 20% of mortality within the first 5 minutes postinjury and no delayed mortality was observed thereafter . heart rate , arterial blood pressure , and rectal temperature were monitored , and the rectal temperature was kept at 37 0.5c ( physical cooling if required ) throughout experiments . at the 24 hours following sham or injury , cortex tissue was rapidly taken from the fresh brain at the site of lesion ( figure 1 ) , and stored in liquid nitrogen immediately . for immunohistochemistry , mice were perfused with cold saline ( 4c ) , followed by 4% neutral - buffered formalin . the cortex tissue was taken , stored overnight in 4% neutral - buffered formalin , and then embedded in paraffin . briefly , frozen brain samples were homogenized in 0.8 ml ice - cold buffer a composed of 10 mmol / l hepes ph 7.9 , 10 mmol / l kcl , 2 mmol / l mgcl2 , 0.1 mmol / l edta , 1 mmol / l dithiothreitol ( dtt ) , and 0.5 mmol / l phenylmethylsulfonyl fluoride ( pmsf ) ( all from sigma chemical co. , st . louis , mo , usa ) . the homogenates were incubated on ice for 30 minutes and vortexed for 30 seconds after addition of 50 l 10% np-40 ( sigma chemical co. , mo , usa ) . the mixture was then centrifuged for 10 minutes ( 5000 g , 4c ) . the pellet was suspended in 100 l ice - cold buffer b composed of 50 mmol / l hepes ph 7.9 , 50 mmol / l kcl , 300 mm nacl , 0.1 mmol / l edta , 1 mmol / ldtt , and 0.5 mmol / l pmsf , and 10% ( v / v ) glycerol and incubated on ice 30 minutes with frequent mixing . after centrifugation ( 12000 g , 4c ) for 15 minutes , the supernatants were collected as nuclear extracts and stored at 70c for further use . protein concentration was determined using a bicinchoninic acid assay kit with bovine serum albumin as the standard ( pierce biochemicals , rockford , ill , usa ) . emsa was performed using a commercial kit ( gel shift assay system ; promega , madison , wis , usa ) following the methods in our laboratory . consensus oligonucleotide probe ( 5-agttga ggggactttcccaggc-3 ) was end - labeled with [ -p]atp ( free biotech . , nuclear protein ( 10 g ) was preincubated in a total volume of 9 l in a binding buffer , consisting of 10 mmol / l tris - hcl ( ph 7.5 ) , 4% glycerol , 1 mmol / l mgcl2 , 0.5 mmol / l m edta , 0.5 mmol g / l poly-(deoxyinosinic - deoxycytidylic acid ) for 15 minutes at room temperature . after addition of the 1 l p - labled oligonucleotide probe , the incubation was continued for 20 minutes at room temperature . reaction was stopped by adding 1 l of gel loading buffer and the mixture was subjected to nondenaturing 4% polyacrylamide gel electrophoresis in 0.5 tbe buffer ( tris - borate - edta ) . after electrophoresis was conducted at 390 v for 1 hour , the gel was vacuum - dried and exposed to x - ray film ( fuji hyperfilm , tokyo , japan ) at 70c with an intensifying screed . levels of nf-b dna binding activity were quantified by computer - assisted densitometric analysis . frozen brain samples were homogenized in 1 ml of buffer containing 1 mmol / l of pmsf , 1 mg / l of pepstatin a , 1 mg / l of aprotinin , and 1 mg / l of leupeptin in pbs solution ( ph 7.2 ) with a glass homogenizer and then centrifuged at 12000 g for 20 minutes at 4c . the supernatant was then collected and total protein was determined by the bradford method . the levels of inflammatory cytokines were quantified using enzyme - linked immunosorbent assay ( elisa ) kits specific for mouse according to the manufacturers ' instructions ( tnf- from diaclone research , france ; il-1 , il-6 from biosource europe sa , belgium ) and previous study of our laboratory . the paraffin - embedded sections ( 4 m ) were used for immunohistochemical assay , which was performed with a goat antimouse icam-1(cd54 ) antibody ( diluted 1:200 , r&d systems , inc . , minn , usa ) , according to previous studies of our laboratory . the sections were incubated with the diluted antibody overnight at 4c in a humid chamber , washed , and blocked with 1.6% h2o2 in phosphate - buffered saline ( pbs ) for 10 minutes . after washing with pbs again , sections were then incubated with biotinylated second antibodies for 1 hour at room temperature . diaminobenzidine ( dab ) was used as chromogen and counterstaining was done with hematoxylin . the number of positive microvessels in each section was counted in 10 microscopic fields ( at 100 magnifications ) and averaged for the positively immunostained vessel number of per visual field . all data were expressed as mean sem , student 's t - test was used to analyze the differences between the sham and tbi groups within a single genotype as well as between genotypes . nf-b activation in the nuclear extracts was assessed by emsa . as shown in figure 2 , low nf-b banding activity ( weak emsa autoradiography ) tbi induced activation of nf-b in the cortex of both nrf2 ( + /+ ) and nrf2 ( / ) mice . nrf2 ( / ) mice showed an increased susceptibility to tbi - induced activation of nf-b than their wild - type nrf2 ( + /+ ) counterparts . concentrations of tnf- , il-1 , and il-6 in the brain samples were measured by elisa . as shown in figure 3 , low concentrations of tnf- , il-1 , and il-6 tbi induced upregulation of tnf- , il-1 , and il-6 in the cortex of both nrf2 ( + /+ ) and nrf2 ( / ) mice . nrf2 ( / ) mice showed larger increase in cortical levels of tnf- , il-1 , and il-6 than their wild - type nrf2 ( + /+ ) littermates after tbi . for assessment of the expression of icam - a in the brain after tbi , immunohistochemical study for icam-1 was performed . as shown in figure 4 , few icam-1-immunostained cerebral microvessels were observed in sham - operated mice of both genotypes . at the 24 hours after tbi , the number of icam-1 positive vessels was significantly increased in the cortex of both nrf2 ( + /+ ) and nrf2 ( / ) mice . nrf2 ( / ) mice showed larger increase in the number of icam-1 positive vessels than their wild - type nrf2 ( + /+ ) littermates after tbi . the most important finding of this study is that nrf2 ( / ) mice had more inflammatory cytokines tnf- , il-1 and il-6 production , icam-1 expression , and their mediator nf-b activation in brain after tbi compared with their wild - type nrf2 ( + /+ ) counterparts . these findings reported here suggest for the first time that nrf2 may play an important role in limiting the cerebral inflammatory response after tbi through modulating the proinflammatory nuclear factor kappa b ( nf-b ) signaling pathway . activation of nf-b signaling pathway has been shown to be central to the pathophysiology of cerebral inflammatory response induced by tbi [ 6 , 7 ] . nf-b can be activated by lesion - induced oxidative stress , bacterial endotoxin , and cytokines . the functional importance of nf-b in inflammation is based on its ability to regulate the promoters of multiple inflammatory genes , including tnf- , il-1 , il-6 , and icam-1 . tnf- is reported to be a major initiator of inflammation and is released early after an inflammatory stimulus . il-6 is increased after tnf- and is considered to be an important proinflammatory cytokine in contribution to both morbidity and mortality in condition of uncontrolled inflammation . icam-1 , a member of the immunoglobulin superfamily which can be profound induced after cytokine challenge , is important in the recruitment of leukocytes during the inflammatory process . this inflammatory agent network is believed to be important in the generation of acute inflammatory response . nf-b activation enhances the transcription of proinflammatory cytokines , and the cytokines are known to in turn activate nf-b . the positive feedback is believed to serve to amplify inflammatory signals and exacerbate brain injury after tbi . in the present study , we evaluated the influence of nrf2 genotype in the tbi - induced activation of proinflammatory nf-b signaling pathway in the brain . the results showed that disruption of nrf2 in mice caused a greater activation of nf-b signaling pathway which played a critical role in the pathophysiology of cerebral inflammatory response induced by tbi . the observed interplay between nrf2 and nf-b signaling corresponds well to the results of study on experimental sepsis , which have demonstrated that nrf2-deficient mice displayed increased nf-b activation in response to lipopolysaccharide ( lps ) . although numerous in vivo studies have reported that nrf2 plays a critical role in counteracting the inflammation in a variety of experimental models [ 1419 ] , the findings which we have confirmed and extended in the model of tbi in the present study , the precise mechanism underlying this network is still unclear . several lines of evidence suggest that nrf2 regulates the inflammatory response by inhibiting proinflammatory nf-b activation through maintenance of redox homeostasis . oxidative stress from reactive oxygen species ( ros ) is believed to be involved in the progression of secondary brain injury following tbi . activation of the nf-b signaling pathway has been shown to be responsive to excess ros and is important in the generation of inflammation . nrf2 , as a key antioxidant transcription factor involved in the intracellular antioxidant defense systems , has been shown to play an important role in limiting ros levels and thereby affect redox - sensitive nf-b signaling pathway involved in the inflammation [ 8 , 1012 ] . the protective function of nrf2 is mainly mediated by a group of nrf2-regulated antioxidant and detoxifying enzymes . therefore , the augmentation of cellular antioxidative or detoxification systems via activation of nrf2-regulated enzymes resulting in decreased proinflammatory cytokines production and adhesion molecules expression via inactivation of nf-b represents a possible anti - inflammatory mechanism for the attenuated inflammatory response seen in brains from nrf2 ( + /+ ) mice but not nrf2 ( / ) mice after tbi . we then in this study postulated that nrf2 regulates the tbi - induced cerebral inflammatory response may at least in part through modulating the cerebral redox status and proinflammatory nf-b signaling pathway . additional work is necessary to elucidate the whole mechanisms involved in these complicated networks . in summary , this present study showed that nrf2 plays a protective role in tbi - induced cerebral upregulation of inflammatory agents in mice . we found that nrf2 ( / ) mice are more susceptible to tbi - induced cerebral nf-b activation , inflammatory cytokine tnf- , il-1 and il-6 production , and icam-1 expression , which then contributed to exacerbated brain injury after tbi . to the best of our knowledge , this is the first study that elucidates the interplay between nrf2 and proinflammatory nf-b signaling pathway in the brain following tbi . these findings raise the possibility that nrf2 will be a new therapeutic target for the treatment tbi .

inflammatory response plays an important role in the pathogenesis of secondary brain injury after traumatic brain injury ( tbi ) . nuclear factor erythroid 2-related factor 2 ( nrf2 ) is a key transcription factor that plays a crucial role in cytoprotection against inflammation . the present study investigated the role of nrf2 in the cerebral upregulation of nf-b activity , proinflammatory cytokine , and icam-1 after tbi . wild - type nrf2 ( + /+ ) and nrf2 ( /)-deficient mice were subjected to a moderately severe weight - drop impact head injury . electrophoretic mobility shift assays ( emsas ) were performed to analyze the activation of nuclear factor kappa b ( nf-b ) . enzyme - linked immunosorbent assays were performed to quantify the production of tumor necrosis factor- ( tnf- ) , interleukin-1 ( il-1 ) , and interleukin-6 ( il-6 ) . immunohistochemistry staining experiments were performed to detect the expression of intercellular adhesion molecule-1 ( icam-1 ) . nrf2 ( / ) mice were shown to have more nf-b activation , inflammatory cytokines tnf- , il-1 and il-6 production , and icam-1 expression in brain after tbi compared with their wild - type nrf2 ( + /+ ) counterparts . the results suggest that nrf2 plays an important protective role in limiting the cerebral upregulation of nf-b activity , proinflammatory cytokine , and icam-1 after tbi .

patients with univentricular heart malformations are at increased risk of suffering from thromboembolic events ( te ) . at least 20% of patients with univentricular hearts have reported to experience te , of which 25% are fatal . despite the high incidence of te , no consensus has been reached regarding the role of long - term anti - thrombotic treatment in this group of patients . here , we present a case of a 19-year - old woman with a univentricular heart who suffered a major stroke . a 19-year - old woman born with a univentricular heart was found unconscious in her bed in the morning . she was respiratory and circulatory stable with no fever at admission to the local hospital . the glasgow coma scale score was 5 ( eyes , 1 ; verbal , 1 ; motor , 3 ) . an electrocardiogram showed sinus rhythm , left axis deviation , and left - sided hypertrophy , but was otherwise normal . a test of arterial blood gasses revealed a fully compensated metabolic acidosis with ph 7.37 ( normal range 7.377.45 ) and base excess 7.7 mm ( 3.0 to 3.0 mm ) . venous blood tests showed raised plasma lactate 3.7 mm ( 0.72.1 mm ) , plasma myoglobin 280 g / l ( 1949 g / l ) , plasma glucose 8.6 mm ( 4.27.2 mm ) , plasma fibrin d - dimer 1.0 mg / l ( 0.00.5 mg / l ) , and inr 1.5 ( < 1.2 ) , whereas the remaining standard tests were all normal , including hemoglobin , leucocyte differential count , electrolytes , c reactive protein , liver and pancreas enzymes , renal parameters , plasma ethanol , plasma paracetamol , and plasma salicylate . shortly after admission , the patient developed babinski reflexes and a pronounced decorticate posture with spontaneous flexion of the arms over the chest and extended legs with feet turned inward . after a tracheal tube was inserted and assisted ventilation was initiated , the patient was transferred to the neurological intensive care unit at a tertiary hospital . a repeated computed tomography scan and magnetic resonance imaging of the head were performed , as well as a computed tomography angiography of the head and the neck . these scans unveiled a major stroke located in the left cerebral ( figure 1 ) and cerebellar hemispheres , corresponding to the areas supplied by the left middle and posterior cerebral arteries and the left superior cerebellar artery . a segmental occlusion in the top of the basilar artery was identified ( figure 3 ) . finally , a transthoracic echocardiography was performed , revealing a well - functioning univentricular heart with no detectable thrombi . warfarin was prescribed and the patient gradually regained consciousness . however , a severe right - sided hemiparesis persisted and the patient was transferred to a local neurorehabilitation unit . later , a magnetic resonance imaging scan of the thorax and upper abdomen was performed ( figure 4 ) . the patient had been referred to a cardiologist at the age of 5 months due to shortness of breath and failure to thrive . cardiac ultrasound and catheterization had revealed a double inlet left ventricle ( figure 5 ) and a hypoplastic right ventricle without transposition of the great arteries . symptoms were caused by heart failure due to high pulmonary flow , which was treated by pulmonary artery banding . at the age of 6 years , a total cavopulmonary connection ( tcpc ) , including a lateral tunnel with fenestration to the right atrium , was established . the surgical procedure markedly improved the patient s well - being , and , at the age of 13 years , the fenestration was closed . life - long prophylactic antithrombotic treatment with salicylic acid was prescribed . during the last surgical intervention , the patient suffered mild brain damage and was now described as behaving at the level of a 12-year - old . postoperative echocardiography revealed good systolic function of the left ventricle and mild right atrioventricular valve regurgitation . since no cardiac thrombi were identified , it is not known whether the described stroke was caused by a cardiac - derived embolus or spontaneous cranial thrombi . spontaneous thrombi in 19-year old patients are , however , extremely rare . hence , seen in the light of a known cardiac malformation , the probability of a cardiac - derived cerebral embolus is very high . the incidence of univentricular hearts is reported to be between 0.5 and three cases per 10,000 live births.1 today , patients with univentricular heart conditions are usually treated surgically with a three - stage tcpc / fontan procedure,2 which separates the systemic and pulmonary venous return a precondition for adequate oxygenation of the arterial blood entering systemic circulation . the technique has evolved from the classic fontan3 ( right atrium - to - pulmonary artery connection ) through an intracardiac lateral tunnel procedure , and it is currently performed in many centers as an extracardiac tunnel procedure by insertion of a tube graft between the inferior vena cava and the pulmonary artery.4 te , both systemic venous and arterial , are a major cause of early and late mortality in tcpc patients . the reported incidence of te in these patients varies from 3% to 25% , depending on study design , imaging technique , and follow - up period duration . studies with longer follow - up periods and more sensitive imaging studies suggest an incidence of at least 20% , of which the mortality rate is 25%.59 asymptomatic pulmonary emboli have been detected in 16% of tcpc patients . although the etiology for the high risk of te is not well defined , possible explanations include abnormal blood flow in the univentricle , arrhythmias , venostasis , dehydration , protein - losing enteropathy , and coagulation abnormalities . no stratification of te risk has been made between the different types of surgical intervention . such data would be very useful and should be compared against the efficacy of each treatment . procoagulant factors ( factors ii , v , vii , ix , and x ; plasminogen ; and fibrinogen ) and anticoagulant factors ( protein c and antithrombin iii ) are lower than normal controls prior to stage two or three of tcpc completion.10,11 increased platelet reactivity prior to tcpc completion has also been shown . a recent report , however , found no significant differences in thromboelastography ( a global whole - blood assay of coagulation ) in pediatric tcpc patients compared with healthy children.12 despite the high incidence of te , no consensus has been reached about the role of long - term antiplatelet or anticoagulation therapy in those patients who remain in stable sinus rhythm . some studies advise against routine anticoagulation,13 whereas others recommend routine antiplatelet14 or anticoagulation therapy.15,16 one recent study suggests that antiplatelet and anticoagulation therapy are equally effective in preventing te.17 te reduce quality of life18 and cause sudden death19 in adult patients with fontan circulation . therefore , in these patients , the benefit of long - term prophylactic antiplatelet or anticoagulation therapy must be carefully considered and weighed against the risk of detrimental hemorrhagic side effects . disagreement about antithrombotic therapy in tcpc patients warrants future study that compares the different therapeutic strategies . future studies should most likely be observational case - control studies due to the practical and ethical problems associated with randomized controlled trials . the need for such studies is emphasized by the presented case , which might suggest that more aggressive antithrombotic strategies should be routinely introduced .

patients with univentricular heart malformations are at increased risk of suffering from thromboembolic events . we present a case of a 19-year - old woman born with a univentricular heart who suffered a major stroke while being treated with only salicylic acid . at least 20% of patients with univentricular hearts have been reported to experience thromboembolic events , of which 25% are fatal . despite the high incidence of thromboembolic events , no consensus has been reached regarding the role of long - term anti - thrombotic treatment in this group of patients . this lack of consensus warrants future studies that compare the different therapeutic strategies .