Datasets:

anumafzal94

/

pubmed-finetuning

like 0

dilatation of pulmonary arteries is a well - known clinical entity commonly encountered in many congenital and acquired heart lesions . idiopathic dilatation of pulmonary arteries ( idpa ) was first recognized as a benign anomaly in 1923 by wessler and jaches . the incidence of this disease is 6 cases per 1000 cases of congenital cardiac disorders . diagnosis of idpa is made after excluding all possible causes that can induce pulmonary artery ( pa ) dilatation . it is usually an incidental finding not fully explained by the patient symptoms and clinical condition . treatment is usually not required as it is considered to be a benign condition , although literature on long - term follow - up is lacking . a 68-year - old female presented with insidious onset gradually progressive shortness of breath from mmrc stage 1 to stage 3 for the last 10 years , which further increased over the past 2 months . she had no associated history of a cough , fever , palpitations , chest pain , pedal edema , orthopnea , or paroxysmal nocturnal dyspnea . on clinical examination , her vitals included pulse rate there was no pallor , icterus , cyanosis , pedal edema , or raised jugular venous pressure . 5600/dl with a differential count of neutrophils 72% , lymphocytes 10% , eosinophils 1% , and monocytes 7% . serum c - reactive protein level was normal ( 0.24 mg / dl ) with elevated serum brain natriuretic peptide levels ( 162 pg / ml ) . anti - nuclear antibodies along with anti - neutrophil cytoplasmic autoantibody levels and thyroid function tests were within normal limit , and there was no evidence of infectious diseases such as tuberculosis or syphilis . x - ray chest revealed mild cardiomegaly of the right ventricular ( rv ) type with mild right atrial dilatation and massive enlargement of the main pa with normal pulmonary vascular markings [ figure 1 ] . ( a ) chest x - ray showing dilated pulmonary artery , ( b ) contrast - enhanced computed tomography chest showing enlarged main pulmonary artery ( 49.75 mm ) , ( c ) contrast - enhanced computed tomography chest showing dilated left pulmonary artery ( 36.96 ) , ( d ) contrast - enhanced computed tomography chest showing dilated right pulmonary artery ( 37.76 mm ) , ( e ) contrast - enhanced computed tomography showing no evidence of pulmonary embolism , ( f ) computed tomography pulmonary artery reconstruction image showing dilated pulmonary artery echo - cardio - graphic findings revealed a normal - sized left ventricle and left atrium with 55% ejection fraction . rv was dilated with adequate systolic function , with dilated right atrium , mild tricuspid regurgitation , and mild pa hypertension ( mean pa pressure 36 mmhg ) . a computed tomography ( ct ) pulmonary angiography with high - resolution ct was done [ figures 1 and 2 ] which revealed dilated main pa with a maximum diameter of 49.75 mm , dilated right main trunk with a diameter of 37.76 mm , and dilated left trunk with a diameter of 36.96 mm . pulmonary function test revealed restrictive airway defect with a normal diffusing capacity of carbon monoxide . she was made to walk for 6 min in which she covered 216 meters without desaturation but had moderate fatigue and severe breathlessness at the end of the test . high - resolution computed tomography sections of lung showing ground glass opacities in lung parenchyma cardiac catheterization was done through right femoral vein / right femoral artery approach . rv angiogram showed the adequate systolic function of rv with normal pulmonary valve and massively dilated the main pa . results of right heart catheterization on the basis of mild symptoms and pulmonary artery pressure ( pap ) < 30 mmhg , a massive dilation of pa could not be explained so the diagnosis of idpa was made after ruling out all possible causes . kaplan et al . postulated it as mal - development of the entire pulmonary tree and congenital weakness of the arterial wall whereas assman thought of it as an unequal division of truncus arteriosus communis . in 1949 , greene et al . and associates established the following pathologic criteria for its diagnosis : simple dilatation of the pulmonary trunk with or without involvement of the rest of arterial treeabsence of intra - cardiac or extracardiac shuntsabsence of chronic cardiac or pulmonary diseaseabsence of arterial disease , such as syphilis , or more than minimal atheromatosis or arteriosclerosis of the pulmonary vascular tree . simple dilatation of the pulmonary trunk with or without involvement of the rest of arterial tree absence of intra - cardiac or extracardiac shunts absence of chronic cardiac or pulmonary disease absence of arterial disease , such as syphilis , or more than minimal atheromatosis or arteriosclerosis of the pulmonary vascular tree . in 1960 , deshmukh et al . , presented report of 13 patients in whom right heart catheterization was performed aimed at elaborating its clinical and physiological aspects and to further draw attention to this anomaly . they opined that normal pressure in the rv and pa should be introduced as the fifth criteria in the diagnosis . our case showed massive dilatation of pa with no apparent intra- or extra - cardiac shunt or any significant heart or lung disease . on right heart catheterization , pap was only 28 mmhg which does not explain the massive dilatation of pa in our case thus confirming the diagnosis . in spite of the well - marked clinical , radiologic and electrocardiographic features , the absence of shunt , the normal relationship in cardiac chambers and normal oxygen saturation are important findings . long - term prognosis of idpa is usually excellent compared to pathological dilatation of pa . however not much data on long - term follow - up of these patients exist . management is also not well established , and any patient with an apparent diagnosis of idiopathic pulmonary hypertension needs to be followed up for a long time to know its benign course . our case adds to the existing literature and spreads physician awareness about this entity and its diagnosis , which should be established after ruling out all possible causes of pulmonary dilatation .

idiopathic dilatation of pulmonary arteries ( idpa ) is a rare abnormality of pulmonary arteries , the reported incidence in literature being as low as 0.007% in autopsy samples . with the improvement in diagnostic modalities , antemortem diagnosis of idpa has been increasingly established by excluding diseases that induce pulmonary arterial enlargement . here , we present a rare case of idiopathic dilatation of the pulmonary artery admitted with shortness of breath where idpa was diagnosed as an incidental finding using computed tomography pulmonary angiography and cardiac catheterization .

laparotomy with cornual wedge resection or hysterectomy has been the traditional treatment for the rare cases of cornual pregnancy . in the last 2 decades , several reports have been published of minimally - invasive surgical techniques used to successfully treat cornual ectopic pregnancies . consistent with the goals of minimally - invasive surgery , these techniques have introduced a surgical alternative with reduced blood loss , less postoperative pain , shorter hospital stay , and a more expeditious recovery . in this report , we describe a simple , stepwise laparoscopic technique used successfully for the management of two patients with large cornual pregnancies , along with a review of risks , benefits , and the pertinent literature . carol was a 28-year - old , african american female , gravida 3 , para 2 at 8-weeks gestation based on her last menstrual period . she originally presented to the emergency department complaining of intermittent vaginal bleeding for 24 hours . her medical history was significant for morbid obesity , pseudotumor cerebri , sagittal sinus thrombosis , and asthma complicated by a previous lung collapse requiring intubation . her obstetric history revealed one uncomplicated , full - term pregnancy with a normal vaginal delivery . her second pregnancy was complicated by cervical incompetence requiring rescue cerclage placement , but ended successfully with a normal vaginal delivery at term . the patient reported no plans for future pregnancies and that this was an undesired pregnancy . her physical examination on presentation showed stable vital signs , a benign abdominal and pelvic examination with minimal old blood in the vaginal vault . abdominal and transvaginal ultrasounds revealed an eccentric gestational sac , 2.7 cm x 2.5 cm , located in the right uterine fundus with a thin myometrial mantle measuring 3.5 mm in thickness , consistent with an interstitial tubal pregnancy . the embryo had a crown - rump length of 7.7 mm , with no cardiac activity . after much discussion and counseling regarding treatment options including the limited data on the risk of uterine rupture with future pregnancy , the decision was made to proceed with laparoscopic surgical excision . during the course of these discussions , the patient received one dose of intramuscular methotrexate with planned outpatient management , but she was then brought back to the hospital on day 3 for definitive surgical management , as the consensus among the providers was that definitive surgical treatment was more prudent . an intact 6 cm x 4 cm right cornual pregnancy with a thinned - out hyperemic myometrial capsule was noted ( figure 1 ) . dilute vasopressin ( 10 iu in 100 ml of normal saline ) was prepared , and a total of 46 ml was injected throughout the cornual pregnancy by using a long 20-gauge spinal needle , introduced directly through the anterior abdominal wall in the midline under direct visualization with the laparoscope . a linear incision was made with monopolar cautery in the thin myometrial capsule , along the long axis of the cornual pregnancy . a well - formed gestational sac was clearly identified and expressed from the cornua using blunt , sharp and hydro - dissection ( figure 3 ) . a large , very thin capsule ( mantle ) overlying the myometrium that had previously housed the ectopic pregnancy was noted and excised at the base in an elliptical fashion , with bipolar cautery and scissors . significant myometrial thickness was still maintained at the base of the cornua , and no gross myometrial defect was noted . the remaining myometrial bed at the right cornua was judiciously cauterized to obtain excellent hemostasis ( figure 4 ) . the specimen was retrieved from the pelvis with the 10-mm autosuture endo catch ( us surgical , norwalk , ct ) and sent to pathology where the diagnosis of an ectopic pregnancy was confirmed . a spinal needle introduced directly through the abdominal wall . a linear incision along the capsule of the cornual pregnancy has been made after complete blanching with vasopressin . only a minimal portion of the right cornua has been removed ( minicornual excision ) with complete excision of the ectopic gestation . the patient tolerated the procedure well with a total operative time of 2 hours and estimated blood loss of 50 ml . the patient 's quantitative -hcg was closely followed until it returned to essentially zero ( table 1 ) . traditionally , cornual ectopic gestations have been treated with exploratory laparotomy and wedge resection of the uterine cornua or even hysterectomy . with the advent of minimally - invasive techniques and the growing evidence and expertise in the field , laparoscopic mini - cornual excision offers a valuable option for patients desiring definitive minimally - invasive surgical treatment of cornual ectopic pregnancy . because patient safety is always the prime goal , mini - cornual excision for cornual pregnancies should only be recommended to hemodynamically stable patients in a tertiary care facility with the necessary laparoscopic skills and expertise to ensure patient safety . the availability of blood products , immediate anesthesia , and critical care staff , and surgical equipment and facilities are also essential for the safe practice of this minimally - invasive procedure . with these conditions and appropriate patient selection , laparoscopic treatment of interstitial pregnancy offers significant advantages over laparotomy , such as short hospital stay , faster return to normal activities , and decreased health care cost , without compromising treatment or patient safety . as illustrated in this case series , we advocate a simple method of a stepwise , minimally - invasive treatment of cornual ectopic pregnancies . several reports over the last 2 decades have illustrated various techniques for treatment of cornual pregnancy , including methotrexate injection , cornuostomy , salpingostomy , and the use of endoloop ( ethicon , cincinnati , ohio ) for small cornual pregnancies . several reports have also indicated the need for ligation of the ascending branches of the uterine arteries or mesosalpingeal vessels to maintain hemostasis . one can argue that suturing may decrease the risk of future uterine rupture , but at this time , evidence is minimal that either approach is superior . in this stepwise technique of mini - cornual excision ( table 2 ) , excellent hemostasis is adequately achieved with generous injection of dilute vasopressin along with judicious use of cautery to minimize tissue necrosis . no vascular ligation is utilized , maintaining adequate blood supply and avoiding the unnecessary tissue ischemia that potentially impairs healing and compromises the tensile strength of the cornual region , negatively impacting future pregnancies . in our technique , only a minute portion of the cornua is excised ( the thin overlying myometrial capsule ) , preserving most of the integrity and architecture of the uterus and likely maintaining significant tensile strength at the surgical site . simply stated , the cornual pregnancy is deroofed , leaving the base intact . stepwise approach for mini - cornual excision several important issues associated with mini - cornual excision must be addressed , including hemorrhage , chronic ectopic pregnancy , recurrent cornual pregnancy , and the care of future pregnancies . risk of hemorrhage remains the paramount concern for all clinicians caring for women with cornual ectopic pregnancies . mini - cornual excision is not advisable in cases of ruptured cornual pregnancy due to the catastrophic hemorrhage and the associated hypovolemic shock commonly encountered in these cases . expeditious laparotomy after initial resuscitation remains the mainstay in such cases . the same principle applies if uncontrollable hemorrhage is encountered during laparoscopic mini - cornual excision . however , several measures can be used preemptively to minimize this possibility , such as vasopressin and bipolar cautery in this case , and the use of endoloops prior to manipulation of the cornual pregnancy . the potential for chronic ectopic pregnancy due to inadequate removal of the ectopic gestation is a rare but real concern . non - excisional management options for cornual pregnancy , such as methotrexate , cornuostomy , salpingostomy , and including mini - cornual excision , all carry a small risk of incompletely removing the cornual gestation and the persistence of chorionic villi in the cornua . this is usually diagnosed by failure of serum hcg to drop to non - pregnant levels . the advantage that mini - cornual excision offers over other methods is that the cornual pregnancy is deroofed , providing easy access that facilitates complete removal of the gestational sac and chorionic villi , minimizing the risk of chronic cornual pregnancy . however , more studies are necessary to examine and compare this new technique with other non - excisional methods . recurrent cornual pregnancy remains a risk , similar to any surgical treatment for an ectopic gestation at any site . conservative management of cornual pregnancy , i.e. , without radical cornual resection , obviously carries a risk of recurrence at the same location . patients should be carefully counseled about the associated risks of cornual pregnancy resection as well as the benefit of maintaining uterine integrity , vascularity , and structure , especially in patients desiring future fertility . risk to future pregnancies and the care of any subsequent pregnancies remain valid concerns after mini - cornual excision , particularly regarding the potential risk of uterine rupture . this concern originates from the potential risk of leaving a weakened cornual region following mini - cornual excision , allowing for potential uterine rupture with future gestations . in addition , excessive use of electrocautery may cause significant concealed damage to the myometrium that can further weaken the cornual region and increase the risk of uterine rupture with future pregnancies . if a significant gap is created in the cornual region while evacuating the contents , the incision should be approximated with laparoscopic suturing , and , if not feasible , a minilaparotomy may be necessary . these considerations should be clearly addressed when counseling patients regarding their management options and the risk of uterine rupture with future pregnancies . with regards to the care of future pregnancies , all patients should be carefully counseled on the importance of early presentation with future pregnancies for complete evaluation , primarily to rule out a recurrent cornual or ectopic pregnancy , and also to establish reliable dates and timely delivery plans . two case reports describe successful , uncomplicated vaginal delivery following laparoscopic management of cornual pregnancy . however , at this time , we recommend close monitoring of future pregnancies for patients treated conservatively for cornual pregnancy , with a planned cesarean delivery at term or upon failure of tocolytic therapy for preterm labor . cornual pregnancy is a potentially life - threatening condition that should be managed safely in a timely fashion . the stepwise approach presented here ; mini - cornual excision , achieves a rapid , systematic , safe , and definitive treatment of cornual pregnancy that is minimally - invasive with minimal blood loss and rapid return to normal activities . careful patient selection and counseling regarding treatment options is essential , particularly for patients desiring future pregnancy .

cornual pregnancy often poses a diagnostic and therapeutic challenge , with a significant risk for morbidity and mortality . traditional treatment for cornual pregnancy has been through laparotomy , wedge resection , or hysterectomy . early diagnosis is now possible through transvaginal ultrasonography and highly - sensitive -human chorionic gonadotropin assays . consequently , several less - invasive therapies and techniques have been introduced over the last 2 decades . we present a simple , stepwise laparoscopic technique for the definitive , minimally - invasive excision of cornual pregnancy , along with a review of the pertinent literature .

exercise physiology and the salutatory effects on weight loss , fat reduction , and insulin sensitivity have been described in great detail . these beneficial effects are now considered to reflect , at least in part , the effect of exercise on the activation of amp - activated protein kinase ( ampk ) . in obese non - diabetics , exercise has been shown to reduce the risk of developing type 2 diabetes by up to 46% . physical training , consisting of 20 min cycling or running , 20 min swimming at submaximal heart rate , followed by 20 min of warm up / cool down three times per week for 4 wk , resulted in a significant reduction in body weight and percentage body fat , and this was associated with improved whole - body glucose uptake , decreased fasting insulin concentrations , and increased circulating adiponectin and mrna expression in muscle . among patients with type 2 diabetes mellitus , increasing exercise led to a reduction in fasting plasma glucose . the 24-hour energy expenditure , whether measured in a respiratory chamber or by using doubly labelled water , increases linearly with increasing body weight . multivariate analysis shows that fat - free mass is the major determinant of energy expenditure , with minor influences of fat mass , age , and gender . nevertheless , the considerable interindividual variation is currently unexplained . there is at the present time little evidence for major adaptations of energy expenditure during overfeeding , and changes in body weight and body composition appear to be the major factors that , by increasing energy expenditure , allow energy balance to be restored . the body - weight gain may therefore be seen as an adaptative change to overfeeding [ 6 , 7 ] . total energy expenditure can be subdivided into three main components : basal metabolic rate ( bmr ) ; the thermic effect of food , or diet - induced thermogenesis ; energy expended in physical activity ( pha ) . the first two components can be measured opportunely with reasonable accuracy and have been fully studied in lean and obese subjects . there is actually no clear evidence that a low bmr is a factor in the development of obesity , even if the issue continues to be debated [ 8 , 9 ] . the thermic effect of food , and more specifically the thermic effect of carbohydrate , has been shown to decrease in obese subjects [ 10 , 11 ] . this decrease may , nevertheless , be secondary to obesity - related insulin resistance and is of too small magnitude to account for a major weight gain . nonexercise activity thermogenesis ( neat)the energy expended for everything we do that is not sleeping , eating , or sports - like exercise and pha , that is crucial for weight control , may be important in the physiology of weight change . we review the current concepts about energy expenditure and evaluate the pha in the context of this knowledge and the available literature . during pha , mechanical work associated with muscle contractions clearly requires energy . as a result of the associated loss of energy as heat during atp synthesis in the mitochondria and atp hydrolysis during muscular contraction , pha may thus have a major impact on the total 24-hour energy expenditure and energy balance . based on the possible means by which alterations in pha can impact on 24-hour energy expenditure and energy balance , the following hypotheses can be formulated . this response would induce to a lower energy expenditure for any given work load and would probably contribute to the realization of a positive energy balance in affected subjects . it was further shown to be similar in both lean and post - obese women . there is then little reason to suppose that this factor might be involved in body - weight gain . , nevertheless , showed that a common polymorphism of uncoupling protein 2 , a protein with close homology to the uncoupling protein of brown adipose tissue ubiquitously expressed in man , was associated with a lower energetic efficiency of muscle contractions . therefore , brown adipose tissue , where uncoupling protein 1 ( ucp1 ) activity uncouples mitochondrial respiration , is an important site of facultative energy expenditure . ucp1 single nucleotide polymorphisms ( snps ) could represent thrifty factors that promote energy storage in prone subjects . these observations and the relationship between this polymorphism and body weight remain to be further evaluated . bmr is higher in trained subjects than in sedentary subjects of the same weight , but the difference can be principally ascribed to changes in body composition , with a lower fat mass and a higher fat - free mass , metabolically active body mass in trained athletes . when exercise training is associated with a substantial negative energy balance , bmr may better still decrease . the increase in energy expenditure induced by a -adrenergic stimulation , derived by mental stress , was also found to be unchanged in obese subjects after a 6-week period of physical training . third , the total energy expended in pha , that is , the period of time devoted daily to pha , may play an important role in determining energy balance . nevertheless , this component of daily energy expenditure is actually very difficult to assess accurately . the doubly labelled water method permits evaluation of total energy expenditure under conditions of everyday life over several days and , therefore , is likely to include habitual pha . the difference between the total energy expenditure and the basal energy expenditure , the suprabasal energy expenditure ( see ) , comprises both the thermic effect of food and pha . this finding strongly suggests that the amount of energy expended in pha is low in obese subjects . whether a low pha exists before obesity , or is merely a consequence of it , remains an open question at the present time . the conclusion from the substantial literature on this topic is that during an acute bout of exercise in untrained fed subjects , carbohydrate oxidation replaces the major portion of the extra energy expended . in endurance - trained subjects consequently , there is an increased ability to oxidize lipids , due to the upregulation of the enzyme amp - activated protein kinase in skeletal muscle . the outcomes are increased maximal o2 consumption and a higher proportion of fat oxidized during the exercise of low - to - moderate intensity . at high intensity , there is evidence that endurance - trained athletes consume a diet containing a high proportion of carbohydrate . due to the hierarchy in substrate oxidation mentioned earlier , these dietary habits perhaps impact on substrate oxidation in everyday conditions . it can be expected , therefore , that athletes who conserve a stable body composition while consuming such a diet will have a high 24-hour oxidation of carbohydrates . in healthy lean untrained subjects studied in a respiratory chamber , moderate pha increased total energy expenditure , essentially by increasing carbohydrate oxidation when the exercise took place after a meal . nevertheless , the same exercise performed in the fasting state , before breakfast , led to a marked increase in lipid oxidation . in fact , since the subjects were fed the same isoenergetic diet under both conditions , exercising before breakfast versus after breakfast led to a negative lipid balance and to a positive carbohydrate balance . it might , therefore , be hypothesized that exercise in the fasting state may preferably promote lipid utilization and favourably affect body composition by decreasing fat stores . this hypothetical scheme appears unlikely , nevertheless , if the diet consumed is not changed , since the positive carbohydrate balance will probably increase carbohydrate oxidation . is there an effect of food intake on pha ? it has been recognized for several decades that severe underfeeding leads to behavioural adaptations that result in a decreased spontaneous pha . more recently , there have been reports suggesting that overfeeding increases energy expenditure more than would be predicted on the basis of body weight and lean body mass changes [ 26 , 27 ] . furthermore , this increase in energy expenditure showed marked interindividual variations and was inversely correlated with body - weight gain . in fact , since changes in bmr and in the thermic effect of food were mainly accounted for by alterations in body composition and dietary intakes , this increase in suprabasal energy expenditure was attributed to a stimulation of spontaneous pha . such pha was unrelated to exercise and hence was termed nonexercise activity thermogenesis ( neat ) . neat is the energy expended for everything we do that is not sleeping , eating , or sports - like exercise . it includes the energy expended walking to work , typing , performing yard work , undertaking agricultural tasks , and fidgeting . the first approach is to measure or estimate total neat . here , total daily energy expenditure is measured and from it , the bmr plus thermic effect of food is subtracted . the second approach is the factorial approach whereby the components of neat are quantified and total neat calculated by summing these components . the amount of neat that humans perform represents the product of the amount and types of physical activities and the thermogenic cost of each activity [ 28 , 29 ] . the factors that impact a human 's neat are readily divisible in biological factors such as weight , gender , body composition , and environmental factors such occupation . the variability in neat might be viewed as random and unprogrammed but human data contradict this thesis . it appears that changes in neat accompany experimentally induced changes in energy balance and may be important in the physiology of weight change . it then becomes intriguing to dissect mechanistic studies that delineate how neat is regulated by neural , peripheral , and humoral factors . neat may be a carefully regulated tank of physical activity that is crucial for weight control . there is no much understanding of the mechanisms that may probably be responsible for the stimulation of neat during overfeeding at the present time . calorimetric studies show that 24-hour energy expenditure increases in healthy subjects after short - term carbohydrate , but not fat , overfeeding [ 30 , 31 ] . this effect was not correlated to the increase in plasma leptin concentrations observed after carbohydrate overfeeding . several animal studies show that the stimulation of the melanocortin-4 receptor ( mc4r ) is associated with an increase in spontaneous pha [ 32 , 33 ] . showed that new mc4r mutations in a large number of severely obese adults living in southern italy . these mutations , not present in normal - weight individuals , are further evidence that defects in the melanocortin pathway are related to severe obesity . how the intake of specific macronutrients impact on this pathway and the mechanisms involved remains to be clarified . the hypothesis that physical activity exerts beneficial effects on body - weight status by mechanisms not associated to an increase in energy expenditure should be considered . nevertheless , data on energy expenditure and body composition do allow some conclusions to be drawn . if an endurance - trained athlete consistently expends a substantial amount of energy in pha and at the same time maintains a constant weight and body composition , energy intake must have been increased appropriately , most probably spontaneously . the mechanisms responsible for this increase in energy intake have not been completely studied . as a result of the complex network in the central nervous system that regulates energy expenditure and the known effects of pha on neuroendocrine regulations , it is very likely that the relationship between energy expended in pha and food intake are is complex . nevertheless , endurance - trained athletes are characterized by a low fat mass , which may be the result of previous periods of negative energy and fat balances . they have low plasma leptin levels too , which are mainly ascribable to the low fat mass , since comparable leptin levels are observed in very lean sedentary subjects . several studies have searched for a direct inhibition of leptin release by acute or chronic exercise . except for a decrease in plasma leptin levels following particularly intense exercises such as an ultra - marathon , these researches have failed to identify a long - lasting reduction in leptin levels after exercise [ 3640 ] . it may specify that a substantial decrease in fat - free mass induced by exercise is required to decrease leptin secretion before low plasma leptin in turn increases food intake . intriguingly , this absence of effects of exercise contrasts with the effect of severe energy restriction , which quickly decreases plasma leptin levels before any marked changes in body composition occur . it may specify that exercise is more efficient than severe energy restriction in the promotion of weight loss without excessive rebound hyperphagia . the effects of pha on energy metabolism and body - weight control remain incompletely understood . there is ample evidence that physical training is associated with low body weight and low fat mass . this relationship unequivocally suggests that negative energy and fat balances are correlated with physical training . the negative energy balance is perhaps to be at once secondary to the quantity of energy expended while exercising , so there is no evidence that exercise influences other components of energy expenditure . the negative fat balance is probably secondary to this negative energy balance . in obese individuals the amount of energy expended in pha appears to be small , which certainly represents a factor that could prevent weight loss . it appears useful to focus on obese patients also in general practice in order to recognize sedentary life styles and encourage pha through individualized programs . some studies [ 43 , 44 ] show a mild and nonsignificant reduction of bmr in patients treated with an integrated dietetic plus physical exercise program and a significant reduction of bmr in surgically treated patients . it will be necessary to have a larger number of patients to confirm these findings . our knowledge of the pathological consequences of the lack of adequate exercise on adipose tissue , skeletal muscle , and the liver is improving , and this will help establish more specific guidelines for the proper exercise regimens that will improve underlying metabolic pathways . neat and physical activity , that is crucial for weight control , may be important in the physiology of weight change . two issues that remain to be resolved are whether pre - obese individuals have a low pha level that contributes to weight gain and , if so , what are the biological determinants of this low pha .

we review the current concepts about energy expenditure and evaluate the physical activity ( pha ) in the context of this knowledge and the available literature . regular pha is correlated with low body weight and low body fat mass . the negative fat balance is probably secondary to this negative energy balance . nonexercise activity thermogenesis ( neat ) and physical activity , that is crucial for weight control , may be important in the physiology of weight change . an intriguing doubt that remains unresolved is whether changes in nutrient intake or body composition secondarily affect the spontaneous physical activity .

polymethyl methacrylate ( pmma ) polymers have been referred as conventional base materials and there is an ongoing effort to improve the properties of denture base materials . the goal is to have longer lasting and more biocompatible denture bases with better mechanical properties and simpler processing techniques that require less time to construct denture.1 mechanical properties of denture base resins are crucial for the clinical success of removable prosthesis . fractures and cracks are the most common types of failures related to base material.2,3 high impact acrylics were developed by the insertion of a rubber compound into the resin to improve impact resistance and strength properties of pmma materials.4,5 on the other hand , the long and rather difficult laboratory procedures of both conventional and high impact resins led to studies about self - cure and light - cure resins.6 self - cure resins offered shorter laboratory procedures but the residual monomer caused an increased risk of tissue reactions and decreased fracture resistance.7 on the other hand , light - curing systems offered simpler laboratory procedures and less risk of allergic reactions as they do not contain methyl metacrylate monomers.8 furthermore , poor fracture resistance of early light - cure systems was improved by the entrance of a new material on the market.9 however , to our knowledge these new self- and light - cure materials have not been comparatively evaluated yet . therefore , the aim of this study was to investigate the 3-point flexural strengths and flexural moduli of these two alternate base materials ( eclipse and weropress ) and compare them to three conventional heat - cure acrylic resins qc 20 , meliodent and paladent and one high impact heat - cure acrylic lucitone 199 . a total of 48 specimens were prepared according to iso 1567 standard with 6 different resins . these patterns were covered with high viscosity polyvinylsiloxane ( silagum putty , dmg , hamburg , germany ) before being invested in conventional flasks with type 3 dental stone ( moldano ; heraeus kulzer , hanau , germany ) . conventional acrylics ( meliodent , qc-20 , paladent 20 ) and high impact lucitone 199 were polymerized at 74 for 9 hours in an automated polymerization unit ( kavo ewl 5501 , kavo electrotechnisches weropress specimens were polymerized in a pressure pot heat cure unit ( ivomat ip3 , ivoclar vivadent ag , schaan , lichtenstein ) under 2 bars of pressure at 45 for 12 minutes . a teflon mold with a transparent plexyglass lid was designed to prepare the eclipse specimens . the eclipse dough was sandwiched in this mold and cured in its specific unit ( enterra vlc curing unit ; degudent gmbh , hanau , germany ) using the recommended 15 minute polymerization cycle . after polymerization the excess materials were removed by trimming with tungsten carbide burs using a handpiece at low speed . both sides of the specimens were polished under running water with # 320- , 400- , and 600-grit silicon carbide papers respectively . before transverse strength test the specimens were immersed in distilled water at room temperature ( 20 2 ) for 15 days . a 3-point bending test device ( mts mini - bionics , model 858 , mts corporation , eden prairie , mn , usa ) was used to determine the flexural strengths and flexural moduli . the device consisted of a loading wedge and a pair of adjustable supporting wedges placed 50 mm apart . the specimens were centered on the supporting wedges and the loading wedge was set to travel at a crosshead speed of 5 mm / min engaged at the center of the upper surface of the specimens . transverse strengths were calculated using the following equation ; where : s = transverse strength ( n / mm ) , p = load at fracture ( n ) , i = distance between the supporting wedges ( mm ) , b = width of the specimen ( mm ) , and d = thickness of the specimen ( mm ) . the mean displacement , maximum load , flexural modulus and flexural strength values and standard deviations were calculated for each group , and the data were analyzed by means of one way analysis of variance ( anova ) ( with mean difference significant at the 0.05 level ) . post hoc analyses ( scheffe test ) were carried out to determine the differences between the groups by using spss statistical software version 11.5 ( spss inc . a total of 48 specimens were prepared according to iso 1567 standard with 6 different resins . these patterns were covered with high viscosity polyvinylsiloxane ( silagum putty , dmg , hamburg , germany ) before being invested in conventional flasks with type 3 dental stone ( moldano ; heraeus kulzer , hanau , germany ) . conventional acrylics ( meliodent , qc-20 , paladent 20 ) and high impact lucitone 199 were polymerized at 74 for 9 hours in an automated polymerization unit ( kavo ewl 5501 , kavo electrotechnisches weropress specimens were polymerized in a pressure pot heat cure unit ( ivomat ip3 , ivoclar vivadent ag , schaan , lichtenstein ) under 2 bars of pressure at 45 for 12 minutes . a teflon mold with a transparent plexyglass lid was designed to prepare the eclipse specimens . the eclipse dough was sandwiched in this mold and cured in its specific unit ( enterra vlc curing unit ; degudent gmbh , hanau , germany ) using the recommended 15 minute polymerization cycle . after polymerization the excess materials were removed by trimming with tungsten carbide burs using a handpiece at low speed . both sides of the specimens were polished under running water with # 320- , 400- , and 600-grit silicon carbide papers respectively . before transverse strength test the specimens were immersed in distilled water at room temperature ( 20 2 ) for 15 days . a 3-point bending test device ( mts mini - bionics , model 858 , mts corporation , eden prairie , mn , usa ) was used to determine the flexural strengths and flexural moduli . the device consisted of a loading wedge and a pair of adjustable supporting wedges placed 50 mm apart . the specimens were centered on the supporting wedges and the loading wedge was set to travel at a crosshead speed of 5 mm / min engaged at the center of the upper surface of the specimens . transverse strengths were calculated using the following equation ; where : s = transverse strength ( n / mm ) , p = load at fracture ( n ) , i = distance between the supporting wedges ( mm ) , b = width of the specimen ( mm ) , and d = thickness of the specimen ( mm ) . the mean displacement , maximum load , flexural modulus and flexural strength values and standard deviations were calculated for each group , and the data were analyzed by means of one way analysis of variance ( anova ) ( with mean difference significant at the 0.05 level ) . post hoc analyses ( scheffe test ) were carried out to determine the differences between the groups by using spss statistical software version 11.5 ( spss inc . the mean flexural strength , flexural modulus , force maximum load and displacement values of eclipse , meliodent , lucitone 199 , weropress , qc 20 and paladent 20 are given in table 2 . one - way anova indicated that there were statistically significant differences in the flexural strengths ( p<.001 ) , flexural moduli ( p<.05 ) , force maximum load ( p<.001 ) and displacement values ( p<.001 ) among the six denture base materials ( table 3 ) . post hoc scheff test indicated that for flexural strength , displacement and force maximum load , the values of eclipse are significantly different from other base materials . only for displacement , besides , there were no significant differences between the values of six denture base materials for flexural modulus ( table 2 ) . the loading characteristics of fracture strength tests imitate clinical situations which a denture base undergoes in the oral environment , we preferred to stick to iso 1567:1999 standard for transverse strength testing.5 even though fatigue fracture is clinically more relevant , as it simulates the clinical failure mechanism more closely , the assessment of flexural strength is easier and thus has been used by other researchers.10 - 12 however , the lack of a thermo - cycling process and loading phase without immersing in artificial saliva could be stated as limitations of this study . it is well known that self - cure systems offer simpler laboratory procedures . however , besides the other mechanical and chemical properties , these materials should have sufficient fracture resistance . to our knowledge , weropress has not been investigated on the basis of flexural properties yet . according to the results of present study , weropress specimens exhibited the lowest transverse strength among all groups but this finding was not statistically significant except for the eclipse group . the use of light - polymerized denture base resins has been supported by several authors , not only for exhibiting acceptable strength and dimensional stability , but also for their relatively complete polymerization without free monomerin addition to their ease of manipulation and elimination of the usual denture processing armamentarium.13 - 17 earlier studies have investigated the mechanical properties of triad ( light - cured resin ) comparing to conventional and high impact resins . the overall results of these studies indicate that the transverse strength of triad is higher than conventional polymethylmethacrylate but lower than high impact resins.18 however , one of the two different base resins we examined , the light - activated urethane dimethacrylate ( udma ) ( eclipse ) , revealed significantly higher flexural strength values where the cold - curing weropress remained within the range of other materials . uzun and hersek19 investigated conventional , hi - impact and strengthened injection mold resins and reported that the transverse strength of six different base materials did not exhibit significant differences which are supported by the findings of similar materials in this study . our results , supporting previous studies , revealed that lucitone 199 has better flexural properties and higher displacement values when compared to conventional resins . however , weropress showed similar displacement and flexural strength values where eclipse specimens exhibited even improved values . therefore , both materials must also be evaluated on the basis of their impact resistance . newly introduced eclipse has been reported to have superior flexural strength and higher flexural modulus when compared to high impact ( lucitone 199 ) , conventional base ( meliodent ) resins and triad resin.6,18 the results of this study are in good agreement with the findings of previous studies . machado et al.18 reported that eclipse exhibited less porosity after polymerization when compared to early udma system ( triad ) . diaz - arnold et al.20 reported that eclipse specimens showed the highest standard deviations in mean flexural strength values ( 15.83 ) in comparison to " so called " high - impact resin groups ( lucitone 199 , diamond d , hi - i , nature - cryl hi - plus other groups ) . they suggested that the high standard deviaton indicated variations in specimen fabrication . according to their comment , as the specimens were not flasked and packed they were not dense enough and this led to the high standard deviation in eclipse group . the eclipse system , as presented by the manufacturer , is not designed for polymerization under pressure . this might be due to the use of semi - transparent white teflon mold instead of the aluminum mold for eclipse group . a possible higher quality of polymerization might have taken place . as the results indicate eclipse resin to have better and weropress to have acceptable flexural properties when compared to well known alternatives , these materials deserve further investigation over their physical properties like impact and fatigue strength , water sorption and solubility and surface characteristics like hardness and staining , to clear out any possible advantages for clinical use . within the limitations of this study following conclusions can be drown ; 1 . regarding the flexural strength properties and simpler processing technique , eclipse system owns a potential as an advantageous alternative to conventional base resins . 2 . weropress system may have similar advantages of easy processing when compared to conventional resins .

purposea new light curing urethane dimethacrylate and a cold curing resin with simpler and faster laboratory procedures may have even improved flexural properties . this study investigated the 3-point flexural strengths and flexural moduli of two alternate base materials.materials and methodsa cold curing resin ( weropress ) and a light curing urethane dimethacrylate base material ( eclipse ) . along with eclipse and weropress , a high impact resin ( lucitone199 ) and three conventional base materials ( qc 20 , meliodent and paladent 20 ) were tested . a 3-point bending test was used to determine the flexural strengths and flexural moduli . the mean displacement , maximum load , flexural modulus and flexural strength values and standard deviations for each group were analyzed by means of one - way analysis of variance ( anova ) ( with mean difference significant at the 0.05 level ) . post hoc analyses ( scheffe test ) were carried out to determine the differences between the groups at a confidence level of 95%.resultsflexural strength , displacement and force maximum load values of eclipse were significantly different from other base materials . displacement values of qc 20 were significantly different from lucitone 199 and weropress.conclusionthe flexural properties and simpler processing technique of eclipse system presents an advantageous alternative to conventional base resins and weropress offers another simple laboratory technique .

a 55 year - old man visited our emergency department because of increasing frequency of chest pain . he had undergone off - pump coronary artery bypass grafting ( cabg ) 10 years ago because of unstable angina associated with three vessel coronary artery disease . at the initial operation , the in situ right internal thoracic artery ( ita ) , in situ left ita and in situ right gastroepiploic artery ( rgea ) grafts were used to revascularize the left anterior descending coronary artery , two obtuse marginal coronary branches , and posterior descending coronary artery , respectively . an excess segment of the distal right ita was connected to the side of left ita as a y - composite graft and anastomosed to the first diagonal coronary artery . coronary angiography and myocardial single photon emission computed tomography ( spect ) were performed at 5 years after surgery as a follow - up study . the 5-year angiography showed all patent grafts and the myocardial spect demonstrated no perfusion decrease . exertional chest pain recurred at 7 years after surgery , and a repeated coronary angiography showed patent previous grafts including faint visualization of the in situ rgea graft associated with significant stenosis at the os of the celiac axis . the computed tomographic angiogram also demonstrated a 90% stenosis at the celiac os , which had been without stenosis on abdominal angiography taken before the surgery ( fig . redo off - pump cabg was performed 10 years after the initial surgery because of an increasing frequency of angina and an aggravated finding of the follow - up myocardial spect , which was a newly developed reversible perfusion decrease in the inferior wall ( fig . , the great saphenous vein was harvested from the lower leg and interposed between the middle part of in situ right ita and distal part of in situ rgea grafts used previously , to supply blood flow from the right ita graft to the posterior descending coronary artery . one year after redo surgery , the patient had no symptoms of angina and coronary angiogram was performed and revealed patent grafts , including an interposed saphenous vein graft ( fig . 3a ) . the myocardial spect test was also performed and demonstrated that there was no perfusion decrease including the inferior wall ( fig . reoperations for coronary artery disease have been increased due to the increased number of isolated cabg . the society of thoracic surgeons statistics indicated that nearly 5% of the current cabg procedures done in the us were repeat surgical revascularization . angiographic indications for reoperation are progression of native coronary atherosclerosis , previous graft failure or a combination of both . one previous study demonstrated that 4 out of 400 patients who underwent cabg using the rgea graft needed percutaneous interventions due to the rgea graft failure during postoperative follow - up of 2211 months . one of those 4 patients required an angioplasty for a newly developed stenosis of the celiac trunk . in the present case , an indication for reoperation the patient had been free of angina , and the angiographic and myocardial spect follow - up studies revealed no abnormal findings at postoperative 5 years . when the patient suffered from recurred angina at postoperative 7 years , coronary angiography showed a faint visualization of the in situ rgea graft associated with significant stenosis at the os of the celiac axis . the 10-year follow - up myocardial spect test demonstrated a newly developed reversible perfusion decrease in the inferior wall . the prevalence of celiac axis stenosis was 7.3% in a korean population although it was lower than the previously reported incidence of celiac axis stenosis in western populations ranged from 12.5% to 24% . in the present case , celiac artery stenting could be an alternative option in such a case . however , we performed a redo operation because celiac axis stenting was associated with a high incidence of late restenosis . the aorta or another in situ arterial graft could be chosen as a blood source . alternatively , patent in situ grafts used previously may be re - used as an inflow conduit . with regards to our patient , the 3 in situ arterial grafts had already been used . the saphenous vein graft was interposed between the middle part of right ita and distal part of in situ rgea grafts used previously .

we report a redo coronary artery bypass grafting ( cabg ) in a 55-year - old man . angina recurred 7 years after the initial surgery . coronary angiography showed all patent grafts except a faint visualization of the in situ right gastroepiploic artery ( rgea ) graft , which was anastomosed to the posterior descending coronary artery , associated with celiac axis stenosis . redo - cabg was performed at postoperative 10 years because of aggravated angina and decreased perfusion of the inferior wall in the myocardial single photon emission computed tomography . the saphenous vein graft was interposed between the 2 in situ grafts used previously ; the right internal thoracic artery and rgea grafts . angina was relieved and myocardial perfusion was improved .

osteosarcoma is the most common primary bone sarcoma representing about 25 - 35% of all cases but constituting only about 0.1% of all neoplasms . a small subset of patients with osteosarcoma may have involvement of multiple skeletal sites without evidence of visceral metastases . less than 100 cases of synchronous type of mogs have been reported in the literature till date . a 15-year - old male patient presented with 2-month history of gradually progressive pain and swelling around right shoulder and knee . anteroposterior ( ap ) radiograph of the right shoulder showed a diffuse homogenous radiodense lesion with wide zone of transition involving nearly entire upper half of shaft of humerus including the epiphysis and diaphysis . solid periosteal reaction was noted on either side of proximal part of the lesion [ figure 1a , b and c ] . ap radiograph of the bilateral knee revealed multiple well - defined osteosclerotic lesions of varying sizes involving the metaphysis of distal femur and proximal tibia [ figure 1a and b ] . an osteosclerotic lesion is also noted in proximal part of right femur in ap radiograph of pelvis with both hips [ figure 1d ] . a provisional diagnosis of osteosarcoma with systemic metastases was made . a 15-year - old child with synchronous mogs , ( a and b ) ap radiograph of the bilateral knee showed multiple osteosclerotic lesions involving the metaphysis of distal femur and proximal tibia ( arrows ) . ( c ) ap radiograph of right shoulder showed extensive osteosclerosis involving upper half of humerus , including the epiphysis with solid periosteal reaction on either side of the lesion . ( d ) ap view of pelvis with both hip showed an osteosclerotic lesion in proximal part of right femur ( black arrow ) . mogs = multifocal osteogenicsarcoma , ap = anteroposterior to establish the presence of suspected pulmonary lesions , nonenhanced computed tomography ( nect ) scan of thorax was performed on a 16-slice computed tomography ( ct ) scanner ( general electric , brightspeed , milwaukee , wisconsin , usa ) from the thoracic inlet to lowermost part of diaphragm . no evidence of any suspicious lesion was noted in the pulmonary parenchyma [ figure 2c and d ] . nect bone window images demonstrated the shoulder lesion extending upto lower half of humerus and punctuate character of lesions involving right knee [ figure 2a and b ] . a 15-year - old child with synchronous mos , ( a ) nect right knee coronal image in bone window revealed the punctuate character of lesions involving bilateral knee . ( b ) nect bone window image of right shoulder demonstrated the diffuse osteosclerosis involving humerus extending up to its lower half and associated periosteal reaction . ( c ) nect thorax coronal and axial images revealed no calcified metastatic lesion in the thorax . mogs = multifocal osteogenicsarcoma , nect = nonenhanced computed tomography for better determination of the skeletal involvement , nonenhanced and contrast - enhanced magnetic resonance ( mr ) imaging of the right shoulder , right knee , bilateral hip , and lumbar spine was performed on 1.5 tesla scanner ( siemens , magnetom essenza , erlangen , germany ) . t1-weighted images of right shoulder demonstrate replacement of normal bright marrow signal by a diffuse ill - defined hypointense lesion in the upper part of the humerus and associated extramedullary component . post - contrast t1 fat - suppressed images revealed patchy intramedullary enhancement with marginal enhancement of extramedullary component . no evidence of intra - articular extension is noted [ figure 3b ] . t1- and t2-weighted images of right knee showed multiple hypointense lesions ( few of which appear confluent ) involving either side of joint . post - contrast proton density fat - saturated images demonstrate multiple peripheral enhancing lesions and patchy marrow enhancement . no soft tissue or intra - articular extension is demonstrated [ figure 3a ] . a 15-year - old child with synchronous mogs , ( a ) post - contrast proton density - weighted fat - saturated coronal mr image of right knee demonstrated multiple peripheral enhancing lesions and patchy intramedullary enhancement involving lower end of femur and upper end of tibia . ( b ) t1-weighted fat - saturated post - contrast coronal mr image of right shoulder showed heterogenous intramedullary enhancement with marginal enhancement of extramedullary component ( arrow ) . mogs = multifocal osteogenicsarcoma , mr = magnetic resonance t1-weighted images of bilateral hip and t2-weighted images of lumbar spine revealed hypointense lesion involving head of femur , posterior wall of acetabulum [ figure 4a and b ] , and l5 vertebral body , respectively [ figure 4c ] . no soft tissue or intra - articular extension is noted . a 15-year - old child with synchronous mogs - non - contrast t1- weighted axial mr images of bilateral hip ( a and b ) and t2-weighted sagittal images of lumbar spine ( c ) revealed hypointense lesion ( black arrow ) involving head of femur , posterior wall of acetabulum ( white arrow ) , and l5 vertebral body ( white line arrow ) , respectively . mogs = multifocal osteogenicsarcoma , mr = magnetic resonance whole body bone scintigraphy using 99 m technetium - methylene diphosphonate ( mdp ) revealed intense tracer uptake involving right humeral head , bilateral femur ( lower end ) and tibia ( upper end ) , and right femoral head . the sites of uptake in ribs may be confused with pulmonary involvement , however , the same can be ruled out on careful evaluation of images , especially oblique views [ figure 5 ] . a 15-year - old child with synchronous mogs - whole body bone 99 m technetium - mdp scintigraphy revealed intense tracer uptake involving multiple skeletal sites . few sites of uptake were also noted in ribs , which mimic pulmonary metastasis , however , the same was ruled out on oblique views . mogs = multifocal osteogenicsarcoma , mdp = methylene diphosphonate biopsy from the shoulder lesion ( hematoxylin and eosin stain [ h and e ] stain 10 and 40 ) showed areas of amorphous chondroid matrix with chondrocytes and chondroblasts . there is evidence of lacy and disorganized basophilic osteoid matrix with cells showing high nucleocytoplasmic ratio and hyperchromasia . above findings suggested chondroblastic type of osteosarcoma [ figure 6 ] . a 15-year - old child with synchronous mogs - histopathological examination of the right shoulder lesion ( h and e stain 10 ) ( a ) and ( h and e stain 40 ) ( b ) showed lacy disorganized basophilic malignant osteoid matrix [ small white arrow in ( a ) and large white arrow in ( b ) ] with osteoblastic cells showing high nucleocytoplasmic ratio and hyperchromasia , areas of amorphous chondroid matrix with chondrocytes and chondroblasts ( large black arrow in ( a ) ) in a background of eosinophilic stroma ( small black arrow ) . above findings suggested chondroblastic type of osteosarcoma . mogs = multifocal osteogenicsarcoma , h and e = hematoxylin and eosin stain patient was started on combination chemotherapy of methotrexate , pirarubicin , and ifosfamide . the serum calcium levels returned to baseline , but the clinical symptoms were persistent till the last follow up . mogs is exclusively diagnosed in patients with multiskeletal involvement and no pulmonary involvement because most of osteosarcomas harbor pulmonary micrometastases at the time of diagnosis . mogs is divided into two types on the basis of pattern of presentation - synchronous and metachronous . there is at least one lesion with features suggestive of a primary osteosarcoma , with remaining lesions more suggestive of metastases . the metastatic lesions appear as purely sclerotic or heavily mineralized metaphyseal lesions with a narrow transition zone , no evidence of cortical destruction or soft tissue mass , or malignant periosteal new bone formation . in contrast , most of lesions in patients with metachronous mogs demonstrate imaging features typical of a primary malignant sarcoma of bone including an aggressive mixed lytic and sclerotic pattern of bone destruction , cortical breech , soft tissue extension , wide zone of transition , and malignant periosteal new bone formation . there are two hypotheses for the pathogenesis of mogs according to synchronous and metachronous types , respectively : ( a ) multisite lesions arising simultaneously , presumably all representing multiple independent synchronous primary lesions , and ( b ) single - site origin , with one dominant site and then early and rapidly progressive metastatic disease . overall , osteosarcomas with multifocal skeletal lesions , especially the synchronous variety , have poorer prognosis compared with unifocal osteosarcoma with skeletal metastases . magnetic resonance ( mr ) and ct imaging however , an accurate assessment of the metastatic disease and metabolic activity of the primary lesions requires a radionuclide study . whole body bone scintigraphy using 99 m technetium - mdp is an ideal technique for this purpose , as it has a high sensitivity in staging metastatic disease . absence of the lesions in the lung fields in the presence of multiple bony lesions confirms the diagnosis of mogs differentiating it from a primary osteosarcoma with multiple metastases . in addition , baseline pretreatment mdp scan helps to assess the effectiveness of the therapy when compared with post - therapy scan , even if the lesions appear similar on cross - sectional imaging . the most commonly used classification of mogs is by amstutz ; however , there appears to be no universal agreement on it . from a pure pathological point of view , conventional osteosarcoma has three subdivisions - osteoblastic , chondroblastic , and fibroblastic . in practice , however , most osteosarcomas show varying amounts of three cell types and matrix . the division means to signify greater than 50% predominance of any histologic type . from management point of view , this separation is artificial because treatment for all types is same and there is no statistical difference in survival of patients with high - grade tumors of three histologic types . all synchronous and metachronous mogs are high - grade ( grade 3 and 4 ) medullary osteosarcomas . synchronous mogs typically shows the same histopathological subtype in all multiple tumor locations , in contrast to presence of atleast one lesion characterized by a different histopathological subtype compared with the primary osteosarcoma in metachronous group . the distinction between the two entities is possible on the basis of evidence of complete absence of pulmonary lesions in synchronous m - ogs . the clinical distinction has significant prognostic importance , as synchronous m - gos has an extremely poor prognosis .

multifocal osteosarcoma is diagnosed when there are two or more lesions in the skeleton without presence of pulmonary metastases . it is further classified as synchronous type when the patient is demonstrated to have more than one lesion simultaneously at presentation and is known as synchronous multifocal osteogenicsarcoma ( mogs ) . we report a case of synchronous mogs showing its multimodality imaging findings including nuclear scan findings with pathological correlation .

tween 80 ( polyoxyethylene sorbitan monooleate ) was purchased from merck ( schuchardt , hohenbrunn , germany ) . water was taken from milli - q water purification system ( millipore , billerica , ma ) . all other components used for the formulation of nanoemulsion were pharmaceutically acceptable for oral administration . the silymarin nanoemulsion was prepared by spontaneous emulsification method ( aqueous phase titration method ) . detailed description of their preparation , physical stability , characterization , and optimization is given in our previously published article . an optimal stable nanoemulsion formulation of silymarin ( 20 mg / kg body weight p.o . ) was developed containing sefsol-218 as an oily phase ( 5% w / w ) , 35% w / w of smix ( mixture of tween 80 as a surfactant and ethanol as a co - surfactant in the ratio of 2:1 ) , and double distilled water as an aqueous phase ( 60% w / w ) . this formulation was optimized on the basis of visual observation , optimum globule size , and minimum polydispersity index . the formulation of silymarin dosage form may lead to a decrease in the assay of silymarin due to mechanical stress , compression , manufacturing processes , excipients , storage conditions , heat , moisture , and alkaline ph . stability studies on optimized nanoemulsion were performed by keeping the sample at refrigerator temperature ( 5c ) and room temperature ( 25c ) . nine batches of the selected formulation were prepared out of which three batches of nanoemulsion formulations were subjected to accelerated stability conditions . the formulation was taken in glass vials and kept at three different temperatures ( 40 + 2c ) ( stability chamber ) , 25 + 2c ( room temperature ) , and 5 + 2c ( refrigerator ) at ambient humidity . samples were withdrawn periodically at predetermined time intervals ( 0 , 15 , 30 , 45 , 60 , and 90 days ) and evaluated for any physical change in the formulation and drug content . analysis was carried out at each time interval by taking 1.0 ml of each formulation and diluting it to 5.0 ml with methanol and quantified by reported high performance thin layer chromatography ( hptlc ) method . the sample was applying on hptlc plate and the content of silybin was quantified using solvent chloroform : acetone : formic acid ( 9:2:1 , v / v / v ) ( rf of silybin 0.46 0.05 ) in the absorbance mode at 296 nm . the amount of drug degraded and the amount remaining at each time interval was calculated . arrhenius plot was constructed between log k and 1/t to determine the shelf life of optimized nanoemulsion formulation . the degradation rate constant at 25c ( k25 ) was determined by extrapolating the value of 25c from arrhenius plot . the shelf life ( t0.9 ) for each formulation was determined by using the formula : silymarin was provided from ranbaxy ( gurgaon , india ) and sefsol 218 ( propylene glycol - monocaprylic ester ) from nikko chemicals ( tokyo , japan ) as gift samples . tween 80 ( polyoxyethylene sorbitan monooleate ) was purchased from merck ( schuchardt , hohenbrunn , germany ) . water was taken from milli - q water purification system ( millipore , billerica , ma ) . all other components used for the formulation of nanoemulsion were pharmaceutically acceptable for oral administration . the silymarin nanoemulsion was prepared by spontaneous emulsification method ( aqueous phase titration method ) . detailed description of their preparation , physical stability , characterization , and optimization is given in our previously published article . an optimal stable nanoemulsion formulation of silymarin ( 20 mg / kg body weight p.o . ) was developed containing sefsol-218 as an oily phase ( 5% w / w ) , 35% w / w of smix ( mixture of tween 80 as a surfactant and ethanol as a co - surfactant in the ratio of 2:1 ) , and double distilled water as an aqueous phase ( 60% w / w ) . this formulation was optimized on the basis of visual observation , optimum globule size , and minimum polydispersity index . the formulation of silymarin dosage form may lead to a decrease in the assay of silymarin due to mechanical stress , compression , manufacturing processes , excipients , storage conditions , heat , moisture , and alkaline ph . stability studies on optimized nanoemulsion were performed by keeping the sample at refrigerator temperature ( 5c ) and room temperature ( 25c ) . nine batches of the selected formulation were prepared out of which three batches of nanoemulsion formulations were subjected to accelerated stability conditions . the formulation was taken in glass vials and kept at three different temperatures ( 40 + 2c ) ( stability chamber ) , 25 + 2c ( room temperature ) , and 5 + 2c ( refrigerator ) at ambient humidity . samples were withdrawn periodically at predetermined time intervals ( 0 , 15 , 30 , 45 , 60 , and 90 days ) and evaluated for any physical change in the formulation and drug content . analysis was carried out at each time interval by taking 1.0 ml of each formulation and diluting it to 5.0 ml with methanol and quantified by reported high performance thin layer chromatography ( hptlc ) method . the sample was applying on hptlc plate and the content of silybin was quantified using solvent chloroform : acetone : formic acid ( 9:2:1 , v / v / v ) ( rf of silybin 0.46 0.05 ) in the absorbance mode at 296 nm . the amount of drug degraded and the amount remaining at each time interval was calculated . arrhenius plot was constructed between log k and 1/t to determine the shelf life of optimized nanoemulsion formulation . the degradation rate constant at 25c ( k25 ) was determined by extrapolating the value of 25c from arrhenius plot . the shelf life ( t0.9 ) for each formulation was determined by using the formula : the silymarin nanoemulsion formulation was prepared successfully by spontaneous emulsification method using sefsol-218 and smix ( mixture of tween 80 and ethanol ) and double distilled water . the droplet size of the formulation was 41.22 0.00314 nm with a polydispersity index of 0.165 . stability of the drug or a formulation is the extent to which a product retains , within the specified limits , throughout its period of storage and use , the same properties and characteristics possessed at the time of its packaging . stability testing evaluates the effect of environmental factors on the quality of the drug substance or a formulated product , which is utilized for prediction of its shelf life , determine proper storage conditions , and suggest labeling instructions . moreover , the data generated during the stability testing are an important requirement for regulatory approval of any drug or formulation . therefore , optimized nanoemulsion formulation was characterized by droplet size , viscosity , and refractive index for the period of 3 months . during stability studies droplet size , viscosity , and refractive index were determined at two different temperatures of 5c and 25c . these parameters were determined at predetermined time intervals ( 0 , 15 , 30 , 45 , 60 , and 90 days ) . no drastic change was observed in the values of droplet size , viscosity , and refractive index at refrigerated and room temperature indicated that optimized formulation is stable and suitable for oral delivery of silymarin . accelerated stability was checked when the formulation were kept at three different temperatures ( 40 + 2c , 25 + 2c , and 05 + 2c ) . the drug concentration remaining was quantified at predetermined time intervals ( 0 , 15 , 30 , 45 , 60 , and 90 days ) where zero time sample was taken as control ( 100% ) . the percentage of undecomposed silymarin remaining in the nanoemulsion formulations was 208.17 g / ml , 208.11 g / ml , and 206.67 g / ml at 5c , 25c , and 40c , respectively , after 90 days of storage . stability studies of silymarin nanoemulsion at 5c stability studies of silymarin nanoemulsion at 25c stability studies of silymarin nanoemulsion at 40c to check the order of degradation of silymarin , natural ( ln ) of percent drug remaining when plotted against time gave the straight line , which signifying that the degradation of silymarin in nanoemulsion formulation followed first order kinetics [ figure 1a c ] . from degradation constant ( k ) values obtained from figure 1a c , half - life and the shelf life of the formulation prepared were calculated [ table 4 ] . it was seen that the shelf life of the formulation was 3.8 years when stored at refrigerator temperature . arrhenius plot was constructed by plotting ln k versus reciprocal of absolute temperature ( 1/t ) [ figure 2 ] . the slope obtained from plot gave the energy of activation of silymarin in the nanoemulsion formulation . first order degradation kinetics of nanoemulsion formulation at ( a ) 5c ; ( b ) 25c ; ( c ) 40c half - life and shelf life of nanoemulsion at different temperatures arrhenius plot between log k and 1/t to determine the shelf life of silymarin nanoemulsion the silymarin nanoemulsion formulation was prepared successfully by spontaneous emulsification method using sefsol-218 and smix ( mixture of tween 80 and ethanol ) and double distilled water . the droplet size of the formulation was 41.22 0.00314 nm with a polydispersity index of 0.165 . stability of the drug or a formulation is the extent to which a product retains , within the specified limits , throughout its period of storage and use , the same properties and characteristics possessed at the time of its packaging . stability testing evaluates the effect of environmental factors on the quality of the drug substance or a formulated product , which is utilized for prediction of its shelf life , determine proper storage conditions , and suggest labeling instructions . moreover , the data generated during the stability testing are an important requirement for regulatory approval of any drug or formulation . therefore , optimized nanoemulsion formulation was characterized by droplet size , viscosity , and refractive index for the period of 3 months . during stability studies droplet size , viscosity , and refractive index were determined at two different temperatures of 5c and 25c . these parameters were determined at predetermined time intervals ( 0 , 15 , 30 , 45 , 60 , and 90 days ) . no drastic change was observed in the values of droplet size , viscosity , and refractive index at refrigerated and room temperature indicated that optimized formulation is stable and suitable for oral delivery of silymarin . accelerated stability was checked when the formulation were kept at three different temperatures ( 40 + 2c , 25 + 2c , and 05 + 2c ) . the drug concentration remaining was quantified at predetermined time intervals ( 0 , 15 , 30 , 45 , 60 , and 90 days ) where zero time sample was taken as control ( 100% ) . the percentage of undecomposed silymarin remaining in the nanoemulsion formulations was 208.17 g / ml , 208.11 g / ml , and 206.67 g / ml at 5c , 25c , and 40c , respectively , after 90 days of storage . stability studies of silymarin nanoemulsion at 5c stability studies of silymarin nanoemulsion at 25c stability studies of silymarin nanoemulsion at 40c to check the order of degradation of silymarin , natural ( ln ) of percent drug remaining when plotted against time gave the straight line , which signifying that the degradation of silymarin in nanoemulsion formulation followed first order kinetics [ figure 1a c ] . from degradation constant ( k ) values obtained from figure 1a c , half - life and the shelf life of the formulation prepared were calculated [ table 4 ] . it was seen that the shelf life of the formulation was 3.8 years when stored at refrigerator temperature . arrhenius plot was constructed by plotting ln k versus reciprocal of absolute temperature ( 1/t ) [ figure 2 ] . the slope obtained from plot gave the energy of activation of silymarin in the nanoemulsion formulation . first order degradation kinetics of nanoemulsion formulation at ( a ) 5c ; ( b ) 25c ; ( c ) 40c half - life and shelf life of nanoemulsion at different temperatures arrhenius plot between log k and 1/t to determine the shelf life of silymarin nanoemulsion the slight decrease in the assay of silymarin was observed in the formulations stored at different temperatures . lt was concluded that the degradation of silymarin in nanoemulsion formulation follow first order kinetics . the shelf life of nanoemulsion formulation was 3.8 years , which could be achieved only with formulation stored in the refrigerator .

background : silymarin , a flavonolignan from milk thistle ( silybum marianum ) plant is used almost exclusively for hepatoprotection . because of its low bioavailability , it was incorporated into a nanoemulsion formulation . the aim of the present study was to check the stability of silymarin nanoemulsion at different temperatures for 3 months.materials and methods : the oil - in - water based nanoemulsion formulation was prepared by titration method . silymarin nanoemulsion was characterized by droplet size , viscosity , and refractive index . droplet size , viscosity , and refractive index were determined every month . the shelf - life of silymarin nanoemulsion was determined by accelerated stability testing.results:it was found that there was no significant change in the droplet size , viscosity , and refractive index at refrigerator and room temperature during the period of 3 months . the half - life of the optimized nanoemulsion formulation was found to be 4.74 years at room temperature.conclusion:these results indicated that stability of silymarin can be enhanced in nanoemulsion formulation using tween 80 as a surfactant .

alcohol consumption is a well - known part of the nigerian culture and frequently part of festivals and celebrations and , within the past decade , there are indications that there has been a rapid increase in alcohol production and importation as well as its consumption across all age groups . for the year after 1995 , the unrecorded alcohol consumption was estimated to be 3.5 litres pure alcohol per capita for population older than 15 in nigeria . alcoholic consumption continues to experience strong growth in nigeria as a result of the aggressive marketing activities of leading players , and drinking is widely considered a part of social activities ; therefore , most consumers drink unaccompanied . the entry of several new local brews whose alcohol concentration and ingredients are not yet clearly identified has emerged as another public health issue . nigeria 's population of about 160 million continues to grow at an annual rate of 3% . similar to the western world , alcohol is also a factor in a large proportion of injuries and road accidents in nigeria and is also associated with physical health problems . prospective studies among european and north american populations show that alcohol consumption , especially heavy drinking , is associated with pancreatitis , liver cirrhosis , tuberculosis , pneumonia , injuries , malignancies , and psychiatric morbidity [ 6 , 7 ] . therefore , the estimation of prevalence and correlates of alcohol consumption is a systematic prerequisite step in the direction of planning an effective intervention program for the target drinking population . however , there is limited large - scale evidence on prevalence and the correlates of alcohol use in nigeria , particularly in rural provinces where majority of nigerians live . while a review of different local studies conducted in primary health care settings in urban areas highlighted high prevalence of alcohol use and associated factors such as male gender , increasing age , low educational level , and marital status [ 1 , 8 , 9 ] , there is a need to examine the magnitude of alcohol use and correlates in settings where most nigerians live in order to influence the public health of nigerians . we report here the prevalence and correlates of alcohol consumption and investigate the relationship between alcohol consumption and sociodemographic and associated level of health risks among 1,203 men and women , using cross - sectional data collected during the baseline survey of the effectiveness of assist linked brief intervention on harmful and hazardous alcohol use in two south - west rural communities in nigeria : a non - randomized intervention study . ibadan is the capital of oyo state , nigeria , and it is the third largest city in nigeria . however , we report , herein , baseline measures of hazardous and harmful use with their sociodemographic correlates . the inclusion criteria for the study were both male and female alcohol users of age 15 years and permanent residents of study areas . the exclusion criteria were nonusers of alcohol of age less than 15 years , not willing to get alcohol intervention , and not a permanent resident of the study areas . we obtained ethical approval for the study from the ethics and research committee of the ministry of health , oyo state of nigeria ; accent was obtained for participants between 15 and 18 years and consent from those over 18 years of age . using systematic stratified sampling method , the selected semirural local governments were lagelu local government ( local government a ) and akinyele local government ( local government b ) areas of ibadan . the classification was according to national population commission in nigeria , based on population and fund allocation . all the 11 lga were classified into urban or semirural each during the first stage of the study . there are five urban local governments and six semirural local government areas in ibadan . in the second stage , one local government was randomly chosen from the six semirural local government areas . in the third stage , four enumeration areas were systematically selected as clusters . the fourth stage involved the mapping and numbering of all buildings in each of the selected enumeration areas . all households within each building were serially listed in the form specifically designed for the purpose . after getting the list of the households , all eligible respondents , who were 15 years and above in each household , were selected and were interviewed by chew using the questionnaires including assist after they gave permission / consent . after administration of the sociodemographic questionnaire , participants were also screened with alcohol , smoking and substance involvement screening test ( assist ) . the assist was used to determine the prevalence of alcohol consumption and associated level of harm . the assist was developed by the world health organization for alcohol and drug screening in high prevalence settings . according to the assist manual , a score of 010 for drugs is regarded as lower risk , 1126 as moderate risk , and 27 + as high risk . however , in this study , the level of harm was generated using a mean assist score at all the phases of the study . for the purpose of this study , current alcohol use was regarded as use in preceding 30 days . we used a set of precoded and pretested sociodemographic questionnaires to elicit sociodemographic characteristics from the respondents such as age , marital status , socioeconomic class , and years of education . data on both lifetime and current alcohol consumption were obtained using the assist . for our univariate analysis , the association between sociodemographic variables and both lifetime and current alcohol use was determined using pearson 's chi square statistics . multivariate analysis was carried out using binary logistic regression analysis , using variables that were significant during univariate analysis to determine association with current alcohol use . a total of 1329 youths and adults were selected and invited to participate in this study . out of these , 1213 completed the questionnaires , giving a response rate of 91.3% . at baseline , responses were incomplete in ten questionnaires and so final analysis was carried out on 1203 questionnaires at baseline . the mean age of respondents at baseline was 24.45 9.23 years , 623 ( 51.8% ) were males , 796 ( 66.2% ) were married , 570 ( 47.4% ) had at least some secondary education , 513 ( 42.6% ) were from low socioeconomic country , 598 ( 49.7% ) from low average socioeconomic group , 400 ( 33.3% ) were unemployed , and 516 ( 42.9% ) were christians ( table 1 ) . prevalence of lifetime alcohol use was 697 ( 57.9% ) , lifetime alcohol use was more prevalent in men p < 0.001 , married respondents p = 0.003 , respondents with low level of education p < 0.001 , respondents of low socioeconomic status , those who were unemployed p = 0.03 , and the christians p = 0.001 ( table 1 ) . prevalence of current alcohol use was 285 ( 23.7% ) ; current alcohol use increased with increasing age , p = 0.02 , was commoner in males , p = 0.003 , the unmarried , p < 0.01 , those with formal education , p = 0.003 , those from low socioeconomic group , p = 0.01 , the unemployed p < 0.001 , and the christians p < 0.01 ( table 2 ) . of current users , strong beer was first choice of beverage in 30.5% of them and other beverages predominantly local cocktails were the least ( 2.9% ) ( figure 1 ) . prevalence of current alcohol use was 285 ( 23.7% ) , 88 ( 30.9% ) were at low health risk , 161 ( 56.5% ) were at moderate health risk , and 36 ( 12.6% ) were at high health risk ( table 3 ) . multivariate analysis revealed that older age group , female gender , high average socioeconomic group , and high socioeconomic group were protective factors , while being unmarried was a risk factor . at 3 months , older age group , female gender , high average socioeconomic group , and high socioeconomic group were protective factors , while being unmarried was risk factor ( table 4 ) . this is the report of baseline measures of a single arm nonrandomized intervention study that aimed to determine in semirural community settings the prevalence and correlates of alcohol use as well as the effectiveness of assist linked sbirt on harmful and hazardous alcohol use in the rural youth and adult dwellers and most probably the first in sub - saharan africa . we found that the prevalence of lifetime alcohol use was 57.9% and current alcohol use 27.3% among the participants . our finding was in agreement with the lifetime prevalence of alcohol ( 56% ) by gureje and colleagues , in a multicentre study across all cultures in nigeria . however , our reported current alcohol use is almost twice that reported ( 14% ) by gureje et al . . this could be a reflection of the difference in the instruments used or in spread of centres used . our self - reported lifetime and current uses are lower than lifetime alcohol use ( 66.6% ) and current use ( 62.2% ) from a study in togo , a neighbouring country . this could be because the permanent mandates commission of the league of nations could not effectively check france and the european companies operating in togo , from importing liquor to the country because of the recognized economic gains from liquor trade for the economy of france and other european countries . we found that current drinking was associated with younger age , male gender , being unmarried , low educational status , low or low average socioeconomic class , christianity , and unemployment . our findings are in line with those of gureje et al . , studies conducted in primary care settings in nigeria , as well as in community . these findings are also consistent with alcohol surveys conducted in togo , a neighbouring country , as well as previous studies in nigeria . in consonance with our study , grittner and colleagues opined that people with lower socioeconomic status ( ses ) could be more vulnerable to problems related to alcohol consumption . the most common consumed alcoholic beverage is beer and local spirits and this finding contrasts with the 1998 study in ibadan by bennett and colleagues that found palm wine and beer . however , the use of local spirits in this study is in consonance with findings from previous nigerian surveys . factors that mediate these observed patterns of beverage choice may include cost of distilled spirits and advertisement by local brewers . we also found that more than two - thirds of the current drinking population were moderate or high risk drinkers . this is pertinent considering that drinking alcohol is associated with a risk of adverse health consequences such as alcohol dependence , cancers , and injuries [ 16 , 17 ] and , in semirural or rural settings , there is limited access to health care . although some primary care attendees may seek consultation for some of the physical health consequences of hazardous drinking , clinicians who are less likely to screen them for alcohol use talk less of initiating an intervention for their alcohol misuse . the multivariate analyses conducted in this study highlight protective and risk factors for alcohol use among dwellers in two semirural communities and provide important epidemiological data in terms of identification of a population who require special attention in terms of substance use prevention and intervention programs . policies that address poverty and improve socioeconomic indices such as increase in job creation and employment and broadening of social network are likely to impact on the level of alcohol use among dwellers in the rural settings in addition to those in the urban settings . the integration of these policies with evidence based alcohol policies that encapsulate demand control , supply control , and harm reduction will go a long way to reduce risky alcohol use and the adverse consequences of alcohol consumption . we are , however , cautious that a cross - sectional study can not underscore a clear causative inference . furthermore , there is the need for multiround cross - sectional studies to evaluate whether the prevalence of drinkers is increasing and whether those who drink are increasing their consumption intensity . an understanding of these trends will guide health promotion and preventive strategies and further lend support for programmes for screening and brief intervention and more intensive programmatic interventions . one , we did not allocate any diagnosis to the alcohol users ; therefore it was difficult to validate the level of health risk with the diagnosis of alcohol use disorder . also the external validity of the prevalence rates is limited because of diverse sociocultural characteristics of the nigerian population . in conclusion , the prevalence of unhealthy alcohol use is high in a representative sample of semirural communities and correlates include male gender , being unmarried , low educational status , low or low average socioeconomic class , christianity , and unemployment . this should inform policy decisions to address the magnitude of problematic alcohol use in rural settings , where majority of youth and adult in nigeria live .

objective . to determine the prevalence and correlates of alcohol use among a sample of nigerian semirural community dwellers in nigeria . methods . in a single arm nonrandomized intervention study , the assessment of baseline hazardous and harmful alcohol use and associated risk factors was conducted in two semirural local government areas of oyo state , nigeria , with the alcohol , smoking and substance involvement screening test ( assist ) . participants included 1203 subjects 15 years and older , recruited between october 2010 and april 2011 . assist score of 010 was classified as lower risk scores , 1126 as moderate risk , and 27 + as high risk . results . prevalence of lifetime alcohol use was 57.9% and current alcohol use was 23.7% . current alcohol use was more prevalent among the younger age group p = 0.02 , male gender p = 0.003 , unmarried p < 0.01 , low educational level p = 0.003 , low socioeconomic class p = 0.01 , unemployed p < 0.001 , and the christians p < 0.01 . of the current drinkers , the majority ( 69.1% ) were at either moderate or high health risk from alcohol use . conclusion . alcohol consumption is prevalent in semirural communities in nigeria and the majority of these drinkers are at moderate or high health risk . screening , brief intervention , and referral for treatment for unhealthy alcohol use should be integrated into community care services in nigerian rural communities .

a replication - deficient recombinant adenovirus expressing human hsp72 was constructed using the adeasy system ( qbiogene , carlsbad , ca , usa ) . the cdna for hsp72 ( approved gene symbol hspa1a ) was amplified by reverse transcription - polymerase chain reaction ( pcr ) using total rna extracted from hela cells that were previously heat shocked at 42 for 30 minutes . the amplified product was cloned into the pshuttle - cmv vector and verified by sequencing . the vector was then transfomed into escherichia coli strain bj5183 together with the padeasy-1 vector that contains the entire adenovirus serotype 5 genome except the e1 and e3 regions . the recombinant adenoviral constructs were selected and transfected into the hek-293 packaging cell line to produce viral particles . viral titers were determined by limiting dilution on 293 cells and the absence of the e1a gene in the viral constructs was confirmed by pcr . the rat retinal ganglion cell line , rgc-5 , neeraj agarwal ( university of north texas health science center , fort worth , tx , usa ) . rgc-5 cells were maintained in medium containing dulbecco 's modified eagle 's medium ( life technologies , rockville , md , usa ) , 10% fetal bovine serum , and antibiotics at 37 in a humidified 5% co2 - 95% air atmosphere . rgc-5 cells grown to 70% confluence in a 24-well plate were transduced with a recombinant adenovirus expressing hsp72 for 2 hours at a multiplicity of infection ( moi ) of 5 to 50 plaque forming units ( pfu ) per cell . forty - eight hours after transduction , adherent cells were lysed with 0.4 ml of 1 laemmli sample buffer and boiled for 5 minutes . the protein samples were resolved by sodium dodesyl sulfate polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane . the membrane was blocked with 5% skim milk overnight , incubated for 2 hours with anti - hsp72 antibody ( stressgen , victoria , canada ) , and reacted for 2 hours with peroxidase - conjugated anti - mouse antibody ( amersham , buckinghamshire , uk ) , followed by being probed with a chemiluminescence kit ( amersham ) . rgc-5 cells grown in a chamber slide were transduced for 2 hours at an moi of 20 pfu per cell . forty - eight hours post - transduction , the cells were fixed with 4% paraformaldehyde , permeabilized with 0.5% triton x-100 , and blocked with 2% bovine serum albumin . the cells were then incubated for 2 hours with anti - hsp72 antibody , reacted for 2 hours with alexa fluor 568-conjugated goat anti - mouse igg ( molecular probes , eugene , or , usa ) , and counterstained with 4',6-diamidino-2-phenylindole . rgc-5 cells were dispensed in a 96 well plate at a concentration of 1 10 cells per well and transduced for 2 hours at an moi of 5 and 20 pfu . the cells were washed , replenished with 100 l of media containing 5 to 20 m etoposide and cultured further . after 48 hours , 10 ul of reagent for used in the cytotoxicity assay ( wst-8 ; dojindo , rockville , md , usa ) per well was added , and the absorbance at 450 nm was read by an automatic microplate reader after 1 hour of incubation . a replication - deficient recombinant adenovirus expressing human hsp72 was constructed using the adeasy system ( qbiogene , carlsbad , ca , usa ) . the cdna for hsp72 ( approved gene symbol hspa1a ) was amplified by reverse transcription - polymerase chain reaction ( pcr ) using total rna extracted from hela cells that were previously heat shocked at 42 for 30 minutes . the amplified product was cloned into the pshuttle - cmv vector and verified by sequencing . the vector was then transfomed into escherichia coli strain bj5183 together with the padeasy-1 vector that contains the entire adenovirus serotype 5 genome except the e1 and e3 regions . the recombinant adenoviral constructs were selected and transfected into the hek-293 packaging cell line to produce viral particles . viral titers were determined by limiting dilution on 293 cells and the absence of the e1a gene in the viral constructs was confirmed by pcr . the rat retinal ganglion cell line , rgc-5 , was originally provided as a gift from dr . neeraj agarwal ( university of north texas health science center , fort worth , tx , usa ) . rgc-5 cells were maintained in medium containing dulbecco 's modified eagle 's medium ( life technologies , rockville , md , usa ) , 10% fetal bovine serum , and antibiotics at 37 in a humidified 5% co2 - 95% air atmosphere . rgc-5 cells grown to 70% confluence in a 24-well plate were transduced with a recombinant adenovirus expressing hsp72 for 2 hours at a multiplicity of infection ( moi ) of 5 to 50 plaque forming units ( pfu ) per cell . forty - eight hours after transduction , adherent cells were lysed with 0.4 ml of 1 laemmli sample buffer and boiled for 5 minutes . the protein samples were resolved by sodium dodesyl sulfate polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane . the membrane was blocked with 5% skim milk overnight , incubated for 2 hours with anti - hsp72 antibody ( stressgen , victoria , canada ) , and reacted for 2 hours with peroxidase - conjugated anti - mouse antibody ( amersham , buckinghamshire , uk ) , followed by being probed with a chemiluminescence kit ( amersham ) . rgc-5 cells grown in a chamber slide were transduced for 2 hours at an moi of 20 pfu per cell . forty - eight hours post - transduction , the cells were fixed with 4% paraformaldehyde , permeabilized with 0.5% triton x-100 , and blocked with 2% bovine serum albumin . the cells were then incubated for 2 hours with anti - hsp72 antibody , reacted for 2 hours with alexa fluor 568-conjugated goat anti - mouse igg ( molecular probes , eugene , or , usa ) , and counterstained with 4',6-diamidino-2-phenylindole . rgc-5 cells were dispensed in a 96 well plate at a concentration of 1 10 cells per well and transduced for 2 hours at an moi of 5 and 20 pfu . the cells were washed , replenished with 100 l of media containing 5 to 20 m etoposide and cultured further . after 48 hours , 10 ul of reagent for used in the cytotoxicity assay ( wst-8 ; dojindo , rockville , md , usa ) per well was added , and the absorbance at 450 nm was read by an automatic microplate reader after 1 hour of incubation . to express hsp72 exogenously in rgc-5 cells that are not easily transfected by conventional methods , the cells were transduced with a recombinant adenovirus expressing human hsp72 . western blot analysis showed that protein bands of 72 kda corresponding to hsp72 were clearly detected in lysates of cells transduced with a recombinant adenovirus expressing human hsp72 . the intensities of the bands were found to be in proportion to the degree of viral transduction . in untransduced control cells , immunocytochemistry yielded consistent results showing that cytoplasmic staining for characteristic hsp72 expression could be detected exclusively in transduced cells but not in untransduced cells , confirming the adenovirus - mediated hsp72 gene expression ( fig . 1b ) . to examine the effect of hsp72 on the death of rgc-5 cells caused by apoptosis , the cells were treated with etoposide immediately after viral transduction . compared with control cells ( fig . 2a ) , early cell death was seen in a small proportion of cells in the culture without serum ( fig . 2b ) , and the degree of cell death was accelerated by the treatment of etoposide ( fig . . however , the etoposide - induced cell death appeared to be blocked by hsp72 expression , as observed by the enhanced viability of cells that were transduced immediately before etoposide treatment ( fig . to confirm the effect of hsp72 on the survival of rgc-5 cells , a cell proliferation assay was performed on cells treated with etoposide following viral transduction ( fig . the rate of viable cells was reduced by 44.8 6.7% and 80.8 9.2% relative to control cells at 5 and 20 m etoposide , respectively . viral transduction itself might be toxic to cells because cell viability was slightly decreased when hsp72 was expressed in control cells . the hsp72 expression , however , seemed to be protective to cells undergoing apoptosis in that the rate of cell death in the cultures exposed to etoposide was progressively reduced as the degree of viral transduction increased . at the highest level of hsp72 expression , the number of viable cells recovered was increased by 24.0 3.1% and 94.1 10.3% over that in the control cultures at 5 and 20 m etoposide , respectively . in this study , we addressed whether hsp72 can protect rgc-5 cells from apoptotic cell death . rgc-5 cells are the only immortalized rgc cell line established to date and are used widely in glaucoma research , although it is uncertain whether the cell line is of mouse or rat origin . to investigate directly the effect of hsp72 on the death of rgc-5 cells , it is necessary to express the protein exogenously in the cells . to overcome this obstacle , we constructed a recombinant adenovirus in which a human hsp72 cdna is under the control of the human cytomegalovirus promoter for its constitutive expression and demonstrated that the viral vector was successful in both transducing rgc-5 cells and expressing its transgene inside the cells . we showed that the degree of cell death by etoposide was inversely proportional to the degree of viral transduction in the cells . etoposide , an inhibitor of topoisomerase ii , is a well - known apoptosis - inducing reagent . therefore , our results present direct evidence for the cytoprotective ability of hsp72 against apoptotic cell death . the protective role of heat shock was first described in light - damaged rat retina and hsp72 protein was identified as the entity primarily responsible for the response . a growing body of evidence has accumulated that induction of hsp72 is essential for neuronal tolerance to a wide variety of stressful conditions including ischemic or excitotoxic insults , seizure , oxidative stress , and apoptotic stimuli . the present study demonstrates that hsp72 expression itself is sufficient to protect rgc-5 cells from apoptotic cell death . apoptosis , or programmed cell death , of rgcs is one of the earlier signs of the pathogenesis of glaucoma . because inhibition of rgc death or a halt of its progression is the key to glaucoma treatments , the ability of hsp72 to intervene in the process of apoptosis is attractive as a novel therapeutic intervention in glaucoma . gene therapy , which is a practical alternative to current therapies that are limited to reduction of elevated intraocular pressure , is an approach by which hsp72 could be useful in a clinical context . recent studies reported that hsp72 induction by zinc or geranylgeranylacetone administration increased rgc survival in a rat glaucoma model , suggesting that hsp72 could be therapeutic for glaucoma . the eye may perhaps be the first organ for which gene therapy is used routinely in a clinical setting because it has advantages such as well - defined anatomy with small size , translucent media allowing excellent visual localization , and easy accessibility by which therapeutic agents can be delivered to the vicinity of cells with a particular defect . the replication - deficient adenovirus generated in this study is a sophisticated gene delivery tool and such viral - based vectors are expected to have enormous potential as a mammalian expression system for gene therapy . recently , it has been reported that hsp72 can be identified in the extracellular compartments and the extracellular hsp72 acts as a cytokine that induces inflammation and modulates the innate immune response [ 17 - 20 ] . the dual role of hsp72 as a molecular chaperone and cytokine suggests that fine tuning its expression may be a potential route for a novel therapeutic approach to glaucoma and other neurodegenerative diseases .

purposeto assess whether the expression of heat shock protein 72 ( hsp72 ) protects rat retinal ganglion cells ( rgc-5 ) from apoptotic cell death.methodshsp72 expression in rgc-5 cells transduced with replication - deficient recombinant adenovirus was analyzed by western blot analysis and immunofluorescence . the effect of hsp72 expression on etoposide - induced apoptotic cell death was examined by microscopic analysis and confirmed by cell proliferation assay.resultswestern blot analysis and immunofluorescence clearly showed adenovirus - mediated hsp72 expression in rgc-5 cells . treatment with etoposide resulted in the death of a proportion of the cells by apoptosis . however , this apoptotic cell death was significantly reduced in cells expressing hsp72 , with the reduction in cell death correlating to the level of hsp72 expression.conclusionsover-expression of hsp72 alone is sufficient to rescue neuronal cells from apoptotic cell death , suggesting that fine - tuning its expression may be an effective neuroprotective approach in retinal degenerative disease .

alzheimer s disease places a considerable progressive burden on the principal caregiver ( schneider et al 1999 ) . the number of people with ad in the usa is 4 million and is predicted to more than treble by 2050 ( sloane et al 2002 ) . kukull and bowen ( 2002 ) estimated that ad comprises more than 50% of total dementia cases . the economic impact of this illness is enormous , exceeding us$100 billion annually in the usa ( boustani et al 2003 ) . in ad , degeneration of basal forebrain cholinergic pathways linked with the cortex is thought to cause the cognitive deficiencies ( bartus et al 1982 ) . cheis block enzymes that metabolise acetylcholine and therefore increase its levels ( becker 1991 ) . donepezil , galantamine , and rivastigmine inhibit acetyl cholinesterase ( lane et al 2004 ) . inhibition of both butyrylcholinesterase and acetyl cholinesterase for rivastigmine ( giacobini 2004 ) , and nicotinic modulation for galantamine ( samochocki et al 2000 ) may contribute to the efficacy of these cheis . the overactivation of glutamate , particularly n - methyl - d - aspartate ( nmda)-selective receptors , has been associated with the degeneration of cholinergic function seen in ad ( francis 2003 ) . memantine may prevent glutamate - induced neuronal damage by noncompetitive antagonism of the nmda receptor ( hartmann and mobius 2003 ) . current treatments may lack a clinically significant effect and new treatment strategies are essential to assist in disease management ( ad2000 2004 ; nice 2005 ) . combining memantine s potential neuroprotective effect with the improvement in cholinergic functioning noted with a chei may lead to additional therapeutic benefits ( wenk et al 2000 ) . recent animal studies have indicated a ceiling effect on benefit in memory impairment and additive or synergistic effects of combining memantine with a chei ( yamada et al 2005 ) , which is the basic science rationale . a computerized literature search of medline ( 1966july 2005 ) , psycinfo ( 1972september 2005 ) , embase ( 1980july 2005 ) , cinhal ( 1982september 2005 ) and the cochrane collaboration was conducted . keywords used were : ad , randomized controlled trials ( clinical trial , single - blind method , double - blind method , random allocation ) , open - label studies , cholinesterase inhibitors ( donepezil , rivastigmine , galantamine , galanthamine , and tacrine ) , and memantine . the reference section of studies identified was scrutinized , the relevant pharmaceutical manufacturers were contacted for any unpublished studies , and the us trials database ( http://www.clinicalstudyresults.org/search/ ) was examined . one trial is published only in summary format online ( fli 2003 ) and in a poster meta - analysis ( doody et al 2005 ) . this poster , however , contains only limited data ( doody et al 2005 ) , and forest laboratories were unable to provide more detailed information ( forest laboratories inc 2005 july 7 , pers comm ) . one study was published in a peer - reviewed journal ( tariot et al 2004 ) . three similar prospective studies have been published only in abstract format ( pass et al 2004 ; patel et al 2004 ; shua - haim et al 2004 ) . two studies were multicenter , randomized , double - blind , placebo - controlled ( fli 2003 ; tariot et al 2004 ; doody et al 2005 ) , and three studies were open label ( pass et al 2004 ; patel et al 2004 ; shua - haim et al 2004 ) . the randomized , controlled trials ( rcts ) ( fli 2003 ; tariot et al 2004 ; doody et al 2005 ) were not designed to determine the relative efficacy compared with placebo of memantine monotherapy , donepezil monotherapy , or combination therapy , but whether memantine would provide additional benefit in a patient already on a chei . tariot et al ( 2004 ) randomized 203 patients to memantine and 201 to placebo . the sample sizes of the open studies varied from 12 to 25 ( pass et al 2004 ; patel et al 2004 ; shua - haim et al 2004 ) . patient numbers were not available for one study ( fli 2003 ) except in a poster meta - analysis ( n = 433 ) ( doody et al 2005 ) . fli ( 2003 ) maintained patients on a stable dose for a chei ( exact details not stated ) for at least 6 months prior to entry . tariot et al ( 2004 ) maintained patients on donepezil for at least 6 months , and at a stable dose of 510 mg daily for at least 3 months prior to the study . none of the open studies stated how long patients had been taking a chei before memantine was begun ( pass et al 2004 ; patel et al 2004 ; shua - haim et al 2004 ) . alzheimer disease and related disorders association ( nincds arda ) diagnosis of probable ad ( fli 2003 ; tariot et al 2004 ; doody et al 2005 ) ; dsm - iv ( apa 1994 ) ; and nincds arda for possible alzheimer s disease ( pass et al 2004 ; patel et al 2004 ; disease stage ranged from mild to moderate ad in one rct ( fli 2003 ; doody et al 2005 ) to moderate to severe ad in the other ( tariot et al 2004 ) . the three open studies did not specify the stage ( pass et al 2004 ; patel et al 2004 ; shua - haim et al 2004 ) . tariot et al ( 2004 ) assessed efficacy with the severe impairment battery ( sib ) ( panisset et al 1994 ) , a modified 19-item ad cooperative study activities of daily living inventory ( adcs adl19 ) ( galasko et al 1997 ) , the clinician s interview - based impression of change plus caregiver input ( cibic - plus ) ( schneider et al 1997 ) , the neuropsychiatric inventory ( npi ) ( cummings et al 1994 ) , and the behavioral rating scale for geriatric patients ( bgp ) ( van der kam et al 1971 ) . fli ( 2003 ) assessed global outcomes ( cibic - plus ) and alzheimer s disease assessment scale cognitive outcomes ( adas - cog ) ; secondary outcomes were the npi and the adcs three studies assessed memory objectively ( exact scale not stated ) and used caregiver report to assess effect on cognition and functioning ( pass et al 2004 ; patel et al 2004 ; shua - haim et al 2004 ) . none of the studies utilised outcome instruments such as time to residential admission or death . caregivers rated tolerability and adverse events in three studies ( pass et al 2004 ; patel et al 2004 ; shua - haim et al 2004 ) . one study assessed emergent adverse events by patient report and vital sign , physical examination , laboratory , and electrocardiogram testing ( tariot et al 2004 ) . fli ( 2003 ) reported adverse events in a pooled analysis of six trials ( doody et al 2005 ) . tariot et al ( 2004 ) reported that at week 24 using last observation carried forward ( locf ) and observed cases ( oc ) , memantine with donepezil produced a statistically significant improvement in the sib , adcs adl , cibic - plus , npi , and bgp in patients with moderate to severe ad compared with donepezil and placebo ( see table 1 for full details ) . it may be difficult to relate results from psychometric scales to a clinical setting ( fox et al 2003 ; ad2000 2004 ) and the clinical significance of combination therapy is unclear . the effect size of 0.36 on cognition , although small ( cohen 1988 ) , is of comparable magnitude to that of the cheis ( rockwood 2004 ) . the effect size for function at 0.12 is very small and raises the issue of clinical relevance . the relative improvements were limited when the full range of each scale is considered , making it impossible to assess response rates , and data were not made available despite requests . floor effects may have influenced the npi and bgp results , as the baseline readings indicated only mild impairment . a second trial failed to demonstrate that combination therapy is significantly more effective than chei monotherapy in patients with mild to moderate ad ( fli 2003 ; doody et al 2005 ) . combination therapy did not produce a statistically significant difference on global or cognitive outcomes compared with placebo chei . chei group and the decline in cognition in the placebo chei group was less than expected . the small group difference was not statistically significant ( exact p value not stated ) . the three open studies noted improvements in carer - rated cognition , but failed to demonstrate objective memory improvements ( pass et al 2004 ; patel et al 2004 ; shua - haim et al 2004 ) . furthermore any effect noted in the open studies should be treated cautiously because of the potential for false positive outcomes owing to random variability , placebo effects , and bias ( khan et al 2001 ) . significantly more patients on memantine donepezil compared with placebo donepezil completed one study ( 85.1% [ n = 172 ] vs 74.6% [ n = 150 ] , p = 0.01 ) ( tariot et al 2004 ) , suggesting that the combination was not associated with significantly greater side effect burden than the chei alone . adverse events that occurred twice as frequently with memantine were : confusion ( 7.9% vs 2.0% ; p = 0.01 ) , and headache ( 6.4% vs 2.5% ; p = 0.09 ) ( tariot et al 2004 ) . adverse events occurred in 78% of patients on memantine , and 72% of patients on placebo ( p not stated ) ( tariot et al 2004 ) . this high rate of adverse events may provide an accurate reflection of adverse events in the wider population of nonstudy patients . future trials should take into account the fact that the patient selection criteria of placebo - controlled studies may overestimate the incidence of adverse events associated with placebo ( bandolier 2003 ) owing to the nature of the underlying disorder . one study has not mentioned tolerability to date except as a pooled figure , which makes specific commentary impossible ( fli 2003 ; doody et al 2005 ) . discontinuation rates of 7.9% with placebo and 6% with memantine may indicate that memantine lacks efficacy in the milder stages of ad ( doody et al 2005 ) . no patients discontinued treatment or reported adverse events in the open studies ( pass et al 2004 ; patel et al 2004 ; shua - haim et al 2004 ) . on the current available evidence , the use of memantine chei combination therapy can not be recommended as there is no evidence that combination therapy is more effective than memantine monotherapy ( tariot et al 2004 ) . on common outcome measures , placebo signal than the memantine donepezil combination / placebo donepezil signal ( tariot et al 2004 ) . the negative mild ad study ( fpi 2003 ; doody et al 2005 ) in our opinion backs the us food and drug administration decision not to allow license extension to mild ad ( fda 2005 ) . the difficulty in obtaining full access to relevant studies is of concern and makes developing evidence - based recommendations problematic . clinicians should have full access studies as directed by new us legislation ( http://www.clinicalstudyresults.org/search/ ) . the publication of a meta - analysis that includes dementia at various stages in advance of full publication or full data disclosure may obscure negative results ( lexchin et al 2003 ; doody et al 2005 ) . healthcare provider guidelines need to consider the economic impact of combination prescribing in a situation where the cost benefits of cognitive is already controversial ( nice 2005 ; maidment et al 2006 ) . no adequate study has yet been presented to determine whether chei combined with memantine has a synergistic effect . further studies including three arms : memantine placebo , placebo chei , and memantine studies should concentrate on patients with moderate to severe ad and include a 12-month extension arm to determine if efficacy is sustained . active treatments should be assessed for a clinical effect in addition to a statistically significant effect . future studies should evaluate the efficacy of combination therapy in non - ad dementia and include formal economic evaluations and pragmatic efficacy assessments such as time to residential facility . on the current dataset the use of memantine chei combination therapy can not be endorsed . chei , and memantine chei . before adding in memantine , cheis should be discontinued or , once on therapeutic dose of memantine , cf and ck have received funding for a project on screening for memory problems from eisai , lundbeck , novartis , pfizer , and shire . cf and idm have received honoraria and meeting travel costs from eisai , lundbeck , novartis , pfizer , and shire . ck has received funding for a project with people with ad from lundbeck and has also participated in a memantine clinical trial . he has received honoraria and meeting travel costs from lundbeck and honoraria from shire and pfizer .

backgroundmemantine and cholinesterase inhibitors ( chei ) have distinct pharmacological actions , and interest in the use of combination therapy for alzheimer s disease ( ad ) is increasing.objectiveto assess the available data on the use of memantine chei combination and to develop evidence - based recommendations.methoda systematic literature review with detailed discussion of the current evidence base.resultsavailable data are limited : five studies of which two were randomized , double - blind , placebo - controlled trials . one study indicated that memantine chei combination is not significantly more effective than placebo chei in mild to moderate ad , but data were published in abstract and poster form only . a second study indicated that the memantine chei combination is significantly more effective than placebo chei in moderate to severe ad . the calculated effect sizes of 0.36 on cognition and 0.12 on function , which were the primary outcomes , were small , indicating a clinically minimal effect on cognition and no effect on function . no data are available on whether combination treatment is more effective than memantine monotherapy.conclusionthe available data do not justify the use of combination therapy . future studies should include three arms ( memantine placebo , placebo chei , and memantine chei ) , be of an adequate size and duration , and use pragmatic measures . clinicians should have full access to data from any future trials .

among smokers who are aware of the ill effects of smoking , 3 out of 4 individuals are interested in quitting . one of the most important responsibilities of a countries health care system is to treat nicotine dependence . this effort consists of different methods such as simple clinical counseling , medications and quit lines . the cost of these methods differs , however and these methods are not equally effective . it also is important to match the treatment method to the local and cultural context as well as to clients current needs . repeated consultation is important in reinforcing the necessity of quitting smoking at every clinical visit . this intervention is relatively cost - effective , because it is part of the existing health care services which are used by the majority of smokers . these interventions are effective because they are offered by health care providers , who are respected by the public and smokers also have a good relationship with them . moreover , it is important to provide the quit lines services free- of- charge from any telephone . even old telephone line systems that responded only to incoming calls showed very significant results . in addition to clinical counseling and quit lines for consultation , an effective treatment can include medication . medication includes nicotine replacement therapy ( nrt ) ( patches , gum , sublingual tablets , lozenges , inhalers and nasal spray ) and prescribed drugs such as bupropion and varenicline . in general , medication is more expensive than medical counseling and quit lines . now after 9 years from the first educational interventions for quitting smoking and one of two complementary integrated programs in the primary health care network , the situation for counseling , human resources and medication is not suitable at the country level and there is insufficient documentation and studies in this regard . thus , it was considered beneficial to identify the best current evidence and incorporate the latest outcomes . this would allow for development of an appropriate framework necessary to assess different methods in order to select the best approaches for essential interventions at the country level . this study specifically targeted decision makers in iran to enable a quantitative systematic review based on the two following two main questions : which smoking cessation methods are most published?which one is the most effective method ? based on a cross - sectional study , english publications from 2000 to 2012 in pubmed were selected . to find articles related to quitting smoking , we considered one of the following keywords from a title : quit or cessation , nrt , champix or varenicline or chantix , zyban or bupropion sustained - release , combination therapy , training , self - learning material , behavior therapy , quit and win , hypnosis , telephone consulting , acupuncture , interactive voice response ( ivr ) , e - cigarettes , pharmacological treatments , non - pharmacological treatments , personal methods , non - nicotine medications . in an expert panel meeting it was proposed to include relevant articles ( at a minimum , these must include the abstracts ) . unpublished and duplicated articles and opinion based papers were excluded as they were not classified as relevant . articles were reviewed separately by two qualified assistants , who were trained and calibrated to achieve desirable agreement in the selecting of articles . in order to reach check reliability , a pilot inter - rater reliability assessment was conducted by the author ( gh ) . the inter - rater reliability was 67% before discussion ; any discrepancies in answers were discussed and a consensus was achieved on review . after the training and pilot assessment , the author ( gh ) determined that the assistants were ready to do the search . the reports of the assistants were observed again by the author ( gh ) , who determined when the assistants were ready to work alone . finally , the assistants selected and categorized the articles according to the following criteria for each method : total number of articles , the number of articles that supported quit smoking efforts , the number of articles that did not support quit smoking efforts and the number of articles without any firm conclusions . again in order to assess the reliability of each assistant , one method was selected randomly and the recorded results were compared by the author ( gh ) . if there were discrepancies in the figures , these were corrected by author ( gh ) . different methods were used for rating articles and the strengths and weakness of each were discussed through an expert panel meeting . finally , the best scoring model was accepted for each stop - smoking method , which included a maximum of 40 scores of which 20 scores were for articles that supported methods ( positive articles minus negative articles ) and 20 points for the highest proportion of supported to the total number of articles . for scoring of each article , one point was possible , since we did not consider differences between articles which were published in pubmed . however , a point was not given for articles that did not have a clear result . because newer treatment methods had less chance for having more published articles ; an index of positive articles to total articles this search resulted in a folder with 3081 titles of articles ; of which 1436 were inaccessible ( at a minimum an abstract ) . out of 1645 remaining articles , 713 were not about treatment and its effect on quitting smoking ( they were about history , smoking cessation programs in countries , relevant policies , rules and regulations for stopping smoking , article 14 of world health organization [ who ] framework convention on tobacco control , etc . ) of the 932 remaining articles , 62 articles did not support quit smoking methods ( with no good results or side - effects ) . of 870 remaining manuscript , 90 cases did not demonstrate a clear result ( even whether the method is usable ) [ figure 1 ] . study selection flow diagram nrt , champix and zyban respectively with 352 , 117 and 71 cases were the most advised method and e - cigarette and non - nicotine medication with one case were the least advised methods . for each method the number of advising articles to the total was 31 out of 32 and for nrt was 376 of 407 ( which was considered the maximum score ) . willpower with two out of 9 was the lowest score and finally nrt with a score of 39 and champix and training with a score of 36 were the best methods . the number of selected articles and the results are shown in tables 1 and 2 . prevalence of smoking cessation methods in included articles ( n=932 ) and the results obtained by number of articles and based on classification of the studies prevalence of quit smoking methods in the included articles ( n=932 and their scores ) unfortunately , after a decade of offering quit smoking services , the situation is not so positive in iran and is still based on older methods such as 15 mg nicotine patches and group therapy . these services have not been updated on the basis of more recent evidence . for determining which quit smoking methods are maximally effective , a comprehensive review of all recent articles was a necessity in order to obtain suitable qualitative indicators for selecting effective quit smoking methods . in this study , it was found that three methods nrt , champix and education for quitting smoking are advised most frequently based on the articles referenced in pubmed between the years 2000 and 2012 . these findings are informative in updating the health care services at the country level and a combination of these methods might be provided . many countries that offer cessation services follow better methods through evaluation and incorporating necessary modifications to these methods . as displayed in the results , nrt , champix , training , combination treatment , zyban and self - help materials received the highest scores with over 30 points ; multi - drug treatment , acupuncture , some methods without medication such as nurse counseling , non - nicotine drugs , will power and e - cigarettes had the lowest scores with less than 20 and the remaining methods including behavioral methods , quit and win , telephone counseling and ivr and hypnotism were in the middle . the results of this study are consistent with the findings of high impact articles in who , centers for disease control and prevention and cochrane , and these results also were consistent with the writers experience . however , it was necessary to prioritize quitting methods based on a new quantitative analysis and simple qualitative methods in order to gain the support of decision makers for further necessary interventions . that is because the systematic reviews , such as cochrane , do not provide guidance on which of the effective methods are best for a particular environment . in the systematic reviews articles finding the relevant articles was challenging in the current study because we selected a huge number of articles for a particular selected method ( based on the accessibility of the full text or abstract ) . boyle et al . and linder et al . in their studies have reported that use of electronic medical registration and continuous use of nicotine patches can increase success of smoking cessation attempts . this study was the first quantitative study , which provided us with a wide perspective about all tobacco cessation methods . scores were based in part on number of publications , thereby creating a bias in favor of older methods with more opportunity for publication . some of the newer methods are quite recent and therefore not surprisingly have few published assessments . this study could be a useful indicator of effective quit smoking methods based on updated scientific documents . the results of this study could be used as a reference for decision makers who are charged with selecting cessation methods at the country level that will produce good outcomes . methods that obtained the higher scores have been applied most frequently in interventions that have had positive effects on quit rates . according to the updated scientific and updated evidence based on a simple and quantitative approach , quit smoking methods with high and better scores including nrt , champix and training have been recognized as effective and the other methods have received lower scores . further studies are needed to implement a comparative study on qualitative and quantitative smoking cessation methods that could lead to increased quit rates at the country level .

background : during recent years , there have been many advances in different types of pharmacological and non - pharmacological tobacco control treatments . in this study , we aimed to identify the most effective smoking cessation methods used in quit based upon a review of the literature.methods:we did a search of pubmed , limited to english publications from 2000 to 2012 . two trained reviewers independently assessed titles , abstracts and full texts of articles after a pilot inter - rater reliability assessment which was conducted by the author ( gh ) . the total number of papers and their conclusions including recommendation of that method ( positive ) or not supporting ( negative ) was computed for each method . the number of negative papers was subtracted from the number of positive ones for each method . in cases of inconsistency between the two reviewers , these were adjudicated by author.results:of the 932 articles that were critically assessed , 780 studies supported quit smoking methods . in 90 studies , the methods were not supported or rejected and in 62 cases the methods were not supported . nicotine replacement therapy ( nrt ) , champix and zyban with 352 , 117 and 71 studies respectively were the most supported methods and e - cigarettes and non - nicotine medications with one case were the least supported methods . finally , nrt with 39 and champix and education with 36 scores were the most supported methods.conclusions:results of this review indicate that the scientific papers in the most recent decade recommend the use of nrt and champix in combination with educational interventions . additional research is needed to compare qualitative and quantitative studies for smoking cessation .

though well known , ruptured sinus of valsalva ( rsov ) aneurysms are rare comprising 0.3 - 3.56 % of all congenital heart diseases.1 they are thin walled outpouchings of the sinus of valsalva and may be tubular or saccular in shape . the right sinus of valsalva is most commonly involved and usually ruptures into right heart chambers . uncommonly they rupture into left heart chambers ( left atrium , left ventricle ) , pulmonary artery , interventricular septum or the pericardial cavity.23 rupture into the left ventricle ( lv ) is very rare.45 we report a young male patient who was diagnosed to have a large aneurysm of left sinus of valsalva with rupture into lv along with distortion of mitral valve requiring replacement of both aortic and mitral valve . to our knowledge , an aneurysm of the left valsalva sinus bulging into the left atrial ( la ) roof and damaging the mitral valve along with concomitant rupture into the left ventricular cavity leading to severe aortic regurgitation ( ar ) and thus requiring a double valve replacement ( dvr ) has not been reported . pk , a 25 year old male patient was referred to our hospital with chest pain and dyspnea on exertion for the previous two months . there was no history of prolonged fever or trauma . on examination , he was of an average built . there was pallor , tachycardia ( hr-110/minute ) , tachypnoea ( respiratory rate-24/minute ) and wide pulse pressure ( bp 124/40 mmhg in right upper limb ) . cardiac examination revealed cardiomegaly , a hyperdyanamic precordial impulse , an ejection systolic murmur grade 2/6 and a pandiastolic murmur at the left parasternal border . twelve lead electrocardiogram showed sinus tachycardia , qrs axis + 60 and lv hypertrophy , and st depression in the left sided leads ( figure 1 ) . transthoracic echocardiography done on phillip ie33 showed a large aneurysm of the left sinus of valsalva with rupture of the aneurysm into the lv ( figures 26 ) . 12 lead ecg showing sinus tachycardia(hr-90/minute ) , qrs axis + 60 and lvh , st depression in left sided leads apical 4 chamber view with anterior tilt ( 5 chamber view ) showing aneurysm from left sinus bulging into left atrium and impinging to mitral valve . parasternal short axis view at the level of great vessels showing large aneurysm arising from left sinus of valsalva standard parasternal long axis view showing aortic valve and small portion of aneurysm posterior to aortic valve and dilated left ventricle . anterior tilt from figure 4 opened up whole aneurysm extending anteriorly to right ventricle outflow and posteriorly bulging into left atrium . the aneurysm bulged into the mitral inflow distorting the mitral valve ( figures 2 and 3 ) . color flow mapping showed 3 jets of aortic regurgitation , one central jet and two other from the ruptured aneurysm ( figure 6 ) . it also revealed turbulent flow across mitral inflow and moderate mitral regurgitation ( mr ) . continuous wave doppler interrogation of the mitral inflow revealed a transmitral mean gradient of 7 mmhg . early surgical intervention was advised and was performed through midsternotomy under routine cardiopulmonary bypass . at surgery , a large aneurysm of the left sinus of valsalva measuring 5 by 6 cm was found originating just distal to the orifice of the left coronary artery and protruding into the lv cavity . posteriorly , the aneurysm had burrowed into the roof of the left atrium causing displacement of the anterior mitral leaflet , resulting in significant mr . the mouth of the aneurysm was closed with a gore - tex ( expanded ptfe ) patch and the aortic valve was replaced with a 19 mm st . jude aortic valve prosthesis .the left sinus portion of the valve was anchored to the gore - tex patch .the mitral valve was inspected through a left atriotomy to assess feasibility of repair . there was marked distortion of the mitral annulus by the aneurysm and the valve cusps were considerably thickened . feasibility of durable repair was ruled out and a valve replacement with 25 st jude mitral valve was performed . the earliest descriptions of sinus of valsalva were in the reports of hope and thurman.67 later , abbott described this malformation as congenital and not acquired in origin.8 most aneurysms are congenital in origin but they may be seen after bacterial endocarditis , atherosclerosis or chest trauma.29 aneurysms of sinus of valsalva are thought to result from the absence of normal elastic and muscular tissue , which leads to thinning of the wall of the aortic sinus.47 in a study of 332 patients collected from western and oriental literature by chu et al , pathological rupture of a sinus of valsalva most frequently involved the right sinus ( 76.8% ) , followed by the noncoronary ( 20.2% ) , and least commonly , the left sinus of valsalva ( 3%).1 on reviewing the english literature we could find only 26 cases of rsov ruptured into the left ventricle and out of them only 3 arose from a left sinus of valsalva aneurysm.5 in all of them , the aneurysm was repaired along with aortic valve replacement . presentation of sinus of valsalva aneurysm is varied .15 with rupture , the presentation is acute with chest pain and dyspnea . chest pain is due to acute ar from the ruptured sinus of valsalva , frank or dynamic coronary artery compression , or dissection into a coronary artery . unruptured sinus of valsalva aneurysms are usually asymtomatic but may sometimes present as right ventricular outflow tract obstruction when they bulge into right ventricular outflow tract , or subaortic stenosis when they bulge into the left ventricular outflow tract . rarely , complete heart block occurs when it erodes into the interventricular septum.12 associated heart defects that have been reported are ventricular septal defect ( in about 50% of cases ) , pulmonary stenosis , tetralogy of fallot , coarctation of aorta , bicuspid aortic valve , valvular and supravalvular aortic stenosis , left superior vena cava and one case report of anomalous origin of left coronary artery from pulmonary artery.2 initially , angiography was the gold standard for the diagnosis but now , noninvasive modes of diagnosis such as echocardiography ( transthoracic , transesophageal ) , spiral computed tomography and cardiac magnetic resonance imaging have taken over as preferred investigations . in our case we were able to delineate the detailed anatomy by transthoracic echocardiography and the patient underwent surgery requiring replacement of both aortic and mitral valve .

we report a rare case of sinus of valsalva aneurysm of left aortic sinus , which was bulging into left atrium ( la ) distorting mitral valve and rupture into the left ventricle with severe aortic regurgitation in a 25 years old male patient . due to the rupture , both aortic and mitral valves were irreparable and required a double valve replacement along with the closure of the neck of the aneurysmal cavity occupying the left atrial roof .

superior mesenteric artery syndrome ( smas ) is a rare condition causing acute or chronic compression of the third part of the duodenum , due to a reduction in the aortomesenteric angle . laparoscopic duodenojejunostomy is a minimally invasive option that has been reported in up to 10 cases . we describe our operative technique in one case and review the literature on this condition . a previously well 66-year - old man presented with acute gastric dilatation . an abdominal computerized tomography ( ct ) scan and oral gastrografin meal revealed a dilated stomach and proximal duodenum due to compression of the third part of the duodenum between the superior mesenteric artery ( sma ) and aorta . gastrografin administration on the fifth day showed no leak , with free flow of contrast into the jejunum . it gives the same results as open surgery with all the advantages of minimally invasive surgery . superior mesenteric artery syndrome ( smas ) , also known as wilkie 's syndrome , is a very rare cause of proximal small - bowel obstruction that was first described by rokitansky in 1861 . although well documented in the english literature , some surgeons doubt the existence of smas as a real entity . smas is characterized by extrinsic compression of the third part of the duodenum between the aorta and the superior mesenteric artery ( sma ) , due to narrowing of the aortomesenteric angle , and results in acute or chronic intermittent duodenal obstruction . a 66-year - old man , with no previous medical history , presented with severe upper abdominal pain and distension that had been present for a few days . he had no history of nausea , vomiting , recent weight loss , altered bowel habits , or previous abdominal surgery . on examination , he was alert , afebrile , with a pulse rate of 107/min and blood pressure of 155/95 mm hg . an urgent computerized tomography ( ct ) scan revealed marked distension of the stomach and proximal duodenum with narrowing of the third part of the duodenum between the superior mesenteric artery ( sma ) and aorta ( figure 1 ) . the sagittal - ct showed a marked narrowing of the aortomesenteric angle ( white arrow ) to 8.6 degrees compatible with a diagnosis of superior mesenteric artery syndrome ( smas ) ( figure 2 ) . the patient 's symptoms improved with nasogastric decompression , and he got himself discharged against medical advice the next day . he presented again in the emergency department 2 days later with similar symptoms , bilious vomiting and severe dehydration . the first and second parts of the duodenum were dilated with a collapsed lumen in the third part . the scope , however , could pass through the third part . gastrografin administration showed hold up of contrast in the third part of the duodenum with proximal dilatation and slow passage into the distal small bowel ( figure 3 ) . conservative management with nasojejunal feeds was not successful because the patient was non - compliant and refused tube feeding . axial computed tomographic scan showing markedly dilated stomach and proximal duodenum with compression of the third part of the duodenum between the sma and aorta . preoperative gastrografin meal showing a dilated proximal duodenum with hold up of contrast in the third part and delayed passage distally . the patient , while under general anesthesia , was positioned supine with both legs abducted to allow the surgeon to stand in between . four ports were inserted - 1st port ( 10-mm camera ) : supraumbilical ; 2nd port ( 5 mm ) : left midclavicular line midway between the umbilicus and costal margin ; 3rd port ( 12 mm ) : right midclavicular line midway between the umbilicus and costal margin ; 4th port ( 5 mm ) : epigastrium ( figure 4 ) . the small bowel was traced from the duodenojejunal ( dj ) flexure to the cecum and found to be normal . the hepatic flexure , transverse mesocolon , and gastrocolic omentum were mobilized to visualize the duodenum and the head of the pancreas , which were elevated by the underlying aortic aneurysm . an on - table egd helped in visualization and kocherization of the dilated duodenum with harmonic shears . a proximal loop of jejunum about 25 cm from the dj - flexure was brought below the dilated duodenum and fixed with it by using interrupted seromuscular 2 0 vicryl sutures . the duodenum and jejunal lumen was then opened by using hook diathermy , and an endogia stapler ( ethicon endosurgery , somerville , nj ) was inserted and fired ( figure 5 ) . after confirming hemostasis of the staple line , the openings in the duodenum and jejunum were sutured together with continuous full - thickness 2 0 vicryl sutures . the anastomosis was tested for a leak , by instillation of methylene blue solution via the nasogastric tube . a tube drain was placed adjacent to the anastomosis , and the 10- and 12-mm port sites closed . a gastrografin meal study on the fifth postoperative day showed the anastomosis to be functioning well with no contrast leak ( figure 6 ) . the delay in discharge was due to social reasons and transfer to a step - down facility . the patient remained well and asymptomatic during follow - up at 1 and 3 months . position of trocar sites on the patient . stapled side - to - side laparoscopic duodenojejunostomy . postoperative day 5 gastrografin meal showing no leak with free flow into jejunum across the anastomosis . the patient , while under general anesthesia , was positioned supine with both legs abducted to allow the surgeon to stand in between . four ports were inserted - 1st port ( 10-mm camera ) : supraumbilical ; 2nd port ( 5 mm ) : left midclavicular line midway between the umbilicus and costal margin ; 3rd port ( 12 mm ) : right midclavicular line midway between the umbilicus and costal margin ; 4th port ( 5 mm ) : epigastrium ( figure 4 ) . the small bowel was traced from the duodenojejunal ( dj ) flexure to the cecum and found to be normal . the hepatic flexure , transverse mesocolon , and gastrocolic omentum were mobilized to visualize the duodenum and the head of the pancreas , which were elevated by the underlying aortic aneurysm . an on - table egd helped in visualization and kocherization of the dilated duodenum with harmonic shears . a proximal loop of jejunum about 25 cm from the dj - flexure was brought below the dilated duodenum and fixed with it by using interrupted seromuscular 2 0 vicryl sutures . the duodenum and jejunal lumen was then opened by using hook diathermy , and an endogia stapler ( ethicon endosurgery , somerville , nj ) was inserted and fired ( figure 5 ) . after confirming hemostasis of the staple line , the openings in the duodenum and jejunum were sutured together with continuous full - thickness 2 0 vicryl sutures . the anastomosis was tested for a leak , by instillation of methylene blue solution via the nasogastric tube . a tube drain was placed adjacent to the anastomosis , and the 10- and 12-mm port sites closed . a gastrografin meal study on the fifth postoperative day showed the anastomosis to be functioning well with no contrast leak ( figure 6 ) . the delay in discharge was due to social reasons and transfer to a step - down facility . the patient remained well and asymptomatic during follow - up at 1 and 3 months . position of trocar sites on the patient . stapled side - to - side laparoscopic duodenojejunostomy . postoperative day 5 gastrografin meal showing no leak with free flow into jejunum across the anastomosis . about 400 cases have been described in the english literature with a slight female preponderance . the availability of dynamic ct - scans has made the diagnosis of this rare and controversial condition much easier . normally , the sma leaves the aorta at an angle of 45 degrees , and it is through this aortomesenteric vascular angle that the third part of the duodenum passes through . a mass of fat and lymphatic tissue around the sma normally provides an adequate cushion to prevent extrinsic duodenal compression . any condition that narrows the aortomesenteric angle to approximately 6 degrees to 16 degrees can lead to smas . in our patient , he also had an accompanying 4-cm infrarenal aortic aneurysm that may have contributed to this narrowed angle . ahmed and taylor stressed the importance of differentiating smas from other conditions causing a similar clinical picture , such as scleroderma , systemic sclerosis , diabetes , myotonic dystrophy , and myxoedema . gondos suggested that the compression in these cases is brought on by dilatation and loss of muscle tone of the duodenum with secondary imprinting of the duodenum by the sma . , patients may present with features of acute gastric dilatation or proximal small bowel obstruction depending on whether the vomitus is bile - stained . the majority of cases are however chronic and present many times over several years for investigation of episodic upper abdominal pain with vomiting , anorexia , and early satiety . typically , the pain is relieved by postural changes that increase the angle between sma and the aorta . a high index of suspicion , in the presence of known risk factors , is the key to early diagnosis and avoiding complications like massive gastric dilatation , necrosis , or even perforation . investigations like abdominal x - rays usually reveal a dilated stomach and proximal duodenum but are nonspecific . endoscopy does not indicate the diagnosis but is important to rule out more common intraluminal causes of obstruction . barium or gastrografin contrast findings suggestive of smas are dilatation of the stomach , first and second parts of the duodenum , abrupt vertical or linear cutoff of contrast in the third part of the duodenum with normal mucosal folds , delay of 4 hours to 6 hours in gastroduodenal transit and reverse peristalsis in the proximal dilated duodenum . with the advent of modern ct scanners , the dynamic ct - scan is a safe , rapid , noninvasive diagnostic tool , which can clearly demonstrate the compression of the duodenum between the sma and aorta and the narrowed aortomesenteric angle . conservative treatment of smas involves nasogastric decompression , prokinetic agents to improve gastrointestinal transit , and reversing or removing the precipitating factor . nutrition may be either in the form of small , frequent feeds in the left lateral or knee - chest posture , or nasojejunal feeding , or total parenteral nutrition . the aim is to provide a high - calorie diet to increase mesenteric fat and expand the aortomesenteric angle . conservative management was attempted , but the patient was noncompliant and refused prolonged tube feeding . we , therefore , decided to perform a surgical bypass for a definitive cure . risk factors that predispose to superior mesenteric artery syndrome several surgical procedures have been described in the literature . strong 's technique of mobilizing the duodenum by dividing the ligament of treitz has the benefit of avoiding an anastomosis but an unacceptably high failure rate . gastrojejunostomy , due to inadequate decompression of the duodenum and the high risk of stomal ulceration , is controversial . duvie has described transposition of the third part of the duodenum anterior to the superior mesenteric vessels to permanently circumvent the obstruction . duodenojejunostomy , first described by staveley , remains the most frequently performed and favored operation over the years , with excellent results . subsequent successful results with acceptable operating time , faster recovery , and shorter hospitalization have been reported by other authors . in our case , laparoscopic duodenojejunostomy showed excellent results with rapid recovery and relief of symptoms until the final follow - up at 6 months . it gives the same results as open surgery with all the advantages of a minimally invasive procedure and should be the treatment of choice whenever surgical correction of smas is indicated .

background : superior mesenteric artery syndrome ( smas ) is a rare condition causing acute or chronic compression of the third part of the duodenum , due to a reduction in the aortomesenteric angle . traditionally , an open duodenojejunostomy is recommended when conservative management fails . laparoscopic duodenojejunostomy is a minimally invasive option that has been reported in up to 10 cases . we describe our operative technique in one case and review the literature on this condition.methods:a previously well 66-year - old man presented with acute gastric dilatation . an abdominal computerized tomography ( ct ) scan and oral gastrografin meal revealed a dilated stomach and proximal duodenum due to compression of the third part of the duodenum between the superior mesenteric artery ( sma ) and aorta.results:esophagogastroduodenoscopy ( egd ) ruled out intraluminal causes . a laparoscopic duodenojejunostomy was performed when conservative management failed . postoperative recovery was quick and uneventful . gastrografin administration on the fifth day showed no leak , with free flow of contrast into the jejunum . the patient resumed a normal diet and remained asymptomatic at 6-month follow-up.conclusion:laparoscopic duodenojejunostomy is feasible , safe , and effective . it gives the same results as open surgery with all the advantages of minimally invasive surgery .

the incidence of breast cancer is very high in karachi and the highest in asia.1 early diagnosis is the most important factor in increasing the survival rate . regular mammographic screening has shown great promise in this regard by decreasing breast cancer mortality by 15%20%.2,3 there are no government - funded screening programs for breast cancer in pakistan . this provides information for an accurate diagnosis and subsequent surgical and neoadjuvant treatment.4 in order to standardize mammographic reporting , the american college of radiology developed breast imaging reporting and data system ( bi - rads ) lexicon terms to describe breast density , lesion features , impressions , and recommendations for further patient management.5 broadly speaking , there are two final assessment categories . assessment is considered incomplete when the radiologist orders further imaging to make a definitive mammographic diagnosis . assessment is considered complete when the radiologist is sure of the diagnosis and categorizes mammograms from 1 to 6 . bi - rads categories 1 and 2 denote a benign lesion and category 3 requires short - term follow - up of the patient . categories 4 and 5 define a suspected malignancy , and biopsy or other appropriate action is advised . category 6 depicts a biopsy - proven malignancy.5 bi - rads has been used for over a decade to provide a uniform and standardized system for reporting of mammographic findings.4 it also helps in advising on subsequent management for patients , which is necessary for adequate treatment.6 previous research on bi - rads has evaluated interobserver and intraobserver variability in description of lesions.7,8 there have been studies examining the consistency between assessment categories and management recommendations.9 a study conducted in australia examined the quality and completeness of the contents of imaging reports with respect to bi - rads.4 however , anecdotal experience suggests that the quality of breast imaging reports is highly variable and information relevant to patient care may be omitted or partially reported in these reports.4 to the best of our knowledge , no such study has been conducted in pakistan . accurate reporting and appropriate recommendations for further workup are of the utmost importance , given that many patients either self - refer or are referred by primary care physicians , and mammography reports are the driving force for appropriate treatment at the outset . in pakistan , breast imaging services are provided by either private imaging centers or government - funded ( public sector ) services that operate independent of treatment centers . except for a minority of tertiary care hospitals in pakistan , no data confirm the involvement of a radiologist in multidisciplinary meetings , whether post diagnosis or during treatment planning . in our system , primary care physicians are responsible for breast imaging and referral of the patient to a breast surgeon if necessary . therefore , it is imperative that mammography reports communicate adequate and clear information to primary care physicians and treatment teams . we conducted this study to evaluate the mammography reports of representative newly diagnosed breast cancer cases from both public sector hospitals and diagnostic centers with respect to their completeness and concordance with bi - rads standards , in the hope of identifying issues for improvement in reporting , particularly in areas which have an impact on patient care . a multicenter , prospective , descriptive study was carried out in the radiology sections of five institutions in karachi , pakistan . the aga khan university hospital is a tertiary care private sector hospital.10 the pakistan naval station shifa hospital is a 600-bed tertiary care public sector hospital serving inservice and retired naval personnel , with an established radiology section.11 the advanced radiology center is a private sector diagnostic radiology facility in karachi for the general public.12 the karachi institute of radiotherapy and nuclear medicine is a public sector cancer diagnostic and treatment center in karachi.13 the civil hospital karachi is a 1900-bed tertiary care public hospital with an established radiology section.14 approval for the study was obtained from the ethical review committee of aga khan university , after seeking consent from participating radiologists . the data were collected prospectively from may to october 2010 . fifty consecutive mammograms reported as bi - rads category 4 or 5 at each center all mammograms reported as bi - rads category 0 , 1 , 2 , or 3 were excluded . fifty reports were obtained from each study site , thus making a total of 250 reports . category 4 and 5 mammography reports were collected from all the study centers , after obtaining consent from the corresponding consultant radiologists . mammogram reports were entered onto a questionnaire developed by the principal investigator in order to maintain confidentiality and privacy . this questionnaire was designed to extract data regarding the components of breast imaging reports taking into consideration the bi - rads lexicon for describing malignant lesions in terms of clinical indication , breast density , lesion location and description , calcification , and status of axillary lymph nodes . the data included patient age , marital status , date of enrollment , registration number , institution from which the report had been generated , and the name of the reporting radiologist . in addition to clinical indication , the type of imaging service and findings based on detailed description of masses , classifications , and distribution and morphology of masses were also recorded . concordance of reporting was ascertained by comparing the radiologist s description for the given diagnosis with standard american college of radiologist reports for bi - rads 4 and 5 categories . the data analysis was performed using the statistical package for the social sciences version 19.0 ( spss inc , chicago , il ) . the chi - square test was used to assess the completeness of reports for the two groups in accordance with the bi - rads lexicon . for the variables stated above , a p value of < 0.05 at a 95% confidence interval was considered to be statistically significant the data analysis was performed using the statistical package for the social sciences version 19.0 ( spss inc , chicago , il ) . the chi - square test was used to assess the completeness of reports for the two groups in accordance with the bi - rads lexicon . for the variables stated above , a p value of < 0.05 at a 95% confidence interval was considered to be statistically significant . the most frequent parameter described in the reports was location of the lesion within the breast followed by a description of the lesion . this was followed by reporting of breast parenchymal density , which was reported for 92% of mammograms ( table 1 ) . the lesions were detected in the background of 61 fatty , 126 fibroglandular , 37 heterogeneously dense , and 26 dense breast parenchymal patterns . in total , 225 were bilateral mammograms and only 25 were unilateral mammograms . one hundred and twenty - six lesions were reported in the left breast and 124 lesions in the right breast . the upper outer quadrant was most frequently involved , and the lower inner quadrant was the least frequent site of the lesions described . clinical indication , breast parenchymal density , lesion location , and presence of calcification were all more frequently mentioned by private centers , with statistically significant p values , while lymph node description parameters were more frequently stated by the government centers , again with a statistically significant p value of 0.013 . description of the masses by the two groups was not significantly different ( p = 0.446 , table 2 ) . the general description of mass was equally good both for the private sector and the government / public sector . the bi - rads system for mammographic reporting is now being used as a universal language in breast imaging centers to enable easy and understandable communication between the radiologist and the breast surgeon . in pakistan , patients are referred for breast imaging not only by breast surgeons , but also by other specialists and family practitioners . self - referral is also common , so clear reports and further workup recommendations communicated in a clear language assume even greater importance . the results of this study can be applied in our country and can be generalized to other developing countries where diagnostic and treatment services are not integrated or where radiologists do not routinely participate in multidisciplinary meetings . almost 40% of reports in this study did not mention the clinical indication for mammography . this is similar to a study conducted by houssami et al4 in which clinical indication was not mentioned in about one - fifth of reports . in our study , breast density , location of the lesion , and a lesion description were given in 92% , 96% , and 93% of reports , respectively . these are much higher percentages than those reported by houssami et al,4 who found these to be 80% , 75% , and 77% , respectively . the difference is most likely to be due to the training of radiologists regarding mammography reporting . all authors except one were either american board - certified or fellows of the college of physician and surgeons , pakistan . both of these training programs include the american college of radiology bi - rads lexicon in their mandatory core syllabus , so these radiologists were likely to be better acquainted with the lexicon . patient selection , patient age , and quality of mammograms may also affect visibility and description of the lesion . reporting of breast parenchymal density is important , because it has an impact on accuracy of diagnosis and indeed the risk of having breast cancer . a statistically significant difference was noted in the description of clinical indication , breast parenchymal density , lesion location , and presence of calcification between public and private centers . this may be due to the frequent participation of private sector radiologists in multidisciplinary meetings and/or continuing medical education events . training in bi - rads leads to improved consensus agreement between experienced breast radiologists with regard to analysis of lesion features and final assessment . this has been documented earlier by berg et al.15 in addition , most centers in the private sector get frequent feedback on their reports , either by the referring physicians or patients , because if there is inadequate or ambiguous information in the reports , the private centers are contacted for clarification . this also results in increased knowledge about what the clinician wants in the reports , but no such mechanism exists in the government sector . this may be due to the fact that mammograms reported as bi - rads category 4 or 5 were included in the study , and every report had a lesion which needed a description . this may be due to late presentation of patients with advanced disease due to low socioeconomic status and lack of awareness among less educated patients presenting in the government sector . the data were collected only from mammography reports and the actual mammograms were not seen at the time of data collection . secondly , the lead radiologist knew that the data were being collected for the study . this might have affected the final reporting quality if the lead was also the reporting radiologist . the third limitation was that there were two private institutions and the rest were government institutions , which might have affected the results . our study shows that overall mammographic reporting for bi - rads categories 4 and 5 in the private sector in karachi , pakistan is more in line with the bi - rads lexicon , as compared with the government sector . based on our findings , recommendations for the future are to arrange refresher courses for radiologists in the government sector and to improve the quality of reports . a checklist for style of breast imaging reports that includes key items

backgroundthe purpose of this study was to evaluate mammography reports for diagnosed breast cancer cases in major government and private centers in karachi , pakistan , with respect to concordance with the breast imaging reports and data system ( bi - rads ) lexicon.methodsa prospective , descriptive , multicenter study was conducted in the radiology sections of the aga khan university hospital , pakistan naval station shifa hospital , advanced radiology clinic , karachi institute of radiotherapy and nuclear medicine , and civil hospital karachi between may and october 2010 after approval from the ethical review committee of aga khan university . mammograms reported as bi - rads category 4 and 5 were included in the study . mammograms reported as bi - rads category 0 , 1 , 2 and 3 were excluded . fifty reports were collected from each center . data were collected about the clinical indication , breast density , location and description of the lesion , calcification , and comments on axillary lymph nodes . this description was compared with the bi - rads lexicon.resultsthe mean age of the patients was 50 12 years . the clinical indication , breast parenchymal density , lesion location , and presence of calcification were better described by the private centers , while description of lymph node status was better stated by the government centers . this difference was statistically significant , except for lesion description . the description of masses by the two reporting groups was comparable.conclusionmammographic reporting of malignant breast lesions in the private sector is more in line with the bi - rads lexicon , as compared with government sector hospitals in karachi , pakistan . lymph node documentation was better in government sector reports .

supraorbital neuralgia is a form of localized headache in or above the eyebrow with possible extension in the entire skin region of nerve v1 . supraorbital neuralgia is defined by the international classification of headache disorders by the following diagnostic criteria : paroxysmal or constant pain in the region of the supraorbital notch and the medial aspect of the forehead of the area supplied by the supraorbital nerve . the most important hallmark is the same pain experienced by pressure on the supraorbital notch . in general , trigeminal neuralgia ( tn ) is unilateral affecting the maxillary ( 35% ) , mandibular ( 30% ) , both ( 20% ) , ophthalmic and maxillary ( 10% ) and ophthalmic ( 4% ) branches and all branches of the trigeminal nerve ( 1% ) . a case of tn involving supraorbital neuralgia and infraorbital neuralgia as the incidence of involvement of ophthalmic division and maxillary division is rare . a 35-year - old man with a history of severe ( score of 10 in the verbal numerical scale ) , shock like and throbbing pain in the right v1v2 region , lasting for 510 s that increased on talking , chewing , smiling , with strong breeze and cold water while washing his face since last 67 years . he visited a dental clinic for the same , for which he has undergone extraction of the upper right posterior teeth ( 16 ) . the pain did not subside even he visited various clinics in various places where he was medicated with tablet carbamazepine 200 mg eight hourly . he reported to department of oral and maxillofacial surgery , modern dental college and research centre , indore . after taking a detailed history , the trigger zones were noted which were nasolabial fold , ala of nose , cheek region , supraorbital rim on right side of the face . diagnostic block was given in the infraorbital and supraorbital regions on different occasions for which pain was relieved for several hours . this confirmed the infraorbital and supraorbital neuralgia . to rule out the possible etiology of the neuralgia , mri of cranium the treatment of peripheral neurectomy was planned as he was on already medication since last 6 years . the patient was taken under ga with endotracheal intubation and the supraorbital nerve was exposed via upper eyebrow incision [ figure 1 ] . the nerve was identified and avulsed by twisting the nerve on the artery forcep [ figure 2 ] . then , the infraorbital nerve was exposed through intraoral approach by giving upper vestibular incision from 13 to 16 region [ figure 3 ] . the term neuralgia is used to describe unexplained peripheral nerve pain and the head and neck are the most common sites of such neuralgias . tn is by far the most frequently diagnosed form of neuralgia with mean incidence of 4 per 100,000 populations and mean age of 50 years at the time of examination . tn is usually unilateral affecting the maxillary ( 35% ) , mandibular ( 30% ) , both ( 20% ) , ophthalmic and maxillary ( 10% ) and ophthalmic ( 4% ) branches and all branches of the trigeminal nerve ( 1% ) . tn has long been recognized in the medical literature ; infact , it was described as early as the first century ad in the writings of aretaeus . nicholas andre in 1756 used the term tic doulourex ( painful sensation ) to describe the disorder . fothergill provided a vivid description of tn in 1773 , hence also called as fothergill 's disease . although several hypotheses have been put forward , the cause of tn has not been fully explained in the literature . for most patients , mechanical compression of the tn can occur as the nerve leaves the pons and traverses the subarchonoid space toward meckel 's cave . most commonly , the nerve compressed by a major artery , usually the superior cerebellar artery . when pain is felt in second and third divisions , the usual finding is the compression of the rostral and anterior portions of the nerve by superior cerebellar artery , if the pain is felt in ophthalmic division , the usual finding is compression of the nerve by the anterior inferior cerebellar artery . however , in our case mri showed no compression of the nerve along its course . other causes can be multiple sclerosis , vascular factors transient ischemia , autoimmune hypersensitivity , secondary to dental diseases such as maxillary sinusitis , third molar infections , trauma and congenital abnormalities in bony canal . lesions with trigeminal ganglion and their rootlets such as central brain lesions , pressure from adjacent cranial structures , tumors of the posterior cranial fossa and vascular compression of nerve root fibers have been reported to be the other causes . tn characterized by paroxysms of severe , lancinating , electric - like bouts of pain restricted to the distribution of the trigeminal nerve . the pain predominantly occurs unilaterally , most commonly on the right side and involves the mandibular and/or maxillary branch or rarely the ophthalmic branch . pain attacks occur spontaneously and also triggered by a nonpainful sensory stimulus to the skin , intraoral mucosa surrounding the teeth and tongue . each attack usually lasts only seconds to minutes , but they may be repeated at short intervals ; consequently , individual attacks can overlap each other and may be described as lingering , painful sensation . attacks can occur at any time and are triggered not only by sensory stimuli to the face , but also by movement of the face . no medical test exists that can be used to diagnose clearly all cases of tn . the diagnosis of tn rests on the clinician 's ability to recognize a distinctive series of signs and symptoms that define this disorder . the criteria emphasize five major clinical features that in essence , define the diagnosis of tn . they are : the pain is paroxysmal.the pain may be provoked by light touch to the face ( trigger zone).the pain is confined to trigeminal distribution.the pain is unilateral.the clinical sensory examination is normal . the pain may be provoked by light touch to the face ( trigger zone ) . diagnostic criteria are defined by the international association for the study of pain ( iasp ) and by the international classification of headache disorders / international headache society ( ichd / ihs ) and include : paroxysmal episodes lasting from a fraction of a 1 sec . to 2 min . , affecting one or more divisions of the trigeminal nerve.the pain has at least one of the following characteristics : a)severe , sudden , superficial , or stabbing ; andb)initiated by trigger factors or trigger points . episodes are similar among patients.patients do not have clinically evident neurologic changes.it is not attributed to other disorders . the pain has at least one of the following characteristics : a)severe , sudden , superficial , or stabbing ; andb)initiated by trigger factors or trigger points . severe , sudden , superficial , or stabbing ; and initiated by trigger factors or trigger points . the most common disorders involved in the differential diagnosis include bursts of headaches , dental pain , giant cell arteritis , glossopharyngeal nerve neuralgia , intracranial tumor , migraine , multiple sclerosis , otitis media , paroxysmal hemicrania , postherpetic neuralgia , sinusitis , sunct headache ( short - lasting , unilateral , neuralgiform pain with conjunctival injection and tearing ) , temporomandibular joint syndrome and tn . initially , administration of anticonvulsant drugs was the treatment of choice . there are several factors that can affect a treatment plan , including the patient 's age , life expectancy , associated medical and psychiatric conditions , compliance with medical therapy and tolerability of adverse effects of drugs . invasive procedures ( peripheral neurectomy , radiofrequency thermocoagulation at gasserian ganglion , retrogasserian rhizotomy , medullary tractotomy , midbrain tractotomy and intracranial nerve decompression ) are usually reserved for those patients who are unable to obtain relief with medical management or experience unacceptable adverse effects from the use of pharmacologic treatments . supraorbital neuralgia is a rare disorder clinically characterized by the following triad : forehead pain in the area supplied by the supraorbital nerve , without side shift;tenderness on either the supraorbital notch or traject of the nerve ; andabsolute , but transitory relief of symptoms upon supraorbital nerve blockade . forehead pain in the area supplied by the supraorbital nerve , without side shift ; tenderness on either the supraorbital notch or traject of the nerve ; and absolute , but transitory relief of symptoms upon supraorbital nerve blockade . in addition , there may be signs and symptoms of sensory dysfunction ( hypoesthesia , paresthesia ) and typical neuralgic features ( lightning pain and exteroceptive precipitating mechanisms ) . the hallmark of supraorbital neuralgia is localized pain in or above the eyebrow ( sometimes extending into the parietotemporal scalp region ) . although etiology and pathogenesis of supraorbital neuralgia are largely unknown , entrapment of the supraorbital nerve at its outlet , trauma to the face , such as when the head hits the windshield or after a punch to the face are thought to be the causative factor and neuralgic pain . the headache might not present for many years until the scar cicatrix tightens enough around the nerve to finally cause entrapment . supratrochlear nerve in this region can be injured by poor - fitting eyeglasses , presenting as a more midline forehead pain . entrapments of first division of the trigeminal nerve can cause unilateral or bilateral throbbing headaches , often just before menses or triggered by bright lights that cause squinting . the proposed treatment is an injection of 2 ml of 2% lidocaine , 1:60,000 adrenalin in the supraorbital canal , which relieves and mostly obviates the pain in 80% of the patients over a considerable time of span . generally , there will be lack of , or only minor benefit from drug treatment , including carbamazepine and indomethacin . there will clearly be tenderness over the supraorbital nerve , especially at its outlet and in some subjects occasionally , a slight local loss of sensation . the persistence of protracted unilateral forehead / ocular pain , tenderness over the nerve and repeated blockade effect strongly suggests the diagnosis and patient 's willingness for surgical treatment . complications reported are local hemorrhage , transient diplopia , transient anesthesia of supraorbital skin , mostly lasting only for few days . correct diagnosis of supraorbital neuralgia is critical in choosing therapy . for persistent or recurrent pain , acupuncture , injection of phenol / glycerol or botulism toxin , neurolysis and root section of the trigeminal nerve are methods that have been successfully employed to treat this condition . consensus on the best treatment for tn , clinical or surgical , does not exist .

supraorbital neuralgia is a rare disorder accounting for 4% of incidence with hallmark of localized pain in or above the eyebrow , clinically characterized by the following triad : ( 1 ) forehead pain in the area supplied by the supraorbital nerve , ( 2 ) tenderness on either the supraorbital notch and ( 3 ) absolute , but transitory relief of symptoms upon supraorbital nerve blockade . the pain presents with a chronic or intermittent pattern . the persistence of protracted unilateral forehead / occular pain , tenderness over the nerve and repeated blockade effect strongly suggest the diagnosis . surgical treatment can be used when the medical treatment fails or in patients who do not tolerate the pharmacological treatment .

ascending bacterial infection is an important antecedent of preterm birth , which continues to be a major cause of neonatal mortality . bacterial vaginosis ( bv ) is a common vaginal condition that reflects a shift from the normal lactobacillus predominant vaginal flora to a vaginal flora characterized by high concentrations of anaerobic bacteria . bv is consistently associated with preterm birth [ 1 , 2 ] ; however , antibiotic treatment trials for bv in pregnancy have not reduced preterm birth , leading to speculation that the maternal and/or fetal host response may be implicated in the pathophysiology of infection - associated preterm birth . we sought to evaluate the relationships between pregnancy , bv and their effects on the vaginal inflammatory response by comparing the vaginal concentrations of interleukin ( il)-1 , il-6 , il-8 and the host defense molecule secretory leukocyte protease inhibitor ( slpi ) among pregnant and nonpregnant women according to bv status . we hypothesized that pregnant and nonpregnant women would have similar proinflammatory cytokine and slpi concentrations in vaginal fluid , when stratified by bv status . we compared vaginal cytokine concentrations among women with and without bv enrolled in two separate prospective observational cohort studies . pregnant subjects ' data came from a natural history study of vaginal flora and pregnancy outcome , conducted from 20002004 , in seattle , washington . pregnant women < 20 weeks ' gestation , 16 years of age , with no history of preterm birth or major medical complications such as chronic hypertension or preexisting diabetes , were eligible to participate . nonpregnant subjects ' data came from a cohort study of racial disparities in preterm birth conducted between 20022006 . study participants were parous women 18 years of age who resided and gave birth in king county , washington , and did not have a history of preeclampsia or hypertensive disorders . by design , the nonpregnant cohort oversampled african - american subjects . the pregnancy cohort study was approved by the university of washington and centers for disease control institutional review boards . the nonpregnant cohort study was approved by the washington state department of health institutional review board . written informed consent was obtained from all subjects at the time of entry into the original cohorts . participants were asked to abstain from vaginal intercourse for 2 days prior to their enrollment visit . urine or vaginal fluid was collected for chlamydia trachomatis and neisseria gonorrhoeae testing by nucleic acid amplification test ( aptima combo 2 ; gen - probe , san diego , ca ) . vaginal fluid was collected from the posterior vaginal fornix using four dacron swabs ( puritan hardwood products , guilford , maine ) . one swab was rolled on a glass slide for gram stain for bv diagnosis by nugent criteria , the second was placed in culture media for trichomonas vaginalis testing ( inpouch tv ; biomed diagnostics , white city , oregon ) , and the third and fourth swabs were placed in cryotubes with 0.9 ml of phosphate buffered saline . interleukin-1 , il-6 , il-8 , and slpi were measured by enzyme linked immunosorbent assay ( elisa ) at the same laboratory . acid phosphatase , a sensitive marker for semen , was detected by colorimetric method using an azo dye . any specimens testing positive for acid phosphotase were excluded from slpi analysis as slpi can be found in high concentrations in seminal fluid [ 6 , 7 ] . subjects were included in the analysis if they had complete data for the following variables : bv status , il-1 , il-6 , il-8 , slpi , and sexually transmitted disease ( std ) results ( c. trachomatis , n. gonorrhoeae and t. vaginalis ) . women with intermediate flora ( nugent score 46 ) or who tested positive for c. trachomatis , n. gonorrhoeae , or t. vaginalis were excluded from the analysis . among 289 women in the pregnancy cohort with normal flora or bv , 246 women ( 86% ) had samples available for proinflammatory cytokine testing . of the 246 women with cytokine results , 118 ( 48% ) women were missing one or more std results ( 101 of 118 were missing t. vaginalis results ; 98 of the 101 women had normal vaginal flora ) and 6 women tested positive for an std ( 4 c. trachomatis and 2 t. vaginalis ) . thus 122 pregnant women , 71 with bv ( nugent score 710 ) and 51 with normal vaginal flora ( nugent score 03 ) , had complete information and were included in the analysis . among 159 women in the nonpregnant cohort with normal flora or bv , two nonpregnant women were missing std results and 12 women tested positive for an std ( 4 c. trachomatis and 8 t. vaginalis ) , leaving 133 nonpregnant women , 45 with bv and 86 with normal vaginal flora in the analysis . chi - squared and mann - whitney u tests were used to compare demographic characteristics at baseline . the mann - whitney u test was also used for univariate analyses to compare analyte concentrations by bv and pregnancy status . mean log - transformed cytokine values and standard deviations were calculated by bv and pregnancy status . additional analyses were conducted using multivariable linear regression to evaluate bv and pregnancy as independent factors associated with cytokine and slpi response ( adjusting for race and age ) . lastly , we evaluated an interaction term for bv and pregnancy using the likelihood ratio test . this interaction term was not significantly associated with cytokine or slpi response and was not included in the final models for each analyte . analyses were conducted using stata version 10.1 ( statacorp , inc . , college station , tx ) . nonpregnant women were older ( mean age = 29.2 years ( range 1846 ) versus 26.7 years ( range 1643 ) p = .005 ) , more often african - american ( 44% versus 20% , p < .001 ) and more likely to report ever douching ( 61% versus 19% , p < .001 ) , and current smoking ( 34% versus 16% , p = .001 ) compared to pregnant women . in univariate analyses , pregnant women had higher concentrations of il-1 ( mean log - transformed values standard deviation : 1.94 0.86 versus 1.43 0.92 pg / ml ; p < .001 ) , il-6 ( 0.63 0.60 versus 0.50 0.40 pg / ml ; p = .002 ) , and il-8 ( 3.20 0.76 versus 2.88 0.80 pg / ml ; p = .003 ) compared to nonpregnant women . among pregnant and nonpregnant women combined , those with bv had higher concentrations of il-1 ( 2.11 0.85 versus 1.31 0.83 pg / ml ; p < .001 ) and il-8 ( 3.15 0.88 versus 2.85 0.71 pg / ml ; p = .004 ) compared to women without bv . concentrations of il-6 did not differ significantly by bv status ( bv+ : 0.64 0.66 versus bv- : 0.50 0.57 pg / ml ; p = .09 ) . the highest concentrations of il-1 and il-8 were found in the subset of pregnant women with bv , compared to all other subjects ( il-1 : 2.31 0.77 versus 1.43 0.87 pg / ml , p < .001 ; il-8 : 3.33 0.83 versus 2.86 0.76 pg / ml , p < .001 ) . vaginal slpi concentrations were assessed for 109 pregnant women and 116 nonpregnant women without evidence of semen in vaginal secretions by acid phosphatase . pregnant women had significantly higher concentrations of slpi compared to nonpregnant women ( 5.08 0.43 versus 4.78 0.52 pg / ml ; p < .001 ) . among all subjects , slpi concentrations were lower among women with bv compared to women without bv ( 4.80 0.53 versus 5.02 0.46 pg / ml ; p = .002 ) . in multivariable analyses , pregnancy remained associated with increased concentrations of il-8 ( p < .02 ) and slpi ( p < .001 ) after adjustment for bv , race , and age ( table 1 ) . pregnancy was marginally associated with increased concentrations of il-1 ( p = .07 ) in the adjusted model . similarly , bv remained associated with increased concentrations of il-1 ( p < .001 ) and il-8 ( p = .04 ) , and decreased slpi concentrations ( p < in this secondary analysis , pregnant women had increased vaginal concentrations of the proinflammatory cytokine il-8 as well as the mucosal host defense molecule slpi , regardless of bv and other cofactors . in addition , we confirmed others ' findings that bv , regardless of pregnancy status , is accompanied by increased vaginal proinflammatory cytokine concentrations along with decreased slpi concentrations [ 810 ] . the primary limitation of this report is that it is a secondary analysis of two different study populations . a second limitation is that missing data in the pregnancy cohort required us to exclude a number of women from the analysis . much of the missing data was missing by design ; therefore , the exclusion of women with data missing by design should not bias the results . taken together , these data suggest that bv should be regarded as a proinflammatory condition for pregnant and nonpregnant women . the vaginal inflammatory response may be on alert in pregnancy , and antigenic stimulation ( such as bv ) appears to result in a more exuberant inflammatory response among pregnant , compared to nonpregnant women . moreover , we observed that slpi concentrations are greater in pregnant women compared to their nonpregnant counterparts , regardless of bv status . increased slpi in the context of pregnancy may be a physiologic host defense mechanism to protect against ascending infections that could result in preterm birth . further prospective studies of vaginal immunology are needed to help elucidate the effects of pregnancy , vaginal flora and other factors on lower genital tract host defenses and the implications for reproductive health .

we compared vaginal proinflammatory cytokine and secretory leukocyte protease inhibitor ( slpi ) concentrations among pregnant and nonpregnant women according to bacterial vaginosis ( bv ) status . one - hundred and twenty - two women at 1220 weeks ' gestation and 133 nonpregnant controls had vaginal concentrations of interleukin ( il)-1 , il-6 , il-8 , and slpi measured by enzyme immunoassay . multivariable linear regression was used to evaluate factors independently associated with vaginal cytokine and slpi response . pregnancy and bv were both independently associated with increased vaginal concentrations of il-1 and il-8 ; pregnant women had increased concentrations of slpi , while women with bv had decreased slpi concentrations .

it is easier to judge the mind of a man by his questions rather than his answers.pierre-marc-gaston , duc de lvis ( 17641830 ) i get it ; science is just like spelling . you just have to memorize it and it does n't make any sense.anonymous u.s . elementary school student the juxtaposition of these quotes illustrates a serious shortcoming of k12 science education . the foundation of science is to ask questions about the natural world and then seek answers . if a student sees spelling and learning science as similar experiences , then we are failing to communicate the fundamental reason why science exists as a discipline and what it has to offer . the student 's quote , sadly , reflects our approach to teaching science : learn the facts and do n't deviate from that script . however , before organizing scientific data into facts , science begins by asking questions as a form of intellectual exploration . young children are full of questions , spawned by true curiosity rather than a desire to impress . but over the course of their education , students and adults ask fewer questions and more passively accept facts as the way things are . however , i would like to think that it is not an inevitable outcome of the educational pipeline . thus it is worthwhile to ask whether we could be doing more to promote questioning as a fundamental tool for science education and in the practice of professional science . you ca n't expect to wake up one morning and run a marathon without training . similarly , asking good questions is a skill that requires practice , training , and mentoring . if a child ( or adult ) is placed in an environment that does not encourage active questioning , then that skill will not become an active habit of mind . socrates is well known for using questioning to probe the validity of an assumption , analyze the logic of an argument , and explore the unknown . questions were a means to educate his students by drawing out their understanding of a subject and then leading them to discover a set of logical conclusions instead of lecturing them on what is true or false . socratic questioning is still advocated as a powerful contemporary teaching method ( brill and yarden , 2003 ) . questioning is a core principle of eastern philosophies as well . in the prashna - upanishad , one of the earliest of the upanishad texts that serve as a foundation of hinduism , pupils pose six great questions to a wise teacher ( prashna means question in sanskrit ) . the buddha also encouraged questioning by his disciples , and a fundamental role for questioning is still embraced in the practices of modern buddhism . i recently had the pleasure of visiting dharamsala , india , where i watched tibetan buddhist monks debate a daily practice that involves one monk continually questioning another monk for an hour , often on esoteric points of buddhist thought . the impressive aspect of this practice is how the monks use this method of questioning / answering to hone their skills in logic and to probe complex questions . the questioning involves great mental concentration and intense exchange , punctuated by episodes of laughter and joy . interestingly , the use of questioning for intellectual exploration and teaching evolved independently in socratic and buddhist schools of thought , and both developed this skill through a high degree of discipline and practice . philosophy and science grew up together and were inseparably intertwined ; logical argument and inductive thinking were ways of exploring / explaining the natural world . facts to memorize , and the framework of using experimentation / data gathering to formulate scientific theories gained hold only in the middle of the second millennium . since that point , science and philosophy have grown steadily apart in subject areas and methodologies . it would be rare to find a scientist and philosopher exchanging ideas with one another at a meeting . however , the art of questioning is practiced by scientists , philosophers , and educators , and these disciplines might learn from one another and explore and exploit each other 's practices and ideas . virtually all educators agree that teaching science should involve more inquiry - based learning and less fact - based memorization ( committee on a conceptual framework for new k-12 science education standards , 2012 ) . many educators are now developing experimental modules that engage students in the practice of scientific inquiry in a laboratory setting and are trying to export these experimental modules and ideas to many schools . pursued properly , a good question also can be an excellent vehicle with which to start a process of inquiry . investigating an answer to a question need not require a laboratory , special equipment , or money . the goal of asking and answering a question is not necessarily to probe a completely untouched area of science ( which is unrealistic for k12 ) . rather , it should be a personal quest to resolve a curiosity and grapple with trying to understand the answer . furthermore , researching one question often results in a further round of questions that dig deeper into a phenomenon . alan alda , the famous actor / director / writer , who is now on the advisory board of the center for communicating science at stony brook university , posed a challenge in science of answering the question , what is a flame ? ( alda , 2012 ) . this challenge was based on his experience as an 11-year - old asking his teacher this same question and receiving the disappointing , few - syllabic answer , last spring , alda received more than 800 answers to that question from scientists , and the answers were judged by 6000 11-year - olds . this example illustrates that a lot of thought is required to understand and explain simple questions about our everyday experiences . why is the sky blue ? can be used to learn an enormous amount about light and the atmosphere . what evidence supports light 's behavior as a wave ? why do we say that it is a particle ? and for more advanced students , how can single photons aimed at a pair of slits create interference patterns on the other side , as though they passed through both slits simultaneously ? by posing questions , one appreciates that science is not all about filling in the correct bubble with a # 2 pencil . that might frustrate a subset of teachers and students who want clear - cut answers . cooler and better prepare students to think about evidence and to navigate in a complex world that does not always have precise answers . questioning can be used to promote independent learning in a school setting in a variety of ways . the key ingredients are that students should have some freedom to choose a question in which they are interested , have an opportunity to research the answer on their own , and then have an opportunity to teach others ( peers and the teacher ) what they learned . i witnessed one especially successful example of spontaneous , curiosity - driven questioning in the katta , a volunteer science discussion group for college students led by milind watve , then at garware college , pune , india ( jog , 2009 ) . a katta in marathi ( the regional indian language ) means a place where people can meet , talk , and exchange ideas . in watve 's katta however , in some instances , students begin to swarm around a question , wanting to know more . this experience often ignites a student , or a group of students , to investigate the question more deeply on their own and then present what they discovered at a later katta . sometimes the group of students decides to investigate the question in a scientific manner , using tools of a laboratory , math , field studies , and so on , as appropriate . in several cases , those investigations went all the way to publications in well - known journals . watve 's role is as a catalyst , providing a safe environment where students can feel free to ask a question without worrying about whether it is good , bad , intelligent , or crazy . usually , no one in the room ( including watve ) is an expert in the subject . but he encourages them to pursue the question regardless , stimulating them to take ownership of the question and think in new ways that possibly may not have occurred to scientists in the field . when i was a child and needed to research a topic for school or find an answer to a question , i pulled out the world book encyclopedia , our family 's prized possession . i did not always have to go the library ; i was fortunate to have a source of knowledge at home . how different the world has become for my teenage kids . through the internet , they have unprecedented access to information encompassing virtually the entire scope of human knowledge . this information is now available on a time scale of seconds , as if it has become a virtual extension of our cerebral cortex . if an interesting question pops into one 's mind , one can research it immediately and from multiple sources , rather than visit the library tomorrow or next week . furthermore , global connections can now be made between a child in india with a question and a scholar in england who can provide a response . however , the rapid blooming of the internet into a vast , thick jungle of information poses a couple of problems our time is limited , and there is no easy formula for integrating information . thus the most important skill for the twenty - first century , in my opinion , is learning how to judge and integrate information from multiple sources to generate conceptual understanding or a new idea . although integrating information is becoming increasingly important for future success , the educational community has not fully grappled with how to teach students these skills . many teachers , for example , say that wikipedia is unreliable and can not be used as a resource . some make blanket statements that .org or .gov sites are good and .com sites are bad . kids are savvy enough to know that such statements are too simplistic and not true . yes , one can find errors in wikipedia , although several studies suggest that there are relatively few ( giles , 2005 ) . but a state - approved high school biology textbook also can have out - of - date information and incorrect simplifications . it is also folly to think that teenagers who seek an answer to one of their own questions will go to their textbook or their teacher ; they will head straight to the internet , and with some judgment , they will find a good resource in short time . in addition , we are already living in a world where most adults are turning to the internet as a source of information about science ( brossard and scheufele , 2013 ) . rather than severely restricting kids from internet research , more attention needs to paid to teaching them best practices , such as directing them to good internet sources , teaching them how to identify potentially flawed information , how to integrate information from multiple sources , and how to reference them . categorically stating that wikipedia is unreliable is insufficient ; rather specific pages or examples on wikipedia where information might be incomplete or inaccurate need to be illustrated ( and these are rare from my experiences with bigger scientific topics ) . students also need to gain a more mature view of knowledge , understanding that it is dynamic and that there are points of contention that demand judgment rather than blind memorization . importantly , there is no need to create two camps of scholarship by creating separate instruction manuals for what kids need to do to get the best grade for a classroom assignment versus how they should assimilate knowledge beyond school . most schools have mottos about teaching students to become life - long learners , but this will not happen unless students see connections between how they research a question for school and how they would research a question on their own . questioning may seem like a good educational approach , so why is it not a more common practice in science education ? first is the perception that the teacher is an almighty vessel of knowledge who imparts information to students . in that formulation , a difficult question with no immediate answer or an uncertain answer can be threatening to a teacher and disappointing to a student . i do not know the answer to that question , but let me look it up or let 's look it up together . many questions do not have quick , easy answers and thus become seeds for investigation . students also should be able to teach their peers when they look up an answer to a question . in this model , teachers and students become partners in their mutual education . a second impediment to using questioning as an educational tool . it can be hard to plan around such uncertainty . with state - mandated curricula the ability to ask a question , research the answer , and present it to the class requires some degree of flexibility in the weekly lesson plan . most teachers , particularly in state - run schools , do not have that luxury . a third impediment to using questioning i already discussed that ancient greeks and contemporary buddhists practice this skill for many years . similarly , teacher training would be required to implement such ideas in a classroom . as discussed in recent editorials by bruce alberts ( 2012a , b ) , at the root of all three obstacles is the lack of time in k12 education for in - depth investigation by students or teachers . state science curricula mandate a list of required topics and information that is so long that it becomes quite difficult for teachers to pack it all in during a school year . this comprehensive , memorization - based approach is great for testing but poor for producing kids who are interested in science or even know what science is truly about . a conceptual understanding of how cells use and make energy is more important than regurgitating all of the steps in glycolysis , which can be quickly relearned online . state educators need to reduce the amount of required material in their science curricula to allow more the time for in - depth learning , teacher initiative and professional development , and exploration of questions . finland is adopting such strategies , with substantially better educational outcomes than the united states ( sahlberg , 2011 ) . identifying a good question and being able to articulate it well is not just an exercise for high school students , but is also a key skill in becoming a successful scientist . a grant proposal often receives a poor score not because the proposed experiments are poorly conceived , but because the questions being asked are not interesting or not clearly articulated . it is easy to fall into this trap , because specific aims are often written in terms of achieving a specific technical goal rather than from the standpoint of framing and answering a compelling question . weaving good questions into the text of a grant can be a way to communicate the goals of a project . many seminars are lackluster because they are swimming in data but lack a captivating question to motivate the data collection . raising questions throughout a seminar engages the audience and involves them in the thought process . posing a single question on a slide also can be an effective means of framing the steps involved in answering that question in subsequent slides . in summary , asking questions is a part of the joy of science . even much later , as a seasoned , well - educated scientist , one can continually learn from and strive to perfect this gift of human intellect .

science begins by asking questions and then seeking answers . young children understand this intuitively as they explore and try to make sense of their surroundings . however , science education focuses upon the end game of facts rather than the exploratory root of the scientific process . encouraging questioning helps to bring the true spirit of science into our educational system , and the art of asking good questions constitutes an important skill to foster for practicing scientists .

gangliocytic paragangliomas ( gps ) are rare and peculiar benign tumors , encountered mostly in the periampullary area of the duodenum and much less frequently in the jejunum or third part of the duodenum . some studies have reported that approximately 90% of gps are found in the second part of the duodenum , from where the tumor can invade the ampulla of vater ( aov ) . gps of the duodenum may present as incidental endoscopic and radiologic findings or as gastrointestinal bleeding due to ulceration of the overlying mucosa . gastrointestinal bleeding is the most common clinical presentation , followed by abdominal pain and anemia . we present the case of a 41-year - old female with gp of the duodenum , along with the clinical data , histology , and immunohistochemical staining results that correlated well with previously reported characteristics of duodenal gps . a 41-year - old female was admitted due to a history of abdominal pain . on admission , contrast - enhanced computed tomography ( ct ) revealed a well - defined , enhancing , 2-cm , oval - shaped mass in the second portion of the duodenum , adjacent to the aov . magnetic resonance cholangiopancreatography showed a well - defined , 2-cm , oval - shaped subtle t2 hyperintense lesion in the second portion of the duodenum , adjacent to the aov , as well as a normal common bile duct . upper gastrointestinal endoscopy revealed a 2-cm subepithelial tumor in the ampullary portion of the duodenum ( fig . histopathology revealed spindle cells , ganglion - like cells , and epithelioid cells in the submucosal layer of the duodenum ( fig . this case showed characteristic histologic features of a tumor composed of three cell types ( epithelioid , spindle , and ganglion ) , which classified the tumor as a gp . 4 ) . histology showed a well - demarcated lesion in the submucosal layer of the duodenum ( fig . a follow - up upper gastrointestinal endoscopy performed 2 months later revealed scar formation in the resection site with convergence of the surrounding folds . various theories of the pathogenesis of duodenal gps have been proposed , but the histogenesis of these tumors is uncertain . a gp is known as a " 10% tumor , " based on the frequency of the inherited forms of the disease . approximately 30% of gps show 10 types of susceptibility gene ( " 10-gene tumor " ) . advances in the genetic studies of paragangliomas will have important consequences for the monitoring of patients , from genetic counseling to personalized clinical management . typical histologic patterns of gp include an admixture of ganglion - like cells , carcinoid tumor - like areas , and spindle cell proliferation . immunohistochemical staining of this tumor showed a strong positive reaction for the s-100 protein in the spindle cells , while the epithelioid and ganglion - like cells expressed synaptophysin ( fig . several authors have reported that the epithelioid and ganglion cells are positive for neuroendocrine peptides , such as somatostatin , pancreatic peptide , and serotonin . the incidence of gps is slightly higher in males than in females ( 1.8:1 ) , and the mean age of appearance is 54 years ( range , 17 to 83 ) . gps are considered benign even though they occasionally involve the regional lymph nodes and display distant metastasis or tumor recurrence , features suggestive of malignancy . the characteristic ulceration and bleeding of the overlying mucosa lead to the usual clinical manifestations of melena and sometimes massive hematemesis and unexplained anemia . approximately 50% of patients seek medical attention for gastrointestinal bleeding , but this case did not have a history of gastrointestinal bleeding episodes . duodenal gps are larger than 1.5 cm in at least one dimension and tend to be ulcerated and to bleed . obstructive jaundice is less common in ampullary gp , but obstructive jaundice due to paragangliomas has been reported . the majority of reported duodenal gp cases have been benign in nature , and simple excision of the tumor is deemed sufficient . the emr procedure is safe and easy to perform , because the tumor protrudes into the duodenum . when endoscopic resection is not possible , surgical resection is indicated , and when regional lymph nodes are positive for metastasis , pancreaticoduodenectomy followed by local radiotheraphy is recommended . because the possibilities of recurrence and metastasis can not be excluded completely , decisions on the treatment method to use must be made after careful preoperative staging of the disease prior to local treatment . furthermore , continuous follow up at the outpatient department for early detection of recurrence is necessary .

gangliocytic paragangliomas ( gps ) are rare tumors of the duodenum , presenting as single sessile or pedunculated polypoid masses . clinical manifestations of duodenal gps can vary from an incidental finding at endoscopy to frequent upper gastrointestinal bleeding caused by mucosal ulceration and abdominal pain . gps are considered benign , but the disease can recur and spread to regional lymph nodes . a 41-year - old female presented with abdominal pain . upper gastrointestinal endoscopy revealed a subepithelial tumor of the ampulla of vater in the second portion of the duodenum . the tumor was resected using the endoscopic mucosal resection technique . the tumor was diagnosed as benign gp of the duodenum using histological and immunohistochemical staining procedures .

prevalence of the periodontal disease varies in different regions of the world , and a higher prevalence and severity of periodontal disease in asian countries is reported . periodontal diseases are chronic infectious diseases that results in the inflammation of specialized tissues that surround and support the teeth . this tissue destruction is characterized by the formation of periodontal pockets that act as reservoirs for bacterial colonization of the dento - gingival environment . periodontal diseases can be divided into two major categories : ( a ) gingivitis nondestructive and reversible gingival inflammation related to a nonspecific bacterial challenge ; and ( b ) periodontitis destructive inflammation of teeth supporting tissues ( periodontal ligament , cementum , and alveolar bone ) related to some specific periodontal pathogens . many risk factors and risk indicators have been identified that are associated with increased risk of periodontal disease . socio - demographic factors of age , sex , education , income , occupation , medical conditions such as diabetes , cardiovascular disease ( cvd ) , arthritis , kidney disease , respiratory disease , stress and habits of smoking , tobacco use , alcohol , and oral hygiene practices have shown significant relationship with periodontal disease . majority of the population are suffering from moderate grade of periodontitis that initiates at an early age , and clinical manifestations of the disease appear after 35 years of age , which if left untreated will ultimately result in loss of tooth . the identification of a relationship between periodontal disease and some systemic conditions or events can improve care and attention to systemic health , either as a preventive or therapeutic strategy . the prevalence of periodontal diseases varies in different regions of the world according to the definition of periodontitis and study population , and there are indications that they may be more prevalent in developing than in developed countries . national oral health surveys have assessed periodontal health in america and it was noted that 82% of adolescents in united states have overt gingivitis . the national health and nutrition examination survey iii conducted during 19881994 have demonstrated that 50% of the adult population has gingival inflammation . the national survey also reported that 19.9% of subjects aged 30 years and 7.3% of those aged 90 years had a clinical attachment level 5 mm and 7 mm , respectively . from a study in uk , it was reported that moderate periodontal disease remains commonplace amongst uk adults and that the associated risk factors of plaque and calculus are in abundance , even among those who profess to be motivated about their oral health and attend the dentist regularly . the continued high prevalence of disease needs to be seen in the context of the far larger number of people who are now potentially at some risk , particularly in the older age groups . national research on periodontal disease is scanty in pakistan ; however , national oral health survey and few other studies provides some information on status of periodontal disease and report prevalence up to 98% and showed 31% with advanced periodontitis . this study was designed to evaluate periodontal disease prevalence and observe demographic and other risk factors / indicators associated with periodontal disease in the general public of a city in pakistan . periodontal patients of any age , gender , socioeconomic status attending margalla dental teaching hospital rawalpindi , pakistan during september demographic characteristics and known risk factors / indicators and periodontal status were noted on a performa prepared for the study . community periodontal index ( cpi ) the index teeth ( 11 , 16 , 17 , 26 , 27 , 31 , 36 , 37 , 46 , and 47 ) were examined at mesial and distal proximal sites on buccal and lingual / palatal sides . periodontitis was defined as a cpi code 3 , which indicates that more than one site had a 3.5 mm pocket or larger in the index teeth . all study parameters were analyzed with respect to periodontitis ( cpi scores 3 ) and nonperiodontitis ( cpi scores 2 ) . statistical analysis was performed using the chi - squared test for comparison of periodontitis and nonperiodontitis patients , and forward selection regression analysis was applied to explore association among study variables . was obtained from the competent authority of the margalla teaching dental hospital , rawalpindi , pakistan . periodontal patients of any age , gender , socioeconomic status attending margalla dental teaching hospital rawalpindi , pakistan during september demographic characteristics and known risk factors / indicators and periodontal status were noted on a performa prepared for the study . community periodontal index ( cpi ) component of cpitn index was used to assess periodontal status . the index teeth ( 11 , 16 , 17 , 26 , 27 , 31 , 36 , 37 , 46 , and 47 ) were examined at mesial and distal proximal sites on buccal and lingual / palatal sides . periodontitis was defined as a cpi code 3 , which indicates that more than one site had a 3.5 mm pocket or larger in the index teeth . all study parameters were analyzed with respect to periodontitis ( cpi scores 3 ) and nonperiodontitis ( cpi scores 2 ) . statistical analysis was performed using the chi - squared test for comparison of periodontitis and nonperiodontitis patients , and forward selection regression analysis was applied to explore association among study variables . was obtained from the competent authority of the margalla teaching dental hospital , rawalpindi , pakistan . majority ( 36% ) was from labor class , and 55% were from age group 21 to 40 years . mean age of patients was 24.2 9.8 years of nonperiodontitis and 37.5 14.7 years of periodontitis group . the findings revealed that 64.5% of the subjects had cpi score 2 ( nonperiodontitis ) , whereas 35.5% were found with cpi score 3 ( periodontitis ) . age , gender , occupation , smoking , diabetes , arthritis , cvd , kidney disease , stress , medications , tooth powder , and tooth brushing habit were significantly ( p 0.037 ) associated with periodontal status . forward stepwise regression analysis showed a significant association of periodontitis with age , occupation , and smoking [ table 3 ] . demographic / medical data of study participants status of cpi and risk factors / indicators associated with periodontitis forward stepwise regression analysis , using cpi scores 2 and 3 as dependent variables this study reports the periodontal status of the general population that visit a dental hospital for a self - perceived periodontal problem or on referral by a dentist . majority of cross - sectional surveys to assess prevalence of periodontal disease have used cpi of cpitn for being simple , inexpensive , less time consuming ; therefore , we also used cpi component of the index to estimate prevalence of periodontal disease in sample population . more than half of the study population was middle - aged comparable with regional data ; subjects with cpi score 2 were four times higher in 20 year age - group whereas subjects aged 40 years and above were four times higher with cpi score 3 . among subjects with cpi score 3 : percentage of females , laborers was higher in their respective groups ; smokers were six times higher ; cvd patients were 4 times higher , patients with respiratory disease , kidney disease , stress , and arthritis were 2 times higher than the nonperiodontitis group . although exhibiting a significant difference between periodontitis and nonperiodontitis groups , subjects using tooth powder and toothbrush were equal in all respective categories . the prevalence of periodontitis with 82% of aged 60 years and above in this study are comparable with the national survey that reports 93% prevalence in the same age group and other studies conducted in pakistan such as chaudhry et al . have reported prevalence of 98% with 31% with advanced periodontitis in army juniors aged 1852 years that is concordant with the current study . a same level of the prevalence of periodontitis has been reported from bangladesh , burkina faso , kenya , libya , and nepal . the prevalence of periodontitis ( 34.5% ) in the present study matches the prevalence ( 27% ) reported by joseph and cherry in trivandrum , india and with another asian study for 32.3% prevalence of periodontitis ( cpi score 3 ) . the main reasons for matching of individuals may be the age of the population and oral hygiene habits . 90% of the population studied was using toothbrush once or more times daily , only 6% using occasionally and 11% not using a tooth brush . participants above the age of 40 years had more periodontitis that is in agreement with other regional studies . age itself does not affect the periodontal status , but it is the cumulative effect of untreated disease reflecting the effect of the age on disease severity . the extent and severity of periodontal diseases were shown to be different in different age groups and the general trend observed in the majority of the studies was increasing severity with increasing age . aging is a natural process and changes are there in host immunity against disease process but if one can practice optimum oral hygiene , he or she can maintain teeth throughout life . increasing severity may be because of the untreated cumulative effect of disease process over the period of time . the significant difference of periodontal status was observed on the basis of gender for defined score categories that disagree with another study . our results demonstrated that quite a higher number of males were with score 2 , which may be attributed to poor attitude toward oral health and smoking . habits like smoking , pan with tobacco chewing was shown to be a significant risk factor for more prevalence of periodontal diseases . tobacco has been shown to affect gingival and periodontal diseases by several means like increased colonization of shallow periodontal pockets by periodontal pathogens and increased levels of periodontal pathogens in deep periodontal pockets . it can also increase the secretion of tumor necrosis factor alpha , prostaglandin e2 , neutrophil collagenase and elastase in gingival crevicular fluid . the prevalence of periodontitis was also higher among smokers , in agreement with other studies but not in tobacco users . the male to female ratio of patients with periodontitis ( 1.7:1 ) is in agreement with other studies . higher prevalence of nonperiodontitis and periodontitis in low - income category corresponds with one study but differs with another study . significant prevalence of periodontitis is reported to be associated with systemic conditions such as diabetes mellitus , arthritis , cvd , respiratory diseases , kidney disease is in concordance with other studies and the current study has also confirmed this association . toothbrush and toothpaste used to maintain day to day oral hygiene and good oral hygiene status was found to be significantly correlated with better periodontal health and this notion was confirmed in the current study as the number of patients without tooth brushing habit showed more periodontal disease . regression analysis of the data of this study showed that with increasing age the odds of having periodontitis increased and aging is reported to be associated with an increased incidence of periodontal disease however , it has been suggested that increased level of periodontal destruction observed with aging is the result of cumulative destruction rather than a result of increased rate of destruction . current knowledge has shown that periodontitis does not present a linear progression and is not age dependent . moreover , its distribution and severity are strongly influenced by host susceptibility and risk factors . untreated chronic periodontitis is responsible for tooth loss in the majority of the cases . foreseeing the bad effects of periodontal diseases on oral as well as general health , the prevention of these diseases should include in national health program and national oral health survey should be conducted to get meaningful data for different oral diseases and plan around preventive / curative measures . further studies will likely be focused on understanding the relationships between different factors and also on the rapid and practical identification of at - risk individuals and will allow us to tailor therapy to more closely suit the needs of our patients as individuals and the achieve better result . as periodontal diseases and their management have been a major concern of research in dental sciences , this study provides an insight into a number of factors that significantly affect periodontal disease status and need to be addressed during periodontal management .

background : investigators have identified an association of socio - demographic and medical factors with periodontal risk . this study observed status and association of periodontal disease and associated risk factors / indictors.materials and methods : all patients attending a dental teaching hospital were interviewed for socio - demographic and medical information through a structured questionnaire . participants were examined for periodontal status using the community periodontal index ( cpi ) , by a single examiner during september to november 2012 . an association of age , gender , smoking habit , systemic conditions , and oral hygiene measures with periodontal status ( [ periodontitis cpi score 3]/nonperiodontitis [ cpi score 2 ] ) was analyzed by applying chi - square test and forward selection stepwise regression analysis.results:one thousand nine hundred and eighteen patients were examined during the study period . the findings revealed that 63.5% of the subjects had cpi score 2 ( nonperiodontitis ) , while 34.5% were found with cpi score 3 ( periodontitis ) . age , gender , occupation , smoking , diabetes , arthritis , cardiovascular disease , kidney disease , stress , medications , and oral hygiene habits of using tooth powder or tooth brushing were significantly ( p 0.037 ) associated with periodontal status . regression analysis showed a significant association of age , occupation , and smoking with periodontitis.conclusion:this study observed prevalence of periodontitis in one - fourth of study sample . the study confirmed various socio - demographic risk factors / indictors associated with increased risk of periodontitis .

these diseases cause considerable morbidity and increase the risk of transmission of human immunodeficiency virus infection . the main aims of sti control program are to interrupt the transmission of infection and to prevent the development of complications and sequelae . while the interruption of transmission is addressed largely through campaigns promoting risk - reduction behavior and condom usage , the prevention of complications and sequelae is tackled through provision of health - care services to detect and treat stis as early as possible . timely treatment of sti is secondary prevention for that particular patient and primary prevention for other members of the community . health - care behavior includes healthcare - seeking behavior of the patient and behavior of the health - care provider . healthcare - seeking delays focus on the time elapsed from infection to initial contact with the health - care provider who makes the diagnosis and recommends therapy . the quality of sti services varies between health sectors and type of providers . seeking treatment from providers who give effective care not only cures the sti but also reduces transmission of current and future infections if people follow risk reduction and prevention messages . the health services - related issues include availability of other systems of medicine , perceived poor quality of care , accessibility , cost , stigmatization , lack of privacy , and confidentiality . the importance of improving the accessibility and quality of health services related to stis and promoting appropriate health - seeking behavior has been recognized in industrialized countries and is equally important in developing countries . insights into the factors that make people decide why , when , and where to seek care can improve the programs that focus on sti control . hence , we decided to study where the patients sought treatment before attending our institution , the appropriateness of that treatment , and the health services - related issues preventing them from seeking treatment from a government health facility . sti patients attending the department of dermatology and venereology of a tertiary care center in south kerala were studied for6months after getting written informed consent . hospital - based , cross - sectional descriptive type of study design was used . semi - structured questionnaire with both close- and open - ended questions was used to collect data . the broad domains under which the details were recorded were sociodemographic characteristics , clinical characteristics , treatment - seeking behavior , details of health facilities visited before visiting our center , appropriateness of treatment , and health services - related issues . inappropriate treatment - seeking behavior of the patient was defined as seeking treatment from sources other than modern medicine health facility . the treatment received from the first point of contact was considered appropriate if it was in accordance with the national aids control organization / world health organization guidelines . details regarding the risk - reduction messages and condom - promotion messages advocated by the first point of contact were also recorded . eighty - five symptomatic sti patients who attended a tertiary care center in south kerala were studied for6 months regarding their healthcare - seeking behavior , the choice of health facility , the behavior of the health - care provider , and the concerns of the patient regarding the services from public sector . among the 85 patients , 47 ( 55.3% ) were males and 38 ( 44.7% ) were females . majority of the males and females were from rural areas ( 94.1% ) , belonged to 2029 age group ( 48.2% ) , married ( 70.5% ) , with high school level of education ( 65.9% ) , and had monthly income less than rs . herpes genitalis ( 34.1% ) , condylomata acuminata ( 20% ) , syphilis ( 17.6% ) , nongonococcal urethritis ( 12.9% ) , gonorrhea ( 10.5% ) , chancroid ( 2.3% ) , and trichomoniasis ( 2.3% ) were the stis in the decreasing order of frequency . sociodemographic characteristics about 32.9% ( 28 ) of patients had inappropriate treatment - seeking behavior . 14 ( 29.8% ) males and 14 ( 36.8% ) females had inappropriate treatment - seeking behavior . majority of the males ( 50% ) tried left over medicines to cure themselves , whereas majority of the females ( 35.7% ) sought the help of ayurvedic doctors [ table 2 ] . nineteen ( 40.4% ) males and 7 ( 18.4% ) females came directly to our tertiary care center for treatment . excluding the patients who directly visited us , appropriate treatment - seeking behavior was seen in 59.6% ( 28 ) males and 81.6% ( 31 ) females . government sector was the choice of treatment for 46.4% ( 13 ) males and 93.5% ( 29 ) females . the difference between males and females in the choice of health sector was statistically significant ( p-0.00018 ) . among the 28 male patients , 18 ( 64.2% ) took treatment from general practitioners , 5 ( 17.9% ) from specialists , and 5 ( 17.9% ) from both . surgeons , physicians , and urologists were the specialists from whom the male patients sought treatment . among 31 female patients , 15 ( 48.4% ) took treatment from general practitioners , 9 ( 29% ) from specialist , and 7 ( 22.6% ) from both . the reasons for taking treatment from the chosen health facility are given in table 3 . the number of health facilities attended prior to attending our center ranged from 1 to 6 for males and 13 for females . nearly 28.6% ( 8) males and 32.3% ( 10 ) females had attended more than one health facility before visiting us [ table 4 ] . reasons for seeking treatment number of health facilities visited among the patients who sought appropriate treatment , only 2 ( 7.1% ) males received appropriate treatment , 2 ( 7.1% ) were referred to higher centers where sti services were available , and the remaining 24 ( 85.7% ) received inappropriate treatment . only one ( 3.2% ) fifteen ( 48.4% ) were referred to higher centers , where sti services wereavailable and the remaining 15 ( 48.4% ) received inappropriate treatment . all the three patients ( two males and one female ) who received appropriate treatment had herpes genitalis . none of the patients received risk reduction messages and condom promotion messages from either the government sector or private sector . many patients had multiple concerns about the government health facility . for majority of the male patients ( 66.7% ) , geographical access was a problem in seeking treatment from a government health - care facility followed by economic constraints ( 47.1% ) , lack of privacy ( 47.1% ) , lack of free medicine ( 47.1% ) , and lack of confidentiality ( 25.5% ) . the concerns and problems for females were geographical access ( 85.7% ) , economic constraints ( 78.6% ) , lack of free medicine 71.4% lack of privacy ( 66.7% ) , and lack of confidentiality ( 11.9% ) . the sti patients who attended the tertiary care centerfor6months were studied regarding their choice of health - care facility before attending our center , the appropriateness of treatment received and their concerns regarding services from the government health - care facility . the majority of the males and females were from rural areas , belonged to 2029 age group , were married , with high school level of education , and belonged to the lower income group . this was similar to the report from zambia and kenya where the proportion of patients who sought inappropriate treatment ranged from 23.7% to 30% . females predominated in inappropriate treatment practices before visiting a modern medicine health facility ( 36.8% vs. 29.8% ) . although the proportion of males and females resorting to treatment from theinformal sector was less in nairobi ( 13% of males and 16% of females ) , there was a predominance of females like in ours . this observation of ours was contradictory to the kenyan study where men resorted to treatment from informal sector more than females , 32.7% and 16.1 , respectively . the informal sector included pharmacists , traditional practitioners , drug peddlers , family members , ayurvedic practitioners , and homeopathic practitioners . a traditional healer was consulted only by one male patient ( 7.1% ) in this study and was similar to kenyan study were 6.1% visited traditional healers . traditional healer was the choice of 14.9% of patients in zambia and 56% of sti patients in uttarakhand . this inappropriate treatment may be due to many factors such as stigma , shame , guilt , lack of easy accessibility to treatment care facilities , lack of knowledge regarding stis , lack of self - efficacy , perceived seriousness , and lack of support from family . government sector was the choice of treatment for 49.4% of patients ( 46.4% males and 93.5% females ) . in zambia , 69.3% sought care at public health facility and 15.8% from private facility and similar to our study females preferred government sector facility ( 59.6% males vs. 79.6% females ) . about 37.7% of the patients sought treatment from public - sector health facilities ( 26.9% men and 46.8% women ) and 38.6% preferred private clinics ( 40.4% men and 37.1% women ) in kenya . contrary to our findings and reports from zambia and kenya , majority sought treatment from private sector ( 72% men and 57% women ) in nairobi . about 28.6% of males and 32.3% of females had attended more than one health facility before visiting us which was high when compared to nairobi where 13% of malesand 18% of females had attended more than one health facility . the reasons cited for not seeking care from public facilities were similar to that reported from literature such as lack of privacy , lack of drugs , long waiting time , and insistence on bringing the sex partner . sexual contact after the onset of symptoms was seen in 55.3% of patients and consistent condom usage was seen in none . this was similar to zambian patients were 57% reported sex after the onset of symptoms and consistent condom use was reported in only 15% . treatment failure at the first point of contact was evident as majority of our patients were referred from other peripheral centers although some patients came directly without reference . although appropriate treatment - seeking behavior was there in all the patients ( 69.4% ) who visited other center 's before visiting our center , the fact that they came to us indicate some form of treatment failure . the proportion of patients attending more than one health facility was also high . among them , only 7.1% of males and 3.2% of females received appropriate treatment . this is a matter of grave concern as inadequate treatment or lack of treatment at the first point of contact with the health system inevitably increases the length of time during which individuals remain infectious providing more opportunities for transmission and chances of drug resistance . none of the patients including those who received appropriate treatment were given risk reduction messages and condom promotion messages . major improvements in the delivery of effective health - care services as well as increased educational efforts both in health facilities and in communities are required . public awareness needs to be raised on the importance of early treatment seeking at public facilities , long - term consequences of stis , and sexual risk reduction strategies for reducing stis . individuals should be made aware that they must seek treatment promptly and refrain from sexual activity until they have been effectively treated . continuous training in syndromic management and the establishment of regular supportive supervision are necessary for both general practitioners and specialists . periodic performance appraisals should be conducted for all public facilities by supervising authorities . as sti control is a government initiative , the private sector is usually not included in periodic training . training as part of sti control programs in future has to include private sector also . standardization of sti care in both public and private facilities should be an important strategy . government and program planners should take into consideration the concerns expressed by the patients regarding the healthservice - related issues such as availability of medicines , issues of confidentiality , stigmatization , and harassment from staff . although the generalizability of the findings is poor , this study should be considered as an eye opener to the existing problems in our health facility . strengthening of sti services in the public sector , periodic training of health care providers of both public and private sector and creation of public awareness regarding the importance of early appropriate treatment should be an integral aspect of sti control program .

background : sexually transmitted infections ( stis ) are a major public health problem in developing countries . these diseases are associated with increased risk of transmission of human immunodeficiency virus as well as adverse outcomes on pregnancy and reproductive health . sexual behavior and healthcare - seeking behavior are identified as the true risk factors of stis.methods:hospital-based cross - sectional study design was adopted . eighty - five sti patients were studied regarding the inappropriate treatment - seeking behavior , the nature of the first point of contact with the health care , the appropriateness of treatment and the concerns of the patient regarding the services rendered by government health - care facilities.results:among the 85 patients studied , 55.3% were males and 44.7% were females . inappropriate treatment - seeking behavior was seen in 29.8% of males and 36.8% of females . about 59.6% of males and 81.6% of females sought appropriate treatment from modern medicine practitioners before attending our institution . only 7.1% of males and 3.2% of females received appropriate treatment . the government sector was the choice of treatment for 46.4% males and 93.5% females and this difference was statistically significant ( p = 0.00081 ) . lack of free medicines , issues of confidentiality , and privacy were the major service - related issues in the public sector.conclusion:appropriate treatment at the first point of contact with the health system is an important measure to prevent further transmission and development of complications . health providers from both private and public sector should be given frequent periodic training regarding syndromic management of stis and the training should stress on the need for risk reduction and condom promotion messages along with medical management . program planners should take necessary steps to ensure adequate and continuous supply of free drugs and tackle issues of confidentiality and privacy .

ozone ( o3 ) , a gas discovered in the mid - nineteenth century , is a molecule consisting of three atoms of oxygen in a dynamically unstable structure due to the presence of mesomeric states . the gas is colorless , acrid in odour and explosive in liquid or solid form . it has a half - life of 40 min at 20c and about 140 min at 0c . ozone occurs at less than 20 g / m from the earth 's surface at concentrations that are perfectly compatible with life . although o3 has dangerous effects , yet researchers believe it has many therapeutic effects.[13 ] the beginning of precise medical o3 generators has only recently allowed the mechanisms , action and possible toxicity of o3 to be evaluated by clinical trials . ozone has a capacity to oxidize organic compounds , and has well - known toxic effects on the respiratory tract when present in smog.[56 ] in medical use the gas produced from medical grade oxygen is administered in precise therapeutic doses , and never via inhalation , and advocates that it has excellent health benefits in dental caries , decrease blood cholesterol and stimulation of antioxidative responses , modifies oxygenation in resting muscle and is used in complementary treatment of hypoxic and ischemic syndromes.[710 ] medical o3 , used to disinfect and treat disease , has been around for over 150 years . used to treat infections , wounds and multiple diseases , o3 's effectiveness has been well - documented . it has been used to disinfect drinking water before the turn of the last century . ozone therapy has been in use since the 1800s and in 1896 the genius nikola tesla patented the first o3 generator in the us , later forming the tesla ozone company . during the first world war ( 1914 - 18 ) doctors familiar with o3 's antibacterial properties , and with few other medical resources available to them applied it topically to infected wounds and discovered o3 not only remedied infection , but also had hemodynamic and anti - inflammatory properties . in the late 1980s , reports had emerged that german physicians were successfully treating hiv patients with 03-aht ( autohemotherapy ) . there was then no pharmaceutical treatment for hiv and a pandemic was feared , so canadian authorities authorized the study to test safety and efficacy of 03-aht in aids patients . ozone was seen effective at disinfecting extracorporeal blood samples of hiv ; unfortunately for aids patients , 03-aht proved to be an in vivo ineffective treatment[1415 ] [ table 1 ] . the chronological use of ozone in medicine ozone is a naturally occurring energy - rich molecule embodying unique physico - chemical and biological properties suggesting a possible role in the therapy of sars , either as a monotherapy or , more realistically , as an adjunct to standard treatment regimens . owing to the excess energy contained within the o3 molecule , it is theoretically likely that o3 , unlike organism - specific antiviral options available today , will show effectiveness across the entire genotype and subtype spectrum of sars . inactivation of bacteria , viruses , fungi , yeast and protozoa : ozone therapy disrupts the integrity of the bacterial cell envelope through oxidation of the phospholipids and lipoproteins . in fungi , o3 inhibits cell growth at certain stages . with viruses , the o3 damages the viral capsid and upsets the reproductive cycle by disrupting the virus - to - cell contact with peroxidation . the weak enzyme coatings on cells which make them vulnerable to invasion by viruses make them susceptible to oxidation and elimination from the body , which then replaces them with healthy cells . stimulation of oxygen metabolism : ozone therapy causes an increase in the red blood cell glycolysis rate . this leads to the stimulation of 2,3-diphosphoglycerate which leads to an increase in the amount of oxygen released to the tissues . ozone activates the krebs cycle by enhancing oxidative carboxylation of pyruvate , stimulating production of atp . it also causes a significant reduction in nadh and helps to oxidize cytochrome c. there is a stimulation of production of enzymes which act as free radical scavengers and cell - wall protectors : glutathione peroxidase , catalase and superoxide dismutase . production of prostacyline , a vasodilator , is also induced by o3 [ figure 1 ] . action of ozone on rbc metabolism activation of the immune system : ozone administered at a concentration of between 30 and 55 g / cc causes the greatest increase in the production of interferon and the greatest output of tumor necrosis factor and interleukin-2 . mechanism of action of o3 on the human lung : ozone exposure induces a significant mean decrement in vital capacity . it significantly increases mean airway resistance and specific airway resistance but does not change dynamic or static pulmonary compliance or viscous or elastic work . the study to evaluate effect of bimosiamose on o3-induced sputum neutrophilia : biomosiamose is an anti - inflammatory glycomimetic and selectin inhibitor . it is found effective against disease states involving inflammatory cells like for example for asthma . this drug , as per last updation , was in phase 2 trials and being evaluated for its efficacy and safety in treating chronic pulmonary obstructive disease ( copd ) , the study is sponsored by revotar biopharmaceuticals ag and was carried out by nct00962481 ( clinicaltrials.gov identifier ) . evaluate the effects of the drug ( sb-656933-aaa ) on the body after a single dose in subjects who have inhaled o3 : drug sb-656933-aaa was developed by glaxosmithkline which was found to exhibit good activity in treating copd as well as cystic fibrosis . this action was found to be enhanced by administration of a single dose of o3 before administration of the aforementioned drug . this drug until latest updated data was in phase 1 stage , study was carried out by nct00551811 . intraarticular o3 therapy for pain control in osteoarthritis of the knee : ozone is being currently tested for its effectiveness in relieving the pain in patients suffering from osteoarthritis of the knee . the current status of the study is phase 2 which is sponsored by ben - gurion university of the negev and the study being conducted by nct00832312 . the effect of ozone therapy for lumbar - herniated disc : ozone is also being evaluated for its efficacy infiltration and its effectiveness in comparison with microdiscectomy in the treatment of lumbar - herniated disc with criteria for surgery . the study is currently in its phase 2 studies , which is sponsored by kovacs foundation and trials being carried out by nct00566007 . the study also evaluates the efficacy of infiltration in presence of corticoids , anesthetics , which is being compared by replacing o3 by oxygen.[3335 ] diabetic complications are attributed to the oxidative stress in the body , o3 was found to activate the antioxidant system affecting the level of glycemia . ozone prevented oxidative stress by normalizing the organic peroxide levels by activating superoxide dismutase.[3637 ] ozone was found to completely inactivate the hiv in vitro , this action of o3 was dose - dependent . ozone was also found to increase the host immunity by increasing the production of cytokine . in an in vitro study , it was observed that o3 is very effective in reducing the concentrations of acinetobacter baumannii , clostridium difficile and methicillin - resistant staphylococcus aureus in dry as well as wet samples , hence it can be used as a disinfectant . oxygen/ o3 mixture was also found to prolong the appearance of arrhythmia induced by potassium chloride , aconitine , etc . an array of ill - effects are observed owing to the reactivity of o3 viz oxidation , peroxidation or generation of free radicals and giving rise to cascade of reactions like peroxidation of lipids leading to changes in membrane permeability , lipid ozonation products ( lop ) act as signal transducer molecules . the main reason for this being presence of unsaturated fatty acids in both lung lining fluid and pulmonary cell bilayers , o3 reacts with unsaturated fatty acids to give their specific products i.e. , lop , which activates the lipases triggering the release of endogenous mediators of inflammation . combinations of o3 and no2 occur in photochemical smog , have hazardous effects on lung alveoli and act additively or synergistically . , can prevent aforementioned effects of o3.[4445 ] in an in vitro study it was observed that arachidonic acid was oxidized in presence to o3 to give peroxides , viz . these peroxides were fond to show following actions contraction of rabbit aortic strips and rat fundus strips in presence on indomethacin and vane 's mixture of vasoactive hormones at doses comparable to naturally formed prostaglandin peroxides . aap also caused aggregation of human platelets in platelet - rich plasma , but these effects were not observed in presence of indomethacin and vitamin e , which indicated that these can be used to treat such toxicity of o3 . ozone was effectively used as an antibacterial agent to treat oral infections caused by actinomyces naeslundii , lactobacilli casei and streptococcus mutans . exposure of about 60 s exhibited 99.9% killing efficiency , but exposure for such a long period showed degradation of saliva proteins . so exposure of 10 s to 30 s was proved effective to kill significant number of bacteria . a single subcutaneous injection of o3 in mouse with spared nerve injury of the sciatic nerve was found to decrease the neuropathic pain - type behavior . mechanism of this action is yet unclear but o3 was observed to regulate the expression of the genes that play vital role in onset and maintenance of allodynia .

ozone ( o3 ) gas discovered in the mid - nineteenth century is a molecule consisting of three atoms of oxygen in a dynamically unstable structure due to the presence of mesomeric states . although o3 has dangerous effects , yet researchers believe it has many therapeutic effects . ozone therapy has been utilized and heavily studied for more than a century . its effects are proven , consistent , safe and with minimal and preventable side effects . medical o3 is used to disinfect and treat disease . mechanism of actions is by inactivation of bacteria , viruses , fungi , yeast and protozoa , stimulation of oxygen metabolism , activation of the immune system . medication forms in a gaseous state are somewhat unusual , and it is for this reason that special application techniques have had to be developed for the safe use of o3 . in local applications as in the treatment of external wounds , its application in the form of a transcutaneous o3 gas bath has established itself as being the most practical and useful method , for example at low ( sub - atmospheric ) pressure in a closed system guaranteeing no escape of o3 into the surrounding air . ozonized water , whose use is particularly known in dental medicine , is optimally applied as a spray or compress . diseases treated are infected wounds , circulatory disorders , geriatric conditions , macular degeneration , viral diseases , rheumatism / arthritis , cancer , sars and aids .

olfactory dysfunction has been reported in several neurodegenerative conditions such as alzheimer 's disease ( ad ) and parkinson 's disease ( pd ) and may be used as a diagnostic tool in these conditions . however , whilst olfactory dysfunction has been reported in korsakoff 's syndrome ( ks ) , the possibility of using olfactory dysfunction to aid in a differential diagnosis in patients with working memory dysfunction has not been fully explored . ks patients usually first present with wernicke 's encephalopathy ( we ) , characterized by opthalmoplegia , gait abnormalities , confusion , and some signs of short - term memory loss , before developing ks . we patients typically respond well to thiamine ( vitamin b1 ) , but unfortunately , the signs of we are often overlooked , and without proper thiamine treatment , the we patient may then develop ks . acute ks may also benefit from early thiamine treatment ; however ks symptoms may be ascribed to other alcohol - related problems , or the memory impairments ( especially working memory ) may be confused with frontal lobe ( fl ) dysfunction . given the potential of thiamine treatment , improving the diagnostic pick - up rate for early ks would be a useful clinical goal . in this study , we examine the relationship between olfaction and memory in ks patients , fl patients , and healthy volunteers to explore the implications of olfactory testing in the diagnosis of ks . we predicted that both patient groups would perform poorly on the memory test and that ks patients would show a more severe olfactory deficit than fl patients . twelve ks patients , four age - matched fl patients ( one left frontoparietal , two right frontotemporal , and one bilateral frontal lesions , due to stroke ) and nine healthy age - matched controls were tested . ethical approval was obtained from the school of psychology at bangor university and the north west wales research ethics committee before this research began . twelve individuals with a clinical diagnosis of alcoholic korsakoff 's syndrome and a history of wernicke 's encephalopathy were recruited from 4 nursing and private care facilities in the uk . written and verbal informed consent was obtained from individual patients and their primary caregiver or family member . the diagnostic guidelines used to verify wernicke - korsakoff syndrome were based on consensus guidelines used for inclusion in an ongoing biomedical study investigating the genetic susceptibility of alcohol - related brain damage . the specific guidelines used were wernicke 's encephalopathy confirmed by medical history of hospitalization with a presentation of confusion and either ataxia or nystagmus ; korsakoff 's syndrome confirmed by a medical history of memory impairment and a past presentation of either confabulation or disorientation , as well as a present indication of short - term memory impairment . only adults under the age of 65 were included . only individuals with an onset date of 6 months prior to recruitment were included to ensure that the patient group represented those in a chronic stage of the illness . the onset date of korsakoff 's syndrome recorded in their medical or care facility admission notes varied from 6 months to 10 years prior to recruitment . only individuals who were currently abstinent from alcohol , and had been for at least 6 months , were included . there was no indication of spontaneous confabulation in any individual included in the korsakoff 's group . all korsakoff 's patients lived in a care environment where proper nutrition and medical attention were offered , although there was variation in the administration of prescription medication and vitamin supplementation , including thiamine . the benton visual retention test - fifth edition ( bvrt - v ) and the brief smell identification test ( b - sit ) . the benton visual retention test - fifth edition ( bvrt - v ) was administered . performance was quantified by the numerical error score calculated relative to the participants iq and age . performance was assessed by the number error score calculated relative to the participants ' iq and age . the 12-item b - sit [ 5 , 6 ] was used to evaluate olfactory function . the b - sit scores were significantly lower in the ks group than in either the healthy control or fl groups ( figure 1(a ) ) . one - way anova revealed a significant main effect of group ( f(2,22 ) = 72.20 , p < .001 ) . post hoc multiple comparisons using tukey 's hsd revealed significant differences between the ks and healthy controls groups ( mean difference of 6.39 , p .001 ) and also between the ks and fl groups ( mean difference of 5.50 , p .001 ) . in contrast , the ks and fl patients had similar high scores on the bvrt - v , compared to the healthy age - matched control subjects , whereas only the ks patients performed poorly on the b - sit ; therefore the poor performance of ks patients on the b - sit can not be attributed to a working memory dysfunction , rather it reflects olfactory dysfunction ( figure 1(b ) ) . one - way anova revealed a main effect of group ( f(2,10 ) = 6.00 , p > .005 ) . post hoc multiple comparisons using tukey 's hsd revealed significant differences interaction between the healthy control and ks groups ( mean difference of 7.10 , p .05 ) and also between the fl and control groups ( mean difference of 6.85 , p .05 ) . the observed deficits in olfactory function support previous studies [ 5 , 7 ] . in contrast , fl patients showed normal olfactory function despite evidence of memory impairment similar to ks patients . this supports our suggestion that assessment of olfactory dysfunction may aid in the differential diagnosis of patients presenting with working memory dysfunction . chronic alcohol misuse typically results in deficits in memory , planning , organizing , judgment making , and social skills . since these are difficulties usually related to frontal lobe damage , the presentation of these symptoms in ks or fl patients might be easily confused . the diencephalic pathology seen in ks may be responsible for the selective impairment in olfactory perception observed , which may explain why the loss of perception is characteristic to the disorder . clinical diagnosis of ks is subject to clinical error . when comparing two surveys conducted on the detection rate of ks , it was revealed that standardised tests can often miss the disorder altogether . the literature documenting olfactory dysfunction in ks patients is relatively limited and sometimes contradictory [ 4 , 6 ] . in hulshoff 's et al . ( 2001 ) study , six fl patients and seven ks patients were tested on odour discrimination . these authors claimed that fl patients were significantly impaired on odour discrimination tasks compared to the ks group , scoring within minimal impairment percentile ranges . however , patients with traumatic fl damage often present with olfactory problems , due to shearing of the olfactory fibres as they pass through the cribriform plate into the underside of the frontal lobes . it is possible that their fl patients may have sustained damage to the olfactory pathways in the inferior part of the frontal lobe , during neurosurgical interventions to remove tumours . in addition , the fl patients ' results only reached statistical significance once subjects who had not reached the odour detection criterion were factored out from analysis . we acknowledge that the present study involved a relatively small number of patients , but the results suggest that assessment of olfactory function may be an effective tool in the differential diagnosis of ks patients from patients with memory dysfunction due only to frontal lobe damage . the nature of ks that often keeps patients in long - term nursing care and the potential for treatment if diagnosed early highlight the importance of an early diagnosis . the b - sit is an uncomplicated , easily administered assessment tool that is simple for ks and fl patients to complete . the use of the b - sit could aid in diagnosis and referral for appropriate thiamine treatment . future studies that include a greater number of patients , as well as comparisons to olfactory performance in other neurological disorders , may be useful in further determining the potential value of the b - sit .

whilst olfactory dysfunction has been reported in korsakoff 's syndrome ( ks ) patients , the diagnostic implications of this have not been fully explored . ks can be difficult to diagnose because cognitive symptoms are similar to other diagnoses . for instance , patients with frontal lobe ( fl ) syndrome may present with memory impairments that are similar to ks . participants were given the benton visual retention test - fifth edition ( bvrt - v ) , to identify working memory dysfunction , and a brief smell identification test ( b - sit ) , to evaluate olfactory function . b - sit scores were found to be significantly lower in the ks group compared to the control and fl groups . in contrast , the error scores on the bvrt - v were significantly higher in both the ks and fl groups compared to the healthy control subjects . therefore , we suggest that olfactory function may aid in the differential diagnosis of patients presenting with working memory dysfunction .

they also shift the center of gravity to the non - paretic lower limb causing asymmetric posture , decreased body balance , and reduced weight movement ability1 . the balance ability of hemiplegic patients suffering from stroke is the most important factor for them and their family members , and its improvement is the most important goal of rehabilitation2 . a ramp is provided as a measure to prevent the risk of a fall , and as a rehabilitation program after injury , it is used as a substitute for stairs3 . a ramp is an essential facility for those who have difficulty with movement , such as the disabled who can not use stairs , and elderly people and pregnant women who can not move about freely4 . in a study of ramp use characteristics of healthy adults , yun et al.5 reported that increases in angle height led to increased muscle activity in the lower limb muscles . yi and kim6 noted that increased ramp height in treadmill training resulted in increased gait speed , and in a study of stroke patients hesse et al.7 observed that slope training using a treadmill improved their stride and gait speed . a method of enhancing stroke patients balance ability is proprioceptive neuromuscular facilitation ( pnf)8 . pnf improves the functions of proprioceptors by stimulating them in the muscles and tendons . it also increases muscle strength , flexibility , and balance9 , and enhances coordination10 . based on theoretical grounds , this study examined the effects of ramp gait training with the pnf technique , which is an effective therapy for the muscle strengthening and retraining necessary for the independent gait of hemiplegic patients , as well as for stroke patients balance . this study was conducted from august 20 to september 30 , 2014 in k hospital located in daegu metropolitan city . the criteria for inclusion were : chronic stroke patients who were diagnosed as having stroke resulting from a cerebral hemorrhage using magnetic resonance imaging or computed tomography , whose onset of stroke was at least six months or longer ability to maintain an independent standing posture for 30 s or longer ; the ability to walk 30 m or longer alone indoors ; the ability to communicate enough and to understand oral instructions given by the therapist ; and patients who were not using assistive devices or receiving drug therapy of internal medicine for the alleviation of spasticity . the subjects voluntarily agreed to participate in this study , and a written agreement was obtained from them . this study was approved by the university institutional review board and was conducted in accordance with the ethical principles of the declaration of helsinki . the total number of subjects was 30 and they were assigned randomly and equally to a control group and an experimental group . table 1table 1.general characteristics of the subjectscgeggender ( m / f)5/56/4age ( yrs)60.5 2.162.1 6.2height ( cm)161.5 4.9162.1 3.6weight ( kg)60.9 4.162.2 6.4paretic side ( r / l)5/56/4onset duration ( mon)12.2 5.214.1 7.0values are means sd ; eg : experimental group ; cg : control groupsummarizes the general characteristics of the subjects who participated in this study . values are means sd ; eg : experimental group ; cg : control group a physical therapist with clinical experience of more than one year conducted the muscle strengthening exercise , range of motion exercise , and stretching exercise , for all subjects . the control group received pnf gait pattern training by the therapist , wherein they walked back and forth over 10 m. this exercise was conducted for 30 min three times per week for four weeks . the experimental group conducted flexion of the knee joint of the paretic side and flexion , adduction , and external rotation of the hip joint of the paretic side . the therapist held the ankle and anterior medial part of the knee of the experimental group and directed , the experimental group moved their paretic lower limb joint to the end of the range of motion at the same time , and to provide the appropriate resistance , the therapist with the right hand placed on the knee joint applied force to the lateral part of the knee and applied resistance to the adduction and external rotation of the hip joint with the other hand11 , 12 . when the subjects exhibited rapid fatigue , respiratory problems , or dizziness during training , the training was stopped immediately and for safety , careful observation and assistance followed13 . the experimental group received training on a specially devised ramp whose angle of inclination , length , and width were 10 , 10 m , and 0.8 m , respectively , for 30 min per day . gait training involving traveling back and forth over 10 m was conducted three times per week for four weeks . the subjects received pnf lower extremity gait pattern training with the help of a physical therapist in front of the ramp gait - training device . when the subjects exhibited rapid fatigue , respiratory problems , or dizziness during training , the training was stopped immediately and for safety , careful observation and assistance were followed13 . the bbs test is used to evaluate the balance of elderly people and neurological disease patients . it is a functional test that simply evaluates three aspects within a short time , such as postural maintenance , postural adjustment by voluntary movement , and reaction to external perturbation14 . it has high intra - rater reliability , inter - rater reliability , and internal validity15 . the bbs test consists of 14 items and each item is scored from zero to four points , giving a maximum possible total score of 56 points . when a subject performs the evaluation items independently or within a fixed time , four points are given14 . the tug test is a method of evaluating functional motions , including dynamic balance and gait ability . a subject stands , walks 3 m back and forth , and sits down in the original spot . the tug test measures the time taken to stand from a sitting posture , walk 3 m and return , and sit down in the chair . in this study , it was performed three times and the average value was calculated and recorded . when the time taken is 30 s or longer , the subject has an unstable movement ability , is dependent , and can not walk outdoors independently . because the measurement method is simple , it can be easily performed by hemiplegic patients with lower limb disability , and it has a high reliability16 . frt is used to evaluate the stability limit and is also a measurement of dynamic balance ability . the measurement method involves subjects standing at a 10 cm distance from a wall on a flat floor , spreading their feet shoulder - width apart in a comfortable standing posture , extending the elbows , flexing the shoulders to 90 degrees , moving the body forward to a maximal extent using the ankle joints only , stretching the body in parallel to a maximal extent , and the distance the end of the middle finger tip has moved is measured17 . to test of the significance of differences in the results before and after the experiment , the paired t - test was conducted . the independent t - test was performed to test the significance of differences between the groups , before and after the experiment . after the intervension , the experimental group bbs and frt values had significantly increased ( p<0.05 ) and the tug value had significantly decreased ( p<0.05 ) . in contrast , the control group s bbs , frt , and tug values showed no significance ( p>0.05 ) . in the comparison of the results of the two groups after the training , a significant difference in the bbs values was found ( p<0.05 ) ( table 2table 2.comparison of the balance ability of the experimental and control subjectscg ( n=10)eg ( n=10)pretestposttestpretestposttestbbs ( score)23.1 3.123.3 2.322.8 2.128.1 2.9*tug ( sec)51.2 7.350.9 7.153.4 6.248.6 4.6*frt ( cm)5.3 2.15.4 1.16.1 1.37.1 2.7*meanse , * significant difference from pre - test , p<0.05 ; a significant difference in gains between the two groups , p<0.05 ; eg : experimental group ; cg : control group ; bbs : berg balance scale ; tug : timed up and go test ; frt : functional reach test ) . meanse , * significant difference from pre - test , p<0.05 ; a significant difference in gains between the two groups , p<0.05 ; eg : experimental group ; cg : control group ; bbs : berg balance scale ; tug : timed up and go test ; frt : functional reach test this study examined the effects of ramp gait training with the pnf technique for four weeks on hemiplegic patients balance ability . stroke patients have difficulty with gait due to unstable standing balance , the weakening of muscle tone , and abnormal muscular contraction timing18 . in addition , the shift of much weight onto the non - paretic side lower limb restricts their physical activity because of asymmetric support , stroke patients and decreases weight movement ability19 . furthermore , decreases in dynamic balance ability reduce ability to respond appropriately to environmental changes and diverse tasks , and dynamic balance ability is closely related to gait ability20 . our results show that after the intervention , the experimental group s bbs and frt values had significantly increased , and its tug value had significantly decreased ; however , the control group s bbs , frt , and tug value significant differences . in addition , there was no significant difference between the two groups after the intervention . this is because the proprioceptive senses of the ankle joints are stimulated more during gait on a ramp than during gait on the ground , or because when flexion of the ankle joints takes place on a ramp , the body s forward and vertical movements occur and balance ability is required to counterbalance the force generated by the lower limbs and align the body . in one experiment , chronic hemiplegic patients were divided into a proprioceptive sense training group and a visual feedback training group , and the proprioceptive sense group s bbs score increased21 . bohannon and lusardi22 reported bbs scores increased with age in a proprioceptive training group . in a study by hwang23 , bbs and tug values of hemiplegic patients , for whom proprioceptive stimulation was performed , were significantly greater than those of a visual feedback group . geiger et al.21 divided the subjects into a proprioceptive training group and a control group , and reported the tug time of the proprioceptive training group decreased from 23.08 s to 14.62 s. lee et al.24 conducted pnf lower limb pattern training for four weeks using elderly people divided into an elastic band group and a control group , and reported the pnf group s frt values were statistically significantly different ; a result which is consistent with the present study results . in the present study , the balance ability of hemiplegic patients who received ramp gait training with the pnf technique significantly improved . it confirms balance recovery through the pnf technique in rehabilitation training owing to the manual treatment effect based on dietz s principles25 . if composite gait training including diverse double tasks is conducted rather than mere lower extremity pattern training with pnf , it should lead to better functional improvement in the gait ability of stroke patients .

[ purpose ] this study examined the effects of ramp gait training using lower extremity patterns of proprioceptive neuromuscular facilitation ( pnf ) on chronic stroke patients dynamic balance ability . [ subjects and methods ] in total , 30 stroke patients participated in this study , and they were assigned randomly and equally to an experimental group and a control group . the experimental group received exercise treatment for 30 min and ramp gait training with pnf for 30 min . the control group received exercise treatment for 30 min and ground gait training for 30 min . the interventions were conducted in 30 min sessions , three times per week for four week . the subjects were assessed with the berg balance scale test , timed up and go test , and functional reach test before and after the experiment and the results were compared . [ results ] after the intervention , the bbs and frt values had significantly increased and the tug value had significantly decreased in the experimental group ; however , the bbs , frt , and tug values showed no significant differences in the control group . in addition , differences between the two groups before the intervention and after the intervention were not significant . [ conclusion ] in conclusion , ramp gait training with pnf improved stroke patients dynamic balance ability , and a good outcome of ramp gait training with pnf is also expected for other neurological system disease patients .

dehydration is the main cause of morbidity and mortality in critically ill patients and assessment of intravascular volume status ( ivs ) is essential for their management ( 1 , 2 ) . however , diagnosis of dehydration and intravascular volume loss is sometimes difficult ( 3 ) . some clinical signs and symptoms are assessed for determining ivs but they have low sensitivity and specificity ( 4 ) . it could be determined by measuring peripheral blood pressure , but in many conditions , it does not reflect accurate intravascular volume status . hypotension is detected in late stage of shock , especially when compensatory mechanisms fail ( 5 ) . central venous pressure ( cvp ) is one of the indices of ivs and early goals of goal - directed therapy approach ( 6 , 7 ) . a common and conventional procedure for measuring cvp is inserting a catheter in a central vein such as internal jugular , subclavian , and femoral veins . however , the major problem with this procedure is the probability of some dangerous and sometimes lethal complications such as arterial puncture , pneumothorax , hemothorax , misplacement in carotid artery , infection , and other rare complications such as cardiac tamponade etc . in addition , central venous catheter insertion is a time consuming and invasive procedure ( 8 - 12 ) . recently , researchers and physicians have attempted to measure cvp with non - invasive procedures such as ultrasonography , transthoracic echocardiography , and transesophageal echocardiography ( tee ) . they have reported a correlation between sonographic inferior vena cava ( ivc ) diameter and cvp ( 1 , 9 , 13 - 16 ) . donahue et al . found a direct correlation between internal jugular vein sonographic diameter and cvp ( 17 ) . however , few studies have attempted to find the best anatomic location and cut points . therefore , the purpose of this study was determining the best anatomic location to find precise correlation between cvp and ivc diameter using tee . study design and setting in the present prospective cross - sectional study , the correlation of sonographic ivc diameter , aorta diameter , and ivc / aorta ratio with cvp were evaluated . patients in need of catheterization and tee who were referred to a teaching hospital in tabriz , iran , from 2013 to 2015 were enrolled . the patients or their relatives had signed the informed written consent form before initiation of the study and the researchers adhered to the principles of helsinki declaration . over the course of the study , all patients over 18 years old who needed central venous catheterization and tee were included . consecutive sampling was used and the patients need for catheterization and tee was determined by an independent cardiologist . those who were prohibited from assuming a supine position ( severe orthopnea , intracerebral pressure rising ) , patients who had moderate - to - severe tricuspid regurgitation , congestive heart failure , broncho - pulmonary dysplasia , body mass index > 30 , and renal and liver diseases were excluded . after central catheterization using seldinger technique , cvp was measured using electronic transducer connected to the cv line inserted in the right internal jugular vein by central approach while the patient was placed in a 15-degree trendelenburg position ( 18 ) . ivc and aorta diameter were measured using tee ( sonos 5500 ; philips medical systems , andover , ma ) and a 3.5 mhz probe . all the ultrasonographies were done by a trained cardiology fellow who was blind to the patients cvp . ivc and aorta diameter were measured at end - expiration and end - diastole in 2-dimensional long - axis mid - esophageal bicaval view . measurements were done in the level of diaphragm , 2 centimeters above the diaphragm and at the point of entry into the right atrium and recorded in millimeter . baseline characteristics of the patients sbp : systolic blood pressure , dbp : diastolic blood pressure , hr : heart rate , cvp : central venous pressure , ivc : inferior vena cava . correlation of cvp with ivc and aorta diameters , and ivc / aorta ratio ivc : inferior vena cava ; ci : confidence interval . area under roc curve of ivc and aorta diameters , and ivc / aorta ratio in estimation of cvp ivc : inferior vena cava ; auc : area under curve ; ci : confidence interval . comparison of area under the curve of inferior vena cava ( ivc ) diameter ( a ) , aorta diameter ( b ) , and ivc / aorta ratio ( c ) in different points in estimation of central venous pressure and comparison between the three indices ( d statistical analysis sample size was determined to be about 45 patients considering minimum correlation coefficient of ivc diameter and cvp to be 0.48 with 95% confidence interval ( ci ) ( = 0.05 ) and 90% power ( = 0.1 ) . spearman s rank correlation test was used to determine the relationship between sonographic ivc diameter and cvp . best index ( ivc diameter , aorta diameter , or ivc / aorta ratio ) and best measurement location ( the level of diaphragm , 2 cm above the diaphragm and at the point of entry into the right atrium ) were determined via calculating and comparing area under the receiver operating characteristics ( roc ) curve ( auc ) . normal cvp was considered 2 - 6 mmhg for this purpose ( 19 ) . in all analyses , p over the course of the study , 39 patients were included ( 53.8% male ; mean age 62.1 5.8 years ) . mean cvp was 6.8 1.4 mmhg and 25 ( 64.1% ) patients had normal cvp , while 14 ( 35.9% ) showed elevated cvp ( > 6 mmhg ) . the relationship of cvp with ivc and aorta diameter table 2 shows the relationship of cvp with sonographic ivc diameter , aorta diameter , and ivc / aorta . as can be seen , cvp had a significant correlation with ivc diameter at the point of entry into the right atrium ( r = 0.85 ; p < 0.001 ) , 2 cm above the diaphragm ( r = 0.48 ; p = 0.002 ) , and in the level of diaphragm ( r = 0.85 ; p < 0.001 ) . at the same time , aorta diameter showed a significant correlation with cvp at the point of entry into the right atrium ( r = 0.68 ; p < 0.001 ) and 2 cm above the diaphragm ( r = 0.44 ; p = 0.005 ) . ivc / aorta ratio also had a significant correlation with cvp at all 3 points . comparing diagnostic values of ivc and aorta diameter evaluation of area under the roc curve showed that the best point for determining cvp was at the point of entry into the right atrium for ivc diameter ( p = 0.01 ) , aorta diameter ( p = 0.01 ) , and ivc / aorta ratio ( p = 0.004 ) ( figure 1a - c ) . therefore , to identify the best index among the 3 , their area under the roc curve was compared at this point ( table 3 and figure 1-d ) . based on the findings , ivc diameter ( auc = 0.98 ; 95% ci : 0.95 - 1.0 ) and ivc / aorta ratio ( auc = 0.96 ; 95% ci : 0.92 - 1.0 ) had higher diagnostic values compared to aorta diameter ( auc = 0.89 ; 95% ci : 0.79 - 0.98 ) at this point ( p = 0.01 ) . this study was conducted to find the precise anatomic location with the best correlation between cvp and ivc diameter , aorta diameter , or ivc / aorta ratio . based on the present findings , the ivc diameters and ivc / aorta ratio had acceptable correlation with cvp . in addition , the point of ivc entry into the right atrium was the best anatomic location to estimate cvp . ultrasound is a non - invasive , easy , available , and useful tool for assessment of volume status ( 20 ) . . showed that when end - expiratory ivc diameter was lower than 10 mm , the cvp would be 10 cmh2o , ( sensitivity 77% and specificity 91% ) and when end - expiratory ivc diameter was 15 mm , cvp would be 15 cmh2o ( sensitivity 90% and specificity 89% ) ( 21 ) . baumann et al . measured cvp using ultrasound and concluded that although estimation of cvp by ultrasound is easy , but absolute values differ from invasive measurements of cvp and ivc indices alone ca nt be used to accurately estimate intravascular volume status ( 22 ) . in line with our study , arthur et al . reported a statistically significant correlation between ivc diameter and cvp ( 16 ) . compared different anatomic locations such as subxiphoid , mid - abdomen and suprailiac to find best anatomic location for calculating the correlation between cvp and ivc diameter . they reported that suprailiac view had better correlation with cvp compared to other anatomic locations but measurement of cvp using ultrasound had low yield ( 23 ) . yet , some studies demonstrate that an increase or decrease in the collapsibility of ivc can be helpful in management of patients in poor condition . based on the findings of those studies , the combination of absolute ivc diameter and collapsibility level , which is known as caval index , is a better estimation of cvp compared to absolute ivc diameter and can be a good replacement for invasive tests ( 24 - 26 ) . the mechanism of this method is based on the fact that the negative pressure generated while inhalation leads to an increase in venous return to heart and ivc collapse . while exhaling , venous return decreases and ivc diameter goes back to the basic state ( 25 , 27 , 28 ) . in the present study , caval index could not be assessed , as the ultrasonography film could not be recorded in the device used . another limitation of this study was the little sample size , yet the minimum power calculated for this study was 85% ; so it seems that little sample size has not affected the results of this study . based on the present findings , the ivc sonographic diameter and ivc / aorta ratio had acceptable correlation with cvp at the level of ivc entry into the right atrium . all authors passed four criteria for authorship contribution based on recommendations of the international committee of medical journal editors .

introduction : the correlation of central venous pressure ( cvp ) with inferior vena cava ( ivc ) sonographic diameter has been reported in several studies . however , few studies have attempted to find the best anatomic location of measurement . therefore , the purpose of this study was determining the best anatomic location to find precise correlation between cvp and ivc diameter using transesophageal echocardiography ( tee ) . methods : in the present diagnostic accuracy study , patients in need of central venous catheterization and tee were enrolled . maximum diameter of ivc were measured during expiratory phase of respiratory cycle at the level of diaphragm , 2 cm above the diaphragm and at the point of entry into the right atrium using sonosite tee device . cvp was measured using an electronic transducer connected to the central venous line . the best location for sonography was determined via calculating and comparing area under the receiver operating characteristics ( roc ) curve ( auc).results:39 patients were enrolled ( 53.8% female ) . mean cvp was 6.8 1.4 mmhg and 25 ( 64.1% ) patients had normal cvp , while 14 ( 35.9% ) showed elevated cvp ( > 6 mmhg ) . evaluating auc showed that ivc diameter ( p = 0.01 ) , aorta diameter ( p = 0.01 ) and ivc / aorta ratio ( p = 0.004 ) had acceptable correlation with cvp . point of entry of ivc into the right atrium with auc of 0.98 ( 95% ci : 0.95 1.00 ) was the location of highest correlation with cvp . conclusion : based on the present findings , the ivc sonographic diameter and ivc / aorta ratio had acceptable correlation with cvp at the level of ivc entry into the right atrium .

teratomas are composed of various cell types , which represent more than one germ layer . sacrococcygeal teratoma is the most common solid neoplasm in neonates , with an estimated prevalence of 1 in 35,000 - 40,000 births . they can be diagnosed prenatally by fetal ultrasound ; 50 - 70% of cases are found during the first few days of life , with less than 10% being diagnosed beyond the age of 2 years . complete surgical resection is necessary to alleviate symptoms and to rule out malignancy because malignant transformation has sometimes been reported . almost all reported cases of adult teratomas have been found as a single tumor , so multiple masses are extremely unusual . we report a case of adult teratoma found as multiple tumors in the presacral area . an 18-year - old female was transferred to our outpatient department from a local hospital . a ct scan was performed for the diagnosis of acute appendicitis , and 3 presacral masses were revealed . a regularly marginated mass measuring 5.5 cm was identified in the left retrorectal space and extended into the ischiorectal fossa ( fig . a high - density mass measuring 6 cm was observed in the right retrorectal area . on coronal view , another nodule measuring 3 cm was found just beneath the mass mentioned above ( fig . the 3 masses were contiguously located ; however , all of them were individually circumscribed and were , thus , regarded as independent masses rather than lobulating daughters budding from one mass . no evidence of bone destruction or invasion of the adjacent structures was found . on digital rectal examination human chorionic gonadotropin ( hcg ) and serum markers , alpha - fetoprotein , carcinoembryonic antigen ( cea ) , and carbohydrate antigens ( ca 19 - 9 , ca 125 ) , were not elevated . the right lower mass showed dense adherence to the sacrum and was filled with sebaceous material and hair . the mass was resected without removal of the coccyx bone although it was adhered to the sacrum . sebaceous material was also aspirated from the cyst in order to obtain a better operative view . all three germ layers appeared in all 3 tumors : fragments of squamous epithelium , hair , sebaceous glands , and neural glia ( ectodermal derivation ) ; adipose tissue and bone ( mesodermal derivation ) ; and respiratory epithelium ( endodermal derivation ) . no malignant or immature cells were found , and a diagnosis of mature cystic teratoma was made . the patient recovered without showing any postoperative complication . teratomas contain tissues that are foreign to their anatomic site and have not resulted from metaplasia . they are derived from embryonic pluripotent cells and may have various degrees of maturation , according to which they are classified as mature , immature , and malignant . they may be inherently malignant or have the potential for malignant degeneration . among the pediatric population , the incidence of malignancy is 7 - 10% when diagnosis is made prior to the age of 2 months , compared with 50 - 67% when the diagnosis is established after that age . however , benign tumors predominate in case reports involving adult populations [ 5 , 6 ] . the possibility of malignancy should be kept in mind when planning the treatment for adult sacrococcygeal or presacral teratomas because cases of malignant transformation have sometimes been reported [ 2 , 5 , 7 ] . with regard to radiologic evaluation , the presence of irregular calcifications has been reported in 75% of benign tumors . calcifications are also found in 25% of malignant teratomas , so they can not be considered to be an indicator of benignity . malignancy is suspected in large tumors with necrosis , poor definition of adjacent soft tissue planes , and sacral infiltration and is certain when locoregional lymph node and distant metastases are noted [ 8 , 9 ] . based on this information , the tumor in the present case was considered to have a benign nature in preoperative evaluation , although imaging features alone do not provide definite differentiation between benign and malignant teratomas . in this case , benignity was confirmed using an intraoperative frozen biopsy . most teratomas contain both solid and cystic areas , although completely solid teratomas do occur . teratomas are usually well - encapsulated single masses , and independently encapsulated cysts can rarely be found within one large tumor . however , the appearance of an adult sacrococcygeal or presacral teratoma as multiple masses is extremely rare , and according to a thorough literature review , only one report has shown a case of presacral teratoma exhibiting three cystic masses . various theories for the origin of teratomas include parthenogenetic development of germ cells within the gonads or in extragonadal sites ; nonparthenogenetic origin from " wandering " germ cells left behind during migration of embryonic germ cells from the yolk sac to the gonad ; and an origin from other totipotent embryonic cells . pluripotent cells are normally present in the gonads and may also be found in abnormal sequestered midline embryonic rests . accordingly , teratomas are found in the mediastinum , the retroperitoneal space , the sacrococcygeal zone and intracranial locations , as well as the gonads . if the pathogenesis of sacrococcygeal or presacral teratomas that are aberrantly sequestered pluripotent cells is considered , the presence of multiple tumors might be possible , as in the reported case , which is very unusual . symptoms of presacral teratomas are often subtle and nonspecific ; however , completely asymptomatic patients , like the present case , are rare . most frequently reported symptoms include lower back and pelvic pain , constipation , urinary retention and lower extremity paresthesias or weakness [ 7 , 11 ] . symptoms mainly result from the mass effect and rarely from infiltration in the case of malignancy . , presacral simple cystic lesions may correspond to anterior meningoceles or rectal duplication cysts . in the appropriate clinical context , they may also represent abnormal collections , such as seromas or urinomas . in the presence of a multiloculated cystic lesion more complex lesions may represent chronic retrorectal abscesses , pilonidal or dermoid cysts , soft tissue , bone tumors and metastatic tumors . whatever the nature of the lesion is ct and mri are the most significant methods to characterize the mass and to evaluate the intrapelvic extension and relationship to other structures . both studies are complementary ; however , ct is the most sensitive study for demonstrating calcification and ossification in sacrococcygeal teratomas , as well as for determining the integrity of the adjacent cortical bone . mri allows a better topographic evaluation of the tumor owing to its direct multiplanar characteristics and provides higher resolution in soft tissues . in this case , mri was not performed because the boundary of the mass was clear on the ct scan . however , for a thorough preoperative study in complicated cases , mri could be necessary . surgical excision is the treatment of choice for presacral teratomas , provided that the tumor can be completely removed . a posterior approach through a sacral incision , a transabdominal approach and a combined approach have been reported , depending on the tumor 's size and location . recently , laparoscopic excision has also been attempted by some particular surgeons [ 12 , 13 ] . in conclusion , a presacral teratoma should be considered in the differential diagnosis of a pelvic mass in adults . an adult teratoma at this site can appear as a multiple tumor , although it is extremely unusual .

although the sacrococcygeal area is the most common site for a teratoma in infants , it is a rare site for a teratoma in older patients . most of the teratomas found in this area in adults are single mass , but in a few cases , multiple masses have been reported . the author reports on the case of an 18-year - old female patient with 3 presacral teratomas . the tumors were surgically removed via a transabdominal approach and were pathologically diagnosed as mature cystic teratomas . this case report indicates that an adult presacral teratoma can appear as multiple tumors , although it is very unusual .

hepatoid adenocarcinoma ( hac ) is a very unusual histological type of primitive extrahepatic cancer . hac can virtually never be distinguished at pathologic examination , on the basis of morphology alone , from hepatocellular carcinoma , whose gross and microscopic features ( sheet - like or trabecular proliferation of neoplastic cells with abundant , eosinophilic cytoplasm , arranged in a solid pattern with sinusoid - like spaces lined by endothelium ) it shares . a final differential diagnosis can be obtained , in most cases , only through immunohistochemistry . as possible origins of this tumor , cancer arising from ectopic liver cells embedded in the organs where hac develops and neoplastic transformation of persistent germ cells or of nonhepatic epithelium capable of multipotential differentiation have been hypothesized . the majority of hacs produce alpha - fetoprotein , whose plasma levels may be very high ; however , some cases have been described in whom alpha - fetoprotein was normal . hac occurs in patients with no history of hepatic disease , alcoholism or addiction to other potential sources of hepatic damage ; their livers demonstrate no functional or morphological abnormalities . blood samples do not reveal elevated levels of hepatic enzymes , and imaging examinations fail to detect any major alteration as to volume and structure of the liver , except in the cases where hepatic metastases develop . no more than 30 hacs , to our knowledge , have been reported to date . twelve of them , in most cases leading to a poor prognosis , occurred in the lungs ; moreover , 2 histologically inhomogeneous pulmonary cancers have been described containing scattered hepatoid foci [ 9 , 10 ] . the majority of extrapulmonary hacs occur in the stomach , while 1 or 2 cases each were found in the mediastinum , esophagus , gallbladder , pancreas , ampulla of vater , renal pelvis , bladder , endometrium , ovary , and testicle . we were not able to find , in the english literature , any published paper reporting soft - tissue localizations of hac . a 68-year - old nonsmoker , nonalcoholic woman , who did not report any exposition to agents inducing liver damage and who had no history of hepatic or pulmonary disease nor of any kind of cancer , underwent a conventional radiography of her left shoulder , complaining of localized pain . an ill - defined radiolucent area ( fig . 1a ) , expression of osteolysis , was found within the scapula . a magnetic resonance examination of the shoulder was therefore performed a few days later , which demonstrated a large ( 8 5.5 4.5 cm ) smooth - margined mass , moderately inhomogeneous and fairly enhancing after intravenous administration of paramagnetic contrast medium , infiltrating the scapular girdle both in its muscular ( mainly in the supraspinatus muscle ) and in its bony component ( fig . 1b , c ) , confirming the radiographic finding and indicating a malignant soft - tissue mass with adjacent bone invasion . ultrasound - guided fine - needle aspiration biopsy of the soft - tissue mass showed malignant cells in a trabecular pattern containing biliary thrombi ( fig . 2 ) ; these features were considered by the pathologist a clue to the diagnosis of a soft - tissue localization of a hepatocellular carcinoma . no significant abnormalities were found in blood samples : in particular , hepatic enzymes , the other liver function parameters and the serum level of alpha - fetoprotein ( 2.4 ng / ml ) were all normal . moreover , at both ultrasound and computed tomography ( ct ) examinations the liver had normal size and margins , with normal hepatic vessels ; no focal lesions were detected and echotexture and density were homogeneous . a 4.5 4 4 cm solid , partly inhomogeneous mass with pleural adhesion was , however , found at ct in the upper lobe of the left lung ( fig . pathologic examination of a ct - guided biopsy of the pulmonary mass revealed hepatocellular carcinoma - like neoplastic tissue whose pattern was undistinguished from the specimen obtained in the soft - tissue mass . a double localization of hac , in the lung and in the soft tissues of the shoulder , was therefore diagnosed , the latter presumably being a metastasis from the former . fifteen months after the diagnosis , she is alive and symptom - free ; the size of both the soft - tissue and the pulmonary lesions has significantly reduced and no further localizations have appeared in any other organ or in the lymph nodes . due to its low prevalence , hac is never taken into consideration when an extrahepatic mass is found at imaging or endoscopy . one might suspect that in some cases of hac the correct diagnosis is not achieved , particularly in the elderly or in patients with severe underlying disease , in whom the diagnostic workout sometimes concludes with a generic cytological ascertainment of the presence of malignant cells within a lesion . in addition to its rarity , hac may be underdiagnosed because of the absence of unequivocal imaging features . in the only paper published in the radiological literature on this topic some ct characteristics have been identified as relatively common to hacs , whatever their localization . according to these authors , hacs are usually large - sized tumors , with the same density of the normal liver at baseline scan ( the presence of necrotic areas , however , often makes masses appear inhomogeneous ) , and moderately enhance after intravenous iodinated contrast medium administration ; invasion of adjacent anatomical landmarks ( such as the pleural surface for pulmonary hacs ) , regional lymphadenopathies and distant metastases are frequently observed . in this series , however , only one of the tumors was localized in the lung , and none of the imaging features described is considered by the authors themselves typical enough to direct the diagnosis . 3 ) shares some of these ct characteristics ( large size , slight inhomogeneity , adhesion to the pleura ) , its features being nevertheless largely nonspecific . similar characteristics as to volume , structure and invasion of the adjacent tissues ( fig . 1b , c ) can be identified in the shoulder mass , which makes our case unique : to our knowledge soft - tissue hacs have never been previously described , either isolated or in association with involvement of the lung , the stomach or other organs . moreover , serum alpha - fetoprotein in our patient was normal , which did not aid the diagnosis . on the other hand , to date this patient has experienced a better prognosis than the average of her counterparts . in conclusion , we suggest that hac although rare should be included in the differential diagnosis when , in patients with a normal liver ( especially if serum alpha - fetoprotein is raised ) , a mass similar in histology to hepatocellular carcinoma is found at any extrahepatic location .

hepatoid adenocarcinoma ( hac ) is a rare type of extrahepatic cancer , whose pathologic features are indistinguishable from those of hepatocellular carcinoma . about thirty cases , nearly half of which occurring in the lung , have been described in patients with a normal liver . no imaging features are typical enough to allow a correct diagnosis . a localization of hac in the soft tissues of the shoulder with invasion of the scapula in a woman without other symptoms is reported in this paper ; soft - tissue hacs have never been described to date . an associate pulmonary hac was eventually found in this patient .

genomics and related fields are becoming increasingly relevant in clinical practice for a wide variety of settings , including the deployment of next generation sequencing in specific scenarios . however , the arrival of genomics to the bedside in its current state represents only the initial part of the translational highway . genomic research falls on a continuum of 4 translational phases beyond initial discovery ( t0 ) : t1 , developing candidate health applications ; t2 , evaluating candidate health applications and developing evidence - based recommendations ; t3 , integrating evidence - based recommendations into care and prevention ; and t4 , assessing health outcomes and population impact . a more realistic expectation would be that interventions of putative value will enter clinical practice and only over time will enough evidence be accumulated to support evidence - based guidelines . research beyond bench to bedside ( t2t4 ) supports the evaluation of the clinical validity and utility of promising applications , as well as their comparative effectiveness and implementation and outcomes research to achieve population health benefits . the history of medicine teaches us that premature implementation of promising new technologies without meeting an evidentiary threshold can lead to potential harms and increasing healthcare costs . yet , a previous pubmed analysis found that less than 1% of the published literature on human genomics was related to phases t2 or beyond . this trend follows closely the current level of funding in human genomics research by the national cancer institute ( only 2% of human genomics research funding goes to t2 or beyond ) . since 2012 , the office of public health genomics , in collaboration with the national cancer institute , has been regularly tracking the translational genomics research scientific literature to develop a current baseline for the field and identify opportunities , gaps and challenges in genomic medicine . we briefly summarize the one year data herein , and discuss a process for integrated horizon scanning of such research that can inform research , policy and practice . each week , the centers for disease control and prevention ( cdc ) s office of public health genomics publishes the free genomics and health impact update newsletter online and delivers it by e - mail to more than 50,000 subscribers worldwide . horizon scanning for translational research in this weekly update includes a pubmed targeted search query , supplemented by monitoring of online news using google alerts , and genomics - related websites . publications collected by this process are reviewed and classified by two or more coders according to the schema in table 1 . in this brief report , we limit our analysis and presentation only to papers identified in pubmed beyond bench - to - bedside phases ( t2t4 ) . because of small numbers , we group products in two groups ( t2 : what works ? ) and ( t3t4 : how has it been implemented and is it working in the real world ? ) . during the one - year period from may 16 , 2012 , through may 15 , 2013 , 505 articles were identified in pubmed . of these , 44% were classified as t2 research and 56% as t3 or t4 ( table 2 ) . there were 312 original research articles , 123 reviews , 38 papers describing clinical guidelines , policies and recommendations , and 32 describing tools , decision support and educational materials . the appendix shows a list of published papers describing guidelines , policies and recommendations , by topic and source . not included here are 7 additional policies and guidelines that were not listed in pubmed during the horizon scan ( e.g. , fda , cms , european union , and uk human genetics commission ) . table 2 also shows specific examples of the types of translational research publications by category . more than three - fourths of these publications ( n=399 ) addressed a specific genetic test or other health application ; almost half of these ( n=180 ) were related to cancer . the next - largest categories were hereditary disorders ( 21% ) , cardiovascular disease ( 11% ) and birth defects ( 6% ) . figure 1 summarizes application - specific publications by indication , along with the proportion in each group related to cancer . cancer represented 45% ( 180/399 ) of all articles referencing a specific genetic test or genomic technology in the t2t4 space . one third of cancer genetic testing and genomic technology articles were related to risk assessment , followed by 19% therapeutic , 18% diagnostic , 16% prognostic , 7% preventive , and 2% population screening , with the remaining 4% addressing a combination of these . germline testing ( including utilization of family history tools ) was the focus in 63% of articles addressing cancer genetic testing and genomic technologies . somatic testing represented 36% , including 5 articles that overlapped both germline and somatic testing . forty nine percent ( 88/180 ) of the cancer genetic testing and genomic technology articles were classified as t2 and fifty one percent ( 92/180 ) were classified as t3 . family history tools and methods represented 7% of all articles in our collection , sub - categorized under t2 ( n=10 ) and t3t4 ( n=25 ) . sixteen percent ( n=82 ) of all articles addressed pharmacogenomic testing . almost half of the pharmacogenomic articles were cancer - related . in this brief report , we present baseline data on an ongoing horizon scanning by the cdc office of public health genomics , in collaboration with nci , of the translational genomics research scientific literature . this public health surveillance activity identifies promising genomic applications for clinical practice as well as knowledge gaps that necessitate additional research . before commenting on these findings , first , in spite of our systematic effort to capture the pertinent literature , our pubmed queries had imperfect sensitivity and specificity . although we have steadily improved specificity through manual curation by multiple reviewers , it is more difficult to quantify accurately the number of missed items . these baseline data can be used to continue to improve search capacity using machine learning tools . we will also continue to refine the use of online search tools to capture research that is not published , or is published only in abstracts from scientific meetings , websites or online databases , or the grey literature . during the one - year period we analyzed , such searches identified 15 additional items , including the 7 additional guidelines and policies ) . finally , we should note that publications in a given year represent the results of research initiated in prior years . to feel the pulse of translational research in genomic medicine , it is important to integrate these analyses with existing databases of clinical trials , genetic testing information , and ongoing research funding by the nih and other institutions . we present these data as a baseline survey of post bench to bedside translational research in genomic medicine . they provide a starting point for future horizon scanning and a foundation for future enhancements as suggested above . while we can not get an accurate estimate of the denominator for such research during the period of horizon scanning , a search of pubmed for genetics and genomics research in humans yielded almost 95,000 published articles in 2012 . therefore , we estimate that our number of t2t4 publications presented here are about half a percent of all published human genetics and genomics research . these data are consistent with previous analyses conducted in the 2000 s for general human genetics research and specifically for cancer . it is not clear what percentage of all genomic research should be distributed across t2 , t3 , and t4 , as genomic medicine is still a rapidly moving discovery field . as the field matures we expect an increasing proportion of research and publications to be conducted in later phases of translation . it is interesting to note that , even in the rapidly developing field of genomic medicine , 38 articles describing guidelines , policies and recommendations were published in a single year ( appendix ) . these articles covered a wide range of topics including newborn screening , prenatal testing , pharmacogenomics , cancer and other fields . surveillance efforts such as the one presented here will become even more important in the near future , as additional guidelines and recommendations are developed for new genomic applications . the cdc office of public health genomics ( ophg ) continues to track new or emerging health applications of genomic research through the gappfinder , , which is an integral part of an online genomic applications in practice and prevention knowledge base ( gappkb ) . as part of gappkb , we classify genomic applications according to the maturity of evidence and readiness for use into routine clinical practice ( according to a three tier classification system ) . these efforts , along with the newly launched nih genetic testing registry will help capture , over time , a more complete picture of the existing evidence on validity and utility of emerging genomic applications and the body of t2t4 research that supports their use in practice . this evolving body of information will inform researchers , practitioners , patients , as well as policy makers . in summary , continued horizon scanning helps identify and monitor translational research that addresses the evaluation , implementation , and health impact of genomic applications . an especially important area is cancer prevention and treatment , where some of this research funded by the national cancer institute is already in progress . we also expect that recent funding by the national human genome research institute for pilot demonstration projects will increase the amount of information available for informed decision making on implementation and impact of genomic medicine . other stakeholders and organizations , private and public are likely to benefit from increasing emphasis on translational research over . the importance of translational research in genomic medicine beyond the bedside can not be overemphasized . relevant research questions in this area need to be asked and subsequently responded to with appropriate funding .

the dizzying pace of genomic discoveries is leading to an increasing number of clinical applications . however , very little translational research is ongoing beyond bench to bedside to assess validity , utility , implementation and outcomes of such applications . here we report cross sectional results of ongoing horizon scanning of translational genomic research conducted between may 16 , 2012 and may 15 , 2013 . based on a weekly , systematic query of pubmed , we created a curated set of 505 beyond bench - to - bedside research publications , including 312 original research articles , 123 systematic and other reviews , 38 clinical guidelines , policies and recommendations , and 32 papers describing tools , decision support and educational materials . most papers ( 62% ) addressed a specific genomic test or other health application ; almost half of these ( n=180 ) were related to cancer . we estimate that these publications account for 0.5% of reported human genomics and genetics research during the same time . these data provide baseline information to track the evolving knowledge base and gaps in genomic medicine . continuous horizon scanning is crucial for an evidence - based translation of genomic discoveries into improved health care and disease prevention .

traumatic diaphragmatic rupture ( tdr ) is known to occur as a consequence of blunt trauma in an rta . tdr often go undetected in the acute phase , especially when it occurs on the right side , due to the management of other life threatening injuries . we are reporting a case of diaphragmatic rupture on right side precipitated by insertion of ictd . we believe this to be the first case report of its kind in the medical literature . a victim of road traffic accident was admitted to the emergency department as a case of suspected head injury with multiple bodily injuries in conscious but irritable state . at the time of admission his general parameters recorded were ; blood pressure ( bp ) ; 130/70 mmhg , pulse ; 78 per minute and regular , respiratory rate ( rr ) ; 12 per minute and regular , and pupils ; semi - dilated , equal and reacting to light . there were no signs of respiratory distress , hemodynamic instability or gi discomfort . on examination , the respiratory system examination revealed that chest movements were reduced on the right lower chest with reduced air entry and bilateral occasional rhonchi . routine laboratory blood tests were within the normal range except , marginally raised serum glutamic oxaloacetic transaminase(sgot ) and serum glutamic pyruvic transaminase ( sgpt ) . the initial chest x - ray pa view [ figure 1 ] showed a homogeneous opacity in right lower chest and the right diaphragm was not clearly delineated . ultrasonography ( usg ) revealed fluid in the right pleural cavity and no abnormal finding in the liver or other viscera and abdominal cavity . routine follow - up x - ray chest on the next day of ictd , showed well - circumscribed soft tissue opacity with a clear - cut circular margin across the midline chest extending high up in right thorax [ figure 2 ] . computerized tomogram of thorax ( ct thorax ) in axial view revealed high raised right diaphragm . coronal reconstitution revealed a mid and posterior laceration of the right dome of the diaphragm with herniation of the liver , gallbladder , omentum and a segment of hepatic flexure in the right thoracic cavity with the mild superior migration of the right kidney . the ictd was seen passing by the side of right lobe of herniated liver , reaching high in the right thoracic cavity and capsular laceration of posterior segment of right lobe of liver but no hemoperitoneum . a contrast study revealed thickened and enhancing anterior end of ruptured diaphragm and ruptured posterior leaf falling posteriorly . the patient had an uneventful recovery and discharged from the surgery department after about 3 weeks of hospital stay . chest x - ray pa view ; on the day of admission , showing homogeneous opacity right mid and lower chest chest x - ray pa view ; post - icd day-1 , showing icd in situ with soft tissue density with concave margins left side in para - cardiac region extending from the abdomen into thoracic cavity traumatic diaphragmatic rupture is an uncommon , difficult to diagnose and potentially a life - threatening injury . right - sided ruptures are rare due to the protective effect of the liver or the strength of the right dome of the diaphragm . mostly tdr presents with non - specific and vague symptoms at the time of trauma either alone or in association with symptoms related to other organ injuries . the diagnosis may be missed in the acute phase in about 30% of the cases due to management of associated serious injuries . blunt thoraco - abdominal trauma leads to an abrupt rise in intra - abdominal pressure , resulting in stretching and rupture of the diaphragmatic muscles . sirbu et al . has observed the ruptured diaphragmatic muscles may continue to provide a barrier across the two cavities until necrosis develop in devitalized muscles through which herniation of abdominal viscera occur and the symptoms are produced when obstruction occur in the incarcerated viscera . thoracostomy and ictd insertion has never before reported to precipitate diaphragmatic rupture and hernia . in the present case diaphragmatic rupture and hernia developed immediately after the ictd insertion without giving time for the necrosis to develop in the injured muscles . the rupture was suspected during a routine , day - one follow - up in x - ray , while the patient had absolutely no symptoms . we hypothesize that the collected blood in the pleural cavity maintained near normal trans - diaphragmatic pressure gradient that kept the continuity of the traumatized diaphragm . abrupt restoration of or even creation of further negative intrapleural pressure following the ictd insertion resulted in precipitation of dr and hernia . meyers and mccabe ( 1993 ) were also of the opinion that the negative intrapleural pressure can be made more negative by thoracostomy tube suction . taheri and stern ( 2012 ) has suggested that abrupt alteration in trans - diaphragmatic pressure gradient can transform an asymptomatic rupture into a symptomatic hernia . coronal transformation of ct thorax , showing anterior part of ruptured leaf of the diaphragm with ictd in situ , right lobe of liver , omentum , gall bladder , a segment of hepatic flexure herniating into the thoracic cavity through the vent in the diaphragm with capsular breach of the posterior part of the right lobe of liver , and collapsed lower lobe of the right lung we presume that , had the ictd not been attempted , the injured muscle might have continued to maintain normal trans - diaphragmatic pressure gradients and a barrier across the two cavities . this also explains why only a some cases of tdr develop hernia while others escape , as observed by kozac et al . to the best of our knowledge this mechanism of development of diaphragmatic rupture and hernia has never been reported in medical literature . we believe this to be the first case of asymptomatic progression to diaphragmatic rupture precipitated by ictd , in the world medical literature .

blunt thoraco - abdominal trauma in collision injuries in road traffic accident ( rta ) occasionally results in diaphragmatic injury and rupture besides other serious multisystem injuries . these diaphragmatic injuries ( di ) frequently go undetected specially when occur on the right side . di associated with hemothorax need insertion of intercostal tube drainage ( ictd ) . ictd has never been reported to precipitate diaphragmatic rupture and hernia . we are reporting such a rare case for the first time in medical literature .

lung cancer is one of the most frequent and commonly diagnosed cancers worldwide , with a high mortality rate . the most common sites for distant metastases of lung cancer are adrenal glands , liver , brain , and bone . we present a case of a 75-year - old nonsmoker male who presented with an ischioanal mass . the biopsy showed adenocarcinoma without any colorectal mucosal lesion , which prompted a positron emission tomography ( pet ) computed tomography ( ct ) scan evaluation , leading to the diagnosis of stage 4 lung cancer with metastasis to the ischioanal fossa and adrenal glands . a 75-year - old male , nonsmoker , diabetic , hypertensive , postcoronary bypass was referred to our hospital with complaints of burning sensation in perianal area with a mass - like sensation causing hindrance to sit . there was no history of constipation , bleeding per - rectum , pain or mass per - abdomen or weight loss . on examination , . per - rectum revealed a growth on the left lateral part around the anal region , no growth felt in the rectal mucosa , and the upper extent of the tumor could not be delineated . contrast - enhanced ct of the abdomen and pelvis done outside showed a 3.7 cm 4.2 cm 2.8 cm mass in the perianal region , medially extending up to the external sphincter close to the anal verge . the patient had undergone a biopsy from the mass outside , which was suggestive of moderately differentiated adenocarcinoma . no immunochemical ( ihc ) evaluation was done . with a suspicion of a skip lesion from a higher growth , we performed a sigmoido - colonoscopy which showed a hard mass on the left side of perianal region with no clear growth arising from the rectal or anal mucosa . carcinoembryonic antigen was 205.7 ng / ml . in view of unusual site of adenocarcinoma in the perianal region , a pet / ct scan was done which revealed a 2.6 cm 2.3 cm mass in the right lower lobe of lung with hilar and axillary lymphadenopathy , bilateral lung nodules with a small adrenal nodule along with a 4.8 cm 3.5 cm mass in the left ischioanal fossa [ figures 1 and 2 ] . we finally concluded that the patient has stage 4 adenocarcinoma lung with metastases to ischioanal fossa , bilateral lung , and adrenal gland . epidermal growth factor receptor ( egfr ) and anaplastic lymphoma kinase ( alk ) mutation analyses were negative . after two cycles of pemetrexed - carboplatin , the patient did not have any benefit . hence , subsequently , his chemotherapy was changed to paclitaxel - carboplatin and after the first cycle itself the mass began to shrink . positron emission tomography computed tomography showing fluorodeoxyglucose avid lesion in the ischioanal fossa positron emission tomography computed tomography showing fluorodeoxyglucose avid lung primary here , we present a case of lung adenocarcinoma with a rare presentation of an ischioanal mass in a nonsmoker which was diagnosed on pet / ct . some rare sites of metastasis published in the literature are subcutaneous nodules , thyroid gland , intracranial tumor - meningioma , and multiple cavitary lesions in a patient with wild - type egfr . angiomyxoma is a rare neoplasm which can also present with a well - defined lobulated mass in the ischiorectal fossa as in our case . lung cancer is generally believed to be smoker 's disease as compared to nonsmoker 's which many at times leads to delayed diagnosis in nonsmokers . in our patient , detailed imaging excluded primary origin in the abdominal cavity as well as from epithelial lining of the rectal and anal mucosa . the histopathology report suggested moderately differentiated adenocarcinoma which led to the suspicion of skip lesion , and later on , pet scan was done which showed the origin in the lung with metastasis to adrenal too . it is essential to distinguish pulmonary adenocarcinoma with intestinal differentiation from metastatic colorectal carcinoma because of critical differences in therapeutic strategies and prognosis , which can be done by ihc and egfr analysis . egfr mutations seem to influence the site of metastasis with a positive egfr status favoring pleural metastasis in pulmonary adenocarcinoma . since egfr and akl mutation were found to be negative in our case , the treatment was started on pemetrexed ( folate antagonist)-carboplatin chemotherapy and later on shifted to paclitaxel - carboplatin therapy which showed more effectiveness in suppressing the mass . overall , this case emphasizes that consideration should be given to wide range of diagnosis in atypical cases of anorectal masses . there are no similar reported cases of primary lung adenocarcinoma presenting as ischioanal fossa mass and this case represents a challenge in both diagnosis and long - term management . there are no case reports of lung cancer presenting as an ischioanal fossa mass as the initial presentation . this case report emphasizes the varied forms of lung cancer presentation which is a diagnostic challenge , especially in nonsmokers .

lung cancer metastasis commonly involves the adrenal glands , liver , bone , and brain . however , it can have some rarer forms of metastatic presentation making diagnosis difficult , especially in nonsmokers . we describe a rare case of lung cancer with metastasis to the ischioanal fossa . overall , this case emphasizes that consideration should be given to wide range of diagnosis in atypical cases of anorectal masses . lung cancer presenting as an ischioanal mass is not reported so far .

echinococcosis in an important parasitic infection that is still a common health problem in undeveloped and developing countries ( 1 ) . the right atrium , right ventricle , and liver have been reported as embolic origins of such cysts ( 4 ) . here , we present a case of embolism of a hydatid cyst inside the left main pulmonary artery . the cyst was in the upper segmental branch of the lingular artery , and segmental and sub segmental branches of the lower lobe artery . however , no hydatid cysts were found in other organs . this case is interesting because there are only a few cases in which isolated pulmonary artery hydatid cyst without other organ involvement has been reported in the literature . we believe that this case is the first example of pulmonary artery hydatid cyst diagnosed by ebus . she had no complaints of sputum , chest pain , or dyspnea , but she had a suspicious history of hemoptysis she had a dog in her childhood and she also lived in the rural area . no abnormal signs were observed on her chest radiograph . pulmonary function tests and laboratory test results were within normal limits except for eosinophilia and minimally elevated d - dimer in the blood test . d - dimer level of the patient was 600 ng / ml , while normal limits are 0 - 500 . a negative d - dimer result may exclude pulmonary embolism , but there are many reasons that cause d - dimer elevation such as infection , trauma , deep venous thrombosis , and disseminated intravascular coagulation . in this case , the reason of elevated d - dimer was parasitic infection . the patient was treated with 250-mg fluticasone dry powder twice daily in an inhaler and montelukast once daily under a suspicious diagnosis of allergic asthma ; she asked for a control examination 2 weeks later . at the control examination thoracic computed tomography ( ct ) was performed to investigate the etiology of cough and her minimally elevated d - dimer level . filling defects were observed inside the left main pulmonary artery , upper segmental branch of the lingular artery , and segmental and subsegmental branches of the lower lobe artery on her thoracic ct angiogram ( figure 1 a - d ) . this finding at the main and superior branch of the lingular artery showed continuity with an 18 16 mm nodular opacity considered likely to be a cystic embolism . the right pulmonary artery and its branches were clear . subcutaneous low - molecular - weight heparin anticoagulant therapy was administered on the basis of the suspicious diagnosis of pulmonary thromboembolism . left and right ventricular parameters on echocardiographic evaluation were normal . no intracardiac thrombi , or any thrombosis in the deep veins of the lower extremities were observed . clinical and radiological findings were not completely compatible with thromboemboli . because pulmonary artery filling defects appeared more well - circumscribed and smooth , and they showed continuity with an 1816 mm nodular cystic opacity different from usual features of emboli , the other reasons such as pulmonary artery sarcoma and hydatid cyst causing filling defects in the pulmonary artery on ct were investigated . so for assessment of the other differential diagnoses , the patient underwent endobronchial ultrasound ( olympus evisexera ii cv180 ) . an anechoic cystic area was visualized inside the left pulmonary artery ( figure 2 ) . we performed endobronchial doppler ultrasound to investigate whether it was a cystic lesion that was causing the filling defects inside the pulmonary artery . doppler ultrasonography revealed a cystic formation that made the vascular filling defect inside the left pulmonary artery . thoracic magnetic resonance angiography was performed to investigate the cyst in more detail and it revealed cystic formations in the left pulmonary artery ( figure 3 a - d ) . the lesions were hyperintense both on t1-w and t2-w mri images that showed the liquid within the cyst was rich of protein . on mri examination , either distal branches of the pulmonary artery were not filled with contrast and showed cystic lesions in them . the nature was the same in the lesions on the proximal branches of the pulmonary artery . indirect hemagglutination and specific ige tests were performed to confirm the diagnosis of hydatid cyst ; both results were positive . the patient was scanned for frequent locations of organ involvement of hydatid cysts , but no other cysts were observed . the diagnosis of pulmonary artery hydatid cyst was decided by the patient s history of living in an endemic area , thoracic ct , mri and ebus findings and also positive serology tests . the size of the cyst in the left pulmonary artery on control thoracic ct scans shrunk 7.9 mm in diameter after one year of albendazole treatment ( figure 4 a and b ) . the liver ( 70% ) and lungs ( 25% ) are the organs most often affected . although cardiac involvement is observed in only 0.2 - 3% of cases , early diagnosis and treatment are important ( 5 ) . in primary cardiac hydatidosis , larvae usually reach the myocardium via the coronary circulation , the pulmonary circulation , or a patent foramen ovale . intestinal lymphatic vessels , thoracic duct , superior and inferior vena cava , and hemorrhoidal and pulmonary veins may be involved ( 6 ) . a variety of cardiac sequelae including sudden cardiac death , massive pulmonary embolism , and pulmonary hypertension may be encountered clinically . echocardiography , ct , and magnetic resonance imaging ( mri ) can be used to identify cardiac hydatidosis ( 7 ) . hydatid cysts located in the pulmonary arteries are frequently the consequence of embolisms from primary cardiac locations ( 8) . in the present case , a hydatid cyst was located inside the left pulmonary artery and its branches , without any cyst in the heart or other organs . intra - arterial hydatid cysts grow slowly into the lumen , ultimately occluding it . in the pulmonary arteries , this process may occur over a long period . because pulmonary arteries have adequate pulmonary perfusion through the bronchial arteries symptoms can be observed when the cysts compress a vital structure or interrupt blood circulation , which may also lead to anaphylactic shock ( 9 ) . , the cough might be the result of compression of the left lower bronchus by the cyst . hydatid cysts usually have a characteristic appearance on mri ; an oval lesion hypo intense and hyper intense on t1-and t2-weighted images , respectively . in this case , the lesions were hyper intense both on t1-w and t2-w mri images that shows the liquid within the cyst was rich of protein ( 10 ) . in the differential diagnosis of pulmonary artery hydatid cyst , pulmonary thromboembolism ( fat , amniotic fluid , septic emboli , particulate material ) and primary arterial tumors such as sarcoma should be considered since they also make intraluminal defects ( 11 ) . radiological findings and the patients clinical features help to make the differential diagnosis since patients with disseminated pulmonary artery thrombosis show a more aggressive clinical manifestation . hydatid disease may involve the heart , including the left ventricle ( 60% ) , right ventricle ( 10% ) , pericardium ( 7% ) , pulmonary artery ( 6% ) , and interventricular septum ( 4% ) ( 12 ) . because of the significant risk of cyst rupture and anaphylactic shock , surgery should be performed promptly after diagnosis . echocardiography , spiral ct , mri , ct angiography , magnetic resonance imaging angiography , and conventional pulmonary angiography can be used for the diagnostic investigation of patients suspected of hydatid pulmonary embolism . if there is no history of hydatid disease , its existence can be suspected based on the presence of anti - echinococcal antibodies and eosinophilia in blood tests ( 14 ) . the present case had eosinophilia and positive indirect hem agglutination and specific ige test results . imaging methods are sometimes limited by the small size of the lesion and the atypical images that are difficult to distinguish from abscesses or neoplasms . routine laboratory diagnosis of hydatid cysts depends on detection of specific antibody response . according to who manual for hydatid cysts , ct findings alone allow a correct diagnosis of 61% hydatid cysts of the liver , lung , kidney , spleen and some other sites and the correct diagnosis rate is 94% if ct is combined with serology ( 15 ) . according to a comma , the sensitivity and specificity of iha was 100% and 83.3 - 99% , respectively ( 16 ) . however , it should be kept in mind that embolectomy of the hydatid cyst from the main pulmonary truncus increases morbidity and mortality ( 16 ) . symptoms are usually absent or nonspecific and include chest pain , dyspnea on exercise , and fever . eosinophilia occurs in 20% of the cases and may be associated with recent rupture ( 18 ) . hydatid cysts can be solitary or multiple and vary in size ( 16 ) . in the present case , a cystic filling defect was found inside the main pulmonary artery and a solid defect was found inside the left lower intermediate artery . rupture into the cardiac chambers occurs most often in the right ventricle and can cause anaphylaxis , or pulmonary or systemic embolism of the daughter cysts ( 19 ) . repeated pulmonary emboli may produce pulmonary arterial hypertension and multiple lung cysts ( 20 ) . in the present case , left ventricular systolic function , the right atrium , and the systolic pulmonary artery pressure were normal and no intracardiac thrombus was found . ebus is increasingly used for lung cancer staging and the assessment of sarcoidosis ( 21 ) . it is useful for producing real - time images of both lymph nodes and pulmonary arteries ( 22 ) . after one year of treatment with albendazole , in the follow - up thoracic ct scan , there was a decrease in the size of the cystic lesion in the left pulmonary artery . as a result , albendazole treatment can be an alternative therapy for surgery especially for patients who reject operation .

hydatid cyst ( hc ) is a parasitic disease that may involve many organs , especially the lung and the liver . pulmonary artery location of the hydatid cyst is extremely rare , but it may cause life - threatening complications . we report a case of a hydatid cyst that completely filled the left main pulmonary artery and its distal part without cardiac involvement . thoracic computed tomography showed filling defects in the pulmonary arteries . endobronchial ultrasound was performed for differential diagnosis and it showed a cystic lesion . hydatid cyst - specific ige and hem agglutination test results were positive . in the literature , cases like this in which the diagnosis of pulmonary hydatid cyst is made by endobronchial ultrasound are not usually seen . although many imaging modalities such as plain chest radiography , cross - sectional imaging ( mdct and mri ) , echocardiography and conventional pulmonary angiography have been used in the diagnostic approach , we recommend endobronchial ultrasound for the differential diagnosis of cases with cystic formation .

alkaptonuria ( aku ) is an autosomal recessive disorder of the tyrosine degradation pathway with deficient activity of homogentisate1,2-dioxygenase leading to accumulation of homogentisic acid ( hga ) . it is characterized by oxidized hga - forming pigmented benzoquinone polymers similar to melanin , which deposit in connective tissue giving the classical discoloration of ear cartilage and sclera . a progressive ochronotic arthritis results and involvement of cardiac valves and coronary calcification efficient renal clearance of hga by both glomerular filtration and tubular secretion exposes the renal parenchyma and collecting system to high concentrations of hga predisposing to nephrolithiasis . high levels of urinary hga are diagnostic of aku and explain the typical discoloration seen on urinary alkalization . haematological complications of aku are rare but can be dramatic with case reports of fatal haemolytic anaemia associated with renal impairment . a 63-year - old man presented to his local hospital with severe urosepsis and acute kidney injury . he had been diagnosed with aku at the age of 40 on the basis of elevated urinary hga , after 10 years of unexplained back pain , short stature and loss of height . he embarked on an extensive orthopaedic career with multiple joint replacements and tendon surgery , subsequently developing hypertension and progressive chronic kidney disease with a baseline creatinine of 190 mol / l . he had undergone elective shoulder resurfacing and radial head excision 2 weeks earlier , when his creatinine had risen to 299 mol / l . he was admitted with fever , renal angle pain and a progression in the acute kidney injury with a creatinine of 727 mol / l , urea 33.9 mmol / l . additional investigations revealed a crp of 163 mg / l , significant anaemia ( hb 74 g / l ) , leucocytosis ( wcc 14.6 10/l ) and a serum bicarbonate of 13 nephrotoxic medication was suspended and anticipating the possible need for haemodialysis he was transferred to the regional renal unit and transfused 2 units of packed red cells . computer tomography of the kidneys , ureters and bladder revealed a left hydronephrosis with an obstructing calculus at the vesicoureteric junction and a further calculus within the kidney . tamsulosin was added to aid calculus expulsion and after 24 h , creatinine had fallen rapidly to 286 mol / l . no positive microbiology was identified on blood or urine cultures however during the subsequent 6 days of antibiotics this recovery of renal function continued with creatinine falling to 113 mmol / l and there was a constant metabolic acidosis despite bicarbonate therapy with an anion gap of 20 mmol / l and a normal lactate . the anaemia was normochromic , normocytic with normal b12 , folate , ferritin and no gi bleeding evident . table 1.laboratory profile during the initial and final 48 hadmissionday 1day 7day 8 ( periarrest)hb g / l ( 140180)74726955hct l / l ( 0.420.54)0.210.220.190.13mcv fl ( 8398)86889193retics 10/l ( 2585)646.1307.6ferritin g / l ( 20300)773.8b12 ng / l ( 200700)216folate g / l ( 320)4.9haptoglobin g / l ( 0.22.0)0.0o2 hb % ( 9599)78.8cohb % ( 0.52.5)2.4hhb % ( 1.05.0)1.9methb % ( 0.41.5)16.825.1ph ( 7.357.34)7.3547.322pco2 kpa ( 4.676.00)2.332.25po2 kpa ( 10.6713.33)[fio2]12.79[4 l nasal cannula]12.00[15 l rebreathe mask]lactate ( 0.42.2)1.22.2gluc ( 3.36.1)8.7base excess mmol / l14.516.3hco3-mmol / l ( 2230)131216anion gap mmol / l2223na mmol / l ( 133146)134139144k mmol / l ( 3.55.3)4.14.44.3cl mmol / l ( 95108)105105ur mmol / l ( 2.57.8)33.934.638cr mol / l ( 50120)727286113bili umol / l ( 020)1497alt /l ( 855)212224ldh /l ( 10250)2632152aca mmol / l ( 2.22.6)1.771.602.02mag mmol / l ( 0.71.0)(0.28 day 5)0.73crp mg / l ( 04)16316684 fig . 1.typical features of ochronosis with pigmentation of the pinnae and sclera ; previous achilles tendon surgery . laboratory profile during the initial and final 48 h typical features of ochronosis with pigmentation of the pinnae and sclera ; previous achilles tendon surgery . at day peripheral pulse oximetry dropped rapidly to 7080% on room air with only minor symptoms ; the arterial po2 on nasal cannula oxygen was 14.7 kpa . the discrepancy between spo2 and arterial po2 raised the question of haemoglobinopathy and fractional hb measurement confirmed significant methaemoglobinaemia of 16.8% . peripheral blood film appearances were consistent with acute , severe oxidative haemolysis with blister cells , ghost / hemi - ghost cells , polychromasia and nucleated red cells . fresh separated serum samples were noted to be highly pigmented ( figure 3 ) . intravenous n - acetylcysteine and oral ascorbic acid were commenced and tazobactam / piperacillin discontinued . despite this , the patient deteriorated rapidly with a bradycardia leading to a pulseless electrical activity circulatory arrest not rescued by prolonged resuscitation . an arterial blood gas immediately prior to cardiorespiratory arrest revealed a worsening of the methaemoglobinaemia to 25.1% , further drop in hb to 44 g / l and persistence of a normal lactate , high anion gap acidosis . fig . 2.blood film consistent with oxidative haemolysis . blood film consistent with oxidative haemolysis . at autopsy , a uniform grey discoloration of the skin was noted . there was widespread ochronosis of cartilage , connective tissues and aortic atheromatous plaques ( coronary arteries with mild plaque disease ) . there was also evidence of ochronosis of the renal parenchyma and pigmented calculi were found in the left kidney , bladder and prostatic parenchyma . aku is well recognized as a condition with significant morbidity related to a progressive spondylo - arthropathy and although cardiac involvement can pose significant risks , the lifespan is not generally thought to be significantly reduced . one previously published case describes fatal haemolysis complicating acute kidney injury in aku ; the addition of methaemoglobinaemia makes this case even more unusual , joining a handful of reports including a recently published case from japan . the cascade of events despite recovery of excretory renal function is a novel aspect of the case . there is little doubt that aku predisposes to renal calculi , usually in later stages of the disease , however tubular and interstitial fibrosis and tubular atrophy have been reported along with ochronotic pigment deposition in the renal parenchyma . the acute kidney injury in this case was almost certainly triggered by the obstructing left ureteric calculus leading to a transient hydronephrosis and urinary sepsis ; however , ochronotic changes were seen within the renal parenchyma at autopsy and an interstitial component to the chronic kidney disease is possible . hga excretion is exclusively renal by both glomerular filtration and tubular secretion and it is postulated that reduced hga clearance led to an acute rise in hga . quantification of plasma hga was not locally available , but the normal lactate , high anion gap acidosis without ketonaemia points to hga accumulation as the likeliest explanation . acute tubular necrosis with retarded recovery of tubular function affecting tubular secretion of hga could explain this and would correlate with the hypomagnesaemia and hypocalcaemia . there is in vitro evidence that hga undergoing oxidation to form benzoquinone polymers acts as a trigger for haemolysis and that the oxidative process can be reversed by adding antioxidants such as ascorbic acid and glutathione . other causes of haemolysis were considered in this case and although the tazobactam / piperacillin was discontinued , there was no evidence of an immune - mediated haemolytic process typical of the igg complex mechanism , which might have implicated this drug . the unusual aspect of this case involves the co - existent complication of methaemoglobinaemia , formed by oxidation of the fe moiety of haemoglobin to fe thereby relinquishing all haem oxygen - carrying capability . a gradual increase in skin discoloration due to hga accumulation was dramatically augmented at day 7 , very likely due to the development of methaemoglobinaemia . several drug triggers have been reported as causes of methaemoglobinaemia , none of which were evident in this case , and it is possible that the oxidative stress provided by hga was responsible . g / l as a result of the haemolytic process , ultimately there was a failure of tissue oxygen delivery leading inexorably to death . in stable aku , antioxidant therapy with ascorbic acid and dietary protein restriction to limit tyrosine and phenylalanine intake have been previously described , however neither strategy has been proven to alter the hga profile or clinical outcome [ 11 , 12 ] . in acute haemolytic crises associated with aku , n - acetyl cysteine , ascorbic acid and continuous venovenous haemofiltration have not been shown to arrest haemolysis . it is not known whether renal replacement therapy of any modality would effectively remove hga or arrest the oxidative process . specific treatment for methaemoglobinaemia including exchange transfusion is recommended when the affected fraction of hb reaches 20% ; however , this guidance is difficult to interpret in the context of a falling hb with ongoing haemolysis where a lower percentage of methaemoglobinaemia is likely to have a more profound effect . methylene blue has been used without obvious benefit ; its pro - oxidant capacity may exacerbate haemolysis in this setting and nephrotoxicity is an additional concern . nitisonone is a reversible inhibitor of 4-hydroxyphenylpyruvate dioxygenase and rapidly reduces serum hga [ 11 , 13 , 14 ] . nitisinone has previously been used in hereditary tyrosinaemia type 1 and in a recently published randomized trial in aku it decreased serum hga levels to below detection in 60% of cases and by 95% over a 3-year period . nitisonone has not been used in the context of a haematological crisis induced by hga toxicity in aku and was not available for our patient , but given its good tolerability and potent ability to modify the aberrant metabolic pathway , it should be considered in future cases . this case report has not been published elsewhere in whole or part including abstract form .

alkaptonuria ( aku ) is a rare inherited disorder of tyrosine metabolism , which leads to an accumulation of homogentisic acid ( hga ) and is associated with a progressive arthropathy . fatal complications are unusual and usually result from cardiac disease or progressive renal impairment ; rapidly fatal haematological complications are exceptionally rare and described in only a handful of case reports . this case involves a 63-year - old male with aku and modest chronic kidney disease who developed rapidly fatal haemolysis and methaemoglobinuria following an episode of acute kidney injury triggered by an obstructing ureteric calculus and urosepsis . the patient succumbed despite aggressive antioxidant therapy with ascorbic acid and n - acetyl cysteine . a rapid build - up of hga due to reduced renal clearance , triggering oxidative haemolysis and methaemoglobinuria is proposed as the mechanism . alternative strategies to consider when conventional antioxidants fail are discussed including the potent inhibitor of hga production , nitisonone .

this study was approved by the institutional review board of marshfield clinic and marshfield clinic research foundation . fifteen mrsa isolates were recovered from 15 patients in a correctional facility over a 13-month period ( figure 1 ) . the patients were housed in 7 of 10 units with a common recreation yard at a 1,200-inmate facility in wisconsin from may 2002 to may 2003 . infections with mrsa were rare in this facility ; the last reported case of mrsa was 16 months ago . because of increased number of sstis during this period , the wisconsin division of public health initiated an investigation to determine whether these strains were epidemiologically related . timeline of incarceration and isolation of methicillin - resistant staphylococcus aureus isolates from different patients . top panel : baseline shows months in which a particular isolate was recovered and patient was identified as infected ; y - axis shows number of patients in each clonal group per month during the outbreak period . bottom panel : horizontal line shows duration in which patients were incarcerated in relation to the outbreak period . month 0 and month numbers with and + symbols represent the respective months of incarceration before and after onset of the outbreak , respectively . all strains were typed by pulsed - field gel electrophoresis ( pfge ) and staphylococcal cassette chromosome mec ( sccmec ) and tested for virulence genes . only the first isolate of each pfge - based clonal group and 1 additional isolate from the same clone were analyzed with spa and multilocus sequence typing . all 15 patients were men ( average age 39 years ) and had sstis at various body sites ( figure 2 ) . all patients , except for inmate y08 , who entered the facility in the seventh month of the outbreak ( figure 1 ) , were incarcerated for 3 to 56 months before the outbreak . all 15 isolates were resistant to -lactams but sensitive to ciprofloxacin , gentamicin , rifampicin , tetracycline , trimethoprim - sulfamethoxazole , and vancomycin . pulsed - field gel electrophoresis ( pfge)based dendrogram of methicillin - resistant staphylococcus aureus strains isolated during the outbreak . a genetic similarity index scale is shown above the dendrogram . strain numbers , clone identification , site of infection , and demographic information are included along each pfge lane . mlst , multilocus sequence typing ; sccmec , staphylococcal cassette chromosome mec ; na , not available ; nd , not determined . pfge analysis grouped these isolates into 2 clonal groups , usa400 ( n = 7 , 47% ) and usa300 ( n = 8 , 53% ) ( figure 2 ) . the first isolate and a randomly selected second isolate of usa300 and usa400 clonal groups were determined to be sequence type ( st ) 8 and st1 , respectively . the representative usa300 strains were spa type t008 ( yhgfmbqblo ) , and usa400 strains were spa type t128 ( ujjfkbpe ) . all 15 strains in both clonal groups were type iva sccmec and positive for virulence factor panton - valentine leukocidin ( pvl ) genes ( luksf - pv ) and staphylococcal enterotoxin gene sek . isolates of usa400 were also positive for sea , sec , seh , sel , and fnba . usa300 strains were positive for fnba and fnbb . both pfge profiles ( figure 2 ) of isolates of usa400 clone were previously observed in native american communities in wisconsin throughout the 1990s ( 4 ) . however , ethnicity of the patients in the current study was not determined . however , unlike type 0014 strain , usa300 strains in this study were sensitive to tetracycline . all 8 strains in the usa300 clonal group were resistant to erythromycin but lacked inducible clindamycin resistance by the d - test ( data not shown ) , whereas only 3 ( 43% ) usa400 isolates were resistant to erythromycin and showed inducible clindamycin resistance . after the outbreak investigation , the facility instituted specific infection control measures for inmates and staff members . measures included promoting frequent hand washing and improving sanitation of laundry , linens , showers , bathrooms , and equipment in the recreation yard . inmates were educated about personal hygiene and consequences of sharing needles and other sharp objects . subsequently , the number of mrsa cases in this facility decreased substantially from 1.25 cases per month during the study period to 0.67 cases per month over the next 6 months . molecular typing data for most reported ca - mrsa outbreaks in athletes and prisoners since 2000 showed that these strains belonged to the usa300 clonal group ( 9 ) . this clone has also been reported in the general community in michigan , predominantly among young african americans with sstis ( 12 ) . recent reports also indicate that infections with usa300 strains are emerging in neonatal and pediatric groups ( 13,14 ) . therefore , this new ca - mrsa clone is not restricted to groups initially reported ( 611 ) but has reached the community at large ( 1214 ) . when and how usa300 clone became established in this wisconsin correctional facility were not clear . since interstate transfer of inmates between correctional facilities is common , we speculate that the usa300 clone might have been introduced from such a transfer . the suspected carrier of usa300 clone in this facility could be a colonized inmate ( y08 ) , who was incarcerated in the same month in which the first usa300 strain was identified . the initial case ( o15 ) of the usa300 clone was in an inmate with an infection of a new abdominal tattoo acquired in this facility . the transferred inmate ( y08 ) was eventually identified as infected with an identical strain in the eleventh month of the outbreak . we speculate that usa300 probably spread among the inmates who were in close contact and shared fomites extensively . irrespective of the mechanism of introduction , subsequent sstis reported from this facility were mainly due to the newly introduced clone . usa300 appears to have become the new dominant ca - mrsa clone in a wisconsin correctional facility , similar to what has occurred in other facilities in the united states . this clonal displacement could be due to better fitness of the usa300 clone than the usa400 clone in vulnerable groups who frequently have > 1 risk factor . tenover et al . compared genomes of several usa300 strains with usa400 and usa500 and usa100 strains ( the last 2 are of healthcare - associated lineages ) ( 15 ) . they reported that usa300 strains have several unique sequences in pathogenicity islands such as phi pvl , phi n315 , and sapin2 , in addition to genes encoding several fibronectin - binding proteins such as fnba , fnbb , and ebh . our limited virulence data for usa300 strains in this study showed that they were positive for fnaa and fnab , but lacked enterotoxin genes sea , sec , she , and sel , some of which are frequently present in the usa400 strains . genome sequence data from multidrug - resistant usa300 strain fpr3757 showed that it has a novel mobile genetic element that contains genes for enzymes of the arginine deiminase pathway and an oligopeptide permease system ( 16 ) . it is speculated that the arginine catabolic mobile element , which is common in s. epidermidis but not in s. aureus , probably offers a selective advantage and contributes toward enhanced growth and survival of usa300 on human skin ( 16 ) . although risk factors such as close contact , crowded environment , contaminated fomites , lack of cleanliness , and most importantly , compromised skin barriers are crucial in transmitting ca - mrsa related infections , the role of unknown genomic fitness or virulence factors of usa300 strains can not be underestimated in its recent spread . whether certain conditions besides those mentioned also favor establishment of one clone of ca - mrsa over another in the community settings is also not clear ( 17 ) . sharing of tattoo paraphernalia may be associated with the outbreak and could be considered a possible risk factor for spread of ca - mrsa .

a retrospective investigation of skin and soft tissue infections caused by community - associated methicillin - resistant staphylococcus aureus ( mrsa ) strains among inmates in a wisconsin correctional facility suggested a shift in mrsa genotype . case timeline indicated a displacement of usa400 clone by usa300 clone . the usa300 index case was associated with an infected new tattoo .

photosensitivity is encountered in 5% of patients with epilepsy , with increased prevalence in association with genetic generalized epilepsies ( gges ) . as patients with genetic generalized epilepsies ( gges ) are not typically evaluated for epilepsy surgery , generalized photoparoxysmal ( ppr ) or photoconvulsive ( pcr ) responses have not been recorded with intracranial electroencephalography ( ic - eeg ) . however , photoepileptic responses were reported in two patients with medically refractory localization - related epilepsy undergoing ic - eeg monitoring for resective surgery , . in these cases , intermittent light stimulation ( ils ) triggered habitual complex partial seizures but not generalized photoepileptic responses . while magnetoencephalography ( meg ) and functional mri studies of photosensitivity in gges provide insight into the networks underlying generalized pprs and pcrs , the mechanisms are still largely unknown , , . an 18-year - old right - handed young man with medically refractory localization - related epilepsy since age 3 years old was evaluated for epilepsy surgery at the south texas comprehensive epilepsy center in san antonio , texas . the patient provided consent for this presentation of his clinical history , mri , and video - eeg findings . he had focal left - sided myoclonic seizures , focal seizures with left - sided or bilateral tonic activity , and associated loss of awareness , as well as secondary generalized tonic clonic seizures ( gtcss ) following left head version , often triggered by decreased sleep and excessive fatigue . his brain mri showed right inferior frontal gyrus cortical dysplasia abutting the motor cortex . on scalp video - eeg monitoring , habitual partial seizures as well as focal and generalized interictal epileptic discharges ( ieds ) were recorded . intracranial electrodes were implanted to confirm the right frontal onset of his spontaneous clinical seizures and map the motor cortex . subdural electrodes over parietal and occipital regions were implanted in order to study the relationship of the epileptogenic dysplastic cortex and the suspected generalized photosensitivity and epilepsy phenotypes . his ic - eeg evaluation ( nihon kohden , japan ; sampling rate : 500 hz , 1- to 70-hz frequency bandpass ) included both subdural grid and strip electrodes ( pmt , minnesota , usa ; 8 8 grid with closely spaced electrodes 2 mm in diameter , 5-mm spacing ; all other electrodes were 3 mm in diameter , 10-mm spacing ) implanted through a right craniotomy . an 8 8 contact grid ( ifg ) was placed over the right inferior perirolandic area , covering the area of cortical dysplasia , while a 5 2 contact grid ( sfg ) covered the more superior sensorimotor cortices ( fig . 1 ) . anteriorly , there were three 1 6 contact frontal strips ( sf712 , mf712 , if16 ) and a 1 6 superomedial strip ( aih16 ) , while posteriorly , there were two 1 12 strips , an occipital strip ( o112 ) and a parietal strip ( p ) , which was reduced to eight contacts ( 512 ) . medially , the o strip crossed the calcarine sulcus , and a posterior interhemispheric 1 6 contact strip ( pih16 ) traversed the supplementary motor area , reaching the posterior cingulate . an additional 1 4 contact strip ( g ) was used as a ground and reference . antiepileptic medications were rapidly tapered ( carbamazepine when video - eeg monitoring was initiated , lacosamide 24 h later ) . our patient underwent ils and hyperventilation on a daily basis , procedures that are routinely performed in order to provoke seizures . as soon as the patient exhibited generalized pcrs during ils , he was asked whether he wanted to continue with the procedure , and he invariably agreed . intermittent light stimulation provoked only generalized myoclonic seizures , never activating any of his habitual focal seizures with loss of awareness or any type of gtcss . extraoperative electrocortical stimulation activated face motor cortex rostral to the epileptogenic zone on ifg and hand and arm motor cortices at sfg5 and 7 , respectively . he underwent a resection of the right frontal lesion covered by ifg , and cortical dysplasia was confirmed by pathological examination . after resolution of a transient left facial paresis , he remains seizure - free at more than three years postoperatively off antiepileptic medications . intermittent light stimulation was performed at ascending and descending frequencies of 130 hz for 10 s at each frequency . he was exposed to ils 13 times during a period of nine days until he exhibited his first habitual seizure ( fig . 2 ) . photic driving responses ( pdrs ) were elicited at all frequencies at contacts o13 , never extending beyond electrodes o16 below 9 hz . at ils frequencies 930 hz , pdrs involved p57 ( medial parietal ) electrodes . photoparoxysmal responses presented as focal spikes at o7 ( lateral occipitoparietal ) at all frequencies , occurring within 200 ms of pdr onset . off aeds , p58 spikes were encountered at ils frequencies > 9 hz , often preceding o7 spikes , with secondary propagation to contacts pih12 ( posterior cingulate ) and aih2 ( medial frontal convexity ) , or in the form of generalized , frontally - predominant , spike - and - wave complexes within 200400 ms of pdr onset . similarly , pcrs recorded in 34 stimulations consisted of either a repetitive low - amplitude myoclonus , affecting the upper more than the lower extremities , and the trunk and face to a lesser extent , which lasted until the end of the stimulus ( type 1 ) , or a brief generalized myoclonic seizure affecting the face and entire body ( type 2 ) . type 1 pcr was associated with propagation of the ictal discharge to contacts p7/8 and 12 , pih12 and 56 , as well as sfg5/7/8 and 10 within 8001200 ms of pdr onset ( fig . type 2 pcr was associated with a generalized spike - and - wave discharge triggered only at ils frequencies of 1525 hz about 6001000 ms after pdr onset ( fig . the frontally predominant discharges were preceded by p57 ( medial parietal ) spiking but with lead from contacts pih12 ( posterior cingulate ) . the ictal discharge also involved contacts p10 , sfg3/4/6/8 , pih14 , and aih12 , as well as the entire sf , mf , and if strips . although the electrode distribution was distinct for each type of pcr , both types of pcrs could be observed during the same stimulus and always in the setting of a medial parietal pdr or spiking . during pcrs , the pdr was briefly visible more anteriorly , at pih12 and/or 56 , at sfg3/5/7/8 and 10 , and at aih2 , but only after onset of the myoclonus . while the right frontal cortex demonstrated continuous periodic ieds interictally , these were not altered by ils or photoepileptic responses . following one gtcs , our patient demonstrated a cluster of spontaneous generalized myoclonic seizures , and the associated ictal discharge involved the same electrodes as the type 2 pcr , with the exception of the o and p strips . our patient with medically refractory partial epilepsy due to focal cortical dysplasia demonstrated generalized and pcrs , which were recorded by ic - eeg for the first time . despite the focal cortical dysplasia underlying his refractory partial epilepsy , our patient had spontaneous generalized myoclonic seizures , as well as generalized pprs and pcrs , which were electroclinically distinct from his focal ieds and seizures . evidence of persistent generalized ieds and pprs even after successful epilepsy surgery further supports the presence of a separate gge phenotype . the coexistence of genetic generalized and symptomatic focal epilepsies has been described in the setting of ic - eeg evaluations and eeg fmri studies , . in one surgical case series , as in our patient , the generalized epilepsy phenotype persisted despite the successful treatment of the focal epilepsy . photoparoxysmal responses were characterized by activation of multifocal discharges in the parieto - occipital , posterior cingulate , and medial prefrontal cortices , demonstrating a posterior - to - anterior propagation or by a frontally predominant generalized discharge . the prominent parietal activation during pprs reflects findings of cortical synchronization in meg and fmri studies , . photoconvulsive responses were characterized by either a bilateral upper extremity myoclonus lasting throughout the stimulus associated with activation of the motor cortices ( type 1 ) or a brief generalized myoclonic seizure associated with a frontally - predominant generalized ictal discharge extensively involving the premotor cortices ( type 2 ) . regional posterior - to - anterior propagation was noted in the type 1 pcr , from the parietal lobe cortices to the motor and premotor cortices . the type 2 pcr did not demonstrate a similar corticocortical propagation ; rather , the emergence of a generalized spike - and - wave discharge suggests activation of a cortical subcortical network , albeit with a lead from the posterior cingulate region and after medial parietal spiking . both types of pcrs could occur during the same stimulus but could involve different cortical areas , suggesting activation of distinct corticocortical or cortical subcortical networks . regardless of the pathway , pcrs only occurred when pdrs involved the medial parietal cortices . furthermore , spiking during ils was first noted in occipital and parietal regions prior to the sensorimotor cortices and frontal lobes . nonetheless , it is important to point out that our observations are limited to a single case , and pprs or pcrs may be expressed differently in people with pure genetic generalized epilepsies , and particular pathways may be specific to some gge syndromes . the interpretation of our data may also be limited by temporal and spatial eeg sampling . increased eeg sampling rates and high - frequency filter settings may have helped demonstrate synchronization of gamma - frequency activity across larger cortical areas even before the appearance of photoepileptic responses . more closely spaced medial ( interhemispheric ) coverage may have yielded better spatial resolution of potential cortical generators and propagation of the ictal discharge . furthermore , thalamic sampling was not clinically indicated but may have elucidated potential cortical subcortical interactions in each type of pcr . in summary , photosensitivity appears to be associated with pdrs extending beyond the primary visual areas . the parietal lobes appear to play an important role in the generation of generalized pprs and pcrs , regardless of their electroclinical characterization . the authors declare that they have no conflicts of interest in the publication of this report .

we evaluated the spatiotemporal distribution of photic driving ( pdr ) , photoparoxysmal ( ppr ) , and photoconvulsive ( pcr ) responses recorded by intracranial electrodes ( ic - eeg ) in a patient with generalized photosensitivity and right frontal lobe cortical dysplasia . intermittent light stimulation ( ils ) was performed thirteen times in nine days . cortical responses to ils recorded by ic - eeg were reviewed and classified as pdrs , pprs , and pcrs . photic driving responses were restricted to the occipital lobe at ils frequencies below 9 hz , spreading to the parietal and central regions at > 9 hz . photoparoxysmal responses commonly presented as focal , medial occipital , and parietal interictal epileptic discharges ( ieds ) , the latter propagating to the sensorimotor cortices . generalized ieds were also generated in the setting of pprs . photoconvulsive responses , characterized by repetitive bilateral upper extremity myoclonus sustained until the end of the stimulus , were associated with propagation of the medial parieto - occipital discharge to the primary sensorimotor and supplementary area cortices , while generalized myoclonic seizures were associated with a generalized spike - and - wave discharge with an interhemispheric posterior cingulate onset sparing the sensorimotor cortices . both types of pcr could occur during the same stimulus . regardless of the pathway , pcrs only occurred when pdrs involved the parietal cortices . while there may be more than one pathway underlying pcrs , parietal lobe association cortices appear to be critical to their generation .

on july 1 , 2004 , the 4 inmates from the california state prison in riverside county were hospitalized with signs and symptoms consistent with clinical botulism , including blurry vision , dysarthria , dysphagia , shortness of breath , and generalized muscle weakness . none had a history of injection drug use and had no needle track marks or skin abscesses . serum , stool , and gastric specimens from suspected case - patients were requested and forwarded to the cdhs microbial disease laboratory ( mdl ) for testing . no sample of the reported pruno batch was available for testing , but a cup with traces of pruno , belonging to 1 of the hospitalized patients , was submitted to mdl . testing for botulinum toxin was conducted by using a mouse bioassay ( 2 ) , and bacterial culture was conducted on stool and gastric aspirate specimens and on washings from the cup . the 4 case - patients had laboratory - confirmed botulism ; botulinum toxin type a was detected in their pretreatment serum ( 3/4 ) , directly from their stool ( 1/4 ) , or from their stool culture ( 3/4 ) . cup washings were negative for botulinum toxin but culture positive for c. botulinum type a. no other botulism cases were confirmed from this prison . * from information gathered , one of the hospitalized inmates began making the pruno on june 21 using unpeeled potatoes smuggled from the kitchen , apples from lunches , one old peach , jelly , and ketchup . on june 25 , this inmate on june 27 , each of the 4 inmates drank 16 ounces or more of the pruno , which they described later to a prison nurse as being magenta in color and smelling like baby - poop . in may 2005 , dcdc was notified of clinical botulism in another inmate of another california state prison in monterey county . a 30-year - old male inmate was admitted to a local hospital with ptosis , ophthalmoplegia , dysarthria , dysphagia , and upper extremity weakness and was intubated . at first , the patient was thought to have miller - fisher variant of guillain - barr syndrome , but subsequent testing of his serum showed a positive result for botulinum toxin type a. upon further questioning , the patient admitted to making and drinking pruno in the prison ; he had used potatoes in making the pruno . pruno mash was found in his cell , and culture at mdl yielded c. botulinum that produced toxin type a. the patient required prolonged ventilatory support but eventually recovered . the homemade prison alcohol called pruno caused botulism in 5 california prison inmates in 2 separate instances . in the 2004 outbreak , all 4 inmates drank from the same batch of pruno and 3 days later had laboratory - confirmed botulism type a. the same c. botulinum type was recovered from a cup that had held that pruno . in the 2005 event , botulism was confirmed for another california inmate at another state prison ; this inmate had drunk pruno , and the same c. botulinum type a was cultured from leftover pruno mash . pruno has been described on the internet as an alcoholic beverage made from apples and/or oranges , fruit cocktail , ketchup , sugar , and possibly other ingredients including bread originated in ( and remains largely confined to ) prisons although alcoholic beverages on prison grounds are considered contraband in california ( title 15 , california code of regulations , section 3016 [ a ] ) , pruno appears to be popular in prisons , and recipes are available on the internet ; most recipes call for some form of fruit , hot water , ketchup , and sugar ( 3,4 ) . the ingredients are reportedly mixed in a plastic bag at different intervals and fermented with intermittent warm heating over several days . in our investigations , the potatoes used in the pruno could have been the source of botulinum toxin . c. botulinum is commonly found in the soil , and its spores have been found on raw potatoes ( 5 ) . several outbreaks of botulism caused by eating potatoes have occurred in the united states ( 68 ) , and laboratory studies have shown that c. botulinum spores on the surface of raw potatoes can survive baking and lead to production of botulinum toxin ( 5 ) . the warm anaerobic fermentation process of making pruno probably predisposes toward production of botulinum toxin , particularly if any ingredient happens to be contaminated with c. botulinum or its spores , such as the potatoes used in these 2 instances . pruno is popular in prisons across the country , and it is somewhat surprising that botulism caused by pruno consumption has not been previously reported . this lack of reporting may be due to the fact that potatoes are not generally used in the making of pruno ; recipes for making pruno and references to pruno found on the internet do not mention potatoes as an ingredient ( 3,4 ) . occasional crackdowns on making pruno in some prisons could have driven some inmates to look for alternative ingredients , including potatoes . nonetheless , with > 2 million inmates in prisons and jails in the united states , this illicit homemade alcoholic drink may put more inmates at risk for botulism . anecdotally , making pruno has been attempted outside prisons , possibly extending the potential risk for foodborne botulism carried by this novel vehicle beyond the prison walls . risk for botulism from consuming pruno should be conveyed to inmates , prison staff , the medical community , and the general public . any inmate with clinical botulism should be examined for an infected wound caused by drug injection and queried about recent drug use and drinking pruno .

foodborne botulism occurred among inmates at 2 prisons in california in 2004 and 2005 . in the first outbreak , 4 inmates were hospitalized , 2 of whom required intubation . in the second event , 1 inmate required intubation . pruno , an alcoholic drink made illicitly in prisons , was the novel vehicle for these cases .

obesity has always been thought to be a risk factor for diabetes and maximum numbers of diabetics are obese ; however , some studies in india have reported that most of the diabetics in india have normal range of body mass index and have reported a high prevalence of lean diabetics . the aim of this study was to find out the prevalence of lean type 2 diabetes mellitus ( dm ) among the recently diagnosed diabetics ( < 24 weeks ) in manipur . the aim of this study was to find out the prevalence of lean type 2 diabetes mellitus ( dm ) among the recently diagnosed diabetics ( < 24 weeks ) in manipur . all recently diagnosed type 2 dm patients within a period of 24 weeks who attended the endocrine clinic of rims from jan to dec 2012 are included in the study . a total of 181 recently diagnosed type 2 dm patients were included and we found that the prevalence of lean dm was 3.9% whose bmi < 19 kg / m of which five are females ( 5.4% of female patients ) and two are males ( 2.2% of male patients . characteristics of the patients evaluated lean type 2 dm was twice as much in females than males . there was not much difference between the lean diabetics and the non - lean diabetics as evident from table 1 when comparing the age of onset , blood sugar levels , and blood pressure . lean diabetics had no previous history of hypertension whereas 33.3% non - lean diabetics had high bp and 5 non - lean diabetics were diagnosed as hypertensive on their visit . neuropathy was the commonest presentation among the patients , 43.1% in non - lean diabetics and 28.6% among the lean diabetics . second - most common presentation was polyuria / polydipsia accounting for 36.2% in non - lean and 28.6% in lean diabetics . visual impairment was also one of the common complaints , 33.9% in non - lean and 28.6% in lean diabetics . one patient had history of stroke and one patient had history of myocardial infarction , both were non - lean diabetics . our study showed a low prevalence of lean diabetes ( 3.9% ) among the recently diagnosed diabetics which is almost at the same range as compared to a study done in south india , but lower than other studies done in other parts of the country . glucose levels were comparable between the two groups and not higher in lean diabetics as indicated in other studies .

introduction : obesity has always been thought to be a risk factor for diabetes ; however , some studies in india have reported that even lean people are prone to diabetes . we conducted this study to see if this holds true for this part of the country.objectives:to determine the prevalence of lean type 2 diabetes mellitus ( dm ) in recently diagnosed type 2 dm in manipur.materials and methods : all recently diagnosed type 2 dm patients , within a period of 24 weeks , who attended the endocrine clinic of rims from jan to dec 2012 are included in the study . exclusion criteria are patients with chronic diseases.results:out of the 181 recently diagnosed diabetics 3.9% had a bmi of < 19 kg / m2 of which five are females ( 5.4% of female patients ) and two are males ( 2.2% of male patients ) . mean age of lean diabetics is 54.86 15.32 , mean fasting glucose is 212 105.5 mg% and mean postprandial glucose is 351.57 167.79 mg% . dm complications were observed in 28.6% of the lean diabetics.conclusion:our study shows a low prevalence rate of lean dm in recently diagnosed type 2 dm .

evans , using a mouse mutant for the lim homeodomain transcription factor ( islet1 , isl1 ) , demonstrated that an isl1 positive ( isl1 + ) population is localised in the secondary heart field ( shf ) , contributing to the outflow tract , right ventricle , atria and ( to a small extent ) the left ventricle . isl1 is considered a marker of shf cells that contribute to the venous and arterial poles of the cardiac tube , while the other cells from the shf contribute only to the arterial pole . the shf or anterior heat field ( ahf ) was identified as a splanchnic mesoderm underlying the caudal pharynx , which provides myocardium to the outflow tract during tube looping . in 2005 , the same research group also identified isl1+/c - kit negative ( c - kit-)/stem cell antigen-1 negative ( sca-1- ) progenitors in the postnatal heart , demonstrating that these cells persist after birth and that these organ - specific progenitor cells may be isolated , purified , expanded and differentiated into mature cardiac myocytes for future cardiac applications . our research group identified isl1 + cells during gestation until the postnatal age , and demonstrated the contemporary expression of isl1 and c - kit in the interstitial cells in the ventricular myocardium in human foetal and postnatal hearts . this paper demonstrated , by confocal analysis , that all isl1 + cells were also c - kit+ , while c - kit+ cells were not necessarily isl1 + , as if isl1 + cells were a subpopulation of c - kit+ cells . it has been supposed that there may be a primordial cardiovascular precursor in the shf that expresses the three markers isl1 , nkx2.5 and fetal liver kinase 1 ( flk1 ) and can generate three lineages : cardiac muscle , smooth muscle and endothelium . the shf cooperates with the first heart field ( fhf ) and the cardiac neural crest cells during the development of the vertebrate heart . the fhf lineage forms the early cardiac tube and generates the left ventricle , while the shf contributes additional cells to the maturing heart and , along with the cardiac neural crest cells , generates the outflow tract vessels and valves . the presence of cardiovascular progenitor cells positive for isl1 and/or nkx2.5 in the shf has been well confirmed by a recent work published in science . the authors suggested that there are two distinct populations , one for the shf and the other for the fhf ; the first population is clearly positive for isl1 and expresses mirna 199a / b , while the second has no distinct markers and expresses mirna 200a / b . progenitor cells of the shf depend on the cardiac specific transcription factors isl1 and nkx2.5 , which play a key role at an early stage of cardiac progenitor formation . their expression is regulated by wnt / beta - catenin signalling , which in turn also regulates bmp4 signalling . this last signalling pathway activates gata4 and srf . despite the key role of isl1 , this transcription factor is not considered an indubitable marker of this subpopulation of shf progenitor cells . it has been demonstrated very recently that isl1 labels both shf precursors and some cardiac neural crest cells and that mef2c is a more efficient marker of the shf progenitor cells in labelling experiments . this paper indirectly suggests both a review of past literature in view of these new data and using a different marker in studies of the shf progenitor cells . moreover , considering heart development in different species , such as chicken , mouse and xenopus , it appears that isl1 is expressed in a common cardiac cell population that splits into fhf and shf lineages during heart development and that this common progenitor also contributes cells to the cardiovascular system . anversa s research group described rat cardiac stem cells for the first time , many research groups have claimed to have discovered new and important cardiac progenitor / stem cells in the adult heart .. since 2005 , the scientific community talked about adult c - kit+ and/or sca-1 + and/or mdr-1 + cells , and embryonic isl1 + cells . these two populations have always been considered different entities and are described separately in many research papers and reviews , although expression of the isl1 transcription factor by cardiac precursor cells has also been reported in adult hearts . di nardo , described for the first time the concomitant expression of the three markers , i.e. , c - kit , sca-1 and isl1 , in the same cardiac precursor cell . prof . di nardo s research group described the concomitant expression of the isl1 , c - kit and sca-1 markers in adult mouse cardiac progenitor cells in 2008 , while in 2009 our research group confirmed the expression of the three markers in adult rat cpcs . in a systematic work published in 2011 about the identification of isl1 + cells in the mouse heart from postnatal day 1 to young adulthood in different strains , the authors found clusters of positive cells in the cardiac ganglia of the studied strains , while found very a few clusters of isl1 + cardiac precursors only in 129svj or balb / c strains and in animals not older than 4 months . recently genead et al . demonstrated the contemporary expression of c - kit and isl1 markers in rat adult hearts in normal , pregnant and infarcted individuals . they reported the expression of both markers in the entire heart and in the right ventricle , the left ventricle , the outflow tract and the peri - infarct and peri - ischemia regions . unfortunately , the study was based on real - time pcr analysis , and whenever immunocytochemistry was shown , no double staining for both markers had been performed . other evidence supports the hypothesis that isl1 + cells are not a different population from sca-1 + cpcs . the contemporary expression of sca-1 and isl1 has been described both in a subpopulation of sca-1+/c - kit- cells identified and isolated from adult mouse hearts and in sca-1 + cardiosphere - derived cells obtained from cardiac explants from normal , sham - operated or post - myocardial infarct hearts . in this study , only sca-1+/cd45- cells were also positive for isl1 and increased in number only after an acute myocardial infarct . considering that other authors identified isl1 + cells in adult murine and rat hearts , weinberger et al . used heterozygous isl1-lacz mice , a more sensitive genetic approach , to investigate the presence and localisation of these precursor cells in 30 animals at different time points after birth ( 10 weeks to 18 months ) . they found four different populations of isl1 + cells : i ) clusters of isl1 + neurons were found in the cardiac parasympathetic ganglia of the posterior side of the heart and in the nervous plexus surrounding the pulmonary veins ; ii ) clusters of isl1 + smooth muscle cells were found in the muscular layer above the aortic and pulmonary valve in the proximal part of the aorta and the trunk of the pulmonary artery ( only a few positive cells were present in the aortic valve leaflets ) ; iii ) clusters of isl1 + cardiomyocytes were found in the left ventricular outflow tract region ; iv ) clusters of isl1 + sinoatrial node ( san ) cells were found in the muscular wall between right atrium and vena cava superior . these results support the hypothesis that in the adult heart many cell populations may derive from isl1 + embryonic precursors , as smooth muscle cells , parasympathetic neurons , san cells , but also that , even if reduced in number , isl1 + cardiomyogenic progenitors , may be present in the adult myocardium . many papers have been published on cpcs , and many research groups claimed to have discovered different populations of progenitor cells . it is strange to think that the cardiac tissue possesses a larger number of stem / progenitor cells compared to the other tissues found in our body , and it is hopeful that cpcs may vary in number with external stimuli or with age as it happens for other adult stem cells . the hypothesis that the myocardium is a non - regenerative tissue is not valid anymore , and much evidence supports the new idea that there is at least one cardiac progenitor cell . isl1 + and c - kit+/sca-1 + cells were considered to be two different populations until 2012 , when prof . sussmann , citing our recent paper published in the european journal of histochemistry in an editorial in circulation research , suggested considering the possibility of studying a population of cells positive for both isl1 and c - kit instead of choosing to study only one side of the coin . in the review and in the research paper published in 2009 , we reported the concomitant expression of isl1 , c - kit and sca-1 in a population of cpcs isolated without any sorting or selection and suggested for the first time that there could be a unique population of cells with several subpopulations and that the several markers identified could be only the effect of different cultivation conditions in the different laboratories . other research groups later described the co - expression of isl1 , sca-1 and/or c - kit and we further demonstrated that , in samples from foetal and postnatal human hearts , there was also an isl1 + subpopulation of c - kit+ cells . anversa among the authors , on a study of the presence of c - kit+ cardiac stem cells in embryonic , foetal and neonatal mouse hearts . they demonstrated that these cells can form cardiomyocytes and coronary vessels and , as we have demonstrated in our paper , they are more abundant than isl1 + cells . moreover , they stated that isl1 + cells are present only in the outflow tract , atria and part of the right ventricle and that they are a population of committed cells derived from an immature primitive cell . we can say that there is strong evidence suggesting that c - kit , sca-1 and isl1 may be markers of subpopulations of cpcs that are present in the embryonic , foetal and neonatal heart and persist from after birth until adulthood . the identification of the real immature cardiac precursor expressing the four cell markers ( c - kit , sca-1 , mdr-1 and isl1 ) and above all the identification of a unique isolation protocol is very important in the clinical practice . this immature common cardiac precursor may represent the perfect candidate for cardiac tissue engineering and , hopefully , may be driven pharmacologically to one phenotype or the other . to identify a standardised protocol is extremely important to go further in the studies on cardiac tissue regeneration , and common guidelines are needed in cardiac stem cell therapy . the isolation of stem cells by cell sorting or immunobead selection using surface markers such as c - kit , sca-1 or mdr-1 is important to identify a standardised protocol of isolation , however isl1 may be useful in basic research to follow the fate of cpcs in heart development and myocardium differentiation . moreover , it is extremely important to understand which is the predominant precursor population in the different stages of life and which population should be used in a paediatric patient instead of an adult one . if fate of immature cardiac precursors may be determined pharmacologically , the possibility to regenerate san cells is very important in curing arrhythmia s both in patients with ischemia and malformations . the identification of the different subpopulations in the developing heart may be a fundamental step in identifying the optimal cell line for cell - based therapies .

cardiac progenitor cells are multipotent stem cells isolated from both embryonic and adult hearts in several species and are able to differentiate at least into smooth muscle cells , endothelial cells and cardiomyocytes . the embryonic origin of these cells has not yet been demonstrated , but it has been suggested that these cells may derive from the first and secondary heart fields and from the neural crest . in the last decade , two different populations of cardiac progenitor or stem cells have been identified and isolated , i.e. , the islet1 positive ( isl1 + ) and c - kit positive ( c - kit+)/stem cell antigen-1 positive ( sca-1 + ) cells . until 2012 , these two populations have been considered two separate entities with different roles and a different origin , but new evidence now suggests a connection between the two populations and that the two populations may represent two subpopulations of a unique pool of cardiac stem cells , derived from a common immature primitive cell . to find a common consensus on this concept is very important in furthering the application of stem cells to cardiac tissue engineering .

a 50-year - old lady was referred for retinal evaluation to rule out aids - related retinal or ocular disorders . optic nerves appeared normal . a visual field examination using 30 - 2 program on oculus center field perimeter was performed to rule out lesions along the visual pathway , as clinical examination could not explain the visual loss or the symptoms . it showed good reliability in both eyes and a left homonymous hemianopia [ figs . 1 and 2 ] . magnetic resonance imaging ( mri ) of brain was done to determine the cause of homonymous hemianopia , such as infarct / bleed or space - occupying lesion . mri scan showed irregular white matter hyperintensity in the right occipital lobe and a hyperintense lesion in the left frontoparietal region in the subcortical and periventricular white matter [ fig . 3 ] . it also showed irregular white matter hyperintensity and a large area of increased t2-weighted and decreased t1-weighted signal in the left frontal lobe posteriorly involving the subcortical white matter and extending into the centrum semiovale and corona radiata , without enhancement or mass effect . mri showing lesions in right parieto - occipital lobe and elsewhere she was referred to a neurologist for evaluation . a cerebrospinal fluid ( csf ) tap was advised for polymerase chain reaction ( pcr ) evaluation for jc virus . pml is a progressive fatal demyelinating disorder associated with oligodendroglial infection by the human papovavirus jc . occasional cases are described in pregnancy , and some cases may have no identifiable evidence of immunosuppression . the causative agent , the jc virus , invades oligodendroglial cells , causing multiple foci of demyelination . after the primary infection , jc virus remains latent in kidneys and lymphoid organs . up to 64% of healthy adults have shedding of jc virus in urine in the absence of any clinical symptoms , suggesting that asymptomatic active jc virus infection is common in immunocompetent persons . the presenting symptoms in a case of pml are focal deficits like mental deterioration , speech disturbance , ataxia , paralysis , hemiparesis , facial weakness , memory failure , and also ophthalmic symptoms like nystagmus , homonymous hemianopia and diplopia with cranial nerve palsy in one eye and cortical blindness in the other eye . previously reported cases are different from the one we are presenting here , as our patient had come with nonspecific visual complaints and no other neurological symptoms . however , pml should also be suspected in the differential diagnosis of apparently healthy patients with focal deficits , like our patient who had no other symptoms except some visual disturbances in both eyes which she could not categorize . the purpose of presenting this case was to highlight the fact that we , as ophthalmologists , may be the first to see patients with pml and we should have a high degree of suspicion in an appropriate clinical setting . this would help us to carry out necessary tests such as visual field examination and , if necessary , an mri scan to arrive at a diagnosis of pml which is a potentially life - threatening disease but may be helped by highly active anti - retroviral therapy ( haart ) . pml should be kept in mind along with other ocular manifestations , such as cmv retinitis , which are commoner . diagnosis of pml may be difficult . because a large percentage of the population is seropositive for jc virus , csf identification of jc virus by pcr is useful and studies suggest a sensitivity of 95% and specificity of 9099% . the mri findings are characteristic in pml , with a high t2 signal and a low t1 signal which does not enhance with gadolinium and has no mass effect . pml is uniformly fatal , and the survival rate is only a few months following the diagnosis . there are recent reports of improved survival following aggressive haart in hiv , and specific jc antiviral treatment with interferon or cidofovir favor early diagnosis . hence , we should consider pml in all patients who present with progressive neurological deficits ( such as visual field defects ) which are usually , but not always multifocal . if jc virus is absent in the csf , brain biopsy should be considered .

we present a case of a human immunodeficiency virus ( hiv ) positive patient who was referred for retinal evaluation to rule out ophthalmic manifestations of acquired immunodeficiency syndrome ( aids ) . she complained of some disturbance in vision in both eyes . fundus examination showed no abnormality . perimetry , done to rule out optic nerve pathology , showed a left homonymous hemianopia . magnetic resonance imaging ( mri ) scan showed features of progressive multifocal leukoencephalopathy ( pml ) . she had no other neurological symptoms or signs .

lupus erythematosus is a chronic , autoimmune disease resulting from an interaction of genetic , environmental , and hormonal factors and characterized by a spectrum of clinical forms with a variable evaluation from a localized cutaneous form to life - threatening systemic form . specific skin lesions of cutaneous lupus erythematosus are classified as acute cutaneous lupus erythematosus , subacute cutaneous lupus erythematosus ( scle ) , and chronic cutaneous lupus erythematosus , according to the clinical characteristics of the lesions . subacute cutaneous lupus erythematosus ( scle ) may present with annular or papulosquamous cutaneous lesions that are symmetrically located in the sun - exposed areas of the body . scle shows typical serological findings , with anti - ro ( ss - a ) antibodies present in up to 100% of patients [ 3 , 4 ] . however , antinuclear antibodies ( anas ) , complement c3/c4 deficiency , rheumatoid factor , circulating immune complexes , lymphopenia , and thrombocytopenia can frequently be detected . severe neurological or nephrological involvement is rare in scle , whereas mild musculoskeletal involvement is commonly observed . it is well known that some patients suffering from cle develop extracutaneous manifestations during the course of their disease ; up to 30% of patients with scle show systemic involvement . most patients with scle can be sufficiently treated with photo protection , topical corticosteroids , antimalarials , or a combination of these . the complement system is a group of plasma and membrane proteins that are sequentially activated via proteolytic cleavages to defend against microbial infections [ 7 , 8 ] . complement contributes to inflammation and tissue damage in this disease , but seemingly in paradox , deficiency of some complement proteins dramatically increases the risk for sle . deficiency states within the classical pathway are associated with increased risk to develop sle and sle - like disease . genetically determined complement deficiencies are inborn errors and may have an impact on the development of the immune system . classical pathway deficiency has led to different hypothesis to explain roles for complement in sle pathogenesis . complement deficiency leads to impaired handling of immune complex and inadequate clearance apoptotic cell debris [ 11 , 12 ] . another hypothesis suggests that the complement system has an important role in the development of tolerance against self . also , complement deficiency results in lack of normal b - cell tolerance and provides production of autoantibodies . in addition , complement components are in some ways also important for regulation of cytokine production , especially type 1 interferons have been shown to have a central role in the pathogenesis of sle [ 14 , 15 ] . while the genetic basis for a majority of sle cases is polygenic , a homozygous deficiency in one of the early complement components alone can be strong enough to cause the disease , a situation similar to a single gene defect in an autosomal recessive disease [ 16 , 17 ] . respectively , 93% and 78% of patients with complete c1q and c4 deficiencies eventually develop sle or a lupus - like disease . genetically , the complement c4 gene located in the class iii region of the major histocompatibility complex ( mhc ) on chromosome 6p21.3 . these proteins are segregated into two classes , the acidic c4a and the basic c4b . c4a is believed to be important in the clearances of immune complexes , and c4b is more powerful in propagating the complement activation cascades . the complete absence of both c4a and c4b proteins may therefore lead to decreased ability of immune defense against microbes as well as inefficient disposal of immune complexes . to date , 28 individuals with complete c4 deficiency from 19 families have been reported [ 21 , 22 ] . among them , 15 individuals developed sle , 7 developed lupus - like diseases , and four of the remaining subjects were only inflicted by kidney diseases . in this study , we present the clinical features and determine the molecular basis responsible for the complete c4a and c4b deficiencies in a lupus patient presented with subacute cutaneous lupus erythematosus and progression systemic form and resistance to treatment . seventeen - year - old patient was a male born by parents of non consanguineous marriage . he was diagnosed with scle at the age of 15 years old and had local therapy in dermatology clinic before admitting our clinic . his temperature 38.3 , respiratory rate 38/min , pulse rate 100/min , and blood pressure was found as 90/70 mmhg . in auscultation , lungs were clear and the heart sounds were normal . his clinical presentation included severe malar rash with marked photosensitivity and bullous lesions on the tips of fingers and hands ( figure 1 ) . there was interface dermatitis with irregularity and loss of basal cells . in the papillary and upper reticular dermis was a perivascular and interstitial lymphocytic infiltrate . there was granular deposition of ig a , igm , and c3 at the dermal - epidermal junction . also he has arthritis which described swelling , tenderness , and pain on all small joints . laboratory tests showed an erythrocyte sedimentation rate ( esr ) of 100 mm / h , c - reactive protein of < 0.3 mg / dl ( normal ) , hemoglobin of 11.1 g / dl , hematocrit of 31% , white blood cell count ( wbc ) of 4900/mm with normal differential count , platelet count of 197000/mm , serum urea of 25 mg / dl , serum creatinine of 0.8 mg / dl , albumine of 3.5 g / dl , total cholesterol of 106 mg / dl , triglycerides of 57 mg / dl , calcium of 8.7 mg / dl , sodium of 140 meq / l , potasium of 4.7 meq / l , chloride of 107 meq / l , alanine aminotransferase of 23 he had positivity for antinuclear antibody ( 1/1280 ) , positivity for anti - ro / ssa antibodies and negative ds dna . prior laboratory measurements showed no detectable c4 proteins , serum c3 levels were lower ( 77 mg / dl ) and c1q inhibitor levels were normal . immunofluorescence experiments showed mesangial deposits of igg , c3 ( + + + ) , iga ( + + + ) and c1q ( + ) . after he was diagnosed as sle according to american college of rheumatology ( acr ) criteria , high - ose pulse therapy was performed with methylprednisolone ( 30 mg / kg / day for 3 days ) , followed by prednisone ( 2 mg / kg / day ) , hydroxychloroquine ( 5 mg / kg / day ) , and topical therapy . he started cyclophosphamide pulse therapy ( 500 mg / m ) because his complains were not resolved . after from second dose of cyclophosphamide ( 750 mg / m ) , he had urticarial lesions and stopped this therapy . he started mycophenolate sodium ( 720 mg / day ) . in spite of these medications , his skin lesions , he received rituximab infusions at a dose of 1 gram at days 1 and 15 . in addition , a 100-mg dose of intravenous methylprednisolone was given immediately prior to the rituximab infusion . after rituximab therapy was administered , oral low dose prednisolone ( 0,5 mg / kg7day ) and mycophenolate sodium were continued . his complaints and laboratory values and sledai scores were improved significantly after rituximab treatment , as shown in figure 1(b ) . repeated laboratory measurements showed no detectable c4 proteins , but serum c3 levels were normal . after pcr amplification with intron - exon binding primers , mutation was detected by direct dna sequencing method . we report a child with sle and c4 deficiency and with severe skin involvement that proved to be subacute cutaneous lupus erythematosus ( scle ) . in our patient , the diagnosis of sle was based on the presence of constitutional symptoms , malar rash , photosensitivity , oral ulceration , arthritis , anemia , a high titer of ana , and low c3 , c4 . the patient resistant to initial therapies including hqk , prednisolon and cyc . rituximab is a chimeric monoclonal igg1antibody that binds specifically to the cd20 antigen and mediates b- cell lysis . prior studies have shown that rituximab therapy can be a safe and efficacious addition to therapy with standard immunosuppressive agents in patients with refractory childhood sle [ 2429 ] . in our case , rituximab led to a remarkable improvement of skin lesions , resulting in a significant decrease of the sledai from 20 at the beginning to 5 at the end of therapy . in addition , he exhibited a low c4 level during the extended period of observation . finally , the genetic phenotyping of complement revealed that he was homozygous for c4b deficiency . sle is a systemic autoimmune disease characterized by the breakdown of immunotolerance and the production of a wide range of autoantibodies that target multiple tissues and organs . these are estimated to be found in less than 1% of sle patients [ 31 , 32 ] . respectively , 93% and 78% of patients with complete c1q and c4 deficiencies eventually develop sle or a lupus - like disease [ 22 , 33 ] . in addition , the concordance rates for siblings with homozygous deficiency of c1q or c4 to develop sle are 90% and 80% , respectively , which are even higher than the rate in monozygotic twins ( 2660% ) with other genetic defects . indeed , approximately 15% of caucasian sle patients exhibit homozygous c4a deficiency , whilst more than 50% of caucasian patients with sle have heterozygous c4a deficiency . c4b deficiency caused autoimmune - associated diseases , such as systemic lupus erythematosus , or diseases with an autoimmune component , such as autism [ 36 , 37 ] . heterozygous and homozygous deficiencies of c4a were present in 4060% of sle patients from almost all ethnic groups such as northern and central europeans , anglo - saxons , caucasians in the us , african americans , asian chinese , koreans , and japanese . the major causes for c4aq0 in caucasian and african sle patients are the presence of a mono - s rccx module with a single , short c4b gene and the 2-bp insertion into the sequence for codon 1213 at exon 29 of the mutant c4a gene . we found heterozygous genetic deficiency of c4a gene , also heterozygous and homozygous deficiencies of c4b in our patient . in conclusion , we report a case of c4b deficiency accompanied with sle with therapy - resistant skin involvement . further studies are needed to clarify the relationship of c4b deficiency and sle which presented severe skin involvement .

the complement system is of great importance in systemic lupus erythematosus . complete genetically determined deficiencies are with few exceptions reported for the various complement proteins , and most of the deficiency states are rare . deficiencies of the factors in the classical pathway are also associated with development sle and sle - like disorders . most of the patients with lupus present skin involvement . approximately , 7595% of patients with cutaneous lupus erythematosus respond to antimalarial therapy and/or topical glucocorticosteroids . immunosuppressive agents are usually considered a second - line approach in patients with resistant disease . in this study , we present the clinical features and determine the molecular basis responsible for the complete c4a and c4b deficiencies in a lupus patient presented subacute cutaneous lupus erythematosus and resistance to treatment .

down syndrome is popularly known as trisomy 21 , because it is a genetic disorder caused by a presence of all or part of a third copy of chromosome 21 , patterson . globally , as of 2010 , down syndrome occurs in about 1 per 1000 live births and results in about 17,000 deaths . most of the hospitals in bangladesh do not have any facilities to confirm the diagnosis of down syndrome using genetic sequencing . thus , we often rely on clinical diagnosis of down syndrome . children with down syndrome are more likely to have multiple health problems than the general population . some of these problems are associated with failure to thrive leading to life threatening serious illness . it is therefore important to be aware of conditions involved and of their presenting symptoms and management . although diarrhea may be a common comorbidity in down syndrome children under 5 years , little is known about such population . like other hospitals of bangladesh and in other developing countries , the case - load of clinically diagnosed down syndrome children having diarrhea is not uncommon at the dhaka hospital of the international centre for diarrhoeal disease research , bangladesh ( icddr , b ) , the only international organization that works on diarrhea disease research . however , there is no published data on the factors associated with clinically diagnosed down syndrome children having diarrhea . identification of factors associated with clinically diagnosed down syndrome and diarrhea in such population may help to reduce morbidity and deaths in resource poor settings . thus , the aim of our study was to describe our experience with down syndrome patients admitted with diarrhea by identifying the factors associated with clinically diagnosed down syndrome in diarrheal children . in this chart review , data were analyzed anonymously ; thus , no parental or ethical consent was required . this was a retrospective chart review that was conducted at the dhaka hospital of icddr , b using electronic database of the hospital ( sheba ) . we used an unmatched case control design and enrolled 8422 diarrheal children of both sexes , aged 059 months , who were admitted to the intensive care unit ( icu ) , high dependency unit ( hdu ) , or longer stay ward ( lsw ) of the hospital from march 2011 to february 2013 . children with clinically diagnosed down syndrome presenting with diarrhea constituted the cases and randomly selected diarrheal children without down syndrome constituted controls . controls were randomly selected by computer randomization using spss ( version 17.0 ; spss inc . , chicago ) from a computerized data source of icddr , b. we used 1 : 3 unmatched case control ratio to increase the statistical power of our analyses . we defined down syndrome clinically if a child had at least seven of the following clinical features : mental impairment , stunted growth , low muscle tone , depressed nasal bridge , slanted eyes , large protruding tongue , abnormal outer ears , wide gap between first and second toes , shortened head and neck , simian crease , and high arch palate . diarrhea was defined if a child had three or more abnormally loose or watery stools per 24 hours , and status of dehydration was defined by dhaka methods of assessment of dehydration that is almost similar to who method and approved by who . the description of the study site ( dhaka hospital of icddr , b ) has been described in our previously published article . management of the diarrheal children with down syndrome was done symptomatically ; that is , management of pneumonia , sepsis , severe cholera , dysentery , severe malnutrition , and other bacterial infections was done following the hospital 's guidelines . the babies with down syndrome were referred to shishu bikash kendro of dhaka shishu hospital or bangabandhu sheikh mujib medical university hospital for further management and developmental rehabilitation . characteristics analyzed included sociodemographic ( age , gender , height and weight , type of residence , source of drinking water , and formula feeding ) , clinical signs ( dehydration and temperature ) , clinical diagnosis ( sepsis , pneumonia , chronic lung disease , pulmonary tb , severe acute malnutrition , congenital heart diseases ( chd ) , motor developmental delay within 059 months ( neck control , sitting , standing with or without support , and walking ) , hypothyroidism , hospital acquired infection ( hai ) [ 9 , 10 ] ) , and outcome during discharge . sepsis was defined as presence or presumed presence of infection with hypothermia ( 35.0c ) or hyperthermia ( 38.5c ) , tachycardia , tachypnea , and abnormal wbc count ( > 11 10/l or < 4 10/l or band and neutrophil ratio 0.10 ) [ 11 , 12 ] . additionally , there may have been altered organ function such as altered mental status and bounding pulse in absence of clinical dehydration or after correction of dehydration . pneumonia was initially diagnosed clinically following the world health organization recommended classification of pneumonia and was confirmed with radiologic evidence of consolidation or patchy opacities . chronic lung disease was defined if there was moist cough for more than 4 weeks with recurrent chest infections , exertional dyspnea , and growth failure with or without the presence of clubbing , chest wall deformity , adventitious sounds on chest auscultation , and/or hyperinflation . severe acute malnutrition was defined as severe wasting ( z score for weight for height / length , < 3 of the median of the who anthropometry ) , severe underweight ( z score for weight for age , < 3 of the median of the who anthropometry ) , or nutritional edema . pulmonary tuberculosis was diagnosed with supportive evidence such as positive tuberculin skin test or a positive contact history with a sputum positive tuberculosis patient plus if there was no improvement of signs of pneumonia or status of severe malnutrition following standard treatment plus even without microbiological confirmation of tuberculosis follow - up improvement with antitubercular therapy . chd was clinically diagnosed with auscultatory murmur heard by using stethoscope over cardiac area of the chest and was confirmed by echocardiography . common chd were atrioventricular septal defect or ventricular septal defect , mitral valve problems , tetralogy of fallot , and patent ductus arteriosus . hypothyroidism was initially diagnosed clinically with any five of the following : history of feeding difficulties , failure to thrive , history of prolonged jaundice after birth , history of constipation , floppiness , large fontanelles , macroglossia , and cold mottled skin in the extremities and the diagnosis was confirmed by measuring tsh or thyroxine level in blood [ 1719 ] . the identification of blood isolates and the susceptibility testing were done with the routine methods at the microbiological laboratory . blood culture and serum electrolyte all data were entered into spss for windows ( version 17.0 ; spss inc . , chicago ) and epi - info ( version 6.0 , usd , stone mountain , ga ) . normally distributed data differences of means were compared by student 's t - test and mann - whitney test was used for comparison of data that were not normally distributed . strength of association was determined by calculating odds ratio ( or ) and their 95% confidence intervals ( cis ) . the cases more often presented with developmental delay , congenital heart disease , hypothyroidism , severe acute malnutrition ( sam ) , sepsis , and lower serum calcium level compared to the controls . during hospitalization the cases all other variables among the cases and the controls shown in table 1 were comparable . this study , though weakened by limited sample size , was able to describe our experience with down syndrome patients admitted with diarrhea by identifying different associated factors for clinically diagnosed down syndrome in diarrheal patients aged 059 months . our observation of association of severe acute malnutrition , developmental delay , congenital heart disease , sepsis , hypothyroidism , and hypocalcemia on admission and prolonged hospital stay and hai during hospitalization with down syndrome in diarrheal patients is not surprising but needs to be reported for the better clinical management of such children . developmental delay was found to be strongly associated with down syndrome in diarrheal children and the finding is consistent with previous study conducted in children without diarrhea . although there is a lack of evidence on the relationship between diarrhea and chd , in this study , we have found strong association between chd and down syndrome in diarrhea patients . in our study we found 53% babies had chd among down syndrome and the observation is consistent with previous data which showed that the prevalence of chd in children with down syndrome involving nondiarrheal children was 4050% [ 22 , 23 ] . thus , developmental delay , failure to thrive , and chd might have an impact in contributing to sam . our observation of association of sepsis and other infections ( such as diarrhea and pneumonia ) with down syndrome in diarrheal children compared to those without down syndrome is also understandable . this is probably due to the fact that children with down syndrome in developing countries invariably present with sam , that is , associated with immunosuppression , and often become prone to severe form of infection such as pneumonia , diarrhea , and sepsis [ 25 , 26 ] . our observation of the association of hypothyroidism with the diarrheal children having down syndrome is also understandable . in our study we found 9.3% babies had thyroid dysfunction among down syndrome whereas the prevalence of thyroid disease with down syndrome in previous studies involving nondiarrheal children was 418% [ 1719 , 23 , 2729 ] . hypocalcemia used to occur mostly in children suffering from diarrhea and/or sam as in our study . although no published data were found on the association of hai and prolonged hospitalization with down syndrome in diarrheal children , the observation is quite understandable . in our study , diarrheal children with down syndrome were observed to have had association with severe acute malnutrition , developmental delay , sepsis and various infections . due to management of their multiple ailments , these children required to stay in the hospital for longer period which is strongly associated with hai [ 31 , 32 ] . the limitation of the study is the lack of genetic sequencing in diagnosing the children with down syndrome . another limitation is the small sample that might have an impact of the lesser association of other factors . our data of down syndrome in diarrheal children and the published data in nondiarrheal children suggest that the presentations of down syndrome are almost similar in diarrheal and nondiarrheal children . down syndrome in diarrheal children was found to have an association with severe acute malnutrition , congenital heart disease , hypothyroidism , developmental delay , sepsis , and hypocalcemia on admission . thus , clinicians may look for these simple clinical parameters in clinically diagnosed down syndrome children with diarrhea for their prompt management that may prevent prolonged hospitalization as well as hospital acquired infection .

there is lack of information in the medical literature on clinically diagnosed down syndrome children presenting with diarrhea . our aim was to describe our experience with down syndrome patients admitted with diarrhea by evaluating the factors associated with down syndrome presenting with diarrheal illness . in this retrospective chart analysis , we enrolled all the diarrheal children aged 059 months admitted to the dhaka hospital of the international centre for diarrheal disease research , bangladesh ( icddr , b ) , from march 2011 to february 2013 . down syndrome children with diarrhea constituted cases and randomly selected threefold diarrheal children without down syndrome constituted controls . among 8422 enrolled children 32 and 96 were the cases and the controls , respectively . median age ( months ) of the cases and the controls was comparable ( 7.6 ( 4.0 , 15.0 ) versus 9.0 ( 5.0 , 16.8 ) ; p = 0.496 ) . the cases more often presented with severe acute malnutrition , developmental delay , congenital heart disease , hypothyroidism , sepsis , hypocalcemia , developed hospital acquired infection ( hai ) during hospitalization , and required prolonged stay at hospital compared to the controls ( for all p < 0.05 ) . thus , diarrheal children with clinically diagnosed down syndrome should be investigated for these simple clinical parameters for their prompt management that may prevent hai and prolonged hospital stay .

calcifying ghost cell odontogenic cyst ( cgcoc ) is a heterogeneous group of lesion existing either as cystic or solid variant.[14 ] the cystic lesion comprises majority of cgcoc accounting for 85% of cases . clinically , cgcoc may present either as central ( 85% ) or peripheral lesion ( 15% ) . it shows bimodal age of occurrence commonly presenting in second and seventh decade of life . cgcoc shows no predilection towards any gender and occurs in equal frequency in either of the jaw bones , anterior to the first molar in the incisor - canine region . asymptomatic bony expansion is the most common presentation of the central lesions , while sessile or pedunculated smooth surfaced mass are features of peripheral lesions.[136 ] radiographically , the central lesion appear as unilocular or sometime multilocular radiolucency with or without calcified structures . size and opacity of the calcified structure varies , sometime occupying the entire lesional area . cgcoc may be associated with an odontoma ( 24 - 35% ) or an impacted tooth , most commonly the canine ( 10 - 32% ) . despite the varied clinical and radiographical presentation , it consists of cystic cavity lined by 4 - 10 cells thickness of odontogenic epithelium and the fibrous wall . basal layer of the epithelial lining is composed of cuboidal or columnar - shaped ameloblast - like cells , overlying the basal layer , there are loosely arranged cells appearing similar to stellate reticulum of enamel organ . anucleated epithelial cells with retention of cellular outline are present either in the epithelial lining or connective tissue is a characteristic finding and are called ghost cells. individual ghost cells may fuse together to form large sheets of amorphous eosinophilic structure on which calcification may occur . irregular masses of calcified structure suggestive of dysplastic dentin are present in association with basal layer denoting the inductive nature of the odontogenic epithelium . a 89-year - old female reported to our dental clinic with the chief complaint of swelling in the right maxillary arch for past 1 month . history revealed that the patient underwent uneventful extraction of tooth no ( fdi ) 14 3 months back in a private dental clinic and was the last tooth to be extracted before her complete edentulousness . one and half months after extraction , the patient was given maxillary and mandibular complete dentures . for the past 1 month the patient was unable to wear the maxillary denture due to mild discomfort in the region of 14 and 15 for which she was referred to our clinic . on intraoral examination we observed completely edentulous maxillary and mandibular arch with mild swelling in the region of 14 and 15 , measuring 3 3 cms . overlying mucosa was sore in few areas possibly due to irritation by the denture [ figure 1 ] . the history of extraction and clinical features made us to arrive at a diagnosis of residual cyst . histopathologically , the lesion showed a fragmented cystic odontogenic epithelial lining with associated fibrovascular connective tissue capsule . the epithelial lining was 3 - 4 cells thickness exhibiting globules of eosinophilic structure suggestive of ghost cells [ figures 3 and 4 ] . some of the ghost cells appear to undergo dystrophic calcification [ figure 5 ] . with this we made a final diagnosis of calcifying ghost cell odontogenic cyst . intraoral photograph showing completely edentulous arch with swelling in the 14 and 15 region ortho pantamograph showing radiolucent lesion in 14 and 15 region low - power photomicrograph showing odontogenic epithelium and globules of eosinophilic structure suggestive of ghost cells ( h and e stain , 10 ) high power photomicrograph showing ghost cells ( h and e stain , 40 ) early stages of calcification seen as basophilic granular areas . in 1962 gorlin et al , was the first person to describe calcifying ghost cell odontogenic cyst ( cgcoc ) under the term calcifying odontogenic cyst ( coc ) . as the cystic variant comprises majority of cgcoc ( 85% ) , term coc was commonly used and still prevails in some literature . from the year of description , these controversies and confusion about the lesion are due to existence of two variants of the lesion : cystic and the neoplastic forms . some authors prefer to consider cgcoc as lesion existing in two forms either cyst or neoplasm - dualistic concept ; others like to regard the lesion as a tumor with a marked tendency toward cystic architecture - monistic concept . in 1981 , praetorius et al , framed a classification based on dualistic concept in which they divided coc ( as it was called then ) into two entities : a cyst and a neoplasm and proposed the term dentinogenic ghost cell tumor ( dgct ) for the neoplastic variant . in 1991 , buchner classified coc majorly on clinical grounds peripheral coc and central coc , further subclassifying each of them into cystic or neoplastic variants and included rare malignant variant of coc in the classification . similarly , in 1991 , hong et al . followed the dualistic concept and divided coc into cystic and neoplastic types . the cystic type is further subdivided into proliferative , nonproliferative , ameloblastomatous and odontoma associated . they used a term epithelial odontogenic ghost cell tumor ( eogct ) for the solid variant , the term that was originally proposed by ellis and shmooker ( 1986 ) . in 1998 , toida indicated the demerits of above classification systems and clarified that the lesion should not be grouped into cystic or cystic is used synonymous for non - neoplastic which was incorrect because the former term describes the morphological pattern while the latter term defines the biological behavior of the lesion . he further mentioned that there may be lesion with cystic architecture with extensive proliferating capacity . toida proposed a classification in which he called cgcoc for the cystic variant and used the term calcifying ghost cell odontogenic tumor ( cgcot ) for the neoplastic variant , the latter term was originally proposed by fejerskov and krogh ( 1972 ) . he further subdivided the neoplastic group into cystic cgcot and solid cgcot , to include neoplasm showing cystic architecture and neoplasm with solid pattern , respectively . [ table 1 ] . classification proposed by toida ( 1998 ) from the above described classifications it is plausible that the dualistic concept was mostly followed , considering cgcoc as a lesion existing in two forms , cyst and neoplasm . however , the approach of who toward cgcoc was different and mostly followed monistic concept . in 1971 , who described the lesion as non - neoplastic cystic lesion and preferred to use the term coc . in 1992 , who classified this lesion under odontogenic tumor but continued to use the term calcifying odontogenic cyst . as the terminology was misleading and did not explain the complete behavior of the lesion , in 2005 , who again renamed the lesion as calcifying cystic odontogenic tumor . from the year of description of cgcoc in 1961 till date different terminologies and classifications have been proposed and practiced in the literature [ table 2 ] . in these terminologies , some characteristic features of the lesion are considered and named accordingly , like origin of the lesion ( odontogenic epithelium- coc , ccot , eogct ) , histopathological features ( calcifying structure , dysplastic dentin , ghost cell- dgct , cgcoc , ogct ) , and architectural pattern ( cystic cgcot , solid cgcot , coc ) . in spite of various terminologies and classifications , discrepancies prevail over the usage of terminology and still some authors which prefer to use the older terminologies . commonly used terminologies for cgcoc inadvertent use of the term coc ( gorlin 1962 ) for these lesions carries the possibility of masking the real biological behavior of the solid neoplastic variant and neoplastic with cystic architecture , which has high proliferating index , on the other hand use of the term ccot ( who 2005 ) for the lesion may result in unwanted extensive surgical procedure for the cystic subtypes.the authors would like to conclude by suggesting that , use of nomenclature should emphasize on biological behavior of the lesion rather than familiar or older terms , so that lesion can be approached and treated accordingly . for example , nomenclature carrying a phrase cystic is generally approached relatively less vigorously ( enucleation or marsupialization ) , than nomenclature carrying a phrase tumor , which are treated more aggressively ( en bloc resection ) and followed - up precautiously for longer period . terminology and classification proposed by toida as cystic ( cgcoc ) , neoplastic ( cgcot ) variant with subclassifying the neoplastic types into cystic cgcot and solid cgcot not only avoids confusion but also helps in planning the treatment accordingly . presentation of lesions with controversial historical description , terminologies and clinical behavior should be encouraged so that it provides opportunities to understand the actual incidence , biological behavior , treatment and recurrence . nomenclature and classification of those particular lesions should be re viewed periodically and should be followed universally .

calcifying ghost cell odontogenic cyst ( cgcoc ) is a relatively uncommon odontogenic lesion characterized by varied clinical , radiographical features and biological behavior . cgcoc can exhibit either as a cystic or a solid lesion . since its first description by gorlin et al , in 1962 , it has been known by different names and classified and sub - classified into various types . in this article we present a case of cgcoc and discuss the related literature regarding the terminology , classification and biological behavior of cgcoc .

the leech is a hemophagic parasite , living on occasional meals of blood obtained by attaching to fish , amphibians , and mammals . infestation occurs by drinking infested water from quiet streams , pools and springs . externally , leeches tend to have a brown and red striped design on an olive colored background . these organisms have two suckers , one at each end , called the anterior and posterior sucker . the posterior is mainly used for leverage while the anterior sucker , consisting of the jaw and teeth , is where the feeding takes place ( 1 ) . an anesthetic limits the sensations felt by the host ( and thus reduces the chance of the host trying to detach the leech ) . a vasodilator causes the blood vessels near the leech to become dilated , and thus provides the leech with a better supply bleeding as much as 150 ml of blood for up to 48 hours . leech saliva contains a complex protein called hirudin , which is a highly effective anticoagulant . the leech needs this to prevent blood clots which would block its feeding ( 1 ) . a leech has been found in the nose , post - nasal space and oropharynx , but rarely in the hypopharynx or larynx . a few cases of leech in the hypopharynx or larynx have been reported in the literature during the past years ( 2 ) . this case report here is intended to give clue for considering leech as a cause of unexplained upper airway obstruction with bleeding per mouth . a 7-year - old child who came from dedo was admitted to jimma university specialized hospital department of pediatrics and child health on may 29 , 2012 with the history of blood stained saliva of 14 days duration and shortness of breath of 3 days duration . there was no history of trauma , foreign body ingestion , throat pain , fever , dysphagia and drug intake . he has spring water contact near the vicinity ( called darto spring in dedo woreda bortolla kebele , south west ethiopia ) which is not protected and is used for both animals and humans . there is leech in the spring and it affects the cattle and they use traditional medicines made from mixing of tobacco leaves and flax seed ( telba ) . they had tried to give the child this traditional medicine though there was no improvement rather he started to have worsening of bleeding and three days prior to presentation he started to have shortness of breath and stridor . examination revealed a child with respiratory distress ( stridor , intercostals and subcostal retraction ) but chest is clear to auscultation and resonant to percussion , normal oral cavity but oropharynx having strikes of blood posteriorly . there was no other abnormal clinical examination finding other than some pallor and slightly pale conjunctiva . he was investigated with assessment of upper airway obstruction secondary to foreign body , plus anemia and bleeding dyscariasis . with cbc , esr , u / a , s / e , coagulation profile and x - ray of the chest & neck ( pa and lateral ) . plain radiograph of the lateral neck view reveals increase in the prevertebral soft tissues and subglottic narrowing but chest x - ray was found to be normal . his hemoglobin was 9.8 g / dl , total leukocyte count 8.6 10/l with neutrophils 60% , lymphocytes 29.2% and erythrocyte sedimentation rate was 28 mm at the end of first hour . bleeding time , prothrombin time and activated partial thromboplastin time were normal while platelet count was 385 10 /l . the child then was taken to the operating theater and under general anesthesia laryngeoscopy was done and it was found that the upper part of the leech was seen at the level of upper trachea first it looks like a blood clot then it was having movement and forceps was applied to takeout alive leech which measures 6 cm . the child then was transferred to the ward with stable vital sign and no active bleeding or sign of respiratory distress . he was observed for 24 hours for development of sign of respiratory distress or any other complication . there was no problem identified then with advice given on the safe water use and discharged home . leech is a common name for over 650 species of carnivorous , blood sucking annelid worms that make up the class hirudinea of phylum annelida . the mouth is located on the small sucker and has three jaws with sharp teeth that make a y - shaped incision in the flesh . the leech can ingest an amount of blood approaching 10 times their own weight and may not require feeding for up to one year after their last meal . this occurs after biting the host ; a process that is pain free due to a local anesthetic in the leech 's saliva(1 ) . they enter the body either by drinking water or through the openings of persons who bath in infected water . this can be associated with inadequate and unsafe water supply in the locality therefore almost all cases have been reported from less - developed countries where access to and use of safe water is often a problem , especially in rural areas ( 913 ) . so far , very few cases have been reported from europe ( 7 , 8) . when ingested through the mouth in drinking water , external wounds from leeches are less dangerous , but they may cause a secondary infection ( 1 ) . leech endoparasitism , although rare , may cause serious , even lethal complications ( 3 ) . lethal dyspnoea , haemoptysis or haematemesis can be the revealing symptoms with further development of anemia . mohammad et al . reported a case of a 6-year - old child who presented suffocating at the emergency room after having been diagnosed and treated for asthma over one month period ( 4 ) . other four patients who inhaled leeches and developed severe attacks of inspiratory stridor , difficulty in breathing and spitting of blood were presented by kaygusuz ( 5 ) . a case report by solomon described a case of acute laryngotracheal obstruction in a 12-year - old boy ( 6 ) . in general a patient having a leech in the oral cavity presents with spitting of blood and a feeling of a foreign body . a leech in the hypopharynx causes bleeding , leading to spitting of blood or haematemesis and that lying in the larynx gives rise to airway obstruction and change of voice . soft tissue radiograph of the neck may reveal a foreign body but is not specific for the leech . examination under general anesthesia ( direct laryngoscopy ) is essential and performed as an emergency for diagnosis and removal of the leech . the application of traditional medications may lead to dislodging of the leech deeper and may result in suffocation to death . from the case seen here we can conclude that the possibility of leech endoparasitism should be considered as a cause of unexplained bleeding from the throat in areas where aquatic leeches are commonly found , particularly when there is a history of recent contact with streams or springs . it is also wise to avoid application of traditional medications since there is a risk of dislodging to major airways leading to suffocation and death .

this paper presents a case of a 7 year - old child who presented with a 14-days history of blood stained saliva and shortness of breath of 3 days with signs of upper airway obstruction . laryngoscopy revealed a blackish living foreign body in the proximal trachea . under general anesthesia the leech was removed by applying forceps . i conclude that a high index of suspicion of leech infestation is required when faced with a child presenting with unexplained bleeding per mouth and signs of upper airway obstruction .

in late 2002 , severe acute respiratory syndrome coronavirus ( sars - cov ) crossed the species barrier from animals to humans . sars first struck in guangdong province , china , and was officially recognized by the world health organization ( who ) in february 2003 . after its introduction into human populations in hong kong in february 2003 , the virus spread across the globe within weeks . when sars was declared to have been contained ( 5 july 2003 ) , there were 8,098 confirmed sars cases , and 774 of these patients died from the disease . after this catastrophic event , one of the most frequently asked questions was whether sars would come back . ten years after the introduction of sars , yet another novel coronavirus ( ncov , or hcov - emc hereafter ) jumped from animals to humans ( 1 , 2 ) . at the time of writing , the virus can readily infect cell lines from multiple hosts , including humans , swine , monkeys , and bats , suggesting that it might have a relatively weak species barrier . it is not known whether there is a low level of circulation of this novel coronavirus in asymptomatic human carriers or if there is an animal reservoir that allows for multiple introductions of hcov - emc into humans . while the transmission route ( or routes ) from animals to humans is not yet identified , a recent report of three human cases from a family cluster in the united kingdom indicates that this virus is transmissible between humans . since the first discovery of hcov - emc as the etiological agent of this novel severe respiratory disease ( 1 , 2 ) , researchers have used various strategies to understand virus entry and its replication capability in mammalian cell lines ( 3 , 4 ) . in the absence of autopsy reports of patients who died from hcov - emc , kindler et al . ( 5 ) describe the efficient infection and replication of hcov - emc in differentiated human primary airway epithelial ( hae ) cell cultures in vitro . this model was used to culture other human coronaviruses such as hcov - oc43 and hcov - nl63 ( 6 ) . this well - characterized primary culture system exhibits high physiological relevance , reflecting the anatomy of the human conducting airway ( 7 ) , and allows better understanding of the cellular tropism of this newly emerged virus . phylogenetic analysis of partial rdrp sequences ( 306 nucleotides [ nt ] ) of bat and other representative coronaviruses . the tree was generated by using the neighbor - joining method in mega5 ( http://www.megasoftware.net/ ) . details of bat coronaviruses that are genetically related to hcov - emc are as shown . report that hcov - emc has faster replication kinetics than sars - cov in hae cells ( 5 ) . sars - cov has a mean incubation period of about 5 days in humans . this relatively long incubation period allowed the identification and isolation of sars patients before they became highly infectious during the sars epidemic . if hcov - emc has a very efficient replication rate in the upper human respiratory tract , the potential use of quarantine and isolation policy to contain a possible epidemic would be extremely limited . in terms of cellular tropism , kindler et al . are the first to show the cellular preference of hcov - emc for human non - ciliated bronchial epithelial cells . so far , susceptibilities of the human pseudostratified bronchial epithelial culture to coronaviruses causing the common cold ( e.g. , hcov-229e , hcov - oc43 , hcov - nl63 ) ( 6 ) and to sars - cov are comparable to that observed after hcov - emc infection . interestingly , these human coronaviruses seem to have different cell specificities ; non - ciliated cells are infected by hcov-229e and hcov - emc , while ciliated cells are more prone to infections by hcov - oc43 , hcov - nl63 , and sars - cov . nevertheless , this finding alone is not sufficient to explain their differential pathogenicities in humans . as acute pneumonia is one of the key presentations in hcov - emc infection in humans , the characterization of hcov - emc in tissues from lower respiratory tracts such as alveolar epithelial cells or alveolar macrophages might provide a more comprehensive picture of this novel disease . the unusual severity of hcov - emc in humans , combined with its high fatality rate , is reminiscent of the clinical presentation of the sars outbreak in 2003 . sars - cov has strategies to limit host antiviral mechanisms by evading interferon ( ifn ) responses ( 8) . on the other hand , evidence from clinical and experimental studies suggests that sars - cov can induce cytokine dysregulation . delineate the immune response triggered by hcov - emc in hae cultures by studying the proinflammatory gene expression profile upon hcov-229e , hcov - emc , and sars - cov infection . the authors observed that both hcov-229e and highly pathogenic coronaviruses can only marginally induce ifn and interferon - stimulating gene responses . in particular , hcov-229e is found to be more capable of inducing proinflammatory gene expression , including tumor necrosis factor alpha ( tnf- ) and cxcl10 , than the more pathogenic human coronaviruses . in contrast to the findings of kindler et al . , another previous study using well - differentiated normal human bronchial epithelial cells indicated that sars - cov induced higher cytokine and chemokine levels than hcov-229e ( 9 ) . in addition , one should note that sars - cov is known to modulate cytokine production by other key cells responsible for innate immunity in the lung ( e.g. , macrophage and dendritic cells ) ( 10 ) . it is therefore essential to study hcov - emc - infected macrophages and dendritic cells . furthermore , due to the nature of purified cell culture ( e.g. , hae ) models , cross talk between epithelial cells , macrophages , and dendritic cells can not be evaluated . additional experimental systems , such as ex vivo respiratory organ cultures and animal models , may provide further understanding of diseases caused by hcov - emc . in addition , clinical parameters determined from hcov - emc - infected patients would be extremely valuable for understanding the disease process in humans and could be used as a reference for data generated from in vitro and animal experiments . based on the lack of ifn response found upon hcov - emc infection in hae cultures , kindler et al . conducted a key experiment and demonstrated the effective suppression of hcov - emc replication by administration of type i or type iii ifn in the cultures . have recently confirmed that hcov - emc is sensitive to the antiviral action of type i ifn by using primary non - differentiated tracheobronchial epithelial cells and other epithelial cell lines ( 11 ) . again , the confirmation of ifn effectiveness in other models , particularly those relevant to lower respiratory tract infections , will strengthen the use of ifn as a possible therapeutic strategy to control hcov - emc infection . nonetheless , kindler et al . the sars event has led to intense scientific interest in coronaviruses and to the discovery of many other novel coronaviruses in humans and animals . with these intense efforts , a great diversity of alphacoronaviruses and betacoronaviruses has been detected in bats ( fig . 1 ) . these findings suggest that bats might be the natural reservoirs of these two viral genera and that some of the bat coronaviruses might have adapted to other mammals in occasional spillover events in the past . although the natural host for hcov - emc is yet to be identified , it is tempting to speculate that hcov - emc is of bat origin . in fact , recent bat coronavirus surveillance studies have indicated that a bat coronavirus ( e.g. , btcov / vm314/2008 ) which is genetically closely related to hcov - emc can be detected in different countries in europe ( 12 ) . but the sequence of this group of bat coronaviruses is still quite distinct from that of hcov - emc . notably , bat coronaviruses that are genetically related to hcov - emc are all detected from pipistrellus or tylonycteris bats ( fig . 1 ) . comprehensive virus surveillance of bats from these genera and others in the middle east should be of top priority . given the fact that sars - cov spread to humans via an intermediate host ( civet cat ) ( 13 ) , other animals ( e.g. , poultry , pets , and game animals ) that have frequent contacts with humans should also be tested . assuming that the confirmed human cases / clusters were caused by multiple introductions of hcov - emc from animals to humans , identifying the source of this novel pathogen is still the key to preventing further spillover events . in clinical and epidemiological settings , further development of serological tests for hcov - emc is urgently needed . so far , a few immunofluorescence assays specific for hcov - emc have been reported ( 14 ) . it is essential to have reliable serological tools to determine whether hcov - emc has been circulating widely in the general population in the affected areas . this would also help answer whether there is sustained transmission of this novel coronavirus in humans . this key information can also help reveal the spectrum of disease severity caused by hcov - emc in humans . it is not known whether hcov - emc is going to be fully established in humans . extensive efforts have been made and will continue to be needed to fight against this possible epidemic . if we are lucky enough to control this novel disease , more resources should be allocated to different areas of coronavirus studies . in fact , the number of bat species tested for coronaviruses is only a fraction of the total number ( > 1,200 ) of bat species . in addition ideally , we should develop an effective universal strategy to treat and prevent human infections caused by animal coronaviruses . 1 ) suggest that there have been a number of introductions of animal coronaviruses ( e.g. , sars - cov and 229e ) into humans in the past . the great diversity of coronavirus in bats will surely increase the odds of yet another zoonotic event occurring in the future .

abstracta novel betacoronavirus , human coronavirus ( hcov - emc ) , has recently been detected in humans with severe respiratory disease . further characterization of hcov - emc suggests that this virus is different from severe acute respiratory syndrome coronavirus ( sars - cov ) because it is able to replicate in multiple mammalian cell lines and it does not use angiotensin - converting enzyme 2 as a receptor to achieve infection . additional research is urgently needed to better understand the pathogenicity and tissue tropism of this virus in humans . in their recent study published in mbio , kindler et al . shed some light on these important topics ( e. kindler , h. r. jnsdttir , m. muth , o. j. hamming , r. hartmann , r. rodriguez , r. geffers , r. a. fouchier , c. drosten , m. a. mller , r. dijkman , and v. thiel , mbio 4[1]:e00611 - 12 , 2013 ) . these authors report the use of differentiated pseudostratified human primary airway epithelial cells , an in vitro model with high physiological relevance to the human airway epithelium , to characterize the cellular tropism of hcov - emc . more importantly , the authors demonstrate the potential use of type i and type iii interferons ( ifns ) to control viral infection .

patients with a history of sexually transmitted infections ( stis ) are at increased risk for the development of ectopic pregnancies because of postinflammatory fallopian tube scarring and deformity . unilateral twin ectopic pregnancy is a rare condition , first described in 1891 by de ott . live twin ectopic pregnancies are thought to occur at a frequency of 1/125 000 . unilateral twin ectopic gestation is thought to occur in approximately 1 in 200 ectopic gestations . one would therefore calculate a frequency of 1 in 20 000 pregnancies with a 1% ectopic rate in the united states . simultaneous bilateral tubal pregnancy is the rarest form of double - ovum twin pregnancy . a 24-year - old primigravida with an unknown last menstrual period presented to the emergency room with a 3-month history of lower abdominal and lower back pain that radiated into her right thigh . the pain occurred two to three times daily , lasting 5 minutes with each episode and worsening during the few days prior to presentation . during the three previous months the patient described irregular vaginal bleeding and watery vaginal discharge . she was evaluated two months previously at another hospital and was diagnosed as having a cyst . she was discharged with a narcotic prescription that she noted had improved her pain , but did not relieve it . coitarche began at 14 years of age and she noted a minimum of 15 previous sexual partners . hospital medical records listed positive toxicology screen results for illegal drugs on multiple emergency room visits . during the previous 6 years , culture and serology results documented four prior separate infections with chlamydia trachomatis , neisseria gonorrhoeae , herpes simplex virus 2 , and treponema pallidum , respectively . current testing for c trachomatis and n gonorrhoeae by dna probe was negative for both species . the patient did not demonstrate any clinical sequelae of herpes simplex virus and thus testing for this sti was not performed on the current admission . on physical exam , pelvic examination revealed blood in the vagina , a closed cervical os , uterine tenderness , and a palpable right adnexal mass . rectovaginal exam concurred with the pelvic exam and stool guaiac testing for occult blood was negative . diagnostic testing showed a quantitative serum -hcg titer of 263 miu / ml , a hematocrit of 38% , and a serum progesterone level of 2.2 ng / ml . additionally , ultrasonographic examination displayed a 10 10 8 cm right adnexal mass containing a nonviable twin pregnancy with each fetal crown - rump length corresponding to a gestational age of 9.3 weeks . a separating linear echo was seen in the mass between the two fetuses ( figure 1 ) . an exploratory laparotomy revealed a hemoperitoneum containing 300 ml and a 10 cm right - sided pelvic mass incorporating the right fallopian tube and ovary . small intestine and the appendix were adherent by fibrous adhesions to the mass . a right salpingoophorectomy , an appendectomy , and an extensive lysis of adhesions were performed . pathological evaluation of the surgical specimen showed a twin pregnancy within the fallopian tube ( figure 2 ) . during more detailed histopathologic examination , the finding of a dividing membrane established the pregnancy to be monochorionic diamnionic , and measurement of the twin fetuses estimated their gestational age at 7 weeks . pelvic inflammatory disease is associated with the greatest increase in risk , but other associated factors include operative trauma , congenital anomalies , tumors , adhesions , and advancing maternal age . arey in 1923 suggested that anything that interferes with the passage of the ovum through the tube increases the risk of an abnormal placental implantation site . additionally , studies suggest a delay in ovum transport and in implantation also increase the risk of monozygotic twinning . minor trauma to the blastocyst during assisted reproductive technology may also lead to an increased incidence of monozygotic twinning . correspondingly , the majority of twin ectopic pregnancies have been monozygotic . as of 1990 , 95% of twin ectopic pregnancies were reported as monozygotic . despite these potential sources for ectopic twin gestation , goker in 2001 reported only the one hundred and first case of unilateral twin ectopic pregnancy , and the sixth to be diagnosed preoperatively . the current case is the eighth in the literature to be diagnosed preoperatively . one reason for the low incidence may stem from the fact that fetal wastage in monozygotic twins is high and malformations are common . in the current case , the patient 's prior stis may have had a direct causal link to her ectopic twin gestation . current studies show that c trachomatis and n gonorrhoeae interfere with the function of the ciliated cells of the tubal mucosa , thereby slowing ovum transport and increasing the risk for tubal implantation . grard reported that 7 of 10 tubes with ectopic pregnancies were found to have c trachomatis . in addition to these findings , it has been demonstrated with laparoscopy that one episode of pid resulted in a 12.8% incidence of bilateral tubal occlusion , two episodes with a 35% incidence , and three episodes with a 75% incidence of bilateral tubal occlusion . this case illustrates one of the long - term consequences of stis with respect to reproductive function . patients with a history of multiple stis are known to be at risk for development of chronic pelvic infection and its associated fallopian tube scarring . the tubal anatomy distortion that ensues potentially increases the risk for a presentation of ectopic pregnancy that is considered uncommon .

background . the incidence of unilateral twin ectopic pregnancy is a rare condition . several factors increase the risk of ectopic pregnancy , the most important of which is pelvic inflammatory disease , followed by operative trauma , congenital anomalies , tumors , and adhesions resulting in anatomically distorted fallopian tubes . we present a case of a woman with a history of four confirmed sexually transmitted infections ( stis ) including chlamydia trachomatis , neisseria gonorrhoeae , herpes simplex virus 2 , and treponema pallidum . the case illustrates the potential impact of sexually transmitted infections ( stis ) on the risk of a twin ectopic pregnancy . case . a 24-year - old primigravida , presented with an unknown last menstrual period , lower abdominal pain , watery vaginal discharge , and vaginal spotting . during this hospitalization , serum -hcg testing was 263 miu / ml and transvaginal ultrasonographic examination suggested a nonviable unilateral twin ectopic pregnancy . at exploratory laparotomy , a 10 cm mass involving the right fallopian tube and ovary was excised . pathological evaluation of the specimen identified a monochorionic , diamnionic twin ectopic pregnancy within the fallopian tube . conclusions patients with a history of multiple ( stis ) are known to be at risk for the development of chronic pelvic infection and postinflammatory scarring . the resulting distortion of the normal tubal anatomy leads to an increased risk of an uncommon presentation of ectopic pregnancy .

the " super scan " of bone scintigraphy is defined as a bone image that " looks too good . " its characteristics include intense activity in the bones and diminished renal parenchymal activity ( 1 ) . ( 2 ) had reported the case of f - fluorodeoxyglucose positron emission tomography ( fdg pet ) super scan involving skeletons , similar to the super scan of bone scintigraphy . a " hepatic super scan " by fdg pet has been reported in a patient with hodgkin disease who had unusually elevated hepatic radioactivity , in addition to the multiple areas of focal uptake in the chest , mediastinal , left axillary , and abdominal lymph nodes , and the adrenal glands . here we report a case of f - fdg pet / ct super scan showing extensive hypermetabolic lesions throughout the skeletons and liver . contrary to the intense hypermetabolism of skeletons and liver , the skeletal muscles of limbs , mediastinum , bowel , and especially brain showed very low fdg uptake . subsequent diagnostic ct imaging of chest and abdomen revealed 3.8 cm sized mass in left lower lung with multiple lymph nodes and hepatic metastasis . excision biopsy of supraclavicular lymph node was performed and histopathologic diagnosis was small cell lung cancer . the patient 's mental status was clear and he underwent f - fdg pet / ct ( biograph sensation 16 , siemens medical systems , usa ) for staging of lung malignancy , 1 hr after injection of 444 mbq ( 12 mci ) f - fdg . f - fdg pet / ct demonstrated focal hypermetabolic lung mass in left lower lobe with diffuse and intense hypermetabolism throughout the skeleton and liver . interestingly , skeletal muscles of limbs , mediastinum , bowel , and especially brain showed very low fdg uptake ( fig . 1 ) . this patient had no medications could disturb cerebral glucose metabolisms , such as corticosteroids and sedatives . a super scan is well - known phenomenon which is characterized by a strikingly high bone to soft tissue ratio on skeletal scintigraphy , with a uniform symmetrical increase in bone uptake and absent renal visualization ( 4 ) . the super scan is associated with various malignancies , and most commonly in carcinomas of the prostate , stomach and breast ( 5 ) . metastasis from lung cancer rarely causes a super scan , although multiple bone metastases or bone marrow involvement frequently occur in patients with lung cancer ( 6 ) . sy et al . ( 7 ) hypothesized that the increased uptake of radiopharmaceutical by diseased bone results in reduced phosphate excretion , thereby producing faint renal images in the bone scintigraphy . first , even though this is not uncommon feature in patients with extensive metastasis , intense and diffuse hypermetabolism throughout the skeleton and liver was demonstrated . the similar findings had reported in other cases of fdg pet super scan , however , this case had shown the best contrast between metastatic organs and non - metastatic organs ( 2 , 3 , 8) . second , fdg uptakes in skeletal muscles of limbs , mediastinum , bowel , and especially brain were remarkably low and this is the unique characteristic of the present case . the faint visualization of the brain , renal cortex , and soft tissue might be the result of extraordinarily high uptake of fdg by bony and hepatic metastatic lesions . low brain uptake of fdg has been reported when using corticosteroids and sedatives , and these conditions should be taken into consideration ( 9 , 10 ) . the present patient had no medications could disturb cerebral glucose metabolisms , such as corticosteroids and sedatives . because of some characteristics in common with super scan on skeletal scintigraphy , this case could be considered as ' metabolic super scan ' .

a 50-yr - old man presented with intermittent hemoptysis and was diagnosed small cell lung cancer . 18f - fdg pet / ct for staging demonstrated extensive hypermetabolic lesions throughout the skeleton and liver . interestingly , skeletal muscles of limbs , mediastinum , bowel , and especially brain showed very low fdg uptake . because of some characteristics in common with super scan on skeletal scintigraphy , this case could be considered as ' metabolic super scan ' .

an adrenocortical adenoma is a benign neoplasm which is derived from cells of the adrenal cortex and may be functionally active or nonfunctional . the discrimination of adrenocortical adenoma from nonadenoma is a common problem for radiologists in the daily practice . computed tomography ( ct ) and magnetic resonance ( mr ) imaging have been found to be useful imaging modalities for the differentiation between adenomas and nonadenomas . unenhanced ct and chemical - shift mr imaging are based on identifying intracytoplasmic lipids in the adrenocortical adenoma . whereas a delayed contrast - enhanced ct performed 15 minutes after contrast material injection is based on the different contrast washout characteristics of adenoma and nonadenoma ( 1 , 2 ) . recently we encountered a myxoid adrenocortical adenoma in which the imaging findings were inconsistent with typical mr imaging findings of an adrenocortical adenoma . the neoplasm is exceedingly rare , with fewer than 60 case reports since the first description of this entity in 1979 ( 3 ) . the most previous reports were concentrated on the pathological features of myxoid adrenocortical adenoma . to date , there have been no radiological reports concerning the radiologic features of myxoid adrenocortical adenoma . hence , we present the imaging findings of a myxoid adrenocortical adenoma with an emphasis on mr imaging features and we will discuss the differential diagnoses . a 74-year - old female was admitted to our hospital for an evaluation of diffuse abdominal pain . she had a history of hypertension with antihypertensive treatment medication . laboratory tests , including a full blood count , urea and electrolyte measurements , were within normal ranges . a contrast - enhanced ct scan of the abdomen during the portal venous phase demonstrated a well - circumscribed , 6-cm , ovoid - shaped , heterogeneously enhancing mass in the right adrenal gland . thereafter a mr imaging was performed and a smooth , ovoid - shaped mass in the right adrenal gland with low signal intensity on t1-weighted images and high signal intensity on t2-weighted images similar to that of fluid was revealed ( fig . signal loss on out - of - phase images compared with that on in - phase images were not observed in the tumor ( fig . the mass showed hyperintensity on high b - value ( 1000 s / mm ) diffusion weighted mr images , but the corresponding high apparent diffusion coefficient value confirmed that the hyperintensity on diffusion - weighted mr images represented t2 shine - through rather than restricted diffusion ( fig . 1f , g ) . the serum and urine marker levels , including those of metanephrines , cortisol , aldosterone and catecholamine , as well as the results of the 24-hour urine collection for vanillylmandelic acid for the detection of a hormonally active tumor were in the normal range . , the tumor measured 6.0 4.7 1.6 cm , was well - circumscribed , a yellow - greenish mass and had a gelatinous consistency ( fig . microscopically , more than 90% of the tumor mass were characterized by a myxoid background containing anastomosing cords and tubules of tumor cells ( fig . most of the tumor cells had a uniform polygonal shape with a distinct cell border . neither mitotic figures nor necrosis were observed as well as no evidence of vascular or capsular invasion . myxoid change is a nonspecific but not uncommon phenomenon in soft tissue tumors ( 4 ) . a significant myxoid background has been incorporated into officially sanctioned nosologic classification , such as myxoma . in addition , a series of tumors may show myxoid changes of the stroma - e.g . however , myxoid adrenocortical tumors are an extremely rare morphologic variant of adrenocortical neoplasm ( 5 ) . to our knowledge , only 56 cases have been reported to date : 23 myxoid adrenocortical adenomas , 2 borderline myxoid adrenocortical neoplasms and 31 myxoid adrenocortical carcinomas . brown et al . ( 6 ) reviewed 300 adrenocortical neoplasms from the mayo clinic from 1965 to 1984 and reported that less than 3% of the carcinomas and 1% of the adenomas had myxoid components . a characteristic feature of these tumors is a myxoid stroma containing cords and nests of cells , some of which exhibit lumens imparting a pseudoglandular appearance ( 6 - 9 ) . the extent of the myxoid change in the reported cases is variable between 10% and more than 90% . it has been thought to be induced by degenerative changes or due to the production of the tumor cells themselves ( 5 , 7 ) . however , the latter is unlikely because myxoid material was not demonstrated in the cytoplasm of tumor cells in the previously reported cases ( 6 , 8) as well as in our case . several previous reports have been identified by us in the anglophone literature concerning myxoid adrenocortical adenoma . but these focused on pathological and not on radiological features . to our knowledge , the presented case is the first description of a radiologic finding of myxoid adrenocortical adenoma . an evaluation was not possible whether a distinction exists between the ct findings of the myxoid variant and a normal adrenal adenoma because neither an unenhanced ct nor a 10 or 15 minutes delayed contrast - enhanced ct were performed . as we mentioned above , the mr findings in the presented case were different from typical adrenal adenoma mr findings . it might be that the differences in the mr findings may be attributed to the myxoid changes because the aforementioned imaging features of the tumor were similar to those of other myxoid - containing soft tissue tumors . myxoid material is composed of a gelatinous matrix stroma with high levels of hyaluronic acid and immature collagen fibers ( 10 ) . because of its high water content , myxoid material appears hyperintense on t2-weighted mr images . additionally , a delayed progressive enhancement may correlate with an abundant myxoid matrix because the enlarged extracellular space in myxoid tissue results in greater accumulation of the contrast medium in the late phase ( 11 ) . thus , in our case seemed the high signal intensity on t2-weighted images and the delayed progressive enhancement of the tumor to be related to the myxoid components . chemical shift imaging is an mr imaging technique used to detect microscopic fat within an organ and is the most sensitive method of differentiating adenomas from other tumors of the adrenal gland ( 12 ) . microscopic amounts of fat can be detected by the observation of signal intensity loss on out - of - phase images . as demonstrated in our case , the large amount of myxoid matrix may possibly contribute to the lack of this characteristic feature on chemical shifting . with this radiologic findings the diagnostic considerations should include pheochromocytoma , ganglioneuroma , schwannoma and hemangioma . although the light bulb sign ( classic , very high signal on t2-weighted images ) is neither specific nor sensitive ( 13 ) , an adrenal mass with very high signal on t2-weighted images , as seen in our case , leads usually to the more likely diagnosis pheochromocytoma . additionally , pheochromocytomas are lipid - poor and will not decrease in signal intensity during out - of - phase sequences . however , pheochromocytomas have been described to be avidly enhanced on t1-weighted imaging after the administration of gadolinium - based contrast material . with this the capillary - rich framework of the tumor with a persistent enhancement on the delayed phase will be reflected ( 14 ) and thus , a delayed progressive enhancement is unlikely . furthermore , the clinical presentation , specific biochemical tests and functional imaging can be helpful in diagnosing pheochromocytoma . because of its similar imaging characteristics to those of myxoid adrenocortical adenoma , ganglioneuroma is one of the main differential diagnoses . histologically , ganglioneuromas show abundant myxoid matrices and a relatively small number of ganglion cells ( 15 , 16 ) . their t2 signal intensity depends on the proportion of myxoid stroma to cellular components and the amount of collagen fibers in the tumor . if the proportion of myxoid stroma is high , the signal intensity of the tumor on t2-weight images will be high also . thus , if a lesion contains a large amount of myxoid stroma it is expected to have a markedly high signal intensity on t2-weighted images . ( 17 ) reported that the enhancement pattern of ganglioneuroma presented a delayed progressive uptake . this might be explained by the presence of an abundance of myxoid matrices in the tumors , as shown in our case . a whorled appearance , one of the mr imaging characteristics of ganglioneuroma , was indicated by curvilinear bands of low signal intensity on t2-weighted images corresponding to interlacing bundles of schwann cells and collagen fibers within the tumor . although it is extremely rare , adrenal schwannoma and juxta - adrenal schwannoma should be considered also in the differential diagnosis . schwannomas have been described with not only a high intensity on t2-weighted images but also with an early mild enhancement and a progressive enhancement , similar to our case ( 18 ) . imaging findings of adrenal schwannoma have been reported to be similar to those of retroperitoneal schwannomas like a juxta - adrenal schwannoma ( 19 ) . additionally , due to its proximity to the adrenal gland there have been many case reports published of juxta - adrenal schwannoma simulating adrenal tumors . hence , juxta - adrenal schwannoma and adrenal schwannoma are entities to be considered in the differential diagnosis . a schwannoma that grows to a large size commonly undergoes degenerative changes , such as cyst formation , calcification and hemorrhage ( 20 ) . another extremely rare benign tumor , an adrenal hemangioma , may show similar imaging findings to those in our case also . the presence of calcification is relatively common but does n't always indicate an adrenal hemangioma ( 21 ) . however , due to the more prominent necrotic and fibrotic areas the delayed central filling is not as common as in hepatic hemangiomas . it might be helpful to differentiate it from other adrenal masses ( 22 ) . in summary , we have presented a pathological confirmed case of myxoid adrenocortical adenoma depicted on mr imaging . the awareness of the entity and its imaging findings might be helpful to avoid a misdiagnosis , although the imaging findings are substantial overlapping with various other adrenal masses and a myxoid adrenocortical adenoma is a rare disease .

we report a case of a 74-year - old female with myxoid adrenocortical adenoma which showed different magnetic resonance imaging findings compared to those of a typical adrenocortical adenoma . the myxoid change in the adrenocortical adenoma is a rare form of degeneration . it presents a considerable diagnostic challenge to both radiologists and clinicians because it can mimic other adrenal tumor types on imaging . the mri findings of the presented case included a high signal intensity on t2-weighted images similar to that of fluid and delayed progressive enhancement .

patients diagnosed with invasive bladder cancer ( bc ) in denmark are treated according to the national guidelines at one of the five uro - oncological centers . the aim of the danish bladder cancer database ( dablaca - data ) is to monitor treatment and general survival of patients diagnosed with bc in denmark . the goal of the database is to provide standards of the highest level of clinical evidence based on expert knowledge in the area . to guide the selection of quality indicators suitable for monitoring treatment and outcome of bc in denmark , a report reviewing the existing literature on the treatment of bc was made.1 in 2015 , dablaca - data consisted of three process indicators and ten outcome indicators concerning the diagnostic and treatment quality of patients diagnosed with bc in denmark . patients with noninvasive tumors ( urothelial papillomas or carcinoma in situ ) are not included in the database . to avoid extensive manual registration of data , the database is largely based on secondary data from the danish national registry of patients ( dnrp ) and the danish national pathology register ( dnpr).2,3 consequently , extensive validation of the data has been done to secure that the algorithms used to identify patients diagnosed with bc ( stage t1t4 ) and the treatment provided for these patients had sufficient quality . only variables regarding the cause of death , used for estimating cancer - specific mortality , and use of neoadjuvant chemotherapy are registered manually . patients are identified in the database by their personal security number , making it possible to link dablaca - data to other danish registries if so desired with a purpose of research or monitoring the quality of treatment . inclusion is based on the data generated by the algorithms , which subtracts patients from the dnrp and the dnpr on a regular basis from all hospitals and private clinics in denmark . in 2013 , 970 patients were referred or allocated to one of the five uro - oncological treatment centers treating bc in denmark and were included in the database . of the diagnosed patients , 26% were women . in 2013 , a total of 970 patients were diagnosed with bc in denmark . among them , 512 ( 53% ) were diagnosed with muscle - invasive bc ( mibc ) and 458 were diagnosed with non - muscle - invasive bc ( non - mibc ) . of the 970 bc patients included in 2013 , 698 were still alive 1 year after diagnosis , corresponding to a 1-year mortality rate of 28% ( 95% confidence interval [ ci ] : 2531 ) . the national standard had been set to 35% prior to evaluation based on a literature review.4 all five treatment centers met the standard . in 2013 , cancer - specific mortality 1 year after bc diagnosis was 25% ( 95% ci : 2227 ) . of the 970 patients , 226 had died because of bc within 1 year after diagnosis , whereas for 54 cases ( 6% ) , registration regarding the cause of death was missing . therefore , cancer - specific death may in reality be higher than 25% but not higher than 31% . the national standard was set at 15% or less.5 only one of the five treatment centers met the standard ( table 1 ) . a total of 300 patients , diagnosed in 2013 , underwent cystectomy due to bc . at cutoff date ( april 15 , 2015 ) , last date for data to be included in the preliminary report , 1-year follow - up after cystectomy was available for 270 patients , whereas data were missing for two patients . 230 were still alive 1 year after bc diagnosis , corresponding to a 1-year mortality of 24% after cystectomy due to bc ( 95% ci : 2128 ) ( table 2 ) . the standard was set at 30% as the highest.6 all treatment centers met the standard . in 2013 , 1-year cancer - specific mortality after cystectomy due to invasive bc was 7% ( 95% ci : 511 ) . a total of 19 patients were registered with bc as the cause of death , while 13 patients had missing data regarding the cause of death . the national standard was set at 12% or lower.7 all five centers met the standard . in all , 135 patients younger than 75 years were diagnosed with mibc ( stage t2t4 ) and underwent cystectomy . among them , the national standard was set at 25% or higher.6 all treatment centers met the standard . in 2013 , a total of 512 patients were diagnosed with mibc ( stage t2t4 ) in denmark . among them , 166 ( 32% ) were cystectomized within 6 months . the 90-day mortality in patients undergoing cystectomy due to invasive bc in denmark was found to be 3% ( 95% ci : 15 ) in 2013 . the national standard was set at 7% or below and was met by all five centers.8 for patients undergoing cystectomy due to bc in 2013 , the median postsurgical admission including primary length of stay and readmissions after cystectomy during the first 90 days was 11 days ( interquartile range [ iqr ] : 820 days ) . all admissions among the patients during the first 90 days were included , no matter the cause and the department . the national standard was set at a median admission of no more than 20 days.9,10 all five centers met this standard . in 2013 , 147 patients diagnosed with bc received their first radiation therapy with curative intent . of these , thus , 1-year mortality after curative radiation therapy due to bc was 32% ( 95% ci : 2439 ) . the national standard was set at 40% or lower.11 two of the five centers did not meet the standard ( 1-year mortality of 42% and 43% , respectively ) . the other three centers met the standard ( 27% , 32% , and 31% , respectively ) . among the 147 patients receiving curative - intended radiation therapy in 2013 , cancer - specific mortality was 23% . the national standard was set at 18% or less.12 only one of the five centers met the standard ( 11% ) ( table 3 ) . of the 970 bc patients included in 2013 , 698 were still alive 1 year after diagnosis , corresponding to a 1-year mortality rate of 28% ( 95% confidence interval [ ci ] : 2531 ) . the national standard had been set to 35% prior to evaluation based on a literature review.4 all five treatment centers met the standard . in 2013 , cancer - specific mortality 1 year after bc diagnosis was 25% ( 95% ci : 2227 ) . of the 970 patients , 226 had died because of bc within 1 year after diagnosis , whereas for 54 cases ( 6% ) , registration regarding the cause of death was missing . therefore , cancer - specific death may in reality be higher than 25% but not higher than 31% . the national standard was set at 15% or less.5 only one of the five treatment centers met the standard ( table 1 ) . a total of 300 patients , diagnosed in 2013 , underwent cystectomy due to bc . at cutoff date ( april 15 , 2015 ) , last date for data to be included in the preliminary report , 1-year follow - up after cystectomy was available for 270 patients , whereas data were missing for two patients . 230 were still alive 1 year after bc diagnosis , corresponding to a 1-year mortality of 24% after cystectomy due to bc ( 95% ci : 2128 ) ( table 2 ) . the standard was set at 30% as the highest.6 all treatment centers met the standard . in 2013 , 1-year cancer - specific mortality after cystectomy due to invasive bc was 7% ( 95% ci : 511 ) . a total of 19 patients were registered with bc as the cause of death , while 13 patients had missing data regarding the cause of death . the national standard was set at 12% or lower.7 all five centers met the standard . in all , 135 patients younger than 75 years were diagnosed with mibc ( stage t2t4 ) and underwent cystectomy . among them , 65 ( 48% ) received neoadjuvant chemotherapy prior to cystectomy . the national standard was set at 25% or higher.6 all treatment centers met the standard . in 2013 , a total of 512 patients were diagnosed with mibc ( stage t2t4 ) in denmark . among them , 166 ( 32% ) were cystectomized within 6 months . the 90-day mortality in patients undergoing cystectomy due to invasive bc in denmark was found to be 3% ( 95% ci : 15 ) in 2013 . the national standard was set at 7% or below and was met by all five centers.8 for patients undergoing cystectomy due to bc in 2013 , the median postsurgical admission including primary length of stay and readmissions after cystectomy during the first 90 days was 11 days ( interquartile range [ iqr ] : 820 days ) . all admissions among the patients during the first 90 days were included , no matter the cause and the department . the national standard was set at a median admission of no more than 20 days.9,10 all five centers met this standard . in 2013 , 147 patients diagnosed with bc received their first radiation therapy with curative intent . of these thus , 1-year mortality after curative radiation therapy due to bc was 32% ( 95% ci : 2439 ) . the national standard was set at 40% or lower.11 two of the five centers did not meet the standard ( 1-year mortality of 42% and 43% , respectively ) . the other three centers met the standard ( 27% , 32% , and 31% , respectively ) . among the 147 patients receiving curative - intended radiation therapy in 2013 , cancer - specific mortality was 23% . the national standard was set at 18% or less.12 only one of the five centers met the standard ( 11% ) ( table 3 ) . by april 15 , 2015 , patients registered in dablaca - data are followed for only 2 and 3 years ( 2012 and 2013 ) . the follow - up is continuous for each patient and ends at death of that patient . the data presented in this paper are based on a preliminary report including all patients diagnosed with bc in denmark in the period between january 1 , 2012 and december 31 , 2013 . dablaca - data is an ongoing database enrolling all patients diagnosed with bc in denmark from 2012 onward . a validation report based on the validation of algorithms prior to the final establishment of dablaca - data is in preparation . further studies based on the results found in dablaca - data are planned with a longer follow - up period . dablaca - data is able to identify danish bc patients and monitor treatment and mortality . the preliminary dablaca - data report showed comparable results between the five uro - oncological treatment centers responsible for the treatment of all patients diagnosed with bc in denmark . differences in mortality among the bc patients may reflect differences in the general mortality in different regions of denmark . the standard for cancer - specific mortality 1 year after bc diagnosis ( 15% ) is believed to be underestimated . most studies of the existing literature focus on cancer - specific mortality in patients who had received treatment due to bc . the dablaca - data includes all patients with bc ; hence , 15% is an underestimate in this database , though 15% is the best estimate when reviewing the literature . the high 1-year survival rate after cystectomy could reflect the fact that all the five uro - oncological centers have high and uniform standards for selecting patients for cystectomy and high quality of the surgical procedure . the board members of dablaca - data expect to see more variation in cancer - specific mortality over time , due to longer follow - up periods . until now , the treatment strategy has differed concerning the trend to choose radiation therapy . all five centers strive toward more uniform treatment protocols in the future than in the past . the median length of stay in a hospital post - cystectomy was very low compared to the standard . this again may reflect the high and uniform surgical standard among the five uro - oncological centers in denmark . the variation seen among the centers regarding cancer - specific mortality after curative - intended radiotherapy may reflect differences in patient selection to radiotherapy . the fact that two of the five centers were slightly under the standard concerning 1-year survival after curative - intended radiotherapy is believed to be insignificant .

aim of databasethe aim of the danish bladder cancer database ( dablaca - data ) is to monitor the treatment of all patients diagnosed with invasive bladder cancer ( bc ) in denmark.study populationall patients diagnosed with bc in denmark from 2012 onward were included in the study . results presented in this paper are predominantly from the 2013 population.main variablesin 2013 , 970 patients were diagnosed with bc in denmark and were included in a preliminary report from the database . a total of 458 ( 47% ) patients were diagnosed with non - muscle - invasive bc ( non - mibc ) and 512 ( 53% ) were diagnosed with muscle - invasive bc ( mibc ) . a total of 300 ( 31% ) patients underwent cystectomy . among the 135 patients diagnosed with mibc , who were 75 years of age or younger , 67 ( 50% ) received neoadjuvent chemotherapy prior to cystectomy . in 2013 , a total of 147 patients were treated with curative - intended radiation therapy.descriptive dataone - year mortality was 28% ( 95% confidence interval [ ci ] : 1521 ) . one - year cancer - specific mortality was 25% ( 95% ci : 2227% ) . one - year mortality after cystectomy was 14% ( 95% ci : 1018 ) . ninety - day mortality after cystectomy was 3% ( 95% ci : 15 ) in 2013 . one - year mortality following curative - intended radiation therapy was 32% ( 95% ci : 2439 ) and 1-year cancer - specific mortality was 23% ( 95% ci : 1631 ) in 2013.conclusionthis preliminary dablaca - data report showed that the treatment of mibc in denmark overall meet high international academic standards . the database is able to identify danish bc patients and monitor treatment and mortality . in the future , dablaca - data will be a valuable data source and expansive observational studies on bc will be available .

full - thickness wounds often need complex procedures for defect closures , in particular when bone , cartilage or tendons are exposed . in recent years , the spectrum of flaps and grafts has been expanded by dermal templates and tissue engineering . matriderm ( dr . suwelack skin and healthcare ltd . , billerbeck , germany ) is a dermal substitute consisting of a non - cross - linked collagen matrix supplemented by elastin hydrolysate of bovine origin . in experimental models , clinical trials with a long - term evaluation demonstrated no difference in the scar elasticity between the described dermal template and split - thickness grafts alone . the healing rate was improved . the major advantage of dermal templates results from the coverage of bone , cartilage or tendon allowing an immediate skin grafting in the same session.[57 ] we present herein a series of patients treated with the collagen elastin matrix and split - skin mesh graft transplantation in a one - stage procedure . twenty - three patients ( 15 males and 8 females ) with 27 wounds were enrolled in this prospective single - centre observational study ( including 5 patients previously reported ) . the age range was 2189 years , with a mean of 74.8 17.2 years . the wounds were either acute ( after surgery ) or chronic ( like leg ulcers ) . all wounds were characterized by exposed bone , cartilage and/or tendons . in the majority of patients , previous transplants ( sometimes multiple ) patients with acute wounds were those who underwent delayed mohs surgery for facial or scalp non - melanoma skin cancer ( nmsc ) and defects where standard surgical procedures like flaps or grafts were impossible due to morbidity , surgical reasons or due to patient 's wishes ( n = 9 ) . the tumour diagnosis was basal cell carcinoma ( bcc ) in four and squamous cell carcinoma ( scc ) in two patients . all facial tumours were localized on the nose , with two nmsc cases of the scalp . one patient suffered from calcifying prepatellar bursitis and another patient presented with a longstanding burn scar of the lower leg suggestive of malignant transformation . the aetiology of the wounds was venous ( 3 ) , mixed arterio - venous ( 7 ) , post - necrotizing fasciitis ( 1 ) , post - surgical ( 2 ) , pressure sores due to paraplegia ( 2 ) and pyoderma gangrenosum ( 1 ) . in all of these wounds , tendon and/or bone the location of wounds was either the foot ( n = 6 ) or the lower leg ( n = 10 ) . , all other measures to improve perfusion had been tried to the bottom of the matter . in five ulcers , wound bed preparation was supported by negative pressure treatment ( vac ; kci licensing , inc . , san antonio , tx , usa ) before to shorten the time to surgery . the dermal collagen elastin matrix ( matriderm ; dr . suwelack skin and healthcare ltd . , billerbeck , germany ) was used in sheets of 74 52 1 mm . matriderm was cut to size and regenerated using ringer 's solution for a couple of minutes until the sheets became translucent . full - thickness skin transplants were used for facial defects . for all other types of wounds , the transplants were fixed with non - absorbable sutures ( face ) or staples ( all other regions ) . as a dressing , silicone sheets ( mepitel ; mlnlycke health care , gothenburg , sweden ) and cotton swaps or compresses were applied . the transplants were covered by silicone sheets , microporous foam ( granufoam ) and treated with intermittent negative pressure ( -125 mmhg ) using the vac therapy system for 7 days . we used this technique in cases were due to anatomical and pathophysiological reasons , transplant survival was critical . perioperative antibiosis was chosen in all facial wounds and in patients with previous severe infections ( like necrotizing fasciitis ) or immunocompromising disorders like serious diabetes mellitus . the drugs were chosen according an antibiogram for leg ulcers . for facial defects , cefuroxim 500 mg was given twice daily . all patients had one or more comorbidities including diabetes , chronic ischaemic heart disease , hypertension , ankylosis , paresis and depression treated by appropriate drug therapy . the use of the dermal template resulted in a complete and stable granulation in 100% of wounds . in the case of complete graft take , the follow - up for 620 months demonstrated not only stability of the wound closure but also a very good aesthetic outcome [ figures 3 and 4 ] . of the two scalp lesions , one healed completely while the other one a very large wound ( 375 cm ) showed only a partial graft take after 2 weeks . patient 14 , arteriovenous leg ulcer with exposed tendons ; ( a ) before treatment ; ( b ) shave excision ; ( c ) matriderm on the wound ; ( d ) split - skin mesh graft ; ( e ) one year later with stable healing patient 2 . calcifying prepatellar bursitis ; ( a ) before surgery ; ( b ) soft tissue defect after complete excision ; ( c ) after three weeks patient 7 . ( a ) after mohs surgery of basal cell carcinoma , larger nasal defect with exposed cartilage ; ( b ) one year after sandwich transplantation patient 8 . ( a ) sandwich transplant after mohs surgery for basal cell carcinoma of the nose . ( b ) about one year later from all soft tissue defects and chronic wounds treated , 17 showed a complete closure ( complete remission , cr ) and 19 achieved a complete granulation with an incomplete closure ( partial remission , pr ; [ table 1 ] ) . of 10 patients with a visual analogue pain score of > 6 , all reported a marked pain relief , but 5 became pain free . the effect on pain was not restricted to a cr of the soft tissue defects / chronic wounds . patients demographics , underlying disease and outcome after sandwich transplantation one patient developed a secondary infection 2 weeks after surgery resulting in a loss of the transplant . the final outcome , however , was a complete wound closure after 8 weeks of conventional good ulcer care . the final outcome of the other three patients with incomplete graft take was a complete closure after 8 weeks of conservative treatment ( n = 2 ) and reduction of the wound area by 80% after 8 weeks of good ulcer care ( n = 1 ) . the transplants did not show any significant shrinkage during follow - up . in a single patient with a surgical wound on the tip of the nose , the transplant failed , but granulation was good and the wound area decreased about 50% in 3 weeks . because there was a partial sorption of the soft tissue resulting in a 2-mm defect , second surgery with a primary wound closure by sutures no adverse events were noted due to the dermal template usage like biocompatibility problems or granuloma formation . the volume of the template and , in particular , the thickness , does not seem to diminish during the healing process . in soft tissue defects , a wound closure often is possible by transplants or flaps . in other cases , alloderm ( kci lifecell corp . , san antonio , tx , usa ) is a human allogeneic dermal matrix with an intact basement membrane . plainsboro , nj , usa ) is a bovine collagen glycosaminoglycan ( chondroitin-6-sulphate ) copolymer with silicone backing . oasis consists of a collagen matrix from porcine small intestinal submucosa ( cook biotech , west lafayette , in , usa ) . there are several products with a combination of matrix components that have been evaluated in vitro and in vivo . scaffolds composed of different ratios of type i comb collagen and chitosan with added hyaluronic acid have been investigated by lin et al . the microstructural observation of the composite scaffolds demonstrated a high pore interconnectivity with the pore size negatively influenced by chitosan . combined dermal matrix structures using collagen , chondroitin sulphate and hyaluronic acid have been developed by wang et al . morphological observation showed that the novel scaffold had uniform and widely interconnected pores and an adequate porosity of about 94% . a porous pullulan collagen hydrogel matrix has been developed recently by stanford university that supports the early phases of wound healing . pullulan is a linear glucosic polysaccharide produced by the polymorphic fungus aureobasidium pullulans , which has long been applied for various applications from food additives . matriderm is composed of elastin and native collagen ( types iii , iv , and v ) of bovine origin . elastin and collagen are two major types of fibrous structures found in the human dermal tissue . in an experimental head - to - head study , matriderm and integra have been evaluated to support split - skin mesh grafting . both products yielded comparable results . the collagen elastin matrix has been used primarily in burn wounds.[1320 ] the technique allows skin grafting above exposed tendons and bony structures . the biomechanical properties of the transplanted skin seem to be much improved compared to grafts alone that may lead to contractures and diminished elasticity . more recently , the same technique has been employed for cranial defects after traffic accidents , defects in skin tumour surgery,[82224 ] defects after various injuries of the hand , painful plantar callosities and various other chronic and postoperative soft tissue wounds . riml et al . observed better outcome with a perichondrodermal composite graft and reported two patients developing fistulae after matriderm - aided skin transplantation . we observed a complete graft take in three of four patients , but further studies are necessary . even if complete graft take is not always possible with our technique , granulation could be improved in all cases . matriderm is a valuable tool when used as a template for split - skin mesh grafts for defect closures when exposed bones , cartilage and tendons would not support a direct transplantation . it is remarkable that the sandwich technique described herein can be combined with intermittent negative pressure to support graft survival . pain is a major factor in chronic wounds that has a substantial negative impact on quality of life . we suppose that the pain relief is supported by wound dressing - like qualities of the dermal matrix and improved granulation , but further studies would be necessary to better explain the clinical observation . in conclusion , collagen matrix can be used in a variety of clinical situations to support defect closures and pain relief in a simple , reliable and fast way with excellent safety .

background : a full - thickness soft tissue defect closure often needs complex procedures . the use of dermal templates can be helpful in improving the outcome.objective:the objective was to evaluate a sandwich technique combining the dermal collagen elastin matrix with skin grafts in a one - stage procedure.materials and methods : twenty - three patients with 27 wounds were enrolled in this prospective single - centre observational study . the mean age was 74.8 17.2 years . included were full - thickness defects with exposed bone , cartilage and/ or tendons . the dermal collagen elastin matrix was applied onto the wound bed accomplished by skin transplants , i.e. sandwich transplantation . in six wounds , the transplants were treated with intermittent negative pressure therapy.results:the size of defects was 875 cm2 . the use of the dermal template resulted in a complete and stable granulation in 100% of wounds . seventeen defects showed a complete closure and 19 achieved a complete granulation with an incomplete closure . there was a marked pain relief . no adverse events were noted due to the dermal template usage.conclusions:sandwich transplantation with the collagen elastin matrix is a useful tool when dealing with full - thickness soft tissue defects with exposed bone , cartilage or tendons .

piperine , a nitrogenous pungent substance , is an alkaloid found in important and oldest spices , namely , piper nigrum ( black peppers ) and piper longum ( long peppers ) . . stated that piperine is naturally occurring organic compound that belongs to family piperaceae . the fruits of piperine possess antidepressant effects , hepatoprotective effects , antioxidant activity , antitumour effects , antibacterial effects , and anticonvulsant effects [ 2 , 3 ] . piperine also has the capability of reducing inflammation , relieving pain , improving digestion , and enhancing the bioavailability . piperine is extensively used in medicinal field for years due to various medicinal properties including painkiller , antioxidant , and bioavailability enhancer . molecular imprinting technology ( mit ) is used to design molecular recognition materials because it is capable of mimicking natural recognition entities like antibodies and biological receptors [ 514 ] . the original concept of molecular imprinting is developed by linus pauling in 1940s , but wulff and sarhan stimulated the interest in imprinting materials . according to vlatakis et al . , in the early 1980s , the molecular imprinting polymers ( mips ) were successfully prepared by using noncovalent mit . molecular imprinting is a universal method to produce polymers with high affinity binding sites for organic , inorganic , biological , and chemical molecules or ions . mips allow the functional and crosslinking monomers to copolymerize in the presence of the target compound or known as template . molecular imprinting polymers can be prepared by various methods such as bulk polymerization , electropolymerization , suspension polymerization , emulsion polymerization , two - step polymerization , and precipitation polymerization . zhou et al . mentioned that the controlled / living radical polymerization ( crp ) is used to prepare mip microspheres as it permits more precise control over the molecular weight , composition , and end group functionality of the obtained polymers [ 2427 ] . mips show excellent thermal and chemical stability and can be used in aggressive media . according to yan and row , mips have many advantages over their biological counterparts including inexpensive , simple preparation , storage stability , repeated operations without loss of activity , high mechanical strength , durability to heat and pressure , and applicability in harsh chemical media . lai et al . stated that mips have been used in important application such as chemical sensors [ 30 , 31 ] , capillary electrophoresis and electrochromatography , catalysis , hplc stationary phases [ 3439 ] , and solid - phase extraction ( spe ) . in this research noncovalent imprinting or self - assembly approach the template and a functional monomer interact by noncovalent interactions in the prepolymerization mixture . according to spivak , noncovalent is simpler molecular imprinting method as compared to covalent and semicovalent because it involves synthetic steps toward the prepolymer complex . in this way interaction between the monomer and template this method has been used to produce imprinted polymers of cinnamic acid . in this research as an application these imprinted polymers are used in extraction of piperine from spiked urine sample . ( united states ) , acrylic acid ( aa ) was bought from nippon shokubai co. ltd . ( japan ) , ethylene glycol dimethacrylate ( egdma ) was purchased from sigma - aldrich co. ltd . ( united states ) , acetonitrile ( acn ) was obtained from kunshan yalong trading co. ltd . ( china ) , 2 , 2-azobisisobutyronitrile ( aibn ) was obtained from sigma - aldrich co. ltd . ( united states ) , methanol ( meoh ) was obtained from nuasa kimia sejati co. ( indonesia ) , acetic acid ( ch3cooh ) was purchased from alpha chemika ( india ) , potassium bromide ( kbr ) was obtained from powder pack chem co. ( india ) , and hexane was obtained from seidler chemical co. ( united states ) . scanning electron microscope ( jeol jsm-6390la ) was used to study the morphology of polymer particles . shaker ( nb-101mt ) was used to allow the rebinding of polymer particles with template . shimadzu lc-20a , a reversed - phase high performance liquid chromatography ( rp - hplc ) , was used to evaluate the batch binding of polymer particles . . 0.5 mmol of template ( piperine ) , 2 mmol of monomer ( aa ) , 8 mmol of cross - linker ( egdma ) , 75 ml of porogen ( acn ) , and 0.011 g of initiator ( aibn ) were added into 150 ml conical flask , respectively . the mixture was sonicated for 10 minutes in order to remove bubbles and allow complete dissolution . then , the conical flask containing mixture was placed in a bucket of ice cubes and the reaction mixture was purged with nitrogen gas for 15 minutes . ice cubes were used in this experiment to allow a suitable environment for noncovalent interactions between piperine and acrylic acid . the polymerization was conducted for 6 hours , initially temperature was maintained at 60c for the first three hours , and later temperature was raised up to 80c and maintained for another three hours in order to complete the polymerization . the produced polymer particles were extracted out by using the centrifugation at 5000 rpm for 10 min . the template was removed by washing the mips successively in the mixture of methanol and acetic acid ( 9 : 1 , v / v ) until the template was not detected by rp - hplc at 270 nm . the hplc was conducted by using the c18 column ( 250 4 mm , 5 m ) with the mobile phase consisting of acetonitrile , distilled water , and acetic acid in the ratio of 60 : 39.5 : 0.5 , v / v / v , respectively . the flow rate was set at 0.6 ml / min with uv detection at 270 nm and injection volume was set at 20 l . the nonimprinted polymeric particles ( nips ) were prepared in the same way without the addition of the template molecule . the similar procedure was used for the synthesis of different molecular imprinted polymers of piperine with varying composition of aa and egdma ( table 1 ) by precipitation polymerization , namely , mip 2 , mip 3 , and mip 4 for mips as well as nip . a series of 150 ml five conical flasks containing 0.5 g of the mip ( mip 1 , mip 2 , mip 3 , and mip 4 ) and nip beads were added with a 75 ml of acetonitrile containing 0.5 mmol of piperine . the conical flasks were shaken on the shaker at 100 rpm and the samples were collected at different time intervals ( 0 , 30 , 60 , 90 , 120 , 150 , 240 , and 360 minutes ) . the collected samples were centrifuged at 5000 rpm for 10 minutes in order to remove any suspended particles and supernatant was used for further analysis . the binding capacity of mips and nip of piperine was calculated by using the following equation:(1)binding capacity%=cicfci100,where ci is the initial piperine concentration in the solution and cf is the final piperine concentration in the solution . a 150 ml conical flask containing 0.5 g of the mip 3 beads was added and a solution of 75 ml of acetonitrile containing equal concentration ( 0.5 mmol ) of piperine and caffeine . both of the conical flasks were shaken on the shaker at 100 rpm and the samples were collected at different time intervals ( 0 , 30 , 60 , 90 , 120 , 150 , 240 , and 360 minutes ) . after shaking at the appropriate time intervals , all the samples were centrifuged at 5000 rpm for 10 minutes . the distribution ratios ( ml g ) of piperine between the mips or nip in the porogen ( acetonitrile ) were determined by the following equation:(2)distribution ratio : kd = cicfvcim , where ci is the initial piperine concentration in the solution , cf is the final piperine concentration in the solution , v is the volume of porogen ( acn ) used , and m is the mass of mip / nip used . the selectivity coefficients for piperine relative to binding competitor caffeine for mip 3 and nip can be calculated by(3)selectivity coefficient : kpiperine / caffeinesel = kdpiperinekdcaffeine , where kd is the batch binding assay of mip / nip for piperine and kd is the batch binding assay of mip / nip for caffeine . the relative selectivity coefficient ( k ) was determined by the following equation:(4)k=kmip 3knip . urine sample was first centrifuged and filtered and then spiked with a piperine to get a concentration of 50 ppm . after this 50 ml of spiked urine sample was added in flask containing 0.5 g of mip 3 . synthesis of microsphere imprinted polymers is a very crucial step in order to produce uniform shape and size of particles . previous studies revealed that various preparation methods have been carried out for the preparation of polymer microspheres such as the synthesis of polymer microspheres by dispersion and emulsion polymerization , where the surfactants in aqueous solution and stabilizers in organic solution are crucial to stabilize the polymer phase and prevent the aggregation of particles . precipitation polymerization can form polymer microspheres with constant size and shape that can lead to narrow dispersion , without the need for any added surfactant or stabilizer [ 4649 ] . in this research we have successfully produced imprinted polymer microspheres by precipitation method in the acetonitrile ( porogen ) . ir analysis is an important chemical characterization method to detect the functional groups present in a compound . the ft - ir spectra of different mips and nip are shown in figure 1 . based on figure 1 , small peak in the range of 3519.29 cm to 3613.06 cm attributed to the vibration mode of o the bands in the range of 2926.75 cm to 2996.02 cm and 2854.76 cm to 2957.24 cm showed the vibration mode of c h stretching of aliphatic compound as well as asymmetric and symmetric ch2 stretching in mips and nip . strong peaks at 1726.11 cm to 1736.42 cm indicated the presence of c = o of acrylic acid . the vibration mode of c = c stretching of aromatic compound can be found within 1635.37 cm to 1636.84 cm . the ch2 bending at 1450.82 cm to 1452.70 cm indicated the presence of alkane group in mips and nip . n stretching of mips and nips after leaching was detected at 1388.44 cm to 1390.06 cm . peaks of mips and nip at 1253.88 cm to 1259.61 cm showed the vibration mode of o ch2o symmetric stretching . small band at 1035.88 cm to 1050.59 cm in mips and nip explained the presence of symmetric stretching of = c o c . the vibration mode of c h stretching of aliphatic compound can be observed at 2954.09 cm to 2985.19 cm . sem analysis is a very important morphological study for polymer particles that provides the idea about the shape and size . , uniform size of imprinted polymers can be formed by using a noncovalent imprinting approach by precipitation polymerization . arabzadeh and abdouss stated that interaction between monomer and template could be another factor that contributed to uniform size distribution with clean surfaces . research conducted by park et al . mentioned that there are various factors that affect the production of uniform polymer microspheres including volume of solvent , reaction of solvent , and presence of template ion . excess solvent or porogen used in the synthesis of polymer particles will produce highly uniform polymer microspheres with imprinted binding sites . rp - hplc was used to evaluate the binding efficiency of mips and nip of piperine . figure 3 depicts the binding capacity of different mips and nip at different time intervals . mip 3 showed the highest binding capacity ( 84.94% ) , followed by mip 2 ( 75.86% ) , mip 1 ( 69.40% ) , and mip 4 ( 60.80% ) . mip 3 contains a higher amount of monomer ratio as compared to mip 1 and mip 2 but mip 4 contains a higher amount of cross - linker . in this study increasing amount of monomer would produce specific interaction sites with the piperine and hence rebinding efficiency was also increased . but the increase in amount of cross - linker has produced a reverse effect as can be seen in mip 4 . if we compare the mips with nip it is clear from figure 3 the binding capacity is low . this can be conferred that nip does not contain any binding site complimentary with the piperine . in order to evaluate the properties of mip of piperine as a sensing material , two compounds ( piperine and caffeine ) were tested using both mip 3 and nip . the distribution ratio of piperine in both mip 3 and nip was higher than the distribution ratio of caffeine in both mip 3 and nip , resulting in higher selectivity coefficient of piperine than that of caffeine in both mip 3 and nip ( table 2 ) . the results indicate that the imprinted polymer has got complimentary binding sites or cavities with the piperine as compared to caffeine . the extensive use of piperine in medicine and spices has generated this idea to first use the selected mip 3 in the extraction of piperine from urine . this will provide us a way forward to expand the application of these imprinted polymer particles . from this study it was found that about 81.18% of piperine was successfully extracted from the spiked urine sample . the binding efficiencies of mips and nip of piperine were evaluated by batch binding assay . mip 3 exhibited the highest binding capacity ( 84.94% ) as compared to nip ( 40% ) .

molecularly imprinted polymer ( mip ) microspheres for piperine were synthesized by precipitation polymerization with a noncovalent approach . in this research piperine was used as a template , acrylic acid as a functional monomer , ethylene glycol dimethacrylate as a cross - linker , and 2,2-azobisisobutyronitrile ( aibn ) as an initiator and acetonitrile as a solvent . the imprinted and nonimprinted polymer particles were characterized by using fourier transform infrared spectroscopy ( ft - ir ) and scanning electron microscopy ( sem ) . the synthesized polymer particles were further evaluated for their rebinding efficiency by batch binding assay . the highly selected imprinted polymer for piperine was mip 3 with a composition ( molar ratio ) of 0.5 : 3 : 8 , template : monomer : cross - linker , respectively . the mip 3 exhibits highest binding capacity ( 84.94% ) as compared to other imprinted and nonimprinted polymers . the extraction efficiency of highly selected imprinted polymer of piperine from spiked urine was above 80% .

taxine - derived alkaloids , taxane - derived substances , and glycosides seem to be responsible for the toxicity of taxus spp . by blocking microtubule , sodium and calcium channels causing conduction abnormalities . we report the case of a 43-year - old man who ingested , for suicidal purposes , common ( or european ) yew leaves ( taxus baccata ) and presented severe hypokalemia , ventricular arrhythmias with hemodynamic instability accompanied by severe multiple organ dysfunction syndrome , including respiratory insufficiency , renal failure , acid - base imbalance with severe hypokalemia , hepatic dysfunction and coma , which led to death 12 hours after taxus baccata ingestion . in this particular case , the cardiac electrical instability was definitely maintained by several causes , including severe hypokalemia , which has not been previously reported as related to taxus poisoning . the occurrence of severe hypokalemia needs further attention in cases with taxus poisoning as its immediate treatment might increase survival chances . the european yew ( taxus baccata , family : taxaceae ) is an evergreen poisonous coniferous tree . the cardiotoxic effects of the yew plant have been known for more than 2000 years . lethal oral doses of yew leaves in humans are 0.61.3 g / kg , corresponding to 3.06.5 mg taxines / kg . the taxoids are metabolized by liver enzymes and excreted into the bile . only a small portion is excreted in urine . taxine - derived alkaloids ( e.g. , taxine a and b , isotaxine b , paclitaxel ) , taxane - derived substances ( e.g. , taxol a and b ) , and glycosides ( e.g. , taxicatine ) seem to be responsible for the toxicity of taxus baccata . taxines e.g. taxine b block sodium and calcium channels , preferentially in cardiac myocytes , thus causing conduction abnormalities . the first symptoms of taxus poisoning ( nausea , vomiting , dizziness , diffuse abdominal pain , tachycardia , muscle weakness and confusion ) begin after about one hour . these symptoms are followed by cardiovascular effects such as bradycardia , and then ventricular tachycardia with severe ventricular arrhythmias and episodes of ventricular fibrillation , severe hypotension and death . a 43-year - old man , without coexisting disease , ingested for suicidal purposes common yew tree leaves ( taxus baccata ) , around 9:30 p.m. the family called the ambulance at 11:11 p.m. at their arrival the patient was obtunded ( glasgow coma scale 12 points ) , non - responsive , hemodynamically stable , with a bp of 110/60 mmhg , sinus rhythm , 86 beats / minute , 12 respirations / minute . one peripheral venous catheter was inserted , 500 ml of ringer solution was administered and the monitored transport to the emergency department was performed . at arrival in the emergency department ( 11:45 p.m. ) , the patient was comatose ( gcs of 7 points ) , presented miosis . his blood pressure was 155/90 mm hg , heart rate 115/min ( sinus tachycardia with qrs waves of 0.13 seconds , qtc interval 0.36 seconds ) , no respiratory distress . the decision of rapid sequence intubation with etomidate and suxamethonium was made , considering airway protection . the patient was ventilated in simv mode ( tidal volume 600 ml , imposed mandatory respiratory frequency 12/minute , with the persistence of 6 spontaneous breaths , peep 5 cm h20 , fraction of inspired oxygen ( fio2 ) 60% ) . a nasogastric tube was put in place after securing the airway and gastric lavage was performed with the evacuation of gastric contents with tisa leaves . intravenous potassium replacement therapy was initiated ( 20 meq / hour ) ; 1000 ml ringer solution was given and the gastric antisecretory therapy was started ( ranitidine 50 mg iv ) . at 11:57 cpr was initiated : the first 200 j biphasic electric shock was given right after the patient went into asystole . the patient went from asystole into pulseless ventricular tachycardia , and a second 200j biphasic electric shock was given . after 20 minutes of cpr the patient presented central pulse , sinus tachycardia ( 120 b / min ) , widened qrs waves and blood pressure 60/40 mm hg . a central venous line was put in place ( central venous pressure 12 cmh2o ) and inotropic support with dopamine 15 micrograms / kg / min was initiated . despite continuous support with increasing doses of dopamine , blood pressure values continued to deteriorate further and continuous infusion of epinephrine was initiated , in increasing doses up to 10 micrograms / min . the patient was transferred in the intensive care department : comatose , intubated , with 8 spontaneous breaths being present , mechanically ventilated in simv mode ( tidal volume 600 ml , mandatory respiratory frequency 14/minute , fio2 80% ) . repeated laboratory values are presented in table i. the blood gas analysis revealed metabolic acidosis : ph=7.21 , pao2=68 mmhg , paco2=39 mmhg , hco3=15 , be= 11 , k=3 meq / l , ca=1.06 meq / l , cl=107 meq / l , lactate 80 mg / dl ; 100 ml nahco3 was repeatedly administered . the patient continued to be hemodinamically unstable , blood pressure 60/45 mmhg , with decreasing heart rate ( 38 beats per min ) for which i.v . the persistent low heart rate required immediate temporary external electrical pacing of the heart : demand mode , frequency of 60/min , intensity of 60 ma , with electrical and mechanical capture . after 30 minutes , the patient presented again ventricular fibrillation and cpr was again initiated , without favorable outcome . time of death : 10 a.m. pulmonary congestion and edema , with eosinophilic contents of the alveoli , cerebral edema and enlarged liver with acute dystrophy were found on autopsy . most cases have been described in young subjects ingesting taxus needles in suicidal intention . as in the present case , the initial symptoms ( nausea , vomiting , abdominal pains , dizziness ) are followed by bradycardia , severe ventricular arrhythmias and episodes of ventricular fibrillation , severe hypotension and death . orogastric lavage and the administration of activated charcoal limit further absorption of toxins from the gut . the development of hypotension , complete heart block , and bradycardia indicates a poor prognosis . in previous cases , considering the large volume of distribution of alkaloids extracted from taxus ( e.g. paclitaxel ) , and the physico - chemical properties of taxines ( high molecular weight and relative water insolubility ) , effective removal of taxines by haemodialysis appears unlikely . our patient presented severe multiple organ dysfunction syndrome , including circulatory shock , respiratory insufficiency , renal failure , severe acid - base imbalance , hepatic dysfunction and coma , that resulted in the occurrence of death very soon after taxus ingestion . in our patient the patient presented polymorphic ventricular tachycardia which is more often associated with long qtc interval . in this particular case , to our knowledge , severe hypokalemia has not been previously reported in case reports concerning taxus poisoning . the metabolic acidosis associated with severe hypokalemia definitely contributed to the complex arrhythmias in our case . in conclusion , the occurrence of severe hypokalemia needs further attention in cases with taxus poisoning as its immediate treatment might increase survival chances . immediate and aggressive supportive treatment is necessary and all factors maintaining organ dysfunctions have to be addressed .

contexttaxine - derived alkaloids , taxane - derived substances , and glycosides seem to be responsible for the toxicity of taxus spp . by blocking microtubule , sodium and calcium channels causing conduction abnormalities . cases with taxus baccata acute intoxication have rarely been reported.case detailswe report the case of a 43-year - old man who ingested , for suicidal purposes , common ( or european ) yew leaves ( taxus baccata ) and presented severe hypokalemia , ventricular arrhythmias with hemodynamic instability accompanied by severe multiple organ dysfunction syndrome , including respiratory insufficiency , renal failure , acid - base imbalance with severe hypokalemia , hepatic dysfunction and coma , which led to death 12 hours after taxus baccata ingestion.conclusionin this particular case , the cardiac electrical instability was definitely maintained by several causes , including severe hypokalemia , which has not been previously reported as related to taxus poisoning . the metabolic acidosis associated with severe hypokalemia definitely contributed to the complex arrhythmias . the occurrence of severe hypokalemia needs further attention in cases with taxus poisoning as its immediate treatment might increase survival chances .

rayer first reported renal vein thrombosis associated with nephrotic syndrome in 1837 , thrombosis is known to be one of the main complications of nephrotic syndrome with the renal vein being the most frequent site.[15 ] awareness of pathogenesis and assessment of the risk factors for arterial thrombosis are required to allow appropriate management of these patients . there are no reliable risk factors to suggest anticoagulation therapy in patients with nephrotic syndrome and prophylactic anticoagulants remain controversial . our case once again highlights the dilemma in managing these patients ; however it also throws some light on management . a 68-year - old retired office manager ( male ) was admitted to the hospital with worsening epigastric pain , clay colored stools , nausea , and ankle swelling . he also complained of weakness and tingling in left arm , slurred speech and difficulty getting words out . his risk factor for cerebro - vascular disease included only hypertension that was well - controlled with felodipine . on examination , there was non - pitting pedal edema , right - sided cerebellar signs ( past pointing , dysdiadochokinesia ) , left hemiparesis , and expressive dysphasia . urine dipstick had 2 + blood , 4 + protein with urinary protein creatinine ratio of 1401 ( approx . computed tomography ( ct ) and magnetic resonance imaging ( mri ) of the brain showed widespread cerebral infarcts in the middle cerebral and posterior cerebral artery territory [ figures 1 and 2 ] . protein c and s levels were at lower end of normal range that was considered secondary to renal loss rather than primary deficiency . ct of brain showing infarcts in middle cerebral artery infarcts mri of brain showing cerebellar infarct haematoxylin and eosin stain : ( a ) shows normal glomerulus . ( b ) shows vacuolated renal tubular cells suggesting heavy proteinuria and uptake of albumin by cells siver stain of glomerulus showing normal basement membrane electron microscopy of glomerulus showing flattening of podocyte foot processes other investigations for hypercoagulable state such as anti - cardiolipin antibodies , factor v leiden mutation were within normal limits . contrast ct of chest / abdomen / pelvis looking for malignancy was within normal limits . infarcts were considered secondary to arterial thombosis as a result of hypercoagulable state seen in nephrotic syndrome . patient did not receive any prophylactic or therapeutic anticoagulation with heparin or low molecular weight heparin during his hospital stay . nephrotic syndrome was treated with three doses of intravenous methyl prednisone and was started on oral prednisone at 1 mg / kg that was tapered down over a period of 3 months . there was good response to treatment with resolution of proteinuria and improvement in renal function . nephrotic syndrome is one of the secondary causes of hypercoaguable state.[68 ] hypercoagulable state can be either primary or secondary . primary causes are due to deficiencies of anti - thrombin iii , protein c or protein s. other secondary causes include : malignancy , pregnancy , and oral contraceptive use . thrombotic complications in patients with nephrotic syndrome occur in both venous and arterial systems , with the most common being renal vein thrombosis . in adults , the majority of thromboses are venous and arterial thromboses are more common in children . review of literature shows that hypercoagulable state is greater in nephrotic syndrome secondary to membranous nephropathy . in our case , there are no data on the absolute risk of development of thromboembolism , but an observational study shows the risk of vascular thrombosis is greatest within the first 6 months of diagnosis , with an annual incidence rate of 1.48% for arterial thromboembolism . cerebral infarction in nephrotic syndrome is rare and has been previously reported in very few cases . described two adult patients , 34 and 36 years of age , who presented with acute cerebral infarction and were found to have a hypercoagulable state due to nephrotic syndrome . although it is not clear why nephrotic syndrome causes a hypercoagulable state , there have been many hypothesis for its mechanism , such as urinary loss of antithrombin iii , factor xii deficiency , protein c , and protein s deficiency , increased platelet aggregation , and increased hepatic production clotting factors.[1316 ] most authors report increased fibrinogen levels . treatment of arterial thrombosis involves anticoagulation with either conventional heparin or low molecular weight heparin or warfarin . prophylactic anticoagulation in patients with nephrotic syndrome and cerebral infarcts is unclear , and we did not give any prophylaxis in our patient . treatment of nephrotic syndrome involves general measures such as treating hypertension , hyperlipidaemia , proteinuria with angiotensin inhibiters , and edema with salt restriction and diuretics . specific treatment of nephrotic syndrome involves immunosuppression with either steroids and antimetabolites or biological agents .

we report a case of 68-year - old caucasian man who presented with cerebral infarcts secondary to arterial thrombosis associated with nephrotic syndrome . his initial presentation included edema of legs , left hemiparesis , and right - sided cerebellar signs . investigations with computed tomography and magnetic resonance imaging of brain showed multiple cerebral infarcts in middle cerebral and posterior cerebral artery territory . blood and urine investigations also showed impaired renal function , hypercholesterolemia , hypoalbuminaemia , and nephrotic range proteinuria . renal biopsy showed minimal change disease . cerebral infarcts were treated with antiplatelet agents and nephrotic syndrome was treated with high dose steroids . patient responded well to the treatment and is all well till date .

a 60-year - old man was referred to our outpatient clinic because of persistent air leakage lasting 17 days from his chest tube , which had been inserted for empyema at another hospital . he had a past history of diabetes mellitus and tuberculous pleuritis treated with antituberculous medicine 30 years ago . he had not been treated previously for empyema by drainage procedures such as closed thoracostomy , percutaneous catheter aspiration , or drainage . a chest computed tomography ( ct ) scan showed loculated pleural fluid collection with air density and pleural wall thickening with enhancement and calcification . further , a 2.2-cm mass - like lesion adjacent to the margin of an empyema cavity was identified retrospectively ( fig . laboratory tests revealed a slightly elevated c - reactive protein level of 1.0 mg / dl , while other parameters were within the normal range . seven days after admission , we planned decortication because of prolonged air leakage and the patient s desire for surgery . the fibrinous contents of the empyema cavity were removed , and the lung was decorticated without difficulty . therefore , the operation was completed after the confirmation of the full expansion of the lung . contrary to our expectations , however , the histopathological diagnosis after the operation was malignant lymphoma . immunohistochemically , the tumor cells were positive for leukocyte common antigen , cd79a , ki-67 ( range , 7080% ) , and cd3 , and negative for cd20 . 2 ) . after the identification of a monoclonal proliferation of b - cells by an immunoglobulin heavy- chain gene rearrangement , the final diagnosis of diffuse large b - cell lymphoma with an aberrant expression of a t - cell marker was made . the postoperative period was uneventful , and the chest tube was removed on postoperative day 12 . we considered the possibility of incomplete resection , and the patient was referred to the hematology department for adjuvant chemotherapy . pyothorax - associated lymphoma ( pal ) is a rare malignant lymphoma developing in the pleural cavity after long - standing pyothorax . according to the current world health organization histological classification published in 2005 , pal is defined as a neoplasm of large b - cells , typically with immunoblastic morphology , usually presenting as a pleural mass. it occurs in patients with a history of long - standing pyothorax resulting from pulmonary tuberculosis or tuberculous pleuritis and is strongly associated with the epstein barr virus ( ebv ) . a majority of these cases have been reported in japan , although some cases have occurred in western countries . it is assumed that the higher prevalence in japan is caused by a higher incidence of ebv infection and lung collapse therapy for tuberculosis in asia , particularly in japan . the etiology of pal is not clearly understood . however , previous reports have suggested that artificial pneumothorax , ebv latent infection , cytokines such as interleukin-6 and -10 , and oxidative stress produced during chronic inflammation might be important factors for pal development . reported a summary of clinical and pathological findings in 106 patients with pal in japan . the median age of the patients was 64 years ( range , 46 to 82 years ) with a male / female ratio of 12.3:1 . the interval between the onset of pleuritis and the initial symptoms of lymphoma was 37 years ( range , 20 to 64 years ) . all of the cases were of non - hodgkin s lymphoma , among which the diffuse large b - cell type was the most common ( 88% ) . the definitive diagnosis of pal can be made by histopathological and immunohistochemical examinations of biopsy or surgically resected specimens . a typical histological examination demonstrates a diffuse destructive proliferation of large cells with a predominant population of immunoblasts . lymphoma cells are mostly positive for cd20 and cd79a in the immunohistochemical examination . according to the pathological findings by aozasa et al . , a majority of the cases were cd20 + and/or mbi+ , cd45ro- , and cd3- , and were of the b - cell lineage . however , there could be an aberrant phenotype with the expression of some t - cell markers , as in our case . ueda et al . analyzed the radiological features of pal to help in the diagnosis of this rare malignant lesion . they reported that a typical radiological finding of pal was a pleural soft - tissue mass adjacent to the margin of a coexistent empyema cavity and the shape of the mass demonstrated on the ct scan was mostly lenticular or crescentic . we were able to find a mass - like lesion on the ct scan retrospectively by reviewing the report of ueda et al . although the optimal treatment is not well - established , most patients with pal have received chemotherapy and/or radiotherapy , as reported in the literature . the prognosis of pal reported in 2002 is poor , with a five - year survival rate of 21.6% , although a better survival rate is observed in patients who are responsive to chemotherapy . however , a recent survey reported an improved overall five - year survival rate of 35% and suggested several prognostic factors for the overall survival . in summary , we have reported a case of pal of a b - cell origin resulting from tuberculous pleuritis . although pal is a relatively rare disease , it should be considered a potential diagnosis in patients with a history of chronic pyothorax .

pyothorax - associated lymphoma is a relatively rare type of lymphoma that occurs in patients who have long histories of tuberculous pleuritis or induced pneumothorax . it is a type of non - hodgkin s lymphoma of mainly the b - cell phenotype and is strongly associated with epstein barr virus infection . a majority of these cases have been reported in japan , although some cases have occurred in western countries . here , we describe a case of pyothorax - associated lymphoma in a patient with a 30-year history of chronic tuberculous empyema . the patient underwent decortication under the impression of chronic empyema with fistula . the histopathologic diagnosis was a diffuse large b - cell lymphoma associated chronic inflammation .

the vacuum sealing drainage ( vsd ) technique is a therapeutic concept to achieve secure and rapid wound healing in traumatic soft wound and chronic infections . its use is widespread among the surgical specialties , many of which employ negative - pressure wound therapy to varying degrees as part of their armamentarium against challenging wounds . the tubes are either drawn transcutaneously through the tissue or placed epicutaneously , depending on the condition of the wound . the wound including the adjacent skin and the drainage tubes is covered by a transparent vapor transmitting polyurethane film . when the drainage tubes are connected with a vacuum bottle , anatomically difficult body regions such as buttocks and perianal infection , it is still questionable whether these dressings have similar beneficial effects . in this case a 58-year - old man suffered from a severe buttocks and perianal infection after injection ( fig . he was admitted to our emergency department after a failure conservative treatment of another hospital . he had a little bit fever ( 38.5 c , 101.3f ) , the wbc was 12 10/l with a normal ecg . a colostomy was applied first to prevent defecation and keep the perianal region clean . after the tissue culture was taken , 3 ) , the drainage tubes became obstructed by a substantial amount of waste ( fig . the infection was controlled 9 days after the first surgery by prompt surgical debridement , the application of vsd treatment , and the use of narrow - spectrum antibiotics based on tissue culture result . finally , granulation tissues on the buttock surface grew well and grafted skin was conducted to close the wound ( fig . four days after the second surgery . after 3 applications of vacuum sealing drainage ( vsd ) treatment , granulation tissues on the wound surface grew well and free dermatoplasty was conducted to close the wound . after 8 weeks , the skin graft had completely survived and the wound had healed well . the colon was sent back to abdominal cavity . a 58-year - old man suffered from a severe buttocks and perianal infection after injection ( fig . he was admitted to our emergency department after a failure conservative treatment of another hospital . he had a little bit fever ( 38.5 c , 101.3f ) , the wbc was 12 10/l with a normal ecg . a colostomy was applied first to prevent defecation and keep the perianal region clean . after the tissue culture was taken , 3 ) , the drainage tubes became obstructed by a substantial amount of waste ( fig . the infection was controlled 9 days after the first surgery by prompt surgical debridement , the application of vsd treatment , and the use of narrow - spectrum antibiotics based on tissue culture result . finally , granulation tissues on the buttock surface grew well and grafted skin was conducted to close the wound ( fig . four days after the second surgery . after 3 applications of vacuum sealing drainage ( vsd ) treatment , granulation tissues on the wound surface grew well and free dermatoplasty was conducted to close the wound . after 8 weeks , the skin graft had completely survived and the wound had healed well . the colon was sent back to abdominal cavity . we found that injection leading to such severe buttocks and perianal infection has never been reported . the management of the perineal skin graft wound is complex , because it has an irregular skin surface and is close to the urethra anteriorly and the anus posteriorly , which can easily contaminate the wound . the vsd technique has been widely used for treating various types of wound surfaces and deep wounds , such as soft tissue in the foot , prosthetic infections , and large - area skin defects , but there are no reports on severe buttocks and perianal infections . the vsd technique combined with a colostomy showed an advantage to treat severe buttocks and perianal infections . first , it is close to the urethra anteriorly and the anus posteriorly , which can easily be contaminated . second , the perineum is irregular . finally , the perineum is too mobile to fix the wound dressing . it has been found to be useful in the treatment of various types of wound surfaces . recently , wu et al have reported the first use of vsd as a convenient and effective alternative to manage the complications of extensive polyacrylamide hydrogel ( paag ) migration after breast augmentation . the mechanism of vsd for prompting granulation growth and accelerating wound healing has been proven at the cellular level . vac therapy is also an excellent alternative for managing complicated wounds after head and neck reconstruction . it has been proven to be safe and comfortable for the patient and provides good results regarding infection control , dead space obliteration , and improvement of wound healing . perianal infections are difficult to treat because of the fecal contamination and the anatomical characteristics . in our study , vacuum - based therapy appears to be safe , effective , and convenient for the patient and nursing staff and allows for less frequent dressing changes .

abstractvacuum sealing is a therapeutic concept to achieve secure and rapid wound healing in traumatic soft tissue damage . its application and effect in the treatment of severe buttocks and perianal infection are unclear.we describe a case of buttocks and perianal infection using the vacuum sealing drainage ( vsd ) technique . a 58-year - old man was admitted with buttocks and perianal severe infection , which was caused by injection . the size of the wounds was 40 30 cm . colostomy was applied prior to the prompt surgical debridement to prevent defecation and keep the perianal region clean . emergency debridement was then conducted . after the wounds were thoroughly washed with conventional disinfection solution , they were then covered by vsd system.the infection was controlled 9 days after the first surgery by prompt surgical debridement , the application of vsd treatment , and the use of narrow - spectrum antibiotics based on susceptibility result . after 3 applications of vsd treatment , skin grafting harvested from the left leg was conducted . all free skin grafts survived at 8 weeks . colon was placed back into the abdominal cavity finally.initial colostomy and debridement , the temporary vsd cover followed after several days by skin grafting is a reliable treatment regimen for severe buttocks and perianal infection .

hybridization is a controversial topic in coral reef ecology 1 , 2 . while small numbers of hybrid embryos can be produced in a few species in vitro , the evidence for hybrids in the field is often equivocal because the genetic techniques used for corals can not distinguish between hybridization and incomplete lineage sorting . in fact , only one of the over 1300 species in the order is generally accepted to be unequivocally of hybrid origin : acropora prolifera 1 , 5 . nonetheless , hybridization is often invoked as a source of evolutionary novelty in the order scleractinia 6 , 7 . here , we report an incidental observation on the potential for hybridization between two closely related scleractinian corals species in the family fungiidae , ctenactis echinata and ctenactis crassa . these species are sympatric , often dominating large multi - specific assemblages of fungiid corals throughout the central indo - pacific . colonies of these species are superficially very similar ( figure 1a and b ) but can readily be distinguished by the shape of the costal dentitions . both species are gonochoric , that is each colony is either male or female , and reproduce by broadcast spawning , releasing gametes into the water column for fertilization ( figure 1c and d ) . at our study site on sesoko island ( 2638'13.00"n ; 12751'56.24"e ) , okinawa , japan , spawning occurs following the full moons from july to august . furthermore , both species release gametes at the same time and consequently there is the potential for hybridization . in the days before the predicted date of spawning in july 2013 , we collected four colonies of c. echinata and six colonies of c. crassa , to produce larvae for other experiments . coral species in the family fungiidae , such as these colonies of fungia repanda , are gonochoric broadcast spawners : each individual releases either eggs ( c ) or sperm ( d ) into the water column where fertilization takes place ( arrows indicate gametes ) . while the species are relatively easy to identify , determining the sex of each individual prior to spawning is impossible without destructive sampling to expose the gametes . consequently , we placed each individual in a separate 20 l bucket containing sea water in the open air at approximately 20:00 h in order to sex each individual once gametes had been released . on the night of 27 july between 22:30 and 23:30 h three c. echinata and five c. crassa spawned revealing that the three spawning c. echinata were female , while four c. crassa were females and one was a male . the size of the eggs of each species at the time of release was distinct with a range in maximum diameter of 244266 m in c. echinata and 133155 m in c. crassa . in contrast to earlier work on c. echinata , we saw no symbiotic algae in the eggs of either species . we collected approximately 5000 eggs from the three c. echinata females and mixed them with sperm from the c. crassa male . as a positive control we mixed eggs from the four c. crassa females with the c. crassa sperm . approximately 100 eggs were observed under a stereo - dissecting microscope for cleavage , indicating fertilization , every 2 to 6 h over the next 24 h. at no point did we observe cleavage in the cross between species indicating that no hybrid embryos were produced . in contrast , over 90% of c. crassa eggs in the positive control were fertilized within 2 h. we conclude that despite synchrony in the time of gamete release between these two closely related sympatric species there appears to be strong pre - zygotic mechanism to avoid hybridization . while our observations are preliminary and in only one direction ( i.e. we did not cross c. echinata males with c. crassa females ) we predict that hybridization between these species is unlikely . this observation adds to a growing body of evidence indicating strong pre - zygotic barriers to hybridization in many scleractinian corals 11 13 .

hybridization is often cited as a potential source of evolutionary novelty in the order scleractinia . while hybrid embryos can be produced in vitro , it has been difficult to identify adult hybrids in the wild . here , we tested the potential for hybridization between two closely related species in the family fungiidae . we mixed approximately 5000 eggs of ctenactis echinata with sperm from ctenactis crass . no hybrid embryos were produced . this observation adds to a growing body of evidence for pre - zygotic barriers to hybridization in corals and challenges the claim that hybridization is a major source of evolutionary novelty in the order .

a 56-year - old man presented with a 12-month history of tingling ulcers on both feet ( figure 1a ) . he was otherwise well . on examination there were ulcers on both feet , 11.5 cm in diameter with a macerated edge . skin - colored to red - brown papules were noted on both knees ( figure 1b ) as well as irregular red circles on both calves . skin biopsies taken from knee papules and red circles on the lower leg showed extravascular eosinophilic deposits in the dermis ( figure 1c ) , which stained positive with pas , igm ( figure 1d ) and kappa stains , but negative with congo red . investigations are summarised here : serum kappa free chains , 85.9 mg / l ( normal 3.319.4 mg / l ) ; serum lambda free chains , 17 mg / l ( normal 7.726.3 mg / l ) ; serum free kappa chains /free - lambda chains ratio , 5.05 ( normal 0.261.65 ) ; serum electrophoresis , elevated ig m gradient ; serum immunofixation , monoclonal ig m / kappa - type immunoglobulin ; urine immunofixation , monoclonal kappa - free chain ; bone marrow microscopy , infiltrate of lymphoplasmocytic cells ( 15% ) ( most cd20 and cd138 positive ) with preferential expression for igm . the cutaneous manifestations of waldenstrm macroglobulinaemia have been classified as either infiltration by neoplastic cells or those related to the paraproteinaemia , such as immunoglobulin deposition , cryoglobulinaemia or blood hyperviscosity . approximately 5% of patients with waldenstrm macroglobulinaemia develop cutaneous manifestations , with neoplastic infiltration being the least common . prognosis does not appear to be influenced by the presence or absence of cutaneous disease . the patient presented with a burning red face which was initially diagnosed as rosacea but with time the more typical purple infiltration developed . macroglobulinaemia the neuropathy is typically sensorimotor , initially with paraesthesias and numbness in the feet and hands . the possible mechanisms in waldenstrm macroglobulinaemia include microangiopathy , direct infiltration of nerves , endoneural deposition of igm protein or amyloidosis , hyperviscosity or immunoglobulin deposit in blood vessels . the tingling ulcers in our patient are probably an example of this and , although biopsies were not taken from the ulcers , may have been due to igm deposition given he also had macroglobulinaemia cutis . there has been only one other case reported , to our knowledge , of ulcers on the sides of the feet . these developed in areas of hyperkeratosis and were associated with dysaesthesia and a burning sensation . however , the biopsy showed a leukocytoclastic vasculitis with a neutrophilic infiltrate . another report described igm dermal deposits that presented as painful hyperkeratotic papules on the soles of the feet that were not ulcerated . storage papules , also known as macroglobulinaemia cutis , are rare but well described and are usually found on the knees or other extensor surfaces . they are usually skin - coloured , red - brown or translucent , and may be umbilicated , crusted or haemorrhagic . after five cycles the lower limb ulceration and neurological symptoms had resolved , although the blood igm level did not change . waldenstrm macroglobulinaemia is a low - grade lymphoplasmacytoid lymphoma that usually presents with nonspecific systemic symptoms , but cutaneous changes may be the initial manifestation and hence may present first to a dermatologist . although our patient presented with tingling ulcers , the diagnosis was reached after skin biopsy from knee papules demonstrated dermal immunoglobulin deposition .

a 56-year - old man presented with tingling ulcers on the feet . on further skin examination , papules on the knees were observed . biopsies revealed extravascular eosinophilic deposits of igm , and waldenstrm macroglobulinaemia was diagnosed . the skin manifestations have resolved with chemotherapy . peripheral neuropathy and storage papules are rare manifestations of waldenstrm s macroglobulinaemia .

foreign bodies are frequently ingested by young children , mostly by ambulatory toddlers who explore their surroundings orally . almost 40 percent1 of the ingestion of the foreign bodies are unwitnessed and 50 percent2 are asymptomatic . depending on the size , shape , content and nature , most ingested small objects on reaching the gastrointestinal tract pass through spontaneously3 within 2 - 6 days , but may take up to four weeks . while serious complications such as bowel obstruction or perforation can occur , gastric outlet obstruction by the ingestion of a foreign body is uncommon.45 we report a case of a toddler presenting with persistent vomiting caused by an ingested foreign body obstructing the gastric outlet . a plain radiograph of the abdomen did not reveal the presence of a foreign body ; however , abdominal ultrasonography detected the obstructing foreign object which was extracted by upper gastroscopy . a 19-month old toddler presented with a one- week history of persistent non - bilious vomiting and intolerance of oral fluids and solids . there was no history of diarrhea , choking or the witnessing of the ingestion of a foreign body . physical examination revealed a distended abdomen with increased bowel sounds , but no tenderness and no organomegaly . the vomiting ceased with intravenous hydration and keeping the patient on nil by mouth . as he was restarted on clear oral fluids , the vomiting recurred . flat film of the abdomen showed paucity of gas in the gut which was reported as normal . the suspicion of a faint radio - density projecting over the stomach was seen retrospectively following the results of the abdominal sonography ( figure 1 ) . abdominal radiograph showed a relative paucity of gas in the gut . the faint radio - density ( arrow ) which represented the foreign body an abdominal ultrasound done showed a small echogenic structure localized to the region of the pyloris . the structure was obstructing the gastric outlet ( figure 2 ) as evidenced by a distended fluid filled stomach . abdominal sonogram demonstrated the presence of a small echogenic structure casting an acoustic shadow localized to the region of the pylorus . the structure appeared to be creating a gastric outlet obstruction as evidenced by a massively distended fluid filled stomach . the procedure revealed a normal but hugely dilated stomach with a funnel - shaped plastic foreign body impacting and completely obstructing the pylorus ( figure 3 ) . the patient was discharged home 24 hours following gastroscopy on a regular diet and ranitidine for mild esophageal erosions . the specimen was examined by the pathologist who confirmed a pink funnel - shaped structure measuring 2.322 centimeters . similar plastic objects are typically fixed to balloons as handles and are readily available to children . on upper gastroscopy , the stomach looked normal but hugely dilated with a foreign body partly impacted in the pyloric channel . the major part of the foreign body was lodged in the stomach extracted specimen was identified as a plastic funnel - shaped structure , pink in color measuring 2.322 cm with bite marks . once past the lower esophageal sphincter ( les ) , the majority of regularly - shaped smooth foreign bodies usually pass spontaneously through the gastrointestinal tract within 4 - 6 days , but may take up to 4 weeks . while 80% of ingested foreign bodies pass through spontaneously , 10 - 20% require intervention and 1% need surgical removal.6 conventional radiography will identify most radio - opaque metallic objects , but may not detect radiolucent objects such as plastic objects , wood , glass , fish or chicken bones . hence , the diagnosis of radiolucent foreign bodies in the gastrointestinal tract can be challenging . oral contrast studies have been utilized to locate ingested non - opaque foreign bodies which appear as filling defects.3 however , oral contrast studies have the potential risk of aspiration in cases of a high grade obstruction or poor control of secretions . they are to be avoided if esophageal perforation is suspected . if perforation is suspected and a study is necessary , an isotonic contrast agent may be used , whereas gastrograffin and barium are contraindicated . sonography , unlike conventional radiography , is not dependent on radiographic density and does not involve ionizing radiation . despite its ease of use and relative low cost , sonography has been considered a poor imaging modality to detect abdominal foreign bodies as an air - filled bowel is difficult to visualize . the foreign object elicits its own primary signs by casting an echogenic mass with a dense acoustic shadow . the secondary signs due to tissue edema or hemorrhage result in a hypoechoic area surrounding the foreign body . distension of the stomach or the bowel segments is a further important secondary sign of an obstructing foreign body . ginsburg et al12 demonstrated that sonography is the most reliable method of detecting non - opaque soft tissue foreign bodies . caspi et al13 revealed that sonography is effective in detecting foreign bodies in vaginal orifices . isaac14 reported the detection of a ball point pen by abdominal ultrsonography in a 4-year - old female . asad et al15 diagnosed a case of appendicitis due to an accidentally ingested endodental file which lodged in the appendix . the graded compression technique was used in abdominal sonography to detect the precise location of the missing object . in a 5-year - old boy , ileal perforation occurring secondary to an ingested fragment of a skewer was identified by rathaus et al16 by using abdominal sonography . the abdominal sonogram revealed the presence of a hyperechoic straight - line foreign body embedded within a hypoechoic inflammatory mass . an earlier case of gastrointestinal perforation due to a swallowed toothpick was recognized sonographically by chau et al.17 in a review of 23 cases of abdominal foreign bodies diagnosed sonographically , kuznetsov et al18 concluded that ultrasonic examination provided the maximal information about sizes , structure , location of foreign abdominal bodies , their depth of location and relationship with abdominal organs . this case report adds to the increasing evidence that the skilled use of ultrasonography , a noninvasive painless diagnostic modality , can detect abdominal foreign bodies . ingestion of foreign bodies should be considered in the evaluation of persistent vomiting in a toddler . some objects may not be radio - opaque and may be difficult to find by plain radiographic views . this report , along with the literature review , shows that abdominal ultrasonography is preferred to plain film19 and oral contrast studies in the diagnosis of suspected foreign body ingestion .

the diagnosis of unsuspected foreign body ingestion is a common problem in children . we describe a toddler who presented with persistent vomiting and dehydration . a plain radiograph of the abdomen did not reveal a foreign body . however , abdominal ultrasonography promptly identified a funnel - shaped foreign body obstructing the gastric outlet . this was extracted by upper endoscopy . a recent review of the literature shows increasing evidence that abdominal ultrasonography is an equally complementary diagnostic modality for ingested foreign bodies in children .

abpa is a rare complication of asthma in children ; only a few case reports and small series have been published . severe asthma is known to cause cor pulmonale in adults , but rarely described in pediatric age group . further , pulmonary thrombo - embolism ( pte ) in children with asthma and cor pulmonale has been described only at autopsy . we describe a child who developed abpa with pulmonary thrombo - embolism and cor pulmonale as a complication of poorly - controlled asthma . a 9-year - old boy presented with bluish discoloration of the nails and lips since last one year andanasarca ( generalized swelling ) , worsening cough , respiratory distress , and periumbilical pain abdomen since 20 days previously . he had past history suggestive of asthma ( recurrent episodes of cough and respiratory distress since the first year of life ) , for which he had received irregular treatment . patient found to have central cyanosis , tachycardia , marked respiratory distress with normal blood pressure . g / l , total leukocyte count 12.8 10/l with neutrophils 80% , lymphocytes 18% , monocytes 1% , and eosinophils 1% . arterial blood gas analysis on 100% oxygen showed ph of 7.36 , pco2 59.5 mm of hg , po2 116 mm of hg , hco3 32.6 mmol / l , base excess 5.2 and oxygen saturation 98.3% , suggesting chronic respiratory acidosis . hrct chest showed central bronchiectasis [ figure 1a ] , minimal right pleural and pericardial effusion , and gross cardiomegaly . chest angiography revealed dilated main pulmonary artery and filling defect in right branch of pulmonary artery [ figure 1b ] . echocardiography finding were : dilated right - sided heart , right ventricular dysfunction , severe pulmonary artery hypertension , and right atrial clot . serum ige levels were 1100 iu / ml ( normal 50 - 100 iu / ml ) . coagulogram revealedpprothrombin time index of 82% , aptt 33 seconds , inr 1.2 and presence of fibrin degradation products . ( a ) hrct chest showing central bronchiectasis ; ( b ) ct angiography showing thrombus in right pulmonary artery ( arrow head ) the patient was managed with salbutamol ( 0.15 mg / kg / dose ) and ipratropium bromide ( 0.5 mg / dose ) nebulization and intravenous hydrocortisone ( 10 mg / kg stat followed by 2 mg / kg every 6 hourly ) for exacerbation of asthma . for congestive heart failure , digoxin ( 3 g / kg / day ) and furosamide ( 2 mg / kg / day ) was given . he received injection ceftriaxone ( 100 mg / kg / day ) for 14 days . low molecular weight heparin ( 1.0 mg / kg 12 hourly for 5 days ) followed by warfarin ( 0.1 mg / kg / day ) was administered for thrombo - embolism after chest angiography . he improved and was discharged on request on warfarin , home oxygen therapy , oral steroids ( prednisolone 2 mg / kg / day ) , and inhaled steroids ( budesonide 400 g / day ) after three weeks of admission . he did nt return for follow - up , and on enquiry , we came to know that he expired after few days of discharge . the criteria for diagnosis of abpa were fulfilled by standard criteria ( asthma , central bronchiectesis , raised serum ige , immediate cutaneous hypersenstivity to a. fumigatus ) , and by severity , the abpa was of the fifth stage ( cyanosis , severe dyspnea , raised ige , central bronchiectesis ) . further work - up of the case revealed features of cor pulmonale and pulmonary thrombo - embolism ( pte ) . in adults , cor pulmonale is well - known in poorly - controlled asthma . in a study from ethopia , its rarity in developed countries might be because of better asthma management as compared to resource - poor countries . in children , of cor pulmonale in poorly - controlled asthma . better management of asthma in children with time might have decreased cases of cor pulmonale in asthma . although cor pulmonale is rare in children with asthma , the tissue doppler echocardiography has shown subclinical right ventricular dysfunction positively correlating with the severity of asthma in children . cor pulmonale as a presenting feature of abpa without asthma had also been reported in adult . as both poorly - controlled asthma and abpa have been associated with cor pulmonale independently , the presence of both in our case may have resulted in cor pulmonale at an early age . to the best of our knowledge , pte had never been reported ante - mortem in asthmatic children with abpa and cor pulmonale . possible underlying mechanism of pte in such cases may be chamber hypokinesia ( due to cor pulmonale ) and polycythemia ( due to chronic hypoxia ) . the hemoglobin was 15 gm% in our case , and echo showed poor right ventricular function . although the diagnosis of asthma is not in doubt ( recurrent cough and respiratory distress , history of asthma in sibling and good response to bronchodilators and steroids ) , we could not rule out cystic fibrosis completely ( second sweat chloride , delta 508 mutation , and cystic fibrosis transmembrane conductance regulator ( cftr ) genes could not be performed ) . both cystic fibrosis and asthma may co - exist in same patient . such combination of complications rarely occurs , even if both cystic fibrosis and asthma co - exist . to conclude , in a poorly - controlled asthma , abpa should be excluded even in children and if present , should be treated aggressively to prevent complications .

allergic bronchopulmonary aspergillosis ( abpa ) , as a complication of asthma , is rare in children . the persistent and poorly - controlled asthma leading to cor pulmonale is not uncommon in adults but rarely described in the pediatric age group . here , we report a case of asthma and abpa complicated by pulmonary thrombo - embolism and cor pulmonale . to the best of our knowledge , such association has never been reported in the pediatric age group .

hpvg was first described in infants with necrotizing enterocolitis ( nec ) by wolfe and evans in 1955 , and was then reported in increasing frequency in adults as well . hpvg has been most commonly associated with an acute gastrointestinal catastrophe , such as mesenteric ischemia , with up to 80% of cases resulting in death . cases in which hpvg is found with mesenteric ischemia often present with abdominal distention , pain , fever , and possibly sepsis , however the extent of the portal venous gas or pneumatosis intestinalis , gas seen on imaging in the small or large intestine , is not predictive of the extent of the disease itself , or of the operative findings . initially noted in abdominal x - ray films as branching radiolucency within 2 cm of the hepatic edge , other modalities such as ultrasound , doppler imaging , and computed tomography ( ct ) detect hpvg with far more sensitivity . with increased use of advanced diagnostic imaging , hpvg has also been an incidental finding in many benign diseases , and therefore can not on its own be used as a prognostic indicator . a 70-year old female patient underwent an elective gastrectomy and feeding jejunostomy for stage iia gastric cancer , after biopsies of a 3 cm gastric ulcer showed moderately differentiated adenocarcinoma . the patient had initially presented with a pulmonary embolism , factor v leiden and subsequently developed an upper gastrointestinal hemorrhage for which she had an upper endoscopy revealing a ut3n0 gastric tumor ( fig . she underwent neoadjuvant chemotherapy with epirubicin , oxaliplatin , and fluorouracil ( eof ) . the initial procedure consisted of total gastrectomy with d2 lymph node dissection , roux - en - y esophagojejunostomy and placement of a feeding jejunostomy . the patient developed ards postoperatively and was treated with high dose steroids . on post - operative day 14 , ct scan showed extensive intra- and extra - hepatic portal venous gas , with an air - fluid level in the main portal vein , as well as small bowel pneumatosis , with free intraperitoneal air ( figs . 1 and 2 . intraoperatively , two small perforations were found at the distal jejunojejunostomy with no ischemia or necrosis of any of the bowel was found . red rubber catheters were placed in the two defects in the edematous anastomosis , proximally and distally along with intra - abdominal drains . she underwent a second look procedure after 48 h , and the abdomen was closed . post - operatively the patient was stabilized and was eventually discharged in stable condition to a rehabilitation facility . now , ten months from her original procedure , the patient is living at home with a performance status of 1 and is currently on chemotherapy as she unfortunately developed a liver metastasis . hepatic portal venous gas with the finding of pneumatosis intestinalis is most frequently associated with ischemic bowel , with a reported mortality of 3980% and up to 100% without operative intervention . first described in 1955 associated in infants with necrotizing enterocolitis , hpvg has since been described in numerous other clinical scenarios . some less morbid causes of portal venous gas include ileus , diverticulitis , gastric distention , inflammatory bowel disease ( ibd ) , hypotension post dialysis treatment , decompression sickness , trauma and iatrogenic causes from instrumentation and recent surgery either with or without complications related the procedure . some benign causes of pneumatosis intestinalis , but not directly shown to cause hpvg , include high - pressure ventilation , chronic obstructive pulmonary disorder ( copd ) , and high dose steroids as well as numerous other conditions both organic and iatrogenic . clinical scenarios leading to hpvg generally fall into three categories : bowel distention / obstruction , ischemia , and idiopathic . these mechanisms are coupled with the two main theories proposed for the pathophysiologic etiology of hpvg : mechanical versus bacterial . first , mechanical disruption of mucosal integrity may result in dissection of gas into the intestinal wall and eventually the portal system . the breach of integrity of mucosa may be related to ulceration from ischemia , ibd , peptic ulcer disease ( pud ) , or from gastrointestinal neoplasms . alternatively , the invasion or translocation of the intestinal wall by gas forming bacteria may result in the production of gas within the intestinal wall and portal system itself . assessment of the varied presentation of patients with hpvg has led to the suggestion of new algorithms in recent years to better identify patients who would benefit from operative intervention , versus those who may not . despite the a small population sizes used for these studies , all placed similar in emphasis on the clinical status of the patient , rather than the ct findings alone , including physical exam findings , vital signs , and laboratory values . these algorithms will ideally help distinguish between patients with potentially benign disease , versus patients with necrotic bowel who may benefit from emergent surgery . based on findings from a retrospective review of 26 patients from their institution , iannitti et al . suggest that surgery should be recommended with certain presentations ( frank peritonitis ) , additional ct findings ( complete small bowel obstruction sbo , mesenteric ischemia ) , certain recent interventions ( e.g. vascular surgery procedures ) , or with complicated medical diagnosis ( complicated infectious or inflammatory process ) . , found that in their sample of 33 patients with hpvg , using a criteria of lower blood pressure ( < systolic bp 108 mm hg ) , higher lactate dehydrogenase ( ldh ) ( > 387 u / l ) , and the presence of pneumatosis intestinalis led to 100% sensitivity and 78.9% specificity for necrotic bowel . another retrospective review of 150 patients by duron et al . showed that abdominal distention ( or ct finding of small bowel distention ) , peritonitis , and lactic academia were the only statistically significant predictors of positive operative findings . in one of the largest retrospective reviews , bani hani et al . pooled data from four tertiary centers and evaluated 209 patient charts who had hpvg in order to better predict which patients require operative intervention . after assessing a range clinical findings , laboratory values , radiologic findings and comorbidities , they found that older age , peritoneal signs , and elevated bun are most highly associated with ischemia and necrotic bowel . one of the most detailed algorithms developed by wayne et al . used a retrospective series of 88 patients . the algorithm incorporates many of the previously mentioned clinical findings , including abdominal exam , lactate ( > 3 mg / dl ) , and radiological findings of pneumotosis intestinalis , as well as , recent instrumention , and significant past medical history suggestive of vascular risk . using these factors , the group tested the algorithm prospectively on 14 patients , ideally reducing the risk of nontherapeutic laparotomies , but with four patients not explored described as our patient had a variety of the potential causes of hpvg , including recent surgery , intestinal distention , ischemia related to hypotension and inotropes . the complicated postoperative course , along with the clinical picture and the finding of extensive hpvg and pneumatosis intestinalis led to frank discussions with the family regarding the grave nature of this finding and the high risk of surgical intervention . nonetheless , the operative findings and outcome of this case illustrate the inability to predict the extent of bowel compromise based on hpvg , suggesting that an aggressive surgical approach is still appropriate , even when the prognosis and radiographic findings appears dismal . written informed consent was obtained from the patient for publication of this case report and any accompanying images . a copy of the written consent is available for review by the editor of this journal .

portal venous gas or hepatic portal venous gas ( hpvg ) found on imaging portends grave outcomes for patients suffering from ischemic bowel disease or mesenteric ischemia . hpvg is more rarely seen with severe but treatable abdominal infection as well as multiple benign conditions , and therefore must be aggressively evaluated . we report a 70-year old female who developed extensive intra- and extra - hepatic portal venous gas , pneumatosis intestinalis and free air associated with a perforation of the jejunojejunostomy after a gastrectomy for gastric carcinoma .

although a rare , but an important cause of drug resistant seizures , the dyke davidoff masson syndrome ( ddms ) is not a difficult diagnosis to make in the era when neuroimaging has profoundly improved epilepsy care . acquired or congenital ( infantile ) cerebral hemiatrophy , also referred to as ddms , is a diagnostic constellation made up of hemiparesis , facial asymmetry , intellectual disability , and epilepsy . on brain imaging , the findings of cerebral hemiatrophy , calvarial thickening , and hyperpneumatization of the frontal sinuses provides radiographic support for the clinical diagnosis . the significance of an early and accurate diagnosis is the prospect of improving the patient 's prognosis and improving their quality of life . this case illustrates a unique epilepsy syndrome and the need for a heightened awareness among epilepsy care providers . furthermore , it emphasizes the importance of early evaluation of patients with epilepsy in sub - saharan africa where the diagnostic gap is still close to 40% . we report a case of ddms in a nigerian with childhood - onset epilepsy and review the literature . a 27-year - old female presented to our clinic with her father because of recurrent seizures and poor scholastic performance . she had normal development until she was 2 years when she had a febrile seizure which was described as focal clonic involving the left side of the body . about 15 years prior to presentation , she developed recurrent generalized tonic - clonic seizures . she demonstrated impaired cognition and poor scholastic performance which prevented her from completing her secondary education . her general physical examination revealed a young female who was small for her age , with a weight of 43.7 kg and a height of 1.56 m ( body mass index , bmi = 17.9 kg / m ) . her score on ravens standard progressive matrices ( rspm ) was 11/60 , indicating intellectual impairment ( below the 5th percentile for her age ) . neurologically , she had left facial hemiatrophy , left hemibody atrophy , and spastic hemiparesis ( power of 4/5 in both left upper and lower limbs with a left extensor plantar response . , we suspected rasmussen encephalitis and requested a cranial magnetic resonance imaging ( mri ) and an electroencephalogram ( eeg ) . her brain mri ( see fig . 1 . ) revealed right cerebral hemiatrophy with features of encephalomalacia surrounded by gliosis ( figure ) . furthermore , on mri , she had right calvarium thickening and hyperpneumatization of the frontal sinus . her eeg revealed a low amplitude background over the right hemisphere with intermittent bursts of generalized sharp - and - slow wave complexes . these features place her in the ilae category of epilepsy with structural metabolic causes . her seizure frequency has been reduced from at least once a week to less than weekly but at least once a month . the findings of cerebral hemiatrophy , calvarial thickening , and hyperpneumatization of the frontal sinuses on mri in the setting of drug - resistant seizure , intellectual impairment , and hemibody atrophy are the diagnostic criteria for ddms in this case . for epilepsy care givers , our case illustrates the fact that seizures associated with hemibody atrophy have a differential diagnosis beyond rasmussen 's syndrome . acute focal weakness following a seizure in a child has many serious and treatable causes . although benign etiologies such as todd 's paralysis and metabolic etiologies such as glucose , sodium , potassium , calcium , and magnesium abnormalities are easily identifiable , structural lesions such as neoplasms , intracerebral abscesses , acute disseminated encephalomyelitis , developmental brain malformations , and signs of trauma and vascular disorders such as ischemic and hemorrhagic infarctions should be excluded . hemiconvulsion - hemiplegia - epilepsy ( hhe ) syndrome should also be entertained . in hhe syndrome , neuroradiological studies may show unilateral edematous swelling of the ipsilateral hemisphere at the time of initial status epilepticus ( se ) . although neuroimaging studies were not conducted at the time of the initial insult in the presented case , the generalized tonic - clonic seizures after hemiconvulsions , which characterized this patient 's presentation , are less typical of hhe syndrome , which is characterized by hemiconvulsions alone . this is in addition to the long latency ( 10 years ) between the acute encephalopathy and the onset of epilepsy ( typically 2 months to 2 years in hhe ) , though the two syndromes have been recognized synonymously . other differential diagnoses should include sturge weber syndrome , basal ganglia germinoma , silver russel syndrome , fishman syndrome , and linear nevus sebaceous syndrome . in rasmussen 's syndrome , the calvarial changes are not found . basal ganglia germinoma presents with similar clinical features , but brain imaging reveals cystic areas , focal hemorrhages , and mild surrounding edema along with calvarial changes . in sturge weber syndrome , brain imaging shows enhancing pial angiomas and cortical calcifications in addition to the clinical features of the phacomatosis . russell syndrome is characterized by the classical facial phenotype ( triangular face ; small , pointed chin ; broad forehead ; and thin , wide mouth ) , poor growth with delayed bone age , clinodactyly , hemihypertrophy with normal head circumference , and normal intelligence . fishman syndrome or encephalocraniocutaneous lipomatosis is a rare neurocutaneous syndrome including unilateral cranial lipoma with lipodermoid of the eye , which usually presents with seizures . mims syndrome ) is characterized by a typical facial nevus , mental retardation , recurrent seizures , and hemimegaencephaly . the etiology of ddms is due to a cerebral insult that may occur in utero or early in life . the acquired type depends on the time of the insult and may be seen in adolescent or adults . in the congenital type , there is a midline shift towards the affected hemisphere , and the sulcal prominence replacing the gliotic tissue is absent . pattern ii corresponds to diffuse cortical atrophy coupled with a porencephalic cyst , while pattern iii corresponds to previous infarction with gliosis in the middle cerebral artery ( mca ) territory . the clinical profile and imaging features in our patient are in keeping with acquired ddms pattern iii . the mechanism of cerebral atrophy and the related progressive neurological deficit are posited to be due to ischemic episodes which reduce the production of brain - derived neurotrophic factors , which , in turn , lead to cerebral atrophy . in some cases , ddms is accompanied by crossed cerebro - cerebellar atrophy , which is thought to be a continuum of cerebro - cerebellar diaschisis . it has been postulated that frequent and excessive excitatory input during seizures via glutaminergic corticopontine the 3 days of unconsciousness was due to either non - convulsive status epilepticus , a prolonged postictal state , or a coma of unknown etiology . the possible etiological association between ddms , prolonged febrile seizures , and middle cerebral artery stroke has been described . because of the high incidence ( 1118% ) of febrile seizures in our environment , with nearly 4% of patients going on to develop epilepsy , inappropriate management of febrile seizure should be highly discouraged to forestall untoward outcomes . medical treatment of ddms includes rational use of antiseizure drugs . if seizures are drug - resistant , they can be treated surgically with hemispherectomy , which has an 85% chance of rendering the patient seizure free . we could not offer hemispherectomy to our patient because epilepsy surgery and other tertiary care epilepsy management , including vagus nerve stimulation is still unavailable in our region of nigeria . currently , management of epilepsy is still limited to rational use of the antiseizure drugs . the relatively high cost of asds , on the background of high unemployment , poor remuneration , and out - of pocket payment for treatment , facilitates poor adherence to medications and widening of the treatment gap . efforts at rapid resolution of acute symptomatic seizures should be advanced to prevent untoward outcome . early diagnosis by an appropriate imaging study , optimization of medical management of the seizures , and enhancement of neurorehabilitation are equally important . to the best of our knowledge , this is the first case of ddms described in our environment in nigeria , although it has been described in other lower - middle income countries like iran , india , tunisia , and turkey . the paucity of neuroimaging facilities in our region may deter early recognition , and , therefore , a high clinical index of suspicion is required . we advocate prompt referral of patients with suspected ddms and refractory epilepsy to regional specialty care facilities in underserved countries to facilitate an early diagnosis and to provide optimal regional treatment .

dyke davidoff masson syndrome ( ddms ) is a rare , but important cause of drug - resistant seizures . dyke davidoff masson syndrome is a constellation of clinical features that consists of hemiparesis , seizure , facial asymmetry , and intellectual disability with distinct neuroimaging features . a 27-year - old lady presented to us with drug - resistant epilepsy , hemiparesis , and intellectual disability that necessitated her withdrawal from school . her brain magnetic resonance imaging ( mri ) showed cerebral hemiatrophy , calvarial thickening , and hyperpneumatization of the frontal sinuses consistent with ddms . we discuss the diagnostic and therapeutic implications of ddms and advocate early referral and evaluation of people with epilepsy in sub - saharan african settings .

a 39-year - old woman ( height : 158 cm , body weight : 45 kg ) had taken nifedipine per oral from the department of the internal medicine for six months . for last one month the dose of nifedipine was increased due to uncontrolled spasmodic pain in her left toes while her face flushing and headache worsened and she was referred to the department of pain medicine . the blood test results showed nothing specific with the erythrocyte sedimentation rate ( esr ) 3 mm / hr and c - reactive protein ( crp ) below 1 mg / l . on physical examination , no lesions , such as skin ulcers or edema , on her hands and feet were found . after excluding the secondary causes such as connective tissue disease , arterial occlusive disease , artery disorder , the authors performed a sympathetic nerve block using 0.2% ropivacaine 8.0 ml at the level of upper third of the left l3 vertebral body and confirmed pain relief , but this symptom relief did not last for more than two days . in the operation room , the dorsum of the patient was draped with betadine in a prone position on the radiographic surgery table . non - invasive arterial blood pressure monitoring , an electrocardiogram , arterial oxygen saturation , and a skin temperature sensor ( 66s , hewlett - packard , usa ) were attached to the insteps of both feet in order to observe the changes of temperature . after the local infiltration of 1% lidocaine 2.0 ml on the skin by the lateral approach used for traditional lumbar sympathectomy , 10 cm rfk ( racz - finch kit , radionics , usa ) cannula with a curved 10 mm active tip was inserted at the level of the lower third of the left 2 vertebral body and the second cannula was inserted at approximately 7 mm below with the same method . we confirmed there was no spread to the psoas muscle by injecting 2.0 ml of contrast material and checking the final location . a total of four cannulae were used in this procedure , and the procedure was sequentially performed from the lower third of the l2 vertebral body to the l2 - 3 intervertebral space with approximately 7 mm intervals ( fig . 1 ) . after inserting an electrode into the needle , we confirmed there was no back pain at 50 hz and 1 volt stimulation , and that there was no muscle contraction on the low back at 2 hz and 3 volts stimulation . next , the first cannula was removed and the third cannula was placed approximately 7 mm below the second cannula , and the second lesion was created with the same method . subsequently , the second cannula was removed and the fourth cannula was inserted approximately 7 mm below the third cannula , and the third lesion was created the same way . the skin temperature of the left and right insteps , as measured before the operation , was 26.4 and 26.6 , respectively . five minutes after the creation of the lesions , the temperature of the left instep started to rise and the skin temperature of left and right insteps was measured as 26.8 and 26.6 , respectively ; the visual analog scale ( vas ) decreased from 6 - 7 before the operation to 0 after the operation . the skin temperature of the left and right insteps , as measured after 30 minutes , showed a definite difference , as it was 34.8 and 28.6 , respectively . the average gap of the skin temperature of both feet was confirmed as 7.3 when we performed infrared thermographic imaging ( iti ) the next day ( fig . no particular side effects or complications appeared after the operation , so the patient left the hospital two days later . the patient showed continuous improvement on the follow - ups performed two months later and one year later . raynaud 's phenomenon induced by an excessive contraction of the peripheral blood vessels in fingers , toes , ears , and nose , is due to exposure to low temperature or stress ; the skin color of the influenced part turns white or blue accompanied by numbness , itchiness , and pain . more than 70% of the causes of this phenomenon are still obscure , and these are classified as primary raynaud 's phenomenon and separately called raynaud 's disease . in addition , raynaud 's phenomenon may be accompanied by other diseases , referred as secondary raynaud 's phenomenon or raynaud 's syndrome . the treatment for raynaud 's phenomenon is to decrease the frequency and the degree of spasm and to protect tissue from injury ; for these purposes , lifestyle modifiaction and vasodilators are first line of therapy . keeping warm temperatue especially hands and feet along with the house is the beginning of life style modification . evading emotional stress , and ceasing cigarette are highly recommended . any dose of beta - blockers , contraceptives , or migraine drugs with vasoconstricting effect calcium channel blockers like nifedipine decrease the frequency and the degree of spasms in approximately two thirds of the patients and help to heal the skin ulcers of fingers and toes . however , in case the frequency and the degree of spasms worsen to the point of disturbing daily life , or in case continuous pain or a skin ulcer occurs in spite of the medication , a sympathetic nerve block , chemical nerve destruction , or operative sympathectomy should be considered . traditionally , a lumbar sympathetic block is performed between the lower third of the l2 vertebral body and the upper third of the l3 vertebral body under c - arm guidance or computed tomography ( ct ) ; umeda et al . , also reported that lumbar sympathetic ganglia is most frequently found at the level of the lower third of the second lumbar vertebra , at the l2 - 3 interspace , and at the level of the upper third of the third lumbar vertebra on both the right and left sides . again in this case , the authors target the lumbar sympathetic ganglia between the lower third of the l2 vertebral body and the l2 - 3 intervertebral space . rf thermocoagulation , which has recently been applied in various pain treatments , is preferred to surgical removal or liquid neurolytic agent , since it makes selective nerve destruction easy by confirming the target nerve through the stimulation of sensory and motor nerves . haynsworth and noe reported that percutaneous sympathectomy using rf thermocoagulation is expected to bring a long duration of pain relief and lower the incidence of post - operative neuralgia , as compared to chemical nerve destruction . research document in korean also reported that lumbar sympathectomy using rf thermocoagulation decreases the risk of complications in comparison with chemical nerve destruction using absolute alcohol , and it has effective treatment results in hyperhidrosis of lower limbs , sympathetically maintained pain ( smp ) , and vascular diseases . recently , many reports have focused on bipolar rf thermocoagulation that can create larger and more predictable lesions than monopolar rf thermocoagulation [ 9 - 11 ] . derby and lee reported that in their experiment model where they placed two rf electrodes at 6 mm intervals and heated them simultaneously , the temperature of the core between the two electrodes exceeded 66 , so they might perform coagulation on a larger area , in case they used a bipolar electrode . pino et al . , reported that the largest lesion in performing bipolar rf thermocoagulation was created at 90 for 120 - 150 seconds with 4 - 6 mm intervals of two electrodes . korean researchers reported that a 5 mm active tip needed more than 80 in temperature and 90 seconds in time within 6 mm intervals , and a 10 mm active tip 90 and 120 seconds within 8 mm intervals , in order to create strip lesion , through bipolar rf thermocoagulation , using egg white as a medium . in sacroiliac syndrome , it was reported that appropriate lesions were created over 90 and more than 90 seconds of rf thermocoagulation within 1 cm intervals of the two electrodes . in this case , the authors created lesions at 80 for 100 seconds with approximately 7 mm intervals between 10 mm active tips based on the above documentation ; in addition , we created three lesions sequentially , therefore , we expected that three sequential strip lesions would be created . in conclusion , the authors suggest that creating sequential lesions using bipolar rf thermocoagulation is capable of making larger lesions than the existing monopolar rf thermocoagulation , and this leads to a higher rate of successful operations while simultaneously avoiding the side effects and complications from chemical nerve destruction . these findings mean that bipolar rf thermocoagulation may be effectively used for hyperhidrosis , smp , and vascular diseases which need a long - term sympathetic nerve block .

a 39-year - old female was suffering from cold - induced raynaud 's attacks in both hands and feet , with symptoms being most severe in her left foot . the patient did not respond to medical treatments and was referred to our department of pain medicine . we performed sequential bipolar radiofrequency lumbar sympathectomy to the patient , which offered a long duration of symptom relief . sequential bipolar radiofrequency lesions could create continuous strip lesion , and thus , could achieve better results , while the potential risk of liquid neurolytic agents could be avoided .

gastrointestinal basidiobolomycosis is an emerging infection , with fewer than 80 cases reported in the english literature . also , a few cases of gastrointestinal basidiobolomycosis , accompanied by liver involvement as part of a disseminated disease , have been reported . this is the first case report of an isolated liver involvement of this fungal infection in a 2-year - old girl , who presented with a liver mass resembling a hepatic abscess . zygomycosis includes 2 orders , one of which causes fungal infections in an immunocompromised host ( mucorales ) and the other in an immunocompetent host ( entomophthorales ) ( 1 ) . basidiobolus ranarum belongs to the second group and is a saprophyte found mostly in soil and decaying vegetable material ( 2 ) . it is a low virulent fungus , and the first human case of this fungal infection was reported in 1956 in subcutaneous tissue ( 3 ) . however , the gastrointestinal ( gi ) involvement of this fungus is an emerging infection and has rarely been reported ( 4 ) . recently , a few cases of gi basidiobolomycosis , accompanied by liver involvement as part of a disseminated disease , have been reported ( 5 ) . to the best of our knowledge , no case has been reported in the english literature with an isolated liver mass caused by basidiobolomycosis without the involvement of any other organ . accordingly , herein we report our experience with a 2-year - old girl , who presented with a liver mass subsequently identified as basidiobolomycosis . a 2-year - old well - nourished and well - developed girl from the iranian city of kangan ( bushehr province ) presented with vague and generalized abdominal pain . she was the first child of the family , born via normal vaginal delivery without any specific disorder . she had had a normal infancy until 2 months prior to her referral , when she developed abdominal pain with no response to routine treatment . laboratory tests showed microcytic hypochromic anemia ( hemoglobin level = 7.8 gr / dl ) . white blood cell count was high ( about 1112000/cc ) with significant eosinophilia ( 25% - 35% ) . immunoserology tests revealed high c - reactive protein ( crp = 13 mg / l , normal < 6 ) and erythrocyte sedimentation rate ( esr = 83 , normal for the patient s age < 10 ) . liver function tests showed high aspartate aminotransferase and alanine aminotransferase ( 57 and 45 iu / l respectively , normal < 31 ) and alkaline phosphatase ( 4030 abdominal ultrasonography demonstrated a prominent liver with a well - defined mass lesion measuring 40 35 cm . the other parts of the gi tract , including the stomach and intestine walls , were normal . upper abdominal magnetic resonance imaging ( mri ) showed normal thickness of the gi tract with no mass , but there were multiple masses in the liver . the first impression of both sonography and computed tomography scan was liver or biliary abscesses ( figure 1 ) . tru - cut needle biopsy displayed a mainly normal liver with foci of eosinophilic infiltration , which was nondiagnostic . therefore , the patient underwent surgery , which showed multiple nonencapsulated liver masses with ill - defined borders , the main one in the parenchyma and the other in the hilar area . during surgery , precise search was made to find any accompanied gi mass , but no mass was identified . also , the omentum was completely free of any tumor or mass lesion . the pathology sections showed splendore - hoeppli bodies and many eosinophils as well as radiating eosinophilic granular material surrounding the fungal elements within the liver parenchyma and in the hilar mass within the lymph node tissue ( figures 2a and2b ) . the fungal elements exhibited broad hyphae with thin walls with no septae or sparse septation . according to the characteristic pathologic features the immune system , cellular and humoral , of the patient was thoroughly investigated , even for the possibility of chronic granulomatous disease . subsequently , antifungal therapy was started , mainly composed of amphotericin b ( 1 mg / kg / d ) for at least 6 months . now after 3 months , the patient is well , the abdominal pain has been relieved , and also esr and eosinophil counts have returned to normal level . basidiobolomycosis is an uncommon fungal infection caused by basidiobolus ranarum , which is an environmental saprophyte ( 6 ) . the most common reported site of involvement is subcutaneous tissue , caused by insect bite or contamination of wounds by soil and dust ( 7 ) . however , gi involvement of this fungus is rare and seems to be secondary to the ingestion of contaminated food and water ( 8) . fewer than 80 cases of gi basidiobolomycosis have been reported in the english literature ( 9 ) , and a small number of them have been accompanied by a liver mass . the cases reported from iran were from shiraz , tehran , and mashhad ( 9 ) . in our previous 14 cases , there was a wide variation of lifestyles , both from rural and urban areas ( 10 ) . it means that the reported liver masses caused by basidiobolomycosis have always been part of a disseminated disease ( 10 - 13 ) . to the best of our knowledge , there has been no report of an isolated liver mass caused by this pathogen without the involvement of the gi tract . the probable theory for the pathogenesis in isolated liver involvement can be the acquisition of this infection after the ingestion of contaminated material and dissemination of the fungus through small lymphatics in the gi tract without creating a mass in the intestine the clinical presentation of hepatic basidiobolomycosis is very similar to tubular gi inasmuch as abdominal pain is the most common presenting symptom in the gi tract . our patient underwent liver biopsy and then laparotomy with the clinical impression of malignancy , which is the exact usual preoperative diagnosis of gi basidiobolomycosis in the previous reports ( 13 ) . the most important laboratory findings in our case were high esr and crp , with significant eosinophilia . also aspartate aminotransferase , alanine aminotransferase , and alkaline phosphatase were significantly high , which were all indicative of parenchymal liver injury most probably secondary to an inflammatory or neoplastic process . imaging studies play a key role in the diagnosis of liver masses before surgery or biopsy . all masses in the solid organs such as liver and kidney tend to show an inflammatory component with adjacent soft tissue stranding , with or without abscess formation ( 14 ) . in this case , sonography and mri were in favor of a liver mass ; however , the possibility of a hepatic abscess was also considered . in most of the previous cases of gi basidiobolomycosis , the final diagnosis was made after surgery and resection of the liver mass ( 9 ) . nonetheless , the gold standard for the diagnosis of every fungal infection is culture . in the majority of the previously reported cases of gi basidiobolomycosis , culture was either negative or was not performed because of the unavailability of the proper tissue ( 5 ) . in our case , cultures turned out to be negative . the pathologic characteristics of this fungal infection are the presence of splendore - hoeppli bodies with many eosinophils and degenerated fungal hyphae ( 13 ) . it can cause liver granuloma with heavy infiltration of eosinophilic liver granuloma and should be considered in the differential diagnosis of hepatic granulomas ( 15 ) . the best treatment in this pathogen is the resection of the mass , accompanied by antifungal therapy including itraconazole or amphotericin b. our patient showed a dramatic response to amphotericin b. in less than a week , eosinophilia disappeared and esr returned to normal and within 2 weeks , she resumed weight gain and her abdominal pain subsided . she is still under treatment , and the plan is to continue the antifungal therapy for at least 6 months , because our previous experience showed the high possibility of recurrence after an early discontinuance of the treatment . in conclusion , basidiobolomycosis should be considered as a differential diagnosis of hepatic abscess with or without gi involvement to prevent delayed treatment .

introduction : gastrointestinal basidiobolomycosis is an emerging infection , with fewer than 80 cases reported in the english literature.case presentation : also , a few cases of gastrointestinal basidiobolomycosis , accompanied by liver involvement as part of a disseminated disease , have been reported.conclusions:this is the first case report of an isolated liver involvement of this fungal infection in a 2-year - old girl , who presented with a liver mass resembling a hepatic abscess .

primary squamous cell carcinoma ( scc ) of the stomach is a rare type of gastric cancer . to date , only approximately 100 cases have been reported in the literature.1 because most of the literature is limited to single case reports ; the clinicopathologic characteristics , pathogenesis , best treatment option , and prognosis of patients with primary scc of the stomach are controversial and remain to be elucidated . in addition , primary scc of the remnant stomach after gastrectomy is an extremely rare occurrence.2345 herein , we report a case of primary scc of the remnant stomach after subtotal gastrectomy , which was treated with surgical resection and systemic adjuvant chemotherapy . a 65-year - old man was admitted to our hospital owing to epigastric discomfort and dizziness . in addition , he experienced syncope a few days before admission and an 8 kg loss of body weight during the past 2 months . he also had a history of anti - hypertensive medication use for the past 16 years . the patient had unremarkable family and social history and he appeared chronically ill . upon physical examination , the vital signs were stable ; however , he had pale conjunctiva . any specific symptoms of gastrointestinal system involvement and signs of gross bleeding were not observed . initial laboratory findings showed microcytic hypochromic anemia with very low levels of hemoglobin ( 5.9 g / dl ) and serum iron ( 15 g / dl ) . the serum levels of the carcinoembryonic antigen and ca19 - 9 were 2.99 ng / ml and 6.4 ku / l , respectively . a subsequent upper gastrointestinal endoscopy revealed a hemorrhagic and fungating tumor in the remnant stomach , near the previous gastrojejunostomy site ( fig . an abdominal computed tomography ( ct ) scan showed a heterogeneous enhanced wall thickening at the suspected gastroenterostomy site combined with several small lymph nodes along the left gastric vessels , retroperitoneal space , and gastrocolic trunk without any evidence of intra - abdominal distant metastasis ( fig . 2 ) . positron emission tomography ( pet ) ct of whole body was performed to exclude the possibility of another primary tumor or distant metastasis . a hypermetabolic mass was observed in the body of the stomach ( maximum standard uptake value : 21.7 ) without distant metastasis ( fig . complete total gastrectomy was performed with standard d2 dissection of the lymph nodes and roux - en - y esophagojejunostomy . gross distant metastasis , peritoneal seeding , or direct invasion into the adjacent organs was not observed . when the resected specimen was opened , an approximately 10-cm ulcerofungating mass was observed just above the previous gastrojejunostomy site with a clear resection margin ( fig . pathologic examination of the resected specimen revealed a keratinized well - differentiated scc with keratin pearl in the remnant stomach ( fig . the tumor extended into the subserosal layer without lymphovascular invasion or metastasis to th5e9 regional lymph nodes ( t3n0m0 , tnm stage iia ) . immunohistochemistry staining showed that the tumor cells were positive for p63 , k903 , and cytokeratin ( ck ) 5/6 ; and negative for ck 7 and ck 20 . the patient received systemic adjuvant chemotherapy with 6 cycles of 5-fu and cisplatin regimen ( 1,000 mg / m of 5-fu on day 1~3 , 800 mg / m of cisplatin on day 2 , every 4 weeks ) and is still alive and recurrence - free at the 54-month follow - up . primary scc of the stomach is a very rare malignant tumor that accounts for 0.04% to 0.07% of all gastric carcinomas.1678 since the first case of primary gastric scc was described in 1905 , less than 100 cases have been reported in the literature to date.1 in addition , scc of the remnant stomach following gastrectomy is extremely rare , and has been described in less than 5 reported cases.2345 because most reports on the primary gastric sccs are restricted to single case reports , the clinical features , pathologic characteristics , pathogenesis , optimal treatment method , and prognosis associated with the disease are controversial and remain to be elucidated . parks9 proposed that primary gastric scc should satisfy the following diagnostic criteria : ( 1 ) the tumor must not be located in the cardia ; ( 2 ) the tumor must not extend into the esophagus ; and ( 3 ) there should be no evidence of scc in any part of the body.10 other diagnostic criteria were proposed by the japanese gastric cancer association , which included the following : ( 1 ) all tumor cells are scc cells , with no adenocarcinomatous components in any sections and ( 2 ) distinct evidence that scc arises directly from the gastric mucosa.11 the pathologic cell type , tumor location , and pet - ct findings of our patient were consistent with both diagnostic criteria . although the pathogenesis of primary gastric sccs is still unknown , several hypotheses concerning the origin of the squamous cancer cell have been proposed , and are as follows : ( 1 ) squamous differentiation in the preexisting adenocarcinoma ; ( 2 ) squamous metaplasia of the gastric mucosa before malignant transformation ; ( 3 ) multipotent stem cells capable of differentiation into any cell type ; ( 4 ) nest of ectopic squamous epithelium in gastric mucosa ; ( 5 ) gastric vascular endothelial cell ; and ( 6 ) epstein - barr virus or human papilloma virus in some patients.157812131415 it has been reported that squamous metaplasia of the normal gastric mucosa could arise in special circumstances ( gastric ulcer , corrosive burn , congenital syphilis , chemoradiotherapy , and long - term treatment with cyclophosphamide).1617 for our patient , we carefully assumed that squamous metaplasia of the remnant gastric mucosa might have occurred owing to the continuous irritation from the bile as a result of gastrojejunostomy , from which cancer cells could have developed subsequently . he reported that the mean age at onset was 64.7 years ( range , 29~81 years ) and the male - to - female ratio was 44:12 . the tumor was most commonly located at the upper third of the stomach ( 57.1% ) . the mean tumor size was 6.6 cm and the type 2 was most frequent macroscopic type . more than half of the cases showed extension beyond t4 invasion ( t4a , 14% and t4b , 45% ) , which resulted in poor surgical curability . gao et al.1 reported , through the review of the most recent 11 cases , that abdominal pain was the most frequently observed clinical presentation , the mean age was 63.8 years , and the mean tumor size was 8.2 cm . recent studies suggested that the clinical characteristics of the primary gastric sccs are more evident in the 6th to 7th decades of life , show male predominance , are commonly located in the upper stomach , and have large tumor size and advanced stage at the time of diagnosis . nevertheless , a case of a primary gastric scc in a 17-year - old boy has been reported.18 although the clinical manifestations of primary gastric sccs are similar to those of adenocarcinoma of the stomach , it might have unusual features . our patient was admitted to the hospital owing to symptoms of chronic hemorrhage of the tumor . other researchers have also reported hemorrhage to be the chief clinical presentation in patients with primary gastric scc.1619 primary gastric scc might resemble a submucosal mass on endoscopy ; therefore , it could be misdiagnosed as gastrointestinal stromal tumor or malignant lymphoma of the stomach.72021 huge exophytic growth , paraneoplastic leukocytosis , and hypercalcemia in primary gastric sccs also have been reported as rare clinical manifestations.10222324 histopathological criteria for the diagnosis of a primary gastric scc was defined by boswell and helwig6 in 1965 . at least one of these criteria should be satisfied for the confirmation of diagnosis , which include keratinizing cell masses with keratin pearl , a mosaic cell arrangement , intercellular bridges , and high concentrations of sulfhydryl or disulphide bonds . keratin pearl arranged in a mosaic pattern in the squamous cell masses confirmed the diagnosis of primary scc in the patient . in addition , immunohistochemical staining of the squamous tumor cells revealed that they were positive for p63 , k903 , and ck 5/6 , which are indicative of scc and are negative for ck 7 and ck 20 ( for adenocarcinoma ) . the standard treatment for primary gastric scc is radical gastrectomy with adequate lymph node dissection . however , prognosis seems unfavorable compared to adenocarcinoma of the stomach , because primary gastric sccs are usually in the advanced stage at the time of diagnosis.178 surgery alone might be insufficient for achieving disease - free survival ; therefore , various adjuvant therapy regimens were administered for supportive treatment . most results were not promising and an ideal chemotherapy regimen for the treatment of gastric scc has not been identified . marubashi et al.25 and modi et al.26 reported the effectiveness of neoadjuvant chemotherapy for gastric scc , and yanagisawa et al.27 reported a complete response of primary gastric scc to chemotherapy with docetaxel and cisplatin plus 5-fluorouracil . the patient is still alive after receiving adjuvant chemotherapy with fp and he was recurrence - free at the 54-month follow - up . considering the favorable response of scc to radiotherapy , chemoradiotherapy could be one of the treatment options . in conclusion , primary scc of the stomach is rare ; however , it might be aggressive , and its pathogenesis and the optimal treatment option remain to be elucidated . according to the treatment principles of gastric cancer

primary squamous cell carcinoma ( scc ) of the stomach is a very rare disease . however , the pathogenesis , clinical characteristics , and prognosis of gastric scc are controversial and remain to be elucidated . herein , we report a case of primary gastric scc of the remnant stomach after subtotal gastrectomy . a 65-year - old man was admitted to our hospital due to epigastric discomfort and dizziness . he had undergone subtotal gastrectomy 40 years previously for gastric ulcer perforation . endoscopy revealed a normal esophagus and a large mass in the remnant stomach . abdominal computed tomography revealed enhanced wall thickening of the anastomotic site and suspected metachronous gastric cancer . endoscopic biopsy revealed scc . total gastrectomy was performed with roux - en - y esophagojejunostomy . a 10-cm tumor was located at the remnant stomach just proximal to the previous area of anastomosis . pathologic examination showed well - differentiated scc extended into the subserosa without lymph node involvement ( t3n0m0 ) . the patient received adjuvant systemic chemotherapy with 6 cycles of 5-fu and cisplatin regimen , and he is still alive at the 54-month follow - up . according to the treatment principles of gastric cancer , early detection and radical surgical resection can improve the prognosis .

zolpidem is a short - acting nonbenzodiazepine hypnotic of the imidazopyridine class used for short - term treatment of insomnia . zolpidem selectively activates only one of the benzodiazepine binding sites of the gabaa receptor ( alpha-1 ) which may account for its selective sedative effects and relative lack of muscle relaxant and anticonvulsant effects compared to benzodiazepines . previously , some rare cases of zolpidem - induced hallucinations have been reported from developed countries . a 20-year - old female patient visited our psychiatric clinic with sadness of mood and irritable behavior for 4 months . now she would remain worried and preoccupied with thoughts of her marital life most of the time in a day with gradual loss of interest in pleasurable as well as routine activities . she had to push herself to go to office and would not take much interest in grooming herself now . her biological functions were disturbed and her risk assessment for suicide revealed a high score . she was diagnosed as a case of major depressive disorder and was put on paroxetine 12.5 mg twice a day and zolpidem 10 mg at bed time for sleep . next day , she reported with complaints of experiencing dream - like pleasurable state in which there was lilliputian like visual and elementary auditory hallucinations after half an hour of ingestion of zolpidem . the mood disturbances observed in the patient slowly over the next 3-month treatment were replaced by euthymia most of the time . the patient started doing her routine activities and no any hallucinations were reported by the patient in her follow - up . in the index case report , the patient developed hallucinations after intake of first dose of zolpidem . patient experienced lilliputian visual and elementary auditory hallucinations within half -an hour of intake of zolpidem . its onset of action is usually within 15 minutes and its half - life is 2.6 hours . , the australian therapeutic goods administration attached a black box warning to zolpidem , stating , that zolpidem may be associated with potentially dangerous complex sleep - related behaviours that may include sleep walking , sleep driving , and other psychotic behaviours . keto and koga reported visual hallucinations in an 82-year - old woman with diagnosis of major depressive disorder after 1 and half month of administration of zolpidem . in contrast , our index patient reported the visual hallucination on the first night . there are reports of occupational hazards with zolpidem - induced hallucinations in a 54-year old driver and the continued use of zolpidem with fluoxetine resulted in nystagmus and gait disturbances . it was recommended that zolpidem be used for short periods of time using the lowest effective dose . zolpidem 10 mg is effective in treating insomnia when used intermittently no fewer than three and no more than five pills per week for a period of 12 weeks . tsai et al . postulated that visual hallucinations associated with zolpidem may be related to sudden withdrawal and restarting of zolpidem . further the author hypothesized the mechanism of this phenomena was associated with alteration in the gaba - a receptor . the author also suggested that zolpidem should never be used as needed basis and the dose should be lowest effective dose . zolpidem has not proven effective in maintaining sleep and is more used for sleep initiation problems . our case highlights that clinicians must be aware of the various pharmacological properties of zolpidem and this molecule can induce hallucinations as was observed in the indexed case . further , such cases suggest more research in this clinical area for the better wellbeing of the patients .

we are reporting a case of zolpidem - induced hallucinations in a 20-year - old patient . the duration of this phenomenon was brief , 15 - 20 minutes . our case suggests that clinicians must be aware of this phenomenon while prescribing zolpidem .

intoxication due to carbon monoxide ( co ) is one of the most common types of poisoning , and one of the most important toxicological global causes of morbidity and mortality ( 1 ) . a weak association between carboxyhemoglobin ( cohb ) level and patients clinical picture is documented ( 2 ) . co binds rapidly to hemoglobin with greater affinity than oxygen ( o2 ) and forms cohb , which leads to a decrease in the o2 carrying capacity of the blood resulting in tissue hypoxia . therefore , organs with high oxygen demand , such as heart , brain and lungs are most sensitive to hypoxia ( 3 - 6 ) . cardiac effects of cohb range from simple arrhythmias to myocardial infarction ( 7 - 9 ) . cardiac troponins ( ctn ) the release of ctn into the circulation occurs as a consequence of cardiomyocyte injury ( 10 ) . highly sensitive - ctn ( hs - ctnt ) assays are developed recently , enabling measurements of concentrations that are 100-fold lower than those of the ones previously measurable ( 11 ) . the current study aimed to assess whether or not myocardial damage occurs in patients with co poisoning . the study investigated the relationship between blood carboxyhemoglobin and hs - ctnt level with a highly sensitive assay in patients with acute co poisoning . the current retrospective study was conducted at the sevket yilmaz training and research hospital that is a state tertiary hospital with 1050 beds , located in the eastern bursa , turkey . the study used the data available in the hospital clinical data warehouse , a centralized data repository integrating information in several databases including the order entry database and the laboratory results database of the hospital . patients diagnosed with co poisoning were included in the study and their corresponding electronic charts were reviewed for data collection . prescription data were linked to detailed clinical information including patient demographics , diagnosis , clinical characteristics ( including past medical history , smoking status ) , co source ( charcoal or fire ) , vital signs at presentation , physical examination characteristics , cohb levels , treatment therapy , complications in erectile dysfunction ( ed ) , and laboratory data ; the latter included specimen collection date , time , and location ( for example : intensive care unit ) . two - hundred - seventeen cases admitted to the emergency medicine unit of the hospital in 2012 , ( january 2012 - january 2013 ) with the diagnosis of acute co intoxication seventy - six patients whose additional diagnoses indicated chronic ischaemic heart disease , heart failure , myocarditis , muscular dystrophy , polymyositis , implanted cardiac resynchronization device , chronic inflammatory disease , and chronic renal failure were excluded . the overall study population included 141 subjects ( 87 females ( 62% ) and 54 males ( 38% ) ; 70% of the poisonings occurred in the winter , 24% in spring and 6% in autumn . the study was approved by the sevket yilmaz research and education hospital ethics committee ( no . 2013/7 - 4 ) and was in compliance with the helsinki declaration ; informed consent was not assumed necessary because of the retrospective observational nature of the study and all steps were taken to ensure the anonymity of the data . blood samples were first collected ( on admission ) in the emergency department and four hours later in the intensive care unit ( icu ) . routine laboratory data ( cohb , creatine kinase - myocardial band ( ck - mb ) and high - sensitivity cardiac troponin t ( hs - tnt ) were recorded . cohb levels were measured by a blood gas analyzer ( omni s , roche diagnostics penzberg , germany ) supported by a co - oximetry panel . hs - ctnt and ck - mb levels were determined by an elecsys 2010 autoanalyzer ( roche diagnostics , penzberg , germany ) using commercial assays . according to the manufacturer of the hs - ctnt stat assay , ng / l , and the 99th percentile in healthy volunteers was 14 ng / l . for quality assurance purposes , the laboratory participates in an external quality assessment scheme run by labquality , helsinki , finland . at the time of the present study , the qc program reported average values as part of the treatment , all the patients inhaled high flow normobaric oxygen and were monitored and followed up in icu . treatment continued until clinical findings stabilized and serum cohb levels decreased to target levels of 5% . the patients intoxicated with co were divided into three groups depending on cohb levels : group i , mild cohb level < 15% ; group ii , cohb levels < 25% and > 15% ; group iii , severe acute co intoxication cohb levels > 25% . samples with hs - ctnt below the limit of blank ( i e , 3 ng / l ) were assigned a value of 1 ng / l . the comparisons between the medians of three groups were performed by the kruskal - wallis test and the post - hoc dunnett tests were used to examine the significance levels between groups . spearman rank analysis was used to assess associations between cohb , ck - mb and hs - tnt levels ( spss , chicago , il ) and p values of < 0.05 were considered significant . the patients intoxicated with co were divided into three groups depending on cohb levels : group i , mild cohb level < 15% ; group ii , cohb levels < 25% and > 15% ; group iii , severe acute co intoxication cohb levels > 25% . samples with hs - ctnt below the limit of blank ( i e , 3 ng / l ) were assigned a value of 1 ng / l . the comparisons between the medians of three groups were performed by the kruskal - wallis test and the post - hoc dunnett tests were used to examine the significance levels between groups . spearman rank analysis was used to assess associations between cohb , ck - mb and hs - tnt levels . ( spss , chicago , il ) and p values of < 0.05 were considered significant . one - hundred - forty of the patients were poisoned at home and only one of the patients was poisoned at work and they used coal or wood for heating . the predominating symptoms were nausea ( n = 89 ) , headache ( n = 86 ) , dizziness ( n = 47 ) and vomiting ( n = 28 ) . cohb levels ranged from 8 to 35 ( median 23 , mean 22.0 6.6% ) on admission . the patients intoxicated with co were divided into three groups depending on their cohb levels : group i , mild cohb level < 15% ( n = 29 ) ; group ii , cohb between 15% and 25% ( n = 67 ) ; group iii , severe acute co intoxication cohb levels > 25% ( n = 45 ) ( table 1 ) ( 12 ) . abbreviations : ck - mb , creatine kinase - myocardial band ; cohb , carboxyhemoglobin ; hs - tnt , high - sensitivity cardiac troponin t. values are expressed as median ( interquartile range ) or mean sd . median hs - ctnt increased with increasing cohb level ( kruskal - wallis p = 0.05 ; table 1 ) . when the post - hoc dunnett test was performed , hs - ctnt levels were not statistically different between the groups . ck - mb levels did not differ between the three groups ( kruskal - wallis ; p = 0.48 ) . cohb levels with hs - tnt values were weakly correlated ( r = 0.173 , p = 0.041 ) ; on the other hand , ck - mb levels were not correlated with those of the cohb ( r = 0.013 , p = 0.883 ) ( table 2 ) . abbreviations : ck - mb , creatine kinase - myocardial band ; hs - tnt , high - sensitivity cardiac troponin t. on admission , 5 of the 141 patients had elevated serum ck - mb levels and 20 had elevated serum hstnt levels ( > 14 ng / l ) , only three of the patients with cardiac markers were elevated on the follow - up period . the findings of the cohort current study of patients with cohb intoxication hs - ctnt levels were slightly higher in severe toxicated patients than in mild toxicated patients without significant correlation between cohb and hs - ctnt levels . cardiac troponins are components of the contractile apparatus of cardiomyocytes and are released during myocardial necrosis . serum troponin elevation is a specific and well established myocardial necrosis biomarker , and can detect extremely small amounts of myocardial necrosis ( < 1.0 g ) ( 12 , 13 ) . very low , but detectable amounts of hs - ctnt levels may reflect a normal biological process of myocyte turnover and it may also be associated with an increased cell turnover ( 14 , 15 ) . the proposed mechanisms of cardiac troponin release include apoptosis , cellular release of proteolytic degradation products , increased cell wall permeability , and formation and release of membranous blebs ( 11 ) . many acute diseases are associated with elevated ctn in the absence of acute ischemic heart disease that can occur for many reasons ( 16 ) . direct toxic effects of circulating cytokines and chemotherapies can cause severe myocardial toxicity as severe sepsis and septic shock ( 12 , 16 ) . recent data showed that one can detect the effects of some toxic chemotherapy by monitoring ctn ( 16 ) . low levels of co activate soluble guanylate cyclase which in turn exerts beneficial effects such as vasodilatation and inhibition of platelet aggregation ( 7 ) . in the current study , hs - ctnt levels were higher in patients with severe co toxicity compared to the ones with mild co intoxication . although ultramicroscopic changes are reported in cases of co toxicity , its relative effects need to be documented ( 17 ) . a direct toxic effect of cohb is discussed as a consequence of experimental studies on cytochrome oxidase ( 17 ) . co binds with cardiac myoglobin causes a rapid decrease in myocardial oxygen reserves ( 18 ) . when the energy source is blocked , then the function of the myoglobin is diminished ( 19 , 20 ) . myocardial fiber necrosis and other changes observed with electron microscopy are associated with impaired energy metabolism ( 22 , 23 ) . however , cardiac troponins are released without electron microscopic changes ( 24 , 25 ) . in this study ck - mb levels did not differ between the three groups and did not correlate with cohb . patients with detectable troponin , but no ck - mb , in the blood may exhibit microscopic zones of myocardial necrosis ( microinfarction ) ( 13 ) . ( 26 ) showed that in co poisoning , patients without known underlying significant coronary artery disease with cohb levels of up to 60% do not develop myocardial damage but they used only cardiac biomarkers ck - mb and ctnt . the current study did not find any significant elevation in ck - mb levels , but in contrast a significant increase in hs - ctnt levels was found , which might be because of the microscopic myocardial necrosis ( 26 ) . myocardial injury , documented with elevations in cardiac biomarkers , could be present in about one - third of the patients with serious co poisoning and it was associated with mortality ( 7 ) . the severity of myocardial injury depended on the duration and amount of co exposure ( 27 ) . moreover , the level of co in the tissues may have an equal or greater impact on the clinical status of the patient than does the blood level of co ( 28 ) . the primary limitation of the current small study group was the method of data collection . there was no information on the length of co exposure and the timing of the blood cohb levels in relation to the co exposures . further studies are necessary in this regard . another limitation was the retrospective nature of the study . the data were reviewed by one researcher who avoided the selection bias ; however , misclassification , may still exist , which can not be verified or validated . these results apply only to the elecsys hs - ctnt and ck - mb ( roche diagnostics ) assays , and may not be generalized to other high sensitivity assays by other manufacturers . finally , the study design was based on the data available in one hospital , and the obtained results may not necessarily be generalized . in conclusion , in patients without clear signs of myocardial infarction , even mild co poisoning is associated with quantifiable circulating levels of hs - ctnt when tnt is measured using a highly sensitive assay and cardiac complications should be considered in such patients . plasma levels of the hs - tnt and ck - mb assays were not correlated with the cohb levels . in conclusion , in patients without clear signs of myocardial infarction , even mild co poisoning is associated with quantifiable circulating levels of hs - ctnt when tnt is measured using a highly sensitive assay and cardiac complications should be considered in such patients . plasma levels of the hs - tnt and ck - mb assays were not correlated with the cohb levels .

backgroundintoxication due to carbon monoxide ( co ) is one of the most common types of poisoning . cardiac effects of carboxyhemoglobin ( cohb ) range from simple arrhythmias to myocardial infarction.objectivesthe current study aimed to investigate the relationship between blood carboxyhemoglobin and high - sensitivity cardiac troponin t ( hs - ctnt ) level with a highly sensitive assay in patients with acute carbon monoxide poisoning.patients and methodsthis retrospective study was conducted on 141 ( 54 males and 87 females ) patients , with acute co intoxication , admitted to the sevket yilmaz research and education hospital emergency unit during a one - year period ( january 2012 - january 2013 ) . the patients were divided into three groups based on cohb levels : group i , mild cohb level < 15% ; group ii , cohb between 15% and 25% ; group iii , severe acute co intoxication cohb levels > 25% . cohb , hs - ctnt ( stat ) , creatine kinase ( ck ) and creatine kinase - myocardial band ( ck - mb ) levels were measured on admission.resultsthe mean age of the patients was 38 16 years . cohb levels ranged from 8 to 35 . hs - ctnt levels on inclusion in this study were slightly different between the groups ( p = 0.05 ) . cohb levels with hs - ctnt values were weakly correlated ( r = 0.173 , p = 0.041 ) ; on the other hand , ck - mb levels were not correlated with cohb ( r = 0.013 , p = 0.883).conclusionsin patients without clear signs of myocardial infarction , even mild co poisoning was associated with quantifiable circulating levels of hs - ctnt when tnt was measured using a highly sensitive assay in the current study patients . plasma levels of the hs - tnt and ck - mb assays were not correlated with the cohb levels in the current study patients .

the treatment regimen includes multi - agent chemotherapy ( three phases : induction therapy , intensification therapy , maintenance therapy ) and central nervous system directed radiotherapy . immune suppression caused due to disease , and its therapy makes these children more prone to infections with severe stomatologic complications . the most common complications are mucositis , xerostomia , bleeding , dysgeusia and infections leading to pain , discomfort and interfere with the course and prognosis of the neoplasm . the study was planned to study the oral manifestations in pediatric population with acute leukemias during the induction phase only . to study the oral manifestation of acute leukemia during induction chemotherapy.to analyze the level of oral hygiene and find its correlation with induction outcome ( short come outcomes in the form of increased febrile neutropenic episodes , induction deaths , number of admissions ) . to study the oral manifestation of acute leukemia during induction chemotherapy . to analyze the level of oral hygiene and find its correlation with induction outcome ( short come outcomes in the form of increased febrile neutropenic episodes , induction deaths , number of admissions ) . to study the oral manifestation of acute leukemia during induction chemotherapy.to analyze the level of oral hygiene and find its correlation with induction outcome ( short come outcomes in the form of increased febrile neutropenic episodes , induction deaths , number of admissions ) . to study the oral manifestation of acute leukemia during induction chemotherapy . to analyze the level of oral hygiene and find its correlation with induction outcome ( short come outcomes in the form of increased febrile neutropenic episodes , induction deaths , number of admissions ) . this was a cross - sectional noninvasive study . thirty three patients both sexes age range ( 5 - 15 years ) in pediatric oncology unit with diagnosis of acute lymphoblastic leukemia and acute myeloblastic leukemia were the subjects for the study . single clinician ( dental surgeon ) performed oral examination of children at the 1 week of induction and 4 week of induction of chemotherapy . patients who have completed first induction phase or those who were on maintenance therapy were excluded from the study . the parents / responsible guardians were informed and explained about the aim and character of the study . patients were evaluated for , oral hygiene by using oral hygiene index - simplified ( ohi - s ) [ table 1a , b ] , dental caries by using def index and decayed missing filled teeth ( dmft ) index , [ table 2 ] and gingival findings by using the patients were also scrutinized for any other findings or lesions in the oral cavity , i.e. , lesion including site and size of the lesion , candidiasis , any other infections as herpes simplex virus , varicella zoster virus , cytomegalovirus , acute necrotizing and ulcerative gingivitis . gingival index of loe and silness debris index : debris is defined as soft , foreign matter consisting of bacterial plaque and food debris . the criteria include : the same examination was again carried out in the 4 week of the induction phase . all the scores and observations were recorded in a diagnostic chart along with the brief patient 's history and complete blood count on the day of observation . these reports were collected and co - related with short term outcomes such as febrile / neutropenic episodes / morbidity / mortalities with the help of routine blood culture reports . the changes in the oral health status were being observed during first week and fourth week and were analyzed with wilkoxon 's signed rank test . the indices scores were converted in to percentage scale . for this pilot study , a cut - off criteria has been set as 50% for oral hygiene , gingival and def / dmft index . debris index : debris is defined as soft , foreign matter consisting of bacterial plaque and food debris . the criteria include : the same examination was again carried out in the 4 week of the induction phase . all the scores and observations were recorded in a diagnostic chart along with the brief patient 's history and complete blood count on the day of observation . these reports were collected and co - related with short term outcomes such as febrile / neutropenic episodes / morbidity / mortalities with the help of routine blood culture reports . the changes in the oral health status were being observed during first week and fourth week and were analyzed with wilkoxon 's signed rank test . the indices scores were converted in to percentage scale . for this pilot study , a cut - off criteria has been set as 50% for oral hygiene , gingival and def / dmft index . a total of 23 male and 10 female patients with acute leukemia were studied prospectively . we found that the dental status namely the gingival and periodontal tissues were affected in this period due to lack of good oral hygiene and overall poor health status following chemotherapy [ table 1 ] . 15 out of 30 ( 50% ) subjects showed increase in ohi - s , loe and silness gingival index . a significant change was observed in these indices ( p = 0.002 ; 0.003 , respectively ) . there were no extractions or dental filling done ; the decay factor was mainly noticed in this period . dental finding pre- and post - induction phase table 5 shows hematological finding pre- and post - induction phase . no significant difference was noted in hemoglobin , total leucocytic count , or absolute neutrophil count ( p = 0.4 ; 0.11 ; 0.53 respectively ) , but highly significant difference was seen in platelet count p < 0.05 . hematological finding pre- and post - induction phase in this study , no interruptions in induction chemotherapy was reported due to dental infections . three patients expired due to debilitating general health , but not due to induction therapy . palatal aphthous ulcer was observed in a child and it was 1.5 cm diameter in size . in another subject angular cheilitis was noted . all the remaining subjects presented no clinical signs of oral lesion . as a regular protocol the suspected foci of infection was cultured and it was found to be candida in angular cheilitis . in the second case of aphthous ulcer neutropenia was noticed as a cause . leukemia is a disease resulting from the malignant transformation of stem cells whose proliferation starts in the bone marrow . oral complaints precipitated by the side - effects of the antineoplastic agents are primarily those of discomfort , sensitivity of teeth and pain , ulceration , gingival hemorrhage , dryness and impaired taste sensation . maintenance of oral hygiene is the basic preventive aid from all kinds of oral infections . patients are advised against any vigorous mechanical dental cleansing aid ( tooth brush / floss / interdental cleaning aids ) to avoid triggering of any bleeding episodes . an alkaline saline rinse of warm water flavored with salt and sodium bicarbonate is recommended for oral cleansing . gingiva reacts differently to even slight amount of plaque if subject is on anti - neoplastic therapy for blood dyscrasias . in the present study , it was observed that the ohi - s count was increased in 50% of individuals . this change in ohi - s definitely affects other oral hard and soft - tissues . inflammation in the gingiva is most common and probably earliest presentation of changes in oral tissues due to plaque . the increased scores of gi in 50% of individuals clearly highlight the problems associated oral hygiene maintenance in these patients . the gingival inflammation , if not treated leads to periodontal problems and may eventually lead to loss of teeth in adult patients . dmft / def index was found to be increased in 10 patient 's , i.e. , 33% of study population . since no active dental treatment is advocated ( advisable ) to any patient undergoing induction therapy , the difference in dmft was only in d , i.e. , decay component of the dmft . although the induction therapy drugs are not directly responsible for the decay process , the change in oral environment due to excess plaque accumulation and/or change in quality and quantity of saliva due to drugs might have played important role in increased in caries process . in most of the patient 's erythematous oral mucosa , burning sensation of mouth was common , since mucositis was not primary objective of this study , the findings were not noted . one subject demonstrated an aphthous ulcer on palatal mucosa but it responded well to the symptomatic therapy . in another subject , angular cheilitis was seen . the angular cheilitis is generally a clinical sign of an inflammatory response to fungal infection . there was no statistical significant difference was observed in terms of short term outcomes of leukemia therapy due to dental problem . in this study , it was observed that the oral health status worsened following first induction chemotherapy in acute leukemic pediatric patients . there was a significant increase in level of ohi , gingival index and def / dmft . lesions like aphthous ulcer and angular cheilitis were noticed in two of the subjects while other subjects did not have any oral complications . these finding suggest that there is a need to institute optimum oral health , during and in between induction phases . further study is study with larger sample size is needed to conclude the role of oral hygiene in the induction outcome of pediatric patients receiving treatment for acute leukemia .

background : treatment of acute leukemia's- a common childhood malignancy , involves intensive and powerful multi - drug chemotherapeutic regime . oral lesions are a common complication in these patients affecting oral health status.aim:this study was conducted to evaluate and assess the oral health status of newly diagnosed leukemic pediatric patients during induction phase and its correlation to outcome of induction therapy.material methods : oral examinations was done in 33 children between the age group of 5 - 15 years with acute lymphoblastic leukemia ( all ) and acute myloblastic leukemia ( aml ) , who were undergoing chemotherapy . oral hygiene index- simplified , ( ohi - s ) decayed missing filled teeth index ( def / dmft ) , loe and sillness index for gingiva , and complete blood count at first and fourth week of induction phase were recorded for each patient . the changes in the oral health status were analyzed with wilcoxon signed rank test.results:during an induction phase it was observed that level of ohi - s ( p = 0.002 ) , loe and sillness index ( p = 0.003 ) , def / dmft index ( p = 0.076 ) , platelet count ( p = 0.00 ) increased significantly and no significant difference was noted in hemoglobin ( p = 0.4 ) and total leucocytes count ( p = 0.11).conclusion : it was observed that , although oral health status had significantly worsened , the induction outcome was not affected .

renal cell carcinoma ( rcc ) may metastasize to any site of the body , but clinically evident metastatic intestinal involvement by rcc is extremely rare . to our knowledge , simultaneous duodenal and colonic metastases have not been reported in the english literature . we report a case of pathologically proven simultaneous duodenal and ascending colonic metastases about four years after a left nephrectomy for rcc . a 76-year - old female patient who had undergone a left radical nephrectomy 4 years previously for rcc ( mixed clear and granular cell type , tnm stage iii ) presented with a 1-month history of dyspepsia , lethargy and pain in the right upper abdomen . her blood pressure was 110/70 mmhg , pulse rate 80/min , respiration rate 22/min and body temperature 36.8c . abdominal examination revealed slight tenderness but normal peristalsis ; however , a movable mass was palpated in the right upper abdomen . the hematocrit was 28.1% and the white cell count was 9700/mm with 77% polymorphonuclear cells and 14% lymphocytes . serum sodium was 134 meq / l , potassium 3.5 meq / l , chloride 101 meq / l and calcium 9.5 mg / l . the result of liver function tests were as follows : total protein 6.5 g / dl , albumin 3.5 g / dl , cholesterol 165 mg / l , bilirubin 0.6 mg / dl , alkaline phosphatase 105 iu / l , ast 28 iu / l and alt 21 iu / l . tumor marker levels , such as carcinoembryonic antigen ( cea ) , carbohydrate antigen 19 - 9 ( ca19 - 9 ) and -fetoprotein ( afp ) , were within normal limits . an abdominopelvic ct scan showed circumferential wall thickening with high enhancement at the second portion of the duodenum and additional enhancement of an irregular protruding mass into the lumen of the ascending colon with multiple lymphadenopathy in the aortocaval area ( figure 1 ) . a gastroscopy showed a large , irregular multi - lobed , partially necrotic and ulcerative protruding mass nearly obstructing the second portion of the duodenum . a colonoscopy revealed a polypoid , nodular mass in the ascending colon , which was purplish in color , had sharp margins and was pliable ( figure 2 ) . microscopic findings of biopsy specimens showed features identical to those of the renal cell carcinoma which was resected 4 years earlier in this patient and immunohistochemical stainings for vimentin was positive ( figure 3 ) . interferon was given at a dose of 2 million iu per square meter three times a week . however , interferon therapy was discontinued after three months due to anemia , anorexia and general weakness . the clinical course of the disease ranges from months to several decades and even spontaneous regression has been documented . approximately 25% of patients with rcc have metastatic disease at the time of diagnosis . the delayed occurrence ( as late as 31 years after a nephrectomy ) of metastatic rcc is well known . solitary metachronous metastases from rcc are rare ; however , they can occur very late in the course of the disease . renal cell carcinoma may metastasize to almost every organ of the body , but 95% of the metastatic lesions involve the lung , lymph nodes , liver , bone , adrenal glands and the opposite kidney . however , there are scattered reports in the literature of clinically evident intestinal metastasis from rcc . to the best of our knowledge , a secondary tumor involving the intestinal tract may be caused by direct extension , lymphatic spread , peritoneal or hematogenous dissemination . in the present case , duodenal and colonic metastases are not generalized carcinomatosis because any other metastasis is not occurred in common metastatic sites and duodenal and ascending colonic involvement are remote from a primary cancer of the left kidney . hypervascularity of the present tumor , as suggested by a ct scan , gastroscopy and colonoscopy , was compatible with the characteristics of metastatic renal cell carcinoma . also , positive immuno - histochemical stain for vimentin elucidated that the duodenal and colonic masses are compatible with carcinoma rather than adenocarcinoma . surgical excision of the local recurrence is the best procedure for therapy , but this can be radical only when the recurrence can be completely excised . chemotherapies , including hormonal and interferon therapies , are effective in some patients with metastatic renal cell carcinoma . in our case although interferon treatment was used to treat metastatic rcc , it is not easy to evaluate its effectiveness because of premature discontinuance of the treatment . in our opinion , endoscopists should consider the possibility of intestinal metastasis of rcc when endoscopic and ct studies show a hypervascular mass in a patient with a previous history of rcc .

we report a case of pathologically proven simultaneous duodenal and colonic metastases about four years after nephrectomy for mixed clear and granular cell type renal cell carcinoma ( rcc ) . a 76-year - old female patient who had undergone a left radical nephrectomy 4 years previously for rcc presented with a 1-month history of dyspepsia and pain in the right upper abdomen . an abdominopelvic ct scan showed circumferential wall thickening with high enhancement at the second portion of the duodenum and additional enhancement of an irregular protruding mass into the lumen of the ascending colon . a gastroscopy showed a large and ulcerative protruding mass nearly obstructing the second portion of the duodenum . a colonoscopy revealed a polypoid , nodular and purplish mass in the ascending colon . microscopy of the biopsy specimen showed the features identical to those of the rcc which was resected 4 years earlier in this patient . we believe this to be the first case illustrating a metastatic renal cell carcinoma as simultaneous duodenal and colon masses .

the prevalence of p. skrjabini in iran has been reported 4.2% in goat , 5.43% in sheep ( 1 , 2 ) , and 0.8% in wild sheep ( 1 , 3 ) . researchers could analyze the divergences and genetic distances among taxa in the rdna nucleotide sequences to perform phylogenetic relationships analysis and species identification researches . the rdna secondary structures are predicted from the corresponding primary sequences according to base pairing , containing all the sequence information . although , there are significant variations in rdna sequences across different taxa ( 4 ) , the corresponding secondary structures of the transcribed rrna are highly conserved during evolution ( 5 ) , perhaps due to the important role of the rrna folding in holding the structural rna functions ( 6 ) . in addition , the secondary structures are more conserved than the primary sequences for the semi - compensatory or compensatory mutations , and therefore when the multiple sequence alignments look less reliable due to deletion or insertion , the structures can help to make more reliable assignment of nucleotide homology with important role in the phylogeny ( 7 ) . in addition , some changes , like expansions and deletions , of a certain helix could be specific to a taxon to help in species identification . so , the secondary structures have drawn a lot of attention from phylogenetic scientists however , the study on secondary structures takes a slower step than that primary sequences because of the limited sequence data in genbank suitable for structure prediction . in this study , the secondary structures of 5.8srrna of p. skrjabini were comprehensively investigated and compared with secondary structure of a p. skrjabini ( eu375510.1 ) and two species of h. muscae ( ay251024.1 ) and h. microstoma ( ay251023.1 ) sequences , which are located in the same family retrieved from ncbi . such case studies are suitable to provision of basic data , both for reconstructing molecular evolution in expansive phylogenetic contexts and for analyzing function in ribosome biogenesis . however , only one study could be derived on parabronema at a molecular level ( 9 ) . the aim of this study was to analyze the 5.8s rrnagene sequence and to study the possible effect of nucleotide substitutions on the topology of the secondary structure of the 5.8s rrna molecule in p. skrjabini and related habronematidae species . consequently , we studied the 5.8s rrna gene sequence of the members of the family habronematidae and determined the probable secondary structure of the5.8s rrna molecule for the first time . dna extraction from worms was performed using an extraction kit ( mbst , iran ) according to the manufacturer s instructions . the rrna gene was amplified using the primer pairs based on the r dna genome sequence ( 9 ) . the forward primer was ps - f : 5-gta ggt gaa cct gcg gaa gg -3 and reverse primer was ps - r : 5-ttagtttcttttcct ccgct -3. the pcr reaction was carried out in a total volume of 100l containing 1pcr buffer , 100 mmol mgcl 2 , 100 m dntp mix ( cinaclone , iran ) , 20 mol of each primer ( cinaclone co. ) , 5 unit/l taq dna polymerase ( cinaclone ) and 1l of template dna ( 100 ng dna ) in an automated thermocycler . the pcr was performed using the following protocol : 5 min incubation at 94 c , 33 cycles of 45 s at 94 c , 45s at 59 c , and 45 s at 72 c , with an additional extension step for 5 min at 72 c . the pcr products were analyzed on 1% agarose gels in 0.5 tbe buffer and visualized using sybersafe staining ( cinaclon , iran ) and a uv illuminator . the pcr product was purified using a quick pcr product purification kit ( mbst , iran ) according to the manufacturer s instructions . genomic dna sequencing using the sanger method was performed in both directions on the pcr product by the kawsar biotech co. iran . the sequences were analyzed using the geneious 5.1.6 software and compared against genbank ( www.ncbi.nlm.nih.gov/ ) using the basic local alignment search tool ( blast ) . the probable secondary structure of the 5.8s rrna molecule was constructed using mfold software ( http://mfold.rit.albany.edu/ ) . common structural elements were initially recognized with the help of mfold(10 , 11 ) by screening for thermodynamically optimal and suboptimal secondary structures ( default settings , with t = 37 c ) . energy levels of the presumptive secondary structures were then calculated with mfold ( 10 , 11 ) . alignment , analysis of the derived nucleotide sequences , and cluster analysis were performed using mega 6.0 software ( 12 ) . dna extraction from worms was performed using an extraction kit ( mbst , iran ) according to the manufacturer s instructions . the rrna gene was amplified using the primer pairs based on the r dna genome sequence ( 9 ) . the forward primer was ps - f : 5-gta ggt gaa cct gcg gaa gg -3 and reverse primer was ps - r : 5-ttagtttcttttcct ccgct -3. the pcr reaction was carried out in a total volume of 100l containing 1pcr buffer , 100 mmol mgcl 2 , 100 m dntp mix ( cinaclone , iran ) , 20 mol of each primer ( cinaclone co. ) , 5 unit/l taq dna polymerase ( cinaclone ) and 1l of template dna ( 100 ng dna ) in an automated thermocycler . the pcr was performed using the following protocol : 5 min incubation at 94 c , 33 cycles of 45 s at 94 c , 45s at 59 c , and 45 s at 72 c , with an additional extension step for 5 min at 72 c . the pcr products were analyzed on 1% agarose gels in 0.5 tbe buffer and visualized using sybersafe staining ( cinaclon , iran ) and a uv illuminator . the pcr product was purified using a quick pcr product purification kit ( mbst , iran ) according to the manufacturer s instructions . genomic dna sequencing using the sanger method was performed in both directions on the pcr product by the kawsar biotech co. iran . the sequences were analyzed using the geneious 5.1.6 software and compared against genbank ( www.ncbi.nlm.nih.gov/ ) using the basic local alignment search tool ( blast ) . the probable secondary structure of the 5.8s rrna molecule was constructed using mfold software ( http://mfold.rit.albany.edu/ ) . common structural elements were initially recognized with the help of mfold(10 , 11 ) by screening for thermodynamically optimal and suboptimal secondary structures ( default settings , with t = 37 c ) . energy levels of the presumptive secondary structures were then calculated with mfold ( 10 , 11 ) . alignment , analysis of the derived nucleotide sequences , and cluster analysis were performed using mega 6.0 software ( 12 ) . the length of 5.8s rrna sequence for p.skrjabini#1 , p.skrjabini#2 , h. microstoma and h. muscae was 158 , 156 , 127 and 127bp , and the dg required for the formation of the secondary structure was 70.50 , 56.40 , 41.50 and 41.40 kcal / mol , respectively . the stem loop structures were folded using the mfold web server ( http://mfold.rna.albany.edu/ ) zuker 2003 ( fig . the 5.8s rrna gene sequences in the habronematidae samples analyzed maximization of the hydrogen bonding formed solid stems , and the largest negative delta g value ( free energy ) . we predicted the motifs for 5.8s rdna of p. skrjabini and three other sequences in genebank ( p. skrjabini#2 , h. muscae and h. microstoma ) . three motifs were identified for 5.8s of p. skrjabini#1 , the first motive- aggggg ( 6bp ) , the second motive- taaaaa ( 6bp ) and the third motive- caaaga ( 6bp ) . the first motive is repeated in two positions [ 10 and 148 ] . in addition , the second motive is repeated in two positions [ 39 and 61 ] . for p. skrjabini#2 three motifs were identified , the first motive gataaatagtgcgaattgca ( 20bp ) , the second motive- gtggat ( 6bp ) and the third motive- ccatcggg ( 8bp ) . the second motive is repeated in two positions [ 13 and 29 ] . for h. muscae there are three motifs , the first motive catcccgatggt ( 12bp ) , the second motive gtcgat ( 6bp ) and the third motive cagacg ( 6bp ) . the second motive is repeated in two positions [ 3 and 122 ] . for h. microstoma we identified three motifs , the first motive cccgatggt ( 9bp ) , the second motive agctgc ( 6bp ) and the third motive cagacg ( 6bp ) . the number of different loops , motifs and the dg for formation of the secondary structure is shown in table 1 , fig . 2 . statistical information of the predicted secondary structure of parabronema skrjabini rrna phylogenetic tree of habronematidae family the secondary structures contain more information than the primary sequences and are the bases of rrna function ; have gained a lot of attention in phylogenetic analysis . in this study , the secondary structure of 5.8s rrna of p. skrjabini was predicted and the structure comparison performed by predicating the secondary structures for a p. skrjabini and two species of habronema ( h. muscae and h. microstoma ) sequences , which is located in the same family retrieved from ncbi . 5.8s ribosomal rna ( 5.8s rrna ) is a non - coding rna component of the large subunit of the eukaryotic ribosome that plays an important role in protein translation . in this study secondary structure with bulge , hairpins , helices , interior , external and multi loops of 5.8s rrna sequence of p. skrjabini was reconstructed under specific settings for base pairing and compared with secondary structure of a sequence of p. skrjabini , and two species of habronema ( h. muscae and h. microstoma ) retrieved from ncbi . the predicted ssu rrna secondary structure in the present study was the first model for p. skrjabini . however , the prediction of the secondary structure was impaired due to a few complete sequences of limited species of parabronema . in total , 41 variable sites in the 5.8s rrna gene sequence were detected in the samples analyze ( fig . p. skrjabini#2 was more similar to h. muscae and h. microstoma and was more invariable than p. skrjabini#1 . there was a 31-nucleotide absence at the beginning of the 5.8s rrna gene of h. muscae and h. microstoma . however , this insertion is present in the p. skrjabini#1and this presence is 30 for p.skrjabini#2 . the motive 2a and 2b for p. skrjabini#2 and the motive 2a and 2b for h. muscae are different in only one nucleotide ( g - c ) . the motive 3a in h. muscae and 3a in h. microstoma is common and motive 1a in h. muscae and h. microstoma had only three - nucleotide difference . we isolated p. skrjabini#1 in sheep and from sanandaj ( west of iran ) , but p. skrjabini#2 is in camel and china , h. muscae and h. microstoama are in horse and italy . the phylogenetic tree ( fig . d : h. muscae ( ay251024.1).the position of motifs is shown on the secondary structures . the nucleotide substitutions are shown by arrows moreover , some changes , such as expansions and deletions , of a certain helix could be specific to a taxon to help a lot in species identification . using mfold software , the probable secondary structure of the 5.8s rrna gene when constructing the secondary structure of the 5.8s rrna gene sequence , the sequence of p. skrjabini was used as a consensus sequence . the secondary structure of the 5.8s rrna gene has not been described for family habronematidae , specially the genus of p. skrjabini . in our study , for the first time we determined the secondary structure of 5.8s rrna in the p. skrjabini and related habronematidae species . we made a multiple alignment and found structural differences among the analyzed samples , parabronema and habronema , which could be further used in the structure modeling across habronematidae .

background : genomic dna was isolated from parabronema skrjabini . rrna region was amplified and sequenced.methods:the rna secondary structure was predicted using mfold software ( http://mfold.rit.albany.edu ) . the secondary structure with bulge , hairpins , helices , interior , external and multi loops was predicted for 5.8srdna of our sequence of p. skrjabini and a sequence of p. skrjabini and two species of habronema ( h. microstoma and h. muscae ) in genbank . rna motifs were predicted by meme program version 4.10.2.results:the length of 5.8s rrna sequence for p. skrjabini#1 , p. skrjabini#2 , h. microstoma and h. muscae was 158 , 156 , 127 and 127bp , and the dg required for the formation of the secondary structure was 70.50 , 56.40 , 41.50 and 41.40 kcal / mol , respectively . common structural elements were initially recognized with the help of mfold by screening for thermodynamically optimal and suboptimal secondary structures ( default settings , with t = 37 c ) . the energy levels of the presumptive secondary structures were then calculated with mfold at the dna level . both motifs and the sequence of p. skrjabini#1 were completely different from the other analyzed samples . this difference might be due to the differences in host and geographical area.conclusion:this is the first molecular study of p. skrjabini in sheep , which could be further used in the structure modeling across habronematidae .

the clinical impact of coronary artery anomalies depends on the capability of anomalous arteries to provide adequate blood supply to the myocardium.[13 ] double left anterior descending coronary artery arising from the left and right coronary arteries is one of the rarest of coronary anomalies . it is usually clinically silent but the recognition of this rare anomaly is important because it may mislead to wrong clinical diagnosis as well as surgical complications.[25 ] in this report , we present a case of double left anterior descending coronary artery with one originating from the left main stem and the second one originating from the same ostium with the right coronary artery , which is diagnosed with multislice computed tomography ( ct ) angiography . a 36-year - old male patient was admitted to our hospital with the complaint of non - specific chest pain . he had a history of smoking and hypertension , potential risk factors for coronary artery disease . also his father at the age of 46 years had died suddenly with unclear etiology . at the time of the evaluation the chest pain was not typical for angina pectoris but the patient was very nervous due to his family history . for further evaluation an exercise test was required but this was not possible as the patient had recently undergone knee surgery for meniscopathy . therefore , to evaluate chest pain and to detect or rule out coronary artery disease , the patient underwent computed tomography coronary angiography ( ctca ) . ctca was performed using a 64 slice ct scanner ( siemens sensation 64 , germany ) . scan parameters were as follows : slice collimation , 32 2 0.625 mm ; rotation time , 0.33 mins ; tube voltage , 120 kv ; tube current , 600 ma ; and pitch , 0.2 . ct angiography was triggered automatically by the arrival of the contrast bolus ( automatic bolus tracking ) . a prescan was taken at the level of the aortic root and a region of interest ( roi ) was placed on the ascending aorta . as soon as the signal density level in the ascending aorta reached the predefined threshold of 120 hounsfield units ( hu ) , the scan started . we injected 80 ml nonionic contrast medium ( iomeron 400/ml ; iomeprol , bracco , italy ) at a flow rate of 5 ml / s in the left antecubital vein . this was followed by a 40 ml saline chaser bolus at a flow rate of 4 ml / s to wash out contrast from the right ventricle . during the scan , the reconstruction interval for the coronary arteries with the fewest motion artifacts was determined ( images at 75% of the r - r interval ) and used for further analysis . for reconstruction of axial images , we used a slice thickness of 0.75 mm and a slice width of 0.5 mm . a medium soft - tissue reconstruction kernel ( b30f ) was used for reconstruction . for post - processing , in addition to the transverse source images , multiplanar reformations ( mprs ) , curved mpr images , maximum intensity projections ( mips ) , and volume rendered ( vr ) images were utilized for the evaluation . vr reconstructions depicted the vascular anatomy well and coronary cta demonstrated an anomalous left anterior descending artery ( lad ) arising from the same ostium with the right coronary artery , which coursed downwardly along the interventricular sulcus , and another lad arising from the left main coronary artery , which spread to the anterior wall of the left ventricle toward the left ventricular apex [ figures 1 and 2 ] . the right coronary artery ( rca ) and the left circumflex artery ( lcx ) were normal . there were no significant coronary stenoses or occlusions however , the anomalous lad was coursing between right ventricular outflow tract and aorta which should be considered to be critical because of the potential to provoke myocardial ischemia or even sudden cardiac death [ figure 3 ] . these ctca findings were consistent with double lad , with one vessel arising from the ostium of right coronary artery and the second one arising from the left main coronary artery . the 3-dimensional ( 3d ) volume rendered image demonstrates both of the left anterior descending arteries ( lad ) , one originating from the left main coronary artery and the second anomalous one from the right side and spreading to the anterior wall of the left ventricle toward the left ventricular apex . the segmented 3d image demonstrates both the left anterior descending arteries ( lad ) , their origin and course . the curved multiplanar reformatted ( mpr ) image demonstrates the interarterial course of anomalous left anterior descending artery ( lad ) originating from the right side and passing between aorta and right ventricular outflow tract ( rvot ) . the incidence of congenital coronary artery anomalies ranges from 0.6% to 1.3% in most of the reported series . some of these are of clinical interest because they can cause ischemic complications or even sudden death.[13 ] however , other coronary artery anomalies do not cause symptoms and their detection during coronary angiography is an incidental finding . double lad originating from both the right coronary and the left main coronary artery is an extremely rare congenital coronary artery anomaly with an angiographic prevalence ranging from 0.01 to 0.03% in the published studies.[37 ] according to the origin and anatomical course from the left and right coronary arteries spindola franco et al . , types i , ii , and iii have a similar pattern ; all of them arise separately from the proximal part of the left anterior descending artery and/or are divided into two left coronary arteries . type iv is defined as the presence of two separate lads , a short lad arising from the left main coronary artery and a long lad arising from the right coronary artery or right sinus of valsalva . according to this classification , identification of the presence of a double left anterior descending artery is important both for diagnostic and therapeutic reasons.[36 ] conventional coronary angiography is still considered as the gold standard for the diagnosis of coronary artery disease . however , detection of coronary artery anomalies is frequently difficult with conventional coronary angiography because of the lack of 3d information which is necessary to locate the origins and courses of the coronary arteries.[35 ] consequently , it is often difficult to differentiate total occlusion of the medial or distal portion of the lad from this anomaly during routine coronary angiography . this lack of 3d orientation becomes even more important when the anomalous vessel courses between the aorta and the right ventricular outflow tract because this condition may provoke myocardial ischemia and sudden death and this information can be missed with conventional angiography.[1357 ] recognition of coronary artery anomalies prior to coronary artery by - pass surgery is of great importance . the cardiac surgeon must be aware of the abnormal anatomy inorder to avoid accidental ligation or transection at the time of surgery.[36 ] multidetector row ct allows 3d comprehension of the coronary artery system and it is extremely useful to identify congenital coronary artery anomalies , regarding both their origins , courses and also relationships with other cardiac structures.[37 ] in our patient , ct angiography provided direct visualization of the dual lad distribution of the type iv variant of spindola - franco and colleagues classification in which first lad originated from the left main , and the second lad originated from the same ostium with the rca . in addition , the interarterial course of the second lad arising from the right side was also clearly depicted . in conclusion , we present a very rare coronary artery anomaly , called double lad type iv , detected during ct coronary angiography . recognition of this anomaly is important because it may lead to misinterpretation of coronary angiograms and severe intraoperative complications during coronary artery by - pass surgery such as incorrect placement of an arteriotomy , inadvertent cutting or ligation of the aberrant vessel during operation .

double left anterior descending coronary artery arising from the left and right coronary arteries is one of the rarest of coronary anomalies . in this report , we present a case of double left anterior descending coronary artery with one originating from the left main stem and the second one originating from the same ostium with the right coronary artery , passing to the left side following an inter - arterial course between aorta and right ventricular outflow tract and spreading to the anterior wall of the left ventricle . the diagnosis was made with multislice computed tomography angiography . to our knowledge , only a few such cases have been published in the literature so far .

the incidence of unicuspid aortic valve ( uav ) is 0.02% in adult population , and unlike the bicuspid aortic valve , there are no familial cases reported . unicuspid valves are more prone to bulky calcification , early , presentation of symptoms , and faster progression . there are no diagnostic criteria of the guidelines for diagnosing uav , and in a literature review , we find that one of four patients can not be precisely diagnosed with two - dimensional transesophageal echocardiography ( 2dtee ) , and the diagnosis is often confused with bicuspid valve . a 40-year - old male patient presented with dyspnea on exertion and palpitation from 2 months ago . he complained of one episode of blurred vision more than 30 min which resolved spontaneously . physical examination revealed normal vital sign and a systolic murmur grade 3/6 in aortic area . 2dtte and 3dtee en face view clearly revealed unicommissural uav [ figure 1 ] , resulting in a circle - shaped appearance , eccentric orifice , medially situated commissure , and calcified lateral part of the leaflet . aortic valve area of 0.9 cm , doppler velocity index 0.2 [ figure 2 ] , mild aortic regurgitation , and severe concentric lvh were observed . there was also dilatation of ascending aorta up to 53 mm [ video 1 ] . as in bicuspid aortic valves , aortic root dilatation of 45 mm or more in association of severe aortic stenosis should be thought of as an indication for replacement of the ascending aorta . the patient was discharged from the hospital in stable clinical condition and on medical follow - up . this case highlights the utility of 3dtee for precise definition of morphology of uav , presence of raphe , and position of commissure . in majority of the cases , commissure attach to the aorta posteriorly ; however , in our case , commissural attachment situated medially . there are two subtypes of uav : slit - shaped and pinhole . as we expect , our patient is a variant of slit - shaped uav because pinhole uav has early presentation in infancy . there is also some embryological difference between these two subtypes : in pinhole uav , leaflet mesoderm grows in circumferentially from annulus , but in slit - shaped uav , mesoderm grows in with two cooptation points . uav associates with some other congenital anomaly of coronary artery , patent ductus arteriosus , and coarctation of aorta ; however , this association is more prevalent in pinhole uav . the symptom of this congenital anomaly is related to the type of anomaly : pinhole anomaly is more likely to be presented by heart failure and failure to thrive during infancy whereas slit - shaped type presents earlier in comparison with other types of valvular aortic stenosis but symptoms are the same : dyspnea on exertion , angina , syncope , calcium emboli , and monocular blindness . this case report highlights two important features for clinicians in their daily practice : first of all , in case of blurred vision , they should search for cardiac source of embolization ; second important feature is the usefulness of 3dtee for determination of the number of cusps , presence or absence of commissures , and shape of the valve . in conclusion , unicuspid unicommissural aortic valve is a rare congenital disorder which presents in the third decade of life and almost always need corrective valve replacement .

a 40-year - old male patient presented with dyspnea on exertion and palpitation from 2 months ago . physical examination revealed normal vital sign and a systolic murmur grade 3/6 in aortic area . echocardiography revealed unicuspid aortic valve with an eccentric orifice , calcification , and aortic valve area of 0.9 cm2 . this case report highlights the usefulness of three - dimensional echocardiography for the determination of number of aortic valve cusps , presence of raphe and morphology of valve .

marfan syndrome is an autosomal dominant connective tissue disorder characterized by a combination of clinical manifestations in different organ systems . patients with marfan syndrome ( mfs ) whose lifetimes are extended may be encountered as acute abdomen ( appendicitis ) cases apart from the obligatory reasons and emergencies arising naturally out of their disease , as in the case reported . in a 28-year - old turkish male , arachnodactyly , pectus excavatum , kyphoscoliosis and , according to pulmonary roentgenogram , a density increase in the left apical field were detected . in addition , according to the echocardiographic examination , ebstein s anomaly , mitral valve prolapse , pulmonary hypertension , and inferior deficiency of mitral , aorta , and tricuspid valves were present . taking into consideration the pathologies that may accompany mfs and the probable future complications , the patients must be closely monitored during anesthesia applications and required measures should be taken beforehand . the gene that causes mfs , fbn1 , is located on chromosome 15 and encodes fibrillin-1 . the condition affects the skeletal , skin / integumentary , ocular , pulmonary , and cardiovascular systems.1 although mfs is a multisystem disorder , the most clinically significant manifestation is cardiovascular disease . because of the abnormal supporting tissues of the aorta and cardiac valves , individuals with mfs are predisposed to the development of aortic dilatation and valvular insufficiency . mitral valve prolapse with regurgitation is common and can lead to the development of endocarditis or congestive heart failure . the natural history of the disease includes a substantial risk of sudden and premature death from aortic dissection . life expectancy is almost halved in patients with mfs , cardiovascular complications being responsible for 95% of deaths.2 however , with rapid advances in medical and surgical treatments , together with reduction of physical and hemodynamic stress , effective management of patients has improved life expectancy.3 the mfs patients whose lifetimes are thereby extended may be encountered as acute abdomen ( appendicitis ) cases apart from the obligatory reasons and emergencies arising naturally out of their disease , as in the case reported here . the case was 28-year - old turkish male , 40 kg in weight and 172 cm tall . it was learned / understood from the anamnesis that the patient s elder brother had the same disease and that two other brothers died after birth ( unexplained sudden death ) . blindness in the left eye ( probably ocular features of mfs ) , long arms and legs , arachnodactyly ( figure 1 ) , kyphoscoliosis , pectus excavatum ( figure 2 ) , and severe pes planus ( talipes calcaneovalgus ) ( figure 3 ) were found to be present in the physical examination . according to chest radiography , density increase in the left apical field ( hyperluscency ) ( thought to be secondary to bullous structure ) , transpiring in the ascendent aorta , a rightward shift of the heart ( due to the effect of the kyphoscoliosis and pectus excavatum ) , and thoracolumbar scoliosis ( kyphoscoliosis ) with a rightward aperture in addition , according to the echocardiographic examination , ebstein s anomaly , mitral valve prolapse , pulmonary hypertension , and inferior deficiency of mitral , aorta , and tricuspid valves were present . moreover , a right bundle block ( secondary to ebstein s anomaly ) was observed in the electrocardiographic examination . the patient was planned to be operated on with the prediagnosis of acute abdomen . during the preoperative laboratory examination no other pathology was detected besides leucocytosis ( 15.8 10/l ) , crp elevation ( 15.6 mg / dl ) , and albumin decrease ( 33 a moving and soft tissue structure ( connection with decreasing aortic dissection ) disturbing phleb of the aorta lumen inside the composition of thoracic descendent aorta and abdominal aorta was observed in the abdominal ultrasonography . however , no findings to support the presence of acute aorta dissection were found in tomographic examination . the patient was being monitored by the cardiology outpatient clinic due to mfs and ebstein s anomaly . more importantly , previous detailed genetic research on the patient showed that there was a mutation in the fbn1 gene ( 15 g21.1 ) on the 15th chromosome . invasive arterial monitoring was conducted preoperatively from the radial artery in case prophylaxis to prevent endocarditis and aspiration pneumonia was applied . due to the risks presented by the skeleton and pulmonary anomaly , central venous catheterization was applied from the left femoral vein with the help of local anesthesia . two vascular acceses were opened and , as one of these was used for anesthesia induction , nitroglycerine infusion was started from the other vascular access in order to repress / prevent hypertension . in view of the cardiac pathology of the case , etomidate neuromuscular blocking was achieved with atracurium besylate and entubation was carried out without any stress response ( hypertension and tachycardia ) under the effect / pressure of sufficient anesthesia depth and nitroglycerine infusion . because of the risk of pneumothorax , end - tidal carbon dioxide ( etco2 ) , peak airway pressure and mean airway pressure values were continuosly controlled and pressure - controlled mechanical ventilation was applied through low - pressure and in a way to ensure that positive end - expiratory pressure = o mmhg . no negativity / pathology concerning the blood gas values was encountered during the operation . at the end of the operation , the patient , in whom cutaneous and subcutaneous local anesthetic infiltrations were applied , was extubated to reverse the neuromusculer blocking effect while nitroglycerine infusion continued . while the patient was recovering consciousness , he was taken to the intensive care unit ( icu ) for monitoring and intravenously patient - controlled analgesia and nitroglycerine infusion continued . the patient was observed in the icu for 2 days after the operation and was transferred to the surgical clinic without any complications . mfs primarily affects cardiovascular , skeletal , ocular , integumentary and pulmonary systems.2 cardiovascular complications are of special importance as they constitute the primary cause of mortality.3 the most serious medical complication of mfs is dilation and dissection of the ascending aorta , which can lead to aortic rupture and premature death if untreated . but management routinely includes use of beta - adrenergic blockers , which have been shown to slow the progressive widening of the aorta in many patients with mfs.4 other cardiovascular complications include mitral valve prolapse , aortic regurgitation , tricuspid valve prolapse , and dilation of the main pulmonary artery . the skeletal manifestations of the condition include tall stature ; thin habitus with increased arm span - to - height ratio ; long , slender fingers ( arachnodactyly ) ; elongated face ; high arched palate ; pes planus ; joint laxity ; scoliosis ; and pectus deformity . ectopia lentis ( lens dislocation ) is a hallmark ocular feature present in approximately 60% of patients . other ocular findings include corneal flatness , increased axial globe length leading to near - sightedness , and hypoplastic irides . other cardinal features involve skin , integument , and dura , and include striae atrophicae ( ie , stretch marks ) , recurrent hernias , and lumbosacral ectasia . the progressive and potentially fatal clinical features of mfs make early diagnosis very important . due to the lack of a molecular diagnostic test , diagnosis depends on the revised ( ghent ) clinical criteria.5 the most prominent major criteria are : a constellation of skeletal manifestations including pectus carinatum or excavatum , reduced upper- to - lower - segment ratio , or arm - span to - height ratio > 1.05 , scoliosis , and reduced elbow extension ; ectopia lentis ; dilatation or dissection of the ascending aorta ; lumbosacral dural ectasia ; and inheritance of a genotype previously associated with classic mfs or an unequivocal family history.5 spontaneous pneumothorax , striae atrophicae , and recurrent hernias are also useful signs for diagnosis . cardiovascular assessment is mandatory before embarking on surgery due to the threat to life from mitral valve prolapse and aortic dilatation individuals are at risk from spontaneous pneumothorax , usually arising out of an apical bulla , which may complicate a present compromise.6 management of anesthesia for mfs has specific precautions for valvular diseases , thoracic aortic aneurysm , and skeletal joint laxity . the anesthesiologist should be prepared for a potentially difficult intubation.6 no single intraoperative anesthetic agent or technique has demonstrated superiority . but the anesthetic technique chosen should not decrease myocardial contractility and should avoid sudden increases in contractility , in order to minimize the risk of aortic dissection or rupture . the presence of significant aortic insufficiency warrants that the blood pressure be high enough to provide adequate coronary blood flow but should not be so high as to risk dissection of the aorta . a patient has been reported who had acute , intraoperative coronary artery obstruction ( presumably not a coronary air embolus).6 patients may have significant pulmonary problems including restriction of lung function due to pectus excavatum , kyphoscoliosis , or intrinsic pulmonary involvement with emphysema . bronchogenic cysts and honeycomb lung that lead to spontaneous pneumothorax must also be kept in mind when using positive pressure ventilation.6 midtracheal obstruction has been reported after harrington rod placement7 and secondary to unexpected tracheomalacia after the induction of general anesthesia.8 patients must be carefully positioned to avoid joint dislocations secondary to joint laxity . although there is a possibility of temporomandibular joint dysfunction , this has not been reported to cause difficulty with laryngoscopy.6 at extubation , care should be taken to avoid sudden increases in blood pressure or heart rate . adequate postoperative pain management is vitally important to avoid detrimental hypertension and tachycardia.6 ebstein s anomaly includes an abnormal tricuspid valve and atrialized right ventricle ( figure 5 ) , that is , the septal leaflets and often the posterior leaflets of the tricuspid valve are displaced into the right ventricle . but the anterior leaflet is usually malformed , excessively large , and abnormally attached or adherent to the right ventricular free wall . atrialized in that it is located on the atrial side of the tricuspid valve , and the remaining functional right ventricle is small . eighty percent of patients with ebstein s anomaly have an interatrial communication ( atrial septal defect or patent foramen ovale ) through which right - to - left shunting of blood may occur.9,10 the clinical presentatation of ebstein s anomaly varies greatly . as in our case if the tricuspid valve is minimally displaced , tricuspid regurgitation may actually be mild enough to go unrecognized until adulthood . in fact , the diagnosis may be made by accident with few , if any symptoms . the electrocardiogram will show evidence of right bundle block or right atrial enlargement in over 50% of the cases.10 anesthesia on patients with ebstein s anomaly depends to a large degree on the clinical manifestations . the right ventricular dysfunction which puts these patients especially at a high risk for anesthesia one must be very observant in ebstein s anomaly patients during the perioperative period for the occurence of arrhythmias ( especially supraventricular arrhythmias such as wolff parkinson white syndrome).10 it is important to review the chronic antiarrhythmic medications that the patient may be receiving . prior monitoring and treatment of the case by the cardiology clinic positively affected cardiac performance . moreover , careful preoperative evaluation , a good preparation , close anesthesia management , and postoperative care prevented fatal complications from developing in the patient . mfs cases are generally operated on to correct their present orthopedic and cardiac anatomical pathologies . however , we may encounter mfs cases in different emergency forms : in the aneurysm rupture , the cesarean section , and finally in the form of acute abdomen cases which may occur as in our case . mfs cases are generally patients that are under the threat of , first , difficult intubation ; second , pneumothorax caused by the presence of pulmonary cysts ; third , restrictive pulmonary diseases due to pectus excavatum and scoliosis ; and last , cardiac valve diseases and transmission anomalies . for cases of mfs , the risks of which have been detected through a detailed cardiac examination including echocardiography , we believe that they can be operated as emergency cases with close anesthesia management and after a careful , detailed but quick preparation which should be carried out by taking the risks into consideration . written informed consent was obtained from the patient for the publication of this case report and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal .

introductionmarfan syndrome is an autosomal dominant connective tissue disorder characterized by a combination of clinical manifestations in different organ systems . patients with marfan syndrome ( mfs ) whose lifetimes are extended may be encountered as acute abdomen ( appendicitis ) cases apart from the obligatory reasons and emergencies arising naturally out of their disease , as in the case reported.case presentationin a 28-year - old turkish male , arachnodactyly , pectus excavatum , kyphoscoliosis and , according to pulmonary roentgenogram , a density increase in the left apical field were detected . in addition , according to the echocardiographic examination , ebstein s anomaly , mitral valve prolapse , pulmonary hypertension , and inferior deficiency of mitral , aorta , and tricuspid valves were present . the patient was planned to be operated on with the prediagnosis of acute abdomen.conclusiontaking into consideration the pathologies that may accompany mfs and the probable future complications , the patients must be closely monitored during anesthesia applications and required measures should be taken beforehand .

endodontically treated teeth restored with post and core face failure due to loosening of the post , fracture of the post or the root itself.1 the common post and core complications documented were post loosening ( 5% ) , root fracture ( 3% ) , caries ( 2% ) , and periodontal disease ( 2%).2 fracture of the coronal tooth structure can occur on anterior teeth as they are subjected to shear stresses . very often the post and core fails , leaving behind an intact crown . root may have adequate bone support and which could be favorably used if the post is retrieved . this clinical report describes the technique of refabricating post and core to match the features of the existing crown . a 34-year - old female patient reported with fractured maxillary right canine tooth ( figure 1 ) . on examination , it was found that the tooth was the root canal treated and restored with a cast post and core and a metal ceramic crown over it ( figure 2 ) . the core was fractured leaving the cast post embedded in the root.the post was loosened using ultrasonic vibrations and retrieved using an artery forceps . the residual cement in the post space was removed and a fiber post of diameter 1.5 mm ( flexi - post , coltenewhaledent ) was bonded using dual - cured composite resin ( paracore , coltenewhaledent ) ( figure 3).the crown was intact , and it was decided to use the same for restoring the fractured tooth . a 50 m polytetrafluoroethylene ( ptfe ) ( teflon ) tape was adapted on the tissue surface of the crown and a dual - cured core build - up composite resin ( paracore , coltenewhaledent ) was injected into the crown and positioned over the bonded post ( figures 4 - 6 ) .. it was then light polymerized for 40 s.the crown was then removed leaving the core bonded to the post and the tooth structure . the core was light polymerized again for 40 s. the teflon tape was removed from the crown , and the crown was cemented to the core using glass ionomer cement ( gic gold label glass ionomer luting and lining cement ) ( figure 7 ) .. the patient was followed up for 1 year , and it was uneventful . a 34-year - old female patient reported with fractured maxillary right canine tooth ( figure 1 ) . on examination , it was found that the tooth was the root canal treated and restored with a cast post and core and a metal ceramic crown over it ( figure 2 ) . the residual cement in the post space was removed and a fiber post of diameter 1.5 mm ( flexi - post , coltenewhaledent ) was bonded using dual - cured composite resin ( paracore , coltenewhaledent ) ( figure 3 ) . the crown was intact , and it was decided to use the same for restoring the fractured tooth . a 50 m polytetrafluoroethylene ( ptfe ) ( teflon ) tape was adapted on the tissue surface of the crown and a dual - cured core build - up composite resin ( paracore , coltenewhaledent ) was injected into the crown and positioned over the bonded post ( figures 4 - 6 ) .. it was then light polymerized for 40 s. the crown was then removed leaving the core bonded to the post and the tooth structure . the core was light polymerized again for 40 s. the teflon tape was removed from the crown , and the crown was cemented to the core using glass ionomer cement ( gic gold label glass ionomer luting and lining cement ) ( figure 7 ) .. the patient was followed up for 1 year , and it was uneventful . the need for retreatment of a tooth and/or prosthetic restoration may arise due to secondary caries , pulpal involvement , trauma to the restoration , and/or foundation , and subjective desires for a more aesthetic or durable restoration . crowned teeth requiring retreatment due to fracture of the underlying tooth structure and/or foundation restoration often possess an undamaged extracoronal restoration . in such cases , it may be desirable to reuse the restoration for the sake of cost and time.3 a badly distorted endodontically treated tooth is always a challenge for any dentist . presented a comprehensive literature review over this topic and described his own way to handle these emergencies . he inserted a prefabricated plastic post into the palatal canal of a maxillary molar . later on following an impression of the remaining tooth , already prepared for a crown was inserted into a fresh fabricated crown , followed by crown cementation.4 an indirect fabrication of two separate castings , first for the post and then fabricating the core for mandibular molars was suggested by sadan et al . this technique was similar to chiche s technique but worked on indirect fabrication method.5 cast post core systems accumulated stress within cast post cores and apical one - third region of the tooth . using fiber posts , the stresses were distributed to the cervical one - third region of the tooth and the supporting bone . specimens restored with fiber - reinforced post systems offered more homogenous stress distribution than cast posts as fiber posts possess a similar modulus of elasticity to that of dentin.6,7 hence , it was decided to use a glass fiber post for this case . the use of ptfe tape provides a space of approximately 50 m , which was used to accommodate the cement.8 in this paper , the most common difficulty in the clinical practice has been discussed . restoration for the endodontically treated teeth , where there is hardly no proper support for the post makes the work for the clinicians more complicated and challenging . this paper describes a novel technique for refabricating a post and core restoration for an existing crown using polyfluoroethylene tape .

a fractured coronal tooth structure beneath an intact crown is a common clinical occurrence . if the underlying root is healthy , the tooth is restored with a post and core followed by refabrication of the crown . this paper describes a technique of using the existing intact crown for the above - mentioned situation . a 34-year - old female was referred with a fractured right canine with an intact crown . a post was found fractured in the canal which was subsequently retrieved . a new fiber post was cemented in the post space followed by adaptation of 50 m polytetrafluoroethylene ( teflon ) tape on the tissue surface of the crown . dual - cured core build - up composite resin was injected into the crown and adapted to the fractured tooth . on curing and removal of the crown , a new composite resin core was found bonded to the tooth structure . the teflon tape was removed from the crown , and the crown cemented to the core using glass ionomer cement . this technique of building up the core of the tooth using teflon tape adapted to the tissue surface of the crown was found to be successful even after 1 year of follow - up .

synovial cysts are infrequent findings in the spine ; when they appear , they are mostly located in the lumbar area . the pathology arises from the facet joint and may cause pain , radiculopathy or myelopathy , . on the background of the international literature , we report this uncommon case of a cervical synovial cyst associated with congenital fusion , including our therapeutic approach . initially , the patient was put in conservative treatment with painkillers and she also received physiotherapy for a short time period . despite these therapies , the patient s pain continued . when presenting at our institution the patient complained of left arm pain beginning in the region of the scapula and shoulder , radiating to the forearm and the fingers iv and v. neurological examination revealed a slight motor weakness ( 1/5 ) of left triceps muscle . mri - scans showed a cyst at c7t1 level located dorsolaterally on the left side with connection to the left facet joint . the remaining cervical discs were highly degenerated , even c7t1 level showing degenerative spondylolisthesis with the respective cyst ( fig . after conformation of the correct level , posterior midline incision was performed and the cyst was totally removed following unilateral muscular dissection only on the left side , under the microscope . initially , the patient was put in conservative treatment with painkillers and she also received physiotherapy for a short time period . despite these therapies , the patient s pain continued . when presenting at our institution the patient complained of left arm pain beginning in the region of the scapula and shoulder , radiating to the forearm and the fingers iv and v. neurological examination revealed a slight motor weakness ( 1/5 ) of left triceps muscle . mri - scans showed a cyst at c7t1 level located dorsolaterally on the left side with connection to the left facet joint . the remaining cervical discs were highly degenerated , even c7t1 level showing degenerative spondylolisthesis with the respective cyst ( fig . after conformation of the correct level , posterior midline incision was performed and the cyst was totally removed following unilateral muscular dissection only on the left side , under the microscope . in the study presented here , a case of subaxial cervical synovial cyst with congenital fusion is described . intraspinal cysts are unusual abnormalities , thus the occurrence of synovial cysts in the cervical region is especially a rarity . signs of a symptomatic cervical synovial cyst are mainly neck pain , pain in upper limbs , radiculopathy and myelopathy , , , , all caused by nerve root and/or spinal cord - compression . brown - squard syndrome , acute myelopathie and spontaneous haemorraghe have been described in coherence with cervical synovial cysts , . the symptoms are similar to all other space - occupying processes , which can make diagnosis difficult . triceps brachii is innervated mainly by c6 , c7 and a minor contribution from c8 nerve roots . the clinical findings observed in neurologic examination ; pain distribution and slight motor weakness at triceps muscle was due to left c8 nerve root compression . the mean age of patients with symptomatic subaxial cervical synovial cysts in numerous studies ranges from 62 to 79 years . the youngest patient mentioned in the reviewed literature was 16 years and the oldest 86 years , . most commonly , as all types of intraspinal , extradural cysts , subaxial cervical synovial cysts are located at the level c7t1 , , , . they appear most infrequently on level c2c3 and c5c6 , . the transitional joint is more affected than the middle levels . at the c7t1 segment so , there may be differently pronounced biomechanical forces and a risk for instability in particular , . we propose , that the possible mechanism of synovial cyst development in our patient could have been as follows : the partially fused vertebrae of the c3 and c4 levels enhance the load on spine while , reducing the number of functional segments . congenital fusion in spine cause hypermobility and increased loading on adjacent segments and this leads to degeneration of intervertebral discs . spondylolisthesis of c7t1 is also a sign of advanced degeneration as seen on our patient . to our knowledge , this is the tenth reported cervical synovial cyst in conjunction with congenital fusion , . a number of case reports and case series have accurately described the morphology of synovial cyst in the subaxial cervical area . connections to other processes like degenerative changes , rheumatoid arthritis , congenital factors and trauma have been drawn . coherent theories have been established about their pathogenesis of synovial cysts . however , at the end of the day their aetiology remains unclear , . in respect to clinical diagnostics , moreover , mr - study helps to distinguish synovial cyst from other cysts located in spine . the synovial cyst differs histologically from the ganglion cyst concerning synovial lining , the containing fluid and existing connection to the facet joint ; synovial cysts are defined as cystic dilatations of the synovium . this differential diagnosis can be important for surgical treatment , because of the drift of synovial cysts adhering to the dura . furthermore , the incidence of synovial cysts is increasing because of the eased availability of mr- and ct - imaging , . in case of significant / intense symptoms further treatment of cervical synovial cysts is usually surgical decompression and extinction of the cyst , , . only few reports describe minimalized surgery , like ct guided aspiration or a non - surgical approach , . these minimalized procedures can be acceptable for the lumbar region , however , in the cervical region higher safety is demanded due to the risk of spinal cord compression . signs of a symptomatic cervical synovial cyst are mainly neck pain , pain in upper limbs , radiculopathy and myelopathy , , , , all caused by nerve root and/or spinal cord - compression . brown - squard syndrome , acute myelopathie and spontaneous haemorraghe have been described in coherence with cervical synovial cysts , . the symptoms are similar to all other space - occupying processes , which can make diagnosis difficult . triceps brachii is innervated mainly by c6 , c7 and a minor contribution from c8 nerve roots . the clinical findings observed in neurologic examination ; pain distribution and slight motor weakness at triceps muscle was due to left c8 nerve root compression . the mean age of patients with symptomatic subaxial cervical synovial cysts in numerous studies ranges from 62 to 79 years . the youngest patient mentioned in the reviewed literature was 16 years and the oldest 86 years , . most commonly , as all types of intraspinal , extradural cysts , subaxial cervical synovial cysts are located at the level c7t1 , , , . they appear most infrequently on level c2c3 and c5c6 , . the transitional joint is more affected than the middle levels . at the c7t1 segment so , there may be differently pronounced biomechanical forces and a risk for instability in particular , . we propose , that the possible mechanism of synovial cyst development in our patient could have been as follows : the partially fused vertebrae of the c3 and c4 levels enhance the load on spine while , reducing the number of functional segments . congenital fusion in spine cause hypermobility and increased loading on adjacent segments and this leads to degeneration of intervertebral discs . spondylolisthesis of c7t1 is also a sign of advanced degeneration as seen on our patient . to our knowledge , this is the tenth reported cervical synovial cyst in conjunction with congenital fusion , . a number of case reports and case series have accurately described the morphology of synovial cyst in the subaxial cervical area . connections to other processes like degenerative changes , rheumatoid arthritis , congenital factors and trauma have been drawn . coherent theories have been established about their pathogenesis of synovial cysts . however , at the end of the day their aetiology remains unclear , . in respect to clinical diagnostics , mr - imaging is the best established technique for visualizing synovial cysts , . moreover , mr - study helps to distinguish synovial cyst from other cysts located in spine . the synovial cyst differs histologically from the ganglion cyst concerning synovial lining , the containing fluid and existing connection to the facet joint ; synovial cysts are defined as cystic dilatations of the synovium . this differential diagnosis can be important for surgical treatment , because of the drift of synovial cysts adhering to the dura . furthermore , the incidence of synovial cysts is increasing because of the eased availability of mr- and ct - imaging , . in case of significant / intense symptoms further treatment of cervical synovial cysts is usually surgical decompression and extinction of the cyst , , . only few reports describe minimalized surgery , like ct guided aspiration or a non - surgical approach , . these minimalized procedures can be acceptable for the lumbar region , however , in the cervical region higher safety is demanded due to the risk of spinal cord compression . written informed consent was obtained from the patient for publication of this case report and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request .

highlightscervical synovial cysts are rare and the symptoms can mislead quickly , for differential diagnostics mr - imaging is important.biomechanical alterations of the spine play a significant role in the development of synovial cyst.surgical treatment should be considered in cervical synovial cysts with neurologic deficit or with cord compression or when the conservative treatment is ineffective .

the main structures that are known to process pain are the primary and secondary somatosensory , insula , anterior cingulated , and prefrontal cortices , as well as the thalamus ( 1 ) . additional structures that play a smaller role are the basal ganglia , cerebellum , amygdala , hippocampus , and areas within the parietal and temporal cortices ( 1 ) . these complex brain structures integrate nociceptive input with contextual information and memory to provide cognitive mediation of pain affect ( 1 ) . additionally , opioid dependence is related to pathologic learning and memory ( 2 ) . we examined the case of a patient who experienced excruciating pain caused by bone metastasis of breast cancer and who became pain - free , experienced amnesia , and recovered from opioid dependence after cardiopulmonary resuscitation ( cpr ) . there are few reports concerning the interrelationship between pain , memory , and drug dependence ; hence , we are reporting a case of amnesia and pain relief with a literature review . a 48-yr - old woman who was diagnosed with breast cancer 5 yr ago was transferred to our pain clinic for pain management on april 21 , 2010 . the patient experienced excruciating pain in her back and in her right lower chest area ( fig . her visual analog scale ( vas ) score was 9 - 10/10 , and she had received morphine ( 300 mg / day , intravenous administration ) . we performed a single epidural block as a trial for predicting its effect before a planned continuous epidural block using an epidural port . a 22-gauge tuohy needle was inserted blindly into the lumbar epidural space at the l1 - 2 level . we used the loss - of - resistance ( lor ) technique to detect the proper epidural space . after observing no leakage of cerebrospinal fluid ( csf ) and blood , we slowly injected 0.4% mepivacaine hydrochloride ( 8 ml ) , without a test dose of the drug . approximately 1 min later , the patient had a sudden seizure of generalized tonic - clonic type for 30 s , and then lost consciousness and demonstrated difficulty breathing . immediately , artificial respiration was performed on her . at that time , her blood pressure ( bp ) level was 100/80 mmhg , and her heart rate ( hr ) was 60 beats / min . the patient was intubated with an endotracheal tube , mechanically ventilated , and her condition was monitored closely . her vital signs were as follows : bp , 110/50 mmhg ; hr , 120 beats / min ; body temperature , 36.5 ; respiratory rate , 20/min ; spo2 , maintained at 100% . a neurologic assessment by a neurologist did not reveal any neurological abnormalities other than unconsciousness . 2 ) twice , but neither scan showed any abnormalities except metastatic lesions in the meninges and bones . 3 ) showed a partial seizure lesion and severe , diffuse cerebral dysfunction in the right temporal lobe area . she made eye contact with the medical team , grasped her hand , and responded to the doctor 's requests . after 17 days , she could have simple conversations with her husband , and started communicating fluently after 22 days . although no neurologic sequelae remained , she could not remember her 3 yr of autobiographic memory prior to the incident , and the severe pain of which she had complained had almost disappeared ( vas 1/10 ) . she again experienced extreme pain ( vas 7 - 8/10 ) , but did not feel any pain in her back or right lower chest where she had experienced pain before . although many studies have been performed to demonstrate this complicated phenomenon , it is still poorly understood . in the present case , the patient did not show any neurological complications except memory loss . memory loss can be classified according to many criteria ; this patient demonstrated retrograde amnesia , particularly remote and episodic amnesia . this generalized and long - lasting episodic memory loss is almost always related to bilateral injury of the limbic network in the thalamus or the hippocampo - entorhinal complex ( 4 ) . most cases of amnesia are not caused by injury of the memory storage area , but usually by dysfunction of the limbic network , which composes pieces of stored memories from many different parts of brain into coherent events . the most common causes are alzheimer 's disease ; traumatic injury ; vascular infarction ; infection ; and metabolic insults including hypoxia , hypoglycemia , and prolonged seizures ( 5 ) . among these various causes , we assume that the causes of amnesia in the present case are hypoxic brain injury and prolonged seizure after respiratory and cardiac arrest . many cognitive impairments and memory losses occur by hypoxic brain injury after cardiac arrest , but the precise mechanism of this phenomenon is not yet clearly proven ( 6 ) . ( 7 ) reported that hypoxic brain injury in an animal model of birth asphyxia produced significant functional deficits in the hippocampus , and caused a reduction of long - term potentiation ( ltp ) , paired pulse facilitation ( prf ) , and post - tetanic potentiation ( ptp ) . this occurred in the absence of gross cellular damage . in a positron emission tomographic study of 2 post - ischemic - hypoxic amnesia patients , there was destruction of the inhibitory pathways to the thalamus and basal ganglia ( 8) . hence , we believe that a short arrest duration , as in our case , may be sufficient to cause memory loss . epilepsy , especially initiated from the temporal lobe , which is related to memory , can cause memory loss . transient epileptic amnesia , accelerating long - term forgetting , and remote memory loss commonly occur after epilepsy ( 10 ) . although our patient did not have any history of epilepsy , a temporary seizure occurred after the epidural block . in addition , eeg showed a partial seizure of the temporal lobe area ; hence , we presume that seizure is another possible cause of amnesia . in an animal model of hypoxia - induced seizures ( hs ) , seizure had an effect on the synaptic plasticity , especially diminish silent synapses and ltp in hippocampus ( 11 ) . in this case , both memory and severe pain disappeared without any neurologic sequelae . we do not know the exact reason of this phenomenon , but are assuming that the pain may be gone due to loss of memory which plays important role in chronic pain . recent studies reveal an interrelationship between chronic pain and the functional , anatomical , and chemical reorganization of the brain . memories of nociceptive stimuli can lead to persistent pain coding in the brain , and these are associated with central mechanisms , and cortical reorganization in the brain ( 12 - 14 ) . both the intensity and chronicity of pain accentuate the development of pain memory ( 14 ) . the amygdala is activated during pain , and it plays a role as a " defensive behavioral mechanism " that controls the transmission of the nociceptive experience to the brain ; this has relevance to the memory storage of past pain experiences and their context . moreover the hippocampus does not appear to have a direct role in the formation of pain or fear avoidance , but is associated with learning pain - related behavior ( 15 , 16 ) . recent neuroimaging studies have demonstrated that the anterior cingulate cortex ( acc ) is closely related to the affective features of pain , such as unpleasantness , and has a multimodal integrative , rather than a specific , nociceptive role ( 15 , 17 ) . there is also an association between pain and the posterior cingulate cortex ( pcc ) ( 18 ) . nielsen et al . ( 13 ) have performed a meta - analysis of the segregation between memory and pain components . they find that the distribution of memory and pain brain activations in the pcc is quite similar . abuse of drugs for a long time cause changes in the brain , and induce memory formation ( 19 ) . neural plasticity is induced by chronic substance consumption , and this is related to drug - induced ltp and synaptic changes in the mesolimbic system . this changes are also implicated in memory formation ( 2 , 19 , 20 ) . opioid dependence , learning , and memory also share the same complex circuits involving the hippocampus , cerebral cortex , ventral and dorsal striatum , and amygdala ( 19 ) . in the present case choi et al . ( 3 ) report 2 patients who experienced pain reduction and improvement of opioid dependence after sudden memory loss . their 2 patients experienced sudden memory loss due to status epilepticus and minor brain injury , respectively . one of their reported patients could recall his episodic autobiographical memory , and he began to feel pain again . in conclusion , we report a case of pain relief and recovery from opioid dependence associated with memory loss . in this case , we do not clearly know the cause of memory loss , pain relief , and the disappearance of opioid dependence . we also do not know why the patient 's most painful memory , of all possible memories , was affected . however , we assume that memory loss plays a major role in the modulation of both pain and opioid use . moreover , understanding this complex mechanism in the brain can help treat intractable pain and addiction , which will allow us to help patients forget their chronic pain in the future .

the mechanism of chronic pain is very complicated . memory , pain , and opioid dependence appear to share common mechanism , including synaptic plasticity , and anatomical structures . a 48-yr - old woman with severe pain caused by bone metastasis of breast cancer received epidural block . after local anesthetics were injected , she had a seizure and then went into cardiac arrest . following cardiopulmonary resuscitation , her cardiac rhythm returned to normal , but her memory had disappeared . also , her excruciating pain and opioid dependence had disappeared . this complication , although uncommon , gives us a lot to think about a role of memory for chronic pain and opioid dependence .

in this issue of critical care , carlier and colleagues describe pharmacokinetic / pharmacodynamic ( pk / pd ) target attainment in critically ill patients receiving meropenem or piperacillin / tazobactam as extended infusions . these investigators found that 48% of patients did not achieve the desired pk / pd target ( 100% time that the free antibiotic fraction exceeds the minimum inhibitory concentration ( mic ) ) , of which almost 80% had a measured creatinine clearance ( crcl ) > 130 ml / minute . more worrisome was the observation that 37% of patients with crcl > 130 ml / minute did not achieve the minimum pk / pd target ( 50% time that the free antibiotic fraction exceeds the mic ) . these investigators concluded that patients not attaining pk / pd targets may be at risk for treatment failure without upward antibiotic dose titration . the findings from this study suggest that we should add inadequate antibiotic dosing to the list of antibiotic treatment characteristics that can adversely impact the outcomes of infected critically ill patients . this is an important issue when one considers that antibiotic use is often viewed as a variable expense in the hospital setting that can be manipulated to achieve cost savings . such an attitude is flawed with the understanding that the most cost - effective approach to treating serious infections is the approach that is most likely to achieve rapid clinical success . the most recent surviving sepsis campaign guidelines recommend that broad - spectrum antibiotics be administered within the first hour of recognition of septic shock , with one or more agents that have activity against the likely causative pathogens , and that the duration of therapy typically be between 7 and 10 days . these recommendations are based on studies demonstrating that the timing of appropriate antibiotic therapy , defined as an antimicrobial regimen demonstrating in vitro activity against the isolated organism(s ) responsible for the infection , is critical in determining the outcomes of such patients [ 3 - 5 ] . however , even if an appropriate initial therapy with an active antibiotic regimen is administered , patient outcomes may not be optimized due to inadequate drug concentration delivery to the site of infection . this is important for both concentration - dependent antibiotics as well as for antibiotics whose efficacy is based on the achieved dosing interval time that the antibiotic concentration is above the mic of the pathogen . moreover , many prescribers of antimicrobial therapy in the hospitalized patient are unaware that drug delivery targets are not met given that therapeutic drug monitoring is not routinely performed for most antibiotic classes . recent randomized trials of inadequately dosed antibiotics ( ceftobiprole and tigecycline ) for patients with nosocomial pneumonia have demonstrated greater treatment failures and mortality for the inadequately dosed antibiotics compared to more optimally dosed comparators [ 6 - 8 ] . the usual rationale for selecting such doses for investigational antibiotics is to minimize any drug - related toxicity . this is highlighted by the current dosing of tigecycline that is half of the originally considered dosing due to greater rates of nausea and vomiting at the higher doses ( the higher doses being more likely to achieve desired drug concentration pk / pd targets ) . additionally , the results from two meta - analyses and a recent clinical trial found that the use of prolonged infusions of betalactam antibiotics achieved similar clinical results compared to similar or higher dosed intermittent infusion antibiotic therapy [ 9 - 11 ] . however , in one of the metaanalyses , a trend towards benefit among patients receiving intermittent infusion antibiotics possibly explained by the use of higher antibiotic doses was observed . for fair balance it should be noted that another recent meta - analysis showed that prolonged or continuous infusion of pipercillin - tazobactam or carbapenems was associated with lower mortality , although these results were primarily from nonrandomized studies . the influence of crcl on outcomes among patients with severe infections also seems to be an important determinant of clinical outcome , in large part by influencing antibiotic elimination and achieved drug concentration targets at the infection site . the use of prolonged antibiotic infusions has been proposed as a strategy to achieve appropriate targeted antibiotic blood concentrations in patients with augmented renal clearance . the potential detrimental influence of augmented crcl on the outcomes of critically ill patients with infections has been demonstrated in several randomized trials . kollef and colleagues found that patients with crcl 150 ml / minute had greater clinical cure rates for vap with 10 days of imipenem compared to 7 days of meropenem despite administering meropenem as a prolonged infusion . in a trial of nosocomial pneumonia , ceftobiprole dosed at 500 mg every 8 hours was clinically inferior and associated with greater mortality compared to ceftazidime dosed at 2 grams every 8 hours plus linezolid dosed at 600 mg every 12 hours . in this trial , increased crcl was found to be associated with a greater risk of mortality , suggesting that under - dosing of antibiotics may be most detrimental in patients with normal or augmented crcl . this may also explain the hesitation among intensivists to use the currently approved dosing regimen of ceftaroline ( 600 mg every 12 hours ) in critically ill patients as it has not been rigorously evaluated in that population . carbapenem antibiotics and beta - lactams represent the most common antibiotics currently prescribed in critically ill patients . however , there is no routine therapeutic drug monitoring available for these agents as exists for aminoglycosides and vancomycin . this creates uncertainty for many clinicians prescribing antibiotics , especially when patient - specific conditions such as renal function , volume status , and hemodynamics are changing . therefore , intensivists must carefully consider how antibiotics are delivered in terms of dose , interval of administration , and duration of infusion in order to optimize pk / pd target attainment . the duration of therapy must also be carefully considered in that longer durations of treatment for optimal success may be necessary for difficult to treat pathogens such as pseudomonas or acinetobacter species . a recent example of new methods for achieving such targets is the use of advanced aerosol delivery systems that hold the promise of exceeding therapeutic targets in the lung with antibiotics such as colistin , aminoglycosides , and fosfomycin that can not be accomplished with parenteral administration . carlier and colleagues must be commended for their study highlighting the relationship between elevated crcl and inability to attain pk / pd targets for prescribed antibiotics despite the use of prolonged infusions . this is an important finding given the increasing use of prolonged antibiotic infusions and suggests that clinicians should carefully evaluate the presence of elevated crcl when making decisions regarding antibiotic dosing . from a practical standpoint , the use of an antibiotic loading dose along with the prolonged antibiotic infusion should be considered in patients with elevated crcl to allow for more rapid attainment of the desired antibiotic concentration at the infection site . moreover , maximal recommended doses of antibiotics should be prescribed in critically ill patients , especially in the presence of elevated crcl , as suggested by arnold and colleagues regardless of whether or not prolonged infusions are employed ( for example , cefepime 2 grams every 8 hours , pipercillintazobactam 4.5 grams every 6 hours , meropenem 1 gram every 8 hours ) . future studies are needed that address the issue of antibiotic dosing optimization in the presence or absence of elevated crcl . such studies also need to carefully consider the influence of confounding factors , such as the mic of the targeted pathogens and the patient 's drug volume of distribution , that can also influence the optimization of antibiotic dosing . crcl : creatinine clearance ; mic : minimum inhibitory concentration ; pk / pd : pharmacokinetic / pharmacodynamic .

critically ill patients with infection provide a number of challenges to clinicians in terms of optimizing their antimicrobial treatment . of foremost importance , initial antibiotic treatment should be selected as to provide coverage for the causative pathogens . however , the administration of those antibiotics ( dosing , interval of administration , duration of infusion , route of administration ) should be prescribed in a manner to ensure optimal drug delivery to the site of infection . this is a challenge given the characteristics of many infected critically ill patients ( shock , elevated cardiac output in the resuscitated state , supranormal creatinine clearance , increased volume of distribution ) . intensive care unit practitioners should utilize treatment strategies that strive to deliver antibiotics in an individualized manner aimed at attaining desired pharmacokinetic / pharmacodynamic targets . the goal of such a treatment strategy is to maximize the likelihood of curing the infection and allowing the critically ill patient the best opportunity for recovery . effective implementation of antimicrobial optimization delivery strategies will likely require a multi - disciplinary approach including intensivists , pharmacists , and infectious disease specialists .

mammographic breast cancer screening is under scrutiny as there is no firm evidence that it reduces mortality in female population . at the same time there is growing evidence that it leads to overtreatment due to false positive results [ 1 , 2 ] . false positives include those patients with positive mammograms , who underwent breast core biopsy and were found to have no cancer by pathology . meanwhile 35% of all breast core biopsies performed in mammographic setting remain indeterminate and are labeled by pathologists as atypical these results lead to diagnostic surgical excision of breast tissue with placement of needle wire in the area of concern in the breast . these procedures are complex , expensive , and invasive and invariably cause stress and anxiety in patients . the efficiency of these procedures is measured in new cancers detected and is estimated to be 215% of all patients who undergo such procedures . of these cancers , the remainder 510% cases are true invasive carcinomas , of which more than 80% have excellent prognostic features ( 35% risk of 5-year mortality ) . thus , even the most conservative estimates show significant overdiagnosis and overtreatment as a result of this approach [ 1 , 2 ] . randomized controlled trials have never yet been proposed to explore the equivalence of conservative management of atypical breast lesions . it is time to explore conservative watchful management of atypical preinvasive breast lesions similar to preclinical prostate cancers , already adapted by medical community . the aim of this short essay is to propose an overall design for this noninferiority trial . is watchful conservative management equivalent to surgical management atypical breast lesions in mammographic screening settings ? inclusion criteria are as follows : females in uk , us , and canada , aged 5070 ( regular mammographic screening age group),any ethnicity , mammographic screening participant with mammography positive result , that is , nonpalpable abnormality or indeterminate calcifications by screening mammogram , requiring biopsy , pathology biopsy result indicating at least one of the following ( in the absence of invasive carcinoma ) : atypical ductal hyperplasia , atypical lobular hyperplasia , flat epithelial atypia , breast papilloma with atypia , breast fibroadenoma with atypia , and ductal carcinoma in situ of low grade , and their synonyms , as outlined by pinder , no prior diagnosis of breast cancer ( either ipsi- or contralateral),no family history of breast cancer . females in uk , us , and canada , aged 5070 ( regular mammographic screening age group ) , mammographic screening participant with mammography positive result , that is , nonpalpable abnormality or indeterminate calcifications by screening mammogram , requiring biopsy , pathology biopsy result indicating at least one of the following ( in the absence of invasive carcinoma ) : atypical ductal hyperplasia , atypical lobular hyperplasia , flat epithelial atypia , breast papilloma with atypia , breast fibroadenoma with atypia , and ductal carcinoma in situ of low grade , and their synonyms , as outlined by pinder , no prior diagnosis of breast cancer ( either ipsi- or contralateral ) , no family history of breast cancer . the procedures should be performed at the participating centers with specialized breast unit with multidisciplinary breast clinical management team in place ( including radiology , pathology , and surgery ) , which follow best practice guidelines and participate in appropriate quality assurance schemes [ 68 ] . exclusion criteria are as follows : clinically diagnosed or self - diagnosed palpable breast masses , any masses diagnosed by screening mammography , core biopsy diagnosis of invasive carcinoma of any type or high grade ductal carcinoma in situ , or diagnosis of encapsulated papillary carcinoma , patients with family history of breast cancer or genetic conditions associated with higher risk of breast cancer , patients with previously diagnosed and treated breast cancers , patients with other malignancies , except noninvasive skin cancers , patients who are unfit for surgery . clinically diagnosed or self - diagnosed palpable breast masses , any masses diagnosed by screening mammography , core biopsy diagnosis of invasive carcinoma of any type or high grade ductal carcinoma in situ , or diagnosis of encapsulated papillary carcinoma , patients with family history of breast cancer or genetic conditions associated with higher risk of breast cancer , patients with previously diagnosed and treated breast cancers , patients with other malignancies , except noninvasive skin cancers , patients who are unfit for surgery . the clinical centers which do not have organized breast units or multidisciplinary breast service in place or perform breast surgery occasionally are excluded . the main idea behind this trial design is evaluation of conservative management of atypical breast lesions detected by core biopsy by annual mammographic follow - up . therefore , conservative management constitutes intervention in this trial . this should not be confused with standard care ( i.e. , surgical management ) , which is used for comparison . current standard of care : needle wire radiologically localized surgical excision of the abnormal area in the breast , after core biopsy diagnosis of atypia secondary outcomes are quality of life score ; follow - up mastectomy rates ; economic measures such as cost per qaly ; rates and time to surgical excisional biopsy in intervention group . challenges related to this trial are as follows : the patient blinding is not possible , as masking of surgery as a procedure is problematic . leaving just a surgical scar without tissue removal appears nonethical and disfiguring for such sensitive body part as breast . also , due to nature of nonpalpable breast lesions , they require placement of needle wire into the breast prior to surgery to guide surgical removal . thus , the patient blinding is not at all possible . surgeon blinding is also not possible for obvious reason . the radiologists will be blinded . entry assumption . 10-year breast specific mortality in both groups could be estimated to be at least 2% ( at least similar to dcis of the breast ) . if there is truly no difference between the standard and experimental management , then 1680 patients are required to be 80% sure that the limits of a two - sided 90% confidence interval will exclude a difference between the standard and experimental group of more than 2% . online sample size calculator for equivalence trial with binary outcome measures was used ( http://www.sealedenvelope.com/power/binary-equivalence/ ) . according to nhs data on breast screening of these , estimate of 7 - 8% had positive mammograms and required core biopsy ( 119.000136.000 women ) . of these , an estimate of 35% ( 35706800 women ) has eligible atypical lesions after core biopsy pathology . assuming that 50% of women will not consent to the study and prefer surgical excision , and additional 10% will not meet the eligibility criteria , the target study population could potentially be recruited into a multicenter trial within 13 years . there should be at least 10-year follow - up in order to reach conclusion , and this might appear problematic . interim analysis can be performed at 5-year follow - up anniversary , if it is approved by the trial monitoring committee . coordinating center should be designated , responsible for randomization scheme delivery , trial management , data collection from all the centers , and data analysis . the organizational structure of the entire trial should be established , with all areas of responsibility and authority clearly declared . steering and monitoring committees will need to be organized in such context and the standards of quality defined [ 10 , 11 ] . the patients in intervention and comparison arms will be followed up at the same mammographic intervals ( once a year ) . if the patient in the intervention arm is diagnosed with positive mammogram or by clinical self - examination during follow - up period , the needle wire localization surgical biopsy or lumpectomy will be performed , using similar methodology as in the comparison group . if diagnosis of invasive cancer or dcis is established after such surgical excision , the women should undergo treatment as per current standard practice , similar to comparison group . it is important that the radiologists and pathologists , who read the participants ' follow - up investigations , remain blinded of prior mammograms and the initial core biopsy result for the entire period of trial . the data analysis should be performed by an intention to treat method . primary outcome . the primary outcomes are breast cancer specific ( table 1 ) and overall mortality ( not shown for brevity , due to similar approach ) . the 2 2 tables will have to be constructed and populated ; 95% confidence intervals will be calculated as described earlier [ 12 , 13 ] . in addition , kaplan - meier analysis with log - rank test could be performed , if the event rate will allow for a statistically valid comparison . quality of life score : generic 36-item short form quality of life instrument could be employed ( ware and sherbourne , 1992 , cited by ) . the difference in scores between intervention and comparison group will be measured by t - test ( if the normality assumptions will be met ) . in addition , the mastectomy rate difference between intervention and comparison groups will be measured ( table 2 ) . after completion , the trial results should be published in an open source medical venue . if completed , this trial will provide high level evidence for justification for either conservative ( watchful ) management or surgical management of patients with atypical breast lesions .

breast cancer mammographic screening leads to detection of premalignant and preinvasive lesions with an increasing frequency . nevertheless , current epidemiologic evidence indicates that the screening reduces breast cancer specific mortality , but not overall mortality in breast cancer patients . the evidence is lacking whether aggressive eradication of dcis ( preinvasive form of breast carcinoma ) by surgery and radiation is of survival benefit , as long - term breast cancer specific mortality in a cohort of patients with dcis is already in a single digit percent range . furthermore , it is currently not known whether the aggressive surgical eradication of atypical breast lesions which fall short of diagnosis of dcis is of any benefit for the patients . here we propose a model for a randomized controlled trial to generate high level evidence and solve this dilemma .

in the absence of telomerase , telomere shortening limits the replicative lifespan of human cells thus providing a stringent tumor suppressive mechanism . however if dna damage checkpoints are compromised , cells can continue to divide until the telomeres lose their end - capping function and are subjected to dna double - strand break repair activity that results in telomere - telomere fusion events . the resulting dicentric chromosomes can initiate cycles of anaphase - bridging , breakage , and fusion that generate the large - scale genomic rearrangements common in human cancer . telomere - driven mutation is therefore a mechanism that generates variation in tumor cell populations , upon which clonal selection can operate and facilitate progression . we have developed high - resolution , single - molecule technologies to study telomere length and fusion in detail ; these methods have provided a level of clarity that was hitherto impossible to achieve in human cells . in colorectal cancer we showed that telomere erosion , dysfunction , and fusion not only precede the adenoma / carcinoma transition , but may also be pre - existent in the normal cells in which the initial mutation occurs . in chronic lymphocytic leukemia ( cll ) we observed extreme telomere erosion and fusion , consistent with cll b - cells undergoing a telomere - driven crisis . importantly , this was also detected in a subset of patients with early - stage disease prior to clinical progression . our recent large - scale analysis of telomere length and fusion in early - stage cll has allowed definition of the telomere length threshold below which telomere fusion is detected and revealed the prognostic value of stratifying patients according to this parameter . patients with telomeres below the telomere fusion threshold had a significantly shorter overall survival that was even more prognostic in early - stage disease patients ( p < 00001 , hr = 19.3 ) , and telomere dysfunction was the dominant variable in a multivariate analysis . based on these observations we hypothesize that short dysfunctional telomeres provide a mutator mechanism capable of driving genomic instability and disease progression . it is therefore important to understand the molecular basis of telomere fusion and how this drives mutation and clonal evolution . we have also investigated the process of fusion between short dysfunctional telomeres in human cells by the direct isolation and characterization of the dna sequence of telomere fusion events . irrespective of the tissue or cell model analyzed , we observed a consistent mutational profile with deletion into the subtelomeric dna and microhomology at the fusion junction ; this mutational profile is consistent with alternative non - homologous end - joining ( a - nhej ) processes . a - nhej involves the coordinated interaction of multiple proteins with nucleating , scaffolding , and resection activity , as well as those ultimately executing dna ligation . we therefore examined the contribution of dna ligase iii ( lig3)-dependent a - nhej and dna ligase iv ( lig4)-dependent classical - nhej ( c - nhej ) pathways in mediating fusion between short dysfunctional telomeres . using a dominant negative telomerase ( dn - htert ) we induced telomere erosion , fusion , and the onset of a telomere crisis in hct116 cells in which the lig3 or lig4 genes had been inactivated using recombinant adeno - associated virus - mediated gene targeting . both wild - type and lig4 clones displayed large - scale genomic rearrangements and telomere fusions , but readily escaped crisis following the re - establishment of telomerase activity . fusions were also detected in lig3 cells but strikingly no clones escaped crisis ; after 2 to 3 months no cells remained in these cultures . all lig3 clones escaped crisis following complementation with a wild - type lig3 cdna , but none escaped following complementation with cdnas containing either a deletion in the lig3 brca1 c - terminal domain or a a874d point mutation , both of which are required for the interaction of lig3 with x - ray repair cross - complementing protein 1 ( xrcc1 ) . these data demonstrate an absolute requirement for lig3 in mediating the escape from a telomere - driven crisis . in order to gain some insight into the underlying mechanisms by which lig3 facilitated the escape from crisis , we undertook a detailed molecular characterization of telomere fusion events mediated by lig3 or lig4 . sister chromatid telomere fusion events were detected in both lig3 and lig4cells , however there was a marked reduction in interchromosomal events in lig4 cells . sequencing of interchromosomal fusions from lig3 cells revealed a higher incidence of breakpoints within telomere repeats and a reduction in microhomology at the fusion junction . our data demonstrated the involvement of both lig3 and lig4 in the fusion of short dysfunctional telomeres , but also indicated that fusions involving lig3 provide a selective advantage to cells undergoing a telomere - driven crisis that facilitates clonal evolution and escape from crisis . the mechanism by which lig3 facilitates the escape from crisis is not clear ; our hypothesis is that interchromosomal fusions , which predominate in cells that can not escape crisis , are more mutagenic and detrimental to the cells in which they occur ; whereas fusion between sister chromatids resulting in localized amplification and deletion events may confer a selective advantage . we consider that the relative balance between these events dictates the ability of cells to escape crisis and that this is modulated by the activities of a - nhej and c - nhej at short dysfunctional telomeres ( fig . 1 ) . further work should elucidate the contributions of other components of the a - nhej pathway in telomere fusion and the escape from crisis , in addition to examining the mutational impact that these pathways have in the context of the evolving cancer genome . figure 1.schematic illustrating our hypothesis for how lig3 may affect the ability of cells to escape a telomere - driven crisis . cells with short dysfunctional telomeres undergo crisis , during which telomere fusion results in the creation of dicentric chromosomes and the initiation of anaphase - bridging , breakage , and fusion cycles ; the ensuing genomic instability leads to large - scale genomic rearrangements . clonal evolution results in cells that escape crisis ; these cells exhibit fewer interchromosomal fusion events compared to fusions between sister chromatids , whereas interchromosomal fusions predominate in cells that can not escape crisis . we consider that this is governed by the relative activities of ligase iii - dependent alternative non - homologous end - joining ( a - nhej ) compared to ligase iv - dependent classic non - homologous end - joining ( c - nhej ) pathways . schematic illustrating our hypothesis for how lig3 may affect the ability of cells to escape a telomere - driven crisis . cells with short dysfunctional telomeres undergo crisis , during which telomere fusion results in the creation of dicentric chromosomes and the initiation of anaphase - bridging , breakage , and fusion cycles ; the ensuing genomic instability leads to large - scale genomic rearrangements . clonal evolution results in cells that escape crisis ; these cells exhibit fewer interchromosomal fusion events compared to fusions between sister chromatids , whereas interchromosomal fusions predominate in cells that can not escape crisis . we consider that this is governed by the relative activities of ligase iii - dependent alternative non - homologous end - joining ( a - nhej ) compared to ligase iv - dependent classic non - homologous end - joining ( c - nhej ) pathways . telomere fusion during crisis is ultimately a cellular survival mechanism that provides short - term relief from telomere erosion , but importantly also facilitates genome instability that allows for the generation of the genomic rearrangements that can facilitate progression . our work identifies the a - nhej pathway as essential for the ability of cells to clonally evolve and escape a telomere crisis . this indicates that intervention(s ) in this pathway may sensitize cells with short dysfunctional telomeres and thus provide a potential therapeutic target in the subsets of tumors in which short dysfunctional telomeres confer such a poor prognosis . moreover , given that telomere dysfunction occurs early in tumorigenesis this may open up the possibility of therapeutic intervention prior to clinical progression . this work was supported by funding to the baird laboratory from cancer research uk , leukemia and lymphoma research and the national institute for social care and health research ; and to the hendrickson laboratory from the united states national institutes of health ( gm088351 ) and the national cancer institute ( ca15446 ) .

telomere dysfunction and fusion play key roles in driving genomic instability and clonal evolution in many tumor types . we have recently described a role for dna ligase iii ( lig3 ) in facilitating the escape of cells from crisis induced by telomere dysfunction . our data indicate that lig3-mediated telomere fusion is important in facilitating clonal evolution .

type 2 diabetes mellitus is one of the most common and disabling metabolic diseases ; its increasing incidence has become a serious threat to human health . increasing evidence suggests that hyperuricemia is an independent risk factor for impaired fasting glucose ( ifg ) and type 2 diabetes . patients with hyperuricemia are at a significantly higher risk of progressing to type 2 diabetes [ 2 , 3 ] . a large number of researchers have begun to consider uric acid as a serum indicator of glycometabolic disorders , because of a correlation between uric acid and glucose metabolism [ 4 , 5 ] . however , changes in serum uric acid and blood glucose do not exhibit a linear relationship , as some have assumed . rather , the relationship follows more of a bell curve . uric acid levels rise with increasing blood glucose concentrations in the normal and prediabetes population . however , in type 2 diabetes patients , uric acid levels tend to decline with increasing blood glucose concentrations [ 6 , 7 ] . the reasons for the inverse relationship between uric acid and blood glucose in type 2 diabetes mellitus remain unclear . serum uric acid levels will increase with increasing serum insulin levels in diabetic patients [ 8 , 9 ] . whether insulin is the factor that influences the relationship between the uric acid and blood glucose is not clear . thus , our study aimed to further explore the connection between uric acid and blood glucose in newly diagnosed type 2 diabetes . we performed a retrospective analysis on the inpatient database in the first affiliated hospital of nanjing medical university ( china ) between 2008 and 2014 . we chose 605 individuals ( 435 males and 170 females ) aged 3074-years with newly diagnosed type 2 diabetes . the diagnosis for type 2 diabetes was in accordance with the diagnostic criteria promulgated by the world health organization ( who ) in 1990 . screening criteria were as follows : ( 1 ) patients must have newly diagnosed type 2 diabetes and have never received hypoglycemic drugs , diet , or exercise therapy prior to admission to the hospital . ( 2 ) patients must have never received any drugs that would affect blood glucose , insulin , or serum uric acid before testing . ( 3 ) patients must have no history of serious liver or kidney problems or infection , trauma , or stress . all patients were admitted to our hospital to screen for diabetic complications and to evaluate islet - beta cell function after they were diagnosed with type 2 diabetes ( fbg7.0 or pbg11.1 ) in the outpatient department . there was no stress hyperglycemia or transient hyperglycemia caused by other reasons . there were 800 cases that were evaluated . among them , 58 patients were excluded because they had taken drugs affecting uric acid , while 89 cases were excluded because they had impaired liver or kidney functions and 48 were not included because their data were incomplete . we analyzed the age , history of diabetes , height , weight , systolic blood pressure ( sbp ) , and diastolic blood pressure ( dbp ) in all the patients . the serology indexes , such as triglyceride ( tg ) , creatinine ( cr ) , and serum uric acid ( sua ) levels , were measured by automatic biochemical analyzer . glycated hemoglobin ( hba1c ) was measured by high - performance liquid chromatography ( hplc ) . the oral glucose tolerance test ( ogtt ) and insulin release test ( irt ) were performed in all patients . blood samples were collected at fasting ( 0 min ) and at 30 , 60 , and 120 minutes after taking 75 g anhydrous glucose to measure plasma glucose ( dextrose oxidase method ) and serum insulin ( radioimmunoassay ) . the body mass index ( bmi ) was calculated by dividing the weight ( kg ) by the height ( m ) squared . total insulin level was represented as the area under curve of insulin during 0120 min of the irt , which was obtained from the irregular trapezoid method ( area = 1/2i=1xi1(yi1 + yi ) ) . all of the comparisons between measurement data in line with the normal distribution were analyzed by independent samples t - test . a test of normality was performed for all the arguments , and the variables showing skewed distribution that took natural logarithms were converted to meet the normal distribution . pearson correlation tests and multivariate linear regression analyses were used to assess the relationship between hba1c and insauc120 , the relationship between serum uric acid and insauc120 , and the relationship between serum uric acid and hba1c . the data were divided according to the two types of patient groups : a low insulin group and a high insulin group , based on the median insauc120 level in male versus female gender groups . the correction between serum uric acid and hba1c was evaluated within each group . a p value of < 0.05 ( two - tailed ) was considered to be statistically significant . in table 1 , the general clinical data gathered for each gender group is presented . regardless of gender , the correlation still existed after adjusting possible influencing factors , such as age , bmi , sbp , dbp , tg , creatinine , and sua by multivariate regression analysis ( table 3 ) . serum uric acid was positively correlated with insauc120 ( figure 1 , table 2 ) . the correlation still existed after adjusting possible influencing factors , such as age , bmi , sbp , dbp , hba1c , tg , and creatinine by multivariate regression analysis ( table 3 ) . serum uric acid showed a negative association with hba1c in each gender group ( male : r = 0.224 , p = 0.000 ; female : r = 0.245 , p = 0.000 ) . when hba1c increased by one unit , the serum uric acid decreased by 3.868 units in male group and by 6.036 units in female group after adjusting age , bmi , sbp , dbp , tg , and creatinine ( table 3 ) . interestingly , after adding insauc120 to the regression equation , the relationship between uric acid and hba1c no longer existed ( table 3 ) . for both males and females , serum uric acid was inversely correlated with hba1c levels in high insulin group ( male : r = 0.281 , p = 0.015 ; female : r = 0.331 , p = 0.006 ) . the relationship still existed after adjusting possible influencing factors such as age , bmi , sbp , dbp , tg , and creatinine by multivariate regression analysis ( table 4 ) . however , no correlation between sua and hba1c was present in the low insulin group ( male : r = 0.102 , p = 0.087 ; female : r = 0.047 , p = 0.704 ; table 4 ) . it has been confirmed that elevated uric acid levels can increase the risk of metabolic syndrome , atherosclerosis , and chronic kidney disease [ 1214 ] . over the years , the association between uric acid levels and glucose metabolism has been a hot research topic . uric acid levels tend to decrease after their first increase , along with an increase in blood glucose concentration [ 1517 ] . a number of studies have found that serum uric acid levels are inversely correlated with blood glucose concentrations in type 2 diabetes patients . however , until now , it has been unclear as to why this relationship exists and what factors influence this relationship . previous studies have been carried out mainly in patients with preexisting type 2 diabetes . in such patients , the levels of uric acid and blood glucose for such studies , a single blood sugar reading was taken , which does not represent the total behavior of fluctuating blood sugar levels susceptible to interference / control by medical intervention . in order to explore the relationship between uric acid and blood glucose more accurately , we chose patients with newly diagnosed type 2 diabetes ( at time of diagnosis immediately prior to medical intervention ) to eliminate the influence of drugs or dietary control . in addition , we used glycosylated hemoglobin ( hba1c ) as a measure of blood glucose metabolism , not affected by occasional fluctuations in blood sugar . our study revealed that , among both the male and female patients with newly diagnosed type 2 diabetes , uric acid levels showed a significant upward trend , while the hba1c levels were significantly lower and correlated with an increase in insauc120 levels . this data suggested that a change in insulin level may lead to a degree of correlation between uric acid and hba1c . subsequently , we found that the serum uric acid levels were inversely correlated with hba1c levels , regardless of patient gender . however , the correlation between uric acid and hba1c disappeared after adjusting insauc120 through multiple linear regression analysis . this further indicated that the correlation between uric acid and hba1c may be affected by insauc120 . therefore , the correlation between uric acid and hba1c was analyzed by stratified analysis according to insulin level . only in the case of high insulin levels there was no association between uric acid and hba1c in patients with low insulin levels . therefore , the correlation between uric acid and hba1c most likely relies on insulin levels . . showed that there were differences in uric acid concentration among the general population , those with impaired glucose tolerance , and newly diagnosed type 2 diabetes patients , only when hyperinsulinemia existed . however , if patients had normal insulin levels , there were no differences in serum uric acid levels , regardless of blood glucose levels . therefore , the findings of modan et al . the reasons for the above situation may be due to the effect of insulin on the metabolism of uric acid and glucose . hyperinsulinemia could increase the activation of the hexose phosphate shunt , which would promote the biosynthesis and transformation of purine , thus increasing the rate of uricogenesis . at the same time , insulin may increase reabsorption of uric acid from the kidneys by stimulating the urate anion transporter on the border membrane in the proximal tubular brush , the end result of which is an increase in the concentration of serum uric acid . therefore , insulin may control the concentration of uric acid and blood glucose at the same time , explaining the inverse correlation between uric acid and blood glucose when blood insulin levels are high . in conclusion , our study confirmed that there is an inverse correlation between uric acid and hba1c , which is dependent on hyperinsulinemia in patients with newly diagnosed type 2 diabetes . high insulin levels may be an important factor affecting the correlation between the uric acid and hba1c . out results suggest that uric acid might serve as a biomarker of blood glucose , but only under conditions of hyperinsulinemia .

objective . the aim of our study was to explore the dependent condition of the relationship between uric acid and blood glucose in type 2 diabetes . research design and methods . we measured the hba1c , serum uric acid , creatinine , lipids profiles , and so forth of 605 newly diagnosed type 2 diabetes patients , and oral glucose tolerance tests ( ogtts ) were performed on each patient . the population was divided into high and low insulin groups . multiple linear regression analyses were conducted to assess the relationship between uric acid and hba1c . results . serum uric acid and hba1c levels were low in newly diagnosed type 2 diabetes patients . however , we found no significant relationship between uric acid and hba1c by regression analysis after adjusting total insulin . the concentration of uric acid was inversely correlated with hba1c in the high insulin group , regardless of patient sex . however , no associations were found in low insulin group . conclusions . the negative correlation between uric acid and hba1c is conditional in newly diagnosed type 2 diabetes patients and is related to hyperinsulinemia . therefore , uric acid is likely only useful as a biomarker of blood glucose in patients exhibiting hyperinsulinemia .

echocardiography , computed tomography ( ct ) and magnetic resonance imaging ( mri ) may be used as summative diagnostic tools to support correct diagnosis . however , most malignant pericardial mesotheliomas have been diagnosed by histology , including immunohistochemical staining , after surgery or autopsy . to determine the exact etiology of constrictive pericarditic disease , clinical suspicion and confirmative evaluation are needed in patients who exhibit the physiology of constrictive pericarditis in transthoracic echocardiography ( tte ) or catheterization . a 59 year - old woman presented to our hospital with a two - month history of intermittent shortness of breath and bilateral lower extremities edema . otherwise her medical history was unremarkable . arterial blood gas analysis showed no hypoxemia or hypercapnea , and serum liver function and kidney function test results were within the normal range . tte demonstrated enlarged right atrium and ventricle associated with pericardial thickening around the posterior cardiac border ( fig . echocardiographic doppler examination demonstrated mitral flow early diastolic velocity decreased with inspiration and increased with expiration ( fig . in addition , diastolic flow reversal of hepatic vein in expiratory phase was also demonstrated . cardiac catheterization demonstrated rapid rising of early diastolic pressures and abrupt equalization in both ventricles , namely dip and plateau pattern ( fig . 2 ) . thoracic ct demonstrated pericardial thickening with multiple pericardial nodules , bilateral pleural effusion and lymphadenopathy in the cardiophrenic area ( fig . f-18 fluorodeoxyglucose ( fdg ) positron emission tomography ( pet ) ct showed several hypermetabolic nodules in the pericardium , and the maximum standardized uptake value was 6.18 ( fig . pericardiectomy and exploration via sternotomy was performed to search malignancy tissue and to relieve symptoms . immunohistochemical staining with calretinin and d2 - 40 ( podoplanin ) were positive , and with cea and ttf-1 were negative ( fig . because the pericardium was the only lesion visible on pet - ct and there was no evidence of primary cancer origin in other organs , the patient was finally diagnosed with primary malignant pericardial mesothelioma . after chemotherapy , repeat thoracic ct showed similar cancer volume compared to that obtained on imaging prior to chemotherapy . secondary tumors are more common causes of cardiac tumors , which originate mostly from the lung , breast , melanomas , lymphoma , or leukemia . the incidence of malignant pericardial involvement with an underlying malignancy has been reported between 0.15 and 21% in the literature , of all patients with an underlying malignancy.1 ) primary malignant pericardial mesothelioma is extremely rare , although it is the most common primary malignant pericardial tumor . its incidence was 0.0022% among 500,000 cases in an autopsy study.2 ) the clinical manifestation of malignant pericardial mesothelioma is nonspecific . common clinical manifestations of pericardial tumors include constrictive pericarditis , pericardial effusion , cardiac tamponade , and heart failure caused by myocardial infiltration.3 ) pericardial mesothelioma can often be misdiagnosed as other cause of constrictive pericarditis prior to undergoing pericardial tissue biopsy . cardiac catheterization examination can demonstrate constrictive physiology , which shows a dip and plateau pattern.4 ) mri and ct used to aid making diagnosis . ct scan can demonstrate the extent of cardiac tumor , the extent of pericardial thickening , the mediastinal lymph node and the extracardiac lesions . these are helpful to distinguish primary pericardial tumors from the other cause of constrictive pericarditis , especially tuberculosis pericarditis . mediastinal lymphadenopathy in patients with tuberculosis pericarditis has characteristically central low attenuation and coalescing of adjacent lymph nodes . in tuberculosis , pericarditis , aortopulmonary , paratracheal , and carinal lymph node invasion is common , but hilar lymphadenopathy is rare.5 ) the delayed phase image of ct scan or mri is helpful to diagnose the pericardial tumor . in delayed phase image these are useful to distinguish the primary pericardial tumors from tuberculous pericarditis.6 ) mri is generally able to depict the tumor and its relation to surrounding cardiac structure.7 ) in a recent report , pet - ct was useful in the staging and preoperative evaluation of pleural8 ) or pericardial9 ) mesothelioma , detection of unsuspected nodal and occult distant metastases . however , most cases of malignant pericardial mesothelioma have been diagnosed by histology , including immunohistochemical staining after surgery or autopsy.10 ) malignant pericardial mesothelioma has poor prognosis and a progressive clinical course . average survival was 10 months regardless of therapy.11 ) moreover , standard treatment has not been established . recently , pemetrexed and carboplatin combination chemotherapy has demonstrated modest activity against malignant pleural mesothelioma as first line treatment.12 ) irinotecan has also been reported to demonstrate clinical activity against pleural mesothelioma in a clinical trial.13 ) in this case , because of ascites , pleural effusion and multiple lymphadenopathy , we initially suspected malignancy with multiple systemic metastases . however , significant fdg uptake in pet - ct was restricted in the pericardium . in retrospect , ascites and pleural effusion were only signs of pericardial constriction . in conclusion , advanced malignant pericardial mesothelioma has no established treatment modality and is often misdiagnosed as other cause of constrictive pericarditis . clinical suspicion is the most important factor to correct diagnosis and early detection of this disease .

malignant pericardial mesothelioma is a rare and progressive cardiac tumor . there is no established standard treatment and the prognosis is poor . most patients were retrospectively diagnosed from surgery or autopsy due to absence of specific clinical manifestation . most patients with pericardial mesothelioma have demonstrated constrictive physiology on echocardiography or cardiac catheterization . therefore , pericardial mesothelioma was often misdiagnosed as other causes of constrictive pericarditis . we report a case of primary pericardial mesothelioma misdiagnosed as pericardial metastasis of unknown origin .

transient global amnesia is a syndrome of temporary and reversible disruption of short - term memory accompanied by repetitive questioning . although the etiology is unknown , the prognosis usually benign , and no particular treatment is required , it is important for all involved clinicians to recognize the diagnosis and possess knowledge about the evaluation of these affected patients . neurologic examination disclosed repetitive questioning with preserved orientation and no focal motor , speech , sensory , coordination , or cranial nerve deficits . neurologic investigations did not reveal any pathologic findings . her memory improved and reverted to normal baseline over the course of a 24-hour hospital stay . transient global amnesia is an interesting syndrome of reversible anterograde amnesia associated with repetitive questioning that occurs with an unclear etiology in middle - aged and elderly individuals . due clinical diligence clinicians , including neurologists , internists , family practice physicians , and psychiatrists , need awareness of this condition . transient global amnesia ( tga ) is a syndrome of temporary disruption of short - term memory accompanied by repetitive questioning . affected patients exhibit no other signs of impaired cognitive functioning and have no focal deficits . a 65-year - old caucasian woman presented to our emergency department with a chief complaint of confusion and forgetfulness . she was enjoying her baseline state of generally good health when , according to her husband , suddenly sometime around mid - afternoon on the day of admission , he found her confused , disoriented , and asking dream - like state where she was in the company of president obama and her deceased mother . she complained of a minimal frontal headache that was pulsating in quality , but there were no associated light aversion , visual auras , nausea or vomiting , nor did she have any past history of migraines . there was no history of any seizure disorder , nor were there any complaints of strange smells , tastes , epigastric rising , or sensations of depersonalization . there were no complaints of any numbness , weakness , tingling , vertigo , slurred speech , double vision , lapses of consciousness , chest pain , shortness of breath , fevers , chills , nausea , vomiting , abdominal pain , or changes in bowel or urinary function . the patient 's past medical history was significant only for well - controlled hypertension and hypercholesterolemia . her medications were vytorin and an unknown antihypertensive , and there were no recent changes in the dosage of these . she carried no previous surgical history , nor did she have any medication allergies or adverse habits . the patient was married , retired , living with her husband , and had three children . general physical examination revealed a blood pressure of 176/84 mm hg , a heart rate of 79 beats per minute , and a temperature of 98.5 f . cardiovascular examination revealed a regular rate and rhythm without murmurs , rubs , or gallops . her lungs were clear to auscultation bilaterally , and her breathing was without retractions or accessory muscle use . she was awake , alert , and oriented to person , place , and time . what happened?. long - term memory was intact ( she was able to state her birth date ) and she was aware of current events , but short - term memory was impaired . no active hallucinations or delusions were noted . cranial nerve examination showed intact visual fields , papillary symmetry and appropriate light reaction , and no evidence of papilledema . her motor examination was normal with intact symmetrical strength and tone and reflexes of 2/4 throughout . coordination , sensation , and gait were all intact and no long - tract findings were seen . laboratory investigations revealed a normal complete blood count , chemistry panel , thyroid stimulating hormone , and coagulation profile . an electrocardiogram demonstrated normal sinus rhythm , and a chest x - ray was within normal limits . magnetic resonance imaging of the brain revealed no acute abnormalities , and a magnetic resonance angiogram of the brain was normal . carotid duplex findings were consistent with less than 30% stenosis of the bilateral internal carotid arteries , and a transcranial doppler study was normal . the patient returned to her baseline normal neurologic state over the course of a 24-hour hospitalized observation period and has not had any further recurrences . tga is a syndrome of temporary disruption of short - term memory accompanied by repetitive questioning . an individual in a state of tga exhibits no other signs of impaired cognitive functioning and has no focal deficits . while the etiology remains unknown , tga most commonly presents in middle - aged and elderly individuals , with the incidence among those 50 years to be estimated at 23.5 to 32 per 100,000 per year . the majority of afflicted patients are between the age of 5080 years , with an average age of approximately 6065 years . risk factors causing an increased risk of stroke such as hypertension , diabetes , and hypercholesterolemia are not believed to be associated with tga , while migraines have been found to be strongly associated with tga [ 3 , 4 ] . the annual recurrence rate is approximately 2.5 to just over 5.0% [ 1 , 5 ] . clinical symptoms of tga suggest that the site of neurologic involvement would be the medial temporal lobe and hippocampus as this area is involved in the formation and retrieval of new episodic memories . neuroimaging studies , specifically diffusion - weighted magnetic resonance imaging studies , show indicated lesions in the ca1 sommer 's sector of the hippocampus , most often on the left side . the etiology of tga remains unknown , but hypotheses include both an arterial and a venous etiology ; phenomena similar to migraines , epilepsy , and psychogenic disorders . arterial ischemia has been proposed as one mechanism as transient ischemic attacks via arterial thromboembolism and tga share certain features such as duration of less than 24 h and occurrence in older patients . however , tga episodes usually last longer and patients with tga tend to have a lower atherosclerotic risk burden [ 1 , 5 ] . additionally , neuroimaging studies have provided conflicting data regarding arterial ischemia as a pathogenesis for tga [ 5 , 8 ] . a venous congestion theory has been proposed in which valsalva maneuvering impedes venous return via the superior vena cava , thus allowing transient retrograde transmission of elevated venous pressure to the cerebral venous system which may result in venous ischemia of the mesial temporal lobes [ 8 , 9 ] . however , it is unclear exactly why venous congestion is so anatomically selective and why tga is not seen more commonly in patients with cerebral venous thrombosis if this were the sole explanation . a migrainous etiology has also been proposed in which tga may be similar to an aura via cerebral spreading depression ( a self - propagating wave of neuronal and glial depolarization ) perhaps triggered by hippocampal glutamate release [ 5 , 8 ] . in argument against this theory is that migraines , as opposed to tga , tend to present in younger individuals and have a recurrent nature . epileptiform etiologies have also been proposed as a cause of tga , given the transient amnesia may manifest some seizures . however , like migraines , seizures are recurrent and cases of electroencephalogram monitoring during tga episodes have not revealed any epileptiform activity [ 3 , 10 ] . psychogenic causes have also been proposed based on findings that subgroups of tga patients have certain phobic and other personality traits such as anxiety and depression ; however , this has not been substantiated across all studies . interestingly , there are certain precipitating triggers that have been identified , including alcohol use , severe nightmares , sexual activity , emotional distress , intense pain or cold , high altitude , myocardial ischemia , and strenuous physical activity along with valsalva maneuvers [ 8 , 13 ] . the diagnosis of tga is clinical and based on the following diagnostic criteria [ 8 , 14 ] : ( a ) information about the beginning of the attack is available from an observer in order to exclude head trauma or loss of consciousness at the onset , and clouding of consciousness or loss of personal identity should be absent ; ( b ) the patient should be examined during the attack to be certain that there are no accompanying neurologic signs or symptoms besides antegrade amnesia ; ( c ) the memory loss should resolve within 24 h ; ( d ) epileptic features must be absent , and ( e ) patients with active epilepsy are excluded . it is important to note that the diagnosis of tga is one of exclusion and an appropriate work - up must be conducted including obtaining oxygenation status , serum electrolytes , glucose , and a toxicology screen . ( to cover the possibility of wernicke 's encephalopathy ) and admitted for observation until the amnesia resolves . if there is suspicion for epilepsy , an electroencephalogram furthermore , neuroimaging is important to additionally exclude pathologies such as trauma and acute ischemia . the differential diagnosis of tga also includes head injury , anoxia , hypoglycemia , intoxication , drug withdrawal , aortic dissection , encephalitis , metabolic derangements , and wernicke 's encephalopathy . usually , with these other entities , patients exhibit more global impairment with the exception of wernicke 's encephalopathy in which amnesia may be the predominant manifestation . interestingly , the condition does not usually recur ( although , as previously mentioned , the annual recurrence rate varies from 2.5 to just over 5% ) and the patients do not have an increased risk of mortality , epilepsy , or stroke following tga . thus , the appropriate management , as was performed in the present case , is to observe the patient as an inpatient until the amnesia resolves . although our patient suffered mild cephalgia ( as is seen in 1040% of all patients with tga ) , she had no localizing symptoms or history suggestive of migraines , nor was there any history of cerebrovascular disease or seizures . if our patient 's memory lapse had not resolved within 24 h , then the other aforementioned etiologies would have continued to be explored and we would have reimaged her , repeated the electroencephalogram study , and considered a lumbar puncture . tga is an interesting entity of reversible anterograde amnesia associated with repetitive questioning that occurs with an unclear etiology in middle - aged and elderly individuals . due clinical diligence clinicians , including neurologists , internists , family practice physicians , and psychiatrists , need awareness of this condition . r.a.r . serves as deputy editor for the journal of medical case reports , associate neurology editor for case reports in neurology , grand rounds , and formerly cases journals .

introductiontransient global amnesia is a syndrome of temporary and reversible disruption of short - term memory accompanied by repetitive questioning . although the etiology is unknown , the prognosis usually benign , and no particular treatment is required , it is important for all involved clinicians to recognize the diagnosis and possess knowledge about the evaluation of these affected patients.case presentationa middle - aged caucasian woman presented for neurologic evaluation for acute forgetfulness . neurologic examination disclosed repetitive questioning with preserved orientation and no focal motor , speech , sensory , coordination , or cranial nerve deficits . neurologic investigations did not reveal any pathologic findings . her memory improved and reverted to normal baseline over the course of a 24-hour hospital stay.conclusiontransient global amnesia is an interesting syndrome of reversible anterograde amnesia associated with repetitive questioning that occurs with an unclear etiology in middle - aged and elderly individuals . due clinical diligence is required in the investigation of these patients . treatment is generally not required , and the condition usually does not recur . clinicians , including neurologists , internists , family practice physicians , and psychiatrists , need awareness of this condition .

in february october 2002 , as part of a broader study , we captured , banded , and marked 156 american crows ( c. brachyrhynchos ) in champaign and urbana , illinois ( yaremych sa . many of the study crows died in the summer ; all recovered crows were tested for wnv . dead crows were retrieved by tracking the radio signal to the carcasses , by chance encounter , or by notification from the public . dead study crows with transmitters were typically recovered < 36 hours after death , as this period was the maximum amount of time elapsed between the last live observation of a crow during radio tracking and recovery of the carcass upon death . we estimated that other marked study crows without transmitters were retrieved up to 72 hours after death . the abundance of dead crows allowed for a simple comparative study involving the use of vectest , rt - pcr , and ihc tests to detect wnv in crow fecal , saliva , and tissue samples . for each dead crow , we diluted fecal scrapings from the cloaca and salivary scrapings from the mouth in vectest buffer solution in the vials provided in the kit . a metal spatula was used to obtain samples , and instruments were sanitized with a wash of soap and water and 70% ethanol before and after use . in some cases , maggots were in such abundance in the mouth and cloaca that they could not be removed from the sample ; they were added to the vials with the feces and saliva . for carcasses with no moist fecal or saliva sample , small metal scissors were used to clip any available dried internal tissues around the mouth and cloaca . samples were shaken by hand for approximately 60 seconds for homogenization . from this point , we followed manufacturer s directions , having replaced mosquitoes with fecal , saliva , and tissue samples . indicator strips were inserted into the solution and interpreted in the field after 15 minutes . samples were stored at 80c after we performed the test . to confirm the results , we used rt - pcr taqman to detect the presence or absence of wnv - rna in these samples by a method similar to that used by lanciotti et al . alternatively , vectest results were confirmed by ihc testing of the brain , heart , kidney , and spleen of the crow carcass from which the samples were derived . the ihc testing was conducted by the university of illinois veterinary diagnostic laboratory , according to the method outlined by heinz - taheny et al ( 7 ) . we used vectest to test all 20 crow samples ; all indicator strips developed control lines , which indicated that the test had performed according to instructions . nineteen samples were positive for wnv with a faint - to - bold wnv line ; one sample was negative for wnv . ihc testing was performed on the crow carcasses from which five of these positive samples were derived , and ihc labeling for wnv antigen was present in all five of these samples , indicating 100% confirmation of the vectest results . the remaining 15 vials containing the vectest crow sample , composed of 14 positives and 1 negative , were assayed by rt - pcr taqman . results from taqman showed 11 positives and 4 negatives ( table ) . in total , 17 ( 85% ) of 20 of the vectest results were confirmed with either ihc or rt - pcr taqman , and 3 ( 15% ) of 20 involved conflicting results between the two testing methods for the samples . no significant difference existed between the positive and negative rates of vectest and rt - pcr in a chi - square analysis of a 2x2 contingency table ( chi square = 2.16 , df=1 , p=0.14 ) . using rt - pcr as the standard criterion , we found that vectest results included three false positives , yielding a false - positive rate of 75% . vectest west nile virus / saint louis encephalitis virus antigen panel assay ( medical analysis systems inc . reverse transcriptase polymerase chain reaction ; taqman ( applied biosystems , foster city , ca ) . although the rates of positives and negatives did not differ between vectest and rt - pcr in this study , this result may be an artifact of small sample size . the false - positive vectest results on american crow fecal , saliva , and tissue samples suggest a low specificity ; therefore , we recommend that vectest be considered experimental in its application to dead american crows until more extensive investigations are conducted . vectest may be useful in early season screening , when rates of positives are typically low , or in nonpeak areas . we conducted this study in mid- to late summer in east - central illinois , during a time when death rates of free - ranging american crows were high . rt - pcr detects genomic sequences of wnv , whereas vectest detects the viral capsid . because of the abundance of environmental rnaase and the possibility of the wnv capsid s persisting longer than the rna , the three false positives detected by vectest may indeed contain wnv capsid . alternately , the conjugate in vectest may react with a nonspecific protein in the fecal , saliva , or tissue samples of the dead crows to create a false positive . this preliminary investigation establishes the basis for more comprehensive research on the full capabilities of this test for wnv detection in birds , including the sensitivity of the test , the postmortem period for which the test is viable , and the effectiveness across a range of species . we suggest that vectest may be a cost - effective , rapid field technique for wnv detection in dead american crows in the early transmission season or in areas with low transmission rates , although confirmation of positives is suggested at this time . this assay may be a useful tool for epidemiologic studies of wnv transmission cycles involving american crows and will help to provide an epidemiologic basis for vector control efforts , although further study is warranted .

a dipstick immunochromatographic assay used for west nile virus ( wnv ) detection in mosquitoes was investigated for application to testing of fecal , saliva , and tissue samples from dead american crows ( corvus brachyrhynchos ) . results suggest that vectest may be an efficient method for wnv detection in field - collected , dead american crows , although confirmation of results and further investigation are warranted .

an 81-year - old woman recognized pruritic scaly erythemas on the scalp 2 months before the visit to our hospital . her medical history included nephrosis syndrome that had been treated with oral cyclosporine 100 mg / day for 8 years . the results of routine blood work before the onset of skin eruptions had been normal . although the head erythemas appeared to be seborrheic dermatitis ( sd ) , the lesions did not respond to topical steroidal lotion . when she visited our hospital , the eruption had disseminated to the trunk and extremities , resulting in generalized erythroderma ( fig . laboratory tests showed white blood cells 13,900/l ( normal 3,5009,800 ) , hemoglobin 11.9 mg / dl ( normal 11.315.5 ) , platelets 271,000/l ( normal 155,000365,000 ) , eosinophils 19.0% , atypical lymphocytes 2.0% , lactate dehydrogenase 517 iu / l ( normal 176353 ) and soluble interleukin-2 receptor 1,510 u / ml ( normal < 550 ) ; human t - lymphotropic virus type i antibody was negative . a skin biopsy of the erythema of the trunk showed that lymphocytes and eosinophils had infiltrated dominantly to the superficial perivascular space . 2 ) . polymerase chain reaction and flow cytometry of the skin specimens failed to detect malignant cells . however , atypical lymphocytes ( basket cells ) were detected in the peripheral blood and bone marrow ( fig . 3 ) . flow cytometry of the blood and bone marrow specimens showed that malignant cells were positive for cd2 , cd3 , cd4 , cd5 , cd7 , cd25 and cd45ra . positron emission tomography - computed tomography revealed abnormal enhancement of axillary and inguinal lymph nodes and bone marrow . we consulted a hematologist and peripheral t cell lymphoma not otherwise specified ( ptcl - nos ) , stage iv according to ann arbor was diagnosed . ptcl can cause sd - like dermatitis that gradually develops into auto - sensitization dermatitis . as chemotherapy was dismissed considering her age , we administered fexofenadine 120 mg / day and oral prednisolone 20 mg / day so as to alleviate erythroderma and pruritus . we added pregabalin 50 mg / day according to the recommendation by yosipovitch , which reduced pruritus dramatically . the amount of daily oral steroid was tapered to 5 mg over 4 months , maintaining remission of cutaneous symptoms . few publications have described sd as a paraneoplastic syndrome in cases with lung cancer and lymphoma [ 4 , 5 , 6 ] . the diagnosis of paraneoplastic syndrome usually requires concurrent onset and parallel course with malignancy at least . although we could not confirm whether the severity of the sd would parallel that of ptcl , sd seems to be a paraneoplasia since the onset of the sd coincided with that of ptcl and the sd was resistant to ordinary topical therapy . although the mechanisms of pruritus as well as the antipruritic effect of anticonvulsive agents are not clear , they probably inhibit central itch pathways . in this case , simple sd and subsequent auto - sensitization dermatitis were suspected at first . however , the sd was too resistant to ordinal therapy and developed to erythroderma . complete blood count revealed the presence of lymphoma that became an important clue to diagnosis .

seborrheic dermatitis is an inflammatory eruption that tends to distribute on the sebaceous areas of the body and is rarely described as a paraneoplasia . here we report a case with a responsive seborrheic dermatitis - like eruption of the head which resulted in generalized erythroderma . intensive examinations detected concurrent malignant lymphoma .

kidney enlargement resulting from the expansion of cysts in patients with adpkd is continuous and quantifiable and is associated with a reduction in renal function . a baseline total kidney volume above 1500 ml is associated with an increase in total kidney volume of 6.76 3.78% per year and a decrease in the glomerular filtration rate of 5.04 5.86 ml / min / year . higher rates of kidney enlargement are associated with a more rapid decrease in renal function . adpkd may become symptomatic with acute complications such as cyst haemorrhage , rupture and infection . adpkd subjects with more episodes of gross haematuria have a larger renal size and higher serum creatinine levels than those with fewer episodes . currently , apart from invasive interventions such as embolization or removal of the entire kidney , no medical treatment for adpkd patients with severe bleeding from the polycystic kidney is available . however , the observation that renal size correlates with the risk of cyst haemorrhage suggests that pharmacotherapy that reduces renal size may reduce the risk of bleeding . rapamycin , an inhibitor of the mammalian target of rapamycin ( mtor ) , has proven highly effective in reducing renal cystogenesis and loss of renal function in animal models of polycystic kidney disease ( pkd ) [ 35 ] . in addition , using rapamycin to treat transplant recipients suffering from adpkd has resulted in a significant reduction in native polycystic kidney size . however , the effect of low - dose rapamycin in kidney volume and renal function of nontransplanted adpkd patients with chronic renal failure has not been established . a 42-year - old man with adpkd presented in october 2004 with persistent severe macroscopic haematuria . computerized tomography ( ct ) of the abdomen showed bleeding from the right kidney . he underwent nephrectomy of the right polycystic kidney ( weight 700 g ) and his postoperative serum creatinine level remained stable at 2.6 mg / dl . in june 2006 , the patient presented with persistent macroscopic haematuria from his left kidney . magnetic resonance imaging ( mri ) of the abdomen showed a left kidney ( size , 17 11.5 10 cm ) with multiple cysts of different sizes scattered throughout the parenchyma . . the haematuria could not be controlled by intensive conservative treatment , and an emergency nephrectomy was proposed when the bleeding became life threatening . we tried treatment with four doses of recombinant factor vii ( novoseven , novo nordisk , spain ) , although this was unsuccessful . since local and systemic hyperfibrinolysis play a role in bleeding in adpkd patients , we administered intravenous txa ( amchafibrin , rottapharm , spain ) at a dose of 1 g/8 h. the massive bleeding promptly stopped , and haematuria gradually ceased . the haemoglobin level and renal function subsequently stabilized with serum creatinine at about 4.8 mg / dl and creatinine clearance of 13 ml / min . because animal and human trials of pkd have shown an effect of rapamycin on renal cysts , our patient was administered rapamycin ( 1 to 2 mg / day ) orally for 8 months . informed consent for off - label therapy ( compassionate use ) with rapamycin during this period was obtained . renal function , haemoglobin level , blood rapamycin levels and total kidney volume measured by mri were monitored throughout the treatment phase . the initial renal volume was 1026 ml and the final renal volume 785 ml , that is , a volume change of 241 ml ( 23.5% ) within 6 months ( figure 1a and b ) . during this time , renal function and haemoglobin level improved and remained stable ( table 1 ) . according to the study protocol , in february the restoration of rapamycin was refused by the patient . in january 2008 , 4 months after hd was started , the patient presented with persistent severe haematuria . by january 2008 , the kidney volume had increased to 1409 ml ( volume change + 624 ml , + 44% ) showing multiple cysts with evidence of bleeding . in february 2008 , the haematuria became life threatening and the kidney was removed ( weight 1309 g ) ( figure 1c ) . coronal mri of a patient with adpkd , before ( a ) and after ( b ) 6-months treatment with low - dose rapamycin . currently , there is no effective treatment available to retard cyst growth and to prevent progression to end - stage renal failure in patients with adpkd . evidence has recently been obtained from animal experiments that activation of the mtor signaling pathway plays a crucial role in cyst growth and increase in renal volume , and that the inhibition of mtor with rapamycin markedly slows cyst development and deterioration of renal function [ 35 ] . on the other hand , several clinical trials are now testing a host of therapeutic interventions in patients with adpkd . their results may improve our therapeutic approach to this disease and allow us to confirm its effect on cyst growth and on renal function . although a reduction in end - stage kidney volume of 24.8 9.7% has previously been reported in adpkd renal transplant recipients receiving rapamycin as an immunosuppressive agent , to our knowledge , this is the first case of a reduction in kidney volume associated with preservation of renal function in a nontransplanted adpkd patient with chronic renal failure receiving rapamycin . in addition , removal of a solitary kidney was prevented and initiation of hd was delayed for 16 months . the therapeutic options to control severe bleeding from the polycystic kidney are limited . we show that it is reasonable to try antifibrinolytic treatment with txa in such devastating uncontrolled bleeding . moreover , low - dose rapamycin reduced the total kidney volume and delayed the loss of renal function in our patient . the fact that there were no further episodes of bleeding during treatment reinforces the concept that rapamycin affects cyst growth and its consequences . thus , the absence of further episodes of cystic bleeding could partly account for the observed efficacy of rapamycin in a kidney volume reduction . an antiproliferative and antiangiogenic role has been suggested , although its ability to reduce the risk of haemorrhagic complications from renal cysts has not been established . these findings are preliminary and do not in themselves prove the efficacy of mtor inhibition for the treatment of adpkd - associated cystic bleeding . however , the increase in kidney volume when treatment was discontinued , followed by recurrence of cystic bleeding when hd was initiated , provides compelling circumstantial evidence . in conclusion , severe persistent bleeding from a solitary kidney in a patient with adpkd was successfully treated with txa . moreover , treatment with a low dose of rapamycin for 8 months resulted in a decrease in kidney volume and preservation of renal function in this nontransplanted adpkd patient with chronic renal failure . these results , although encouraging , require confirmation and further elucidation by subsequent prospective trials .

this is the first report of a case of a reduction in kidney volume and preservation of renal function in a patient with autosomal - dominant polycystic kidney disease ( adpkd ) receiving rapamycin . a 42-year - old man with adpkd and a severe persistent bleeding from his solitary left kidney was successfully treated with tranexamic acid ( txa ) . he also received low - dose rapamycin for 8 months , and this was associated with a 23.5% reduction in kidney volume , improvement and stabilization of renal function , and normalization of haemoglobin levels . when treatment with rapamycin was interrupted , renal function deteriorated within an 8-month period and haemodialysis ( hd ) became necessary . kidney volume increased at once , and life - threatening bleeding prompted a nephrectomy 4 months after the onset of hd . these data suggest that the reduction in kidney volume and preservation of renal function with rapamycin could be the result of the antiangiogenic , antiproliferative effects of rapamycin .

nasopharyngeal carcinoma ( npc ) is an endemic disease within specific regions in the world . the highest incidence is found among southern chinese people , especially those of cantonese origin , whereas among caucasians from north american and other western countries it is sporadic . radiation therapy ( rt ) , alone or combined with chemotherapy , is a paramount approach as initial treatment option for npc . distant metastasis , however , remains one of the major problems after radical treatment in patients with locally advanced disease . we report a case of a 68-year - old patient with advanced npc who developed intrathoracic endotracheal metastasis after rt . we believe this to be the first reported case of intrathoracic endotracheal metastasis in an npc patient . a 68-year - old man presented at our in - patient department on september 21 , 2004 , with a 3-month history of headache and hearing loss . computed tomography ( ct ) revealed a nasopharyngeal mass extending into the left parapharyngeal space , left carotid sheath , and skull base . an enlarged cervical lymph node , about 2 2 cm , was found in the left level ii . pathology showed nasopharyngeal undifferentiated nonkeratinizing carcinoma . according to the 2002 american joint committee on cancer staging system , the patient received an initial dose of 66 gy by conventional rt and a boost dose of 10 gy by three - dimensional conformal radiation therapy ( 3d - crt ) to the primary site . prophylactic radiation was given to his bilateral neck with doses of 63.3 gy to the upper neck and 50 gy to the lower neck . however , 2 months later , a metastatic nodule about 1.5 1.1 cm was found in the left lower lobe of the lung . he received 4 cycles of chemotherapy with vinorelbine and cisplatin , 2 cycles of chemotherapy with docetaxel and cisplatin , and a 3d - crt dose of 66 gy to the nodule in 33 fractions over 6.5 weeks . thirty - four months after the initial rt , the patient presented with a cough and hemoptysis . ct showed the presence of an enlarged lymph node measuring approximately 1.5 1.5 cm in the para - aortic arch . 2 ) . immunohistochemical analysis found ck ( + + ) , ck7 ( - ) , ck20 ( - ) , ttf-1 ( - ) , and eber ( + + + ) , confirming the tumor 's nasopharyngeal origin . he was treated with conventional rt with anterior - posterior / posterior - anterior fields to 40 gy to his mediastinum . the patient tolerated the treatment well with no significant acute side effects and no treatment interruption . he died of nonmalignant disease with no signs of tumor recurrence in august 2008 , 2 years after treatment completion . metastatic tracheal tumors are extremely rare ; they usually arise from direct invasion by neighboring primary lesions such as carcinomas of the bronchus , larynx , thyroid , or mid - esophagus . similarly , tracheal metastasis from a very distant site has also been poorly documented and the upper trachea is the most frequently involved site . to the best of our knowledge , there is no report on intrathoracic endotracheal metastasis with nasopharyngeal origin . distant metastasis after treatment is the main problem in npc patients with advanced disease . in a large cohort study by lee et al . , 2,687 consecutive patients were irradiated with 6-mv photons , and the median total dose was 66 gy . after a median follow - up of 3.4 years , 732 patients ( 27% ) were found with progressive disease , 16% of whom had distant failure a predominant pattern of treatment failure . however , the specific sites of distant failure in that study were not given . yi et al . found the bone to be the most common site of distant metastasis , followed by the liver and the lung . the patient we presented here developed solitary metastasis both in the lung and in the para - aortic arch prior to the presence of an intrathoracic endotracheal lesion . it is not certain whether the secondary tracheal tumor is the consequence of the lung metastasis . anatomically , lung malignancies may spread to the mediastinum and result in mediastinal lymph node involvement through intrapulmonary and hilar lymphatic drainage . the enlarged tracheal nodule in this patient was not likely to be caused by direct invasion of the mediastinal lymph nodes since they were separated anatomically . the presence of endophytic tumor growth and the intact outer layer of the trachea found on ct images suggest that it was most likely a separate metastatic deposit . hemoptysis with coughing is the most common symptom in patients with endotracheal or endobronchial metastasis , with an incidence of 41 - 62% . although ct provides valuable information about the tumor location and its effect on the distal lung parenchyma , lymph node status and other metastatic lesions , and helps us to plan further management , bronchoscopy remains the gold standard for quickly establishing the diagnosis and management [ 8 , 9 ] . the appropriate management of patients with endotracheal metastases depends on tumor stage , tumor location , histopathology , patient 's performance , and coexisting disease(s ) . since these patients usually present with advanced disease , surgery should not be routinely performed unless the patient is in an emergency situation that needs prompt symptom relief . bronchoscopic treatment can be considered as an alternative to surgery to avoid excessive morbidity and mortality associated with the procedure . however , if the treatment is not emergent , other modalities such as brachytherapy , external beam radiotherapy and chemotherapy can be considered . in our case , long - term complete tumor control was achieved by conventional rt plus 3d - crt , suggesting external beam rt may be an appropriate management approach to achieve long - term tumor control for this disease .

intrathoracic endotracheal metastasis from a very distant site is extremely rare . we report the first case of such a disease in a 68-year - old man with nasopharyngeal carcinoma who presented with a cough and hemoptysis 34 months after finishing radiotherapy . prior to tracheal metastasis , he developed a solitary metastasis in the lung and underwent chemotherapy followed by radiotherapy . computed tomography showed the presence of an enlarged lymph node in the para - aortic arch . fiberoptic bronchoscopy revealed an endotracheal tumor 1 cm above the carina . histological and immunohistochemical analyses confirmed its nasopharyngeal origin . he was treated with conventional radiotherapy and three - dimensional conformal radiotherapy ; complete tumor remission was achieved . he died of nonmalignant disease with no signs of tumor recurrence 2 years after treatment completion . radiotherapy may be an appropriate management approach to achieve long - term tumor control for this disease .

this series of articles provides regular surveillance of new technologies which may impact on critical care . several countries have developed national horizon scanning systems to identify and monitor new health technologies . there is variation in how these centres gather information , but a consistent set of high priority sources has been identified . for the purposes of this article , the outputs of major health technology assessment centres , national regulatory authorities , and recognized scientific news sources ( table 1 ) were systematically searched for developments relevant to acute and critical care this was combined with a manual medical literature search , along key editorial themes subjectively selected for this issue . point - of - care testing is a major emerging theme throughout the health sector , encompassing both new diagnoses and monitoring of known diseases and their treatment . areas of research range from the potentially lucrative markets for outpatient , ' office'-based and patient self - testing , through to in - hospital diagnostics , which include both rapid access analysis of traditionally laboratory bound diagnostics and direct patient imaging . both aspects are particularly relevant to critical care clinicians , who rely on time sensitive diagnosis and treatment in a hyper - acute setting . an example of bedside imaging in cardiac assessment has already been cited in the first article of the present series . sample analysis , meanwhile , is rapidly developing to encompass bedside biochemical markers , physiological homeostasis monitoring , and novel ultra - rapid forms of infectious disease diagnosis . b - type natriuretic peptide can be a rapid and effective marker of ventricular strain and heart failure , and can now be measured using a point - of - care diagnostic panel ( triage bnp test ; biosite inc . , san diego , ca , usa ) . similar current and forthcoming technologies include rapid access d - dimer assays for diagnosis of pulmonary embolism as part of a structured point - of - care algorithm and unpublished early developments in stroke diagnostics . validation and clinical trials of these technologies have taken place primarily in the emergency department setting , but heart failure , cerebrovascular accident and pulmonary embolism are all of added significance in the intensive care unit ( icu ) as both primary and acquired conditions . rapid bedside diagnosis of such conditions with minimal need for intrahospital transport may be of great potential benefit to intensivists . the importance of tight glucose control in sepsis is becoming well established , although work continues on refining the target range , with a study of 4,000 patients now in progress ( normoglycaemia in intensive care study , anzics , commencing 2004 ) . the first major prospective study of tight glucose control in sepsis introduced a novel algorithm requiring frequent measurements , which raised concerns over patient safety and resource utilization in general icus . point - of - care ' stick ' glucose testing is already prevalent , but technology now exists for continuous in vivo glucose monitoring , which , although intended for ambulatory use , could improve accuracy in the acute setting . a subcutaneous interstitial glucose sensor system ( continuous glucose monitoring system ; medtronic minimed , inc . , northridge , ca , usa ) was tested against clamp controlled hypoglycaemic and hyperglycaemic excursions in volunteers ; it was shown to be closely correlated with reference analyzer results ( r= 0.91 ; p < 0.001 ) and highly responsive ( half - time 4.0 1.0 min ) . similarly , another device ( glucoday ; a. menarini diagnostics , florence , italy ) , utilizing a 15100 l micropump and a biosensor coupled with microdialysis to give a claimed response time of 2 min , will reach european markets this year . such devices may be incorporated into manual algorithms , or they may potentially open the way to automated closed - loop glucose control . microbiological diagnosis within clinical laboratories has been advancing apace . polymerase chain reaction technology is well established , but progressive refinements have made possible the rapid and near real - time diagnosis of current , novel , or newly relevant pathogens , including hiv and sars ( severe acute respiratory syndrome ) . techniques initially aimed at viruses because of their manageable size can now also be applied to bacteria and can be used for broad , simultaneous screening of multiple pathogens ( pneumoplex , prodesse , milwaukee , wi , usa ) . further refinements in microarrays and microfluidics are anticipated to bring handhand and point - of - care systems into use in the near future . point - of - care and rapid laboratory based technologies will soon be able to elicit not only pathogen identity but also patterns of drug resistance . developments include the use of adenylate kinase assay for accelerated laboratory based identification of drug - resistant bacteria , including methicillin - resistant staphylococcus aureus and vancomycin - resistant enterococci ( baclite , acolyte biomedica , salisbury , uk ; ) . point - of - care testing within emergency and critical care areas is likely to develop rapidly in the next 5 years , but it will bring complications relating to quality control , medicolegal liability , certificated training for icu and other nonlaboratory staff , increased cost , and territoriality issues . finally , other bedside technologies that have recently been assessed include the use of handheld ultrasound devices to detect occult pneumothoraces , which have been shown to have a higher sensitivity than chest radiography ( 48.8% versus 20.9% ) against a computed tomography standard . preliminary investigations suggest that handheld infrared pupillometry may be of clinical use in detecting midline cerebral shift in head injury patients . more procedure orientated assistance may become available from near - infrared technology , which has been piloted in a computerized bedside visualization device to aid venous cannulation . a study of icu patients in calgary demonstrated crude death rates of 45% among patients with icu - acquired bsi , as compared with 21% in those without ( p < 0.0001 ) . s aureus was isolated in 18% of cases in the study cited above . in this context , the development of an antistaphylococcal vaccine ( staphvax ; nabi pharmaceuticals , boca raton , fl , usa ) represents a promising new health technology . staphvax is currently in phase iii trials for end - stage renal disease , but phase ii trials are under way in postoperative and long hospital stay patients . health technology assessment encompasses the best use of current health care devices as well as emerging technologies . medical devices represent a prime infection hazard , and us centers for disease control and prevention guidelines cover the safe use of intravascular devices to minimize acquired bsi . however more recent work demonstrates that the incidence of catheter - related bsi may be significantly reduced by adding a further device needle - free , disinfectable connectors instead of three - way stopcocks to the existing recommendations ( 0.7 infections/1000 days versus 5.0 infections/1000 days of catheter use ; p < 0.03 ) . clinical management of sepsis is normally outside the remit of this section of the journal . however , it is noteworthy that new mechanical technology has been applied to the direct treatment of sepsis rather than to cardiovascular or tissue perfusion monitoring . a recent european multicentre open randomized phase ii trial investigated the use of the endotoxin adsorber system en500 ( fresenius , bad homburg , germany ) in 145 patients with severe sepsis or septic shock due to suspected gram - negative infection . the study demonstrated a trend toward reduced icu stay and more rapid reduction in lipopolysaccharide levels , but it failed to show any difference in outcome . isabel is a web - based , diagnostic decision support tool intended to provide diagnosis reminders and minimize missed diagnosis of critical disease processes . it is currently in use in several uk and overseas hospitals , with development supported by uk department of health funding followed by a commercial launch . the methodology is novel ; a commercial artificial intelligence inference engine ( autonomy , cambridge , uk ) is used to extract and structure information from standard paediatric textbooks , and to generate diagnostic reminders from this knowledge base in response to unstructured free text clinical information . the software has been under development for some time and was reviewed in this journal in 2002 , but it is now being modified to encompass adult critical illness . a review of decision support systems by the uk national institute of clinical excellence is pending . the isabel project was initially set up on a charitable basis by the parents of a child who survived a prolonged stay in paediatric intensive care after a missed diagnosis of necrotizing fasciitis . although the system is as yet little known among adult intensivists , its technology is innovative and its proposed status as an ' online second opinion ' may give it , together with similar expert systems , a powerful consumerist resonance with patients , carers and managers . the uk national institute of clinical excellence findings should be monitored with interest by critical care providers . more broadly , the uk health service is currently in the grip of a globally unprecedented large - scale national project for it ( npfit ) . structured as a series of private finance initiatives , this ambitious programme will ultimately see in a host of regionally standardized patient information systems , image storage , and networked monitoring and audit systems , linked to a national electronic patient record ' spine ' . broader concern is growing about catastrophic and unpredictable ' emergent behaviour ' in massively interconnected information technology ( it ) systems , which are rapidly becoming too complex to test or accurately model . emergent behaviour in complex systems has already been explored in popular fictional media , in which predicted outcomes are spectacular but somewhat discouraging ; however , even without quite such an apocalyptic scenario , we may well see a rising incidence of total system failures due to unpredictable nonlinear behaviour that is , major collapses triggered by small unforeseen causes . in the light of recent north american power outages and destructive computer failures in the uk social service and tax systems , emergent behavour must now be considered a clear and present threat to our increasingly networked health services and their supporting infrastructure . levels of concern are such that the uk government is funding a 10 million research programme into it complexity and catastrophic failures . they therefore require the successful convergence of multiple hospital systems , which makes them uniquely vulnerable to the consequences of system failures , whether in diagnostics , supplies , information flow , or indeed electrical power . second , the currently stated uk npfit vision is that all icu subsystems , including networked monitoring , telemetry and audit systems , will eventually be integrated into npfit , with control over equipment selection and data collection handed to the regional private sector consortia and to national audit bodies . clinician engagement and choice may not feature highly on the agenda , and there are clear concerns over the future of independent research and audit . finally , clinicians from other countries would be well advised to follow such developments because the uk is not unique in its desire to radically modernize and standardize health it , starting with a drive toward electronic patient records . in april 2004 , president bush issued an executive order calling for us national implementation of electronic medical records within 10 years , from a current baseline of 19% implementation . in a series of presidential speeches he went on therefore , this represents another area in which political and technological developments outside the icu may have a direct impact on clinical practice and patient safety , and intensivists are strongly recommended to consult early and engage with those driving their local and national health economy . very few of these are designed or marketed to be specific to intensive care , and few are traditional ' devices ' that can be physically handled or attached to a patient . however , critical care is a distillation of acute hospital practice , and any health care technology that has an impact on diagnosis , monitoring , and management of acute conditions will be of heightened importance in the clinical pressure cooker of intensive care . point - of - care testing , accelerated microbiological diagnostics , decision support systems and networked it systems are all key developments that will exert an impact on future critical care practice . bsi = bloodstream infection ; icu = intensive care unit ; it = information technology .

this commentary represents a selective survey of developments relevant to critical care . selected themes include advances in point - of - care diagnostic testing , glucose control , novel microbiological diagnostics and infection control measures , and developments in information technology that have implications for intensive care . the latter encompasses an early example of an artificially intelligent clinical decision support mechanism , the introduction of a national health care information technology programme ( uk npfit ) and its implications , and exotic threats to patient safety due to emergent behaviour in complex information systems .

although lung carcinoma remains more common in males than females , the difference is decreasing . cytological methods in the diagnosis of malignant lesions of the lungs has been generally considered to be one of its most successful applications . flexible fiberoptic bronchoscope revolutionized respiratory cytology as techniques such as bronchial brushing ( bb ) , bronchoalveolar lavage ( bal ) , and bronchial biopsy became more easy , accessible , and popular . fine needle aspiration cytology ( fnac ) has proved to be the most helpful method for the diagnosis of lung tumors . our aim was to compare the efficacy of these three cytological techniques in lung malignancies by correlating them with histopathological diagnosis by bronchial biopsy . in our study , out of all the suspected cases of lung carcinoma from january 2010 to december 2012 , 67 cases were selected where bal , bb , and fnac samples , as well as bronchial biopsy were available . if any of the three samples was inadequate or not received , the case was not included . the samples were received as follows : ( 1 ) bal samples were received as 20 ml aliquots of normal saline in sterile vials . samples were centrifuged in cytospin and prepared into air - dried and wet - fixed smears . ( 2 ) bb samples were received as air - dried and wet - fixed slides . ( 3 ) fnac samples were received as air - dried and wet - fixed smears obtained by ultrasonography ( usg ) or computed tomography ( ct)-guided transthoracic or transbronchial approach . the air - dried smears were stained with may grunwald geimsa and the wet - fixed slides with papanicolaou and hematoxylin and eosin stains . ( 4 ) bronchial biopsies were received in 10% formalin , processed and stained with hematoxylin and eosin stain , special stains , and immunohistochemistry wherever required . in our study of 67 cases suspected of lung cancer , 45 were males whereas 22 were females . four cases were negative for malignancy on biopsy , 63 cases were found to be positive , thereby giving a male : female ratio of 2.15 . majority of the cases were found to be associated with smoking in early age group . in our study , bal showed 30 true positive cases and 3 true negative cases , which was confirmed by biopsy . however , 1 case was diagnosed as false positive and 33 cases as false negative by bal . bb showed 41 true positive cases and 3 true negative cases with only 1 case as false positive and 22 cases as false negative . fnac gave the best result with 56 true positive cases and 4 true negative cases . moreover , 7 cases were false negative and no false positive case [ table 1 ] . sensitivity of bal was 47.61% and of bb was 65.07% ; it was highest for fnac at 88.88% . specificity of bal was 75% , bb was 75% , and that of fnac was 100% . similarly , positive predictive value and negative predictive value of fnac were far better than that of bal and bb . accuracy of bal was 44.77% , bb was 65.67% , and that of fnac was 89.55% [ table 2 ] . comparison of test results of fine needle aspiration cytology ( fnac ) , bronchial brushing ( bb ) , and bronchoalveolar lavage ( bal ) of the 30 cases diagnosed by bal as lung cancer , 11 were squamous cell carcinoma , 14 adenocarcinoma , 3 small cell carcinoma , and 2 cases were undifferentiated large cell carcinoma . in 41 cases diagnosed by bb as lung cancer , 18 were squamous cell carcinoma , 18 adenocarcinoma , 3 small cell carcinoma , and 2 of undifferentiated large cell carcinoma . out of the 56 cases diagnosed by fnac as lung cancer , 22 were squamous cell carcinoma , 26 adenocarcinoma , 4 cases small cell carcinoma , 2 undifferentiated large cell carcinoma , and 1 each adenosquamous carcinoma and metastatic ductal carcinoma [ table 3 ] . morphological classification of various lung malignancies figure 1 ( a ) fine needle aspiration cytology ( fnac ) of adenocarcinoma showed pleomorphic cells with abundant cytoplasm and prominent nucleoli ( hematoxylin and eosin , 400 ) . ( b ) bronchial brush smear of squamous cell carcinoma showed pleomorphic and hyperchromatic cells in sheets ( hematoxylin and eosin , 200 ) . ( c ) fnac smear of small cell anaplastic carcinoma showed loose clusters , round cells with scant cytoplasm , nuclear moulding , and streak of nuclear trail ( giemsa , 200 ) . ( d ) bronchial brush smear of large cell undifferentiated carcinoma consisted of large pleomorphic cells , hyperchromatic pleomorphic nuclei , multinucleated cells , and atypical mitotic figures ( hematoxylin and eosin , 200 ) . ( a ) fine needle aspiration cytology ( fnac ) of adenocarcinoma showed pleomorphic cells with abundant cytoplasm and prominent nucleoli ( h&e stain , 400 ) . ( b ) bronchial brush smear of squamous cell carcinoma showed pleomorphic and hyperchromatic cells in sheets ( h&e stain , 200 ) . ( c ) fnac smear of small cell anaplastic carcinoma showed loose clusters , round cells with scant cytoplasm , nuclear moulding , and streak of nuclear trail ( giemsa stain , 200 ) . ( d ) bronchial brush smear of large cell undifferentiated carcinoma consisted of large pleomorphic cells , hyperchromatic pleomorphic nuclei , multinucleated cells , and atypical mitotic figures ( h&e stain , 200 ) a pivotal improvement in sampling cells from the lower respiratory tract occurred with the development of the flexible bronchoscope in the late 1960s . today , any part of the respiratory tract can be sampled with this device . with this , the emphasis shifted from the diagnosis of malignancy in operable patients and confirmation of metastases to the use of cytology as a first line diagnostic procedure on which crucial management decisions could be based . in our study , in comparison to bal , bb gave higher number of true positive and true negative cases , and much lesser number of false positive and false negative cases , showing its superiority over bal in diagnosing lung cancers [ table 1 ] . complications of bronchoscopy are rare ( 0.5 and 0.8% for major and minor complications , respectively ) , and include laryngospasm , bronchospasm , disturbances of cardiac conduction , seizures , hypoxia , and sepsis . exfoliated cells that are lying in the bronchus start developing degenerative changes , thus progressively losing their morphological details , which are important in differentiating them from nonmalignant cells that are shed off by the normal bronchial epithelial lining . with bal , the bronchoscope is wedged into position as far as it goes , and the distal airways are flushed with several aliquots of sterile saline , usually approximately 20 ml . the first aliquot is more representative of the cellular material from larger airways , whereas subsequent aliquots reflect the alveolar compartment . bal is also used for the diagnosis of malignancy , with sensitivity ranging from 35 to 70% . the sensitivity of bal for detecting malignancy is higher for multifocal or diffuse tumors such as bronchioloalveolar carcinoma . false positive results are occasionally encountered as a result of atypical type ii pneumocytes in the setting of pneumonia , diffuse alveolar damage , bone marrow transplantation , and chemotherapy . in bb , fiberoptic bronchoscopy a brush is applied to the surface of an endobronchial lesion , and the entrapped cells are either smeared onto a glass slide or rinsed in a collection medium for thin layer or cell block preparation . if smears are made , immediate fixation ( by immersion into 95% ethanol or spray fixation ) of the smears is essential to preserve morphologic detail . fnac involves sampling the lesion with the help of a fine needle usually 2526 gauze . the success of fnac depends on four requirements : ( 1 ) samples must be representative of the lesion investigated ; ( 2 ) samples must be adequate in terms of cells and other tissue components ; ( 3 ) samples must be correctly smeared and processed ; and ( 4 ) the biopsy must be accompanied by relevant and correct clinical / radiological information . definitive diagnosis can not possibly be made if these requirements are not fulfilled . its accuracy in many situations can approach that of histopathology in providing an unequivocal diagnosis . the sensitivity , specificity , and accuracy of bal samples were 47.61 , 75 , and 44.77% , respectively , when a single sample of bal was collected [ table 2 ] . wei et al . reported sensitivity of 45.% . in our study , the values of sensitivity , specificity , and overall accuracy of bb were 65.07 , 75.0 , and 65.67% , respectively . the sensitivity of 65.07% for brushing in our study was in agreement with other researchers such as rivera and mehta ( 63.0% ) . however , gaur et al . reported the sensitivity of brushing to be as high as 87.3% in their study . fnac showed sensitivity , specificity , and accuracy as 88.88 , 100 , and 89.55% , which were much superior to those of bal and bb [ table 3 ] . the sensitivity of 88.88% for fnac was in agreement with other researchers such as rivera and mehta et al . ( 90.0% ) and tuladhar and panth ( 84.0% ) . in the present study , bronchial biopsy classified 39.68% cases ( 25/63 ) as squamous cell carcinoma whereas fnac diagnosed 39.28% cases ( 22/56 ) as squamous cell carcinoma . on the other hand , bb could diagnose 43.90% of the cases ( 18/41 ) as squamous cell carcinoma , bal was able to diagnose only 36.66% cases ( 11/30 ) as squamous cell type . similarly , fnac showed 46.42% cases ( 26/56 ) of all the cases to be of adenocarcinoma , whereas bb samples classified 43.90% cases ( 18/41 ) as adenocarcinoma . while in bal samples , 46.66% cases ( 14/30 ) were morphologically diagnosed as adenocarcinoma , 7.93% cases ( 5/63 ) bb samples showed 7.31% cases ( 3/41 ) as small cell carcinoma , whereas in bal samples , 10% cases ( 3/30 ) were of small cell type . thus , fnac promises to be a very convenient , efficient , time saving diagnostic technique , which can be performed for screening of suspicious cases and early diagnosis of malignancies in the lung . however , fnac has its limitations because it gives more false negative results than biopsy . therefore , cases that are highly suspicious for malignancy on radiology and clinical examination , which were negative on fnac , may later be biopsied to confirm the morphological typing of the malignant lesion . to conclude , fnac is a significantly superior cytological technique in the diagnosis of malignancies in the lung because it demonstrates far better specificity , sensitivity , and accuracy in comparison to bal and bb .

background : lung cancer is the leading cause of death in developed countries and is increasing at alarming rates in developing countries . cytological techniques such as bronchoalveolar lavage ( bal ) , bronchial brushing ( bb ) , and fine needle aspiration cytology ( fnac ) can aid in the early diagnosis of lung malignancies.materials and methods : a total of 67 cases , suspected of lung cancer between january 2010 and december 2012 , were selected where samples of bal , bb , fnac , as well as biopsy were obtained and processed according to the standard procedures of cytology and histology . the aim of this study was to compare the diagnostic efficacy of the three modalities , i.e. , bal , bb , and fnac in diagnosing malignant neoplasms of the lung . biopsy was considered to be the gold standard diagnostic test.results:sensitivity of bal , bb , and fnac was found to be 47.61 , 65.07 , and 88.88% , respectively , whereas specificity of bal , bb , and fnac was 75 , 75 , and 100% , respectively.conclusions:fnac is the best technique among the three for the diagnosis of lung cancers .

variceal bleeding is the most common lethal complication of cirrhosis , with a mortality rate of 20% . gastroesophageal varices ( govs ) are present in 50% of cirrhotics , and approximately 25% of patients with portal hypertension have gastric varices . gastric varices are commonly classified as govs ( gastric varices in continuity with esophageal varices ) and isolated gastric varices ( igvs ) . these are further divided into gov1 ( govs along the lesser curve of the stomach ) , gov2 ( govs along the fundus ) , igv1 ( igvs in the fundus ) , and igv2 ( igvs in the gastric body , pylorus , or antrum ) . although the prevalence and risk of bleeding of gastric varices are lower than those of esophageal varices , gastric variceal bleeding tends to be more severe , requires more transfusions , and is associated with higher mortality ( ~45% ) . gastric varices tend to be larger and more tortuous compared with esophageal varices , characteristics that , combined with their anatomical location ( particularly fundic varices ) , make endoscopic management more challenging . current management strategies for gastric varices include pharmacotherapy ( -blockers and vasoactive agents ) , endoscopic therapy ( band ligation , thrombin , and tissue adhesives ) , transjugular intrahepatic portosystemic shunt ( tips ) placement , and surgical intervention . therefore , recommendations for management of gastric varices are based on recent prospective and retrospective studies , expert consensus opinion , and experience with esophageal varices . the pathophysiology of gastric varices is not as well understood as that of esophageal varices ; however , the former are mostly seen in patients with cirrhotic portal hypertension . no studies to evaluate pharmacologic therapy or endoscopic therapy for primary prophylaxis of gastric varices have been performed , and recommendations are based primarily on the guidelines for managing esophageal varices . large gastric varices with red color signs , especially in patients with advanced liver disease ( child 's class c ) , are most likely to bleed . endoscopic therapy and tips are both considered first - line treatments for gastric variceal bleeding ; however , current guidelines favor endoscopy as the preferred initial intervention . endoscopic therapeutic options for gastric variceal bleeding include band ligation , tissue adhesives , thrombin , and sclerotherapy . the greatest evidence exists for tissue adhesives such as cyanoacrylate ( n - butyl-2-cyanoacrylate , cyanoacrylate undergoes rapid polymerization on contact with living tissues and obliteration of varices occurs when the injected cyanoacrylate adhesive hardens on contact with blood . two randomized controlled trials have compared cyanoacrylate injection with variceal band ligation , showing mixed results for initial hemostasis but reduced rebleeding rates with cyanoacrylate ( 22% versus 44% and 31% versus 54% ) . another study compared cyanoacrylate injection with sclerotherapy and found better control of initial hemostasis as well as lower rebleeding rates with cyanoacrylate . meticulous adherence to technique is crucial when using tissue adhesives to prevent irreversible damage to endoscopes caused by polymerization . a recent study reported the use of endoscopic ultrasound to guide injection of feeding veins with excellent results ; however , the risk of damaging expensive equipment may prevent its widespread usage . complications of tissue adhesives include embolization , with case reports of portal vein embolization , coronary emboli , splenic infarction , pulmonary emboli , and cerebral stroke [ 13 - 16 ] . thrombin is a promising agent that does not carry the risk of embolization and damage to equipment . a recent study using bovine thrombin to control gastric variceal bleeding demonstrated a hemostasis rate of 92% and no episodes of rebleeding . several other studies with thrombin have shown promising results [ 17 - 19 ] . however , controlled trials comparing thrombin with other agents are required before it is universally accepted . the role of tips in the management of gastric varices alone or in comparison with esophageal varices has been investigated in multiple studies . chau et al . reported a 96% initial hemostasis rate and 29% rebleeding rate with tips in patients with fundal varices , and these were similar to the rates for cirrhotics with esophageal varices . in another retrospective series comparing tips in 40 cirrhotics with gastric variceal bleeding and 232 patients with esophageal variceal bleeding , the rates of rebleeding were similar ( 20% versus 15% ) . clearly , with hemostasis rates over 90% , tissue adhesives and tips are both highly effective management options for gastric variceal bleeding . lo et al . carried out a randomized controlled trial comparing tips ( n = 35 ) and cyanoacrylate glue ( n = 37 ) for secondary prophylaxis of gastric variceal bleeding . however , the rebleeding rate was significantly higher in the cyanoacrylate arm compared with the tips arm ( 38% versus 11% ) . in a uk - based retrospective study , the two therapies were equally effective for initial hemostasis but patients with tips had a lower rebleeding rate ( 20% versus 35% ) . however , tips was considerably more expensive than cyanoacrylate therapy . finally , in a recent retrospective study comparing tips ( n = 44 ) and cyanoacrylate therapy ( n = 61 ) for gastric variceal bleeding , rebleeding rates and mortality rates were similar between the two groups . however , the tips group had increased morbidity requiring hospitalization and had a higher incidence of encephalopathy ( 11 versus 1 ) . the pathophysiology of gastric varices is not as well understood as that of esophageal varices ; however , the former are mostly seen in patients with cirrhotic portal hypertension . no studies to evaluate pharmacologic therapy or endoscopic therapy for primary prophylaxis of gastric varices have been performed , and recommendations are based primarily on the guidelines for managing esophageal varices . large gastric varices with red color signs , especially in patients with advanced liver disease ( child 's class c ) , are most likely to bleed . endoscopic therapy and tips are both considered first - line treatments for gastric variceal bleeding ; however , current guidelines favor endoscopy as the preferred initial intervention . endoscopic therapeutic options for gastric variceal bleeding include band ligation , tissue adhesives , thrombin , and sclerotherapy . the greatest evidence exists for tissue adhesives such as cyanoacrylate ( n - butyl-2-cyanoacrylate , cyanoacrylate undergoes rapid polymerization on contact with living tissues and obliteration of varices occurs when the injected cyanoacrylate adhesive hardens on contact with blood . two randomized controlled trials have compared cyanoacrylate injection with variceal band ligation , showing mixed results for initial hemostasis but reduced rebleeding rates with cyanoacrylate ( 22% versus 44% and 31% versus 54% ) . another study compared cyanoacrylate injection with sclerotherapy and found better control of initial hemostasis as well as lower rebleeding rates with cyanoacrylate . meticulous adherence to technique is crucial when using tissue adhesives to prevent irreversible damage to endoscopes caused by polymerization . a recent study reported the use of endoscopic ultrasound to guide injection of feeding veins with excellent results ; however , the risk of damaging expensive equipment may prevent its widespread usage . complications of tissue adhesives include embolization , with case reports of portal vein embolization , coronary emboli , splenic infarction , pulmonary emboli , and cerebral stroke [ 13 - 16 ] . thrombin is a promising agent that does not carry the risk of embolization and damage to equipment . a recent study using bovine thrombin to control gastric variceal bleeding demonstrated a hemostasis rate of 92% and no episodes of rebleeding . several other studies with thrombin have shown promising results [ 17 - 19 ] . however , controlled trials comparing thrombin with other agents are required before it is universally accepted . the role of tips in the management of gastric varices alone or in comparison with esophageal varices has been investigated in multiple studies . chau et al . reported a 96% initial hemostasis rate and 29% rebleeding rate with tips in patients with fundal varices , and these were similar to the rates for cirrhotics with esophageal varices . in another retrospective series comparing tips in 40 cirrhotics with gastric variceal bleeding and 232 patients with esophageal variceal bleeding , the rates of rebleeding were similar ( 20% versus 15% ) . clearly , with hemostasis rates over 90% , tissue adhesives and tips are both highly effective management options for gastric variceal bleeding . . carried out a randomized controlled trial comparing tips ( n = 35 ) and cyanoacrylate glue ( n = 37 ) for secondary prophylaxis of gastric variceal bleeding . however , the rebleeding rate was significantly higher in the cyanoacrylate arm compared with the tips arm ( 38% versus 11% ) . in a uk - based retrospective study , the two therapies were equally effective for initial hemostasis but patients with tips had a lower rebleeding rate ( 20% versus 35% ) . however , tips was considerably more expensive than cyanoacrylate therapy . finally , in a recent retrospective study comparing tips ( n = 44 ) and cyanoacrylate therapy ( n = 61 ) for gastric variceal bleeding , rebleeding rates and mortality rates were similar between the two groups . however , the tips group had increased morbidity requiring hospitalization and had a higher incidence of encephalopathy ( 11 versus 1 ) . the initial steps in the management of gastric variceal bleeding are similar to esophageal varices and include attention to airway and obtaining intravenous access with prompt hemodynamic resuscitation , institution of vasoactive medications ( somatostatin analogues , octreotide , vasopressin , and terlipressin ) to reduce portal pressure by splanchnic vasoconstriction and prophylactic antibiotics followed by diagnostic and potentially therapeutic upper endoscopy ( figure 1 ) . the next step in the management may be endoscopic injection of tissue adhesives or tips placement . with a lower complication rate , comparable hemostasis and survival rates , and lower cost , endoscopic therapy with tissue adhesives is likely to be the treatment of choice for acute bleeding and secondary prophylaxis in most patients . on the other hand , tips will remain an important second - line modality in patients who fail endoscopic therapy . however , additional controlled studies are needed before valid conclusions can be made , and individual patient characteristics must be considered in management decisions . primary prophylaxis may be instituted with -blockers in patients with large varices with red color signs and advanced liver disease . further research on management of acute bleeding , primary prophylaxis , and comparisons between tissue adhesives and thrombin would be welcome .

gastric variceal bleeding is a common problem in patients with cirrhosis and is associated with increased morbidity and mortality . management is complex and includes pharmacotherapy , endoscopic therapy , and shunt placement . recent studies indicate that endoscopic therapy with tissue adhesives has similar hemostasis rates and outcomes in terms of mortality as shunt placement but has a lower complication rate and therefore could be considered the first line therapy for acute bleeding and secondary prophylaxis of gastric varices .

child abuse is a serious social health problem all over the world with important adverse effects . this is an issue concerning millions of children and families which influence significantly children of any ethnicity , color , social status and religion and encompasses all ages ( before birth , in infancy , childhood , adolescence , etc . ) this is in the range of 4.7 to 91.6% according to the type of maltreatment and place of study ( 2 - 5 ) . relationship between child abuse and mental disorder is well known in different countries ( 6 - 9 ) . evidence shows that child abuse and neglect are related to various disorders in adolescence , which include mental disorders , psychological and behavioral disorders , substance abuse , and poor physical health ( 10 - 14 ) . results in one review found emotional , sexual and physical child abuse as the most serious risk factors for depression . and sexual child abuse and family violence as the greatest risk factors for anxiety disorders ( 15 ) . other studies assessed the association between childhood sexual abuse and major depression and anxiety at higher age , and found that severe forms of sexual abuse were correlated with a greater risk of outcomes ( 16 - 19 ) . in iran , our knowledge about various effects associated with child abuse types and specific mental disorders is not sufficient . our overall objective was to extend our understanding of the relation between mental conditions including anxiety , stress and depression , and child abuse and neglect . maybe dispelling this gap in knowledge would disclose findings that could be as an alarm for health professionals and decision makers for prevention and intervention programming aimed at reducing both child abuse and poor mental health outcomes in adolescents . in 2013 , we conducted a cross - sectional survey in two secondary school levels ( 6th and 7th level ) in yazd province located in central iran . of the 745 students from 25 classes eligible to participate , 700 completed the questionnaire with a response rate of 94% . the first part of the questionnaire included 20 demographic questions . in the second part a standard self - reported , valid and reliable ( minimum internal consistency for sexual domain : 0.87 ) questionnaire was applied for recording child abuse information in neglect , psychological , physical and sexual domains ( 20 ) . all questions could be answered by a 4-level scale ( never , sometimes , often and almost always ) . to score the questionnaire , children with positive answer to at least one question in each domain of emotional , physical and neglect were considered victims of that domain ; children with positive answers to at least one question in each domain of emotional , physical and neglect were included in the total number of child abuse victims of all domains . another questionnaire used for measuring mental health situation among the adolescents was dass ( depression anxiety stress scales)-42 . the dass is a 42-item self report instrument designed to measure the three related negative emotional states of depression , anxiety and tension / stress in adolescents . dass is made up of 42 self - report items to be completed over five to ten minutes , each reflecting a negative emotional symptom . each of these is rated on a four - point likert scale of frequency or severity of the participant s experiences over the last week with the intention of emphasizing states over traits . these scores ranged from 0 , meaning that the subject believed the item did not apply to him at all , to 3 , meaning that the subject considered the item to apply to him very much , or most of the time ( 21 ) . in iran validity and reliability of dass-42 questionnaire were assessed ( 22 ) . correlation coefficient with beck anxiety inventory and beck depression inventory was 0.81 and 0.74 and alpha coefficient for depression , anxiety and stress 0.94 , 0.85 and 0.87 respectively ( 23 ) . adolescents with scores less than 9 , 7 and 14 for depression , anxiety and stress were considered as normal by coding zero in dependent outcome , and the other scores as faced with mental disorders by coding one in logistic regression model . mental health and child abuse questionnaire score could vary from 0 to 126 , and 38 to 152 respectively . in both of them the collected data was analyzed using spss software and chi - square test , independent t - test and logistic regression analysis . in order to identify predicting factors for mental disorders in students , each variable was entered separately , and in the last step for multivariate analyses , those variables were entered which were significant in the univariate analyses to find the set of best predictors of mental disorders in adolescents using forward conditional model . considering the importance of the issue and the necessity of taking students satisfaction and trust to cooperate honestly in responding to the questions , at first , nature and purpose of the questionnaire were clarified for students and anonymity was also emphasized . of the 700 respondents aged 12 to 18 years ( mean 13.3 years ; sd 0.9 ) , 57% were females . the majority ( 92.8% ) of students did not have another job and few ( 3.8% ) of them said they used alcohol or drug . among the adolescents 6.5% were single child in the family whereas 40.7% , 21.7% and 31.1% were first , mean mental disorder score was 30.824.1 ( range : 0 - 119 ) and it was 56.1 6.5 ( range : 38 - 81 ) for child abuse . there was a statically significant correlation between mental disorder and child abuse score ( spearman rho : correlation coefficient = 0.2 ; p - value < 0.001 ) ( figure 1 ) . the highest correlation between mental disorders and child abuse was found in psychological domain , spearman s rho coefficients were 0.46 , 0.41 and 0.36 for depression , anxiety and stress respectively ( p - value < 0.001 ) . other coefficients for correlation between mental disorder ( i.e. depression , anxiety and stress ) and four domains of child abuse are shown in table 2 . p value < 0.001 for all correlations . among adolescents with experience of at least one type of child abuse , suffering from some degree of depression was 45.3% vs 6.8 % in adolescents without it . there were statically significant relationships between severity of different types of mental disorders and experience of at least one type of child abuse ( chi square : p - value < 0.001 ) ( table 3 ) . chi square : p value < 0.001 . based on the results of simple logistic regression for mental disorder , related variables including type of school ( governmental / non profit ) , sex , birth order , student s or parent s substance abuse and parents living situation in model 1 and four domains of disorders ( all p < 0.05 ) , were candidates to enter in the multivariate analysis in two models . however , of the above mentioned variables , sex , birth order , parent s substance abuse in model1 and neglect severity , emotional abuse severity and having experience of sexual abuse ( all p < 0.05 ) in model 2 , were significant in the multivariate analysis . based on these results , females , last born adolescents and subjects with parental drug or alcohol abuse had mental disorder odds of 3 , 0.4 and 1.9 times compared to others . odds of mental disorder for students with child abuse and neglect in various severities are shown in table 4 . model.1 : hosmer and lemeshow test : chi square ( 6 ) = 1.4 , p - value = 0.96 ; a total of 76.8% of subjects were correctly classified . model.2 : hosmer and lemeshow test : chi square ( 7 ) = 6.3 , p - value = 0.5 ; a total of 78.8% of subjects were correctly classified . 93.5% of the adolescents had experienced at least one type of neglect , psychological , physical and sexual abuse ranging mild to severe . all 4 types of child abuse and neglect were associated with all types of mental disorders including depression , anxiety and stress . the current findings are also consistent with other studies that found relations with specific types of child abuse and mental conditions ( 6 , 24 - 30 ) , although relationship between assessment of child abuse and mental disorders is not directly comparable because of diversity in instruments or methods . a review from canada reported that all types of abuse are damaging to children physically , emotionally , and psychologically and can cause long - term difficulties with behavior and mental health development ( 6 ) . in a population - based survey of 1000 children and adolescents aged 10 - 17 years in the usa , a linear relationship between multiple victimization and other childhood disorders as well as adolescent depression and anger / aggression was shown ( 31 ) . in the present study the highest correlation scores for all mental disorders ( depression , anxiety and stress ) were found in psychological domain . in a prospective cohort study childhood neglect another study emphasized the effect of sexual abuse on depression and chronic pain in adulthood and revealed that the more severe the abuse , the stronger was the association with poor outcomes in adulthood ( 32 ) . our results similarly showed a dose - dependent relationship between psychological abuse with mental disorders so that the severe type predicted mental disorders 30 times more than the mild kind in logistic regression model . in the model other variables including sex , birth order and drug or alcohol abuse by parents were considered as predictors of mental disorders . the finding was similar to the results of other studies on iranian adolescents which showed that mental disorders , in particular depression and anxiety , were more prevalent in females ( 33 , 34 ) . among siblings , the lowest rank position appeared to be a protective factor against the development of mental disorders . many studies showed that a higher rank position in the birth order was positively associated with higher risk ( 35 ) . one study concluded that being the middle child and living with both biological parents appeared to be protective factor against the development of emotional disorders or attention deficit hyperactivity disorders ( adhd ) ( 36 ) . we found that alcohol and/or substance abuse by parents predicted depression , anxiety and stress symptoms in adolescents . this result is parallel with a lot of studies which mentioned the effect of parental addiction on psychological , emotional and behavioral disorders on children ( 37 - 39 ) . our findings show that 93.5% of the adolescents in yazd , iran have experienced at least one mild type of child abuse and neglect and that child abuse has strong relationship with mental conditions . generally child abuse is an important public health disorder in iran as well as other parts of the world . it is notable that in some societies child abuse and neglect is perceived in terms of very harsh physical assault and sometimes this behavior is considered necessary for punishment of the child ( 40 ) . so awareness of health care providers about child abuse and its association with mental disorders is needed . child abuse should be considered and explored by psychologists who encounter adolescents with mental disorders ( i.e. , depression , anxiety and stress ) . mandatory reporting of child abuse by all care givers e.g. those attending schools , in order to prevent or reduce its detrimental effects , is useful . in addition , success in preventing child abuse could lead to reductions in the prevalence of mental disorders . in the present study however , the data from this study were cross - sectional and retrospective in nature . it is probable that some reported types of abuse especially emotional and neglect were due to some mental disorders like depression . moreover many other important mental disorders ( e.g. , personality disorders ) could be included in the study . our findings show that 93.5% of the adolescents in yazd , iran have experienced at least one mild type of child abuse and neglect and that child abuse has strong relationship with mental conditions . generally child abuse is an important public health disorder in iran as well as other parts of the world . it is notable that in some societies child abuse and neglect is perceived in terms of very harsh physical assault and sometimes this behavior is considered necessary for punishment of the child ( 40 ) . so awareness of health care providers about child abuse and its association with mental disorders is needed . child abuse should be considered and explored by psychologists who encounter adolescents with mental disorders ( i.e. , depression , anxiety and stress ) . mandatory reporting of child abuse by all care givers e.g. those attending schools , in order to prevent or reduce its detrimental effects , is useful . in addition , success in preventing child abuse could lead to reductions in the prevalence of mental disorders . in the present study several types of child abuse and mental conditions were assessed . however , the data from this study were cross - sectional and retrospective in nature . it is probable that some reported types of abuse especially emotional and neglect were due to some mental disorders like depression . moreover many other important mental disorders ( e.g. , personality disorders ) could be included in the study .

backgroundchild abuse is a serious social health problem all over the world with important adverse effects.objectivesthe aim of this study was to extend our understanding of the relation between mental disorders and child abuse.materials and methodsthe study was designed as a cross - sectional survey on 700 students in secondary schools using multiple cluster sampling in yazd , iran in 2013 . we applied 2 self reported questionnaires : dass ( depression anxiety stress scales)-42 for assessing mental disorders ( anxiety , stress and depression ) and a standard self - reported valid and reliable questionnaire for recording child abuse information in neglect , psychological , physical and sexual domains . the collected data was analyzed using spss software . p - values < 0.05 were considered as significant.resultsthere was a statically significant correlation between mental disorder and child abuse score ( spearman rho : 0.2 ; p - value < 0.001 ) . the highest correlations between mental disorders and child abuse were found in psychological domain , spearman s rho coefficients were 0.46 , 0.41 and 0.36 for depression , anxiety and stress respectively ( p - value < 0.001 ) . based on the results of logistic regression for mental disorder , females , last born adolescents and subjects with drug or alcohol abuser parents had mental disorder odds of 3 , 0.4 and 1.9 times compared to others ; and severe psychological abuse , being severely neglected and having sexual abuse had odds 90 , 1.6 and 1.5 respectively in another model.conclusionsprogramming for mandatory reporting of child abuse by physicians and all health care givers e.g. those attending schools or health centers , in order to prevent or reduce its detrimental effects is useful and success in preventing child abuse could lead to reductions in the prevalence of mental disorders .

on june 9 , 1999 , the first report of e. coli in a person who had visited an open farm in north wales was made to the communicable disease control team of north wales health authority . six days later , on june 15 , two more patients with culture - positive e. coli o157 infection reported having visited the farm . the farm owner immediately and voluntarily closed the farm , and all local physicians were informed of the cases by fax on june 15 and asked to report further cases . the farm received 50,000 visitors a year and had a range of animals and several food outlets . most contact with animals occurred in the barn , which contained a variety of farm and domestic animals . the first three case - patients had visited the farm on may 31 , the 2nd day of a 2-day annual festival held on the farm . the festival had admitted 3,000 visitors each day , all of whom had access to the open farm . attractions at the festival included food stalls and a number of visiting animals ( rare and unusual farm animals brought to the farm for the festival ) . local case - finding efforts on june 15 did not initially disclose any further cases associated with the farm . the outbreak control team recommended washing and disinfecting all public areas and preventing contact between visitors and farm animals or animal feces . after complying with these recommendations , the farm was allowed to reopen 2 days later on june 17 ; however , it was to operate under a prohibition notice served under the provisions of the health and safety at work act 1974 , restricting visitors from having direct contact with animals . however , later that same day a fourth case was reported in a person who had visited the farm on june 5 , five days after the first three patients . the farm was formally closed to all visitors under the terms of a second prohibition notice . a national public warning was issued , all communicable disease control units were alerted , and a telephone helpline was set up and received over 150 calls . children at three local nurseries and two primary schools , where primary cases had occurred after group visits , were screened for further cases . health and safety arrangements were reviewed at the farm ( 9 ) and the recommendations of the outbreak control team were implemented ; these included a one - way flow through the petting area , positioning of washing facilities immediately adjacent to the exit , exclusion of farm animals from eating areas , and reinforcement of the importance of handwashing . because patients reported a wide variety of activities and contact with animals , a case - control study was conducted to identify particular high - risk exposures . a case was defined as hemolytic uremic syndrome or e. coli o157 culture - positive diarrhea in any child < 15 years of age who had visited the farm on or after may 31 and become ill within 10 days of the visit . controls were selected from children < 15 years old who remained well in the 2 weeks after a farm visit and whose parents had contacted the telephone helpline . only one control child was chosen from each family or group . where appropriate , information was obtained from an adult who had accompanied the children to the farm . attempts to contact callers were abandoned after three separate unsuccessful day and evening phone calls . potential risk factors were identified from preliminary interviews , a site visit , and a risk - assessment exercise conducted by the proprietor after the outbreak was discovered . questions included date of visit , contact with animals or surrounding barriers , areas of the farm visited , food consumption , personal behavior ( e.g. , thumb - sucking ) , handwashing , use of the toilet , whether soiling was visible on the child , and whether the child had fallen at the farm . in an attempt to categorize the degree of exposure to each type of animal , respondents were asked to estimate the time they spent with each . the nature of the animal contact was recorded as cuddling , kissing , feeding from hand , bottle feeding , or stroking . the risk for illness , expressed as an odds ratio ( or ) , was calculated for each exposure , using epi info version 6 ( centers for disease control and prevention , atlanta , ga ) . some exposures , such as animal contact , were analyzed both by category ( contact / no contact ) and by comparison of the risk for light contact ( only feeding from the hand or bottle feeding ) with more intense contact ( cuddling , stroking , or kissing ) . to investigate confounding , logistic regression was performed , using spss version 7.5 for windows ( microsoft , redmond , wa ) , with the probability of becoming ill as the dependent variable and exposures associated with an increased risk for illness , at p<0.10 , as independent variables . strains were confirmed biochemically and serologically as e. coli o157 and were phage typed and tested for resistance to antimicrobial agents by methods summarized previously ( 10 ) . pulsed - field gel electrophoresis ( pfge ) was performed by the method of willshaw et al . ( 11 ) . a total of 17 primary cases ( 1 adult , 16 children ) and 7 secondary cases in household contacts ( 2 adults , 5 children ) were ascertained . ten patients ( 1 adult , 9 children ) required hospital admission , including 3 children with hemolytic uremic syndrome . ten of the primary case - patients had visited the farm on may 31 , bank holiday monday ; the remaining seven had visited during the following 15 days . isolates from all the cases except one , where the sample was not submitted for typing , were characterized as phage type ( pt ) 2 , verocytotoxin type ( vt ) 2 , and were resistant to streptomycin , sulphonamides , and tetracycline ( ssut ) . eleven of 46 ( mainly floor ) fecal samples taken by veterinarians were positive for e. coli o157 . ten strains were pt2 , vt2 , ssut , and one strain was pt4 , vt2 , and sensitive to antimicrobial agents . these 11 strains were from pens or paddocks containing calves , goats , pigs , sheep , and a pony . the results of pfge showed that the human and animal strains of e. coli o157 pt2 vt2 were indistinguishable . controls had a mean age of 4.5 years ( sd 2.7 ) compared with the patients mean age of 5.4 years ( sd 3.1 ) ; this difference was not significant ( p=0.35 ) . the proportion of girls was similar in patients ( 55.6% ) and controls ( 61.5% ) . table 1 shows results of univariable analysis . as all case - patients had been in contact with goats , calculating an or for any contact was not possible . ( when one of the cells contains a zero , defining a confidence interval is not possible . ) attendance on bank holiday monday , eating ice cream , eating cotton candy ( i.e. , candy floss ) , any contact with cows or goats , and high goat contact were all associated with increased risk ( p<0.10 ) . no link between the risk for illness and duration of contact with cows or goats was found . cotton candy was only available on bank holiday monday , a special festival day on which visitors were also more likely to have contact with cows ( or 5.56 , p=0.03 for those attending on may 31 compared with other days ) . for these reasons , bank holiday monday was not an independent variable and so was excluded from the multivariable analysis . the results of multivariable analysis for the other four variables are shown in table 2 . the association between illness and eating ice cream or cotton candy increased and remained significant ; the magnitude of effect for cow and goat contact was similar to univariate analysis , although neither factor was statistically significant . to check whether bank holiday monday was unique , the analysis was repeated for the 24 bank holiday monday attenders only ; results are shown in table 3 . no or reached statistical significance , reflecting the smaller dataset ; however , the magnitude of the independent effect of these variables ( as evidenced by ors ) is similar to that for the whole study population , suggesting that the risks were similar on the bank holiday monday to the whole study period . or , odds ratio ; ci , confidence interval . boldface type indicates variables with increased or statistically significant at 95% level . or , odds ratio ; ci , confidence interval . a total of 17 primary cases ( 1 adult , 16 children ) and 7 secondary cases in household contacts ( 2 adults , 5 children ) were ascertained . ten patients ( 1 adult , 9 children ) required hospital admission , including 3 children with hemolytic uremic syndrome . ten of the primary case - patients had visited the farm on may 31 , bank holiday monday ; the remaining seven had visited during the following 15 days . isolates from all the cases except one , where the sample was not submitted for typing , were characterized as phage type ( pt ) 2 , verocytotoxin type ( vt ) 2 , and were resistant to streptomycin , sulphonamides , and tetracycline ( ssut ) . eleven of 46 ( mainly floor ) fecal samples taken by veterinarians were positive for e. coli o157 . ten strains were pt2 , vt2 , ssut , and one strain was pt4 , vt2 , and sensitive to antimicrobial agents . these 11 strains were from pens or paddocks containing calves , goats , pigs , sheep , and a pony . the results of pfge showed that the human and animal strains of e. coli o157 pt2 vt2 were indistinguishable . controls had a mean age of 4.5 years ( sd 2.7 ) compared with the patients mean age of 5.4 years ( sd 3.1 ) ; this difference was not significant ( p=0.35 ) . the proportion of girls was similar in patients ( 55.6% ) and controls ( 61.5% ) . table 1 shows results of univariable analysis . as all case - patients had been in contact with goats , calculating an or for any contact was not possible . ( when one of the cells contains a zero , defining a confidence interval is not possible . ) attendance on bank holiday monday , eating ice cream , eating cotton candy ( i.e. , candy floss ) , any contact with cows or goats , and high goat contact were all associated with increased risk ( p<0.10 ) . no link between the risk for illness and duration of contact with cows or goats was found . cotton candy was only available on bank holiday monday , a special festival day on which visitors were also more likely to have contact with cows ( or 5.56 , p=0.03 for those attending on may 31 compared with other days ) . for these reasons , bank holiday monday was not an independent variable and so was excluded from the multivariable analysis . the results of multivariable analysis for the other four variables are shown in table 2 . the association between illness and eating ice cream or cotton candy increased and remained significant ; the magnitude of effect for cow and goat contact was similar to univariate analysis , although neither factor was statistically significant . to check whether bank holiday monday was unique , the analysis was repeated for the 24 bank holiday monday attenders only ; results are shown in table 3 . no or reached statistical significance , reflecting the smaller dataset ; however , the magnitude of the independent effect of these variables ( as evidenced by ors ) is similar to that for the whole study population , suggesting that the risks were similar on the bank holiday monday to the whole study period . or , odds ratio ; ci , confidence interval . boldface type indicates variables with increased or statistically significant at 95% level . or , odds ratio ; ci , confidence interval . this outbreak is the largest caused by vtec o157 in visitors to an open farm and the first case - control study of risk factors for infection on an open farm in the united kingdom . our study has demonstrated a strong association with eating either ice cream or cotton candy and an increase in risk associated with goat and cow contact . a case - control study among farm visitors in the united states in 2000 showed an association between e. coli o157 infection and contact with cattle , nail biting , and food purchase ( 12 ) . considering sources of bias , particularly in the selection of controls or in gathering information , is important . callers to a helpline are likely to differ in some ways from the other visitors , perhaps being better informed and more anxious . however , their ice cream or cotton candy eating habits are unlikely to differ . information on known risk factors , such as handwashing and food history , may be susceptible to rumination bias , that is , a tendency for those who have been ill to systematically bias the reporting of exposure . patients may have been more likely to recall eating ice cream , as this was one of the foods widely reported in the media as a possible source of infection in the early stages of the investigation . however , the association with cotton candy was unexpected , and there is no reason to think that patients were more likely to recall this than the controls . the association between illness produced by vtec o157 and contact with cows and goats reflects previous experience of direct transmission to humans ( 4,5,7 ) . cattle are regarded as the most important reservoir for vtec o157 ( 13 ) . however , the strong association with cotton candy and ice cream merits further discussion . ice cream was supplied by the same local manufacturer to 65 other outlets in north wales . cotton candy was manufactured on site on the may bank holiday by a vendor using a process repeated at different fairs throughout north wales . both are particularly sticky , messy foods , and it is possible to envisage two mechanisms by which eating them makes the ingestion of e. coli o157 more likely . first , after eating one of these foods , sticky hands may be more prone to pick up contaminated organic matter from the environment or directly from animal coats by stroking . secondly , to clean sticky hands , small children are likely to lick their fingers . our investigation reinforces existing advice ( 9,14 ) on handwashing , specifically that handwashing facilities should be positioned immediately adjacent to exit areas where animal contact is encouraged , and that one - way systems and adequate supervision can facilitate effective handwashing . advice concerning the importance of supervised handwashing before and after eating should be reinforced at the point of selling food . our findings , and those of others ( 4,5,7,12,13 ) also suggest that calves may not be suitable animals for petting . in addition , we recommend specifically that food , particularly sweet and sticky food , only be sold and eaten in clean areas of the farm .

an outbreak of vero cytotoxin producing escherichia coli o157 ( vtec o157 ) gastroenteritis in visitors to an open farm in north wales resulted in 17 primary and 7 secondary cases of illness . e. coli o157 vero cytotoxin type 2 , phage type 2 was isolated from 23 human cases and environmental animal fecal samples . a case - control study of 16 primary case - patients and 36 controls ( all children ) showed a significant association with attendance on the 2nd day of a festival , eating ice cream or cotton candy ( candy floss ) , and contact with cows or goats . on multivariable analysis , only the association between illness and ice cream ( odds ratio [ or]=11.99 , 95% confidence interval [ ci ] 1.04 to 137.76 ) and cotton candy ( or=51.90 , 95% ci 2.77 to 970.67 ) remained significant . in addition to supervised handwashing , we recommend that foods on open farms only be eaten in dedicated clean areas and that sticky foods be discouraged .

receptor tyrosine kinases ( rtks ) control many aspects of cell physiology , including cell proliferation , survival , metabolism , migration and differentiation . many rtks exhibit increased intrinsic tyrosine kinase activity upon binding ligand , thus activating numerous secondary signaling intermediates and pathways , such as pi3k - akt - mtor and ras - erk . importantly , many rtks also exhibit changes in cell surface membrane traffic by undergoing internalization via clathrin - mediated endocytosis ( cme ) upon ligand binding . these rtks are recruited to clathrin - coated pits ( ccps ) , eventually leading to receptor internalization . ccps are 50100 nm structures associated with the inner leaflet of the plasma membrane , and are comprised of a lattice - like assembly of the protein clathrin , the adaptor protein ap2 , and 3050 other specific proteins recruited from the cytosol . some ccps undergo scission from the plasma membrane by the gtpase dynamin 2 , leading to formation of intracellular vesicles ; however , most ccps undergo abortive turnover at the plasma membrane without producing vesicles , suggesting that these structures may have other role(s ) directly at the plasma membrane . for some rtks , the activation of receptor - proximal signaling intermediates occurs simultaneously with the residence of the receptor within ccps . we have recently shown that upon activation of the epidermal growth factor ( egf ) receptor ( egfr ) , the phosphorylation of the signaling adaptor gab1 , as well as the downstream phosphorylation of akt , requires clathrin . importantly , this requirement for clathrin did not reflect a requirement for egfr internalization from the plasma membrane , as blocking egfr endocytosis by perturbation of dynamin 2 ( which allowed egfr enrichment within plasma membrane clathrin structures ) did not impact egfr signaling . thus , we proposed that some plasma membrane clathrin structures function as cell surface signaling microdomains , enriched in specific factors required for activation of egfr signals ( e.g. gab1-akt ) , but dispensable for others ( e.g. , erk ) . indeed using total internal reflection fluorescence microscopy ( tirf - m ) and computational image analysis , we resolved that egf stimulation increased the levels of phosphorylated gab1 ( pgab1 ) within ccps . we also showed that the requirement for clathrin for the activation of akt signaling was specific for signaling by egfr , such that clathrin was not required for egf - stimulated akt phosphorylation in cells that also express erbb2 . egfr and erbb2 preferentially form heterodimers ; these egfr - erbb2 heterodimers exhibit differences in the activation of c - src and c - cbl compared to egfr homodimers . hence , the requirement for clathrin for the phosphorylation of gab1 and akt was specific for signaling by egfr homodimers but not that by egfr - erbb2 heterodimers . whether this novel function of clathrin extends to other receptor tyrosine kinases beyond egfr is an important question that has not yet been examined . met is another rtk which has some similarities to egfr in terms of the signaling pathways activated by the ligand - bound receptors . in contrast to egfr , met is activated upon binding to its ligand hepatocyte growth factor ( hgf ) . like in egfr signaling , activated met elicits the phosphorylation of gab1 , which contributes to activation of many downstream signals , including pi3k - akt . while egfr requires the signaling adaptor grb2 to recruit and elicit phosphorylation of gab1 , met can also bind directly to gab1 upon phosphorylation of y1349 within met . furthermore , met undergoes recruitment to ccps and clathrin - mediated endocytosis following binding to hgf . whether met may have a similar requirement for clathrin as does egfr for the activation of akt is not known . we have thus used similar methods as we have recently done for egfr to examine whether hgf stimulation ( i ) leads to enrichment of phosphorylated gab1 within ccps , and ( ii ) elicits akt phosphorylation that is dependent on clathrin . to examine the role of clathrin in met signaling , we used retinal pigment epithelial cells ( arpe-19 , rpe henceforth ) as we had previously used to study egfr signaling . rpe cells stimulated with hgf exhibited an increase in phosphorylation of gab1 and akt , but not that of egfr ( fig . 1a ) , showing that this cell line effectively and specifically responds to hgf stimulation . ( a ) rpe cells were stimulated with either 5 ng / ml egf or 50 ng / ml hgf for 5 minutes . whole - cell lysates were prepared , resolved by immunoblotting , and probed with anti - phospho - egfr ( y1068 ) , anti - phospho - gab1 ( y627 ) and anti - phospho - akt ( s473 ) antibodies . ( b - c ) rpe cells stably expressing tag - rfp - t fused to clathrin light chain ( rfp - clc ) were stimulated with 50 ng / ml hgf and immunostained for pgab1 . shown in ( b ) are representative micrographs obtained by tirf - m ( scale 5 m , arrowheads indicate pgab1-positive ccps , selected manually ) . images obtained by tirf - m were subjected to automated detection of clathrin structures followed by quantification of pgab1 and rfp - clc in each detected object , as in . shown in ( c ) is the mean pgab1 fluorescence intensity detected within clathrin structures in the presence and absence of hgf compared to randomized control ( > 35 cells per condition from 3 independent experiments ) . ( a ) rpe cells were stimulated with either 5 ng / ml egf or 50 ng / ml hgf for 5 minutes . whole - cell lysates were prepared , resolved by immunoblotting , and probed with anti - phospho - egfr ( y1068 ) , anti - phospho - gab1 ( y627 ) and anti - phospho - akt ( s473 ) antibodies . ( b - c ) rpe cells stably expressing tag - rfp - t fused to clathrin light chain ( rfp - clc ) were stimulated with 50 ng / ml hgf and immunostained for pgab1 . shown in ( b ) are representative micrographs obtained by tirf - m ( scale 5 m , arrowheads indicate pgab1-positive ccps , selected manually ) . images obtained by tirf - m were subjected to automated detection of clathrin structures followed by quantification of pgab1 and rfp - clc in each detected object , as in . shown in ( c ) is the mean pgab1 fluorescence intensity detected within clathrin structures in the presence and absence of hgf compared to randomized control ( > 35 cells per condition from 3 independent experiments ) . to determine if phosphorylated gab1 ( pgab1 ) is enriched in clathrin structures upon hgf stimulation , we performed immunostaining to detect pgab1 in cells stably expressing fluorescently - labeled clathrin and imaged these samples using tirf - m followed by automated detection of ccps and measurement of total pgab1 within these structures ( fig . similarly to what we had observed for egfr signaling , hgf stimulation elicited an increase in pgab1 signal within ccps ( fig . randomizing the position of the pgab1 image relative to that of clathrin ablated the hgf - stimulated increase in pgab1 detected within ccps ; this shows that the overlap of pgab1 and ccps in actual image sets was due to specific enrichment of this signaling protein in ccps and not due to random overlap of these signals ( fig . thus , like we observed upon egf stimulation , hgf - stimulated gab1 phosphorylation is enriched within clathrin structures . to determine if hgf - stimulated gab1-akt signaling requires clathrin , we treated rpe cells with the pharmacological clathrin inhibitor pitstop2 and probed for phosphorylated akt ( pakt ) by immunoblotting . indeed hgf - simulated akt phosphorylation was similarly inhibited by pitstop2 treatment as was seen in the egf - stimulated condition ( fig . 2 ) . we previously complemented the inhibition of clathrin by pitstop2 using clathrin sirna gene silencing and knocksideways silencing , confirming a requirement for clathrin in egf - stimulated akt phosphorylation . we also previously showed that pitstop2 treatment was without effect on egf - stimulated akt phosphorylation in cells expressing erbb2 , demonstrating that pitstop2 is not directly inhibiting akt phosphorylation . these observations strengthen the interpretation that pitstop2 inhibits akt phosphorylation by perturbation of clathrin instead of through off - target effects . hence , our results indicate that clathrin is similarly required for hgf - stimulated akt phosphorylation as was seen for activation of this signaling pathway by egfr . rpe cells were treated with 10 m pitstop2 or vehicle control ( 0.1% dmso ) for 30 min . following drug treatment , cells were stimulated with either 5 ng / ml egf or 50 ng / ml hgf for 5 minutes in the continued presence or absence of the inhibitor , or left unstimulated ( basal ) . whole - cell lysates were prepared , resolved by immunoblotting , and probed with anti - phospho - akt ( ps473 ) anti - total - akt or anti - actin antibodies . shown in the left panel are representative immunoblots , and in the right panel the mean se of the pakt values in each condition ( n = 4 , * , p < 0.05 ) . rpe cells were treated with 10 m pitstop2 or vehicle control ( 0.1% dmso ) for 30 min . following drug treatment , cells were stimulated with either 5 ng / ml egf or 50 ng / ml hgf for 5 minutes in the continued presence or absence of the inhibitor , or left unstimulated ( basal ) . whole - cell lysates were prepared , resolved by immunoblotting , and probed with anti - phospho - akt ( ps473 ) anti - total - akt or anti - actin antibodies . shown in the left panel are representative immunoblots , and in the right panel the mean se of the pakt values in each condition ( n = 4 , * , p < 0.05 ) . the similar requirement for clathrin for egf- and hgf - stimulated akt phosphorylation , as well as the enrichment of pgab1 within ccps upon stimulation with either hormone suggests that clathrin may play a similar role in signaling by each of these receptors ( fig . notably , this function of clathrin is not required for all rtks , as clathrin is dispensable for activation of akt upon egf stimulation in cells expressing erbb2 and thus signaling from egfr - erbb2 heterodimers ( fig . nonetheless , we have shown that clathrin controls signaling by a number of rtks , demonstrating that this function of clathrin in controlling signaling at the cell surface is broader than the regulation of egfr . we propose that clathrin may function as a signal scaffold , forming a clathrin signaling microdomain enriched in specific signals . thus , recruitment of rtks to these clathrin signaling microdomains places them in close proximity to required signal regulators ; alternatively , clathrin signaling microdomains may function to exclude specific negative regulators such as phosphatases . figure 3.specific receptor tyrosine kinases require clathrin for activation of gab1-akt signaling upon ligand binding . shown is a diagram depicting egfr homodimers and met as rtks that require plasma membrane clathrin signaling microdomains for the phosphorylation of gab1 leading to activation of phosphatidylinositol-3-kinase ( pi3k)-akt signaling . in contrast , egfr - erbb2 heterodimers do not require clathrin signaling microdomains for activation of gab1-pi3k - akt signaling . shown is a diagram depicting egfr homodimers and met as rtks that require plasma membrane clathrin signaling microdomains for the phosphorylation of gab1 leading to activation of phosphatidylinositol-3-kinase ( pi3k)-akt signaling . in contrast , egfr - erbb2 heterodimers do not require clathrin signaling microdomains for activation of gab1-pi3k - akt signaling . we observed quantitative enrichment of pgab1 within ccps ; however , pgab1 signal was also observed outside of ccps in tirf - m images in hgf - stimulated cells ( fig . 1 ) , as we observed for egf - stimulated cells this may result from movement of pgab1 to other parts of the plasma membrane subsequent to phosphorylation within ccps , perhaps as a result of interaction of the ph domain of gab1 with phosphatidylinositol-3,4,5-trisphosphate . it should also be noted that both egfr and met are recruited to structures other than clathrin under some circumstances , such as actin - dependent dorsal ruffles and invadosomes . whether these receptor signaling modes also require plasma membrane clathrin signaling microdomains or whether these are clathrin - independent signaling profiles is an important question that remains to be answered . in conclusion , we find that met signaling requires clathrin and leads to enrichment of certain signaling intermediates within ccps in a manner similar to that of egfr signaling . this suggests that the role of clathrin to form signaling microdomains at the plasma membrane may not be unique for egfr but also functions in this manner for other rtks such as met . funding for this research was provided by an operating grant from the canadian institutes of health research to c.n.a .

abstractreceptor tyrosine kinases , such as the epidermal growth factor ( egf ) receptor ( egfr ) and met lead to activation of intracellular signals including akt , a critical regulator of cell survival , metabolism and proliferation . upon binding their respective ligands , each of these receptors is recruited into clathrin coated pits ( ccps ) eventually leading to endocytosis . we have recently shown that phosphorylation of gab1 and akt following egfr activation requires clathrin , but does not require receptor endocytosis . we examined whether clathrin regulates akt signaling downstream of met , as it does for egfr signaling . stimulation with the met ligand hepatocyte growth factor ( hgf ) leads to enrichment of phosphorylated gab1 ( pgab1 ) within ccps in arpe-19 cells . perturbation of clathrin using the inhibitor pitstop2 decreases hgf - stimulated akt phosphorylation . these results indicate that clathrin may regulate met signaling leading to akt phosphorylation similarly as it does for egfr signaling .

parkinson 's disease ( pd ) is one of the most common neuro - degenerative disorders characterized by tremor , bradykinesia , rigidity and postural instability as well as several nonmotor features including dementia and depression . the exact pathophysiology of the disease is largely unknown though oxidative stress and mitochondrial dysfunction are generally believed to play a critical role . in fact , several epidemiologic studies have demonstrated an increased risk of dementia , another neuro - degenerative disorder , among patients with chronic autoimmune inflammatory diseases . psoriasis is a common immune - mediated skin disorder with an estimated prevalence of 24% in the adult population . patients with psoriasis are well - known to have a high prevalence of comorbidities , especially metabolic syndrome and cardiovascular diseases . chronic inflammation is believed to play a pivotal role for this increased risk as several studies have illustrated the unfavorable effect of oxidative stress and inflammatory cytokines on endothelial function , resulting in premature atherosclerosis . in light of chronic inflammation thus , we conducted a systematic review and meta - analysis of observational studies to investigate if the risk of pd is increased in patients with psoriasis compared with nonpsoriasis participants . two investigators ( patompong ungprasert and narat srivali ) independently searched published articles indexed in medline and embase database from inception to october 2015 using the search terms that comprised the terms for psoriasis and pd described in supplementary data . the eligibility criteria included the following : ( 1 ) cohort study or case control study comparing the risk of pd between subjects with and without psoriasis , ( 2 ) relative risk ( rr ) , hazard ratio , incidence ratio ( ir ) , odds ratio ( or ) or standardized ir with 95% confidence intervals ( cis ) or sufficient raw data to calculate these ratios were provided . study eligibility was independently determined by the two aforementioned investigators . the senior investigator ( wonngarm kittanamongkolchai ) served as the deciding vote for any different decisions . this scale assessed each study in three areas including ( 1 ) the recruitment of the subjects ( 2 ) the comparability between the two groups and ( 3 ) the ascertainment of the outcomes of interest and exposures of interest for cohort study and case control study , respectively . a standardized data collection form was used to extract the following information : first author 's last name , title of the study , year of publication , year of study , country where the study was conducted , study population , method used to identify cases and controls , number of subjects , average duration of follow - up ( for cohort study ) , demographic data of subjects , confounders that were adjusted and adjusted effect estimates with 95% ci . any discrepancies were resolved by referring back to the original articles . if the necessary data were not provided in the article , the corresponding author of the article would be contacted . data analysis was performed using review manager 5.3 software from the cochrane collaboration ( london , united kingdom ) . we pooled the point estimates from each study using the generic inverse variance method of dersimonian and laird . as the outcome of interest in this study was relatively uncommon , we used or of case control study as an estimate for rr to combine this data with rr of cohort study to increase the power and precision of our pooled estimates . we used a random - effect model rather than a fixed - effect model because of the high likelihood of between - study variance due to different populations and study designs . cochran 's q test , which is complemented with the i statistic , was used to assess statistical heterogeneity . this i statistic quantifies the proportion of total variation across studies that is due to true heterogeneity rather than chance . a value of i of 025% represents insignificant heterogeneity , more than 25% but 50% low heterogeneity , more than 50% but 75% moderate heterogeneity , and more than 75% high heterogeneity . funnel plot and egger 's linear regression were used for evaluation of publication bias using comprehensive meta - analysis version 2.2 software ( englewood , new jersey , usa ) . two investigators ( patompong ungprasert and narat srivali ) independently searched published articles indexed in medline and embase database from inception to october 2015 using the search terms that comprised the terms for psoriasis and pd described in supplementary data . the eligibility criteria included the following : ( 1 ) cohort study or case control study comparing the risk of pd between subjects with and without psoriasis , ( 2 ) relative risk ( rr ) , hazard ratio , incidence ratio ( ir ) , odds ratio ( or ) or standardized ir with 95% confidence intervals ( cis ) or sufficient raw data to calculate these ratios were provided . study eligibility was independently determined by the two aforementioned investigators . the senior investigator ( wonngarm kittanamongkolchai ) served as the deciding vote for any different decisions . this scale assessed each study in three areas including ( 1 ) the recruitment of the subjects ( 2 ) the comparability between the two groups and ( 3 ) the ascertainment of the outcomes of interest and exposures of interest for cohort study and case control study , respectively . a standardized data collection form was used to extract the following information : first author 's last name , title of the study , year of publication , year of study , country where the study was conducted , study population , method used to identify cases and controls , number of subjects , average duration of follow - up ( for cohort study ) , demographic data of subjects , confounders that were adjusted and adjusted effect estimates with 95% ci . any discrepancies were resolved by referring back to the original articles . if the necessary data were not provided in the article , the corresponding author of the article would be contacted . data analysis was performed using review manager 5.3 software from the cochrane collaboration ( london , united kingdom ) . we pooled the point estimates from each study using the generic inverse variance method of dersimonian and laird . as the outcome of interest in this study was relatively uncommon , we used or of case control study as an estimate for rr to combine this data with rr of cohort study to increase the power and precision of our pooled estimates . we used a random - effect model rather than a fixed - effect model because of the high likelihood of between - study variance due to different populations and study designs . cochran 's q test , which is complemented with the i statistic , was used to assess statistical heterogeneity . this i statistic quantifies the proportion of total variation across studies that is due to true heterogeneity rather than chance . a value of i of 025% represents insignificant heterogeneity , more than 25% but 50% low heterogeneity , more than 50% but 75% moderate heterogeneity , and more than 75% high heterogeneity . funnel plot and egger 's linear regression were used for evaluation of publication bias using comprehensive meta - analysis version 2.2 software ( englewood , new jersey , usa ) . two investigators ( patompong ungprasert and narat srivali ) independently searched published articles indexed in medline and embase database from inception to october 2015 using the search terms that comprised the terms for psoriasis and pd described in supplementary data . the eligibility criteria included the following : ( 1 ) cohort study or case control study comparing the risk of pd between subjects with and without psoriasis , ( 2 ) relative risk ( rr ) , hazard ratio , incidence ratio ( ir ) , odds ratio ( or ) or standardized ir with 95% confidence intervals ( cis ) or sufficient raw data to calculate these ratios were provided . study eligibility was independently determined by the two aforementioned investigators . the senior investigator ( wonngarm kittanamongkolchai ) served as the deciding vote for any different decisions . this scale assessed each study in three areas including ( 1 ) the recruitment of the subjects ( 2 ) the comparability between the two groups and ( 3 ) the ascertainment of the outcomes of interest and exposures of interest for cohort study and case control study , respectively . a standardized data collection form was used to extract the following information : first author 's last name , title of the study , year of publication , year of study , country where the study was conducted , study population , method used to identify cases and controls , number of subjects , average duration of follow - up ( for cohort study ) , demographic data of subjects , confounders that were adjusted and adjusted effect estimates with 95% ci . any discrepancies were resolved by referring back to the original articles . if the necessary data were not provided in the article , the corresponding author of the article would be contacted . data analysis was performed using review manager 5.3 software from the cochrane collaboration ( london , united kingdom ) . we pooled the point estimates from each study using the generic inverse variance method of dersimonian and laird . as the outcome of interest in this study was relatively uncommon , we used or of case control study as an estimate for rr to combine this data with rr of cohort study to increase the power and precision of our pooled estimates . we used a random - effect model rather than a fixed - effect model because of the high likelihood of between - study variance due to different populations and study designs . cochran 's q test , which is complemented with the i statistic , was used to assess statistical heterogeneity . this i statistic quantifies the proportion of total variation across studies that is due to true heterogeneity rather than chance . a value of i of 025% represents insignificant heterogeneity , more than 25% but 50% low heterogeneity , more than 50% but 75% moderate heterogeneity , and more than 75% high heterogeneity . funnel plot and egger 's linear regression were used for evaluation of publication bias using comprehensive meta - analysis version 2.2 software ( englewood , new jersey , usa ) . our search strategy yielded 202 potentially relevant articles ( 183 articles from embase and 19 articles from medline ) . one hundred and sixty four articles were excluded at this stage since they were case reports , review articles , correspondences or interventional studies , leaving 20 articles for full - length article review . sixteen of these articles were excluded after the full - length review as they did not report the exposure or outcome of interest , leaving three retrospective cohort studies and 1 case figure 1 outlines the search and literature review process . the clinical characteristics and quality assessment of the included studies the inter - rater agreement for the quality assessment was high with the kappa statistics of 0.64 . search methodology and literature review process clinical characteristics and quality assessment of the included studies all studies did reveal an increased risk of pd among patients with psoriasis even though the increased risk did not always reach statistical significance . the pooled analysis of all studies demonstrated a significantly increased risk of pd in patients with psoriasis with the pooled risk ratio of 1.38 ( 95% ci , 1.151.66 ) . forest plot of this meta - analysis to confirm the robustness of our results , we performed jackknife sensitivity analysis by excluding one study at a time from the pooled analysis . the pooled risk ratios from this sensitivity analysis changed slightly , ranging from 1.25 to 1.47 with the lower bounds of the corresponding cis remained above 1.0 . furthermore , there was no evidence of publication bias detected by egger 's regression test ( p = 0.72 ) . furthermore , there was no evidence of publication bias detected by egger 's regression test ( p = 0.72 ) . furthermore , there was no evidence of publication bias detected by egger 's regression test ( p = 0.72 ) . this meta - analysis is the first study that comprehensively combined all available data on the risk of pd among patients with psoriasis . we were able to demonstrate a significantly elevated risk with 38% excess risk compared with subjects without psoriasis . why patients with psoriasis have a higher risk of pd remains unclear and therefore , further studies are required . first , this association might be just the result of confounding by obesity as obesity is associated with both psoriasis and pd . high body mass index has been shown to increase the risk of pd in a dose - dependent manner in a recent epidemiologic study while the relationship between obesity and psoriasis has been recognized for over a decade . a systematic review and meta - analysis of observational studies published between 1980 and 2012 showed the pooled or for obesity for patients with psoriasis compared with subjects without psoriasis of 1.66 . moreover , the odds for obesity were more prominent in patients with severe psoriasis than those with mild psoriasis . it is hypothesized that the cytokines and bioactive products such as tumor necrosis factor - alpha , interleukin-6 , leptin and resistin produced by adipose tissue could predispose patients to psoriasis . the second explanation is related to chronic inflammation that is seen in patients with psoriasis . as previously mentioned , chronic peripheral inflammation could have an essential role in the development of neuro - degenerative diseases . it has been demonstrated that peripheral inflammation can induce microglial activation , resulting in liberation of free radical / reactive oxygen species and , ultimately , neuronal damages . the microglial - mediated neurotoxicity is of particular importance for the development of pd as substantia nigra pars compacta , the principal pathological region of pd , has the highest density of microglial cells compared with other parts of the brain . in fact , animal models and postmortem studies of patients with pd consistently demonstrated robust microglial activation in the substantia nigra . more interestingly , frequent use of nonsteroidal anti - inflammatory drugs , particularly ibuprofen , is associated with a lower risk of developing pd which could serve as an indirect evidence to support the role of chronic inflammation in the pathogenesis of this disease . the major strength of this study is the advantage of systemic review and meta - analysis that allows a comprehensive estimation of the risk . the major limitation is related to the methodology of the primary studies as those studies were conducted using coding - based medical registry which would raise a concern over misclassification and coding incompleteness . moreover , because of the observational nature of the primary studies , this meta - analysis could only demonstrate an association but could not establish causality . our meta - analysis demonstrated a significantly increased risk of pd among patients with psoriasis . patients with psoriasis are at a higher risk of parkinson 's disease with 38% excess risk compared with subjects without psoriasis . patients with psoriasis are at a higher risk of parkinson 's disease with 38% excess risk compared with subjects without psoriasis . patients with psoriasis are at a higher risk of parkinson 's disease with 38% excess risk compared with subjects without psoriasis .

background : patients with psoriasis might be at a higher risk of developing parkinson 's disease ( pd ) as a result of the detrimental effect of chronic inflammation on the neuronal tissue . this meta - analysis aimed to investigate this risk by comprehensively reviewing all available data.methods:we conducted a systematic review and meta - analysis of cohort and case control studies that reported relative risk , hazard ratio , odds ratio , or standardized incidence ratio comparing the risk of pd in patients with psoriasis versus subjects without psoriasis . pooled risk ratio and 95% confidence interval ( ci ) were calculated using random - effect , generic inverse variance methods of dersimonian and laird.results:three retrospective studies and one case control study met our eligibility criteria and were included in this meta - analysis . the pooled risk ratio of pd in patients with psoriasis versus participants without psoriasis was 1.38 ( 95% ci , 1.151.66 ) . the statistical heterogeneity was low with an i2 of 35%.conclusions : our meta - analysis demonstrated a statistically significant increased risk of pd among patients with psoriasis .

the palatal groove is defined as a developmental groove in root , that when present is usually found on the palatal aspect of the maxillary incisor teeth . palato - radicular groove is a rare developmental anomaly with prevalence rate of 2.8 - 8.5% , mostly present on the lingual surface of the maxillary lateral incisor . these grooves typically begin in the central fossa area of the incisors , extend over the cingulum and continue apically down the root surface . some clinicians believe that the radicular groove represents the mildest form of dens invaginatus and therefore , the pathogenic mechanism is relatively common . this means that there is minimal infolding of the enamel organ and epithelial sheath of heartwig during odontogenesis . deep radicular groove can pre - dispose to pulp necrosis and establishment of combined periodontal and endodontic lesions . this can result in ineffective endodontic treatment attempts , because the lesion can be exclusively periodontal , or if not , as in combined case , the treatment can be of little use without the removal of the local pre - disposing factor and treatment of the resulting periodontal pathosis . considering , the great clinical importance of the palato - radicular groove and rare occurrence , the purpose of this paper is to report a case of deep palato - radicular groove on a maxillary lateral incisor with associated periodontal and pulpal involvement . a multidisciplinary treatment approach was carried out , which resulted in periodontal healing and resolution of periradicular radiolucency . an 18-year - old female patient reported to the department of conservative dentistry and endodontics with a chief complaint of intermittent pain and discharge in the upper front tooth region since 6 months . the patient medical and family histories were non - contributory , and the results of the extra oral examination were unremarkable . examination on palatal aspect revealed a localized pocket of 8 mm depth with pus discharge from the pocket . on careful examination , a deep palatogingival groove was observed , which was extending deep into the apical region [ figure 1 ] . revealing palatogingival groove on lateral incisor the tooth did not respond to vitality testing using electronic pulp tester ( parkell electronics division , new york , usa ) . radiographic examination revealed a well - defined radiolucency in relation to right lateral incisor extending until the apical region of the right central incisor [ figure 2 ] . pre - operative radiograph based on the history , clinical and radiographic examination the lesion was provisionally diagnosed as pulp necrosis , suppurative periradicular periodontitis and moderate localized periodontitis secondary to the palatoradicular groove . based on the history , clinical and radiographic examination the lesion was provisionally diagnosed as pulp necrosis , suppurative periradicular periodontitis and moderate localized periodontitis secondary to the palatoradicular groove . a collaborative management was planned using a combination of endodontic therapy , odontoplasty , and periodontal regenerative procedure . root canal treatment was initiated on right lateral and central incisors since the lesion was extending to the apical region of the right central incisor . working length was determined by radiographic as well as electronic methods ( root zx j. morita co. , kyoto , japan ) . ca(oh)2 dressing was given for a week . in the following visit after removing ca(oh)2 , master cone was selected and obturation was completed by gutta - percha and ah-26 sealer ( dentsply maillefer , bellaigues , switzerland ) using cold lateral condensation technique [ figure 3 ] . the surgical area was made aseptic and local anesthesia was administered . since , the discharge and the bony defect was on the palatal side , sulcular incisions were placed on palatal side [ figure 4 ] and a full thickness mucoperiosteal flap was raised on palatal aspect to access the palatogingival groove . on reflection , apical curettage and root planning was carried out [ figure 5 ] and the groove was restored with glass - ionomer cement [ figure 6 ] ( fuji ii ; gc corporation , tokyo , japan ) . a resorbable membrane ( guided tissue regeneration ) groove preparation and restoration the flap was repositioned and stabilized with sutures [ figure 7 ] . patient was recalled at an interval of 1 , 3 [ figure 8 ] and 6 [ figure 9 ] months for the follow - up . three months follow - up six month follow - up revealed absence of signs and symptoms and periodontal pocket [ figure 10 ] . the surgical area was made aseptic and local anesthesia was administered . since , the discharge and the bony defect was on the palatal side , sulcular incisions were placed on palatal side [ figure 4 ] and a full thickness mucoperiosteal flap was raised on palatal aspect to access the palatogingival groove . on reflection , apical curettage and root planning was carried out [ figure 5 ] and the groove was restored with glass - ionomer cement [ figure 6 ] ( fuji ii ; gc corporation , tokyo , japan ) . a resorbable membrane ( guided tissue regeneration ) groove preparation and restoration the flap was repositioned and stabilized with sutures [ figure 7 ] . patient was recalled at an interval of 1 , 3 [ figure 8 ] and 6 [ figure 9 ] months for the follow - up . three months follow - up six month follow - up revealed absence of signs and symptoms and periodontal pocket [ figure 10 ] . historic perspective : oehlers in 1958 for the first time described such condition as radicular invagination in an upper lateral incisor in a chinese female . speculated that the palatal groove represents an in folding of the enamel organ and hertwig 's epithelial root sheath and parallels the pathogenesis of dens invaginatus . palatoradicular groove could manifest either as : periodontal diseasea true endodontic diseaseit may appear as a combined endodontic periodontal problem . a true endodontic disease it may appear as a combined endodontic the radicular groove is an ideal plaque trap for promoting periodontal break - down and pulp necrosis . reason for the occurrence of combined lesions is existence of communication between the pulp chamber and the periodontium . friedman and goultschin have suggested that pulpal necrosis followed by apical periodontitis is often the earliest manifestation of palato radicular groove . surgical removal of granulation tissue and irritantsgingivectomy and apically positioned flapsurgical exposure and flattening of the groove by grinding , with or without application of guided tissue regeneration techniquesplacing amalgam restoration in the grooveorthodontic extrusion of the tooth . surgical removal of granulation tissue and irritants gingivectomy and apically positioned flap surgical exposure and flattening of the groove by grinding , with or without application of guided tissue regeneration techniques placing amalgam restoration in the groove orthodontic extrusion of the tooth . the prognosis of a tooth with a palatal groove depends mainly on location of the groove , severity of the periodontal problem , accessibility of the defect and the type of groove ( shallow or deep , short or long ) . to enhance periodontal attachment on the denuded root dentine , guided tissue regeneration technique was used to regenerate the lost periodontal structures through differential tissue development . techniques used are classified as : barriers and enamel matrix derived proteins . in this case , a bioresorbable collagen based barrier was used , which showed satisfactory result by reducing the pocket depth to 2 - 3 mm . the rate of healing of the surgical site was good and the radiographic bone regeneration was rapid and impressive without any signs of external root resorption . this case report presented the successful treatment of a pulpal - periodontal combined lesion on a maxillary lateral incisor associated with a palato radicular groove . the key to achieving long - term favorable results in this particular type of developmental anomaly is accurate diagnosis and elimination of inflammatory irritants and contributory factors . clinician 's awareness of existence of such a peculiarity may help to avoid misdiagnosis and improper treatment of these patients .

this study is to report the rare localization of a radicular groove on the palatal aspect of the maxillary lateral incisor and to discuss the pathology and management of the concomitant endo - periodontal defect . unilateral palato - radicular groove was located on the maxillary right lateral incisor of an 18-year - old female patient . the groove was associated with deep local periodontal pocket resulting in pulp necrosis and the formation of a large periapical lesion . a collaborative management was carried out using a combination of endodontic therapy , surgical enucleation , odontoplasty , and periodontal regenerative procedure resulting the successful healing of the periapical lesion .

use of radioactive pharmaceuticals for diagnostic nuclear medicine procedures is one of the main sources of radiation exposure resulting from ionizing radiation to populations . annual assessment of patients absorbed dose can give a quantitative estimate of per capita population absorbed dose . risk of exposure to ionizing radiations is expressed by factors such as shortening of life span and induced malignancies . the international commission on radiological protection ( icrp ) provides the effective doses , and hence the radiation risk to patients caused by various radiopharmaceuticals and nuclear medicine procedures . although , the annual number of nuclear medicine procedures and their collective dose are way below the corresponding values for medical x - ray examinations ( 2% and 6% , respectively ) , the mean dose per procedure is larger for nuclear medicine ( 4.6 msv ) than for medical x - rays ( 1.2 msv ) . with respect to the rapid growth in number of nuclear medicine procedures performed in iran , and considering the fact that previous survey in tehran was performed a decade ago , in 2003 , we performed this study to give an updated estimate on the statistics and trends of nuclear medicine procedures as part of a residency thesis . the data of the annual diagnostic nuclear medicine procedures were obtained for all four active nuclear medicine centers affiliated to shahid beheshti university of medical sciences , tehran , iran , during 2009 and 2010 . the data comprised the type and frequency of examinations , type of radiopharmaceuticals used , range of administered activity for each examination , and age distribution of the patients . as the amount of dose used in different nuclear centers varied , the mean administered activity for each examination was used in the five age brackets of < 1 year , 1 - 5 years , 6 - 10 years , 11 - 15 years , and > 16 years . the first column in table 1 shows the diagnostic nuclear medicine procedures and corresponding radiopharmaceuticals used . to calculate the effective dose and collective effective dose , the authors used the effective dose per unit administered activity given in icrp publication no . 53 ( 1988 ) and its addenda , icrp publication no . 80 ( 1999 ) , and icrp publication no . the effective dose per examination ( fourth column ) was obtained by multiplying the mean administered activity ( second column ) by the corresponding effective dose per unit administered activities for each examination ( third column ) . the annual number of each examination in the five age groups is listed in the fifth column of table 1 . the collective effective dose for each examination is shown in the last column , which was calculated by multiplying the effective dose per examination by the corresponding number of examinations in each age bracket . the effective dose per procedure was obtained by summing the effective doses used for all radiopharmaceuticals , and the collective effective dose was obtained . mean administered activities , effective dose per unit administered activities , effective dose per examination , annual number of examinations , and collective effective doses for diagnostic nuclear medicine examinations in 2010 frequency and percentage of nuclear medicine examinations in 2009 - 2010 the annual activities of the nuclear medicine centers in 2010 is provided in table 1 , which comprises the examination type , radiopharmaceutical used , mean administered activities ( mbq ) , effective dose per unit administered activity ( msv / mbq ) , and the effective dose per examination ( msv ) for each examination in the five age groups . some miscellaneous procedures , such as red blood cell scan , indirect radionuclide cystography , and dacryoscintigraphy using tc pertechnetate , are provided as the annual total number of examinations and corresponding collective effective doses are calculated and provided in the last row of table 1 . figure 1 is showing the percentage of the total number of examinations and percentage collective effective dose . during these 2 years , results reveal a 6.14% and 3.63% increase in the annual number of examinations and collective effective dose , respectively [ figure 1 and table 2 ] . the contribution of nuclear medicine procedures from total annual number of examinations and collective effective dose ( average of 2009 , 2010 ) percentage share of radionuclides from total number of procedures and collective effective dose ( average of 2009 , 2010 ) the most frequently performed procedures were bone ( 30.16% ) , cardiac ( 28.96% ) , renal ( 17.97% ) , and thyroid scintigraphies ( 7.93% ) , which contributed to 24.01% , 36.76% , 5.82% , and 2.08% of the average collective and effective dose during these 2 years . figure 2 shows the relative contribution of radionuclides to collective effective dose and total number of procedures as averaged over these 2 years . the most frequently used radiopharmaceutical was tc , which contributed to 98.20% of a total number of examinations and 89.89% of collective effective dose . although i accounted for only 0.34% of procedures , it contributed to 5.68% of the collective effective dose . comprehensive studies on diagnostic nuclear medicine procedures and their contribution to the population absorbed doses have been reported by many investigators worldwide . however , despite the rapid growth of these procedures in iran , there is a profound lack of statistics and the previous survey in tehran was conducted a decade ago . compared to the previous study by the same group in the same centers , striking differences are noted in trends of diagnostic nuclear medicine procedures . thyroid scintigraphies with i which accounted for 2.35% of total number of procedures and resulted in 16.59% of collective effective dose in 1999 and 2000 contributed to only 0.03% of the number of examinations and 0.07% of the effective dose in 2009 and 2010 . this is due to substitution of i with tc for thyroid examinations , which has led to less radiation absorbed dose from i to the patients . on the other hand , there is tremendous growth in the number of cardiac ( 55.7-fold ) and bone ( 3.60-fold ) scans with increases from 0.52% and 8.4% to 28.97% and 30.25% during the same period . the huge increase in the number of cardiac examinations is mainly due to the introduction of single - photon emission computed tomography technique . the changes in bone scan frequency could be the result of an increase in the prevalence of malignancies and lack of other screening techniques such as positron emission tomography ( pet ) scanners in the country . the overall number of thyroid examinations has decreased from higher than 80% in 1989 to 7.91% in 2010 . this could be the result of lower prevalence of goiter due to the implementation of iodine enrichment diet programs , lower referral of patients by specialists , and the introduction of fine needle aspiration and advanced ultrasonography techniques . the latter two reasons are also responsible for the 78-fold decrease in liver / spleen tc - sulfur colloid examinations from 7% in 1989 to 0.09 in 2010 . together , bone , cardiac , and renal scans accounted for 70.04% of examinations and 66.59% of collective effective dose . based on the results of our study , striking changes are noted on the trends of diagnostic nuclear medicine procedures in iran . this field is still evolving in the country , and this trend will change further with the introduction of pet scanners .

purpose : use of radiopharmaceuticals for diagnostic nuclear medicine procedures is one of the main sources of radiation exposure . we performed this study with respect to the rapid growth in nuclear medicine in iran and lack of updated statistics.materials and methods : the data were obtained for all active nuclear medicine centers affiliated to shahid beheshti university of medical sciences during 2009 and 2010.results:the most frequently performed procedures were bone ( 30.16% ) , cardiac ( 28.96% ) , renal ( 17.97% ) , and thyroid ( 7.93% ) scans . there was a significant decrease in the number of thyroid scintigraphies with 131i and 99mtc - sulfur colloid liver / spleen scans and tremendous increase in the frequencies of cardiac and bone scintigraphies compared to one decade ago.conclusion:compared to previous studies , there were striking changes in trends of diagnostic nuclear medicine procedures in tehran . this field is still evolving in the country , and this trend will further change with the introduction of positron emission tomography scanners in future .

intestinal pseudomelanosis is a condition characterized by dark pigmentation of the intestinal mucosa , such as colon , small bowel , and stomach . among intestinal pseudomelanosis , melanosis coli is the most common and a well known condition , which occurs with the laxative use , especially anthraquinone containing laxatives . the dark brown pigmentation of melanosis coli is actually lipofuscin in macrophages and not melanin ( 1 ) . interestingly , extracolonic pseudomelanosis has also been rarely reported in the literature ( 2 , 3 ) and several etiologies have been suggested for the development of extracolonic pseudomelanosis . most commonly reported location of extracolonic pseudomelanosis is the duodenum , although it can also be found on the mucosa of the stomach , jejum or ileum ( 2 - 4 ) . in addition , few reports on pseudomelanosis ilei have attributed its cause to chronic oral iron therapy , but the association is still unclear ( 2 , 5 ) . few reports showed that there are considerable association with end stage renal disease and hypertension ( 3 ) . herein , we describe 6 cases of the small bowel pseudomelanosis with possible etiology being chronic iron intake . the cases included one man and 5 women , with a mean age of 62 yr ( median 69.5 , range 34 - 73 ) . summary on endoscopic findings , associated medical conditions , and concurrent medications of the subjects are shown in table 1 . five ( 83% ) patients had chronic kidney disease , 2 of whom were undergoing peritoneal dialysis , 5 ( 83% ) patients had hypertension , and 3 ( 50% ) patients had diabetes mellitus . various classes of antihypertensive medication including beta blockers , thiazides , angiotensin receptor blockers , and calcium channel blockers were being taken by the hypertensive patients . other common medications included statin ( hmg - coa reductase inhibitor ) and potassium binder . all patients had been taking iron sulfate for an average of 32.8 months ( 13 - 66 months ) . four patients underwent both upper and lower endoscopy , and the remaining two underwent upper endoscopy or colonoscopy . numerous brown spots were observed on the mucosa of terminal ileum in 3 patients , duodenum in 1 patient , jejunum in 1 patient , and both duodenum and terminal ileum in 1 patient ( fig . the patient had undergone subtotal gastrectomy with billroth ii reconstruction due to early gastric cancer . biopsies were taken during endoscopy and specimens were stained with hematoxylin and eosin and also stained for iron . histology revealed pigment deposition within macrophages of the lamina propria and a positive prussian blue stain indicated hemosiderin deposition ( fig . the cases included one man and 5 women , with a mean age of 62 yr ( median 69.5 , range 34 - 73 ) . summary on endoscopic findings , associated medical conditions , and concurrent medications of the subjects are shown in table 1 . five ( 83% ) patients had chronic kidney disease , 2 of whom were undergoing peritoneal dialysis , 5 ( 83% ) patients had hypertension , and 3 ( 50% ) patients had diabetes mellitus . various classes of antihypertensive medication including beta blockers , thiazides , angiotensin receptor blockers , and calcium channel blockers were being taken by the hypertensive patients . other common medications included statin ( hmg - coa reductase inhibitor ) and potassium binder . all patients had been taking iron sulfate for an average of 32.8 months ( 13 - 66 months ) . four patients underwent both upper and lower endoscopy , and the remaining two underwent upper endoscopy or colonoscopy . numerous brown spots were observed on the mucosa of terminal ileum in 3 patients , duodenum in 1 patient , jejunum in 1 patient , and both duodenum and terminal ileum in 1 patient ( fig . the patient had undergone subtotal gastrectomy with billroth ii reconstruction due to early gastric cancer . biopsies were taken during endoscopy and specimens were stained with hematoxylin and eosin and also stained for iron . histology revealed pigment deposition within macrophages of the lamina propria and a positive prussian blue stain indicated hemosiderin deposition ( fig . small bowel pseudomelanosis is a finding that is rarely encountered during endoscopy and its etiology is still not fully understood ( 3 , 5 ) . whereas melanosis coli is relatively common condition occurring in more than 70% of persons who use anthraquinone containing laxatives , pseudomelanosis of although examination of the small bowel has been facilitated with the introduction of capsule endoscopy ( ce ) or double balloon endoscopy ( dbe ) , pseudomelanosis of the small bowel is still a rare finding . a portuguese center with experience of more than 600 ce and 100 dbe reported only two cases of small bowel pseudomelanosis ( 2 ) ; one case showed pigmentation in the entire small bowel and the other case in the ileum ( 6 ) . in korea , pseudomelanosis duodeni or ilei has been reported sporadically in 7 cases in patients taking oral iron ( 7 - 9 ) . interestingly , 6 cases of pseudomelanosis ilei associated with charcoal ingestion have been reported only in korea ( 10 - 14 ) . in our case series , all patients had been taking oral iron at the time of upper or lower endoscopy . of the 6 cases , 3 had undergone upper and lower endoscopy before initiating iron therapy , which revealed normal mucosa without pigmentation on duodenum and terminal ileum . therefore , the cause of pseudomelanosis of small bowel in these patients could be attributed to oral iron therapy . apart from oral iron therapy , other possible causes of small bowel pseudomelanosis include chronic kidney disease , hypertension , and certain medications like antihypertensive drugs ( 3 , 15 ) . it has been hypothesized that coupling of absorbed iron with a sulfur moiety from antihypertensive medications could be the underlying mechanism for pigment accumulation in macrophages of small bowel mucosa ( 2 ) . fernando ( 16 ) demonstrated that absorbed iron coupled with sulfur in pseudomelanosis duodeni , using electron probe x - ray analysis of epithelial cells and macrophages at different levels of the intestine . he proposed that this coupling results in impaired iron transport that leads to the accumulation of ferrous sulfates . as for the source of sulfur , antihypertensive medications such as furosemide and hydrochlorothiazide which contain sulfur moiety have been implicated ( 17 , 18 ) . typically , the biopsy specimen shows dark brown to black granular deposits in the lamina propria of the tips of intestinal villi , and the deposits often contain iron as hemosiderin in ferric or ferrous form ( 19 ) . a recent retrospective study showed that pigment - laden macrophages were sometimes observed even when it was not apparent during endoscopy ( 3 ) . in another case of pseudomelanosis in which there were pigmentations from stomach to jejunum , review of previous histopathology slides from antral ulcer two years earlier revealed granular pigment in the lamina propria with positive stain for iron ; however , pigmentation was not evident endoscopically at that time ( 20 ) . it could be postulated that duration of iron therapy is associated with the development of pseudomelanosis in the small bowel and determines its extent , but this association could not be validated possibly due to the small sample size . although the causes of pseudomelanosis of the small bowel and its underlying mechanism are still unknown , our case series with a relatively large number of patients suggests that there could be a likely association between pseudomelanosis of the small bowel and chronic oral iron therapy .

an accumulation of pigment deposits on mucosa , called melanosis or pseudomelanosis , of the small bowel is observed infrequently during endoscopic examination . we describe 6 cases of small bowel pseudomelanosis ; the possible etiology of which was chronic iron intake . we observed numerous brown spots in duodenum , jejunum , and terminal ileum during upper and lower endoscopy . interestingly , all patients have been taking oral iron for several years . histology showed pigment depositions within macrophages of the lamina propria and a positive prussian blue stain indicating hemosiderin deposition . herein , we demonstrate that long term iron therapy may result in pseudomelanosis of small bowel , such as duodenum , jejunum , and ileum .

methods to guide excision of impalpable lesions include hook - wire insertion ( hwl ) , intra - operative ultrasound ( ious ) and radio - guided occult lesion localisation ( roll ) using the injection of tc - labelled colloidal human serum albumin.1 a new technique , roll using i seeds ( rollis ) offers many advantages2 as illustrated in this report . a surveillance f-18 fludeoxyglucose positron emission tomography / computed tomography ( fdg pet / ct ) scan in a 59-year - old female with a history of metastatic melanoma showed intense uptake within a 3 4 mm subcutaneous nodule on the left posterior chest wall ( fig.1a and b ) . ultrasound ( us ) showed an oval - shaped well defined hypoechoic vascular mass ( fig.2 ) . ( a ) and ( b ) whole - body f-18 fludeoxyglucose positron emission tomography / computed tomography ( fdg pet / ct ) scan shows focus of intense uptake in the left posterior chest wall ( arrow ) . ultrasound scan of the chest wall shows the hypoechoic lesion with vascularity . on the morning of surgery an i seed ( 2 mbq ) the surgeon used a hand - held gamma probe , set to detect the energy from the 27 kev photon emitted by the i seed to locate and remove the lesion . successful removal of seed and lesion was confirmed by absent radioactive counts in the wound , high counts within the specimen and visualisation of the lesion and seed on x - ray ( fig.4a ) . following tissue fixation , a further grid specimen radiograph ( fig.4b ) demonstrated lesion and seed co - ordinates for the pathologist . a follow - up f-18 fdg pet / ct scan showed only faint uptake in the surgical bed consistent with post - operative change ( fig.5a and b ) . ultrasound guided seed insertion ( a ) long - axis view showing seed deployment needle ( arrow ) within a hypoechoic posterior chest wall mass corresponding to the lesion seen on the pet - ct study . ( b ) long - axis and ( c ) short - axis views of the lesion taken immediately after seed deployment . ( a ) intra - operative specimen radiograph confirms excision of lesion with seed in situ ( arrow ) . ( b ) x - ray of specimen in a grid following tissue fixation in formalin shows the co - ordinates for the lesion and i seed ( arrow ) . post - operative ( a ) ct and ( b ) f-18 fludeoxyglucose positron emission tomography / computed tomography ( fdg pet / ct ) images taken at the same slice position . the previous focus of intense tracer uptake is no longer seen . there is minimal uptake in the surgical bed consistent with post - operative change ( arrow ) . in parallel with the increasing detection of impalpable breast lesions with screening mammography , the development and increasing use of sophisticated imaging techniques ( such as f-18 fdg pet / ct ) has led to earlier detection of small lesions in other parts of the body , some of which require pre - operative image - guided localisation for excision . various methods of doing this have been described , including the use of hwl of pulmonary nodules , musculoskeletal , retroperitoneal and liver lesions36 and roll to mark recurrent renal cell carcinoma , papillary carcinoma of the thyroid , retroperitoneal sarcoma , lesions of the popliteal fossa and recurrent thigh rhabdomyosarcoma.7 in general , hwl is the most commonly used technique but has been associated with complications including movement of the wire after insertion and wire transection during surgery.8 because the wire extends outside the skin , the localisation procedure must be performed on the day of surgery . this makes the surgical and radiology lists interdependent with delays or cancellations in either department inevitably reducing efficient use of resources . for lesions in difficult locations ( such as in our patient ) the great advantages are that this eliminates the need for a separate pre - operative localisation procedure , does not expose the patient or staff to ionising radiation and gives real - time three - dimensional feedback during surgery . however , to use ious the lesion must be sonographically visible and us equipment and a suitably trained surgeon available . radio - guided techniques such as roll have been effectively used for breast and non - breast lesions.7,9 as with the use of hook - wires , however , the insertion procedure must be performed within 24 h of surgery due to the short half - life of tc ( 6 h ) . the inherently non - radio - opaque nature of tc labelled colloids also means that confirming accuracy of placement of the injection is difficult unless a contrast agent or marker clip is also used.10 i seeds are radiopaque 4.5 0.8 mm titanium cylinders containing approximately 2 mbq of iodine-125 adsorbed onto a silver wire . because they are solid and radiopaque , accuracy of placement experience with rollis to localise impalpable breast lesions has shown that i seeds rarely migrate.11 the seed acts as a point source of radio - activity , giving precise real - time feedback as to the location of the lesion in three dimensions.12 all of this helps to make surgery easier . i has a physical half - life of 60.14 days , which means the seed can be inserted several days ( and in the case of patients undergoing neoadjuvant chemotherapy many months)13 before surgery . this has been shown to improve the utilisation of radiology resources,14 theatre lists,15 and patient convenience.16 the radiation exposure to patient , family and staff from the use of i seeds is minimal17 however the seed is a regulated sealed source of radioactivity , therefore its whereabouts must always be tracked . to minimise the risk of seed loss , good multidisciplinary communication and a seed handling protocol are essential . whilst there are meta - analyses evaluating the use of i seeds to localise breast lesions,2,18 there are only a few reports describing the use of this technique outside the breast . fleming et al.19 used rollis to localise a cluster of in - transit melanoma nodules in the lower leg of a 73-year - old man and grotz et al.20 used it in eight patients ; two with in - transit melanoma metastases . straver et al.21 used seeds to mark malignant axillary nodes prior to neoadjuvant chemotherapy , and jackson et al.22 to localise a pet - positive node in a patient with an unknown primary . the use of i seeds to guide excision of pulmonary nodules has also been trialled.23 in conclusion , this case report provides another example of the successful use of rollis as a relatively simple and accurate method to guide the excision of an impalpable lesion , other than in the management of breast cancer .

cancer screening and surveillance programmes and the use of sophisticated imaging tools such as positron emission tomography - computed tomography ( pet - ct ) have increased the detection of impalpable lesions requiring imaging guidance for excision . a new technique involves intra - lesional insertion of a low - activity iodine-125 ( 125i ) seed and detection of the radioactive signal in theatre using a hand - held gamma probe to guide surgery . whilst several studies describe using this method to guide the removal of impalpable breast lesions , only a handful of publications report its use to guide excision of lesions outside the breast . we describe a case in which radio - guided occult lesion localisation using an iodine 125 seed was used to guide excision of an impalpable posterior chest wall metastasis detected on pet - ct .

sexual dysfunctions ( sds ) frequently affect the elderly and can lead to dissatisfaction with interpersonal relationships and have an adverse impact on overall well - being and mood . sds include erectile dysfunction , orgasmic dysfunction , lack of sexual desire , dissatisfaction with intercourse , etc . . among these , the majority of patients of both sexes report a lack of sexual desire , and men , especially , report erectile dysfunction . epidemiological data have shown that about 40% 45% of elderly women and 20% 30% of elderly men may have sds . furthermore the prevalence of sds in men younger than 40 years of age has been reported to be 2% whereas that in men over 80 years of age has been reported to be 86% . therefore , many patients with sds tend to seek current medical intervention for management of their sds , especially erectile dysfunction ( ed ) , such as medication , intraurethral suppositories or intracavernosal injeccasetions , implantation of a penile prosthesis , and hormonal therapy or psychotherapy . pharmacopuncture as a new and unique modality of treatment in korean medicine has had a promising effect on many kinds of diseases . however , until now , the focus of experiments and case reports has been musculoskeletal diseases , and to the best of our knowledge , no studies on the use of pharmacopuncture to treat sds exist . therefore , this study reports one case of sexual dysfunction ( sd ) treated with only sweet bee venom ( sbv ) pharmacopuncture . a 51-year - old man complaining of sd was administered udenafil ( phosphodiesterase 5 inhibitor ) for 15 days . he had low back pain since 2009 , and his symptom , such as numbness in both leg and feet , which had been severe , deteriorated . he underwent a magnetic resonance imaging ( mri ) scan of the lower back , and the intervertebral disc space between l5 and s1 was found to be narrowed and a herniated disc was manifested . thus , he decided to undergo surgery to insert artificial cartilage between l5 and s1 . after surgery , the numbness in both legs and feet and the lower back pain were decreasing . during his admission period from october 10 to october 30 , he asked if sd could be treated with korean medicine . after receiving our response , he decided to undergo 20 days of treatments without any kinds of herbal medicines and western drugs for sd . he completed the international index for erectile dysfunction questionnaires ( iief , appendix ) before and after treatment . firstly , gwanwon ( cv4 ) and hoeeum ( cv1 ) were used at doses of 0.1 cc and 0.2 cc , respectively , as well as sinsu ( bl23 ) and gihaesu ( bl24 ) at a dose of 0.1 cc at each site bilaterally . the pharmacopuncture treatment using these 4 points was conducted for 10 days . after that procedure , cv4 and cv1 were selected to maintain the sexual function effect , and the sbv pharmacopuncture was administered at doses of 0.1 cc and 0.2 cc , respectively , every other day for 10 days ( fig 1 ) . to evaluate the sexual function , we had the patient complete the iief questionnaire before and after treatment . in this study , no medical diagnostic devices were used to measure erectile dysfunction . sexual dysfunction involves several factors concerning mental satisfaction , so although completing and interpreting the results of a questionnaire are easy , no absolute and discrete values exist for individuals with and without sd . in a study , the iief questionnaire was tested in 111 men with sexual dysfunction and 109 age - matched normal volunteers . therefore , mean scores for controls ( normal volunteers ) and patients could be obtained . in this study , those mean scores were adopted and the scores for this case , both pre - treatment and post - treatment , and the control s scores and the patient s scores are presented in ( fig 2 ) . firstly , gwanwon ( cv4 ) and hoeeum ( cv1 ) were used at doses of 0.1 cc and 0.2 cc , respectively , as well as sinsu ( bl23 ) and gihaesu ( bl24 ) at a dose of 0.1 cc at each site bilaterally . the pharmacopuncture treatment using these 4 points were selected to maintain the sexual function effect , and the sbv pharmacopuncture was administered at doses of 0.1 cc and 0.2 cc , respectively , every other day for 10 days ( fig 1 ) . to evaluate the sexual function , we had the patient complete the iief questionnaire before and after treatment . in this study , no medical diagnostic devices were used to measure erectile dysfunction . sexual dysfunction involves several factors concerning mental satisfaction , so although completing and interpreting the results of a questionnaire are easy , no absolute and discrete values exist for individuals with and without sd . in a study , the iief questionnaire was tested in 111 men with sexual dysfunction and 109 age - matched normal volunteers . therefore , mean scores for controls ( normal volunteers ) and patients could be obtained . in this study , those mean scores were adopted and the scores for this case , both pre - treatment and post - treatment , and the control s scores and the patient s scores are presented in ( fig 2 ) . in this study , four acupuncture points were used , cv4 , cv1 , bl23 and bl24 . cv4 is the front collecting point ( mu point ) of the small intestine and represents the intersection of the interior branches of the three yin channels of the foot . it can explain the broad effect on gynecological syndromes and disorders of the urogenital tract . also , it can play an important role in tonifying in cases of emotional and physical exhaustion . in traditional chinese medicine ( tcm ) , it can nourish blood and yin , warm the uterus and lower warmer , invigorate kidney , yang and original qi ( yuan qi ) , and expel dampness and cold from the lower warmer . cv1 is the beginning point of the governing vessel , the penetrating vessel and the conception vessel . thus , its effect lies in difficult urination and defecation , enuresis and impotence , pain in the penis , sweating of genitals , etc . bl23 is the back shu point of the kidney , so its indication lies in strengthening the renal function and circulation , and its point is used for all chronic diseases including disorders of the urogenital tract bl24 is one of the back shu points , and its action strengthens the lower back , regulates menstruation , and invigorates blood ; especially , it is useful for lower backache and stiffness of the lower back . the iief questionnaire is composed of 15 questions , and it is a useful tool in a clinical setting . it is a validated , multidimensional , self - reporting questionnaire and can be used to evaluate erectile function and treatment outcomes . the 15 questions can be classified into 5 categories : erectile function , orgasmic function , sexual desire , intercourse satisfaction and overall satisfaction . for example question numbers 1 , 2 , 3 , 4 , 5 and 15 can be categorized as erectile function . the perfect score differs according to the category , being 30 for erectile function , 10 for orgasmic function , 10 for sexual desire , 15 for satisfaction with intercourse , and 10 for overall satisfaction . in this case study , the patient s scores in each category were similar to those of the control group , except for sexual desire , where the patient s scores were very low . after treatment , the results showed improved erectile function , sexual desire , satisfaction with intercourse , and overall satisfaction . based on the patient s subjective self - evaluation , he also showed improvements in the duration of erection , hardness ( vascularity ) of the penis , and shortening of recovery period ( re - action ) , his lower back pain decreased , the flow of urine when urinating was not interrupted , and generally he felt more confident in his life . although such sign as eye contact , brightness of eyes , volume of his voice , etc . are subjective , in this circumstance , a personal problem , observing such features may be helpful . this study has limitations in that the result of 1 case can not be generalized because of loss of control and insufficient number of subjects . besides the iief questionnaire , no other signs of improvement , such as pulse diagnosis , digital thermal imaging test , etc . nevertheless , this study could be regarded as helpful to broaden the scope for using sbv pharmacopuncture to treat urogenital diseases . in the future , additional systematic research or randomized clinical trials in this area will be needed to find the ways to treat sexual problems using pharmacopuncture and korean medicine treatments .

sexual dysfunction ( sd ) is a health problem which occurs during any phase of the sexual response cycle that keeps the individual or couple from experiencing satisfaction from the sexual activity . sd covers a wide variety of symptoms like in men , erectile dysfunction and premature or delayed ejaculation , in women , spasms of the vagina and pain with sexual intercourse , in both sexes , sexual desire and response . and pharmacopuncture , i.e. injection of subclinical doses of drugs , mostly herb medicine , in acupoints , has been adopted with successful results . this case report showed the effect of bee venom on sd . a 51-year - old male patient with sd , who had a past history of taking western medication to treat his sd and who had previously undergone surgery on his lower back due to a herniated disc , received treatments using pharmacopuncture of sweet bee venom ( sbv ) at gwanwon ( cv4 ) , hoeeum ( cv1 ) , sinsu ( bl23 ) , and gihaesu ( bl24 ) for 20 days . objectively , the patient showed improvement on most items on the international index for erectile dysfunction ( iief ) like 28 to 29 out of perfect score 30 for erectile function , 10 to 10 out of perfect score 10 for orgasmic function , 6 to 8 out of perfect score 10 for sexual desire , 10 to 13 out of perfect score 15 for satisfaction with intercourse , and 6 to 8 out of perfect score 10 for overall satisfaction ; subjectively , his words , the tone of his voice and the look of confidence in his eyes all indicated improvement . among the variety of effects of sbv pharmacopuncture , urogenital problems such as sd may be health problems that pharmacopuncture can treat effectively .

during fetal development , the testes develop in the abdomen and later descend into the scrotal sac in the third trimester , usually between weeks 28 to 32 . during the descent , it may be arrested anywhere along its tract ( cryptorchidism ) or may migrate into an abnormal position ( ectopic testis ) . the most common sites of undescended testis are high scrotal , canalicular , abdominal , and bilateral.1 cryptorchidism , the most common congenital anomaly of the genitourinary tract in males , is encountered in 1% of boys.2 in cryptorchid testicles , the incidence of testicular cancer is considered to be 3 to 48 times greater than in the general population . testicular cancer is developed in 10% of the cases with undescendent testicles.3 various tumor markers are available in the form of alpha fetoprotein ( -fp ) , beta human chorionic gonadotrophin ( -hcg ) , lactate dehydrogenase ( ldh ) , and placenta - like alkaline phosphotase ( plap ) . they are helpful not only in making the diagnosis but also in formulating a management plan . their sensitivity and specificity vary according to the type of testicular tumor.4 due to measures of prevention in force , it is uncommon to find cases of tumors in intra - abdominal testicles . this case report presents a new case of an adult patient with an intra - abdominal testicular tumor . a 54-year - old patient , the father of three children , was referred to our hospital ( babol clinic hospital , in the north of iran ) . he had normal bowel habits with no history of weight loss or change in appetite . he had a history of herniorrhaphy and left orchiectomy about 18 years before . on initial examination in the emergency ward , his temperature was 38c , heart rate 74/min , respiratory rate 18/min , and blood pressure 118/80 mmhg . on physical examination , his head and neck exam were within normal limits , and there was no lymph node enlargement . his chest was clear to auscultation , and no cardiac murmur was audible . abdominal examination showed a pelviabdominal mass that was hard in consistency and mobile ; there was , however , no hepatosplenomegally , no inguinal hernias , and no lymph node enlargement . scrotal examinations revealed a normal right testis and scrotum , whereas the left testis was neither palpable in the scrotum nor in the inguinal region . clinical laboratory studies revealed a white blood count of 16,200 cell / mm , with 92% neutrophils , 4% lymphocytes , 2% monocytes , and 2% eosinophil ; hemoglobin of 14.6 g / dl ; and a platelet count of 188,000/mm . the erythrocyte sedimentation rate was 17 mm / h and c - reactive protein was + + . tumor markers ( -hcg and -fp ) were normal too . in ultrasonographic scanning , the suprapubic mass was demonstrated to be a large complex soft tissue mass ( 5.4 cm 4.6 cm ) with a hypoechoic area at the center . it is complemented with a ct scan observing an ovoid cystic mass with heterogeneous enhancement left anterolateral to bladder with 55 43 48 mm dimensions . there was negative evidence of the presence of adhesion between the mass and bladder but there was compressive effect on the bladder . laparotomy was done through lower midline incision and the total excision of the tumor was carried out . the pathological report revealed a massive complete fibrohyalinosis of testicular parenchyma with focal dystrophic calcification , but there was no evidence of malignancy ( figures 14 ) . in humans , testes develop in the abdomen and normally descend into the lower portion of the scrotum during the third trimester . during the descent , it may be arrested anywhere along its tract ( cryptorchidism ) or may migrate into an abnormal position ( ectopic testis ) . the most common sites of undescended testis are high scrotal ( 50% ) , canalicular ( 20% ) , and abdominal ( 10% ) , bilateral ( 10%).1 the cancer risk of an ectopic testis is 40 times higher in a normal testis . furthermore , an abdominal testis is four times more likely to undergo malignant degeneration than an inguinal testis.2 the cancer of undescended testes usually peaks in the third or fourth decade of life.2 tumor in an abdominal testis is more likely to be seminoma , but tumors in testes previously corrected by orchipexy are more likely to be nonseminomas.5 in ultrasonographic scanning , most gcts ( giant cell tumors ) are solid , hypoechoic tumors . . imaging and laboratory studies ( -fp and b - hcg ) are quite useful in suggesting the diagnosis . exploratory laparotomy and subsequent pathological examination are diagnostic too.5 undescended testes with intra - abdominal testes are more likely to be seminomas . for this reason , testicular cancer should be considered as the differential diagnosis of an abdominal mass in patients with a nonpalpable testis . the first one posits that local temperature elevation of an ectopic testis is , somehow , procarcinogenic . if this hypothesis is true , then orchidopexy ( testis descend and fixation in the scrotum ) could protect against cancer if the procedure is performed before precancerous cells differentiate to a critical point such as that of puberty . the second hypothesis posits that an underlying hormonal condition predisposes to both cryptorchidism and testicular cancer . if so , orchidopexy would not prevent the testicular cancer ; and orchidectomy would be required.2 a high intra - abdominal temperature has been incriminated as the cause of carcinogenesis in the testis . there may be a decrease in the spermatogenesis , leidig cell abnormality , and delay in the development of the sertoli cells in the testis , leading to infertility.6 in our case , there was no evidence of sterility due to the testicular malfunction and the patient had three children . painless enlargement of the testis , or abdominal mass , is the common mode of manifestation in a cryptorchid testis . rarely , an abdominal testicular tumor can cause an acute abdomen , a massive abdominal mass , pain , and hematuria because of adjacent visceral infiltration.6 our patient had no such complications . classically , scrotal ultrasonography shows hypoechoic intratesticular mass in seminoma and at times with some calcification and cystic changes though mainly in nonseminomas . ct scanning of the abdomen and the pelvis is a very sensitive tool for the metastatic evaluation , which definitely helps plan the management . ct scan of the chest can usually be omitted unless there is an abnormal cxr finding.7 in developed countries , the existence of undescended testicles in the adult population is rare , which is due to systematic practice of elective orchidopexy before the second year of life to prevent cancer and infertility . orchidopexy does not eliminate cancer risk but allows an early diagnosis by making testicles accessible to exploration.3 in conclusion , despite the elevated risk of testicular cancer in patients with intra - abdominal testicles , we consider it a low incidence disease . this could be due to standard practice of orchidopexy in pre - adolescent patients and orchiectomy in post - adolescents ones with cryptorchidism . nevertheless , there are still some cases of intra - abdominal testicle tumors , which could presumably be avoided with the adoption of adequate prevention strategies .

this case study aims to report an unresolved abdominal mass in an adult with cryptorchid testis and provide a review of related literature . we investigated a 54-year - old man who had cryptorchidism with a history of left orchiectomy 18 years prior . he was diagnosed with an intra - abdominal testicular mass after referring to the emergency ward with pelvic pain . the incidence of testicular cancer in undescended testicles is 40 times greater in the general population . in developed countries , the existence of undescended testicles in adult population is rare , which could be due to systematic practice of elective orchidopexy before the second year of life as well as orchiectomy in post - adolescent patients with undescended testicles . despite these preventive measures , there are still some isolated cases of intra - abdominal testicular tumors in adults .

these tumors have been reported in diverse sites including gallbladder , stomach , esophagus and colon , but are only rarely reported in the small intestine . outcome is poor in patients with sarcomatoid carcinoma , because patients usually present with large tumor at extended stages . we report a case of a 62-year - old man with sarcomatoid carcinoma involving the small intestine and review the relevant literature . a 62-year - old man was admitted to konyang university hospital due to abdominal pain experienced for one month . laboratory tests revealed anemia ( hemoglobin , 5.9 g / dl ; hematocrit , 18.7% ) and neutrophilia ( 13.0 10/l ) . no distant metastasis was detected after the patient underwent a positron emission tomography ( pet)-ct scan . segmental resection revealed a mass located at the ileum , 40 cm from the ileocecal junction . the resected specimen showed an ulcerofungating mass that measured 15 9 2 cm in dimension . the cut surface revealed a grayish white , solid , and firm mass , with areas of hemorrhage and necrosis . the mass extended through the entire thickness of the wall of the small intestine , with invasion into the mesenteric fat . spindle cells were arranged haphazardly in a fascicular growth pattern , with nuclear hyperchromasia and distinct nucleoli . smooth muscle actin , s-100 , cd34 , hmb-45 , desmin and c - kit were negative ( fig . three months later , pet - ct showed a recurrent mass in the pelvic cavity . after resection of recurrent small bowel mass , the patient restarted chemotherapy with doxorubicin , dacarbazine , ifosfamide and mensa . sarcomatoid carcinoma is a controversial and rare tumor that displays both carcinomatous and sarcomatous features . it has variety of names including carcinosarcoma , metaplastic carcinoma , spindle cell carcinoma , and pleomorphic carcinoma . for the small intestine , sarcomatoid carcinoma was first described by dikman and toker in 1973 . less than 30 cases of small intestinal sarcomatoid carcinoma have been reported in the english language literature to date . in korea , only one case of small intestinal sarcomatoid carcinoma has been reported in the duodenum . clinically , sarcomatoid carcinoma in the small intestine seems to be a disease that affects elderly patients , presenting at a mean age of 57 years . presenting symptoms include : abdominal pain , intestinal obstruction , palpable abdominal mass , gastrointestinal bleeding , and anemia . in the present case , a mixture of epithelial - looking and mesenchymal - like cells characterized the typical biphasic pattern . monophasic tumors show a predominance of the mesenchymal - like component , with minimal to absent epithelioid areas . monophagic sarcomatoid carcinoma may be confused with other sarcomas due to the absence of carcinomatous features . a wide panel of immunohistochemical markers was performed to sort out a diagnosis from a wide range of differentials , including leiomyosarcoma , epithelioid angiosarcoma , epithelioid malignant peripheral nerve sheath tumor ( mpnst ) , gastrointestinal stromal tumor ( gist ) , and melanoma . the absence of s-100 and hmb-45 ruled out the possibilities of an epithelioid mpnst and melanoma . lack of c - kit and cd34 ruled out the possibility of a gist and an epithelioid angiosarcoma . this tumor was suggested to be epithelial in origin and had transformed to a sarcomatous tumor . however , due to the high malignancy of sarcomatoid carcinoma , many patients are diagnosed with the tumor at a late stage and die due to metastasis . the duration of survival is generally only a few months . in this case , although the patient was treated with adjuvant chemotherapy , the tumor recurred within three months after surgery . informing the patient of the aggressive biological behavior of the tumor and careful follow - up would be necessary for patients . in summary , we present a case of sarcomatoid carcinoma in the small intestine . as small intestinal sarcomatoid carcinoma demonstrates highly aggressive behavior , radical surgery and short - term follow up are recommended .

sarcomatoid carcinoma of the small intestine is an extremely rare malignant neoplasm that usually has a poor prognosis . we report a case of sarcomatoid carcinoma arising in the small intestine in a 62-year - old man who was hospitalized for abdominal pain . computed tomography revealed wall thickening of the small intestine . the resected specimen showed a gray - whitish solid mass with hemorrhage and necrosis . microscopically , the tumor was composed of pleomorphic spindle and discohesive polygonal cells with frequent mitosis . no carcinomatous component was recognized . immunohistochemistry revealed coexpression of cytokeratin and vimentin by the tumor cells , whereas expressions of c - kit , cd34 , hmb-45 , smooth muscle actin , and desmin were negative . the diagnosis was sarcomatoid carcinoma of the small intestine .

odontomas are hamartomas of aborted tooth formation , which account for 22% of the odontogenic tumors . compound odontomas manifest as a regularly shaped , solitary or multiple small tooth - like denticles , where all dental tissues are represented in a structural and more orderly pattern . a complex odontoma presents as an amorphous conglomeration of dental tissues consisting of enamel , dentin , cementum , pulp , and enamel organ . peripheral compound odontomas are rare , arise extraosseously , and have the tendency to exfoliate . the majority of compound odontoma cases ( 74.3% ) , are diagnosed before the age of 20 years , during routine radiographic examination , occurring commonly in the anterior maxillary region , without any gender bias . a 15-year - old , apparently healthy female patient reported to the department of orthodontics , with the chief complaint of forwardly placed front teeth . , it was found that 47 was missing and in place of that a small tooth - like structure was present [ figure 1 ] . the lesion was asymptomatic , with no signs of infection or ulceration of the surrounding mucosa . erupted odontoma in the region of 47 orthophantomogram revealed a missing 47 and a single small tooth - like radiopaque structure with a single root above the alveolar bone level in place of the missing second molar . a radiolucent zone was seen around the root - like structure [ figure 2 , figure 3 ] . orthophantomogram showing the odontome erupted position of the odontoma seen after 18 months this structure was extracted and it showed no morphological resemblance to any tooth of the normal series . after extraction the specimen was sent for histopathological examination , which confirmed it as a compound odontoma having enamel , dentin , pulp chamber , and cementum in the same order of arrangement as that of a normal tooth [ figure 5 ] . they are the most common odontogenic tumors constituting 22% of all odontogenic tumors of the jaws . the world health organization defines odontomas as being of two types : complex odontomas , a malformation in which all dental tissues are present , but arranged in a more or less disorderly pattern ; and compound odontomas , a malformation in which all the dental tissues are represented in a pattern that is more orderly than that of the complex type . enamel , dentin cementum , and pulp are arranged as they would be in a normal tooth . the intraosseous odontomas occur inside the bone and may erupt into the oral cavity ( erupted odontoma ) . the extraosseous or peripheral odontomas are odontomas occurring in the soft tissue covering the tooth bearing portions of the jaws , having a tendency to exfoliate . the review of literature reveals that 16 cases of erupted odontomas have been reported in which eight were compound odontomas . the etiology of odontomas has been attributed to various pathological conditions like local trauma , inflammatory and/or infectious process , hereditary anomalies ( gardners syndrome , hermanns syndrome ) , odontoblastic hyperactivity , and alterations in the genetic component responsible for controlling dental development . the persistence of a portion of lamina may be an important factor in the etiology of a compound or complex odontoma and either of this may occur instead of a tooth . peripheral odontogenic hamartoma 's ( poh ) histogenetic source may arise from soft tissue remnants of dental lamina . gingival rests of serres , seem to retain the ability to pursue epithelial - mesenchymal interactions that could lead to odontoma formation . since odontomas are seen in hereditary anomalies like gardners syndrome and hermanns syndrome , alteration of the genetic components might be responsible for odontoma formation . hitchin suggested that the odontomas are inherited through a mutant gene or interference , possibly postnatal , with genetic control of tooth development . stated that the differentiation of normal and tumor odontogenic cells is accompanied by the expression of some common molecules . the gene products present in some mesenchymal cells were also seen in the odontogenic tumor epithelium . the data may be related to a tumor - specific overexpression of the corresponding genes transcribed at an undetectable level during normal development and / or to an epithelial - mesenchymal transition proposed to occur during normal root formation . a plausible explanation for the result is that odontogenic tumor epithelial cells are recapitulating genetic programs expressed during normal odontogenesis , but the tumor cells demonstrate abnormal expression patterns for these genes . in 70% of odontomas , pathological anomalies are observed in relation to the neighboring teeth such as devitalization , malformation , aplasia , malposition , and impacted teeth ( unerupted teeth ) , where , as in the present case , the odontoma was associated with aplasia of 47 . radiographically , odontomas present as well - defined , radio - opacities situated in the bone , but with a density that is greater than bone and equal to or greater than that of a tooth . a radiolucent halo , typically surrounded by a thin sclerotic line , surrounds the radio - opacity . the radiolucent zone is the connective tissue capsule similar to that of the normal tooth follicle . in this case it was seen radiographically as a dense radiopaque structure outside the jaw bone , with clear external margins , presenting normal organization of dental tissues ( like enamel , dentin , pulp , and cementum ) . histopathological examination showed the presence of enamel , dentin , cementum , as well as pulp chamber in the normal order . commonly compound odontoma ( intraosseous ) is located between the apex of a primary tooth and the crown of a permanent tooth preventing the eruption of the latter . however , in the present case , the odontoma was located outside the jaw bone , in the soft tissue covering the tooth bearing portion of the jaw . it presented an area of bone resorption from the periosteal surface , which looked like a concave radiolucent zone . this odontome had the tendency to exfoliate as it had erupted into the oral cavity and was also mobile and about to be exfoliated . although microscopic and radiographic examinations confirm the diagnosis of compound odontoma , this case needs to be differentiated from supplemental and supernumerary teeth . supplemental tooth is the one , which resembles a normal tooth both morphologically and histologically and is located adjacent to the normal tooth , whereas , a supernumerary tooth is a tooth - like structure of variable size and shape . however , histologically it represents the normal organization of the tooth structure , like enamel , dentin , pulp , and cementum , including the periodontal ligament . in this case odontoma was associated with aplasia of 47 , whereas , the supplemental tooth and the supernumerary tooth were seen along with the normal series of teeth . the odontoma may arise from the remnants of dental lamina , gingival rest of serres . immunocytochemical investigations have indicated that a pattern of cellular activity involving reduced dental epithelium is associated with tooth eruption . this epithelial signaling could explain the remarkable consistency of eruption times , as it is likely that the dental epithelium is programmed as a part of its functional life cycle . however in the case of odontomas erupting into the oral cavity the mechanism behind the eruption times remains uncertain , as some odontomas erupt at a very young age and others at an older age . in the present case , after examining the two radiographs taken at an interval of 18 months [ figure 2 , figure 3 ] , it can be said that the erupting third molar beneath the odontoma might have been the cause of eruption and mobility of this odontoma . in the present case , since it was an erupted odontoma attached only to the soft tissue and being mobile on palpation , it was extracted . since these odontomas are not adherent to the bone they can be easily enucleated and curetted . in cases of larger odontomas where there are multiple components , it is necessary to take intraoperative radiographs to ensure that all the calcified masses have been removed . if any portion of the lesion is left unexcised such residual odontomas may remain unchanged throughout . very rarely the wound may get infected after an incomplete removal , since the avascular odontoma portion acts like foreign body . a rare case of erupted compound odontoma that was about to be exfoliated has been reported . the presence of a single tooth - like structure in the region of 47 , associated with a congenitally missing 47 is reported . the important feature found in this case was that the eruption time of this odontoma was approximately the same as that of the mandibular right second molar , which could be related to the aborted tooth formation .

odontomas are considered to be hamartomas rather than a true neoplasm . they consist chiefly of enamel and dentin , with variable amount of pulp and cementum when fully developed . they are generally asymptomatic and are included under the benign calcified odontogenic tumors . they are usually discovered on routine radiographic examination . eruption of an odontoma in the oral cavity is rare . peripheral compound odontomas arise extraosseously and have a tendency to exfoliate . in this article we are reporting a case of a 15-year - old girl with peripheral compound odontoma , with a single rudimentary tooth - like structure in the mandibular right second molar region , which is about to be exfoliated . its eruption in the oral cavity and location in the mandibular posterior region is associated with aplasia of the mandibular right second molar , making it an interesting case for reporting .

chondroblastoma is a rare tumor entity that comprises approximately 1% of all benign bone tumors . in up to 95% cases , it occurs in the second decade of life with a male : female ratio of 2:1 . the most frequent localizations of chondroblastoma are epiphyses of long bones ( proximal humerus , proximal femur , distal femur and proximal tibia ) . patella , pelvis , fibula , small bones of hands and feet , ribs , skull , mandible , maxillae , vertebrae , scapulae and sternum are considered as atypical localizations . although fine needle aspiration cytology ( fnac ) is gaining acceptance as very convenient and reliable method for the rapid diagnosis of bone lesions , very few cases of chondroblastoma diagnosed on cytology have been reported in the literature . an 18-year - old - female presented with pain in left leg for last 1-month and progressively increasing swelling around the knee joint for last 15 days . various investigations like routine blood and urine examination , serum acid and alkaline phosphatase , serum calcium and phosphorus were within normal limits . magnetic resonance imaging of leg showed abnormal marrow infiltration in medullary cavity of head and upper shaft of fibula hypo - intense on t1-weighted t2-weighted sequences and hypo - to hyper - intense on short tau inversion recovery ( stir ) sequence , the vertical length being 8 cm approximately . there was cortical destruction with extra - osseous extension of abnormal marrow signals abutting soft tissue and musculature namely peroneal , extensor digitorum longus , flexor hallucis longus , tibialis anterior and posterior , and soleus muscle . the extra - osseous component was large and measured 7.3 cm 4.7 cm approximately . magnetic resonance imaging knee joint short tau inversion recovery coronal reveals abnormal hyperintense medullary marrow signal in the head of fibula ( epiphysis ) extending inferiorly into upper shaft of the fibula . there is associated cortical destruction with sotissue components the fnac smears , stained with giemsa stain , showed neoplastic mononucleated and binucleated chondroblasts , multinucleated osteoclast - like giant cells , and chondromyxoid matrix fragments representing early cartilage in hemorrhagic background . the chondroblasts were distributed singly in smears , had round to oval nuclei with indentation and lobulation , and fine evenly distributed chromatin . the giant cells were indistinguishable from those seen in other bone neoplasms [ figure 2a and c ] . ( a ) photomicrograph showing chondroblasts distributed singly ( yellow arrow ) in smear , have round to oval nuclei with indentation , fine chromatin and dense cytoplasm with rounded well - defined borders . binucleated forms ( green arrow ) and multi nucleated osteoclast - like giantcells ( red arrow ) are also evident ( giemsa , 400 ) ( b ) photomicrograph of fine needle aspiration smear showing chondroid matrix ( giemsa , 100 ) ( c ) photomicrograph showing chondroblasts with binucleated forms ( green arrow ) and multi nucleated giant cells ( giemsa , 400 ) subsequent intralesional curetting was done with bone autografting . histopathology revealed tumor composed of sheets of polyhedral chondroblasts with round to ovoid , indented and lobulated nuclei and thick sharply defined cell membrane . at places , thin network ( chicken - wire like ) to dense obvious deposits of calcification was evident . chondroblastoma was first described by codman in 1931 , who designated it as epiphyseal chondromatous giant cell tumor . jaffe and lichtenstein in 1942 differentiated chondroblastoma from giant cell tumor and established the term benign chondroblastoma . very few cases with extracortical soft tissue invasion or metastasis are reported . atypical cases of chondroblastoma are reported , especially in older patients , tend to involve unusual sites and have a greater tendency to expand the affected bone . the present case was a young female having atypical localization ( fibula ) of chondroblastoma with extracortical soft tissue invasion . the histological diagnosis of typical chondroblastoma is not difficult due to their characteristic appearance with rounded or polygonal chondroblasts , multinucleated giant cells and eosinophilic chondroid extracellular matrix with focal chicken - wire calcification . although aspiration cytology is very convenient and reliable method for the rapid diagnosis of bone lesions , the failure rate is high . high failure rate of aspiration cytology in bone tumors is mainly due to the hardness and fibrous nature of the tumors and if they are guarded by thick cortex leading to difficulty in piercing the needle . fnac of giant cell tumor also shows two population of cells ; dominant histiocytoid mononuclear cells and multinucleated giant cells . presence of chondroid matrix is believed to be the decisive feature to differentiate chondroblastoma from giant cell tumor , which is seen better in giemsa - stained smears than in papanicolaou - stained smears . also , mononuclear cells in chondroblastoma have irregular ridged nuclei with longitudinal clefts , while , in giant cell tumor , the cells resemble histiocytes with nuclei similar to those of the giant cells . in difficult cases , cytologically histiocytes of lch are like chondroblasts of chondroblastoma but not associated with any type of matrix production . fine needle aspiration cytology provides a simple , quick , easy and reliable method of preoperative diagnosis of chondroblastoma and can be used as a substitute of surgical biopsy . the cytologic features of the chondroblasts and chondroid matrix are the diagnostic hallmarks of chondroblastoma .

chondroblastoma is a rare benign cartilaginous tumor typically seen in long bones , especially femur , tibia and proximal humerus . extracortical soft tissue invasion or metastasis is rarely seen . we report here a unique case of chondroblastoma of the fibula with extracortical soft tissue invasion . differential diagnosis on cytology is discussed .

lobar or total lung lavage by flexibile fiberoptic bronchoscopy ( fob ) is an alternative to whole lung lavage ( wll ) in the treatment of pulmonary alveolar proteinosis ( pap ) . bronchopulmonary lavage was introduced by j. ramirez and used not only in alveolar proteinosis but also in status asthmaticus and in desquamative interstitial pneumonia with good results.the use of multiple segmental or lobar lavage by fob has been reported in english medical literature in less than 10 cases but often with interesting results . partial lung lavage , performed with bronchoscope has been considered a possibility when wll is potentially harmful as in the case of severe hypoxemia and when extracorporeal membrane oxygenation is not feasible . since there is no pediatric - size double - lumen endotracheal tube available , unilateral lung lavage by bronchofiberscope and selective ventilation , with cuffed endotracheal tube , is an alternative . paquet and karsli also utilized a two - cuffed endotracheal tube for the treatment of a pediatric patient . based on these experience we report a case of a patient with pulmonary alveolar proteinosis and presenting an influenza a h1n1 pneumonia treated and resolved with helping of fob . a 41-year- old woman , suffering from idiopathic alveolar proteinosis ( biopsy confirmed ) ( pap ) was referred to intensive care unit of the hospital of lavagna because of respiratory failure : pao2/fio2 ( p / f ) ratio 130 , severe respiratory acidosis ( ph 6.96 and paco2 112 ) tachypnea ( respiratory rate : 40 breaths per minute ) , tachycardia ( pulse : 130 beats minute ) , fever ( t 38.8c ) and stupor . prior to admission she was given a 7- day course of clarithromycin for an upper respiratory tract infection . in the week before the admission dyspnoea had been progressively increasing . the patient had been followed for five years at the respiratory diseases department of hospital of sestri levante for pap . no therapy had been prescribed during the last two years because her condition had stabilized . in the month prior to admission she complained of dyspnoea and mucous expectoration . in the week before admission dyspnoea was present also at rest . admission chest x - ray showed diffuse bilateral interstitial and alveolar infiltrates ( figure 1a ) ; computed tomography ( ct ) scan of the thorax showed diffuse asymmetric alveolar infiltrates , ground - glass opacities associated with reticulo - nodular pattern ( figure 1b ) . arterial blood gas performed by administering oxygen fio2 60% by venturi mask showed a severe acidosis ( pao2 44 mmhg , paco2 121 ph 6.96 ) . ( b ) computed tomography scan : diffuse asymmetric alveolar infiltrates , ground - glass opacities associated with reticulo - nodular pattern . ( b ) computed tomography scan : diffuse asymmetric alveolar infiltrates , ground - glass opacities associated with reticulo - nodular pattern . thirty minutes after admission to the intensive care unit , the patient was invasively ventilated by pressure - controlled ventilation : inspiratory positive airway pressure ( ipap ) : 28 cm h2o , positive end expiratory pressure ( peep):15 cm h20 , respiratory rate:16 per minute and fio2 80% with a tidal volume of 290 ml . arterial blood gas analysis revealed worsening parameters : ph 6.73 , paco2 170 mmhg , pao2 112 mmhg . ( ph 7.22 , paco2 63.5 , pao2 112 with p / f ratio 234 ) . twenty - four hours later a normal ph was achieved ( ph 7.35 paco2 50 pao2 112 ) ; peep was reduced ( 12 cm h2o ) . broad spectrum antibiotics ( piperacillin + tazobactam 18 g in continuous infusion + levofloxacin 1000 mg every 24 hours ) and antimycotical therapy associated with stress doses of hydrocortisone 300 mg iv . were initiated at the admission . over the next five days the clinical picture worsened and the peep was increased to 18 cm h2o and the patient remained hypercapnic ( paco2 106 mm hg with ph 7.18 ) . she underwent bronchoscopic aspiration and lavage which returned milky , thick fluid from the entire bronchial tree . the real time polymerase chain reaction ( pcr ) of bronchoalveolar lavage sample resulted positive for influenza a h1n1 virus . the biochemical analysis of bronchoalveolar lavage ( a presence of foamy macrophages and elevated lipid index ) and electronic microscopy of bronchoalveolar lavage ( amorphous material with multi lamellated structure in concentric arrangement ) confirmed the concurrence of influenza a h1n1 virus pneumonia with idiopathic alveolar proteinosis . the white blood cells ( wbc ) count was 3800 with 85% polymorphonuclear leukocytes with relative lymphopenia ( 3.2% ) ; the hematocrit was 42% , haemoglobin 11.8 g / ml and c - reactive protein ( crp ) 20.44 mg / l , lactate dehydrogenase ( ldh ) 2058 u / l . urinary antigen test for legionella pneumophila and streptococcus pneumoniae were negative as were igm antibodies for mycoplasma pneumoniae . pcr for the identification of adenovirus , human coronavirus , metapneumovirus , chlamydia pneumoniae , haemphilus influenzae , legionella pneumophila , mycoplasma pneumoniae and streptococcus pneumoniae . antigens of aspergillus and ziehl - neelsen stain for acid - fast bacilli and nucleoid acid amplification tests to identify mycobacterium tuberculosis in blood and bronchoalveolar lavage were also negative . a lobar lavage by bronchofibroscopy was performed seven days after admission using segmental lavage technique with instillation of 2000 ml of warm saline water . after bronchopulmonary lavage tidal volume increased as did p / f ratio and blood gas analysis parameters improved . the radiographic abnormalities gradually cleared ( figure 2 ) , peep was progressively reduced , the laboratory data improved ( wbc 7230 , ldh 633 u / l , crp 0.70 ) and the patient was transferred to the division of respiratory diseases a week later .pulmonary function tests showed a mild restrictive syndrome : forced vital capacity ( fvc ) 74.4% of predicted , forced expiratory volume in one second ( fev1 ) 78.5% of predicted , total lung capacity ( tlc ) 77.8% of predicted , tiffeneau index 90.2 ) and a moderate - severe reduction of diffusion capacity for co ( 40.5% ) . figure 2after bronchoscopic lung lavage , a gradual clearing of the diffuse alveolar infiltrates and the ground glass opacities . after bronchoscopic lung lavage , a gradual clearing of the diffuse alveolar infiltrates and the ground glass opacities . the clinical and radiologic picture improved progressively and the patient was discharged 42 days after admission to hospital . the patient continued follow - up and the functional respiratory parameters returned to the values present before the illness . there are three clinically distinct form of pap : congenital ( 2% of cases ) , acquired ( also referred as primary or idiopathic 90% of cases ) and secondary ( 510% ) . the clinical presentation of pap varies from asymptomatic ( 31% of acquired cases ) to a more chronic presentation with dyspnoea and cough sometimes accompanied by sputum described as white and gummy or chunky . pulmonary function test usually reveals restrictive lung disease , decreased carbon monoxide diffusion capacity and rarely hypoxemia . chest ct scan findings are non - specific and often show smooth thickening of sepal lines superimposed on areas of ground - glass opacities , known as crazy - paving . the classic findings include a milky fluid containing large amounts of granular cellular eosinophilic ( proteinaceous ) material with morphologically abnormal foamy macrophages filled with pas - positive intracellular inclusions . when electron microscopy is available , the presence of concentrically laminated phospholipid structures called lamellar bodies can confirm the diagnosis . the infectious agents include nocardia , mycobacterium tuberculosis , mycobacterium avium - intracellulare , pneumocystis jirovecii , and cytomegalovirus . single lung lavage by fob was performed in conscious patients as well as patients under general anaesthesia and mechanical ventilation ; in recent years the use of bal lung lavage has increased ; it seems to be effective as whole lung lavage . bal lung lavage a is well - known and established procedure in primary pulmonary alveolar proteinosis . bal lung lavage was previously used in other pulmonary alveolar disorders.the only effective treatment of pap is bronchoalveolar lavage : the procedure is safe and does not require anesthetic support . it is recommended only in milder disease or conversely , in particular severe cases , in which the physiological derangement of wll would not tolerated by patient or when extra - corporeal membrane oxygenation is not available . our case report illustrates that extremely severe respiratory failure can be successfully managed with the alternative technique of lobar lung lavage by flexibile fiberoptic bronchoscopy .

lobar fiberoptic lung lavage is a well - known procedure used in primary pulmonary alveolar proteinosis ( pap ) ; the use of this procedure has increased in the recent years . this procedure has also been used in other pulmonary diseases such as desquamative interstitial pneumonia with good results . we describe a case of extremely severe respiratory failure due to concurrence of pap and influenza a h1n1 virus pneumonia which resolved with the help of this procedure . the patient , a 41-year - old woman , needed less mechanical ventilation after undergoing lobar fiberoptic bronchoscopic lavage . moreover , a rapid and progressive improvement in the computed tomography of the lungs was observed . flexibile fiberoptic bronchoscopic lobar lavage is a simple , safe procedure used not only in milder disease , but also in particular severe cases in which the physiological derangement of whole lung lavage would not be tolerated by patient or when extra - corporeal membrane oxygenation is not available .

schimke immuno - osseous dysplasia ( siod ) is a fatal syndrome inherited as an autosomal recessive trait , and manifests with facial dysmorphism , growth failure , nephropathy , recurrent infections , hypothyroidism , episodic lymphopenia , and neurologic symptoms . biallelic loss of function mutations of swi / snf2- related , matrix associated , actin dependent regulator of chromatin , subfamily a - like 1 ( smarcal1 ) gene are the only known cause of siod . swi / snf2 related , matrix associated , actin dependent regulator of chromatin , subfamily a - like 1 protein is homologous to the swi2/snf2 family of atp - dependent chromatin remodeling proteins and has annealing helicase activity . in this report , we present an eight - year - old siod patient with a missense mutation on a conserved motif of snf2 domain of smarcal1 . the patient manifested abdominal mass due to intussusception secondary to epstein - barr virus ( ebv)-negative non - hodgkin b - cell lymphoma ( nhl ) , and expired due to septicemia following chemotherapy . we did report the first case of siod with end stage renal disease due to steroid resistant nephrotic syndrome from iran , herein , we report on a child with siod and intussusception that has not been reported previously . the patient was the third child of consanguineous parents and the product of a normal vaginal delivery at term . his postnatal course did not show anything abnormal , except for a poor growth rate . at the age of four years he had a peculiar face , short neck , disproportionate short stature and low growth indices as well as extremity edema and hypertension . laboratory examinations demonstrated nephrotic range proteinuria ( 2626 mg / day ) , hyperlipidemia ( tg=293 mg / dl , cholesterol=307 mg / dl ) , hypoalbuminemia ( alb=2.2 mg / dl ) , t - cell deficiency ( cd4/cd8=0.36 , normal range : 1.3 - 3.9 ) and hypothyroidism . bone survey revealed generalized osteopenia , platyspondyl of cervical spines , beaking of thoracolumbar vertebrae , epiphyseal dysgenesis of femur and shallow acetabulum . . therefore , molecular analysis of smarcal1 gene in the patient and his family members was performed . the analysis revealed homozygousity for the missense mutation c.1682g > a ( r561h ) in the patient ( panel a figure 1 ) . the parents and one sibling were heterozygous for this mutation ( panel b , c and d figure 1 ) . at the age of eight years , he developed colicky abdominal pain and vomiting . pathologic analysis of the resectioned mass showed diffuse infiltration of medium sized lymphocytic cells with conspicuous nucleoli and high mitotic figures ( figure 3 ) . immunohistochemistry of the lymphoma cells was diffusely reactive for leukocyte common antigen ( lca ) and cd20 ( figure 4 ) . all other markers such as cd3 , cd2 , cd3 , cd5 , cd7 , cd15 , and cd30 were also negative . the patient was treated with chemotherapeutic agents including vincristine , cyclophosphamide , adriamycine and intrathecal methotrexate using half of their usual doses , because of the underlying immunodeficiency . following chemotherapy , he developed febrile neutropenia ( wbc=2000 , pmn=10% , lymph=78% , eos=5% , mono=4% , baso=3% ) , and despite supportive care and prophylactic antibiotics , expired due to enterobacter sepsis . the sequences of smarcal1 related to schimke immuno - osseous dysplasia ( siod ) . sequence ( a ) , from the patient of this report exhibiting characteristics of schimke immuno - osseous dysplasia with a homozygote aa sequence ( c.1682 ) leading to the substitution of arginine ( cgc ) at position 561 in the protein by histidine ( cac ) . panels ( b , c and d ) show heterozygote ( g / a ) pattern of the same section from the patient s parents and siblings . non - hodgkin lymphoma is a heterogeneous group of malignancies originating from b and t lymphocytes , and has different etiologic , morphologic , immuno - phenotypic , genetic , and clinical features . there are several risk factors for nhl including congenital and acquired immunodeficiency states , infection with chronic antigen stimulation , autoimmune disorders , and environmental factors . according to the comprehensive database from the immunodeficiency cancer registry , the most common tumors in primary immunodeficiencies are lymphomas . the incidence of nhl is increased 10 - 100 or more in people with acquired or congenital immunodeficiency . such an association is not surprising , because the immune system plays a critical role in the recognition and destruction of malignant cells , and successful elimination of these cells requires an intact immune surveillance system . therefore , excessive generation of malignant cells coupled with immunodeficiency may result in the increased risk of cancer . the present patient with siod is an example of a syndromic immunodeficiency that presented with edema and poor growth ; however , immunodeficiency was not the major clinical problem . the arginine residue at position 561 is located in a conserved snf2 motif ( iia ) that contributes to the enzyme active site , and is in close proximity to walker b magnesium binding site . therefore , we suspect that the nonconservative substitution of histidine for arginine affects function of the active site and possibly dna binding . patients with siod have t cell deficiency , which generally affects cd4 cells in the most severe manner . although our patient had episodic lymphopenia , low cd3 , cd4 , cd4/cd8 ratio , and low igg level , he did not have prominent symptoms of immunodeficiency such as recurrent infections prior to presenting with large b cell lymphoma at the age of eight . the only reported case of siod with lymphoproliferative disorder in the literature is a 5-year - old saudi arabian boy who presented fever of unknown origin and ebv - related non - hodgkin lymphoma . the cause of this difference is not clear ; however , it might be due to a milder immunodeficiency state in our patient . it has been suggested that milder , but measurable immunodeficiency , is mostly unrelated to ebv infection . the other possibilities include unknown lymphotrophic virus and dysregulation of b cell proliferation with resultant malignant proliferation . also , given the recent findings of a role for smarcal1 in dna repair and replication , siod patients may have an increased cancer risk , although their short lifespan limits the manifestation of such a risk . the poor prognosis of nhl in immune deficiency states is accompanied by increased risk of complications such as sepsis following chemotherapy . although our patient did not have a history of increased infection , he developed severe septicemia and unfortunately died following chemotherapy . this is consistent with increased rate of opportunistic infections in the presence of immunosuppressive agents after renal transplantation in siod patients . the signs and symptoms of the present case , who expired of enterobacter sepsis following chemotherapy , showed that he had siod with intussusception secondary to ebv - negative non - hodgkin lymphoma . the patient 's history might be taken as evidence to recommend supportive care and more limited immunosuppressive protocols in siod patients .

schimke immuno - osseous dysplasia is a rare autosomal recessive multisystem disorder characterized by steroid - resistant nephrotic syndrome , immunodeficiency , and spondyloepiphyseal dysplasia . mutations in swi / snf2 related , matrix associated , actin dependent regulator of chromatin , subfamily a - like 1 ( smarcal1 ) gene are responsible for the disease . the present report describes , for the first time , a schimke immuno - osseous dysplasia child with smarcal1 missense mutation ( r561h ) and manifestations of intussusception secondary to epstein - barr virus - negative non - hodgkin lymphoma , who expired due to septicemia following chemotherapy . the report emphasizes the necessity of more limited immunosuppressive protocols in schimke immuno - osseous dysplasia patients with lymphoproliferative disorders .