text
stringlengths 844
19.4k
| summary
stringlengths 210
2.37k
|
|---|---|
microbial keratitis ( mk ) , epithelial loss from the cornea with underlying stromal infiltration by white blood cells and disintegration of the stroma , occurs when one of the protective mechanisms of the ocular surface is disrupted . it is a vision - threatening condition that requires rapid and appropriate management and antibiotic treatment if vision loss is to be prevented . mk caused by pseudomonas aeruginosa is commonly associated with contact lens wear ( table 1).121 predisposing risk factors for microbial keratitis can vary with geographical location and can depend on the penetration of contact lens wear . the differences may also be associated with the incidence of single nucleotide polymorphisms ( snps ) in cytokine genes in different populations . recently , snps in the gene for interleukin ( il)-10 have been associated with severity of and predisposition to mk.22 in developing countries , trauma to the eye may be a predominant risk factor,23 whereas in developed countries , contact lens wear is often the most important risk factor.24 a study from malaysia suggested that as p. aeruginosa is also a common inhabitant of soil , water , and vegetation , it may also be the main pathogen following vegetation - related corneal injury in certain regions.15 the incidence of contact lens - related microbial keratitis has been estimated over the past 20 years , and has remained almost constant at 1/2500 contact lens wearers who wear lenses on a daily wear basis ( that is removing lenses each night and placing in disinfecting solution prior to re - wearing the lens the next day ) , or 1/500 wearers if the lenses are worn on a continuous or extended wear basis ( ie , the person wears lenses for 24 hours , sleeping in lenses overnight).25 it is now common for lens wearers to discard their lenses after 2 weeks or 1 month of wear.25 in a study from north america , it was found that the incidence of all ulcerative keratitis was 2.76 per 10,000 person - years ( 95% confidence interval [ ci ] : 2.463.09 ) but the incidence of contact lens - associated keratitis was 13.04 per 10,000 person - years ( 95% ci : 11.1315.17 ) , with an adjusted relative risk of 9.31 ( 7.4211.7 ; p < 0.001 ) compared with non - contact lens wearers.1 another study put the incidence of mk at 1.1 per 10,000 persons / year in the us24 but a different study found an incidence of 79.9 per 10,000 persons / year in nepal.23 the risk with therapeutic contact lenses is higher at approximately 52/10,000 yearly.26 a study of armed forces of the uk evacuated because of keratitis from the middle east showed an incidence of mk of 35 per 10,000 ( with 74% being associated with soft contact lens wear).27 the percentage of microbial keratitis cases caused by pseudomonas species ( most likely p. aeruginosa ) is shown in table 2 for different geographical locations.113,1518,2844 whilst p. aeruginosa / pseudomonas sp . are usually a predominant causative agent , temperate zones tend to have a higher incidence of gram - positive bacteria causing the disease and less aggressive keratitis.44 in most studies , pseudomonas sp . are usually isolated in monoculture from cases of mk , however , a study from thailand demonstrated that in 46% of mk cases caused by pseudomonas sp . other gram - negative bacteria including escherichia coli , acinetobacter calcoaceticus , klebsiella pneumoniae , serratia marcescens , and enterobacter sp . could also be cultured.16 however , the predominance of p. aeruginosa during contact lens - associated mk is not always seen . for example , even though 29.4% of mk cases were associated with contact lens wear in a study from wellington , new zealand , no cultures of p. aeruginosa were reported.19 the predominant gram - negative bacteria isolated was moraxella sp . ( 12.5% of all bacterial isolates),19 and this predominance of moraxella sp . from mk scrapes has been reported from a study in christchurch , new zealand.45 climate may also affect the incidence of p. aeruginosa keratitis . in australia , the incidence of p. aeruginosa contact lens microbial keratitis ( clmk ) is increased in tropical compared to temperate zones , whereas the incidence of serratia marcescens clmk is higher in temperate zones.44 determinants of the clinical outcome of mk include distance of the ulcer from the limbus and the minimum inhibitory concentration ( mic ) of the first antimicrobial used or lowest mic if combination therapy was used.5 a large multicenter clinical trial with participants from india and the us has shown that p. aeruginosa ulcers were significantly worse for visual acuity than patients with other bacterial ulcers , but interestingly showed significantly more improvement in 3-month best - spectacle - corrected visual acuity than those with other bacterial ulcers.46
pseudomonas sp . are often associated with the largest ulcers.5 ideally , every case of presumed mk should be scraped for microbiological investigations , especially with the possibility of increasing isolation of antibiotic - resistant microbes . however , it must be borne in mind that there is often a small ulcer and so relatively little material might be obtained . corneal scrapings obtained with a surgical blade ( eg , bard - parker blade # 15 ) , kimura spatula , or 21-gauge disposable needle should be inoculated on chocolate agar , sheep blood agar , and into thioglycolate broth , and incubated at 35c . sabouraud s agar plates should also be used and these are maintained at 25c to enhance fungal growth . samples may also be inoculated onto non - nutrient agar and into brain heart infusion broth . scraping of small lesions ( smaller than 2.0 mm ) is probably not worthwhile , and patients with such lesions can be empirically treated . scrapes should not only be sent for microbial culture , but also smeared onto microscope slides and examined by gram stain ( and potassium hydroxide if fungal keratitis is suspected ) . however , as there is often only a small amount of material , cultures on agar plates for bacteria and fungi , as well as gram stain , are most often used . the following clinical parameters are useful in monitoring the clinical response to antibiotic therapy : blunting of the perimeter of the stromal infiltrate , decreased density of the stromal infiltrate , reduction of stromal edema and endothelial inflammatory plaque , reduction in anterior chamber inflammation , re - epithelialization , and cessation of corneal thinning . therapies used in different geographical locations are shown in table 3.4,5,8,9,12,16,31,39,42,4749 monotherapy with ciprofloxacin ( 0.3% ; or another fluoroquinolone ) is commonly used . in severe cases , subconjunctival injections of gentamicin may be used.31 the combination of two fortified antibiotic preparations , 1.5% gentamicin and 5% cefuroxime , covers almost the entire range of common bacterial pathogens causing corneal ulcers . randomized controlled trials have demonstrated that monotherapy with fluoroquinolones has non - inferiority and fewer side effects compared with combination therapy.50,51 a study from iran recommended the concurrent use of ceftazidime and amikacin or ceftazidime and ciprofloxacin as the initial treatment based on antibiotic sensitivities of isolates , and as all p. aeruginosa isolates were resistant to chloramphenicol , trimethoprim , vancomycin , and cefazolin , these antibiotics should probably not be included in any empirical antibiotic regimen in that country.47 data from taiwan41 demonstrate that ciprofloxacin was statistically significantly more effective against p. aeruginosa than the combination of cefazolin and gentamicin . whilst therapy is most often , if not always , commenced prior to results of cultures being obtained , a study from japan has shown that the therapeutic outcome was better when antimicrobial agents were selected based on culture results , thus reemphasizing the importance of culture studies.18 sometimes a combination of piperacillin / tazobactam might be effective with unresponsive p. aeruginosa mk.52 the use of steroids in conjunction with antibiotics has been a source of controversy for many years , despite the demonstration in an animal trial that the combination of tobramycin and dexamethasone was safe and resulted in the reduction of clinical scores and lower bacterial numbers in the cornea.53 however , a recent large scale multicenter clinical trial that enrolled subjects in india and us found that the use of moxifloxacin combined with prednisolone phosphate did not improve overall clinical outcome.46 sensitivity of pseudomonas sp . to antibiotics by geographical region is shown in table 4.2,7,8,16,20,21,2831,35,37,4042,47,54 generally p. aeruginosa is sensitive to fluoroquinolones , but there have been reports of multi - resistant p. aeruginosa strains , for example , from australia where the strains were resistant to ciprofloxacin , gentamicin , tobramycin , and amikacin but was sensitive to ceftazidime , imipenem , meropenem , and timentin.55 recent data examining possible synergistic activity between different classes of antibiotics against p. aeruginosa has shown that a combination of meropenem / ciprofloxacin gave the lowest mean fractional inhibitory concentrations ( ie , best synergy ) for p. aeruginosa isolates , with 90% of isolates showing an additive or synergistic effect56 and so this may be a promising therapy for the more resistant strains . comparisons between tables 3 and 4 demonstrate that ciprofloxacin is the most commonly prescribed antibiotic to treat mk in iraq , however only 62% of pseudomonas sp . likewise for india , tobramycin is one of the most commonly prescribed antibiotics but only 30% of pseudomonas sp . this is different from all other most commonly prescribed treatments in other geographical locations which are > 95% effective . whilst there are no true cut - off points for sensitivity or resistance for topically applied antibiotics , it is perhaps important for those countries where there are high levels of apparently resistant strains of p. aeruginosa to monitor the clinical outcome of mk very carefully . in conclusion , pseudomonas sp . ( predominantly p. aeruginosa ) is often isolated from cases of contact lens - induced microbial keratitis . the most commonly used therapies to treat this disease are either monotherapy with a fluoroquinolone or fortified aminoglycosides . strains of p. aeruginosa isolated from contact lens - induced mk are commonly still sensitive to these antibiotics , but geographic differences in sensitivity exist and should be taken into account when recommending treatment options . | pubmed and medline were searched for articles referring to pseudomonas keratitis between the years 2007 and 2012 to obtain an overview of the current state of this disease .
keyword searches used the terms pseudomonas
+ keratitis limit to 20072012 , and [ ulcerative or microbial ] + keratitis
+ contact lenses limit to 20072012 .
these articles were then reviewed for information on the percentage of microbial keratitis cases associated with contact lens wear , the frequency of pseudomonas sp . as a causative agent of microbial keratitis around the world , the most common therapies to treat pseudomonas keratitis , and the sensitivity of isolates of pseudomonas to commonly prescribed antibiotics .
the percentage of microbial keratitis associated with contact lens wear ranged from 0% in a study from nepal to 54.5% from japan
. these differences may be due in part to different frequencies of contact lens wear . the frequency of pseudomonas sp . as a causative agent of keratitis ranged from 1% in japan to over 50% in studies from india , malaysia , and thailand .
the most commonly reported agents used to treat pseudomonas keratitis were either aminoglycoside ( usually gentamicin ) fortified with a cephalosporin , or monotherapy with a fluoroquinolone ( usually ciprofloxacin ) . in most geographical areas , most strains of pseudomonas sp .
( 95% ) were sensitive to ciprofloxacin , but reports from india , nigeria , and thailand reported sensitivity to this antibiotic and similar fluoroquinolones of between 76% and 90% . |
there are three unpaired visceral branches of the abdominal aorta , the celiac trunk ( ct ) , the superior mesenteric artery ( sma ) and the inferior mesenteric artery ( i m a ) , proceeding in a cranio - caudal direction . the two upper unpaired visceral branches originate from the aorta in a prefixed site at the level of the first lumbar vertebra , whereas the lower one has more variable points of origin . this is true for all ages and for both genders ( 1 ) . on the other hand , the i m a is diverged generally at the level of the third lumbar vertebra , considerably below the origin of the sma and the ct ( 2 ) . thus , there have been many reports on the variations between ct and sma , but the variations of the i m a are found to be extremely rare . the abdominal vessels , especially the ct and sma , frequently show diverse anomalies in their origin and course to date ( 3 - 7 ) . either component of the ct sometimes arises directly from the abdominal aorta or independently from the aorta . in addition , the ct unites with the sma at their origins to form a common trunk , the celiacomesenteric trunk ( cmt ) ( 3 ) . the rare occurrence of cmt at the level of the first lumbar vertebra is stated to be 1%-2.7% . according to report and review on other abdominal arterial anomalies associated with the cmt , a left colic artery arises from the distal portion of the cmt , corresponding to the sma ( 4 ) . the left colic artery arising from the sma has been reported to occur at a low frequency of 1% . the prevalence of the variation on the i m a , such as the absence of the i m a or the formation of a common mesenteric artery in which the i m a joins the sma , is extremely rare ( 8) . we encountered a rare variation of the i m a branching out of the sma during a routine dissection of an 82-yr - old female cadaver at our university in 2011 . during a routine dissection carried out at jeju national university medical school in 2011 , we found a case in which the i m a arose from the sma . this variation was observed in an 82-yr - old korean woman cadaver , whose cause of death was ' unknown ' the protocol for the current report did not include any specific issue that needed to be approved by the institutional review board of the jeju national university and it conformed to the provisions of the declaration of helsinki in 1995 . gross dissection was performed in the customary fashion . in order to indicate the arteries , the distance between two branches of the abdominal aorta and the external caliber of the main arteries at their origin were also measured . the typical vascular network ( fig . 1a , b , and b1 ) of abdominal aorta was absent , and the ct and the sma were the only unpaired visceral branches out of abdominal aorta ( fig . 1c , and c1 ) . since the i m a did not arise from the abdominal aorta , the sma can be also named as the common mesenteric artery or bimesenteric trunk . the ct and the sma arose at a distance of 14.3 cm and 12.5 cm respectively from the bifurcation of the abdominal aorta to the right and left common iliac arteries , which correspond to the level of the first lumbar vertebra . the sma had a caliber of 8 mm , and was approximately 18 mm below the ct ( 10 mm in external caliber at its origin ) . the sma gave off its first ( inferior pancreatico - duodenal artery ) and second branch 27 mm and 35 mm away from its origin , respectively ( fig . the second branch ( 3 mm in external caliber ) , corresponding in course and distribution to the i m a , gave rise to the classical branches of the i m a , the left colic artery , the sigmoid , and the superior rectal arteries ( fig . after the second branch , the sma indicated classical branching pattern which proceeded inferiorly and laterally to be attached to the right and middle colon . this is the first report on the common mesenteric artery , which the i m a arises from the sma , of a korean . among a total of ten cases including the present case , the occurrence of common mesenteric artery were observed in cadavers ( 2 , 9 - 14 ) except for the case of a common arterial trunk among the ct , sma and i m a in a radiological description ( 15 ) . all reports were on male , but the variation observed in the case of yamasaki et al . ( 13 ) had been the only female case until the current case was discovered . all reported cases were associated with an artery that shared the same characteristics of the ordinary i m a , even though it arose from the sma instead of the abdominal aorta . in all cases , the i m a always diverged as the first branch of the sma , except for a gwyn and skilton ( 10 ) . in the present case , the i m a arose as a second branch 35 mm away from the origin of the sma , and the first branch ( inferior pancreaticoduodenal artery ) was 27 mm distal to the sma . besides , katagiri et al . ( 4 ) reported that a left colic artery arose from the cmt and that the sigmoid and the superior rectal arteries branched out of the original i m a . although the presence of a cmt is rare ( 3 , 5 ) , the occurrence of the i m a arising from the sma , rather than the abdominal aorta , is even rarer . benton and cotter ( 16 ) reported a variation of the double imas , which arose independently from the abdominal aorta . other researchers rarely described any other variation of i m a ( 17 , 18 ) , and thus lippert and pabst ( 8) mentioned the frequency of the variation in which the i m a arises from the sma to be less than 0.1% . ( 12 ) suggested the embryological explanation for the development of the celiac - mesenteric system ( fig . namely , the seven primitive splanchnic branches arising from the abdominal aorta in embryo are connected by the ventral longitudinal anastomosis among the roots of the omphalomesenteric artery , of which some disappear and the classical branches - the left gastric , common hepatic , splenic , of ct , the sma and the ima - are formed . the longitudinal anastomosis vessels disappear between the sma and i m a during the process of development . the common mesenteric artery can be regarded as an anomaly of the arterial convergence like in this case ( 2 , 12 , 14 ) . clinically , the functional results after sigmoid colectomy following ligation or preservation of the i m a was reported ( 19 ) . ligation of the i m a caused a higher rate of fecal incontinence ; on the other hand , preservation of the i m a during sigmoid colectomy lowered the frequency of postoperative impaired anorectal function . since both the sma and i m a supply the whole colon , identification of the i m a is particularly important when performing surgical and radiological procedures . obstructive diseases such as thromboembolism of the common mesenteric artery ( 2 ) and en bloc resection of the head of the pancreas including the superior mesenteric vessels ( 20 ) can cause fatal colonic degeneration , associated with the area requiring the blood supply of the i m a . | anatomical variations of the inferior mesenteric artery are extremely uncommon , since the inferior mesenteric artery is regularly diverged at the level of the third lumbar vertebra .
we found a rare case in which the inferior mesenteric artery arose from the superior mesenteric artery .
the findings were made during a routine dissection of the cadaver of an 82-yr - old korean woman .
this is the tenth report on this anomaly , the second female and the first korean .
the superior mesenteric artery normally arising from abdominal aorta sent the inferior mesenteric artery as the second branch .
the longitudinal anastomosis vessels between the superior mesenteric artery and inferior mesenteric artery survived to form the common mesenteric artery .
this anatomical variation concerning the common mesenteric artery is of clinical importance , performing procedures containing the superior mesenteric artery . |
the levonorgestrel intrauterine system ( lng - ius ) , originally developed for long - term contraceptive use , has shown to have a profound effect on the endometrium . the system has been used extensively for the treatment of heavy menstrual bleeding and for the conservative treatment of non - atypical as well as atypical endometrial hyperplasia ( wildemeersch et al . , 2003 , 2007 ; buttini et al . , 2009 ; 2014 ) and even for early endometrial adenocarcinoma ( wildemeersch et al . , 2010 ) . during the years 2001 - 2013 we performed a pilot study on 120 patients with a particular type of lng - ius fibroplant ( apcor research , belgium ) for the conservative management of benign and/or premalignant uterine conditions . part of that study concerned the clinical results of 13 patients where endometrial hyperplasia was found after investigative hysteroscopy and d&c , eleven among them showing atypical hyperplasia / endometrioid intraepithelial neoplasia. benign endometrial polyps were found in another 23 patients ( janssens , 2013 ) . all 36 patients were treated by the insertion of the lng - ius , aiming at preventing recurrence or worsening of the endometrial pathology . informed consent before entering the study had been obtained before receiving the experimental device . patients were regularly followed - up as appropriate , while avoiding hysterectomy as much as possible . in this report , we describe a patient who presented with the patient is a 44-year old premenopausal woman who consulted with heavy menstrual bleeding and dysmenorrhea . pelvic ultrasound revealed a thick irregular endometrium ( maximum thickness 22 mm ) presumably polypoid , in an otherwise normal uterus . the histological diagnosis of the specimen was atypical hyperplasia / endometrioid intraepithelial neoplasia , with architectural atypia grade 3 and cellular atypia grade 1 . informed consent was obtained and a fibroplant lng - ius was inserted and anchored in the uterus in november 2001 . meticulous follow - up was conducted , i. e. including at least a yearly pelvic ultrasound and an endometrial pipelle ( endometrial suctionapparatus ) biopsy . march 2004 new pipelle samples were taken , showing again arrested secretion , areas of indifferent aspect , suggesting complete regression of atypical hyperplasia . pelvic ultrasound prior to the biopsy showed a normal uterus with a quasi - atrophic aspect of the endometrium , endometrial thickness less than 3 mm and a correctly positioned lng - ius . colordoppler flow study of the uterine artery showed a ri ( resistance index ) of 0.77 , as seen normally in the postmenopausal period . eight months later our patient was referred to a tertiary centre for extensive ultrasound investigation , which confirmed our findings . in september 2006 , a new d&c was performed . hysteroscopy revealed only a discrete irregular aspect at the posterior wall of the uterine cavity . the fibroplant lng - ius was still correctly anchored in the uterine fundus , and easily removed with simple traction . endometrial sample showing glandular complexity with stratification , loss of polarity , more eosinophilic cytoplasm , nuclear enlargement and atypia ( h&e 100 ) . a new fibroplant lng - ius was inserted in october 2006 . in september 2009 , histological examination showed important decidual transformation , probably hormonally induced and the lng - ius was replaced for the second time . a last endometrial sample was taken in october 2010 , showing chronic non - specific endometritis. from 2011 until now the patient was followed regularly , showing an atrophic uterus with a lng - ius inside . the woman is in amenorrhea since about 10 years and apparently very happy with this treatment and follow - up schedule . atypical endometrial hyperplasia , also called adenocarcinoma in situ , is a well - known precursor of overt endometrial carcinoma . a rate of 45.9% of endometrial carcinoma was found in hysterectomy specimen in women with this particular subtype of endometrial hyperplasia ( pennant et al . , 2008 ) . as was experienced in the observational study we conducted , meta - analysis on the oncogenic potential of polyps reveals a malignancy rate between 0.8 and 8% ( lee et al . , 2010 ) . in a recently published prospective belgian study of 1220 pre- , peri- and postmenopausal women with abnormal uterine bleeding atypical hyperplasia was found in one single patient , i.e. 0.1 % of the total cohort studied , belonging to the post - menopausal group of 454 women ( van den bosch et al . , 2015 ) . endometrial hyperplasia without atypia was found in 48 patients , about 40 times more frequently . in this perspective , the pre - menopausal patient with atypical endometrial hyperplasia we presented seems a rather exceptional case . conservative treatment of atypical endometrial hyperplasia with lng - ius can be considered in selected cases , such as in women who wish to preserve their fertility . however , conservative treatment carries an inherent oncologic risk as no correct staging is possible and the risk of missing a concurrent ovarian cancer can not be neglected . therefore , patients opting for conservative treatment should have a strict gynaecological follow - up with regular endometrial biopsy and pelvic ultrasound . endometrial hyperplasia has been treated before in other centres with lng - ius . in an australian systematic review a 96% regression rate for nonatypical endometrial hyperplasia treated with lngius was found ( buttini et al . , there was ( also only ) one patient with atypical endometrial hyperplasia , treated with a lng - ius for more than seven weeks . the patient had normal endometrial histology on subsequent assessment . in a korean study ( lee et al . , 2010 ) complete regression of endometrial hyperplasia was achieved in all 12 cases . in the ( also single ) case of atypical hyperplasia , the regression was attained at the 9th month after insertion of the lng - ius . a norwegian research group found lng - ius to be effective at reducing the occurrence of
hyperplastic endometrial polyps , with effectiveness superior to that of oral progestin and observationonly ( arnes et al . , 2014 ) . furthermore , in the first prospective comparative trial of its kind conducted by the same group , a study was performed to examine the results of the treatment of 170 patients with endometrial hyperplasia which were treated either by an oral progestogen or by lng - ius : all 53 women treated with an lng - ius showed histologically normal endometrium after 6 months of therapy ( rbo et al . , 2014 ) . in this study nineteen patients were diagnosed with atypical hyperplasia and six of them were successfully treated with lng - ius . the authors concluded that cyclical progestogens are found to be less effective compared with continuous oral therapy and lng - ius , and should not be used any more for this indication . we present a case of a 44-year old premenopausal woman with a premalignant uterine polyp opting for conservative therapy . today , 14 years after the start of her treatment , the patient is in good health and very happy with this therapeutic option . considering the rather limited value of a case - report the positive experience should encourage further studies , especially since recent literature data indicate that conservative treatment of premalignant endometrial pathology is a real option with high success rate in selected women such as patients who want to preserve their fertility , have contraindications for surgery or refuse hysterectomy | prevention of progression to invasive carcinoma in patients with a premalignant endometrial lesion using longterm treatment with levonorgestrel ( lng ) releasing intrauterine systems ( ius ) remains controversial , especially when manifest cellular atypia has been found in the endometrial biopsy specimen .
we present a case of a 44-year old premenopausal woman with a premalignant uterine polyp who declined hysterectomy and was followed - up for more than 12 years after the first lng - ius was inserted .
endometrial atrophy installed , no pathology was detected and hysterectomy was thereby successfully avoided .
the positive experience in this case should encourage further studies as literature data indicate that conservative treatment of premalignant endometrial pathology is a real option with a high success rate for women who have a contra - indication for surgery , refuse the classical approach for personal reasons or want to preserve their fertility . |
osteopetrosis ( op ) has also called with its historical names as a albers - schnberg disease , which was firstly described by a german radiologist [ 1 , 2 ] . the main cause of the disease is osteoclastic activity defect , which results hypersclerotic fragile bone [ 3 , 4 ] . autosomal recessive op ( aro ) has a two subtype , which are infantile malignant op and intermediate type . infantile malignant aro has diagnosed within the first year of the life that has fatal clinical progression due to the bone marrow deficiency and infection . important neurological symptoms are cranial verve palsies due to the obliteration of cranial nerve foramina such as vision loss , deafness , and facial paralysis . the most common neurological finding is visual loss due to the optic nerve compression within the optic channel . in contrast to the aro , autosomal dominant op ( ado ) is described as adult benign type due to the normal life expectancy [ 2 , 3 , 7 ] . ado diagnosis is given easily by recurrent bone fracture history , osteomyelitis , radiologic and laboratory findings , and genetic examination . the typical signs are bone within the bone on the end bones , sclerotic appearances on the long bone and multiple previous fracture lines . other radiological findings are hypoplastic maxillary sinus , teeth deformity and multiple carious . the genetic mutation in the chloride channel 7 ( clcn7 ) gene has been shown . clcn7 gene mutations are heterogeneous , but the result is osteoclastic activity failure [ 4 , 6 ] . she was evaluated with magnetic resonance imaging ( mri ) , which showed chiari i malformation with a 7 mm descent of cerebellar tonsils ( fig . 1 a and b ) . computed tomography demonstrated diffuse calvarial thickening and loss of the medullary space ( fig . 2 ) . her past medical history was consistent with left eye surgery due to amblyopia when she was a child and she was blind in her left eye . radioactive i treatment had been given due to the graves disease and hyperthyroidism ; therefore , she was hypothyroidic and was using levothyroxine daily . her physical examination revealed prominent occipital area and midfacial hypoplasia . increased cortical thickness in her long bones c ) . there were no abnormal findings on neurological examination except of left eye amorozis . large enough posterior fossa craniectomy with c1 laminectomy was performed with ssep and mep monitoring . she developed superficial wound infection , which was treated with simple washout and antibiotics . figure 1:(a ) sagittal t2-weighted image showing cerebellar tonsillar herniation and diffuse thickening of the occipital bone . ( b ) axial t1-weighted image showing compression on the upper cervical spinal cord ( green arrow ) and cerebellar tonsillar herniation ( red arrow ) . figure 2:axial ct image ( bone window ) showing diffuse calvarial thickening and loss of the medullary space . figure 3:patients ' picture showing midfacial hypoplasia on the face ( a ) , x - ray graphy of the right femur ( b ) and x - ray of left femur ( c ) showing diffuse cortical thickening . ( a ) sagittal t2-weighted image showing cerebellar tonsillar herniation and diffuse thickening of the occipital bone . ( b ) axial t1-weighted image showing compression on the upper cervical spinal cord ( green arrow ) and cerebellar tonsillar herniation ( red arrow ) . axial ct image ( bone window ) showing diffuse calvarial thickening and loss of the medullary space . patients ' picture showing midfacial hypoplasia on the face ( a ) , x - ray graphy of the right femur ( b ) and x - ray of left femur ( c ) showing diffuse cortical thickening . op is a rare and hereditary skeletal disease , which resulting from destructive or absence of osteoclastic activity . over this case is the second ado case associated with chiari type i , which presented with hindbrain headache and numbness on the upper extremity without other cranial nerve compression sign . mri revealed brain stem compression , tonsillar herniation , occipital bone thickening and shallow posterior fossa . the first diagnosis was chiari type i , but detailed history , endocrinologic and radiologic work - up yielded as an ado , which was a final diagnosis . reported that untreated aro patients died by the age of 4 years because of the pancytopenia and recurrent infection , which had a 75% rate . there are two type describe , which have different clinical , biochemical and histological manifestation . type i has osteosclerosis on the cranial vault , while type ii has end - plate thickening of vertebral body ( rugger jersey spine ) and end bones in the pelvis . both the types are strictly family related and seen in late childhood [ 3 , 10 ] . the fracture frequency is increased in type ii and normal type i [ 1 , 2 , 4 , 8 , 10 ] . de oliveira et al . reported that there is no need to perform genetic study to confirm the disease . tohidi and bagherpour suggest that ado is rare condition , which can be asymptomatic . therefore , accurate diagnosis can be achieved with the proper clinical , endocrinologic and radiologic investigation . calcium , phosphorus and alkaline phosphatase levels are usually within the normal limits in the benign op [ 7 , 10 ] . dlouhy and menezes proposed in their report that even if their report is the first case ado with chiari , further study is needed . in their report , the cause of the chiari malformation in the op explained as unclear . moreover , the absence of the osteoclastic activity leads to underdeveloped occipital bone , and this results in a smaller posterior fossa . in conclusion , however , patients can present with only chiari symptoms without other cranial nerves compression symptoms ; therefore , ado can be overlooked for differential diagnosis . symptomatic chiari malformation needs surgical intervention , but it should be kept in mind that the patients with chiari malformation should investigate differential diagnosis for ado . whole skeletal survey must be done , whether there are sclerotic chances , thickening skull base , bone within the bone appearance , rugger jersey spine , erlenmeyer flask deformity on the long bone and fracture line on the bone . | osteopetrosis ( op ) is hereditary x - linked , autosomal recessive ( aro ) , or autosomal dominant ( ado ) skeletal disease .
aro has two subtypes , which are infantile malignant and intermediate type .
aro and x - linked op have poor clinical outcome .
ado is called adult benign type because of the normal life expectancy , which has type i and type ii . here , the authors present an ado patient with chiari type i. concomitant ado with chiari type i malformation is an extremely rare condition .
literature research yielded only one case report to date . |
as medical house officers who trained together in internal medicine in the 1980s , we ( jnk , sal ) believed we knew who provided the highest - quality care . the best interns were those who spun the urine , gram - stained the sputum , and wrote notes on late - night admissions before the sun rose the next morning . the best residents had deep funds of knowledge , provided pertinent references , and did not leave the hospital until they had checked the radiographs of all patients admitted to their service . the best attending physicians had wise judgment , impeccable integrity , and stayed late at night to discuss difficult cases with families and house officers . today , the medical profession , and society at large , defines quality in terms of the capacity of the physician s health care organization to promote health and prevent error . the physician s distinctive role is diminished ; in fact , some argue that medicine should emulate the equivalent actor model of commercial air travel , in which passengers have full confidence on boarding a flight without knowing or caring who the pilot is.1 quality today focuses on systems and organizations . the medical community identifies high - quality hospitals as those with computerized order entry systems , online alerts to prevent drug interactions , and intensive care units staffed with fellowship - trained intensivists . similarly , the present - day high - quality physician practices in a group with reminder systems for identifying patients who should have flu shots , mammograms , and cholesterol and psa screenings . increasingly , these expectations are leveraged with explicit performance measures.2,3 these ideas , many embodied in the institute of medicine s landmark report on quality , to err is human,4 have fueled initiatives to improve quality at the system level.511 quality has become an increasingly frequent concern of health policy makers and researchers . we performed a pubmed review of english language articles on quality of care in the united states and documented an increase from 6 articles per year during the period 19661979 , to 55 per year from 1980 to 1994 , and 207 per year from 1995 to 2005 . however , the proportion of articles on quality of care that focused solely on the physician dropped from 34% in the first period ( 19661979 ) to 18% in the latter 2 periods ( 19802005 ) . meanwhile , we note an increase in the number of articles on quality that focus on the implementation and use of information systems to improve safety . these findings reflect the transformation from physician - oriented to systems- and technology - oriented concepts of quality ( see the appendix for the methodology of the literature review ) the physician - centered concept of quality emerged from a crisis over a century ago . more than 150 schools of medicine existed in the 1800s all over the united states , with no formal accreditation . charges of charlatanism and quackery were commonplace.12 in response , the flexner report of 1910 called for dramatic reform in medical education with an emphasis on standardization , accreditation , licensing , and commitment to scientific methods.13 many medical schools closed following the flexner report . those that survived catalyzed a transformation in medical practice from craft to profession.12 as a profession , medicine enjoyed authority and autonomy through the early and middle decades of the twentieth century . during these years , physicians were largely self - governed and self - regulated . notions of quality care were based on abstract but noble ideals for doctors , including respectful personal relationships with patients.14 by the middle of the twentieth century , the profession was thriving . physicians delivered to patients groundbreaking achievements of medical science , including antibiotics , antipsychotics , cardiac revascularization , and orthopedic implants . however , the end of the twentieth century brought significant changes to the medical practice , with attendant consequences for quality . first , the locus of care shifted from the home and the small physician office to the hospital and the large multispecialty practice . second , because physicians were reimbursed on a fee - for - service basis , they had no incentive to keep costs in check . other models of risk sharing arose in response to rising costs , and with them , a corporate presence emerged in medicine . third , the aging of the population put an increasing proportion of citizens at risk for adverse effects of an ever more aggressive diagnostic and therapeutic armamentarium . fourth , reports documented an epidemic of medical errors,58,15 spurring thinking about containing and reducing these errors . the history of quality measurement in the last 30 years provides another lens into the shift from physician - based to systems - based notions of quality . many initial efforts at quality assurance focused on physician error , typically using a peer review approach . berwick16 pointed out that such efforts to identify bad apples created anxiety and defensive maneuvering among physicians but did little to improve care . a cornerstone of care improvement initiatives in the late twentieth century was the use of comprehensive information systems that have so far been unaffordable for many small practices and hospitals.17 experts in quality of care pointed to the successes in error reduction reported by u.s . and japanese industries that subscribed to continuous quality improvement techniques.9 all of these developments favored the creation of large health care delivery systems and the definition of quality as the ability to deliver timely , appropriate , safe , and evidence - based care . the physician of the mid - twentieth century worked long hours . in reality , this as the century closed , a newer generation of medical professionals was less willing to sacrifice personal and family priorities . the focus on controllable lifestyle increased as couples entered the physician workforce , both partners now needing to juggle professional and home interests.1820 the new generation of physicians favored limited working hours , shared practices , night float coverage , hospitalist care of inpatients , and other structural factors permitting them to lead more balanced lives . physicians and other scholars have written thoughtfully about the tension between caring for others and caring for themselves,21 the challenges of humanistic care,22 and the difficulty of maintaining professional standards in large health care organizations.23 for example , the physician worklife study explicitly examined relationships between characteristics of the workplace , physician stress , and physicians physical and mental health.24 collaborations between physicians and other professionals ( e.g. , physician assistants , nurse practitioners ) represent but one approach to addressing physician overcommitment while ensuring quality care . if quality today is embodied in a system that delivers , not a physician who cares , what is the physician s role in quality ? we fully support the development of health care systems that leverage resources to deliver the right care to the right patient at the right time . however , we also wonder whether the focus on effective care systems dilutes the importance of attention to clinical nuance a patient s fearful glance , a subtle erythematous eruption , an emerging electrolyte disturbance . five years after to err is human was released , half of americans stated that they were dissatisfied with the quality of health care in the united states.25,26 patients are distraught when their physicians hurry in the office , do not look them in the eye , or send them home quickly from the hospital . they want clear explanations for their health problems and constructive suggestions on how to manage these problems . these dimensions of patient satisfaction have not been measured traditionally , but are now assessed by the national committee on quality assurance23 through the health plan employer data and information set . if physicians are held accountable for their satisfaction scores , the argument is that they will strive to improve the scores . patients are taking an active role in shaping health care delivery as well , as witnessed by the emergence of consumer - driven health care . we interpret the popularity of the boutique practice movement as a market expression of patients preferences for individualized care , and failure of the profession to deliver it . thus , the progress made in improving patient safety practices at the organizational level has not translated into patient admiration and trust in the profession . we suggest that the explanation may lie in the dichotomy discussed here between physician - based and systems - based concepts of quality . while the medical community focuses on error reduction , patients continue to seek trust , compassion , information , and reassurance from their physicians . we suggest that organizational efforts to improve quality must be coupled with a recommitment to these core values embodied in the definition of medical professionalism : hard work , mastery of a body of knowledge and skills , and empathic relationships with the patients whom physicians serve , placing patient interests above physician self interest.27 we suggest that physicians have , largely unwittingly , abdicated key elements of medical professionalism . while patients may be reassured by the increasing safety of america s hospitals , the kaiser foundation report suggests they still are disappointed with their care.25,26 in fact , many physicians share this vision and find , regrettably , that they must work increasingly hard to maintain the patient - centered care they provide . the american board of internal medicine ( abim ) has recognized the need to recommit to professionalism and has articulated principles and commitments to guide professionalism in medicine in the present era.24,28 these principles emphasize the primacy of patient autonomy and social justice and call for integrity , respect , and compassion among physicians . the society of general internal medicine ( sgim ) has also addressed these issues through working groups . we applaud the efforts of the abim , the sgim , and other organizations in this area and challenge our leaders to use technology , incentives , and other levers to reinforce fundamental patient - centered tenets of the profession . more generally , we urge that these essentially separate initiatives to reduce error in our hospitals on the one hand and to increase professionalism among physicians on the other be joined in a more comprehensive effort to improve the quality of medical care . using the pubmed search engine , we utilized the keyword quality of care to identify articles on quality . citations were excluded if they did not deal with quality of care , did not have an abstract , were not in english , or did not evaluate quality of care in the united states . within each period , we reviewed randomly selected citations until we found 50 per period that were not excluded . to estimate the number of articles dealing with quality of care in each of the 3 periods , we multiplied the total number of citations ( hits ) by the ratio of eligible citations we reviewed to the total ( eligible plus ineligible ) that we reviewed , and then divided by the number of years in the period . ( for example , in the period 19801994 , quality of care generated 1,792 citations . we estimate the number of citations in this period as \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ 1792 \times { { \left ( { { 50 } \mathord{\left/ { \vphantom { { 50 } { 108 } } } \right . \kern-\nulldelimiterspace } { 108 } } \right ) } } \mathord{\left/ { \vphantom { { { \left ( { { 50 } \mathord{\left/ { \vphantom { { 50 } { 108 } } } \right . \kern-\nulldelimiterspace } { 108 } } \right ) } } { 15\,{\text{years } } = } } } \right . \kern-\nulldelimiterspace } { 15\,{\text{years } } = } 55\,{\text{per}}\,{\text{year } } $ $ \end{document}. ) we completed a detailed coding form on the abstracts of the 50 eligible citations per period . the coding form classified the abstract as addressing physician - centered aspects of quality ( such as credentials , training , or volume ) or systems - centered aspects of quality . | for much of the twentieth century , quality of care was defined specifically in terms of physician characteristics and behaviors .
high - quality physicians were well trained , knowledgeable , skillful , and compassionate .
more recently , quality of care has been defined in terms of systems of care .
high - quality organizations develop and adopt practices to reduce adverse events and optimize outcomes .
this essay discusses this transformation from physician - based to organization - based concepts of quality and the consequences for patient care and medical professionalism . |
a 56-year - old male patient visited emergency room of our hospital with myalgia , chill and fever of 38.0c . he revealed intrahepatic ductal dilatation on the abdomen ct and positive antibody test for clonorchis sinensis . we conducted him brain mri which showed bitemporal signal change with enhancement and edema more prominently on the right side ( figure 1a ) . he was transferred to our neurology department . on cerebrospinal fluid ( csf ) study , white bood cell count was 8/mm ( 100% lymphocyte ) with normal glucose ( 52 mg / dl ) and increased protein ( 92 mg / dl ) . electroencephalography ( eeg ) showed 57 hz medium to high amplitude background slowing without epileptiform discharge . csf hsv type 1 polymerase chain reaction ( pcr ) was positive whereas csf hsv type 2 pcr was negative . we managed him with intravenous acyclovir ( 30 mg / kg / day ) for 3 weeks . except for slight drowsiness and memory impairment , the other neurologic deficit was not found . about hospital day , he showed characteristics change with irritability , overeating , and inappropriately increased sexual desire . we considered these phenomena as kluver - busy syndrome and tried him escitalopram ( 10 mg / day ) , valproic acid ( 1,000 mg / day ) and quetiapine ( 25 mg / day ) and these medications had some effect . on hospital day , he was discharged from hospital with memory deficit and mild general weakness . after 10 days he was admitted our department again with delusion and visual hallucination . through neurological examination , we found out that he got still memory impairment and newly developed mild weakness on his left limbs with nm ( video ) . on follow - up cerebrospinal fluid study , white bood cell count was 30/mm ( 100% lymphocyte ) with normal glucose ( 42 mg / dl ) and increased protein ( 80 mg / dl ) . follow - up brain mri showed signal change on bilateral white matter and right thalamus and internal capsule and bilateral temporal cortical laminar necrosis ( figure 1b , c ) . brain perfusion spect with technetium-99 m ethyl cysteinate dimer [ tc-99 m ethyl cysteinate dimer ( ecd ) ] reveals perfusion decrease in the right fronto - parieto - temporal cortices , thalamus , and basal ganglia ( figure 1d ) . eeg showed brief or long runs of periodic isolated triphasic waves on right frontotemporal electrode . and then we conducted eeg - electromyography ( emg ) monitoring , which showed no cortical electrical change with myographic pauses that were related with negative myoclonic jerks ( figure 2 ) . the duration of these electrical pauses ranged from 50 to 250 milliseconds ( ms ) . we concluded that the cause of nm was due to subcortical brain damage such as right thalamic lesion and the right internal capsule lesion resulted in left hemiparesis . and we added clonazepam to phenytoin . his nm got better with improvement of weakness and discharged from hospital with constant memory impairment after two - month hospitalization . asterixis may be seen with metabolic encephalopathy including hepatic , renal and respiratory failure , drug intoxication , and electrolyte imbalance . in such cases these features have led to the perception that asterixis represents a non - specific and non - localising abnormality of the motor system . in contrast to bilateral nm , unilateral cases are relatively uncommon and have been associated with a variety of focal cerebral lesions.6 previous study of stroke cases found 30 patients with nm out of 1,550 acute stroke patients and the lateral thalamus was the most frequently involved site with nm . but , other sites of brain such as basal ganglia , midbrain , pons and cerebellum were also involved.7 the pathogenic mechanism for nm remains unclear . the postural stability or tonic control of the extremities is related to multiple brainstem spinal pathways such as the vestibulospinal , reticulospinal , or rubrospinal tracts . the ventrolateral nucleus of the thalamus is the area in which cerebellar - rubral or vestibulocerebellar fibers converge , and is also connected with the prefrontal area.7 in our patient , the follow - up brain mri showed the lesions in right thalamus and internal capsule . so we supposed the pathophysiological cause of nm might be the lesion in the lateral thalamic region close to the internal capsule . hsv encephalitis is a morbid disease , with a 70% mortality rate in the absence of treatment and 10% with current antiviral therapy.1 movement disorders related to hsv encephalitis are not commonly reported in the existing literature . chorea , ballism , choreoathetosis and myoclonus have been infrequently cited in the literature as a clinical presentation of hsv encephalitis . the brain parenchymal damage due to hsv encephalitis may involve the thalamus or its pathways , the movement disorder may be observed . this is probably attributed to the fact that not every patient was examined with the stretching of the arm in previous hsv encephalitis . in this case nm with the deterioration of brain lesions in the course of recovery might be caused by whether the relapse or natural course of hsv encephalitis . , there is clinical deterioration , neuropsychologic deficits , expansion of the lesions in mri , and presence of viral replication or reactivation in the csf proven by pcr for hsv type 1 dna.8 we think in our case , the finding that the follow - up csf hsv type 1 pcr became negative means it was not the relapse . a previous report showed mri deterioration in hsv encephalitis despite clinical recovery.8 an immune - mediated process is suspected to be responsible for the mri progressive changes . we suppose that clinical deterioration of this case might be correlated with severe brain mri deterioration . emg silent periods are usually longer in duration ( 100400 ms ) as compared to subcortical myoclonus . subcortical nm is usually confirmed by the emg studies which clearly demonstrated that the involuntary movements were synchronous with loss of muscle tonus and emg silence without any detectable eeg correlate.5 in this case , emg silent periods were 50250 ms in duration and any detectable eeg correlate was not present . these findings were compatible with subcortical nm . in the literatures , treatment of subcortical nm antiepileptic drugs such as carbamazepine , valproic acid , phenytoin , lamotrigine and oxcarbazepine have been reported to be able to induce or aggravate nm . on the contrary , levitracetam , valproic acid and ethosuximide have been reported to be able to improve nm.5 initially we treated him with valproic acid for kluver - busy syndrome , then the patient got nm . but considering the unilaterallity of nm , controlateral thalamic lesion was more responsible for nm ( allowing for valproic acid effect ) . next visit , we treated him with phenytoin instead of valproic acid because of his first eeg finding of periodic isolated triphasic waves on right frontotemporal electrode , which could elicit cortical nm . the improvement may be related with drug effect or the healing process of right thalamic lesion . the patient showed negative myoclonus on his left arm and leg . when he was instructed to raise his both legs at supine position , his left leg drifted down with arrhythmical and jerky movements which were associated with brief loss of hip flexor and knee extensor muscles tone . because of his left leg weakness the examiner s hands supported his both legs . and then when he outstretched his both arms with hand pronation at supine position , his left hand also showed slight drift with irregular and jerky movements which were associated with the loss of finger and wrist extensor muscles tone . | various neurologic manifestations of herpes simplex virus ( hsv ) encephalitis have been reported on the literatures .
chorea , ballism , choreoathetosis and myoclonus were reported as movement disorders which might be related with brain lesion by hsv encephalitis , but negative myoclonus ( nm ) has never been reported before .
nm can be characterized as a shock - like involuntary jerky movement caused by a sudden , brief interruption of muscle activity .
we experienced a case of hsv encephalitis with nm in unilateral arm and leg .
in polygraphic monitoring , electroencephalography ( emg ) silent periods are 50250 ms in duration with no detectable emg correlate . |
lindau ( vhl ) disease.1 rchs are hamartomatous malformations most commonly detected in patients between ages 25 and 30 years.1 they are located juxtapapillary in 17% of cases.1 in general , juxtapapillary rchs ( jrchs ) are treated if they are progressive or if they affect visual acuity ( va).2 herewith , we report a typical case of progressive jrch that was successfully treated with a single injection of intravitreal ranibizumab ( ivr ) . a 44-year - old man , known to have vhl disease was referred to our ophthalmology clinic for routine fundus examination in 2008 . the patient had chronic renal failure after he underwent bilateral partial nephrectomy for renal cell carcinoma , and he also had spinal cord hemangioma diagnosed by spinal magnetic resonance imaging . on examination , results of slit - lamp examination of both eyes and fundus examination of the right eye were normal . fundoscopy of the left eye revealed an exophytic juxtapapillary capillary hemangioma along the nasal margin of the disc . no serous retinal detachment or exudates fluorescein angiography of the left eye showed early and late hyperfluorescence of the lesion with no leakage ( figure 2a ) . a computerized humphrey automated perimeter ( humphrey - zeiss , san leandro , ca , usa ) ( program 30 - 2 ) threshold test for visual field ( vf ) was normal in both eyes . no action was undertaken , and the patient was asked to return to the clinic yearly for follow - up . on subsequent follow - up visits , we noticed a progressive increase in the size of the hemangioma , which in 2012 reached a diameter double that of the optic disc ( figure 1d ) . also , some exudates and a minimal late leakage were observed in the peripapillary region on fluorescein angiography ( figure 2c ) . due to the rapid increase in size of the jrch , we decided to treat the patient with ivr . after detailed discussion with the patient , informed consent was received and ivr ( 0.5 mg ranibizumab ; lucentis , genentech , inc , san francisco , ca , usa ) was performed as an off - label treatment . three weeks after a single injection of ivr , vascular channels within the hemangioma became less prominent . six months after the single ivr , fundus examination showed a fibrotic , yellow - white appearance as a result of tumor scarring , and only few vascular channels could be seen within the hemangioma ( figure 3 ) . fluorescein angiography revealed a decrease in the vessels within the hemangioma and a decrease in late leakage ( figure 2d ) . during all after ivr , there was no further increase in hemangioma size , no significant systemic or ocular adverse events associated with ivr were noted , and no additional injections were needed . most rchs show slow progression over time , but a small percentage may regress spontaneously . if rchs enlarge over time and are left untreated , risk of exudation and subretinal fluid accumulation , cystoid macular edema , and retinal detachment increase , which can lead to progressive visual loss.2 the goal in the treatment of rch is preservation of va and the vf without destruction of the function of the retina around the tumor . treatment depends on the size and location of the hemangioma and the clinical manifestations.2 treatment strategies for jrch change from observation to laser coagulation , radiation therapy , transpupillary thermotherapy , vitreoretinal surgery , and photodynamic therapy ( pdt ) . in addition , juxtapapillary lesion therapies are often recalcitrant to treatment and the visual outcome of rch after treatment varies.3 in general , observation is chosen as the initial management of jrch , as they behave differently from the peripheral type of rch . some jrchs have been noted to remain stable for years.1,2 the treatment of these lesions should only be undertaken if vision is reduced or if there is lesion progression , as treatment usually leads to significant reduction in acuity due to adverse effects on the optic nerve and major retinal vessels.2 transpupillary thermoplasty has been used in the treatment of two reported cases of jrch that resulted in complete fibrosis , although one case developed optic atrophy.1 laser photocoagulation applied to the neural tissue surrounding the tumor can cause permanent scotomas.2 external radiation therapy has been shown to be effective in the treatment of optic disc hemangiomas,2 but due to the posterior location of the tumor and its proximity to optic nerve , all these approaches are risky and can result in permanent va deterioration or scotomas . pdt was shown to be effective in causing fibrosis and involution of the primary angioma , but its use on the peripapillary area is limited by vaso - occlusive effects . for larger tumors , verteporfin may only be activated on the surface of the tumor , and the reactive oxygen species may not cause closure of deeper tumor vessels.4 recent studies indicate that rch may depend on vascular endothelial growth factor ( vegf ) , as patients with vhl disease who present with rch have elevated ocular levels of anti - vegf.5 anti - vegf therapy has been reported to reduce vascular permeability by altering the balance of vasoactive cytokines like nitric oxide and endothelin-1 or by directly altering endothelial tight junction proteins.6 it is postulated that excessive accumulation of hypoxia - induced factor in the neoplastic stromal cells of rch leads to the production of other angiogenic factors that are able to maintain and promote the growth of primary hemangiomas.7 many cases have been reported in which jrchs were treated successfully with systemic administration of the anti - vegf ( vegf - receptor inhibitor ) su5416 , with a decrease in macular edema.79 it was believed that this treatment decreased the vasopermeability of the tumor , but the size of the tumor did not change.9 von buelow reported one single case treated with systemic anti - vegf treatment ( bevacizumab ) but with limited benefit . moreover , the systemic treatment could be associated with severe side effects.10 recent reports of combined therapy with anti - vegf and pdt have shown promising results in these lesions.1113 ziemssen et al reported a case of jrch successfully treated with a single combination of intravitreal bevacizumab and pdt . the patient had marked regression of the hemangioma , an increase in va , regression of the scotoma on vf testing , and macular drying that persisted at the 1 year follow - up visit.11 mennel et al reported a patient with jrch in the right eye that was associated with severe macular and peripapillary leakage.12 the patient was treated with two sessions of pdt ( sparing the part of the hemangioma located within the optic disc ) and five injections of bevacizumab . in this single case , the combination of anti - vegf and pdt appeared to be an effective strategy for the treatment of jrch without side effects.12 by combining anti - vegf with reduced fluence pdt , the outline of the primary angioma can be better delineated and may thus reduce the energy and the treatment area , thereby minimizing the damage to the neurological tissues.13 fong et al reported a patient with jrch had associated macular edema and epiretinal membrane.13 the patient was treated with ivr injection and pdt 1 week before pars plana vitrectomy and epiretinal membrane peeling surgery . the use of this triple combined approach resulted in improvement of va that remained stable at the 1 year follow - up visit.13 recently , some researchers have applied intravitreal anti - vegf therapy alone for the treatment of rch . ach et al reported the outcome of intravitreal bevacizumab for a rch located in the midperiphery.14 a total of nine injections ( administered every 1314 weeks ) of 2.5 mg bevacizumab were given intravitreally in the left eye over a period of 26 months . repeated intravitreal injections of bevacizumab stopped the growth of the present rch and perhaps inhibited the development of new hemangiomas in the treated eye . this is supported by the observation of ongoing growth of hemangiomas in the kidney , brain , and untreated fellow eye.14 dahr et al reported two patients with juxtapapillary or large peripheral angiomas secondary to vhl who were treated with intravitreal injections of pegaptanib ( 3 mg/100 l ) , given every 6 weeks for minimum of six injections per patient . one of these two patients had improvement in va , but no significant change in fluorescein leakage or tumor size was detected in either patient . the follow - up was at 1 year , and some adverse effects ( hypotony and tractional retinal detachment ) were reported.15 in our case , the patient had a progressive jrch with no associated leakage or exudates . we performed a single ivr in order to halt the progression of jrch and prevent all possible complications . ranibizumab likely inhibited vegf in and around the tumor and also suppressed permeability via the blockage of vegf . also , ivr seems to have the advantage of a decreased potential for retinal damage compared with other treatments for jrch . the patient was continuously followed on a routine basis to assess any need for further ivr if any progression of jrch was noted . in conclusion , ivr treatment can be effective in the stabilization of jrch resulting from vhl disease and in the prevention of the exudation of hemangiomas . ivr therapy might therefore be considered as an alternative treatment for progressive jrch , especially in patients with normal va . however , longer follow - up and greater numbers of cases are needed to confirm the effectiveness of ivr for progressive jrchs . | we report a case of a patient known to have a von hippel lindau disease with documented progressive juxtapapillary retinal capillary hemangioma ( jrch ) with well - preserved visual acuity ( va ) and visual field ( vf ) .
the patient received a single injection of intravitreal ranibizumab ( ivr ) .
six months after ivr injection , the jrch showed reduced vascularization , fibrosis , and mild shrinkage , and va and vf remained unchanged .
ivr therapy might therefore be considered as an alternative treatment for progressive jrch , especially in patients with well - preserved va and vf . |
pain is an integral part of human pathosis . however , its intensity , nature , type , duration , and progress differ with the degree of pathology . amongst the pain off hand reported by a majority of the population , one of the frequent is dental pain with higher intensity as comparable to other types of pain in account.1 etiological rationale for dental pain stands mostly for endodontic , periodontal or a combination . dental caries sought as a common disease only second to common cold forms one of the bases for endodontic problems thereby leading to pain following extensive involvement.2 pulpal inflammation as the sequel of dental caries figures a significant component of endodontic diseases . many general dental practitioners find management of the inflamed pulp challenging in their routine dental practice . to handle such challenges , clinicians use devitalizing agents where dental anesthesia fails to be effective . these agents are delineated as harmful to the patients posing facts being highly toxic , allergic , carcinogenic and mutagenic / genotoxic.3,4 in addition , there are reported cases that support the verity and proves the detrimental effects of agents . the reports range from gingival to the alveolar necrosis.5 - 7 in spite of the disadvantages noted , general dental clinicians are seen to use these products in their routine practice as per published literature from few countries.8,9 with the advent of information being available at fingertips in today s era due to the accessibility of data on internet and online databases , it is very easy for a clinicians to keep themselves updated with the current concepts . thus , it can be hypothesized that general dental practitioners are benefitting to update their knowledge with current technology in hand . the same also applies with updating of knowledge in respect to devitalizing agents since it forms a major part of dental practice . however , there is no latest reported literature available , which speaks about the behavior of general dental practitioners in relation to devitalizing agents considering the hypothesis aforementioned . thus , this study aims to analyze knowledge , attitude and practice of general dental practitioners regarding the use of devitalizing agents in their respective practice . keeping into account the reach limitation of contributors , the survey was limited to pune and nashik district of maharashtra , india . 100 practicing general dentists were randomly selected as per the list of practitioners available to local state association . the questionnaire was designed to cover general information of the participating dentist and concerning different aspects of devitalising agents . general information was in place to record the qualification of the practitioner , location / address for correspondence , experience - years of practice and whether the practitioner is a part of teaching faculty in a dental school . following collection of general information , questions formulated regarding devitalising agents were handed over to the professionals comprising 13 questions . these questions were subjected to internal and external validity by respective subject experts and persons known in the state of the art . the questions inquired as use of devitalising agents , type of agent used , purpose of use , frequency of use , usage in deciduous or permanent dentition , post - operative problems experienced ( if any ) , frequency of the complications experienced , duration of use of devitalising agent within the tooth , clinically observed changes in the tooth , reasons for usage and awareness regarding side effects / complications after use of devitalising agents . the questions were major in multiple choice questions , and the respondents were given the freedom to choose one or more suitable choices that meet their nature . the collected data was subjected to statistical analysis using spss ( statistical package for social sciences ) version 17.0 ( ibm statistics , chicago , illinois , usa ) . the response rate was 97% , of which the effective and complete replies received 77% ( 75 ) ; since 22 practitioners did not use devitalizing agents in their clinical practice . however , preliminary data was in receipt from all 97 respondents and thereby the demographic and professional results of the respondents was drawn . 37% ( 36 ) of the respondents had 1 - 5 years of professional experience whereas 16% ( 16 ) of the respondents had more than 16 years of work experience . very few respondents were using arsenic devitalising fiber , 3% and 5% sodium hypochlorite , phenol and camphorated mono - chloro phenol ( table 1 ) . however , the frequency of use amongst the majority was very less with its maximum use in permanent teeth as compared to primary teeth . 47% ( 35 ) of the respondents kept the devitalising agent inside the tooth for 3 - 5 days , whereas the practitioners reported the stay for 7 - 15 days as well . 52% ( 39 ) of the respondents obtained only partial devitalisation with use of the devitalising agents . majority of general practitioners ( 61% ) did not observe any post - operative complication following the use of devitalising agent . however , the remaining respondents reported severe post - operative pain 24% ( 18 ) as the most frequently observed complication . few others noted complications like swelling 5% ( 4 ) and gingival necrosis 7% ( 5 ) . 33% ( 25 ) of the respondents were not aware of the complications of devitalizing agents . the remaining respondents were aware of possible complications like necrosis of gingiva ( 43% ) , necrosis of bone ( 25% ) and severe pain ( 19%)(table 2 ) . awareness of side effects / complications of use of devitalising agent in study group . until date , there are few studies8,10 reported on the aspect of endodontic therapy , in general dental practice . however , this study has a better response rate since the survey was done in person rather using any other technological means . when compared to other research,8,10 the respondents using devitalizing agents in practice were much higher , in spite of maximum having knowledge related to the existing complications . the use of aldehyde containing agents was more in the present study than other studies where they have used the recently available devitalizing agents like arsenic based compounds . although , majority of practitioners belong to practice group of 1 - 5 years , the same could have confounding factors with respect to their education pursued till establishment of practice . the reasons reported by the practitioners for use of agents as fore - stated is probably due to the fact that these agents are perceived to be quick and painless in action , eliminating the necessity of administration of local anesthesia thus saving time and maximising patient cooperation . for pediatric patients , reasons for use of such agents were the difficulty they face in managing behavior of a child in administering local anesthesia . this projects the use of devitalizing agents overruled the importance of local anesthesia in endodontic treatment . the fact that more than half of the respondents obtained only partial devitalisation of the pulp suggests that the action of the devitalising agent is unpredictable , hence can not be completely relied upon . majority of dental practitioners did not observe post - operative complications , but few did . however , the existence of literature5 - 7 and the intensity of harm the patients experienced to date can not be ignored . in addition , few respondents in the present study also observed post - operative complications in variety . thus , it can be concluded that general dental practitioners in pune and nashik district of maharashtra , india do use pulp devitalizing agents in spite of possessing knowledge related to the complications . this arises the need today to establish better understanding of the subject by practitioners in the region through their involvement in continuing dental education programs of the title . however , it is also recommended that a similar study to be carried out considering a larger sample and covering major area which could represent national knowledge , attitude and practice of general dental practitioners regarding the use of devitalizing agents . | background : this study aimed to analyze knowledge , attitude and practice of general dental practitioners regarding the use of devitalizing agents in their respective practice.materials and methods : a total of 100 practicing general dentists were randomly chosen as per the list of practitioners available to local state association .
the questionnaire was designed to cover general information of the participating dentist and concerning different aspects of devitalizing agents .
the collected data was subjected to statistical analysis using spss ( statistical package for social sciences ) version 17.0 ( ibm statistics , chicago , illinois , usa ) .
descriptive statistics was drawn with respective percentages to have a comparative overview.results:the response rate was 97% , of which the effective and complete replies received were 77% ( 75 ) .
56% respondents used paraformaldehyde containing pastes .
majority of general practitioners ( 61% ) did not observe any post - operative complication following the use of devitalising agent .
33% ( 25 ) of the respondents were not aware of the complications of devitalizing agents.conclusion:thus , it can be concluded that general dental practitioners in pune and nashik district of maharashtra , india do use pulp devitalizing agents in spite of possessing knowledge related to the complications . |
a 6-year - old girl presented with unilateral hearing loss . at the physical examination , the otologic status and head and neck status were normal . pure tone audiometry and speech testing showed total deafness of the right side , but normal hearing thresholds in the left side . an examination with brain stem electric response audiometry ( bera ) showed no response from the right ear . for further evaluation of the seventh and eighth cranial nerves , high - resolution mr imaging was performed using the 3.0-t achieva system ( philips medical systems , best , the netherlands ) . mr imaging protocols included the following : a three - dimensional driven equilibrium radio frequency pulse ( 3d drive ) sequence ( tr / te 2000/200 , 1.2 mm slice thickness , matrix 336 336 , field of view 200 200 mm , number of acquisitions 1 ) and a t2-weighted fast spin - echo ( fse ) sequence ( tr / te 2555/80 , 2 mm slice thickness , matrix 400 313 , field of view 130 130 , number of acquisitions 2 ) on axial and parasagittal planes . parasagittal mr imaging was obtained perpendicular to the course of the acoustic nerve for the iac . as seen on temporal bone hrct , there were two narrow bony canals in the iac of the right temporal bone . the iac was divided by a bony septum into a relatively large anterosuperior portion ( 1.6 mm ) and a stenotic inferoposterior portion ( 0.8 mm ) ( figs . the anterosuperior portion ended in a wide connection in the facial canal and a narrow connection to the vestibule . the inferoposterior portion ended in narrow connections to the cochlea and vestibule . the facial nerve canal was intact along its course , except for a slightly widened labyrinthine segment . there were no abnormalities in the cochlea , vestibule , and semicircular canals as seen on hrct . as seen on mr imaging , the inner ear structures were normal , and the vestibulocochlear and facial nerves in the iac were clearly identified on the left side . on the right side , the cochlea , the vestibule , and the semicircular canals were normal . however , there was no identifiable neural structure in the inferoposterior compartment of the right duplicated iac . there was only one nerve structure , assumed to be the facial nerve , on the anterosuperior compartment of the duplicated iac ( figs . a narrow iac is a rare congenital malformation of the temporal bone and it usually exists along with several other abnormalities of the temporal bone and various systemic developmental anomalies , including cardiac , renal , skeletal , and intestinal malformations ( 1 ) . this malformation comprises only 12% of congenital temporal bone anomalies , and it is usually unilateral ( 3 , 4 , 9 ) . congenital isolated narrowing of the iac implies that there are no associated abnormalities in the inner ear , middle or external ear structures , and the absence of any acquired osseous condition predisposing to stenosis of the iac ( 10 ) . in this case , the iac was unilateral and there was no evidence of other temporal bone or systemic developmental anomalies . there are two widely accepted hypotheses that explain the association of a narrow iac with sensorineural hearing loss . one hypothesis is that the embryonic cochlear and vestibule induce the growth of the vestibulocochlear nerve and the bony canal develops around the nerve together with the facial nerve by chondrification and ossification of the mesoderm in the eighth week of gestation . when the vestibulocochlear nerve is aplastic or hypoplastic , the iac fails to develop and becomes stenotic ( 1 , 4 ) . the other hypothesis is that the primary defect is bony stenosis that inhibits the growth of the vestibulocochlear nerve and causes impaired transmission of an induction signal from the intact cochlea and vestibule . however , given the fact that the facial nerve function is usually preserved and it has a normal gross morphology in most cases of narrow iac , this hypothesis is less likely ( 1 ) . the facial nerve develops separately and it is later surrounded as the canal forms around the vestibulocochlear nerve . this may cause the duplication of the iac in some cases of a narrow iac with the aplastic or hypoplastic vestibulocochlear nerve . in this case , the right iac was duplicated with a bony septum that separated the canal into a relatively large anterosuperior portion containing an intact facial nerve and empty stenotic inferoposterior portion . to date , only five cases of a narrow iac with duplication have been reported . these investigators described a case of narrow iac with duplicated canals that joined at the fundus of the iac . cho et al . ( 5 ) reported a third case in 2000 and it was a case of narrow iac with duplication . however , two separate canaliculi of the iac showed similar diameters and did not join at the fundus of iac . these investigators described a similar case of narrow iac which was associated with bilateral enlargement of the vestibule and the lateral semicircular canal and bilateral dysplastic cochleae . this was a case of a narrow iac that was separated into two narrow bony canals . our case was an isolated unilateral narrow iac that was not associated with any other labyrinthine abnormality . in this case , the iac was divided by a bony septum into two bony canals that were joined at the fundus of iac . the normal range of the iac is 2 - 8 mm , with an average of 4 mm , and a narrow iac is defined when a canal is smaller than 2 mm in vertical diameter as seen on hrct ( 9 ) . the hrct scan is the diagnostic modality of choice as it provides excellent bony detail and high sensitivity and specificity in demonstrating the congenital inner ear and temporal bone abnormalities ( 1 ) . however , a ct scan has a limited role in assessing the neural components of the iac . ( 6 ) described seven cases with congenital or unexplained sensorineural hearing loss and five of those cases with a normal iac showed aplasia or hypoplasia of the vestibulocochlear nerve or of only the cochlear branch on mr imaging . in patients with a narrow iac , assessment of the cochlear nerve is crucial for selecting patients for cochlear implantation ( 4 ) . patients with aplastic cochlear nerves may not respond to the electric stimulation of the cochlear implantation . these reports emphasized that an hrct scan alone is not sufficient to rule out the risk of aplasia or hypoplasia of the vestibulocochlear nerve and that mr imaging should be performed to look for the defect of neural structures in the iac of patients with sensorineural hearing loss . mr imaging has become the modality of choice along with hrct for the assessment of abnormalities in patients with sensorineural hearing loss . especially , the use of high - resolution gradient - echo imaging provides detailed anatomical images of the vestibulocochlear and facial nerves of an iac and is essential for cochlear implant candidates ( 6 ) . there are several newly developed high - resolution gradient - echo mr imaging sequences which include 3d magnetization prepared rapid gradient echo ( mp - rage ) , 3d balanced fast field echo ( b - ffe ) , 3d fourier transformation - constructive interference in the steady state ( 3d ft - ciss ) , and 3d drive sequences ( 5 , 7 ) . these sequences are all three - dimensional for data acquisition and submillimetric in spatial resolution , which are optimal to evaluate the neural structures less than 1 mm in diameter , such as the auditory and facial nerves . in this case , we used a 3d drive sequence with a high field 3-tesla mri scanner to obtain detailed images for the neural structures of the iac . cho et al . ( 5 ) reported a case of narrow iac syndrome with aplasia of the vestibulocochlear nerve and intact facial nerve that were successfully demonstrated by using parasagittal reconstruction mr imaging . in this case , the iac was narrow and was composed of two separate canaliculi as seen on hrct . on 3-t mr images using 3d drive and a t2-weighted fse sequence with axial and parasagittal planes perpendicular to the course of the iac , there were a relatively larger anterosuperior portion containing the intact facial nerve and a stenotic inferoposterior portion without any neural contents . in conclusion , an isolated narrow iac with duplication associated with congenital sensorineural hearing loss and normal facial nerve function is extremely rare , and to the best of our knowledge , this is the sixth case reported for this malformation . an examination of this anomaly should include a past medical history and physical examination , auditometry including auditory brainstem response , a high - resolution ct scan , and high - resolution mr imaging . it is of great importance to make a diagnosis of aplasia or hypoplasia of the vestibulocochlear nerve in the iac for cochlear implant candidates . for this purpose , high - resolution submillimetric gradient - echo mr images , such as 3d - ciss and 3d drive , or t2-weighted fse sequences should be obtained in the parasagittal plane perpendicular to the course of the vestibulocochlear and facial nerves . | a narrow internal auditory canal ( iac ) with duplication is a rare anomaly of the temporal bone .
it is associated with congenital sensorineural hearing loss .
aplasia or hypoplasia of the vestibulocochlear nerve may cause the hearing loss .
we present an unusual case of an isolated narrow iac with duplication that was detected by a ct scan . in this case , the iac was divided by a bony septum into an empty stenotic inferoposterior portion and a large anterosuperior portion containing the facial nerve that was clearly delineated on mri . |
small cell carcinoma is a malignancy that occurs mainly in the lung , and primary lesions in the head and neck are very rare . extrapulmonary small cell carcinoma ( epscc ) shows a fair response to either chemotherapy or chemoradiotherapy , similar to small cell lung carcinoma ( sclc ) ; however , poor prognosis has been reported due to its high metastatic potential . irinotecan hydrochloride ( cpt-11 ) , a topoisomerase i inhibitor , has been reported to be effective against sclc . here , we report a rare case of epscc of the tonsil , treated with cpt-11 and cisplatin ( cddp ) , which is the recent treatment protocol for sclc . the present case represents the first report of cpt-11 usage for epscc of the oropharynx . our case suggests that cpt-11 and cddp may become an effective treatment option for epscc of the oropharynx . a 65-year - old male presented to our hospital complaining of sore throat for 2 weeks . he smoked heavily ( 70 cigarettes per day for 40 years ) and was also a long - time alcohol drinker . physical examination revealed an ulcerated mass in the left palatine tonsil and multiple swollen left neck lymph nodes . computed tomography ( ct ) scans of the head and neck revealed a well - defined , 3.2 3 cm mass in the left tonsil with multiple left cervical lymph node involvement . hematoxylin and eosin - stained sections revealed nests of monotonous , small , round carcinoma cells with scant cytoplasm and frequent mitotic figures in the subepithelial tissue ( fig . immunohistochemically , the tumor cells were positive for neural cell adhesion molecule ( cd56 ) , synaptophysin , chromogranin , cytokeratin , and epithelial membrane antigen ; the cells were negative for s-100 protein , hmb-45 , leukocyte common antigen , and thyroid transcription factor-1 ( fig . these findings indicated small cell carcinoma . to differentiate primary small cell carcinoma from a metastatic sclc , in addition , systemic workup , such as of the brain , as well as abdominal ct and fdg - pet showed negative findings for distant metastasis . the tumor was diagnosed as oropharyngeal cancer , t2n2bm0 ( tnm classification , uicc , 2002 ) . because cardiac echo revealed severe aortic stenosis and moderate aortic regurgitation , the patient received aortic valve replacement before treating the epscc of the tonsil . the tonsillar mass then grew to 4.6 3.8 cm , and the left neck lymph nodes also progressed ( fig . one month after the cardiac operation , he underwent radiotherapy of the tonsil and the bilateral cervical area with a dosage of 65.4 gy in 35 fractions . he was also planned to receive three courses of chemotherapy with a regimen including cpt-11 ( 60 mg / m , days 1 and 15 ) and cddp ( 30 mg / m , days 1 and 15 ) at 4-week intervals . because severe thrombocytopenia occurred after the first course of chemotherapy , the second and third courses were performed with reduced doses of cpt-11 ( 48 mg / m , days 1 and 15 ) and cddp ( 24 mg / m , days 1 and 15 ) at 3-week intervals . epscc compromises only 2.54% of all small cell carcinomas and is commonly found in the esophagus , colon , pancreas , uterus , and breast . it reveals a fair response to either chemotherapy or chemoradiotherapy but exhibits a poor prognosis . in general , the clinical course of epscc is known to be aggressive because of frequent metastases and recurrences . systemic disease from the onset of treatment , even when no distant metastasis is recognized at the first medical examination . in the head and neck region , the most common sites are the larynx , nose , and paranasal sinuses , and the major salivary glands . primary small cell carcinoma of the tonsil is rare ; only 11 cases have been reported [ 3 , 4 , 5 , 6 , 7 , 8 , 9 ] . the prognosis of patients with epscc of the tonsil has been poor , as 6 of those 11 patients died from the disease mainly due to systemic metastasis . when a diagnosis of epscc arising in the head and neck region is made , the patient should be evaluated first to determine whether the disease is a primary or metastatic cancer . primary sclc is rarely occult because it is aggressive and fast - growing . in our case , chest and abdominal ct and fdg - pet revealed no other lesions , and the tonsillar mass was determined to be the primary lesion . the histopathological aspects of epscc include round , oval- to spindle - shaped small cells with dense chromatin , absence of nucleoli , and inconspicuous cytoplasm . mitosis , necrosis , apoptosis , and lymphatic , vascular , and perineural invasion are common . immunohistochemical staining for neuroendocrine markers , including chromogranin a , synaptophysin , and cd56 , is usually positive . in this case , histologic features and immunoreactivity for neuroendocrine markers were suggestive of epscc . although the treatment of this tumor has not been defined clearly , it can require surgical excision of the localized tumor , radiation therapy to the primary site , multiple - drug chemotherapy , or a combination of these modalities . platinum - based chemotherapy , such as the use of etoposide ( vp-16 ) and cddp , has been recognized as the standard regimen for epscc . recently , cpt-11 combined with cddp was found to be more effective than vp-16 and cddp . two cases of chemotherapy using cpt-11 and cddp have been reported for epscc arising in the head and neck region : one in the larynx and the other in the nasal cavity [ 10 , 11 ] . both cases achieved long - term remission . in our case , radiation therapy to primary and locoregional sites followed by immediate chemotherapy with cpt-11/cddp resulted in complete remission of the tumor , although the patient later died of liver metastasis . in this report , we describe a case of small cell carcinoma of the tonsil treated by combined chemotherapy with cpt-11/cddp after radiotherapy . this is the first report on the use of combined cpt-11/cddp chemotherapy in small cell carcinoma of the oropharynx . | we report a rare case of extrapulmonary small cell carcinoma arising in the palatine tonsil treated by combined chemotherapy with irinotecan / cisplatin following irradiation therapy .
this chemotherapy regimen was recently found to be effective for small cell lung carcinoma .
our case is the first report of combined irinotecan / cisplatin chemotherapy to treat extrapulmonary small cell carcinoma of the oropharynx . |
hepatitis b virus ( hbv ) is an important risk factor for developing hepatocellular carcinoma ( hcc ) ( 1 ) . hcc is the fifth most common cancer worldwide , and it causes significant public health problems , especially in association with chronic hepatitis b ( 2 ) . morphologic lesions during hepatocarcinogenesis include dysplastic lesions ( dysplastic foci ( df ) and dysplastic nodules ( dns ) ) with low- and high - grade dysplasia and small cancerous lesions ( 2 cm in diameter ; early hcc ) ( 4 - 7 ) . the most common cause of cirrhosis in shiraz transplant center , which is the largest liver transplant center in the country , is hbv related , and majority of patients with hcc in this center are also hbv related ( 1 ) . therefore , we attempted to determine the incidence of hcc and its precursors in this group of cirrhotic patients through a thorough examination of explanted hbv - related cirrhotic livers . a two - year cross - sectional study was performed on 103 explanted hbv - related cirrhotic livers from the pathology department of shiraz university of medical sciences . during the study period ( 2014 - 2015 ) , explanted cirrhotic hbv - related livers ( recipient cirrhotic liver after liver transplantation ) received in the department of pathology were fixed in formalin for 24 - 48 hours . histologic sections from any hepatic nodule larger than 1 cm in diameter or those with any kind of difference with background parenchyma , such as color or consistency , were studied ( figures 1 and 2 ) . sections were stained with hematoxylin and eosin method , and slides were examined under a double - headed microscope by two pathologists . df were classified into having either small cell changes ( scc ) , formerly called small cell dysplasia , or large cell changes ( lcc ) , formerly called large cell dysplasia . nodules were studied and classified as low - grade dysplastic nodules ( lgdn ) , high - grade dysplastic nodules ( hgdn ) , and hepatocellular carcinoma ( hcc ) ( 5 ) . the following criteria were used to classify the different nodules in cirrhotic livers : cellularity , thickness of hepatocellular plates , nuclear atypia ( either pleomorphism or irregular contour ) , nucleocytoplasmatic ratio , cytoplasmic staining ( eosinophilic , basophilic , amphophilic , and clear ) , pseudoacinar pattern , stromal invasion , portal tracts , biliary pigment , lipid vacuoles , and iron status of nodules ( 8) . in lgdn , hepatocytes are not completely abnormal . that is , they show normal or slightly increased nucleocytoplasmic ( n / c ) ratio , minimal nuclear atypia , and no mitotic activity , but portal tracts are still present . compared with lgdn , hgdn have all of their features except the n / c ratio is higher , nuclear atypia is more obvious , cytoplasmic basophilia is more significant , and liver plates ( more than two cells thick ) are thickened with mitotic figures . in hcc , cell size is usually decreased , nuclear density is at least twice that of normal , nuclear atypia is definite , mitotic figures are present , and pseudoacinar formation may be present ( 9 ) . the term early hcc mean hcc in an early stage that are small in size ( usually < 2 cm ) . histologically , hcc are well differentiated and lack prominent cellular and structural atypia ( 10 - 13 ) . for convenience , we used the term advanced hcc ( ahcc ) for hccs that are greater than 2 cm in size in this article . the chi - square test was used to evaluate the significance of the relation between the nodules and their categorical variables . a total of 103 patients were included in the study . among the patients , 14 ( 13.16% ) were women , 89 ( 86.4% ) were men , age ranged from 20 to 73 , and mean age was 51.4 10.5 . among all explanted cirrhotic livers , 92 ( 89.3% ) had df with lcc , 57 ( 55.3% ) of which showed scc as well . out of these 103 explanted livers , 39 ( 37.9% ) had lgdn , 38 ( 36.9% ) had hgdn , 19 ( 18.4% ) had early hepatocellular carcinoma ( ehcc ) , and 21 ( 20.4% ) had ahcc ( figures 3 - 6 ) . note that all the cases with ehcc and ahcc also had scc , lcc , hgdn , and lgdn . thirteen cases of ehcc were accompanied with ahcc , and 6 cases of ehcc did not show any ahcc ( size larger than 2 cm ) . all of the 21 ahcc cases were transplanted with the preoperative diagnosis of malignancy and hepatitis b - related cirrhosis . however , among livers with ehcc , 6 were not accompanied with ahcc , 2 of which were unsuspected before surgery and diagnosed on the explanted liver . the two ahcc cases were smaller than 2 cm in diameter ( table 1 ) . our results showed that the presence of scc , lgdn , and hgdn has a statistically significant association with ehcc ( p < 0.05 ) and hcc ( p < 0.05 ) . moreover , the presence of ehcc is associated with ahcc ( p < 0.05 ) . hcc is a poor prognostic cancer , and it is one of the most common causes of cancer death around the globe . hcc is also common in countries with high incidence of hbv - related cirrhosis ( 1 ) . despite the improvements in treatment modalities for hcc , the survival rate remains low even after liver transplantation because hcc can not be easily diagnosed before the advanced stage ( 14 ) . therefore , studies on the incidence and diagnosis of precancerous lesions of hcc are important , especially for patients who develop hcc secondary to hbv infection and cirrhosis . therefore , pathologists and clinicians should be able to diagnose ahccs and ehccs from their precursor lesions using various techniques preoperatively ( 10 ) . hepatic precancerous lesions are currently divided into two categories depending on cytological and histological changes : microscopic df and macroscopic dns ( 11 ) . df can be recognized only in microscopic examination as they are smaller than 1 mm . dns are recognizable both in gross examination of hepatic specimens and in microscopic examination as well - defined nodule lesions that are different from the background cirrhotic liver tissue in size , color , texture , or degree of bulging on the cut surface . hccs can be either ehcc ( less than 2 cm ) or ahcc ( larger than 2 cm ) ( 8 , 9 ) . globally , hbv is the most common cause of cirrhosis and hcc in iran ( 12 ) . in this study , we attempted to identify the true prevalence of hcc and its precursors in 103 explanted livers through thorough sectioning of at least 15 sections for each liver after precise inspection of the gross specimens . among all 103 explanted cirrhotic livers in our study , 92 ( 89.3% ) had df with lcc . according to this result , lcc is a common finding in cirrhotic livers of patients with chronic hepatitis b , but it does not seem to be associated with any malignant lesion , thus confirming the lack of premalignant potential in theses lesions . that is , some studies similar to our own found that lcc ( formerly called lcd ) had no histogenetic association with hcc ( 13 ) . others concluded that lcc in relation to hbv might not only be an innocent bystander but might be closely related to hepatocarcinogenesis ( 15 ) . it can be diagnosed by the presence of clusters of hepatocytes with a small size , minimal nuclear atypia , high n / c ratio , and high nuclear crowding . the report by plentz et al . indicated that severely decreased expression of p16 and p21 , telomere shortening , and accumulation of dna damage in scc and hcc compared with lcc and cirrhotic nodules were all suggestive of the malignant potential of scc compared with lcc ( 17 ) . in our study of 103 patients with hepatitis b - associated liver cirrhosis , 57 ( 55.3% ) had scc . out of these 57 livers with scc , 19 ( 70.4% ) had ehcc and 21 ( 36.8% ) had hcc . our results showed that the presence of scc is associated with ehcc ( p < 0.05 ) and hcc ( p < 0.05).therefore , scc may be associated with the presence of ehcc or hcc . according to our results , a thorough sampling is advised for every patient with scc to detect any malignant lesion . for example , in one study , scc was proved to be associated with aneuploidy and elevated dna index , and it was found to be a moderate - to - high risk for progression to hcc ( 18 ) . among the 103 explanted livers , 39 ( 37.9% ) had lgn , 38 ( 36.9% ) had hgdn , 19 ( 18.4% ) had ehcc , and 21 ( 20.4% ) had ahcc . thus , 70% and 53% of the cases with lgdn and 50% and 55% of the cases with hgdn showed ehcc and hcc , respectively . this association was statistically significant ( p value < 0.05 ) . according to previous studies , lgdn and hgdn are indicators of increased risk of hcc in cirrhotic livers . hcc nodules are commonly seen within dns ( i.e. , nodule - within - nodule pattern ) ( 14 ) . in conclusion , scc , lgdn , and hgdn seem to be common associated findings and precursors of hcc in livers infected with hepatitis b. a strict follow - up and a precise and thorough sampling and sectioning of livers with scc and any abnormal dns , especially those larger than 1 cm , are highly recommended because of their association with malignancy . | backgroundthe most common cause of liver transplantation in iran is hepatitis b positive cirrhosis , and it also one of the major and important causes of hepatocellular carcinoma ( hcc ) .
most cases with hcc follow a multistep sequence .
morphologic lesions during hepatocarcinogenesis include dysplastic lesions and small cancerous lesions ( 2 cm in diameter ; early hcc ) . however , insufficient information is available on the incidence of hcc and its precursors in hepatitis b - related cirrhosis.objectivesin this study , we determined the incidence of hcc and its precursors in hepatitis b - related cirrhosis in the largest liver transplant center in iran.methodsin a two - year study , all explanted livers of patients with hepatitis b virus ( hbv)-positive cirrhosis were completely sectioned and examined .
each specimen was investigated grossly and microscopically to determine any abnormal nodule or cellular changes ( at least 15 sections from each liver).resultsamong all explanted cirrhotic livers ( 103 livers ) during the study period ( 2014 - 2015 ) , 92 ( 89.3% ) had dysplastic foci with large cell changes ( lcc ) , 57 ( 55.3% ) of which showed small cell changes ( scc ) as well .
thirty - nine cases ( 37.9% ) had low - grade dysplastic nodules ( lgdn ) , 38 ( 36.9% ) high - grade dysplastic nodules ( hgdn ) , 19 ( 18.4% ) were early hepatocellular carcinoma ( ehcc ) , and 21 ( 20.4% ) were hepatocellular carcinoma more than 2 cm .
all the cases with ehcc and hcc of more than 2 cm also had scc , lcc , hgdn , and lgdn .
thirteen cases of ehcc were accompanied with hccs more than 2 cm , and 6 cases of ehcc did not show any hcc ( larger than 2 cm).conclusionsscc , lgdn , and hgdn are common associated findings and precursors of hcc in livers infected with hepatitis b. a strict follow - up and a precise and thorough sampling of livers with scc and any abnormal dysplastic nodules ( dns ) , especially those larger than 1 cm , are highly recommended because these dns are highly associated with malignancy . |
one of the reasons for the changes is concern for the patient 's safety . to err is human , a landmark report released by the institute of medicine ( iom ) in 1999 estimated that medical errors cause injury to approximately 3% of hospital patients and results in a minimum of 44,000 and perhaps as many as 98,000 deaths per year in the united states . another important finding came from the harvard medical practice study 1 , in which the authors reviewed over 30,000 randomly selected hospital records at new york state in 1984 as part of an interdisciplinary study of medical injury and malpractice litigation . they found that injuries from adverse events occurred in 3.7% of hospital admissions , 27.6% of which were due to negligence and in which 13.6% led to death . the annual cost attributable to all adverse drug events and preventable adverse drug events for a 700-bed american teaching hospital was estimated by one study as $ 5.6 million and $ 2.8 million repectively . though it is expected that such medical errors occur in saudi arabia , there are no studies on their extent in saudi hospitals . calls for a change in the instructional methods have resulted in innovative medical curricula . the new curricula stress the importance of proficiency in several clinical skills by medical graduates rather than mere acquisition of knowledge . as evidenced by their endorsement by many of the international bodies and medical schools , it is universally accepted that clinical skills constitute an essential learning outcome . the acquisition of appropriate clinical skills is key to health education ; however , students sometimes complete their educational programs armed with theoretical knowledge but lack many of the clinical skills vital for their work . a major challenge for medical undergraduates some medical schools in the middle east have changed their curricula and adopted such educational strategies as problem - based learning . also many medical schools have started to utilize clinical skills laboratories for training . the objective of this narrative review article is to highlight the importance of simulation as a new teaching method for undergraduate and postgraduate education . this is a narrative review of literature on a medical simulator and the use of simulation in medical education . a literature search of medline / pubmed database for english - language publications and reference lists from relevant articles published between 1990 and august 2009 was conducted . the main search terms were medical simulation , medical simulator , medical education , and clinical skills . medical training programs should ensure that students have the necessary learning opportunities and assessed by the appropriate methods . clinical skills competencies including communication skills , history - taking , professional attitudes , awareness of ethical basis of healthcare , physical examination , procedural skills , clinical laboratory skills , diagnostic skills , therapeutic skills , resuscitation skills , critical thinking , clinical reasoning , problem solving , team - work , organization skills , management skills , and information technology skills should be part of the core undergraduate curriculum . traditionally , the acquisition and ongoing improvement of high level psychomotor skills required by future physician take place in an apprentice - style model of see one , do one , teach one. this apprentice - style of learning is no longer considered acceptable because of the increasing concern for the quality of patient care and safety and change in health care systems . the pressure of managed care has shaped the forms and frequency of hospitalization and led to a higher percentage of acutely ill patients and shorter inpatient stays . this has resulted in fewer opportunities for the medical learner to access a wide variety of diseases and physical findings . relying on exposure to real hospital patients during training years may result in an ad - hoc method of learning clinical skills , as this depends on the availability of cases , and consequently to less than optimal development and performance of clinical skills . there are many reports that indicate concerns for the level of skills medical graduates even in western countries possess . the acquisition of expertise in clinical medicine requires the learner 's engagement in deliberate practice of desired learning outcomes . according to issenberg et al ( 2002 ) deliberate practice involves ( a ) repetitive performance of intended cognitive or psychomotor skills in focused domain , coupled with ( b ) rigorous skills assessment , that provides learners ( c ) specific , informative feedback , that results in increasingly ( d ) better skills performance , in a controlled setting . concerns about patient safety and fewer available patients for learning , and many other factors have led to the introduction of simulation and the development of simulation centers and clinical skills laboratories in medical education . aviation and aerospace industries have been using simulation as a teaching tool for many years . simulators are now widely used in education and training in a variety of high risk professions and disciplines , including the military , commercial airlines , nuclear power plants , business and medicine . recently , the inclusion of clinical skills training into the curricula of medical students has seen significant growth . there are many examples of curricular reform that include clinical skills training , the use of simulators , and the creation of clinical skills centres . simulation has been defined as a situation in which a particular set of conditions is created artificially in order to study or experience something that is possible in real life ; or a generic term that refers to the artificial representation of a real world process to achieve educational goals via experimental learning . a simulator is defined as a device that enables the operator to reproduce or represent under test conditions phenomena likely to occur in actual performance . on the other hand , simulation based medical education can be defined as any educational activity that utilizes simulative aides to replicate clinical scenarios . trainers can make mistakes and learn from them without the fear of distressing the patient . experiential learning , which is a part of the definition of simulation , is an active process during which the learner constructs knowledge by linking new information and new experience with previous knowledge and understanding . experiential learning or learning from experience during simulation based training sometimes involves the use of clinical scenarios as the bases of learning . the practice of scenarios can be done individually , but it is mostly carried out by a team from the same or different specialties or professions in a simulated environment made to resemble the intended environment as closely as possible in order to immerse students in an experience closest to real life . the practice of a scenario can be videotaped for immediate feedback to participants during the debriefing sessions . video recording of the scenario is also used to initiate discussion and to make sure that all learning objectives were covered . debriefing can focus both around the cognitive process involved in the recognition of the problem and the implementation of the management guidelines and the technical level at which the ability of the learner to apply rules and appropriate responses in a stressful situation is evaluated . during the full scale scenario - based training , the learner can acquire such important skills as interpersonal communication , teamwork , leadership , decision - making , the ability to prioritize tasks under pressure , and stress management . however , training through simulation should be viewed as an adjuvant and not a replacement for learning with real patients . simulation is not intended to replace the need for learning in the clinical environment , so it is important to integrate simulation training with the clinical practice during curriculum development . simulators can be classified according to their resemblance to reality into low - fidelity , medium- fidelity and high - fidelity simulators . example of a low - fidelity simulator is the intravenous insertion arm [ figure 1 ] and resusci - anne [ figure 2 ] . moderate fidelity simulators give more resemblance of reality with such features as pulse , heart sounds , and breathing sounds but without the ability to talk and they lack chest or eye movement . they can be used for both the introduction and deeper understanding of specific , increasingly complex competencies . high fidelity simulators combine part or whole body manikins to carry the intervention with computers that drive the manikins to produce physical signs and feed physiological signs to monitors . they can talk , breathe , blink , and respond either automatically or manually to physical and pharmacological interventions . good examples of high - fidelity simulator is the meti human patient simulator ( hps ) which is model driven [ figure 4 ] and the noelle obstetric simulator which is instructor driven . in general , the higher the fidelity , the more expensive it is . cardiology simulator meti human patient simulator ( hps ) virtual reality can also be incorporated into the simulators ( mostly part - task simulators ) to enhance learning . virtual reality varies greatly according to its level of sophistication in its level of realism and of the user 's interaction with the virtual environment . a common form of virtual reality involves the use of haptic ( touch ) feedback to produce a feeling of resistance when using instruments in a simulated environment . high - fidelity and virtual reality simulations can bridge the gap between theory and practice by immersing the learner in a realistic , dynamic , complex setting . the recreation of reality or fidelity is important for the success of simulation and for the participant . since some simulators can be used to encourage independent or self - directed learning , they should be integrated into the overall curriculum . the intended outcomes should be predefined and the training carried out in a controlled environment . issenberg et al performed an excellent systematic review and identified ten features of high - fidelity medical simulation that can lead to effective learning . the simulated scenarios are realistic enough to engage the students emotionally , thus providing a unique learning experience , where the high fidelity simulator patient simulation can be adapted to accommodate the need of various medical specialties such as anesthesia , emergency medicine and trauma , intensive care medicine , obstetrics , pediatrics , and radiology as well as for the use of other professionals such as nurses , paramedics , and respiratory therapists . . a single high - fidelity simulator with its monitoring system and other necessary equipment may cost up to $ 200 000 . in addition , synthetic body fluids , replacement skins , bandages , syringes and other supplies are necessary to simulate the experience of treating real patients in a real hospital . the ability to practise without risk simulation has many advantages , for it results in highly trained medical graduates who are less likely to make life - threatening or costly medical errors . it has also proved to be effective in both undergraduate and post graduate education as well as faculty development . simulation can be used in the primary health care setting to improve confidence in performing life - saving skills , clinical skills , communication skills , and the quality of care for patients with chronic diseases such as diabetes mellitus and bronchial asthma . such simulators as part task trainers , computer - based systems , virtual reality and the haptic system , simulated patients , simulated environment , and integrated simulators have been also used effectively to assess and evaluate clinical skills . the major challenge to medical simulation is the fact that evidence to date is weak in methodology . the assumption that such learning is directly transferable to the clinical context is often untested . only a few studies have shown a direct positive impact in the clinical outcome from the use of simulation for medical training . advantages of simulation in conclusion , the promise of simulation - based medical training offers useful opportunities to reduce risks to patients and learners , improve learners competence and confidence , increase patient safety , and reduce health care costs in the long run . however , robust research is needed to see if simulation training does actually improve patient outcomes . | one of the most important steps in curriculum development is the introduction of simulation- based medical teaching and learning .
simulation is a generic term that refers to an artificial representation of a real world process to achieve educational goals through experiential learning .
simulation based medical education is defined as any educational activity that utilizes simulation aides to replicate clinical scenarios .
although medical simulation is relatively new , simulation has been used for a long time in other high risk professions such as aviation .
medical simulation allows the acquisition of clinical skills through deliberate practice rather than an apprentice style of learning .
simulation tools serve as an alternative to real patients .
a trainee can make mistakes and learn from them without the fear of harming the patient .
there are different types and classification of simulators and their cost vary according to the degree of their resemblance to the reality , or
fidelity. simulation- based learning is expensive .
however , it is cost - effective if utilized properly .
medical simulation has been found to enhance clinical competence at the undergraduate and postgraduate levels .
it has also been found to have many advantages that can improve patient safety and reduce health care costs through the improvement of the medical provider 's competencies .
the objective of this narrative review article is to highlight the importance of simulation as a new teaching method in undergraduate and postgraduate education . |
a prospective observational cohort study of patients presenting for home carealmost 1/5 of patients with advanced cancers suffer from pressure ulcersnone of the patients enrolled had a new pressure ulcer during home carepressure ulcer resolved completely with care in 40% of the patientsthis care could be provided at a median cost of rs . a prospective observational cohort study of patients presenting for home care almost 1/5 of patients with advanced cancers suffer from pressure ulcers none of the patients enrolled had a new pressure ulcer during home care pressure ulcer resolved completely with care in 40% of the patients this care could be provided at a median cost of rs . the national pressure ulcer advisory panel ( npuap ) defines pressure ulcers ( pu ) as a form of localized tissue injury that develop as a result of pressure or pressure in combination with friction / shear . hendrichova et al . , from italy had found a rate of 22.9% in cancer patients treated at a palliative care unit . brink et al . , found a prevalence rate of 10.5% in patients under home care for terminal cancers . dealey et al . , estimated that the cost of treating pus in uk ranged between 1,21414,108 depending on the severity of the ulcer . the healthcare system in india is overburdened and few facilities are available for providing end - of - life care . invariably , most of the care is delivered at home and caregivers are family members . the kerala model of palliative care depends on a network of trained volunteers and nurses who provide homecare services through regular visits . in addition to developing a trained cadre of community - based care providers , several innovative methods are used to bring down the cost of care . our homecare service consists of trained palliative care nurses who conduct regular homecare visits for terminal cancer patients supported by a trained palliative care physician . for logistic reasons , while there are few publications on the burden of pus in indian patients in hospital settings , we could not find any data in patients suffering from cancer . in the present paper , we present data on prevalence of pu , the effectiveness in terms of healing , duration of persistence as well as the expenditure incurred for this care in a cohort of homecare patients with cancer included for a prospective study . after obtaining irb approval , patients presenting for home care were included in this prospective observational study ( ctri number : ctri/2014/03/004477 ) . patients were selected for homecare service provided they resided within a distance of 35 km from the center . patients were followed up at fortnightly interval till death . as a part of the homecare process , a trained nurse would visit the house of the patient and provide care and education . visits were conducted as per a preplanned route plan at fortnightly intervals . during each visit , the data collected included the size , location , and stage of pu if any . all pus were staged by the nurse using the npuap staging scheme . in patients without pus , caregivers were trained in the importance of regular postural changes , maintaining hygiene and nutrition . during each visit , the trained nurse assessed if any pus had developed in the interim . in patients with pre - existing pus , similar in addition , simple saline dressings were instituted using cloth strips cut from cotton dhotis . these strips were boiled in a steamer that is meant for steaming pancakes ( idlis ) for at least 20 minutes . instead of using commercially available normal saline , normal drinking water mixed with 2 tsp salt per liter of water would be boiled for 5 minutes and used for cleansing . for patients with foul smelling / malodorous wounds metronidazole tablets the cost of medications and other consumables supplied to the patient as well as the cost of staff and salary was borne by the hospital . the fixed cost per visit which included payment for the nurses salary , driver salary , and car fuel costs worked out to be rs . the salary paid per hour was derived from the monthly salary for the driver and nurse . the total costs of consumable items like medications given to each patient were derived from the medicine records maintained prospectively for each visit . the cost of metronidazole tablets and sticking tapes used in patients with pu was included in the wound care costs . the total costs of visits were calculated by adding the total expense per visit with the expenses incurred in consumable items like medicines . the total cost was divided by the total number of days in home care to obtain the cost per day for each patient . data on demographic variables , cancer site , stage , treatment received , and performance status at first visit was recorded on a datasheet . median and interquartile range were calculated for continuous variables , while frequencies were calculated for categorical variables . logistic regression analysis was conducted to find out the influence of various prognostic factors on the healing of pus . duration of persistence of pus was estimated from the date it was noticed first till the date it was healed . in patients with pu at the first visit , the date of first visit was taken as the start date . patients were censored at the date of death if the ulcer was not completely healed by then . for purpose of analysis , cancers with less than 10 patients were grouped together as a single category . table 1 shows the demographic profile of the patient population in the study . out of these , 27 ( 25% ) patients were unfit for any chemotherapy , surgery , or radiotherapy and were referred for palliative care . in these patients , 23 had progressive disease after receiving treatment for their cancer outside the hospital while 4 were not treated in view of their advanced age and performance status . the sociodemographic and disease related profile of the 108 patients included in the study nineteen ( 17.6% ) patients had received curative intent treatment with surgery or radiotherapy while 62 ( 57.4% ) had received palliative treatment prior to registration for home care . in the 62 patients treated with palliative intent after diagnosis , palliative chemotherapy had been delivered in 25 patients while the rest ( n = 37 ) received palliative radiotherapy . the distribution of pus as per prognostic categories in 21 patients with pus , complete healing of the pus was seen in 9 ( 42.9% ) while in another 5 ( 23.8% ) , reduction in the stage was observed . in 5 ( 23.8% ) patients , the stage of pu did not change while in 2 ( 9.5% ) patients , an increase in stage was noted . figure 1 is a waterfall plot showing the change in the stage of pus between the first and the last homecare visit . both the 2 patients who had an increase in the stage of pu during homecare visits had an initial stage 1 pu that subsequently increased to stage 2 before they died . waterfall plot showing the extent of change in the stage of pu between the 1st and last homecare visit . patients with complete resolution of pu are depicted by hatched bars while solid bars represent patients where pus did not resolve completely . as can be seen none of the patients with grade 34 pressure ulcers had a complete resolution . however , in these patients , a decrease in stage was observed in 3 patients while in other 3 the stage remained stable table 3 shows the influence of various factors on the healing of pus . on logistic regression analysis financial status , paralysis , and performance status significantly influenced the healing pus . influence of various prognostic factors on the resolution of pus during home care median estimated duration of persistence of any pu in these 21 patients was 56 days ( 95% ci : 0117 days ) [ figure 2 ] . the median duration of survival of patients with stage 12 pu was 75 days versus 37.5 days for stage 34 pu ( p = 0.22 , ns ) . in the 21 patients with pu , any pu was observed by the homecare team in a median of 3.5 visits ( iqr : 2.54.5 ) . in this same group , numbers at risk at each time point are shown below the graph the median total expenditure incurred in caring for the patients with pus was rs . 2323.40 ( iqr : rs . 1878.402768.40 ) and the median daily expenditure was rs . this includes the cost of homecare visits where care for pu had to be provided as well as visits were pu care was not provided as the pu had healed . the total cost incurred by the hospital in caring for patients in the homecare services was rs . the expenditure incurred by the hospital in caring for the 21 patients with pu was rs . the present study showed that almost 20% patients with advanced cancer taken up for homecare services suffer from pu in our population . this figure is comparable to that reported by hendrichova et al . , but higher than that reported by brink et al . this high prevalence of pu at presentation points to the need for sensitization of oncologists towards this common but unappreciated problem faced by patients with terminal cancers . poor performance status and presence of paralysis predicted an increased risk of presenting with pus in this cohort of patients [ table 2 ] . the causes behind development of pu is poorly understood and is not a result of a single factor . in a recent systematic review coleman et al . , have identified three major domains that predict an increased risk of pu development . these domains are mobility / activity , skin perfusion ( e. g. , diabetes ) and skin condition , particularly existence of a stage i pu , as important predictors of development of pu . due to the small number of patients with pu , only the single domain of reduced mobility / activity ( in form of paralysis and performance status ) emerged as significant . the limited lifespan of these patients also influenced this as parameters related to limited skin perfusion and existing pu are likely to be significant only with longer duration of follow - up . in the present study , 40% of the pus had completely healed before the last homecare visit . the median time taken for complete healing of pressure ulcers was 56 days from the date of registration in homecare services . this is comparable to the results reported by mcnees et al . , where 44% of pressure ulcers and wounds had healed in cancer patients and the median time taken for healing was 55 days ( 49 days ) . , in their study only 10% of pressure wounds had healed prior to the death of the patient . in contrast to stage i and ii pus , majority of which healed in the present study , none of the stage iii - iv pu healed completely . however , 50% of these patients had a reduction in stage and none had a worsening in the stage . brandeis et al . , have shown that with good nursing care majority of the pressure ulcers heal within a period of 1 year . in the present cohort , the limited lifespan of the patients with advanced pressure ulcers ( median survival with stage 34 ulcer : 37.5 days only ) prevented complete healing . , in patients surviving less than 180 days ( 6 months ) , none of stage iv pus healed completely . in fact the authors hypothesized that such pus may represent a reflection of the underlying disease burden and be a part of the spectrum of the overall co - morbidity preceding death in such patients . the healing of the pus in the present study was influenced by the baseline performance status and presence of paralysis . while patients with poorer performance status had a poorer chance of healing of pu , paradoxically in all three patients with paralysis the ps healed . two patients had a stage i pu and one had a stage ii pu all three of which had healed completely by the end of the homecare visits . this finding is likely to be due to chance because of the small number of patients . the model of homecare service as delivered through our center is a derived from the kerala model of home - based palliative care services . an advisory model is adopted and patient 's relatives are entrusted with providing nursing care without relying on hiring specialized nurses . this model was borne out of necessity , as there is a triple combination of high patient load , lack of trained nursing manpower , and poor financial status in our part of the world . in developed nations , the cost of caring for pus alone can exceed $ 2 billion ( ~1% of total healthcare budget ) as reported by severens et al . such expenditure is not possible in our country where the total healthcare budget is only $ 6 billion . additionally , the nature of family ties in our part of the world is such that usually want to take care and nurse the sick patient . the role of the homecare team is to educate and empower the caregiver in the family by teaching them simple and cost effective methods of caring for the patients , as well as allaying their apprehensions and misgivings . however in most such palliative homecare services , trained physicians are not available . as a result in the event of any untoward event relatives are forced to turn to local hospitals where patients may not have been primarily treated for their cancer . the present homecare team on the other hand has a close communication with the palliative care specialist as well as other oncologists in the hospital . as a result , in the event of any emergency or sudden problem , thus both the patients as well as the caregivers are assured of continuity of care . the present study is thefirst study which reports the prevalence and outcomes of pus in terminal cancer patients managed using the kerala model of palliative home care . the strengths of this study are its prospective nature wherein detailed observation of the patients condition was made by a trained palliative care team . the low cost of the present model is evident in the fact that the total expenditure for caring of 21 patients with pu was rs . this compares very favorably to the cost incurred for caring and preventing pu in a long term care facility in 539 patients as reported by xakellis et al . due to resource limitations , we could only include patients who resided within a distance of 35 km from the institute . given the hybrid nature of our homecare model , the outcome data can not be readily generalized to patients referred to other homecare services in india . it is also unknown if the effectiveness of care as used in this model compares favorably to the more established and expensive methods of wound care . the costs reported are direct costs incurred by the hospital as indirect costs incurred by the patients relatives in caring for the patients with pu were not recorded . the actual indirect cost of such a care model needs to be further studied using prospective studies . in this study , , a recent cochrane review has also shown that there is little evidence that use of structured pu risk assessment tool is useful in reducing the risk of developing pu . our prospective study demonstrates that there is a high prevalence of pus in patients referred to home care with terminal cancers . the hybrid model of homecare service delivery , as adopted in the present study , was able to prevent new pus from developing in the patient population . in addition , complete healing was seen in 40% of the patients , with an average expenditure of rs . | aim : to report the prevalence and outcomes of pressure ulcers ( pu ) seen in a cohort of cancer patients requiring home - based palliative care.materials and methods : all patients referred for home care were eligible for this prospective observational study , provided they were living within a distance of 35 km from the institute and gave informed consent . during each visit ,
caregivers were trained and educated for providing nursing care for the patient .
dressing material for pu care was provided to all patients free of cost and care methods were demonstrated .
factors influencing the occurrence and healing of pus were analyzed using logistic regression .
duration for healing of pu was calculated using the kaplan meier method .
p < 0.05 are taken as significant.results:twenty-one of 108 ( 19.4% ) enrolled patients had pu at the start of homecare services .
none of the patients developed new pu during the course of home care .
complete healing of pu was seen in 9 ( 42.9% ) patients . the median duration for healing of pu
was found to be 56 days .
median expenditure incurred in patients with pu was rs .
2323.40 with a median daily expenditure of rs .
77.56.conclusions:the present model of homecare service delivery was found to be effective in the prevention and management of pus .
the high prevalence of pu in this cohort indicates a need for greater awareness for this complication.clinical trial registry number : ctri/2014/03/004477 |
ruptured rudimentary horn is a life threatening obstetrical emergency encountered frequently in the emergency department where the diagnosis is either missed or delayed . unicornuate uterus results from abnormal development and fusion of the mullerian ducts usually associated with various degrees of rudimentary horn which may be communicating or non - communicating with the uterine cavity . there is no communication between the two cavities in 75% to 90% of the cases and the incidence of pregnancy in non - communicating horn is high as 83% with incidence of uterine rupture observed in 90% of cases mostly in second trimester as was observed in our case.12 the thin muscular wall of the pregnant uterus ruptures early because of under development and poor distensibility of the myometrium . an unusual case of a primigravida married four months back with pregnancy 22 weeks reported to nizwa regional referral hospital with acute abdominal pain of two hours . on admission she was in shock with pale , cold , clammy extremities , feeble thready pulse 120 beats / minute , blood pressure 78/45 mmhg and respiratory rate 18/min . abdomen was enlarged to 28 weeks size , tense with generalized acute tenderness all over . abdominopelvic ultrasound showed a fetus of 22 weeks with increased free intraperitoneal fluid collection and absent fetal cardiac activity . uterus with cervix separate from the gestational sac was seen clearly lower down in the pelvis . she was taken for emergency laparotomy with the provisional diagnosis of abdominal pregnancy with fetal death . during laparotomy haemoperitoneum of around there was complete rupture of left rudimentary horn of the uterus with the dead fetus lying in the intact amniotic sac covered with 1000 gms of clots [ figure 1 ] . no evidence of placental adherence to the rudimentary horn was observed . the left fallopian tube and left ovary appeared normal and both were attached to the left rudimentary horn [ figure 2 ] . the fetus within the amniotic sac [ figure 3 ] along with the placenta and membranes was removed from the abdominal cavity . there was no communication between the rudimentary horn and the main unicornuate uterine cavity which was confirmed with a probe . the uterus lying separate in the pelvis was soft in consistency , globular and enlarged to 8 weeks size . the right fallopian tube and ovary found healthy were attached normally to the unicornuate uterus . excision of the rudimentary horn and left fallopian tube with conservation of the left ovary was done . the specimen was sent for histopathological examination which was reported as sections from the uterine horn show areas of haemorrhage and necrosis . follow up appointment was arranged for her with a plan for intravenous urogram to rule out any associated renal anomalies . she reported after three weeks with complaints of pain abdomen which subsided with mild analgesics . a repeat abdominopelvic ultrasonography followed by ct abdomen and pelvis was found to be absolutely normal . ( a ) left ruptured rudimentary horn ( b ) fetus in intact amniotic sac ( a ) right unicornuate uterus ( b ) left ruptured rudimentary horn ( c ) left fallopian tube ( d ) left ovary fetus in intact amniotic sac obstructive genitourinary malformations may be diagnosed in prepregnancy workup for complaints of dysmenorrhoea , endometriosis , infertility , and for various pregnancy complications like recurrent miscarriages , preterm labor and malpresentations . however if the rudimentary horn is underdeveloped with non - functional endometrium dysmenorrhoea may be absent . the use of ultrasonography , ct scan , magnetic resonance imaging , 3d ultrasound and laparoscopy may be helpful for diagnosing such abnormalities . buntugu3 used placement of a foley 's catheter into the uterine cavity prior to performing a transabdominal ultrasound for diagnosing an extrauterine pregnancy although not accepted as a preferred method . the associated urologic anomalies are reported to be as high as 50%-80% due to close approximity of the two systems and must be diagnosed either at laparotomy by palpation or postnatally by magnetic resonance imaging or intravenous urogram.4 pregnancy in a non - communicating horn of uterus is possible by intraperitoneal sperm and ovum transmigration or contralateral tubal pick up of the fertilized ovum within the peritoneal cavity . the reported incidence of pregnancy in the rudimentary is 100,000 to 140,000 being a rare form of ectopic pregnancy.5 rupture of pregnancy in rudimentary horn by second trimester is the most common outcome but silent rupture with continuation of pregnancy as secondary abdominal pregnancy was reported in some studies . cases of pregnancy progressing to third trimester and resulting in a live birth after caesarean section have also been documented . pregnancy continued till term as abdominal after ruptured rudimentary horn of a unicornuate uterus and the placenta was attached in part to the myometrium of the horn deriving the blood supply for the live fetus.68 a very unusual case of twin pregnancy in a unicornuate uterus with one fetus in the non - communicating rudimentary horn has been reported where the outcome was successful birth of twins by caesarean section.4 chances of placental adherence are increased due to poorly developed musculature , scant decidualization and small size of the horn . magnetic resonance imaging has been a useful preoperative tool for both diagnosing pregnancy in rudimentary horn and any abnormal placentation . ultrasound has a sensitivity of 33.3% for diagnosing this anomaly and sensitivity reduces with advancing pregnancy adding to the diagnostic dilemma.1 sonographic diagnostic criteria suggested by tsafri9 are presence of pseudo - pattern of an asymmetrical bicornuate uterus , absent visual continuity between the cervical canal and the lumen of the pregnant horn and the presence of myometrial tissue surrounding the gestational sac . immediate surgery is recommended whenever rudimentary horn pregnancy is diagnosed but conservative management until viability is achieved , has been advocated in very select cases with larger myometrial mass where facilities for emergency surgery may be possible any time . a rudimentary horn pregnancy , can never be delivered vaginally and mode of delivery is always a laparotomy both with eventuality of ruptured horn or if pregnancy continues as abdominal post rupture . surgical removal of the rudimentary horn is mandatory to avoid risk of recurrence of rupture with increased maternal morbidity . however , laparoscopic excision of unruptured rudimentary horn pregnancy has been increasingly carried out with safe and favorable outcome in many expert centers now.10 a careful examination of the uterus by experienced obstetrician in every case suspected as mullerian anomaly may help to avoid misdiagnosis and catastrophic haemorrhage . high clinical suspicion , early diagnosis and timely laparotomy can reduce maternal and perinatal mortality and morbidity . | rudimentary horn is a developmental anomaly of the uterus .
pregnancy in a non - communicating rudimentary horn is very difficult to diagnose before it ruptures . a case of undiagnosed rudimentary horn pregnancy at 22 weeks presented to nizwa regional referral hospital in shock with features of acute abdomen .
chances of rupture in first or second trimester are increased with catastrophic haemorrhage leading to increased maternal and perinatal morbidity and mortality .
management of such cases is a challenge till today due to diagnostic dilemma .
expertise in ultrasonography and early resort to surgical management is life saving in such cases . |
fibrous dysplasia is not hereditary in nature and it caused by mutation in the gnas1 ( guanine nucleotide binding protein , alpha stimulating activity polypeptide ) gene ( 20q13.2 ) and this gene encodes a g - protein which results in overproduction of camp in the affected tissues . furthermore , there is increased the proliferation of melanocytes thus results in cafe - au - lait spots . fibrous dysplasia has three clinical patterns namely monostotic , polyostotic , craniofacial form . about 3% of lesions associated are with skin pigmentation and hyperfunctioning endocrine disorders known as the mccune albright syndrome . the skull base and proximal metaphysic of femora are two sites most commonly involved . in the skull fd involves skull bases and facial bones . in childhood fd presents as facial asymmetry or a bump , but symmetric expansion of malar prominences and/or frontal bosses may be seen . due to abnormal growth and deformity of craniofacial bones may result in encroachment on cranial nerves . female patients experience increased pain level during pregnancy and during the menstrual cycle because of estrogen receptors found in fd . bianco et al . demonstrated that fd is a disease of bone marrow stromal cells ( bmsc ) . the bmscs form structural framework upon which hematopoiesis occurs in the bone marrow and a subset of bmsc are multipotent stem cells capable of differentiating into multiple cells including osteoblasts , osteocytes , chondrocytes , bone marrow adipocytes and other cells . in fd bmsc differentiate along osteogenic lineage , but differentiation is arrested and instead undergo proliferation giving rise to fibro - osseous masses of tissue . g - protein is central in cell originating pathway leads to the generation of intracellular second messenger , camp / protein kinase a signaling . all mutation in gs alpha identified in association with fd is the 201 position . in > 95% cases arginine is replaced by either cysteine or histidine ( r201c or r201h ) . this result in inhibition of intrinsic gtpase activity of gs alpha protein and it is this aspect that leads to constitutive , ligand - independent generation of intercellular camp . gene amplification techniques such as polymerase chain reaction is now possible to test for genetic mutation in peripheral blood samples . actively formed lesions in adolescents have greatly increased isotope update that corresponds closely to radiographic extent of the lesion . some characteristic feature is bar - shaped pattern , whole - bone involvement and close match between the size of the lesion on radiograph and the size of the area of uptake . the extent of the lesion is visible clearly on computed tomography , and cortical boundary is depicted more clearly than radiograph . the thickness of cortex , endosteal scalloping and periosteal new bone reaction and homogeneity of the poorly mineralized lesional tissue are well demonstrated . delicate trabeculae of immature bone with no osteoblastic rimming enmeshed within a bland fibrous stroma of dysplastic spindle - shaped cells without any cellular features of malignancy . variable number of immature , nonstress oriented , disconnected dysplastic trabeculae floating in a sea of immature mesenchymal cells that have little or no collagen about them . change is noticed . the malignant transformation rate is unknown , but it is likely to be not > 1% . cancer is more likely to occur in polyostotic disease , and most common histological types were osteosarcoma , fibrosarcoma and chondrosarcoma . there are also reports suggesting that the malignant transformation may be more common in mazabraud 's syndrome ( fd in association with intramuscular myxomas ) . the findings in various studies showed that high dose intravenous pamidronate decreases pain and the markers of bone metabolism . | fibrous dysplasia ( fd ) is a benign intramedullary fibro - osseous lesion .
fd is a bone developmental anomaly characterized by replacement of normal bone and marrow bone by fibrous tissue .
it involves any of the bones as single lesion ( monostotic ) or in multiple bone lesions ( polyostotic ) or all of the skeletal system ( panostotic ) .
long bones are most commonly involved , which mostly identified incidentally and clinically appears asymptomatic .
clinical , radiographical and histopathological findings will help in confirming the lesion .
there are many treatment option available , but still management of fd remains challenging . |
a common upper airway and digestive tract is a rare congenital anomaly that is usually fatal and exact incidence of which is not known . the diagnosis is assumed to be made if there is inability to perform endotracheal intubation of a newborn with respiratory distress in an expert hand in a neonate not cried at birth . we present a newborn clinically suspected as a case of esophageal atresia with tracheo - esophageal fistula that was diagnosed retrospectively to have laryngeal atresia with absent vocal cords and a common aerodigestive tract continuing distally with trachea . we received a spontaneous vaginally delivered male outborn baby at 35 weeks period of gestation , weighing 1900 grams to a 24-years - old primigravida with antenatal risk factors of gestational diabetes mellitus and polyhydramnios . the baby was born limp without any cry and required immediate resuscitation with bag and mask ventilation . the initial intubation was reportedly difficult , and baby required frequent et suctioning for copious secretions . clinically , a strong suspicion of esophageal atresia ( ea ) and tracheo - esophageal fistula ( tef ) was made as feeding tube did not pass into the stomach . the chest x - ray revealed lower end of feeding tube going very low almost to t 6/7 level , and serial x rays revealed the feeding tube going sometimes to left side and sometimes to the right side , in retrospect , we came to know that it was in the trachea and was negotiating to left or right main bronchus . baby also had other associated anomalies at birth i.e. imperforate anus and absent right kidney . the evaluation with ultrasound revealed dilated left renal pelvis with non - visualized right kidney . the newborn was then placed in the left lateral decubitus position and a right posterolateral thoracotomy was performed . tracheo - esophageal fistula was isolated just one cm above the carina and was transfixed and ligated . the feeding tube could not be seen or felt in the operative field on maneuvering by anesthesiologist . a trial of passing a large bore tube i.e. mucus sucker was attempted , which went through but again could not be traced in the operating field as it was going into the trachea along with the ett . a trial of suctioning attempt on the mucus sucker made the right lung deflate with desaturation noticed by the anesthesiologist , which gave us a clue as to the connection of the upper end of esophagus with the trachea . an attempt was made by the otolaryngologist intraoperatively to negotiate the fiber - optic scope through the blind upper pouch , which was unsuccessful . neck exploration for creating a cervical esophagostomy was carried out ; however , the procedure was abandoned due to non - visualization of the upper end of esophagus . peroperatively , we found after neck exploration that there was only one continuous hollow tube containing the et tube . a feeding gastrostomy and sigmoid colostomy was carried out , and baby was shifted back to neonatal intensive care after the completion of surgery . baby was continued on ventilation and other supportive management with antibiotics , iv fluids , and inotropes . however , the baby succumbed on day 4 of life despite aggressive therapeutic and ventilatory support . direct laryngoscopy revealed only aryepiglottic folds behind the epiglottis , no vocal cords , and there was no visible opening for the trachea suggesting a common upper airway and digestive tract . fiber - optic scope was passed through the common opening , which revealed normal hypopharynx with normal development of the epiglottis but no evidence of true vocal cords . there was a collapsing lumen opening into a non - collapsible structure i.e. esophagus ( collapsible ) with absence of proximal trachea continuing with distal trachea ( non - collapsible ) [ figure 1 ] . a complete autopsy revealed laryngeal atresia with absent vocal cords and a common aerodigestive tract continuing distally with trachea [ figure 2 ] . flexible fiber - optic scopy view of the upper airway showing the epiglottis superiorly , an atretic larynx anteriorly , and esophagus ( hollow tube ) posteriorly postmortem specimen of upper airway showing atretic larynx with no vocal cords and dilator in esophagus very early in the development of a fetus during the third and fourth weeks of gestation , foregut divides to form the esophagus and the trachea . for an unknown reason , sometimes , the wall does not form properly and a tracheal esophageal fistula and/or esophageal atresia may be the result . upper airway agenesis seems to result from the ventral displacement of the tracheo - esophageal septum that forms during this period and a variety of different anomalies can result , including laryngeal and tracheal atresia . the various types of atresia are the result of arrest at different stages in embryonic development . the infant with pure laryngeal atresia presents with a normal color at birth , but cyanosis rapidly develops after clamping of the umbilical cord . about one - half the cases reported in the literature had other potentially fatal malformations . the vast majority of fetuses with complete larynx atresia die because the condition is not recognized and not treated immediately or because of other life - threatening anomalies . laryngotracheoesophageal cleft ( ltec ) is a rare congenital anomaly that results from failed posterior fusion of the cricoid cartilage associated with incomplete development of the tracheo - esophageal septum . ltec presents with increased secretions , respiratory distress , aspiration , and recurrent pulmonary infections . peroperatively , we anticipated that we might be dealing with a case of ltec , and we had planned for a second stage repair after complete evaluation and optimal stabilization . suspicion for a possible esophageal atresia and trachea - esophageal fistula in our case was based on clinical presentation with copious oral secretions and failure to pass down the feeding tube . at operation we found to have an absent upper blind pouch of esophagus with a common upper airway and digestive tract continuing with trachea distally and lower end of esophagus opening into the trachea . difficulty in locating the upper end of esophagus and deflation of right lung with desaturations while suctioning with a mucus sucker passed for locating the upper end raised a strong possibility of this rare congenital anomaly , which was established in the post - mortem . the diagnosis of congenital defect of a common upper airway and esophagus must be suspected if a newborn infant does not cry and develops severe cyanosis with respiratory distress soon after birth and an attempt for endotracheal intubation is unsuccessful even in expert hand , although such cases are diagnosed peroperatively or in autopsies . antenatal ultrasound findings of fetal ascites , fluid in the upper airway or enlarged and hyperechogenic lungs can raise suspicion of upper airway anatomical defects . these signs may be absent as in our case in the presence of a tracheo - esophageal or a broncho - esophageal fistula because the fluid from the lungs can pass into the stomach via the fistula . hence , in our case , an antenatal ultrasound failed to raise suspicion of a possible laryngeal atresia and tracheal agenesis . first , multiple views of feeding tube through orogastric route on chest x - ray did not show any coiling of the tube but showed passage into left or right side ( which we now know was passing into left or right main bronchus ) . second , inability to locate the upper blind pouch of esophagus in a case of ea with tef should raise the suspicion of a common wall of aerodigestive tract . we aim to familiarize our colleagues with this rare and challenging congenital anomaly for which a high index of suspicion and good team management is required . | a common upper airway and digestive tract is a rare congenital anomaly that is usually fatal and its exact incidence is not known .
it is a diagnostic challenge as it requires high index of suspicion .
it should be considered in a neonate with respiratory distress in a non - vigorous baby requiring endotracheal intubation , which is difficult even in expert hand .
we present a newborn with suspected tracheo - esophageal fistula that was diagnosed intraoperatively to have absent upper blind pouch of the esophagus and on autopsy found to have laryngeal atresia with absent vocal cords and a common aerodigestive tract continuing distally with trachea .
the neonate was ventilated with endotracheal tube ( ett ) placement which in retrospect we came to know that it was in the esophagus .
the neonate also had associated multiple congenital anomalies of vacterl association .
the importance of teamwork between neonatologist , pediatric surgeon , anesthesiologist , and radiologist is highlighted for diagnosis and management of such rare cases . |
success is measured by the extent to which the community of scientists can successfully tackle hard problems . as the diversity of the group of problem solvers increases , so too does the group s ability to find innovative solutions to difficult and complex problems ( page , 2007 ; jackson and joshi , 2011 ; kets and sandroni , 2015 ) . as it was a half century ago when the nascent space program benefited by the inclusion of physicists and engineers who were refugees from world war ii europe , so it is today . scientific enterprise will be at its best when its leaders are drawn from our nation s entire talent pool , a truly representative science . this is inclusive excellence in science , technology , engineering , and mathematics ( stem ) . , 37% of our population is persons of color ( national center for science and engineering statistics [ ncses ] , 2015 ) , and the census bureau projects that our nation will be majority minority in 25 years . already , more than half of the 50 million students in k12 public schools are ethnic minorities ( national center for education statistics , 2013 ) . this diversity is the legacy of our history as an immigrant nation whose origins are in large part founded on colonization , indentured servitude , slavery , and genocide of persons of color . even as today s diversity is a product of our troubled past , it is also our greatest strength for the future . to continue our global leadership in stem innovation , we must find ways to replace exclusion with inclusion , drawing from the many experiences and communities that together form our country s deep and dynamic talent pool . our great opportunity is to capture the energy and perspectives presented by our nation s ethnic diversity . despite the general acknowledgment of the importance of diversity in science , and despite many programs and the investment of many resources , we have not been able to substantially improve the pervasive underrepresentation of minorities in stem pathways . while the number of underrepresented minorities entering college interested in studying stem ( today , 33% ) has kept pace with the national demographics , the fraction of underrepresented minority stem baccalaureates and stem phds has remained stubbornly stuck at around 16 and 9% , respectively.1 this disparity is not simply due to poor preparation . when the outcomes of students with similar precollege backgrounds high school math , high school science labs , and family interest in higher education are compared , underrepresented minorities switch out of stem disciplines at significantly higher rates than whites and asians ( huang et al . , 2000 ) . among undergraduates who enter college planning to study stem , only 20% of underrepresented minorities complete a stem baccalaureate degree compared with 40% of whites and asians ( committee on underrepresented groups and expansion of the science and engineering workforce pipeline , 2011 ) . the persistence rate of minorities is halved again at the graduate level : among those with science baccalaureates , the yield ( science baccalaureates who go on to earn a science phd ) of underrepresented minorities is about half that of whites and asians ( ncses , 2015 ) . what , then , would it take to double the persistence of underrepresented minorities in science ? many decades of effort and experience have brought us to the point where we can describe strategies that work to dismantle institutional barriers to inclusion . the university of maryland baltimore campus ( umbc ) meyerhoff scholars program , the university of california berkeley biology scholars program , and the louisiana state university hierarchical mentoring program are examples of programs that have resulted in important gains in the persistence of underrepresented minorities in stem ( matsui et al . , 2003 ; wilson et al . , 2011 ; maton et al . , , we should carefully examine existing programs to see whether there are viable opportunities to apply them to similar challenges at other institutions . for example , umbc is collaborating with two other majority - serving research universities , pennsylvania state university and the university of north carolina at chapel hill , to understand how the meyerhoff scholars program can be successfully adapted to and adopted on another campus ( depass and chubin , 2015 ) . because programs are often designed to address specific needs , their successful implementation on other campuses requires adapting essential program elements to work in a different context . as justice sotomayor wrote a student s sense of belonging is affected by everything he or she experiences and everyone he or she encounters his or her instructors , dorm , and fellow students , the campus newspaper , and the language used by faculty and administrators ( e.g. , graham et al . , 2013 ; hurtado and alvarado , 2015 ) . a campus should gather its many parts to work together to create a climate that openly values inclusion of all persons for example , the association of american colleges and universities ( aacu ) teaching to increase diversity and equity in stem ( tides ) program brings together faculty teams that work collectively to share information and insights about inclusive practices ( www.aacu.org/tides ) . rather than forbidding overlap between grants as a matter of course , should nt we encourage institutions to strive for effective synergies ? funding agencies , accrediting organizations , and scientific societies to work with us to achieve alignment of different efforts on a single campus or on several campuses to maximize the impact of diversity initiatives . the responsibility to build and sustain an inclusive climate that supports access and success of all students resides at the organizational level . while committed faculty , funding , and campus champions are essential in initiating efforts , real and sustained progress will require concerted action within and among institutions . at many colleges and universities , stand - alone interventions such as summer bridge programs or cohort learning communities might be effective for as long as they are funded , but they do not result in the school s lasting capacity for inclusion . what these programs can do , however , is provide experimental incubators through which the institution can learn how to integrate inclusive practices across the campus . institutional accountability includes the intentional skills development of faculty and administrators so they have the opportunity to learn how to communicate about and across differences and effectively integrate active learning in their teaching . institutional capacity includes changing the curriculum and modernizing the expectations of faculty so students can be successful and faculty will be encouraged to participate in activities that promote inclusion of students from all backgrounds . institutional accountability includes the frank assessment of campus climate for inclusion and the continuous measurement of institutional progress ( aacu , 2015 ) . the howard hughes medical institute s current initiative inclusive excellence : engaging all students in science , challenges colleges and universities to significantly improve their capacity for inclusion so all students especially those who are currently underrepresented can be successful ( www.hhmi.org/programs/undergraduate-science-education-grants ) . several strategies have been shown to work , and knowledgeable leaders have emerged who are committed to inclusive excellence in stem . while these advances deserve celebration , they also bring into focus how far we have yet to go . the need to increase our capacity for inclusion is too urgent for any of us to be content with our present rate of progress . by insisting that institutions take responsibility for creating inclusive campuses , leveraging successful models through adaptation and adoption , and aligning strategies across the stem ecosystem , we can double the persistence of students from all backgrounds in stem by 2025 . as our nation resolved to do five decades ago , so now again must we reach for the stars . many decades of effort and experience have brought us to the point where we can describe strategies that work to dismantle institutional barriers to inclusion . the university of maryland baltimore campus ( umbc ) meyerhoff scholars program , the university of california berkeley biology scholars program , and the louisiana state university hierarchical mentoring program are examples of programs that have resulted in important gains in the persistence of underrepresented minorities in stem ( matsui et al . , 2003 ; wilson et al . , 2011 ; maton et al . , , we should carefully examine existing programs to see whether there are viable opportunities to apply them to similar challenges at other institutions . for example , umbc is collaborating with two other majority - serving research universities , pennsylvania state university and the university of north carolina at chapel hill , to understand how the meyerhoff scholars program can be successfully adapted to and adopted on another campus ( depass and chubin , 2015 ) . because programs are often designed to address specific needs , their successful implementation on other campuses requires adapting essential program elements to work in a different context . a student s sense of belonging is affected by everything he or she experiences and everyone he or she encounters his or her instructors , dorm , and fellow students , the campus newspaper , and the language used by faculty and administrators ( e.g. , graham et al . , 2013 ; hurtado and alvarado , 2015 ) . a campus should gather its many parts to work together to create a climate that openly values inclusion of all persons . for example , the association of american colleges and universities ( aacu ) teaching to increase diversity and equity in stem ( tides ) program brings together faculty teams that work collectively to share information and insights about inclusive practices ( www.aacu.org/tides ) . rather than forbidding overlap between grants as a matter of course , should nt we encourage institutions to strive for effective synergies ? we call on other organizations funding agencies , accrediting organizations , and scientific societies to work with us to achieve alignment of different efforts on a single campus or on several campuses to maximize the impact of diversity initiatives . the responsibility to build and sustain an inclusive climate that supports access and success of all students resides at the organizational level . while committed faculty , funding , and campus champions are essential in initiating efforts , real and sustained progress will require concerted action within and among institutions . at many colleges and universities , stand - alone interventions such as summer bridge programs or cohort learning communities might be effective for as long as they are funded , but they do not result in the school s lasting capacity for inclusion . what these programs can do , however , is provide experimental incubators through which the institution can learn how to integrate inclusive practices across the campus . institutional accountability includes the intentional skills development of faculty and administrators so they have the opportunity to learn how to communicate about and across differences and effectively integrate active learning in their teaching . institutional capacity includes changing the curriculum and modernizing the expectations of faculty so students can be successful and faculty will be encouraged to participate in activities that promote inclusion of students from all backgrounds . institutional accountability includes the frank assessment of campus climate for inclusion and the continuous measurement of institutional progress ( aacu , 2015 ) . the howard hughes medical institute s current initiative inclusive excellence : engaging all students in science , challenges colleges and universities to significantly improve their capacity for inclusion so all students especially those who are currently underrepresented can be successful ( www.hhmi.org/programs/undergraduate-science-education-grants ) . several strategies have been shown to work , and knowledgeable leaders have emerged who are committed to inclusive excellence in stem . while these advances deserve celebration , they also bring into focus how far we have yet to go . the need to increase our capacity for inclusion is too urgent for any of us to be content with our present rate of progress . by insisting that institutions take responsibility for creating inclusive campuses , leveraging successful models through adaptation and adoption , and aligning strategies across the stem ecosystem , we can double the persistence of students from all backgrounds in stem by 2025 . as our nation resolved to do five decades ago , so now again must we reach for the stars . | in spite of modest gains in the past 50 years , the united states has not been able to substantially improve on the pervasive underrepresentation of minorities in postsecondary stem pathways .
we suggest a way to guide a national effort to double the persistence of underrepresented minorities in stem in the next decade . |
the ever - aging american population is presenting to spinal surgeons increasingly with high expectations of continued quality of life well into the seventh , eighth , and ninth decades of life . however , while surgical treatment of asd is the only viable option for patients failing conservative measures , the surgical interventions are associated with relatively high morbidity and mortality rates . indeed , in a series reported from johns ' hopkins consisting of 361 patients , the 30-day mortality rate was found to be 2.4% . in a more series by smith et al . , multicenter data from the spinal deformity study group demonstrated that even in expert centers 26.2% of patients suffered a minor complication and 15.5% suffered a major complication . several factors contribute to these high complication rates , including reduced bone mass and weaker fixation points , a higher associated rate of medical comorbidites , patient deconditioning due to immobility , and a rigid and nonflexible deformity [ 3 , 4 ] . in addition , the surgical enterprise necessary to correct asd is typically a long - segment fusion with instrumentation and osteotomies . therefore , in this population , a major surgical intervention is being applied in a highly compromised patient population [ 5 , 6 ] . to combat these challenges , modern surgeons have begun to apply minimally invasive surgery ( mis ) techniques to address asd [ 79 ] . mis techniques have been associated with reduced intraoperative blood loss , lower infection rates , and quicker mobilization , all of which would be highly desirable in the asd population . while the early mis fusion experience has focused on one- and two - level procedures for degenerative spinal disease , a variety of techniques have been developed more recently for use in asd . pelvic fixation is an important tool in the armamentarium of the modern spinal surgeon , as screws or bolts of a large diameter and length can be placed safely for caudal anchoring and extend anterior to the spine in the sagittal plane and lateral to it in the coronal plane . iliac fixation is useful in asd for long instrumentation constructs , sagittal and coronal deformity corrections , and stabilization of low sacropelvic instability [ 1113 ] . this paper builds upon that experience with the application of this technique in the setting of asd . a consecutive series of 10 patients were treated over an 18-month period at a single institution . all patients underwent mis treatment of asd using expandable interbody cage placement and percutaneous pedicle and iliac screws . asd was defined as a cobb angle greater than 20. all deformities were rigid with less than 10 of motion in the coronal or sagittal planes across the deformity segments on flexion , extension , and lateral bending films . all patients had also failed conservative measures and had severe back and/or back and leg pain with distance limited gait . the accuracy of iliac screw insertion was examined using postoperative spiral ct scanning to confirm that screws were entirely within the bony confines . patients were positioned prone on the jackson table so that the pelvis would not be obscured on fluoroscopic imaging by the base of the operating table . pre - operative imaging , including 3 d reconstructed ct scans of the pelvis , was helpful for planning screw placement trajectories and to validate the fluoroscopic data in the operating room . iliac cannulation is performed prior to pedicle screw cannulation to maximize the ability to image the pelvis . in addition , the decompression , osteotomies , and interbody fusion are accomplished prior to screw placement . for each side of the iliac crest , the fluoroscope is angled in the sagittal and coronal planes in the obturator outlet view so that the x - ray beams are approximately parallel to both the inner and outer tables of the ilium ( figure 1 ) . the teardrop that is visualized is the safe corridor and placement of instrumentation within this two - dimensional space ensures safe screw placement , even with 80 mm long screws ( figure 2 ) . a 1.5 cm incision is then made overlying the posterior superior iliac spine of the pelvis ( psis ) . a jamshidi needle is then docked onto the most superficial aspect of the psis and walked ventromedially , with care not to enter into the sacroiliac joint . however , the exact starting point along the superinferior plane of the psis can vary according to the specific screw trajectory desired , as multiple acceptable paths are acceptable . a drill or osteotome can be used to create a bony depression to better seat the screw or bolt head to minimize hardware prominence ( figure 3 ) . after entering 5575 mm , the jamshidi needle cannulated cancellous screw taps are then placed over the k - wire followed by final screw insertion . pedicle screw cannulation and placement then proceed followed by rod insertion and hookup ( figure 4 ) . since the iliac screws will be more dorsal and lateral than pedicle screws , the appropriate rod bending in two planes facilitates screw - rod mating . in addition , starting the s1 screws high and the iliac screws low provides more distance between the screw heads , making the connection easier ( figure 5 ) . bending the rods while attached to the rod holder facilitates this two - plane bending when using a french bender . the exact amount of curvature to place in the rods is based upon the surgeon 's judgement of preoperative curvature , desired degree of correction , and flexibility in the spine after decompression and osteotomies . the series was consecutive with no patients lost to followup , and in no case was conversion to a traditional open technique necessary . a total of 10 patients ( 7 women and 3 men ) were treated using this technique ( table 1 ) . a total of 69 segmental levels were treated ( mean = 6.9 ) , with a range of 49 . the mean operative time was 302 minutes from skin - to - skin , and the mean intraoperative blood loss as measured by the perfusionist was 480 cc . length of acute care stay averaged 5.6 days ( range of 47 ) after surgery . three of the 10 patients were discharged to an inpatient rehabilitation facility , and the rest were discharged to home . 65 mm 8 mm screws were used in 5 patients , and 80 mm 8 mm screws were used in 5 patients . early radiographic outcomes were determined using pre - and postoperative 36 standing x - rays at last followup . the mean preoperative cobb angle was 35 which improved to a mean of 8.0 , reflecting an average of 27 of improvement . the mean preoperative global lumbar lordosis as measured between l1 and s1 was 27 which improved to a mean of 48 , reflecting an average of 21 of improvement . there were no intraoperative complications . however , one patient had two asymptomatic medial screw breaches at t10 and l5 . due to the many benefits of mis surgery , it has the potential to improve the outcomes of surgery for asd . because these patients are often medically compromised , a reduction in infection rates , intraoperative blood loss , and quicker mobilization may have a significant impact on their recovery . while in the past mis surgeons focused primarily on short segment fusions for degenerative disease , there is increasing interest in using mis techniques for asd . however , the concept that is emerging for mis deformity surgery is that the goals and standards being developed for open deformity surgery must also be met with mis surgery . in this paper while the series is of limited size , radiographic evaluation demonstrated safe iliac screw placement using a relatively straightforward technique that did not require specialized equipment is possible . using a single c - arm and the obturator outlet view , standard size iliac screws while image guidance can be helpful in many settings , navigation systems are expensive , prone to error , and require additional setup time . thus , we have chosen to continue using a simplified c - arm method for screw placement . the introduction of commercially available cannulated iliac screws has also helped to make this procedure widely accessible to surgeons and renders the procedure as accessible as open screw placement . it should however be remembered that screw misplacement with any surgical technique can result in sciatic nerve injury , major vessel disruption , pelvic fracture , or retroperitoneal hematoma formation , and these risks are higher in the asd population . when applying this technique , many of the considerations for open surgery are relevant to the mis setting . it is critical to recess the iliac screw heads to reduce complaints of hardware prominence . this can be accomplished by using the drill or osteotome to created an opening in the posterior cortical wall of the ilium . in additional , starting the screw below the psis keeps the saddle low . with regard to hardware connections , placing the iliac screw heads medial and the pedicle screws lateral keeps the screw saddles in a single plane and facilitates rod - screw mating . however , despite these efforts , multiple - rod plane bending is often necessary as lateral offset connectors can not be applied using a truly percutaneous method . it should also be noted that in this series the screws were either 65 or 80 mm in length . open deformity surgeons commonly use longer screws to obtain superior fixation . in this series , we generally did not treat cases of severe scoliosis ( > 60 ) or major kyphosis , and the series also did not include serious revisions and thus have had success with the shorter iliac screws . furthermore , maintenance of the soft tissue envelope and posterior tension band with mis surgery preserves the spine 's native integrity and thus may obviate the need for these longer screws . ultimately , the placement of screws greater than 100 mm in length should be feasible but will be yet another area requiring validation in the clinical setting . while mis surgery for asd has not been able to completely replace open , conventional methods , the expanding spectrum of mis techniques has allowed the modern mis surgeon to perform ever more complex surgeries in this patient population . percutaneous iliac screws represent one such advance to allow for successful caudal anchoring of long - segment spinal fixation constructs . | introduction .
adult spinal deformity ( asd ) surgeries carry significant morbidity , and this has led many surgeons to apply minimally invasive surgery ( mis ) techniques to reduce the blood loss , infections , and other peri - operative complications .
a spectrum of techniques for mis correction of asd has thus evolved , most recently the application of percutaneous iliac screws .
methods . over an 18 months 10 patients with thoracolumbar scoliosis underwent mis surgery .
the mean age was 73 years ( 70% females ) .
patients were treated with multi - level facet osteotomies and interbody fusion using expandable cages followed by percutaneous screw fixation .
percutaneous iliac screws were placed bilaterally using the obturator outlet view to target the ischial body .
results .
all patients were successfully instrumented without conversion to an open technique .
mean operative time was 302 minutes and the mean blood loss was 480 cc , with no intraoperative complications .
a total of 20 screws were placed successfully as judged by ct scanning to confirm no bony violations .
complications included : two asymptomatic medial breaches at t10 and l5 , and one patient requiring delayed epidural hematoma evacuation .
conclusions .
percutaneous iliac screws can be placed safely in patients with asd .
this mis technique allows for successful caudal anchoring to stress - shield the sacrum and l5-s1 fusion site in long - segment constructs . |
malaria is a common protozoan disease in tropical countries caused by the genus plasmodium transmitted by the bite of infected anopheles mosquitoes . severe complicated malaria is most frequently caused by plasmodium falciparum and much less commonly by plasmodium vivax or other plasmodium species . abdominal pain as a presenting complaint has been reported in 21.433.5% of patients with malaria and is usually mild and transient . it occasionally can be severe and persistent , especially with complications such as splenic infarction , splenic rupture , splenic torsion , acalculous cholecystitis , and hepatitis . however , acute pancreatitis causing abdominal pain and complicating malaria is very rare and there are only 12 cases reported from literature till now . five patients admitted in the christian medical college , vellore between 2005 and 2010 with a diagnosis of malaria and acute pancreatitis are described . malaria was confirmed by demonstration of the characteristic ring forms of either p. falciparum or p. vivax on a thin blood smear . acute pancreatitis was diagnosed in the presence of at least two of the following criteria : acute , persistent , and severe abdominal pain not subsiding with proton pump inhibitors , elevation in serum lipase or amylase to three times greater than the upper limit of normal , and characteristic findings of acute pancreatitis on radiographic imaging . other causes of pancreatitis such as alcohol , gall stones , and hypercalcemia were ruled out . in addition , a medline search was performed to identify the cases of malaria with acute pancreatitis reported in the literature using the search terms malaria , cases were accepted where information regarding the demographics , laboratory tests , and the outcome was provided . this study was approved by the institutional review board of christian medical college , vellore ( irb min no . the mean age of the patients was 40.4 years , and 4 out of 5 were males . all the patients were healthy before the current illness , and none had prior history of chronic alcohol consumption or cholelithiasis . none of the patients had any prior history of abdominal procedures including endoscopic retrograde cholangiopancreatography . all the patients had a history of abdominal pain , which was central and did not improve with proton - pump inhibitors . all of these patients had p. falciparum infection with a variable parasitic index , ranging from 0.14 to 32 , as demonstrated on a thin film . pancreatic enzymes were significantly elevated in all , with a mean serum lipase level of 1795 u / l ( normal value : < 190 u / l ) and a mean serum amylase level of 584 u / l ( normal value : < 100 u / l ) . ultrasonography evidence of acute pancreatitis ( bulky pancreas ) was seen in two patients , and a further two patients had minimal left - sided pleural effusion . thrombocytopenia ( platelet count < 100,000/cumm ) , renal dysfunction ( serum creatinine > 1.4 mg / dl ) and hyperbilirubinemia were seen in all the patients . all the patients were treated with an artemisinin - based combination therapy along with doxycycline . one of the patients ( case 5 ) required a nasojejunal tube placement for pancreatitis . one patient ( case 3 ) who presented with a parasitic index of 0.5% severe malaria with hepatic , renal , neurological and hematological dysfunction and required invasive ventilator support and multiple sessions of hemodialysis . despite these aggressive measures the patient profile , laboratory investigations , and outcome of these five patients are shown in table 2 . india 's expansive geography and tropical environment are ideal for sustaining malaria vectors , and it accounts for 76% of cases from southeast asia . although the overall deaths have reduced since the launch of national malaria control program , it is argued that reports of approximately 1000 deaths per year are grossly underestimated . p. falciparum contributes to 52% of the total malaria cases in india and is responsible for the majority of deaths . acute pancreatitis as a complication of malarial infection , though rare , has been usually reported with p. falciparum . it has been associated with at least four deaths , in the reported 15 cases reported in literature based on our medline search . primary care physicians deal mostly with vivax malaria in most parts of india as it is usually the predominant species . in our case recent studies have shown that vivax malaria can be as severe as falciparum malaria , a fact consistent with our finding of a severe complications such as pancreatitis due to p. vivax . in our case series , one patient died as a result of multiorgan involvement including acute pancreatitis , the causative organism being p. falciparum . only two patients ( case 1 and case 4 ) had a high parasitic index . hyperparasitemia though a predictor for severe malaria is not the only marker for severity . in patients not previously exposed to malaria poor immunity may result in severe disease even with parasitic index as low as 2% . the pathogenesis of pancreatitis is probably not different from that of other organ involvement in malaria and includes cytoadherence of infected red blood cells ( rbcs ) to the vascular endothelium , sequestration of rbcs , and rosetting . however , sequestration occurring in other organs including pancreas is not known as of now . in our literature search , we found only 15 cases of malaria complicated by pancreatitis and their profile is summarized in table 3 . literature review of patients with malaria and acute pancreatitis in our country , malaria continues to be a major public health problem in india , accounting for sizeable morbidity and mortality . the burden of falciparum malaria is very high in places such as orissa and the northeastern states where the mortality rate due to malaria is even higher . fever and abdominal pains are very common presentations to the emergency department and pancreatitis accounts for about 11% of those cases . primary care physicians deal with these common problems in their daily practice and their etiology quite often remains a diagnostic dilemma . greater awareness of the rare complications of a common infection such as malaria is essential to recognize it early and to initiate early management or early referral to a higher center . physicians may be familiar with the various complications of falciparum malaria but less so with acute pancreatitis . the ability to properly diagnose and to manage acute pancreatitis due to malaria is particularly important in malaria - endemic areas such as india . maintaining a high index of suspicion for acute pancreatitis in patients with malaria presenting with abdominal pain can be important in the early diagnosis and prevention of pancreatic complications . | malaria is endemic in large parts of india and can cause multiorgan failure and death .
acute pancreatitis as a complication is rare and is potentially fatal .
this case series describes five adult patients between 2005 and 2010 who presented with a short duration febrile illness and diagnosed to have malaria with acute pancreatitis .
the mean age of the five patients with acute pancreatitis was 40.4 years and four of them were males .
none of them were alcohol consumers and did not have any other risk factor for acute pancreatitis .
plasmodium falciparum was responsible for all the cases .
pancreatic enzymes were significantly elevated in all the patients with a mean serum lipase level of 1795 u / l ( normal value : < 190 u / l ) and a mean serum amylase level of 584 u / l ( normal value : < 100 u / l ) .
ultrasonography evidence of acute pancreatitis ( bulky pancreas ) was seen in two patients , and a further two patients had minimal left - sided pleural effusion .
thrombocytopenia ( platelet count < 100,000/cumm ) , renal dysfunction ( serum creatinine > 1.4 mg / dl ) , and hyperbilirubinemia were seen in all the patients .
one patient died due to multiorgan failure .
acute pancreatitis is a very rare complication of malaria , and a high index of suspicion is required in patients presenting with severe malaria and abdominal pain . |
starting in june 2005 , several players of a dutch soccer team , consisting of 35 members , noted soft - tissue infections . in october 2005 , the municipal health service received a report of a patient , a member of this soccer team , who had been hospitalized for an abscess resulting from mrsa . other members of the team had skin infections as well , and screening was started . a case was defined as a patient who had a culture - confirmed mrsa infection during the outbreak period october 2005 through january 2006 . healthcare staff obtained specimens by swabbing the patients ' nose , throat , or wound . a total of 56 persons were screened : 42 members of the soccer club and 14 of their roommates . the 42 members consisted of soccer players , coaches , and people who used the same training facilities , locker room , and showers . the roommates screened were all those who lived with an mrsa - positive player and those who lived with an mrsa - negative player but had skin infections . of the 56 persons screened , we identified an mrsa infection in 11 persons : 9 soccer players and 2 roommates ( table ) . most infections lasted for several weeks . for all players who had soft tissue infections , mrsa was diagnosed . among those in whom one roommate had an abscess in the armpit , but the soccer player she lived with was mrsa negative . * mrsa , methicillin - resistant staphylococcus aureus ; gi , gastrointestinal ; na , not available ; nt , not tested ; ns , not specified . this player was the index case - patient and was hospitalized . to prevent further mrsa transmission , on october 28 the soccer club was instructed to increase hand hygiene , not share personal items , use liquid soap and disposable towels , put a towel on the bench before sitting , increase frequency of cleaning the facilities , and provide more ventilation to the locker room and showers . all patients were treated with cotrimoxazole for 1 week or , if needed , longer until wound infections were healed . perineum cultures from 3 patients showed carriage of mrsa in the gastrointestinal tract , and rifampicin was added to cotrimoxazole for 1 week or , if needed , longer until wounds were healed . furthermore , patients used chlorohexidine , gluconate scrub , povidone iodine , and mupirocin ointment for 5 days . a patient was declared mrsa free after 3 cultures , taken at 1-week intervals , were mrsa negative . one patient , who also had eczema , remained mrsa positive . in november 2005 , mrsa was isolated from a 33-year - old soccer player with a boil , who was a member of a neighboring team . this soccer player had competed against the team with the mrsa - positive players on october 8 , before mrsa - positive results were known and hygiene measures recommended . immediately , this player 's team was screened for mrsa ; all other players were mrsa negative . the mrsa isolate from this player was included in the analysis . to characterize the mrsa strains , the following typing methods were used : pulsed - field gel electrophoresis ( pfge ) , staphylococcal protein a ( spa ) typing , multilocus sequence typing , sccmec typing , and pcr of pvl genes ( luks - lukf ) . all mrsa isolates were identical and identified as the european ca - mrsa st80-mrsa - iv strain . all strains were pfge type 28 ( according to the dutch pfge classification system ) , spa type t044 , st80 , sccmec iv , and pvl positive . all mrsa isolates had identical susceptibility patterns ; they were resistant to oxacillin ( and thus to all -lactam antimicrobial drugs ) , tetracycline , and fusidic acid . they were susceptible to rifampicin , ciprofloxacin , gentamicin , erythromycin , clindamycin , vancomycin , teicoplanin , and cotrimoxazole . this study shows transmission of the ca - mrsa st80-iv strain among members of a dutch soccer team . transmission apparently occurred not only between members of this team but also to a competing soccer team . transmission of the usa300 strain between members of different teams was previously described for football teams ( 8) . we can not rule out the possibility of an independent colonization of the st80-mrsa - iv strain in the competing team , but the 2 teams competed against each other during the period when the first symptoms were noted by members of the first team . because soccer involves much less contact than football , rugby , or wrestling , mrsa transmission may not necessarily have been caused by skin - to - skin contact but this possibility has also been suggested in a report about a ca - mrsa outbreak among sports participants ( 12 ) . to our knowledge , this is the first report of an outbreak of the ca - mrsa st80-iv strain in a sports team . as with the usa300 strain , more outbreaks of ca - mrsa st80-iv are likely . therefore , to identify and control an outbreak as early as possible , sports physicians and coaching staff should be alerted and informed about ca - mrsa . | an outbreak of community - acquired methicillin - resistant staphylococcus aureus occurred among members and close contacts of a soccer team .
typing of the isolates showed the outbreak was caused by the well - known european st80-iv strain . to our knowledge , this is the first report of an outbreak of this strain among members of a sports team . |
stroke accounts for approximately 11% of all deaths worldwide and is the most common cause of adult - acquired disability . among all stroke cases , ischemic stroke and intracerebral hemorrhage ( ich ) account for about 8085% and 1520% , respectively . intravenous thrombolysis by using tissue plasminogen activator ( tpa ) is the only approved treatment for acute ischemic stroke . however , tpa has very narrow time window ( within 4.5 h after onset ) of application . therefore , only a minority of patients ( 2% to 4% ) can receive timely therapy . cell therapy might be a promising strategy for stroke . bone marrow - derived mononuclear cells ( bm - mncs ) and mesenchymal stem cells ( bm - mscs ) both are bone marrow stromal cells ( bm - scs ) and are most frequently used in preclinical and clinical neurorestorative studies in stroke . bm - mncs / mscs have self - renewal capacity and pluripotency to differentiate into several mesenchymal cellular lineages , including osteoblasts , chondroblasts , adipocytes , myocytes , and fibroblasts . they can also differentiate into non - mesenchymal lineages , including neurons and glial cells . preclinical studies observed that bm - mncs / mscs transplanted either intracranially or intravascularly could migrate to damaged brain tissue and exert a neuroprotection effect by inhibiting apoptosis , decreasing peri - infarct inflammation , and promoting angiogenesis [ 79 ] . therefore , during the past decade , a series of clinical trials was performed to assess the effectiveness and safety of bm - scs transplantation after stroke . due to the small number of patients recruited in individual trials , the statistical power of the conclusions is weak . one recent single - arm meta - analysis showed this cell therapy could effectively improve national institutes of health stroke scale ( nihss ) scores , modified barthel index ( mbi ) score and modified rankin score ( mrs ) . however , without comparison with a control group , there might have observational bias . therefore , this study aimed to pool previous controlled trials to assess the effectiveness of bm - scs - based cell therapy after ischemic stroke . this study generally followed the preferred reporting items for systematic reviews and meta - analyses ( prisma ) guidelines . relevant studies published from 1 jan 2000 to 1 sept 2014 were searched among pubmed , medline , embase , and the cochrane database . we only included randomized or non - randomized controlled trials that assessed effectiveness of bm - mncs / mscs - based cell therapy in either ischemic stroke patients . the basic data extracted from original studies included : family name of the first author , year of publication , type of stoke , study design , number of patients , mean age , type of cell used , route of cell delivery , number of cells injected , time interval from stroke to therapy , follow - up , baseline nihss score , and outcome indicator measured . to assess the effectiveness of cell therapy , the outcome indicators used to assess therapeutic effectiveness include modified rankin score ( mrs ) , barthel index ( bi ) or modified barthel index ( mbi ) , and national institutes of health stroke scale ( nihss ) . original data were pooled and analyzed by using review manager 5.3 ( the cochrane collaboration ) . the risk ratio ( rr ) and corresponding 95% confidence intervals ( ci ) of mrs 2 ( cell therapy vs. control ) were estimated . for the discontinuous data , including bi or mbi and nihss score , weighted mean difference ( wmd ) and corresponding 95% ( ci ) was estimated . the chi - square based q test and i value were used to assess between - study heterogeneity , which also determines the methods used for making estimation . the random - effects model ( dersimonian and laird method ) was used when p < 0.1 in q test or i > 50% , which indicates significant heterogeneity . otherwise , the fixed - effects model based on mantel - haenszel method was applied . this study generally followed the preferred reporting items for systematic reviews and meta - analyses ( prisma ) guidelines . relevant studies published from 1 jan 2000 to 1 sept 2014 were searched among pubmed , medline , embase , and the cochrane database . we only included randomized or non - randomized controlled trials that assessed effectiveness of bm - mncs / mscs - based cell therapy in either ischemic stroke patients . the basic data extracted from original studies included : family name of the first author , year of publication , type of stoke , study design , number of patients , mean age , type of cell used , route of cell delivery , number of cells injected , time interval from stroke to therapy , follow - up , baseline nihss score , and outcome indicator measured . to assess the effectiveness of cell therapy , the outcome indicators used to assess therapeutic effectiveness include modified rankin score ( mrs ) , barthel index ( bi ) or modified barthel index ( mbi ) , and national institutes of health stroke scale ( nihss ) . original data were pooled and analyzed by using review manager 5.3 ( the cochrane collaboration ) . the risk ratio ( rr ) and corresponding 95% confidence intervals ( ci ) of mrs 2 ( cell therapy vs. control ) were estimated . for the discontinuous data , including bi or mbi and nihss score , weighted mean difference ( wmd ) and corresponding 95% ( ci ) was estimated . the chi - square based q test and i value were used to assess between - study heterogeneity , which also determines the methods used for making estimation . the random - effects model ( dersimonian and laird method ) was used when p < 0.1 in q test or i > 50% , which indicates significant heterogeneity . otherwise , the fixed - effects model based on mantel - haenszel method was applied . based on searching and screening with the preset criteria , 5 trials [ 1115 ] were finally included in this meta - analysis . the 5 trials involved a total of 228 patients , among which 104 were in the cell therapy group and 124 were in the control group . two studies used bm - mscs and 3 studies used bm - mncs [ 1315 ] . four studies transplanted cells through iv injection [ 1113,15 ] and 1 used ia injection . the time interval from stroke to cell therapy varied from several days to several months after stroke . four trials reported outcome with 6-month follow - up , while 1 study reported 5-year outcome . generally , modified rankin score ( mrs ) , barthel index ( bi ) , modified bi ( mbi ) , and national institutes of health stroke scale ( nihss ) scores are the 3 indicators most used to assess clinical outcomes of cell therapy . two studies reported bi and 2 studies reported mbi at the end of follow - up . generally , although the cell therapy group had slightly higher bi or mbi score , the mean difference was not significant between cell therapy and control group ( wmd : 2.50 , 95%ci : 4.69 to 9.68 , p=0.50 , i=46% ) ( figure 2 ) . subgroup analysis was performed by stratifying bi and mbi . subgroup using mbi as the indicator of daily activities of living reported significantly higher mbi score in the cell therapy group than in the controls ( wmd : 7.44 , 95%ci : 1.82 to 13.06 , p=0.009 , i=0% ) ( figure 2 ) , but no significant difference was observed in the bi subgroup ( wmd : 3.24 , 95%ci : 12.14 to 5.65 , p=0.47 , i=0% ) ( figure 2 ) . two studies reported nihss at the end of follow - up . generally , the mean difference of nihss score was significant lower in the cell therapy group than in the control group ( wmd : 1.85 , 95%ci : 2.77 to 0.93 , p<0.0001 , i=24% ) ( figure 3 ) . due to the non - randomized design of some studies , we only compared the proportion of patients with mrs 2 before and after cell therapy in the experimental arm . the meta - analysis did not find significant change in the proportion of patient in the mrs 2 group before and after cell therapy ( 13/86 vs. 15/86 ) ( rr : 1.81 , 95%ci : 0.37 to 8.95 , p=0.47 ) ( figure 4 ) . infection , recurrence of stroke , and death were used to assess the safety of bm - mscs transplantation . our meta - analysis did not find any difference in these 3 indicators between the cell therapy and control group ( figure 5 ) . two studies reported bi and 2 studies reported mbi at the end of follow - up . generally , although the cell therapy group had slightly higher bi or mbi score , the mean difference was not significant between cell therapy and control group ( wmd : 2.50 , 95%ci : 4.69 to 9.68 , p=0.50 , i=46% ) ( figure 2 ) . subgroup using mbi as the indicator of daily activities of living reported significantly higher mbi score in the cell therapy group than in the controls ( wmd : 7.44 , 95%ci : 1.82 to 13.06 , p=0.009 , i=0% ) ( figure 2 ) , but no significant difference was observed in the bi subgroup ( wmd : 3.24 , 95%ci : 12.14 to 5.65 , p=0.47 , i=0% ) ( figure 2 ) . two studies reported nihss at the end of follow - up . generally , the mean difference of nihss score was significant lower in the cell therapy group than in the control group ( wmd : 1.85 , 95%ci : 2.77 to 0.93 , p<0.0001 , i=24% ) ( figure 3 ) . three studies reported the change in mrs at the end of follow - up . due to the non - randomized design of some studies , we only compared the proportion of patients with mrs 2 before and after cell therapy in the experimental arm . the meta - analysis did not find significant change in the proportion of patient in the mrs 2 group before and after cell therapy ( 13/86 vs. 15/86 ) ( rr : 1.81 , 95%ci : 0.37 to 8.95 , p=0.47 ) ( figure 4 ) . infection , recurrence of stroke , and death were used to assess the safety of bm - mscs transplantation . our meta - analysis did not find any difference in these 3 indicators between the cell therapy and control group ( figure 5 ) . in animal models , transplantation of bm - mncs or mscs could reduce inflammation , decrease the infarct size in the brain , and improve neurological function in several models of stroke through multiple mechanisms [ 1618 ] . a recent meta - analysis based on 46 preclinical animal studies previous preclinical studies observed that although bm - mscs and bm - mncs could transdifferentiate into neuronal - like in vitro , they did not have basic neuronal functional properties ; this transdifferentiation seldom happens in vivo . in fact , a study based on animal models showed that only a very small proportion ( about 0.02% ) of the intravenously delivered bm - mncs migrate to the ischemic area of the brain , while most of the transplanted cells develop a macrophage / microglial phenotype . generally , the transplanted cells have a stimulating effect on release of cytokines and neurotrophic factors , including brain - derived neurotrophic factor ( bdnf ) , basic fibroblast growth factor ( bfgf ) , nerve growth factor , vascular endothelial growth factor ( vegf ) , insulin - like growth factor-1 , hepatocyte growth factor ( hgf ) , and stem cell factor . these factors can induce angiogenesis , reduce neuronal apoptosis , enhance axonal regeneration , rebuild synapses and dendrites , and promote differentiation of endogenous neural stem and progenitor cells . these effects do not necessarily require the presence of transplanted cells at the injury site in the brain . therefore , the paracrine effects of transplanted cells might be fundamental to positive clinical outcomes . however , in clinical trials , data on the exact effects of bm - mncs / mscs - based cell therapy after stroke are still conflicting . this study , based on 5 double - arms trials , demonstrated that bm - derived stromal cells might have some benefits in lowering the grade of impairment caused by ischemic stroke . in fact , a 1-point increase of nihss score decreases the likelihood of an excellent outcome by 17% . in addition , there might be some benefits in activities of daily living as measured by mbi . however , the studies involved a limited number of patients and were conducted by a same research team , so the statistical power of the finding might be weak . clinical trials usually define favorable outcome of stroke as mrs grade 2 . however , this meta - analysis failed to demonstrate significant benefits of bm - mscs / mncs - based cell therapy in increasing the proportion of mrs 2 patients . due to this study did not find any severe adverse events associated with cell therapy , suggesting it is a relatively safe intervention . firstly , the number of trials and the number of patients recruited in each trial were small . in addition , different trials reported different clinical outcomes , which makes it hard to use the same scale to summarize the results . these limitations significantly weaken the statistical power of the findings . secondly , to develop an effective cell therapy strategy , several factors , including eligibility criteria of the patients , timing , and route and dose of cell transplantation , should be considered in clinical practice . however , based on the available evidence , these factors still need to be optimized . patients with moderate , but not mild or severe , stroke might be more suitable for cell therapy , since patients with mild strokes generally have uniformly good outcome and patients with severe stroke are less likely to respond to the intervention and thus are unlikely have good outcome . the 5 trials recruited patients with basic nihss scores ranging from 4 to 20 , which means minor , moderate , and moderate - to - severe patients were all recruited . therefore although bm - mncs / mscs transplantation might generate some benefits in lowering the grade of impairment caused by ischemic stroke , large rcts are required to further confirm the effectiveness of bm - mscs / mncs - based cell therapy and to optimize the conditions required for best therapeutic effects . | backgroundautologous bone marrow stromal cells ( bm - scs ) transplantation might be a potential therapy for stroke .
although a series of clinical trials were performed to assess the effectiveness and safety of bm - scs transplantation after ischemic stroke , the results are still conflicting . this study aimed to pool
previous controlled trials to assess the effectiveness of bm - scs - based cell therapy after ischemic stroke.material/methodsrelevant studies were searched among online databases .
barthel index ( bi ) or modified barthel index ( mbi ) , national institutes of health stroke scale ( nihss ) , and rankin score ( mrs ) were used to assess therapeutic effects .
the frequencies of adverse events were extracted for assessing safety of stem cell therapy .
data analysis was performed by using review manager 5.3.resultspatients who received cell therapy had significantly lower nihss score ( 1.85 ) than the controls .
in addition , there might be some benefits in daily activity measured by mbi , but this meta - analysis failed to demonstrate significant benefits of bm - scs - based cell therapy in increasing the proportion of mrs 2 patients .
we did not find any severe adverse events associated with bm - scs - based cell therapy.conclusionsalthough bm - mncs / mscs transplantation might generate some benefits in lowering the grade of impairment caused by ischemic stroke , large rcts are required to further confirm the effectiveness of bm - mscs / mncs - based cell therapy and to optimize the conditions require for best therapeutic effects . |
enormous esthetic demands have led the dentists to adopt the resin composite restorations in routine dental practice . surface roughness of the dental restorations remains a striking problem associated with the use of direct composite resins which increases plaque retention resulting in gingival inflammation , superficial discoloration , and secondary caries . on the contrary , smooth , highly polished restorations are shown to be less susceptible to plaque accumulation and extrinsic discoloration ; bear improved mechanical properties . the performance of a composite restorative is also dependent upon the type and size of the filler . usually , a composite with smaller size filler particles provides better surface finish than one containing larger filler particles . refinements in the particle size through enhanced milling and grinding techniques have resulted in composites with particles that are sub - micron ( nano - hybrid ) , typically averaging about 0.4 - 1 m and generally considered to be the universal composites as they can be used for most anterior and posterior applications owing to excellent strength and polishing ability . a variety of finishing and polishing procedures are routinely employed such as carbide burs , diamond points , abrasive disks , abrasive finishing strips , and polishing pastes . recently , one - step polishing systems such as pogo ( dentsply / caulk , milford , de , usa ) and onegloss ( shofu inc , japan ) are introduced by which contouring , finishing , and polishing can be completed using a single instrument in minimal time . pogo is a one - step diamond micropolisher and onegloss is an aluminum oxide finisher and polisher , which provide ideal finish for all types of composite and cemented restorations . paul , usa ) have been developed which is the only system having a universal design that facilitates finishing and polishing in all the regions of the tooth . it consists of two - step finishing and polishing elastomeric wheels impregnated with aluminum oxide powder particles . assessment of surface roughness using profilometer has been the criterion to measure and predict the deterioration of restorations of different material types . the most commonly used parameter to describe surface roughness is ra , which is the arithmetic mean of vertical departure of a profile from the mean . although the surface finish of composites has been widely investigated both in laboratory as well as clinical studies , information about the quality of surface finish from different polishing systems on the surface roughness of nano - hybrid composite resin is scarce and limited . therefore , this in vitro study was aimed to investigate the influence of different polishing systems on the surface roughness of two different nano - hybrid composite resins . the null hypothesis for the present study stated that there shall not be any difference in the polishing ability of either the tested polishing systems or the experimental nano - hybrid composites . seventy identical teflon wells were fabricated ( 10 mm diameter and 3 mm height ) and randomly assigned to two groups ( n = 35 each ) based on the type of restorative material ; group i tetric n - ceram ( ivoclar vivadent , mumbai , india ) and group ii filtek z350 ( 3 m espe , st . each group was further subdivided into four subgroups based on the polishing regimen used as follows : subgroup ia and iia onegloss ( shofu inc , japan ) ( n = 10 ) , subgroup ib and iib - pogo ( dentsply / caulk , milford , de , usa ) ( n = 10 ) , subgroup ic and iic sof - lex spiral ( 3 m espe , st . paul , usa ) ( n = 10 ) and subgroup i d and iid mylar strip ( control ) ( n = 5 ) . restorative materials were polymerized according to manufacturer 's instructions using an led curing light ( ledition , ivoclar vivadent , liechtenstein , usa ) placed perpendicular to the specimen 's surface at a distance of < 1.0 mm . specimens were examined for obvious voids , labeled on the bottom , and randomly separated as per subgroup treatment protocol . except for the mylar strip groups , specimens in the other three subgroups were wet - grounded for 30 s with 1200-grit silicon carbide paper on a metallurgical finishing wheel to provide a baseline before applying the polishing systems . the polishing procedure was varied according to the polishing system used as follows : subgroup ia , iia onegloss ( shofu ) polishing disk was used for 30 s at 15,000 rpm with a low - speed handpiece for each sample . subgroup ib , iib the flat , broad surface of pogo diamond micro - polisher disk was first applied using light hand pressure , followed by a gentle buffing motion for 30 s at 15,000 - 25,000 rpm with a low - speed handpiece . subgroup ic , iic - first the finishing wheel was used followed by the polishing wheel for 30 s each with moderate pressure applied with a handpiece speed of 10,000 - 20,000 rpm . subgroup i d , iid ( control ) restorative materials were polymerized with the mylar strip on top of the specimens and no finishing or polishing system were used . to reduce the variability , the same operator performed all the procedures . surface roughness test was performed with a contact profilometer ( perthometer , mitutoyo , s j-201p ) having a diamond tip stylus with a tip diameter of 2 m . three successive measurements in different directions were recorded for all specimens in each group , and the average surface roughness ( ra ) value was obtained . the cut - off value for surface roughness was 0.25 mm , and the sampling length for each measurement was 1.25 mm . independent sample t - test and post - hoc tests were used to compare the means between two groups and one - way analysis of variance was used to evaluate the intra - group comparison ( confidence interval = 95% ) . tetric n - ceram ( group i ) provided smoother surface finish as compared to filtek z350 ( group ii ) ( p = 0.04 ; confidence interval = 95% ; degree of freedom = 68 ) . pogo group ( ib , iib ) created similar smooth surfaces as with mylar strip group ( i d , iid ) , while significantly rougher surfaces were obtained after applications of sof - lex spiral group ( ic , iic ) and onegloss group ( ia , iia ) ( p < 0.05 ) in both the main groups . none of the polishing systems achieved equally smooth surfaces as that of mylar strip group ( p < 0.0001 ) . however , pogo ( ib , iib ) created maximum smoothness among all the polishing systems tested [ figure 1 ] . graphical representation of the mean score of surface roughness of all the polishing systems finishing and polishing of resin composite restorations are critical steps to enhance the esthetics and longevity of restored teeth . poorly polished restorations are susceptible to surface discoloration , plaque buildup , gingival irritation , and recurrent caries . the surface quality of resin composite restorations is associated with the polishing quality along with its inborn physical properties like volume , hardness , quantity of filler particles and organization of the resin matrix . the present study employed wet 1200-grit silicone carbide paper ( average abrasive particle size : 30 m ) for finishing the resin composite surface to simulate the clinical scenario as similar particle size abrasives are incorporated to most dental finishing instruments . mylar strip produced perfectly smooth restoration surface , although it is rich in the resin organic binder . finishing and polishing in such a case results in harder , more wear resistant and esthetically pleasing surface which is attributed to the removal of the superficial resin layer . the efficiency of abrasive systems is related to the flexibility of the backing material in which the abrasive is embedded , the hardness of the abrasive , geometry of the instrument and its manner of use . the abrasive particles must be relatively harder than the filler of composite for a finishing system to be effective . if not , the polishing agent will only remove the soft resin matrix and leave the filler particles protruding from the surface . in the present study , pogo polisher produced smoother surfaces than onegloss and sof - lex spiral wheel similar to previous studies . pogo is a flexible micro - polisher disk with fine diamond particles whereas , sof - lex spiral contains elastomeric impregnated with aluminum oxide particles , and onegloss is polyvinylsiloxane impregnated with aluminum oxide . the excellent polishing ability of pogo may be attributed to lower surface roughness and harder diamond ( 7000 khn ) particles as compared to aluminum oxide ( 2100 khn ) . furthermore , visual inspection of the polished specimens with pogo revealed an enamel - like glossy surface while onegloss and sof - lex - spiral wheel system created a duller appearance . comparatively better surface finish in the case of tetric n - ceram ( group i ) could be linked to the relatively less hard filler constituents as tetric n - ceram has barium glass ( 1.25 moh 's ) , ytterbium fluoride ( 206 khn ) filler whereas filtek z350 consists of zirconia ( 1600 khn ) and silica ( 820 khn ) as fillers . the sof - lex spiral wheel is a two - step technique whereas onegloss being a single step polishing system . in the present study , sof - lex spiral wheel resulted in better surface finish than the onegloss in agreement with the earlier studies where multistep polishing systems resulted in better surface finish than the single step . in the composition of resin composites , an interdependent relationship exists between the amount of inorganic filler particles and that of the organic matrix . in the present study , it may be attributed to higher filler loading of tetric n - ceram ( 82.5% w ) as compared to filtek z350 xt ( 78.5% w ) and so the resin matrix content of filtek z350 ( 20 - 25% w ) is higher than the tetric n - ceram ( 10 - 15% w ) , which makes the polishing of filtek z350 more difficult . this study utilized two - dimensional ( 2d ) profilometry for quantitative assessment of the surface characteristics of the polished composites as used in previous research ; however , three - dimensional profilometry could have provided a complete description of the surface topography . in addition , the atomic force microscopy equipped with a 0.01 m tip would have offered a much better spatial resolution of the traced surface . according to chung , the ra value determined by 2d profilometry was < 1 m when the composite surfaces were visibly smooth . on the other hand , if 2d surface roughness ( ra ) were above 0.2 m , it exceeded the clinically acceptable threshold for composite resin restorations . according to bollen et al . , higher ra values were accompanied by increased plaque accumulation and a higher risk for dental caries and periodontal diseases . however , other studies reported that there is no difference in plaque accumulation throughout the roughness ( ra ) range of 0.7 - 1.4 m . in the present study , therefore within the limitation of the present study it can be concluded that polishing action of pogo is better then the onegloss and sof - lex spiral wheel . in addition , tetric n - ceram seems to be better in context to polishing ability , than filtek z350 . | objective : the study aimed to investigate the influence of different polishing systems on the surface roughness of nano - hybrid composite resins.background:different shapes of polishing systems are available according to the site of work . to minimize variability , a new system with single shape
is developed that can be utilized in both anterior as well as posterior teeth.materials and methods : seventy composite discs were fabricated using teflon well ( 10 mm 3 mm )
. two main group of nano - hybrid composite group i filtek z350 and group ii tetric n - ceram were used ( n = 35 for each group ) .
both groups were further divided into four subgroups .
subgroup a onegloss ( n = 10 ) , subgroup b - pogo ( n = 10 ) , subgroup c sof - lex spiral ( n = 10 ) , subgroup d - mylar strip ( control , n = 5 ) .
samples were polished according to the manufacturer 's recommendations .
surface roughness test was performed using contact profilometer .
the obtained data were analyzed using the one - way analysis of variance test.result:tetric n - ceram produced smoother surfaces than filtek z350 ( p < 0.05 ) .
mylar strip and pogo created equally smooth surfaces , while significantly rougher surfaces were obtained after applications of sof - lex spiral and onegloss
( p < 0.05).conclusion : polishing ability of tetric n - ceram is better than filtek z350 xt .
pogo seems to be a better polishing system than onegloss and sof - lex spiral . |
strychnine is a bitter , white , powder alkaloid derived from the seeds of the tree strychnos nux - vomica . it has had an interesting past , initially having been introduced in the 16th century as a rodenticide , and until recently it was used as a respiratory , circulatory and digestive stimulant . it is no longer used in any pharmaceutical products , but is still used as a rodenticide . strychnine is also found as an adulterant in street drugs such as amphetamines , heroin and cocaine . strychnine poisoning is uncommon , and in most severe cases , the patient dies before reaching hospital . the management of strychnine poisoning is well documented , but there is less information available about the elimination kinetics of strychnine . we report the toxicokinetics of strychnine in a patient who survived a deliberate strychnine ingestion . a 42-year - old man with no significant past medical history presented approximately 1 hour after ingestion of a bottle of wine together with some " white powder " from his garden shed ( this was later confirmed to be strychnine ) . he was able to walk in to the emergency department , but he was agitated and ataxic , in keeping with his ethanol intake . within a few minutes of his arrival , his condition rapidly deteriorated and he developed a marked tremor and muscular spasms and shortly after this had a respiratory and secondary cardiac arrest . at this stage he was transferred to the intensive care unit ( icu ) and the national poisons information service ( london ) was contacted for further advice on management . he continued to have marked muscle spasms and so was paralysed with 0.1 mg / kg pancuronium given intravenously . postarrest , his blood pressure was 85/40 mmhg , heart rate 96 beats / min and temperature 38.2c . arterial blood gases showed a severe metabolic acidosis ( ph6.51 , pao2 9.5 kpa , paco2 2.6 kpa , hco3 3.7 mmol / l , base excess [ be ] -18 ) and he was given 3 mmol / kg 8.4% sodium bicarbonate ; his metabolic acidosis improved over the next 8 hours ( ph7.26 , paco2 5.35 kpa , pao2 13.4 kpa , hco3 18 mmol / l , be -9 ) . he remained hypotensive despite fluid resuscitation and over the first 24 hours he required norepinephrine to maintain his blood pressure ( maximum dose 900 g / h ) . his temperature rose to 39.9c on day2 but settled after simple cooling measures and rehydration . iu / l , ( although there was no evidence of myoglobinuria ) and his creatinine peaked at 194 mol / l on day 2 . he was extubated on day3 , initially with some persisting twitching and muscular spasms , requiring boluses of midazolam and diazepam and an alfentanil infusion for analgesia . by day5 eight serum samples were obtained over the first 5 days and subsequently analysed on a hewlett - packard 6890 gas chromatograph ( stockport , cheshire , uk ) equipped with a nitrogen phosphorous detector for strychnine concentrations . the patient 's initial concentration at 1.5 hours after ingestion was 4.73 mg / l , falling to 0.38 mg / l and to 0 at 74 hours and 100 hours postingestion , respectively . the data conformed to a monoexponential elimination curve and the calculated elimination half - life was 12 hours . strychnine poisoning is an uncommon but potentially fatal poisoning and most patients die before reaching hospital . in the case he was initially asymptomatic but rapidly developed severe muscle spasms leading to respiratory arrest . with meticulous supportive care in the icu he made a complete recovery . this poison is a competitive antagonist of the inhibitory neurotransmitter glycine at receptors in the spinal cord , brain stem and higher centres . the classical features of strychnine poisoning occur from 15 to 30 minutes after ingestion and include heightened awareness , muscular spasms and twitches and hypersensitivity to stimuli . in large ingestions , these can progress to painful generalised convulsions , during and after which the patient retains consciousness . the cause of death is usually respiratory arrest secondary to respiratory muscle spasms , although prolonged muscular spasm can lead to hyperthermia , rhabdomyolysis and associated renal failure due to myoglobinuria . severe metabolic acidosis can occur due to increased lactate levels following repeated muscular activity , although the lactate is rapidly removed once the muscular spasms have been controlled . prompt recognition of poisoning and initiation of treatment are required to prevent deterioration and death . control of convulsions and muscular spasms requires either high doses of benzodiazepines , such as 1 mg / kg diazepam , or , in resistant cases , paralysis with neuromuscular blockers such as pancuronium . in addition , meticulous supportive care is required , and careful monitoring and observation for complications such as acute renal failure . clinical effects of strychnine ingestion have been seen at doses as small as 2 mg in a child and 20 mg in an adult . survival after ingestion of large amounts has been reported : 480 mg ( 24 mg / kg ) in a child and 3750 mg in an adult . death from strychnine ingestion has been reported in adults after doses as low as 5 to 10 mg . since severe , life - threatening features have been reported after the ingestion of small amounts and patients can deteriorate rapidly , strychnine ingestion should be regarded as potentially fatal and the patient should be admitted to an icu for close observation and appropriate treatment . in this case , as with many other reported cases , both the concentration of strychnine in the preparation ingested and the amount taken were unknown . the serum strychnine concentration of 4.73 mg / l at 1.5 hours postingestion is the highest reported concentration that a patient has survived . in previous reports , concentrations of 2.1 mg / l at 3 hours and 3.8 mg / l at 0.5 hours caused death . the potential fatal serum concentration of strychnine is not known and clinical features rather than the serum concentration should guide management . at a postmortem , less than 4 hours after an intentional ingestion of strychnine , a serum concentration of just 0.33 mg / l was found . a postmortem study showed that a strychnine concentration of 3.32 mg / l in the blood of the inferior vena cava was associated with concentrations of 11.4 mg / l , 2.42 mg / kg , 2.32 mg / kg and 98.6 mg / kg in bile , brain , skeletal muscle and liver , respectively . of the 50 reported cases of strychnine poisoning in the past 36 years , only two nonfatal cases have included data on serum strychnine concentrations . both of these patients had much lower concentrations ( 1.6 mg / l at 4 hours after ingestion and 2.17 mg / l at 6 hours after ingestion , respectively ) than that found in our patient . strychnine is rapidly absorbed from the gastrointestinal tract , with symptoms occurring within 10 to 20 minutes of ingestion . it is also absorbed through other mucous membranes , as in poisonings when strychnine has been mistaken for cocaine . strychnine has been shown in animal studies to be metabolised in the liver by cytochrome p-450 microsomal enzymes , but 130% is excreted unchanged in the urine . the proportion of strychnine excreted unchanged appears to be smaller when larger amounts are ingested . in our patient , elimination of strychnine obeyed first - order kinetics with a half - life of 12 hours . only three other papers have reported on the elimination kinetics of strychnine , and these provide conflicting views of its toxicokinetics . edmunds and colleagues were the first authors to describe the elimination of strychnine and theirs is the only other report on the kinetics of strychnine in a patient who survived . they reported a 42-year - old man who ingested an unknown quantity of strychnine and developed severe muscle cramps and convulsions and had a respiratory arrest 35 minutes after ingestion . in that case , the elimination of strychnine obeyed first - order kinetics with a half - life of 10 hours , based on 19 blood samples collected over a 53-hour period , the first of which was taken at 4 hours after ingestion . palatnick et al . also reported first - order kinetics with a half - life of 16 hours , based on 18 serum concentrations over a 51-hour period in a 34-year - old man after ingestion of 125 ml of a 2% strychnine solution . heiser et al . reported zero - order kinetics in a fatal case in a 51-year - old man who presented after ingesting 4.8 g of strychnine . his serum concentrations were measured in only five samples , ranging from 3.5 mg / l at 0.5 hours after ingestion to < 0.1 mg / l at 43 hours after ingestion . the differences in the kinetics of strychnine found in our patient from the kinetics in the above three cases almost certainly reflect the influence of clinical parameters such as different periods of hypotension , metabolic acidosis and renal impairment , all of which would influence hepatic metabolism and renal elimination of strychnine . however , the calculated half - life of 12 hours in our patient is comparable to the half - lives previously reported ( 10 hours and 16 hours ) , suggesting that the true elimination half - life of strychnine lies between 10 and 16 hours . we describe a case of severe strychnine poisoning with a favourable outcome in which the strychnine half - life was 12 hours . the patient presented early , his symptoms were recognised and meticulous supportive care was instituted without delay . all of these factors were probably important in preventing what would otherwise have been a fatal ingestion of strychnine . strychnine overdose is rare but potentially fatal with prompt recognition of the characteristic features and rapid supportive care , survival is possible ingestion of small amounts and/or low plasma strychnine concentrations are associated with fatality strychnine has a toxicokinetic half - life in overdose of 12 hours elimination of strychnine in our patient obeyed firstorder kinetics , as has previously been reported | introductionstrychnine poisoning is uncommon , and in most severe cases , the patient dies before reaching hospital .
the management of strychnine poisoning is well documented , although there are few data on the kinetics of elimination of strychnine after overdose.case reporta 42-year - old man presented shortly after ingestion of an unknown quantity of strychnine powder . after a respiratory arrest , with intensive supportive management requiring admission to an intensive care unit , he survived .
eight serum samples were taken over the first 5 days and analysed subsequently for strychnine concentrations.resultsthe initial concentration at 1.5 hours after ingestion was 4.73
mg / l , falling to 0.38 mg / l at 74 hours postingestion .
serum concentrations followed a monoexponential elimination curve with a calculated elimination half - life of 12 hours.discussion and conclusionstrychnine poisoning presents with classical features , and with early diagnosis and supportive management , the patient can survive .
the initial serum concentration of 4.73
mg / l is the highest reported concentration in a patient who has survived .
previous reports of the elimination half - life have suggested it is between 10 and 16 hours , which conforms to the elimination data in our case . |
sarcoidosis is a systemic granulomatous disease of unknown origin , characterized by the presence of noncaseating granuloma in affected organs ( 1 ) . lesions are commonly seen in the lungs , lymphatic system , eyes , skin , liver , spleen , salivary glands , heart , nervous system , muscles , and bones ( 1 , 2 ) . although neurosarcoidosis is a rare manifestation of sarcoidosis , the clinical symptoms can be devastating and occasionally life - threatening . the diagnosis of neurosarcoidosis can be challenging because the disease can present with a lot of symptoms and diverse radiologic findings ( 1 - 5 ) . among them , spinal sarcoidosis is a very rare entity , occurring in < 1% , and can be manifested as intramedullary , intradural extramedullary , intraspinal epidural spaces and in vertebral bodies ( 6 ) . in korea , only a few cases of neurosarcoidosis involving brain , spinal nerve root , peripheral nerve and spinal dura , have been reported with or without histological confirmation in the literature . patients with spinal sarcoidosis are considered to be at high risk for severe neurological sequelae ( 7 ) . the information available about spinal sarcoidosis management and diagnosis comes from a few case reports , small series and expert opinions ( 8 - 10 ) . however , the documents gave conflicting conclusions regarding the treatment , including corticosteroids and alternative immunosuppressants ( 6 , 7 ) . we recently experienced a patient with isolated spinal cord sarcoidosis , which was confirmed by tissue biopsy and well responsive to high - dose corticosteroid and immunosuppressant . a 54-yr - old woman , with no significant past medical history , presented with progressive 4-extremities weakness and sensory changes , followed by urinary difficulty since 1 month ago and was admitted to our hospital in october 2007 . physical examination revealed increased deep tendon reflex , positive babinski sign and decreased motor power with medical research council ( mrc ) grade 2 strength in the right side and mrc grade 4 strength in the left side . initial magnetic resonance imaging ( mri ) revealed increased t2 signal from c4 to c6 level , edematous expansion of the cord and intense nodular enhancement ( fig . 1a ) . based on the mri , spinal cord tumor , demyelinating disease involving multiple sclerosis , serological studies for systemic autoimmunity , including rheumatoid factor and antinuclear , anti - dsdna , anti - ssa / ssb , and antiphospholipid antibodies , showed no abnormality . the cerebrospinal fluid ( csf ) analysis including biochemistry , igg index and oligoclonal band was normal . one month later , the follow - up spinal mri showed the more extended lesion relative to previous mri , and which highly suggested the spinal cord tumor such as intramedullary astrocytoma ( fig . based on the suspicion of intramedullary astrocytoma , the laminectomy and tissue biopsy of 2 l , which showed yellowish color , were performed at the central portion of dorsal column in affected cervical cord lesion . postoperatively , patient 's neurologic deficits were not aggravated and , unexpectedly , the histology of biopsy revealed non - caseating granuloma without malignant cell ( fig . angiotesin converting enzyme ( ace ) was mildly elevated to 56 ( u / l ; normal , , there was no disease activity on other organs with using brain mri , chest and abdominal computed tomography and nerve conduction study ( ncs ) . the patient was treated with high - dose corticosteroid ( 60 mg / day ) followed by methotrexate ( 10 mg / week ) for over 2 yr . two years later , cervical spinal cord lesion was much improved in the spinal mri ( fig . 1d ) , however clinical symptoms of weakness and sensory change were not definitely improved . recently , the patient had to stop corticosteroid medication because of the cellulitis in the left leg . instead , we tried thalidomide 100 mg daily for 1 month with the goal of titrating up to 400 mg per day , which had been reported to be effective in the refractory neurosarcoidosis ( 11 ) . however the patient refused high - dose thalidomide due to severe fatigue and high cost , and just treated with low - dose thalidomide ( 100 mg / day ) and treatment did not show distinct effect in our patient . the spinal cord sarcoidosis is very rare and the diagnosis of this entity is difficult , as there are no pathognomic diagnostic study for neurosarcoidosis ( 3 , 12 , 13 ) . in general , this disease has been diagnosed clinically using mri , lumbar puncture and attendant laboratory tests , and the diagnosis is possible when systemic sarcoidosis is detected in other organs involving lung , kidney , eye and skin . spinal cord sarcoidosis may present as an idiopathic inflammatory demyelinating disease both clinically and radiologically ( 5 ) . only a positive biopsy of suspicious lesions in the central nervous system is considered to be definitive confirmation of the diagnosis of isolated neurosarcoidosis . zajicek and colleagues established a diagnostic classification system for neurosarcoidosis that distinguished ' definite ' , ' probable ' and ' possible ' neurosarcoidosis based on tissue evidence of non - caseating granuloma and supportive evidence of sarcoid pathology in laboratory and imaging studies ( 13 ) . however , biopsy should be cautiously considered if possible because of the risk involved in approaching the spinal cord . our patient was initially suspected to have intramedullary astrocytoma or multiple sclerosis based on neurologic symptoms and mri results . of course , the possibility of multiple sclerosis was not high because the clinical symptoms and cervical lesion were gradually progressive for months . the spinal cord biopsy was challenging procedure , nevertheless the cord biopsy and laminectomy were performed for diagnostic confirmation in the consent of patient , and the histology of which was unexpectedly consistent with sarcoidosis . the histology revealed multinucleated giant cells , lymphocytes and aggregated histiocytes within granulomatous inflammation , consistent with non - caseating granuloma seen in sarcoidosis . a few cases with neurosarcoidosis have been reported , however most cases suggested only clinical manifestation without histology , or demonstrated indirect biopsy in the brain , meninges and lymph node ( 6 - 10 ) . with an initial treatment , we tried high dose corticosteroid and immunosuppressant . systemic corticosteroids and immunosuppressive therapy are the treatment of choice for neurosarcoidosis , however which shows partial response especially in the spinal cord neurosarcoidosis ( 4 , 6 - 10 ) . unfortunately , 25% of neurosarcoidosis still have a refractory course with steroid treatment and , and 20%-40% of those refractory patients will not respond to current conventional immunosuppressant ( 3 ) . in our case , the clinical symptoms were initially severe and rapidly progressive , and therefore the combined therapy of high - dose corticosteroid and immunosuppressant was necessary . combination with immunosuppressant was useful to improve symptom control and reduce corticosteroid - related side effects in some cases . therefore , making a diagnosis of neurosarcoidosis was therapeutically essential , since corticosteroid and immunosuppressant treatment must be started and continued for years in order to prevent progression and permanent disability . a few reports have documented that the high - dose thalidomide ( 400 mg / day ) was effective in the refractory neurosarcoidosis ( 11 ) , and so we tried low - dose thalidomide ( 100 mg / day ) for one month in our patient . however there was no clear evidence that thalidomide was effective in our case of neurosarcoidosis , although there was limitation on the dosage and duration of treatment compared with other cases . our case indicates that diagnosis of spinal cord sarcoidosis is not easy and may require histological examination , and high - dose corticosteroid and immunosuppressant will be a good choice in the treatment of spinal cord sarcoidosis , and the thalidomide has to be debated in the treatment of spinal cord sarcoidosis . this is the first korean case , to our knowledge , which shows an isolated spinal cord sarcoidosis confirmed by direct tissue biopsy and good response to corticosteroid and immunosuppressant . | we report a case of 54-yr - old woman who presented with 4-extremities weakness and sensory changes , followed by cervical spinal cord lesion in magnetic resonance imaging . based on the suspicion of spinal tumor
, spinal cord biopsy was performed , and the histology revealed multinucleated giant cells , lymphocytes and aggregated histiocytes within granulomatous inflammation , consistent with non - caseating granuloma seen in sarcoidosis .
the patient was treated with corticosteroid , immunosuppressant and thalidomide for years .
our case indicates that diagnosis of spinal cord sarcoidosis is challenging and may require histological examination , and high - dose corticosteroid and immunosuppressant will be a good choice in the treatment of spinal cord sarcoidosis , and the thalidomide has to be debated in the spinal cord sarcoidosis . |
in spite of precautions , a foreign body retained in the abdominal cavity after surgery may lead to persistent problems such as adhesions , perforation , and abscess or fistula formation ( 123 ) . endoloop ligature ( ethicon , somerville , nj , usa ) is surgical instrument to facilitate the ligation of pedicles in laparoscopic procedures . vicryl ( polyglactin 910 ) and polydioxanone ( ethicon ) endoloop ligature can be used . it consists of a 45 cm long ligature inserted into a plastic tube ( narrow at one end and scored at the other ) . the plastic tube should be removed after the suture is formed in a ligature with a knot . retained plastic tube of the endoloop ligature in the abdominal cavity is difficult to detect in the absence of clinical suspicion and familiarity with the appearance , since it is very narrow and thin . there has been no report on ct findings of retained endoloop ligature plastic tube . with the approval of the institutional review board of our hospital , we describe ct findings of foreign body reaction related to retained endoloop ligature plastic tube , which was misinterpreted as acute appendicitis . she has undergone ct scan due to intermittent abdominal pain one month after laparoscopic cholecystectomy . operative findings and pathologic results revealed localized peritonitis related to retained endoloop ligature plastic tube ( fig . 1e ) that was used in laparoscopic cholecystectomy and appendix was normal . on retrospective review of ct images the imaging appearances of retained surgical instruments in the postoperative abdomen and pelvis can be confusing and difficult to identify . unintentionally retained surgical instruments lead to substantial morbidity , and mortality rates with the range of 1135% ( 4 ) . to our best knowledge , the presented case is the first report of ct findings of foreign body reaction related to retained endoloop ligature plastic tube , which had been misdiagnosed as acute appendicitis because of the location and morphologic characteristics . among retained surgical instruments , gossypiboma in the abdomen counts for 50% of malpractice claims for retained foreign body ( 2 ) . gossypiboma is the term sometimes used to describe the foreign body reaction to a surgical sponge retained within the body for a long period . the radiologists consider a gossypiboma to be specifically indicated by a ct finding of a low - density heterogeneous mass with an external high - density wall that is further highlighted on contrast - enhanced imaging and that has a spongiform pattern containing air bubble ( 5 ) . the spongiform pattern with gas bubbles is the most characteristic ct finding for gossypibomas ( 5 ) . the former usually occurs early in the postoperative period and may involve secondary bacterial contamination , which results in various fistulas and abscess ( 5 ) . ct findings of the presented case were localized peritonitis around air - containing tubular structure in right lower quadrant of the abdomen . the underlying mechanism of localized peritonitis can be explained by the nidus formation of the retained plastic tube as foreign body reaction and surrounding inflammation around the retained plastic tube nidus . however , in hindsight , there were some differences between the ct findings of acute appendicitis and those of presented case ; 1 ) tubular structure was artificially straight , 2 ) relatively long and evenly outlined , and 3 ) air was contained inside the tubular structure . we failed to identify the retained endoloop ligature plastic tube without surrounding inflammation on ct scans performed one month after laparoscopic cholecystectomy . on the retrospective review , ct images at that time showed bizarre tubular structure in upper abdomen . we neglected this finding as an unexplained artifact because we did not have any knowledge on a retained surgical item in the patient . for the radiologist , correct interpretation of the findings is even more challenging because 1 ) no surgical item is suspected , 2 ) the radiologist may not recognize the item as a foreign body , and 3 ) retained items often elicit a reaction creating a fluid collection that mimics a postoperative abscess or even tumor recurrence ( 6 ) . the confidence in the ability to identify or exclude suspected and incidentally encountered retained surgical items is critical . the radiologist 's failure to identify a retained surgical item if there is any suspicion related symptom from the retained surgical item , radiologist should recommend further study such as ultrasonography or mri and image - based retained surgical item detection may be enhanced . therefore , radiologists should remember that unintentionally retained surgical instruments are often clinically unsuspected and may be first recognized on imaging . a higher index of suspicion should be maintained when bizarre findings can not be explained in any other way . in summary , we identified that ct findings of foreign body reaction related to retained endoloop ligature plastic tube might mimic acute appendicitis . the retained endoloop ligature plastic tube was artificially straight , relatively long and evenly outlined , and air - containing tubular structure in contrast of inflammatory appendix . the possibility of a retained foreign body should be considered and a higher index of suspicion should be maintained when unfamiliar findings can not be explained in any other way . with the increased complexity and more frequent use of surgical instruments , the radiologists need to be familiar with the imaging findings of a variety of unintentionally retained surgical instruments . | many hospitals experience one or more retained surgical instrument events with risk of patient morbidity and medicolegal problems . identification of retained surgical instrument is important .
the radiologists should be familiar with imaging finding of retained surgical instrument . in a 62-year - old female with a retained plastic tube ,
localized peritoneal infiltration around air - containing tubular structure mimicked acute appendicitis on abdomen computed tomography ( ct ) , one year after laparoscopic cholecystectomy .
we reported ct findings of foreign body reaction related to retained endoloop ligature plastic tube mimicking acute appendicitis . |
a 16-year - old boy visited to our neurology clinic with a 12-month history of a clicking noise in the both ears and palatal discomfort . the clicking resembled the sound of snapping fingernails and was externally audible at a distance of 50 cm . he denied any voluntary control over this movement as well as any sensation of urge before the movement . he complained of throat fullness in daytime . on neurologic and otolaryngologic examination , rhythmic contraction of whole soft palate muscles the movement was able to be suppressed for a few seconds by touching the back of his neck , but it could soon return after the voluntary suppression . in addition , the entrainment at each slow and fast finger tapping with external pace was found ( video ) . needle electromyography ( emg ) of tvp muscle showed rhythmic contractions with a frequency of 2.6 hz with amplitude of 150 v ( figure 1 ) . there were no abnormal results in other laboratory , audiologic tests , and brain magnetic resonance imaging . after diagnosis of ept , despite of medications including benzodiazepines , muscle relaxants , and anticonvulsants for 1 month , his symptoms were not changed at all . therefore , we started to inject 15 units of bta ( botox , allergan , inc . , though the success of the first bta therapy was lasted about 10 weeks , the additional injections of bta were needed for 3 times due to recurrence . the dosage of bta was finally elevated to 20 units and there were 4 times injection of bta at interval of 3 months , but the presenting symptoms showed again . his involuntary movements were clinically closed to ept because of ear click perceived as objective tinnitus , bilateral involvement , no brain lesions and involvement of tvp muscle by emg . although no single clinical finding is pathognomonic for pmds , several features are quite helpful.10 in general , pmds are characterized by distractibility , entrainment , coactivation sign , variable frequency , amplitude and direction , increase with attention , and poor response to medications.8,11 this patient also showed entrainment of soft palate muscle contraction to external paced finger tapping . furthermore , pmds have particular histories including precipitating factor or trivial trauma preceding acute onset , emotional trigger , psychological stressors and psychiatric comorbidities such as anxiety disorders.8 in this patient , mild trauma ( e.g .. voice abuse ) before onset suggest to psychogenic type of ept rather than primary type . in our case , the only difference from usual psychogenic pt is that this abnormal movement was not well responded to treatment . psychogenic pt is usually reported to have good response to non - physiological treatment or placebo.8 in summary , bilateral objective tinnitus , bilateral tvp muscles involvement , mild trauma before onset , and entrainment of soft palate contraction suggest a psychogenic ept . | essential palatal tremor ( ept ) is a rare disorder which shows rhythmic involuntary movement of the muscles of soft palate , especially tensor veli palatini muscle .
ept is classified by two subtypes , which is primary and secondary ept .
secondary ept includes psychogenic type .
we describe a case of intractable psychogenic ept . |
esophagorespiratory fistula ( erf ) is an uncommon condition , despite of the anatomical proximity of these structures . malignancy of esophagus , lung , or mediastinum is recognized as the most common cause . causes of erf development include direct tumor invasion and subsequent perforation or after radiation , laser therapy , chemotherapy , or pre - existing stents.1 benign erf is rare and may be due to trauma or infection.2 however , there have been few reports describing benign erf and its treatments in south korea . here we report a case of nonmalignant esophagopleural fistula successfully treated by covered self - expanding metallic stents . a 73-year - old man was admitted to chungnam national university hospital complaining right chest discomfort . he had 20 pack - years smoking history but had neither an operation history nor a medical history such as diabetes , hypertension , pulmonary tuberculosis , or hepatitis . physical examination was unremarkable except for diminished respiratory sounds in the whole right lung field . the results of laboratory studies showed a white blood cell ( wbc ) count of 8,500/mm ; hemoglobin of 12.5 g / dl ; and platelet count of 164,000/mm . the serum biochemistry presented na of 140 meq / l ; k 4.3 meq / l ; cl 107 meq / l ; aspartate aminotransferase 19.5 iu / l ; alanine aminotransferase 12.4 iu / l ; total bilirubin 0.9 mg / dl ; and lactate dehydrogenase ( ldh ) 246 iu / l ( all within normal ranges ) with hypoalbuminemia ( 2.8 g / dl ) and elevated serum creatinine level ( 1.65 mg / dl ) . chest x - ray revealed right pleural effusion ( fig . pleural fluid analysis revealed ph of 7.0 ; red blood cell 3,200/mm ; wbc 4,800/mm ; total protein 4.0 g / dl ; and ldh 2,246 iu / l compatible with exudative parapneumonic effusion , for which an antibiotic therapy was initiated with chest tube catheter insertion ( fig . stent insertion was considered as the first treatment due to the large fistula and pleuritis . a 14-cm long , 18-mm diameter covered choo stent ( three months after the stent insertion , the stent was easily removed by pulling removal snare with an alligator forceps ( fig . erf is used to describe all fistulas located between the esophagus and the airway tree ; however , esophagotracheal and esophagobronchial fistulas mostly account for the remaining erf cases ( 3% to 11% ) of esophagopulmonary fistulas.3,4 accordingly , there have been very few previous reports concerning benign esophagopleural fistula and its treatment . recent reports5 regarding malignant esophagopulmonary fistula other than esophagotracheal and esophagobronchial fistulas showed technically successful stent placement outcome in 14 patients and complete fistula sealing in 12 patients ( 86% ) . known causes of acquired benign erf include trauma and infection.6 - 8 the former lesions may be due to the increase in fistula caused by surgical procedures , blunt chest trauma , and prolonged ventilator assistance . other reported infectious causes include syphilis , mycotic disease , and crohn 's disease . in our case , the cause of the esophagopleural fistula was unclear . also a specific infectious agent was not isolated at the time of diagnosis and treatment . leaks of the esophagus are associated with a high mortality rate and need to be treated as soon as possible . therapeutic options include surgical repair or resection or conservative management with antibiotic therapy and cessation of oral intake . endoscopic techniques to overcome this issue have been reported with obliterating agents , such as fibrin glue or cyan acrylic glue,9 - 11 endoscopic clip application,12,13 and endoscopic suturing device.14,15 recently several types of covered and uncovered stents have been used in the treatment of erfs . self - expanding metal stents ( semss ) have been considered a safe and effective treatment for malignant dysphagia stricture , and fistula in inoperable patients.16 primarily sems has been used to palliate malignant state but are less commonly used in benign state due to concerns about their nonremovability and high complication rate . recent technical improvement overcame these limitations . to evaluate fistula closure and stent patency or migration , repeat esophagogram at 1 week , then every 1 to 2 months after the procedure is suggested . in our case , the cause of the esophagopleural fistula was unclear . therefore , it appears that implantation of membrane - covered metal stents is an effective alternative for the treatment of esophagopleural fistula . | the most common cause of esophagorespiratory fistulas ( erfs ) is associated with malignancy .
the use of self - expandable metal stents is effective for the treatment of malignant erfs , but benign erf is rare , which is why its optimal treatment is not defined yet . there have been few reports describing benign esophagopleural fistula and its treatments in south korea . here ,
we report a rare case of spontaneous esophagopleural fistula , which was successfully treated by endoscopic placement of a membrane covered metal stent . |
hepatitis c virus ( hcv ) infection is one of the major epidemics afflicting young adults . in some countries the effective management of the new cases is critically important because , without treatment , patients will develop chronic hcv infection , hcv - related cirrhosis , liver failure , and hepatocellular carcinoma . the treatment typically involves combined interferon - alpha ( ifn- ) and ribavirin ( rbv ) therapy . cure rate of up to 70% depending on genotype as judged by the negative hcv ribonucleic acid ( rna ) polymerase chain reaction detection . ifns are integral players in immunity , and a number of immune - mediated complications can arise during ifn therapy . ifn- can commonly induce thyroiditis , which is classified as either autoimmune or nonautoimmune ifn - induced thyroiditis ( iit ) . autoimmune iit manifests as hashimoto 's thyroiditis , which is defined by an emergence of or worsening of antithyroid antibody levels with or without hypothyroidism . in rare cases , autoimmune iit also manifests as graves ' disease , which is defined by antithyroid antibodies with hyperthyroidism . ifn- is a type i ifn that has been widely used as a therapeutic agent mostly , for infectious and malignant diseases . ifn- binds to ifn receptors and activates various signaling pathways , including the jak - stat pathway , and the map kinase pathway leading to transcription of target proteins which mediate its immune and anti - tumor effects . one of the most remarkable successes of ifn- as a therapeutic agent has been in the treatment of chronic hepatitis c , where the combination of ifn- and rbv induces remission in up to 50% of patients . however , ifn- therapy can cause numerous and wide - ranging side effects , including severe complications that can result in morbidity and discontinuation of therapy . this study aimed at measuring the prevalence of thyroid disease in hcv patients on treatment with ifn and antiviral drug rbv . this study was conducted in departments of biochemistry and medicine of a tertiary care hospital attached to a medical college in north india . fifty patients already diagnosed with hcv infection and on ifn therapy ( 3 miu thrice a week dose ) and antiviral therapy with rbv 10001200 mg daily were included in the study . purposive sampling was performed depending on the number of hcv patients coming to medicine outpatient department . patients already on any kind of thyroid treatment ; co - infection with human immunodeficiency virus or hepatitis b virus ; pregnancy and lactation ; concomitant serious medical illnesses such as malignancy , severe cardiopulmonary disease , or uncontrolled diabetes mellitus were excluded from the study . similarly , patients with a history of any other drug affecting thyroid function ( such as lithium , amiodarone and iodine preparations ) , patients with a history of radiation that can alter the levels of thyroid hormone were excluded . routine biochemical ( liver function test and renal function test ) and hematological tests were performed using automated techniques . thyroid function tests , including serum thyrotropin ( thyroid - stimulating hormone [ tsh ] ) , and free thyroxine ( ft4 ) , and free triiodothyronine ( ft3 ) were performed by an ultrasensitive immune chemiluminescent noncompetitive assay ( access 2 , beckman coulter ) . thyroid disease was defined as any value of these markers ( tsh , ft3 , and ft4 , ) which was greater or less than the normal values . the reference range ( rr ) for tsh was 0.355.5 uiu / ml , ft4 0.611.12 ng / dl and ft3 was 2.53.90 pg / ml . quantitative variables were expressed as mean standard deviation as the data was normally distributed . quantitative variables were expressed as mean standard deviation as the data was normally distributed . the karl pearson coefficient was calculated and p < 0.05 was considered significant . the mean age of patients was 45 10 years . mean baseline alanine transaminase levels were 147 52 u / l [ table 1 ] . general baseline characteristics of patients a total of 13 patients ( 26% ) developed hypothyroidism after 12 weeks of treatment . thyroid disorders in hepatitis c virus patients after 12 weeks interferon and antiviral therapy thyroid profile was measured at baseline before the start of therapy , then at 12 weeks of treatment . the mean tsh levels were significantly higher in 26% hypothyroid patients as compared to euthyroid patients ( p < 0.05 ) [ table 2 ] . hepatitis c is a disease that is disseminated worldwide , and chronic infections affect up to 80% of the infected subjects . ifn- is one of a group of cytokines with antiviral , antiproliferative , and immunomodulatory properties . in cases of hepatitis c , the presence of moderate to severe necroinflammatory activity and/or moderate to severe fibrosis ( as assessed by a liver biopsy ) the drug is available in both conventional and pegylated forms and is frequently used in association with rbv an antiviral drug . the treatment is continuous and lasts from 6 to 12 months , and retreatment may be necessary . the use of ifn- is well documented to be associated with thyroid disorder , the commonest autoimmune disorder associated with ifn- therapy . ifn therapy can precipitate immune - mediated abnormalities de novo or can exacerbate an existing autoimmune tendency ; ifn- is thought to have a direct inhibitory effect on thyrocytes preventing hormonogenesis and secretion ; immunostimulation in the presence of hepatitis c infection . this is thought to include activation of lymphocytes and natural killer cells , increased production of tumor necrosis factor , ifn- , interleukins and other cytokines and increased production of immunoglobulins , all lead to the development of thyroid auto - antibodies with complete destruction and consequently permanent hypothyroidism in genetically susceptible individuals it is possible but purely speculative that exogenous ifn- synergizes with the endogenous source , thus exaggerating the effect on the thyroid thus causing additional hypothyroidism . hashimoto 's thyroiditis is diagnosed in up to 40% of patients , and hypothyroidism can be triggered by ifn-. hypothyroidism frequently escapes diagnosis due to the overlap of its symptoms with those induced by ifn- itself , such as fatigue , somnolence , and depression . destructive thyroiditis represents a form of nonautoimmune iit characterized by self - limited thyrotoxicosis with a triphasic evolution similar to that of subacute thyroiditis destructive thyroiditis may recur upon re - treatment , and it is not necessary to discontinue ifn- use . the patient who has developed thyrotoxicosis in the study may be because of destructive thyroiditis . case reports and follow - up studies of large cohorts of patients on ifn therapy have confirmed that immune - mediated complications are uncommon but can occur in a number of different organ systems . nuclear antigen immune complexes and has a key role in the development and maintenance of autoimmunity . ifn therapy can precipitate immune - mediated abnormalities de novo or can exacerbate an existing autoimmune tendency . this is manifest in the rise in titer of existing antibodies and in the development of clinical disease in patients with preexisting antibodies . there is no association between severity of disease and response to therapy with ifn - induced thyroid dysfunction . in a study 20 treated patients ( 18.69% ) developed thyroid dysfunction with a relative risk ( rr ) of 11.25 and the attributable risk of 91% . there is a wide range in the incidence of newly developed thyroid dysfunctions and thyroid antibodies in ifn - treated hcv patients . ifn a therapy alone or in combination with other drugs has different effects on the incidence of thyroid dysfunctions . hcv patients on ifn and antiviral therapy have an effect on the thyroid gland , so these patients should be regularly screened for thyroid disorders and appropriately treated to maintain euthyroid status . | background : hepatitis c virus ( hcv ) infection is common worldwide .
the treatment typically involves a combination of interferon - alpha ( ifn- ) and ribavirin ( rbv ) therapy ; however , the use of ifn- is well documented to be associated with thyroid disease , the most common autoimmune disorder associated with ifn-.aim:the aim of the present study was to know the prevalence of thyroid abnormality in the hcv - positive patients on ifn and antiviral therapy.materials and methods : fifty known hcv positive patients were enrolled for the study .
all the patients were on ifn ( 3 million unit subcutaneously 3 times / week ) and antiviral therapy ( oral rbv 10001200 mg / day ) .
thyroid function tests were performed first at the start of treatment and then after 12 weeks of treatment.results:13 ( 26% ) of the patients were found to develop hypothyroidism , and 1 ( 2% ) patient developed hyperthyroidism in the course of 12 weeks therapy.conclusion:hcv patients on ifn and antiviral therapy have an effect on the thyroid gland , so these patients should be regularly screened for thyroid disorders and appropriately treated to maintain euthyroid status . |
primary hyperparathyroidism ( phpt ) syndrome is an endocrine disorder , characterized by excessive secretion of parathyroid hormone from one or more parathyroid glands . the elevation of pth usually leads to hypercalcemia and hypophosphatemia ; patients may present with classic skeletal disease , recurrent nephrolithiasis , or be asymptomatic , detected on routine biochemical screening . a dramatic increase in the incidence of phpt occurred in the late 1960s , due primarily to the introduction of the multichannel autoanalyzer . the clinical profile of phpt in the western countries had shifted from a symptomatic disorder , toward a more asymptomatic state . however , phpt has a variable clinical expression and symptomatic phpt is still the predominant form of disease in many developing countries , with skeletal manifestation ( osteitis fibrosis cystica ) being very common . earlier studies from india have attributed the greater severity of phpt to delayed diagnosis and widely prevalent vitamin d deficiency . hypercalcemia is considered to be a rare cause of pancreatitis but the true cause and effect relationship between phpt and pancreatitis remains controversial . phpt has been associated with different types of pancreatitis . despite its rarity , a cause and effect relationship some patients suffer from 2 or more attacks of pancreatitis before a diagnosis of phpt is made . we present a patient who had repeated admissions for acute pancreatitis , 4 episodes over a period of 15 months . a 32-year - old man was first admitted to a district hospital with an episode of acute pancreatitis . he had elevated serum amylase and computed tomography ( ct ) abdomen revealed diffusely enlarged pancreas with irregular outline with no calcification or dilatation of main pancreatic duct [ figure 1 ] . , he suffered 3 more episodes of acute pancreatitis . during the second episode , ct abdomen revealed focal necrosis in the body ( less than 30% ) . ct abdomen showing diffusely enlarged pancreas with irregular outline for the fourth episode of acute pancreatitis , he was admitted in our institute . he denied any history of alcohol abuse and there was no family history of pancreatitis . lipid profile was normal ( total cholesterol 157 mg / dl , triglyceride 158 mg / dl , ldl cholesterol 85 mg / dl , and hdl cholesterol 40 mg / dl ) . the serum calcium was 10.4 mg / dl ( normal range 8.8 - 10.5 mg / dl ) and serum albumin was 4.6 g / dl . during the first 3 episodes of pancreatitis , the serum calcium at the upper limit of normal gave us clue that he may be having underlying hypercalcemic disorder . repeat serum calcium was 13.1 mg / dl , phosphate 2.0 mg / dl , albumin 4.8 g / dl , and serum alkaline phosphatase was 284 serum 25-hydroxyvitamin d was 10.31 ng / ml and serum ipth was 610.7 pg / ml . ultrasonography neck revealed a hypoechoic lesion 2.1 1.2 cm at the lower pole of left lobe of thyroid . left inferior parathyroid adenoma was localized on a radionuclide parathyroid scan ( 99mtc mibi ) [ figure 2 ] . he denied any history of bone pains , bone fractures , neuropsychiatric symptoms , or muscle weakness . radionuclide parathyroid scan ( 99mtc mibi ) showing left inferior parathyroid adenoma parathyroid adenoma was removed . eighteen months after successful parathyroid surgery , there has been no recurrence of abdominal pain and his serum calcium is within the normal range . his current biochemical parameters are serum calcium 8.2 mg / dl ; serum phosphorus 3.9 mg / dl ; ipth 32 pg / ml , and 25(oh ) d3 29.33 pg / ml . the mayo clinic experience between 1950 and 1975 found that out of 1153 patients with phpt , only 17 ( 1.5% ) had coexisting pancreatitis , and alternative explanations for pancreatitis were found for several patients . but several studies have suggested a causal association between pancreatitis and phpt . the prevalence of acute pancreatitis in phpt has been estimated to be between 1.5% and 13% . phpt has been associated with different types of pancreatitis , such as acute , subacute , or chronic calcifying pancreatitis . a study involving 83 cases of pancreatitis combined with phpt found that about 70% of the patients suffered from acute relapsing or chronic pancreatitis . some patients suffer from 2 or more attacks of pancreatitis before a diagnosis of phpt is made . in a study from india , pancreatitis was associated in 6 of 87 patients ( 6.8% ) with phpt . all patients with a past history of pancreatitis had suffered two or more attacks . in our patient serum calcium estimation after the first episode of pancreatitis would have eliminated this delay .. it is important to estimate serum calcium after an episode of unexplained pancreatitis . this will minimize the delay before the diagnosis of phpt is made . despite its rarity , a cause and effect relationship is still suggested by the fact that parathyroidectomy seems to prevent recurrence of pancreatitis . nearly 100% improvement in pancreatitis symptoms after the cure of phpt has been reported . hypercalcemia can lead to de novo activation of trypsinogen to trypsin , resulting in autodigestion of the pancreas and subsequent pancreatitis . another explanation is that hypercalcemia leads to the formation of pancreatic calculi , ductal obstruction , and subsequent attacks of acute or chronic pancreatitis . the mean calcium values among patients with phpt and pancreatic disease have been reported to be significantly higher than those in patients with phpt without pancreatic involvement . | the association between pancreatitis and primary hyperparathyroidism ( phpt ) is controversial .
we report a 32-year - old man who presented with recurrent episodes of acute pancreatitis .
primary hyperparathyroidism was diagnosed after the fourth episode of pancreatitis .
he had no additional risk factors for pancreatitis .
eighteen months after successful parathyroid surgery , there has been no recurrence of abdominal pain and his serum calcium is within the normal range . |
the prevalence of intestinal parasitic infection is high in sub - saharan africa , where the majority of hiv / aids cases are from [ 2 , 3 ] . diarrhea causing opportunistic parasites like cryptosporidium parvum and isospora belli is common among hiv positive persons with cd4 count less than 200 cells/l [ 4 , 5 ] . antiretroviral treatment ( art ) increases the length and quality of life and productivity of patients by improving survival and decreasing the incidence of opportunistic infections in people with hiv through reduction of the viral load and increasing the level of cd4 cells . nevertheless , in ethiopia , few studies have tried to investigate the extent of intestinal parasitic infections in relation to art experiences and cd4 count [ 4 , 5 ] . therefore , we investigated the prevalence of intestinal parasites among hiv positive persons who were naive and who were on art in hiwot fana specialized university hospital , eastern ethiopia . the study was conducted in hiwot fana specialized university hospital , harar , ethiopia . the hospital is found in harari national regional state which is one of the federal democratic republic of ethiopia regional states located 515 km from addis ababa . in harar a comparative cross - sectional study was conducted among naive and on art hiv positive persons in hiwot fana specialized university hospital from march to april , 2011 . the study population was all the hiv positive individuals who were on art and pre art care in the art unit of the hospital during the study period . individuals who were on parasitic treatments during the data collection period were excluded . the prevalence of intestinal parasites among art - naive group hiv positive individuals was taken as 50% and to detect a difference of 15% between the two groups with the assumption of 95% confidence level ( cl ) , power of 80% ( 0.84 ) and ratio 2 : 1 of those on art and art - naive group . double proportion formula was applied to calculate the sample size which was 274 on art and 137 art - naive group . small pieces of labeled clean plastic sheets and wooden applicator sticks were distributed and the participants were instructed to bring sizable stool specimen of their own . with the provision of specimen , then , it was examined by direct wet mount method using normal saline ( 0.85% nacl solution ) at hiwot fana specialized university hospital laboratory in order to prevent the loss of motile stage of parasites . the remaining sample was preserved with 10% formalin and transported to the laboratory of medical laboratory sciences department haramaya university . in the laboratory , it was examined by formol ether concentration technique and modified zeihl - neelsen method ( for detection of opportunistic parasites cryptosporidium species , cyclospora cayetanensis , and isospora belli ) . the most recent cd4 t - cells counts of the participants were obtained from their art fellow - up record in the hospital . data were entered into epideta version 3.1 and transported to spss version 16 software for analysis . the prevalence of intestinal parasites was determined in relation to different variables pearson 's chi square test was used to assess statistical significance difference between proportions . a statistical test result was reported as significant when its p value was less than 0.05 . ethical clearance was obtained from haramaya university colleges of health and medical sciences institutional research and ethical review committee . all the participants were explained about the purpose and their right to participate or not to participate in this study . those who gave their written consent participated in this study . those participants who were found positive for intestinal parasitic infection were treated free of charge using the standard drugs by nurses in art unit . a total of 259 on art and 112 art - naive group hiv positive clients participated in the study , and the response rate was 86.7% . the mean age of the participants was 33.6 ( sd 10.04 ) and many of the art - naive group ( 68.5% ) and on art ( 70% ) participants were female . the majority of the study subjects were in the age group of 2534 , married , daily laborers , and urban dwellers ( table 1 ) . the overall prevalence of intestinal parasites among the study participants was 33.7% ( 125/371 ) . it was significantly higher in the art - naive group ( 45.5% ( 51/112 ) ) compared to those on art ( 28.6% ( 74/259 ) ) ( p = 0.002 ) . some were infected with nonopportunistic ( 31.8% ) and very few with opportunistic ( 3.5% ) parasites . eleven parasite species were detected : entamoeba histolytica / entamoeba dispar ( 13.4% on art - naive group and 13.5% on art group ( p > 0.05 ) ) and giardia lamblia ( 7.1% on art - naive group and 8.5% on art group ) were the common ones . opportunistic parasites like crypotospriudum ( 7.1% ) and isospora belli ( 4.5% ) were found only in art - naive group group . some of the art - naive group ( 26.8% ) and few of the on art ( 17.4% ) subjects were diarrheic ( p < 0.05 ) ; most of them were infected with g. lamblia ( p > 0.05 ) , crypotospriudum species , i. belli , and s. stercolaris . the overall prevalence of intestinal parasites was significantly higher among diarrheic ( 53.3% ( 40/75 ) ) as compared to nondiarrheic ( 28.7% ( 85/296 ) ) study participants ( p < 0.05 ) ( table 2 ) . about 31% ( 31/100 ) , 17.3% ( 34/196 ) , and 13.3% ( 10/75 ) of the study participants with cd4 count less than 200 cells/l , 200499 cells/l and greater than or equal to 500 cells/l , respectively , were diarrheic . the prevalence of diarrhea is significant in participants with cd4 count less than 200 cells/l ( p = 0.005 ) . in the bivariate analysis , age , sex , occupation , residence , education , and marital status of the participants did not show significant association with prevalence of intestinal parasites . participants with cd4 count less than 200 cells/l ( cor : 1.93 ; ci : 1.03 , 3.61 ) , diarrheic ( cor : 2.84 ; ci : 1.69 , 4.77 ) , and art - naive group ( cor : 2.09 ; ci : 1.32 , 3.31 ) had higher risk of intestinal parasites . the participants with cd4 count < 200 cells/l were 2.07 times more likely to be infected with intestinal parasites than those with cd4 count 500 cells/l . the diarrheic participants and the art - naive group ones were 2.30 and 2.60 times more likely to be infected with intestinal parasites ( table 3 ) . intestinal parasitic infections are the major causes of morbidity and mortality in hiv positive patients [ 47 , 10 ] . in this study , about 33.7% of the participants were infected with intestinal parasites . the result is almost similar to the ones reported from afar , ethiopia , cameroon , and saudi arabia , but lower than those from jimma , hawassa , bahir dar , dire dawa and afar of ethiopia , india , kenya , and jakarta . the difference in the prevalence might be due to differences in geographical location , sensitivity of diagnostic techniques , study participants ' immunity status , environmental hygiene , socioeconomic status , access to safe water supply , or other . several species of protozoa and other intestinal parasites have been associated with acute and chronic diarrhea and even weight loss in hiv / aids patients [ 19 , 20 ] . in this study , entamoeba histolytica / e . but it is higher than a report in ethiopia ( 4.2% ) , saudi arabia ( 5.2% ) , and jakarta ( 0.3% ) . it is lower than the one in kenya ( 58.3% ) and ethiopia ( 23.8% ) . however , it is higher than report of 1.1% in ethiopia , 0.6% in senegal , and 1.9% in jakarta . it is also lower than report of 16.6% in kenya and 16% in ethiopia . the prevalence of crypotospriudum species was 2.2% and this is lower than the findings from other studies which are found in the range of 4.9% to 15.8% [ 5 , 1215 , 17 ] . while isospora belli was found at 1.3% . this is lower than other studies which are found in the range of 3.9% to 11.7% [ 5 , 1315 ] . the lower prevalence of both parasites in this study might be due to that our study participants are in the art care who were taking art and/or treatment for opportunistic infection . the other reason might be due to difference in immunity , diarrheic status , environmental and personal hygiene of the study participants . other nonopportunistic intestinal helimiths were identified at the rate of ranging from 0.5% to 4.0% . this is similar to study carried out in ethiopia , but it is slightly lower than another study in ethiopia and saudi arabia . the effect of strongyloides stercoralis in hiv infected patients , which is disseminated strongloidiasis , was reported in another study . in this study , we tried to compare the prevalence of intestinal parasites with the diarrheic status , cd4 count , and art experience of hiv positive persons . the prevalence of intestinal parasites was significantly higher among diarrheic as compared to nondiarrheic groups . the most common diarrheal causing parasites were e. histolytica , gardia lamblia , crypotospriudum species , isospora belli , and strongyloides stercoralis . similarly , there are reports which showed that diarrhea can be caused by opportunistic and nonopportunistic parasites [ 5 , 15 , 22 ] . the association between opportunistic parasitic infection and hiv is widely reported [ 4 , 15 , 23 ] . however , in this study , most of the parasites identified were nonopportunistic . the relationship between nonopportunistic parasite and hiv was not well established . even though the defense against them might be damaged by hiv , the exposure to this parasites are likely to occur independent of hiv infection but heavier parasitic load might accumulate as well as experience of delayed clearance of parasite in individual with concurrent hiv induced immunosupperssion [ 23 , 24 ] . the prevalence of intestinal parasites was highly significant among those study participants with cd4 count < 200 cells/l in this study . the correlation of cd4 count with opportunistic parasites could not be assessed because of small number of individuals infected with crypotospriudum species and isospora belli . however , the association of these two parasites with hiv positive persons , who have cd4 count < 200 cells/l , is reported in other studies [ 4 , 5 , 15 , 23 ] the prevalence of intestinal parasites was significantly higher when art - naive group compared to those on art study participants . opportunistic parasites , which are crypotospriudum species and isospora belli , were found only in art - naive group group . art increases the immunity status hiv positive persons and decreases the incidence of opportunistic infections . the detection method for microsoporidia was not employed and sensitive diagnostic techniques for strongyloides stercoralis and enetrobius vermicularis were not used . therefore , the prevalence intestinal parasites in our study participant may have been underestimated . hiv negative control groups were not included in this study which was the other limitation . opportunistic and nonopportunistic parasites were identified with a different rate . the prevalence of intestinal parasites was higher among those hiv infected individuals with diarrhea , low cd4 count , and art - naive group groups . those results posit the need for considering early detection and treatment of intestinal parasites in hiv infected individuals in order to reduce their morbidity . this seeks great attention by those clinical service providers who are working in the art unit . adherence counseling of art , health information dissemination on environmental , and personal hygiene should also be given to hiv / aids patients . in addition further large scale study by using different diagnostic techniques , hiv negative control and assessing predisposing factors of intestinal parasites is recommended . | background .
intestinal parasitic infection affects the health and quality of life of people living with hiv .
this study was aimed to determine the prevalence of intestinal parasites among hiv positive individuals who are naive and who are on antiretroviral treatment ( art ) in hiwot fana specialized university hospital , eastern ethiopia .
methods .
a comparative cross - sectional study was conducted on 371 ( 112 art - naive group and 259 on art ) hiv positive individuals .
stool specimens were collected and examined by direct wet mount , formol ether concentration technique , and modified ziehl - neelsen methods .
results .
the overall prevalence of intestinal parasitic infections was 33.7% ; it was significantly higher among the study participants who were art - naive group ( 45.5% ) ( aor : 2.60(1.56,4.34 ) ) and diarrheic ( 53.3% ) ( aor : 2.30(1.34,3.96 ) ) and with cd4 count < 200 cells/l ( 46% ) ( aor : 2.07(1.06,4.04 ) ) .
the most commonly identified parasites were entamoeba histolytica / e .
dispar ( 13.5% ) , giardia lamblia ( 8.1% ) , strongyloides stercoralis ( 4.0% ) , and cryptosporidium species ( 2.2% ) . conclusion .
hiv positive individuals with diarrhea and low cd4 count and art naive groups were more infected with intestinal parasites than their counterparts .
early stool examination and treatment of intestinal parasites for hiv / aids patients is essential . |
the differential diagnosis of fever and back pain in an intravenous drug abuser is broad . pyomyositis is an intramuscular abscess of the large skeletal muscle groups with most initial cases in the tropics but with increasing worldwide distribution in nontropical areas as well . diagnosis is based on a combination of clinical , laboratory , and radiologic findings [ 1 , 2 ] . we present a case of primary pyomyositis with osteomyelitis that , despite appropriate antibiotics and drainage , progressed and extended into the epidural space , compressing the entire spinal column . the objectives of this paper are to : ( 1 ) present a case of progressive pyomyositis and ( 2 ) review the diagnosis and treatment of an infection that has been increasing in incidence in tropical and temperate climates . a 46-year - old gentleman presented to the hospital complaining of right paraspinal back pain of 2-month duration with increasing intensity . in the days prior to admission , he had also noticed fevers , decreased appetite and overall malaise . the patient had a medical history of uncomplicated , untreated genotype 1 hepatitis c virus ( hcv ) and dyspepsia . he continued to smoke a pack of cigarettes a day and denied alcohol use . initial physical examination revealed a temperature of 102.2 degrees farenheit , a heart rate of 137 beats per minute , a blood pressure of 109/71 mmhg , and a respiratory rate of 16 breaths per minute with an oxygen saturation of 97% on room air . his cardiovascular exam revealed a regular tachycardia , without murmurs , rubs or gallops . his back exam revealed spinal tenderness from l2 through l4 without fluctuance or costovertebral angle tenderness . his extremity exam was significant for a right - sided psoas sign , otherwise , strength and range of motion was intact . neurologically there were no cranial nerves deficits , reflexes were symmetrical and normal , and distal sensation was intact . laboratory data revealed a white blood cell count of 11.2 10 cells / mm , a hemoglobin of 11.2 gm / dl , and platelets of 220 10/l . meq / l and the remainder of his chemistry panel , coagulation studies and liver function tests were normal . erythrocyte sedimentation rate was 80 mm / hr . an initial chest x - ray was normal . blood and urine cultures were drawn and the patient was started on vancomycin . a magnetic resonance image ( mri ) with gadolinium contrast of the lumbar and thoracic spine done on the day of admission revealed a large multiloculated abscess measuring 12 cm craniocaudally by 3 cm axially within the right posterior paraspinal musculature from l2 through l5 , with subtle enhancement of the l3 and l4 right transverse processes consistent with osteomyelitis . there was dural enhancement at l3 and l4 but no epidural abscess ( figure 1(a ) ) , and his cervical spine was unremarkable ( figure 2(a ) ) . a pigtail catheter drain was inserted into the paraspinal abscess on hospital day 2 . blood and abscess cultures grew methicillin - resistant stapyolococcus aureus ( mrsa ) sensitive to vancomycin with a minimum inhibitory concentration [ mic ] of 0.5 g / ml . the patient improved clinically by hospital day 5 . white blood cell count , which initially had increased , trended down to normal . the peak vancomycin level measured on day three was 32 mcg / ml , with a trough of 12 mcg / ml . a transesophageal echocardiogram ordered on admission for initial concern for endocarditis revealed a small filamentous echodensity in the right anterior mitral valve leaflet consistent with a small ruptured chordae without evidence of vegetations of valvular regurgitation . a human immunodeficiency virus ( hiv ) his hcv viral load was 1.32 10 , with a normal alpha - fetoprotein level and an ultrasound consistent with cirrhosis but without focal masses . the patient inadvertently removed the pigtail catheter 4 days after insertion , on hospital day 6 . he remained afebrile . on hospital day 11 , the patient complained of new onset tingling in his fingertips bilaterally with upper extremity weakness and minimal discomfort of his shoulders and chest muscles . exam at this time showed no meningismus , normal cranial nerve function and reflexes . strength was decreased bilaterally and symmetrically on shoulder abduction ( 2/5 ) , elbow flexion and extension ( 4/5 ) , abductor pollicis brevis function ( 3/5 ) , finger abduction ( 4/5 ) and finger extension ( 3/5 ) . there was continued , decreased right paraspinal tenderness but an improved psoas sign , with no new findings otherwise . a repeat mri performed at this time revealed an extensive rim - enhancing epidural collection posterior to the spinal cord and cauda equina that extended from the level of the first cervical vertebra to the sacrum , with continuous and severe cord compression against the anterior spinal column ( figures 1(b ) and 2(b ) ) consistent with a large spinal epidural abscess . the patient was emergently taken to the operating room on day 11 for decompression and epidural abscess debridement . cultures taken from the epidural abscess intraoperatively grew mrsa , and the mic to vancomycin remained < 0.5 ug / ml in this culture , which excluded both a vancomycin intermediate resistant organism ( where the defined mic is between 48 ug / ml ) and a fully vancomycin resistant organism ( where the mic is 16 ug / ml ) . he had no neurological impairment and was discharged on hospital day 18 to a short - term rehabilitation center for physical and occupational therapy and a six - week course of intravenous vancomycin , chosen based on microbiological culture data , where he recovered without sequelae . pyomyositis is a suppurative infection of the large skeletal muscles without an apparent spread from contiguous structures . initially reported largely in the tropics , it has become a disease of worldwide occurrence , with many cases reported in temperate climates . thought to be due to seeding of a muscle from transient bacteremia , the exact pathophysiology is unknown , as only 5% to 37% of patients with pyomyositis are bacteremic . staphylococcus aureus is responsible for greater than 70% of infections , though multiple other organisms have been reported . comorbid conditions may contribute to the pathogenesis of pyomyositis , with approximately half of infected patients having diabetes mellitus , cirrhosis , aplastic anemia , sickle cell disease , rheumatologic disease , malignancy , a history of intravenous drug use or being immunosuppressed either by the use of a medication or by hiv [ 5 , 6 ] . the most commonly involved muscles are those in the thigh and gluteal region , though infection of the deltoid , psoas , biceps , gastrocnemius , and paraspinal region have also been reported . there is often no sign of underlying muscle or soft tissue swelling or infection . patients often do not present at this stage due to the vague nature of the complaints . stage 2 begins two to three weeks after the initial onset of symptoms and includes worsening muscle pain , swelling , erythema and fever . a localized purulent collection has developed by this stage , and patients often seek medical attention . if patients are not treated in this stage , they progress to stage 3 , which include sepsis and clinical signs of toxicity . diagnosis involves recognition of the appropriate signs and symptoms as well as a high index of suspicion . adjunctive laboratory testing is often not helpful , with variations in the white blood cell count , c - reactive protein and/or erythrocyte sedimentation rate being dependent on underlying diseases , especially , hiv , and often being nonspecific . despite obvious muscle destruction , serum creatine kinase and aldolase are often normal . blood cultures are positive only in a minority of patients . mri with gadolinium contrast is the preferred diagnostic test , if available , showing low signal intensity on t1 weighted images and high signal intensity with diffuse borders and contrast enhancement of t2 weighted images . while other imaging modalities have been used in resource - poor settings , mri with gadolinium contrast is the gold - standard imaging test especially in cases of infections that affect more than the extremities , as it can provide a more specific diagnosis if there are multiple infections simultaneously ( i.e. , pyomyositis and osteomyelitis , as in this case ) . more advanced stages require intravenous antibiotics with initial broad coverage for all potential pathogens , keeping in mind that patients with underlying medical comorbidities have a higher risk of gram - negative infections . often times , interventional radiology or surgical intervention is necessary to drain abscesses and fluid collections . complications of pyomyositis include muscle scarring , residual weakness , osteomyelitis , septic arthritis , pericarditis and septic shock , among others . with appropriate therapy , patients usually recover well without sequelae . what is unique to the present case is that the patient 's infection progressed despite appropriate antibiotic therapy and drainage . it also highlights the close anatomical relationship of the involved progressive infection : the initial pyomyositis of the paraspinal muscle , which lies just posterior to the lumbar transverse processes , and psoas muscle , which abuts the lateral portion of the vertebral body , had eroded into the lumbar vertebrae and eventually extended into the spinal canal . despite the dramatic clinical deterioration of our patient | community - acquired methicillin - resistant staphylococcus aureus ( ca - mrsa ) is responsible for a broad range of infections .
we report the case of a 46-year - old gentleman with a history of untreated , uncomplicated hepatitis c who presented with a 2-month history of back pain and was found to have abscesses in his psoas and right paraspinal muscles with subsequent lumbar spine osteomyelitis . despite drainage and appropriate antibiotic management the patient 's clinical condition deteriorated and he developed new upper extremity weakness and sensory deficits on physical exam .
repeat imaging showed new , severe compression of the spinal cord and cauda equina from c1 to the sacrum by a spinal epidural abscess .
after surgical intervention and continued medical therapy , the patient recovered completely .
this case illustrates a case of ca - mrsa pyomyositis that progressed to lumbar osteomyelitis and a spinal epidural abscess extending the entire length of the spinal canal . |
spinal cord injury ( sci ) is the most devastating form of neurological injury , disturbing the normal sensory , motor , and/or autonomic functions . the annual incidence of sci in the usa is about 40 cases per million of population . sci is caused principally by trauma ( e.g. traffic injuries , falls , and violence ) . the risk of death is highest in the first year after sci and varies by level and severity of injury . cardiovascular disease is one of the principal causes of death.3 , 4 in the usa , diseases of the circulatory system are the most common causes of death . in norway , the main causes of death following the experience of a sci are pneumonia / influenza , ischemic heart disease , and urogenital disease . in patients with acute cervical scis ( rather than thoracolumbar scis ) , cardiovascular deficits , including severe bradycardia , asystole , and loss of peripheral vascular tone , are known complications.5 , 6 acute autonomic imbalances developing after disruption of the sympathetic pathway ( located in the cervical cord ) are thought to trigger such cardiovascular events.5 , 6 , 7 although autonomic dysfunction developing after sci can have fatal consequences , including cardiac arrest , many clinicians do not recognize such risks , and the conditions are often misdiagnosed . here a 26-year - old male pedestrian was admitted to hospital via the emergency room after a traffic accident . he was mentally alert and complained of weakness and numbness of both the upper and lower extremities . on physical and neurological examination , no external injuries were evident except for an abrasion on the left arm . the baseline electrocardiogram ( ecg ) revealed sinus bradycardia ( 57 beats / min , fig . 1 ) . initial chest and abdominal computed tomography ( ct ) did not reveal any abnormality or trauma - related injury . a skull fracture , with a small subdural hemorrhage at the right frontal convexity was evident on brain and facial ct . spinal ct revealed acute fractures at the c67 bilateral articular facets and the right - side lamina of c6 ( fig . 2b ) . on the first day of admission , the patient underwent microscopy - assisted corpectomy and discectomy with anterior interbody fusion . postoperatively , the patient remained in the icu for monitoring . on the fifth postoperative day ( pod ) , a pneumonic infiltration with pleural effusion was evident on a follow - up chest x - ray ( fig . 3 ) . bronchoscopy was performed , and a large volume of purulent secretion was evident in the dependent portion . the patient was transferred to the division of pulmonology for further respiratory treatment in an icu . antibiotics were commenced , ventilator support put in place , and a tracheostomy performed . during the icu stay , intermittent bradycardia ( 3055 beats / min ) was evident , without specific symptoms ; his vital signs were stable . intravenous atropine ( 0.25 mg ) was given twice to treat severe bradycardia ; the heart rate was recovered in a few seconds . echocardiography revealed no specific abnormality , and the left ventricle exhibited normal systolic function ( ejection fraction 60% ) . on the 22nd pod , chest ct was scheduled for differential diagnosis of a pulmonary thromboembolism . during a positional change prior to imaging in the ct suite , the heart rate fell to 23 beats / min , and blood pressure was not palpable at the carotid artery . after immediate cardiac massage over 1 min , the patient was resuscitated and exhibited stable vital signs . holter monitoring was performed on the day after cardiac arrest ( fig . 4 ) . however , 26 pauses were evident , the longest of which was 17.9 s. a temporary cardiac pacemaker was initially placed because of the patient 's poor general condition and the risk of infection . on the 31st pod , the patient was transferred to the department of rehabilitation after ventilator weaning on the 90th pod and was discharged 2 months later . cardiovascular complications , such as bradycardia , arterial hypotension , and loss of peripheral vascular tone , are common complications of acute sci.3 , 4 such cardiovascular phenomena are usually observed in patients with upper thoracic or cervical scis . bradycardia is the most common form of dysrhythmia developing after sci , especially in the acute phase of injury . several studies have shown that almost all patients with complete cervical scis will develop bradycardia , and 16% will suffer cardiac arrest.5 , 9 cardiac dysfunction usually commences within 35 days after injury , and it typically resolves in 68 weeks.8 , 10 although bradycardia developing after acute sci is usually temporary , there is a real risk of cardiac arrest , and adequate management is required . treatment of bradycardia in sci patients generally involves administration of oxygen , atropine , inotropes , and aminophylline . temporary and permanent pacemakers have been placed in patients who are refractory to general treatment and experience life - threatening events such as cardiac arrest.10 , 11 we recommend that patients with acute scis should be admitted to icus or similar high - care settings in order to facilitate acute cardiopulmonary management ; this is especially important if a patient has a high - level sci or exhibits hemodynamic instability . several studies have shown that icu monitoring and aggressive medical management improve the outcomes of patients with acute scis.12 , 13 additionally , such patients can develop multiple ( cardiovascular , respiratory , and urinary ) complications , trophic skin changes , and heterotopic ossification . hence , a multidisciplinary icu approach is needed to minimize various problems . however , most clinicians do not recognize the risk of severe bradycardia that can trigger cardiac arrest and often misdiagnose the conditions that then would develop . in our case , the patient was transferred from the department of orthopedics to the division of pulmonology because he developed respiratory complications and thus required further icu care after surgery . the patient usually self - recovered and was stable , and showed no specific symptoms . on the 22nd pod , a ct to explore the possibility of pulmonary thromboembolism was planned because the hypoxia was persistent and the d - dimer level was elevated . however , the patient went into cardiac arrest during a positional change in the ct suite located outside the icu . consequently , a cardiac pacemaker was inserted after asystole was confirmed by 24-h holter monitoring . disruption of the supraspinal sympathetic pathways , inducing parasympathetic dominance , by a cervical sci , is the major cause of cardiovascular instability.15 , 16 the preganglionic sympathetic nerve fibers exit the spinal cord at the first - to - fourth thoracic vertebrae ( t1t4 ) and are controlled by higher centers via messages transmitted through the cervical spinal cord . however , the parasympathetic system is controlled by the vagus nerve , which originates in the medulla . thus , the extent of sympathetic dysfunction is related to the location and severity of the sci . any increase in vagal reflexes , as might be induced by tracheal suctioning , a hypoxic episode , or a change in posture , can precipitate a bradycardia event . other studies have shown that the sympathetic hypoactivity gradually improves within 46 weeks after injury.5 , 16 the proportion of sci patients requiring a pacemaker ranges from 9% to 17%.5 , 10 , 18 percutaneous cardiac pacing is only a temporary tool employed in emergency situations . such a pacemaker is associated with risks of injury , skeletal muscle contraction , and pacing failure , and it suffices only until permanent transvenous cardiac pacing can be established . cardiac pacemaker implantation is indicated for patients with high - level scis and continuing symptomatic bradycardia and they do not respond to medical management or suffer recurrent cardiac arrests . sanghvi et al described a patient with a traumatic c7d1 dislocation who experienced continuous severe bradycardia and cardiac arrest for 2 months after injury . gilgoff et al reported a patient with a c2 sci causing complete quadriplegia ; the patient experienced symptomatic bradycardia for 21 months after injury despite intensive medical management . clinical improvement was evident after insertion of a cardiac pacemaker . in conclusion , patients who suffer scis are at risk of severe bradycardia and cardiac arrest attributable to dysfunction of the autonomic nervous system . the risks are highest during the acute phase of injury and in patients with upper thoracic or cervical scis . monitoring in an icu , careful assessment of autonomic dysfunction , and aggressive medical management , in addition , procedures that may increase vagal reflexes should be very carefully performed after prior preparation for a possible emergency situation that may develop very rapidly . | bradycardia is the most common form of dysrhythmia developing after disruption of the sympathetic pathway by a spinal cord injury ( sci ) , and it can have fatal consequences , including cardiac arrest . here , we report a case of cardiac arrest developing after cervical sci attributable to sympathetic hypoactivity .
a 26-year - old male pedestrian was admitted after a traffic accident .
radiologically , fractures were apparent at the c67 bilateral articular facets , and cord contusion with hemorrhage was evident at c47 . during his stay in icu , intermittent bradycardia was noted , but the symptoms were not specific . on the 22nd postoperative day , the patient was taken to the computed tomography suite for further evaluation and experienced cardiac arrest during a positional change .
after immediate cardiac massage , the patient was resuscitated .
we scheduled holter monitoring , which detected 26 pauses , the longest of which was 17.9 s. the patient underwent cardiac pacemaker insertion .
no further cardiac events were noted . |
maggot therapy is categorised as a debridement for chronic infectious wounds using disinfected live maggots for medical use ( herein referred to as maggots ) . since the 1930s , maggot debridement therapy ( mdt ) has been conducted mainly in north america . in japan , first conducted mdt in 2004 and reported the healing of an ulcerated lesion , leading to the avoidance of major amputation of a limb of a patient with severe cli for whom neither a revascularization procedure nor a transplantation of bone marrow and peripheral mononuclear cells to the lower limb was effective . wound healing is intractable in most cli patients who have reduced blood flow in the skin ; therefore , revascularization is the most important factor for successful management . in addition , the debridement of wounds with no sufficient tissue blood flow may deteriorate ischaemic lesions . treatment decisions are often difficult for cli patients with a reduced cardiac function and surgical intervention or endovascular surgery for revascularization is risky , or not clinically and technically possible . herein , we report a cli patient with severe cardiac dysfunction for whom highly invasive surgery , such as bypass surgery , was impossible due to a history of fulminant myocarditis , but functional limb salvage was achieved after wound bed preparation ( wbp ) with mdt . a 73-year - old man consulted our institution for a skin ulcer of the left third toe in september 2014 . he had a clinical history of fulminant myocarditis , myocardial infarction , acute cardiac failure , chronic renal failure ( undergoing dialysis ) , arteriosclerosis obliterans of the lower limb , hypertension , diabetes and visual disturbance . he was a non - smoker , living by himself , and he could walk with support . his notable illness was an episode of fulminant myocarditis and acute cardiac failure in december 2011 , which was treated in the icu for 15 days , and he was discharged from hospital 3 months later . at the time of discharge , he still had significant cardiac functional disorder with an ejection fraction ( ef ) rate of less than 20% . in april 2014 , he developed ulceration of the right toes , diagnosed as arteriosclerosis obliterans of the lower limb at the cardiovascular medicine department and underwent percutaneous transluminal angioplasty ( pta ) . in september 2014 , delayed healing of the ulceration of the skin was noted ; thus , he was referred to the plastic surgery department . upon the first consultation at the plastic surgery department , ischaemic ulcer of the left third toe biological data on the left limb were examined between the revascularization procedure and surgical management , and blood test and wound culture were examined at the time of surgical management . ajb : ankle joint nerve block ; crp : c - reactive protein ; mrsa : methicillin - resistant staphylococcus aureus ; pta : percutaneous transluminal angioplasty ; snb : sciatic nerve block ; s. maltophilia : stenotrophomonas maltophilia . endovascular surgery was not conducted after october 2016 . in september 2014 , after performing pta for the left lower limb , amputation of the left third toe was conducted . in december 2014 , re - stenosis of the bilateral below - knee arteries and necrosis of the left first toe were noted , thus re - pta was conducted for the bilateral limbs . subsequently , amputation of the left first toe was performed . in september 2015 , arterial re - stenosis of the lower extremity developed along with necrosis of all the left toes , plantar and dorsum , and so pta was performed again ; transmetatarsal amputation ( tma ) was also performed in the same month . however , delayed wound healing , infection and necrosis progressed in the transected surface of the left limb . therefore , in january 2016 , the first and second toes were amputated at lisfranc s joint , and the other three toes were further amputated at the base of the transmetatarsal bone , and the amputated surface was left as an open wound for wbp and post - operative infection management . at the time of the amputation , extensive arterial contraction and severe arteriosclerosis were noted in the left lower limb ; thus , an additional revascularization procedure by pta could not be performed . subsequently , cleansing of the wound , topical ointment of sulfadiazine silver , venous drip infusion of an antibiotic agent ( daptomycin ) , and surgical debridement at the bedside were conducted daily , but the yellowish necrosis lesion did not reduce , and his pain aggravated ( figure 1(a ) ) . ( b ) after one session ( 48 h ) of treatment , the reduction of necrotic tissues is seen . ( d ) after six sessions of treatment , debridement was conducted to the deep portion from the ulcerated base , and favourable granulation can be seen on the amputated surface . the patient strongly desired to save his limb and refused to undergo major amputation of the limb . surgical management under general anaesthesia ( such as bypass surgery ) or extensive and highly invasive debridement for a long time was also considered unacceptable , because the patient fulfilled three items of the revised cardiac risk index ( history of cardiac failure , insulin - dependent diabetes and renal failure ) , had ef of 18.4% and had a constantly high level of b - type natriuretic peptide ( over 2000 pg / ml ) . as conventional treatment methods were considered difficult for the patient to tolerate , mdt was started from february 2016 . second instar larvae of maggots were placed on the surface of the skin ulcer at six larvae per 1 cm , covered by a mesh sheet and dressing was performed . the maggots were removed when they grew to third instar larvae and were replaced by second instar larvae . by defining a 48-h duration as one session , a total of six sessions were conducted . for pain control , the oral administration of nsaids was performed and he could tolerate the pain , although it remained to a certain extent . subsequently , compared with the conventional treatment , the reduction of necrotic tissues at the ulceration site was noted each time the maggots were replaced , and favourable granulation was observed . mdt was particularly effective in the portion where the margin between the granulation and necrosis was unclear , and the deep portion of the ulceration where manual debridement was difficult ( figure 1(b d ) ) . intraoperative and post - operative views are shown in figure 2(a , b ) . under sciatic nerve block , additional debridement and partial simple reefing suture were done , and skin graft with a split thickness of 20/1000 inches was conducted , harvesting the graft from his left inguinal region . the operation took 1 h and 40 min , and the amount of bleeding was 140 ml . after conducting partial simple reefing , split thickness skin graft of 20/1000 inches was used . post - operatively , about 70% of the grafted skin was taken , although it was unstable for 2 weeks , and his pre - operative pain markedly reduced . although some raw surface remained , the range was relatively small , and additional surgical management was unnecessary . after rehabilitation exercise , as of one post - operative months , he became able to stand with assistance when moving from a wheelchair , walk using a four - point walker , and his barthel index improved to a score of 80 ( figure 3(b ) ) . the barthel index improved from a score of 45 to 80 , and the patient started to walk using a four - point walker . in patients with cli , debridement may deteriorate necrosis by inducing ischaemia of normal tissues . therefore , blood flow evaluation and the revascularization procedure are important before conducting debridement . however , clinically or technically , up to ( maximum ) 14% of cli patients are unable to undergo surgical management or endovascular surgery for angioplasty . also , soga et al . reported a vascular re - stenosis rate of 86.0% and re - occlusion rate of 52.8% in cli patients who underwent endovascular management . in our patient , although the preoperative ankle brachial index and skin perfusion pressure were relatively maintained , arterial restenosis of the lower extremity was seen before healing , and pta was conducted three times . in addition , vascular reconstruction by additional pta was difficult after october 2016 . some cli patients are unable to undergo highly invasive surgery because of a reduced cardiac function . reported that 15.6% of their cli patients had an ef rate of less than 50% and 41.1% had coronary artery disease ( cad ) . in addition , a mortality rate of less than 25% has been reported within a year for cli patients . physiologic classification of the american society of anesthesiologists ( asa ) reports perioperative mortality rate of class - iii patients ( angina , old myocardial infarction , and insulin - dependent diabetes ) and class - iv patients ( unstable angina ) of 1.8% and 7.8% , respectively . the revised cardiac risk index , which is commonly used to predict cardiovascular events during a perioperative period , defines six risk factors : ischaemic cardiac disease , history of cardiac failure , cerebrovascular disease , insulin - dependent diabetes , renal failure and high - risk surgical management . if a patient has three or more of these risk factors , when conducting non - cardiac surgery , the average cardiovascular complication rate is reported to be 9.1% and mortality due to cardiovascular disease is 3.6% . our patient had three of these risk factors , suggesting a high risk during the perioperative period . adjuvant therapies for ischaemic ulcer , other than mdt , include hyperbaric oxygen therapy , cell therapy , gene therapy ( intravascular growth factor ) and ldl apheresis . however , these therapies require special equipment and qualification as a specialist ; thus , they are difficult to perform flexibly depending on the needs of a particular situation . on the other hand , mdt can be conducted less problematically in ordinary hospitals or outpatient clinics , although it is categorised as a private practice in japan and thus not covered by the japanese national health insurance system . four debridement methods are considered for the selective removal of necrotic tissues : ( 1 ) surgical debridement , ( 2 ) enzymatic debridement , ( 3 ) autolytic debridement and ( 4 ) biological debridement . surgical debridement removes necrotic tissues with scissors or a scalpel , which entails bleeding and pain of patients , as well as damage to peripheral intact tissues to some extent . enzymatic debridement uses chemical agents for liquefaction of necrotic tissues and is also called chemical debridement . this can be done without anaesthesia and is relatively simple to perform with little risk of bleeding ; however , it is a time - consuming procedure and thus not suitable for situations requiring more immediate results . autolytic debridement involves the application of wound dressing materials such as ointments or hydrocolloid materials , making it suitable for wounds that locate near the body surface or autonomic healing power of the wound is maintained . there are three major benefits of wbp by mdt for cli patients [ 1921 ] . first , selective and efficient debridement can be performed . even for wounds with unclear margins with the surrounding normal tissues , maggots selectively englobe and liquefy only necrotic tissues . in addition , as maggots naturally favour darker environments ( negative phototaxis ) , maggots reach to the deep portions of a wound where surgical debridement is difficult . pain associated with mdt can be controlled with oral analgesics or by controlling the number of applied maggots , making local or surface anaesthesia unnecessary . further , the technique for mdt is relatively straightforward and easily learned , so a certain efficacy can be obtained irrespective of the proficiency of each surgeon . even for patients of advanced age , with dementia , or unfavourable systemic conditions , for whom surgical debridement is problematic , mdt can be utilised . maggots have a sterilising effect both in vivo and in vitro . in the body , maggots eliminate bacteria through a digesting process in their foregut , midgut and hindgut . in an extracorporeal ( in vitro ) study , antibacterial peptide contained in maggots secretion was shown to be effective against gram - positive bacterium , including methicillin - resistant staphylococcus aureus ( mrsa ) . thus , mdt is considered suitable for cli patients who likely face the presence of multiple drug - resistant bacteria at high incidence , because of relative immune deficiency and long - term hospitalisation . harmful bacteria including mrsa were not detected in wound cultures of our patient in the months of january and february 2016 , while mdt was being conducted , suggesting effective antibacterial action of the maggots secretions . such processes include activation of fibroblast migration , angiogenesis ( the formation of new blood vessels from pre - existing vessels ) within the wound bed and an enhanced production of growth factors within the wound environment . these are believed to have been part of the success of wbp with our patient although his skin perfusion pressure ( spp ) in the dorsum of the foot was only 15 mmhg before mdt . a recent case report also indicated the possibility of mdt to improve blood flow , in addition to supporting its effectiveness for debridement , showing the increased skin perfusion pressure by 42 mmhg in the dorsum and 27 mmhg in the plantar . nevertheless , the number of published articles on this aspect is limited , and thus further investigation will be necessary before clear determination can be made . our case presented with five problematic conditions : ( 1 ) delayed wbp due to circulation failure , ( 2 ) difficulty of angioplasty after re - stenosis , ( 3 ) contraindication of highly invasive treatment , ( 4 ) infection by mrsa and ( 5 ) pain . to cope with these difficulties , mdt provided the benefits of the following : ( 1 ) capability of wbp by removing necrotic tissues with unclear margins , ( 2 ) possibility of improving blood flow , ( 3 ) effective debridement with low invasiveness , ( 4 ) antibiotic effect on mrsa and ( 5 ) capability of pain control using analgesics , adjusting the number of maggots and duration of treatment . the barthel index at the time of discharge from the hospital was a score of 80 ; thus , we considered that functionally meaningful limb salvage could be pursued . from these facts , mdt is believed to be an effective method to improve the wound surface with delayed healing , under the condition that a certain revascularization procedure is performed . mdt is one of the promising adjuvant treatments for patients with an unfavourable systemic condition and difficulty in undergoing highly invasive surgery . in conclusion , we could achieve functionally meaningful lower limb salvage by wbp with mdt for an ulcerated lower limb lesion in a cli patient who had a severe cardiac disorder , delayed healing of the wound surface and difficulty in undergoing a revascularization procedure after arterial restenosis . mdt is considered one of the adjuvant treatment strategies even for patients with cli , provided it is performed appropriately . the authors certify that there is no actual or potential conflict of interest in relation to this article . none of the authors received any financial support in association with this study and have no relationships that may pose an actual or potential conflict of interest . | abstractischaemic skin ulcer occurred on the foot of a 73-year - old man who had a history of fulminant myocarditis with severe cardiac dysfunction .
we attempted wound bed preparation by maggot debridement therapy and salvaged his limb .
it can be one of the adjuvant treatment strategies for critical limb ischaemia . |
subfoveal choroidal neovascularization ( cnv ) is a leading cause of visual loss in the geriatric population . peripapillary cnv membranes ( ppcnvm ) have been associated with multiple etiologies [ 2 , 3 ] . while ppcnvm , associated with optic nerve head drusen ( onhd ) , is a well - described entity in the pediatric population , it is not reported in the adult population ( pubmed search november 29 , 2014 ) . herein , we report a case of ppcnvm associated with onhd impacting the macula , which required treatment with an anti - vascular endothelial growth factor ( anti - vegf ) agent . a 75-year - old male presented with a chief complaint of blurry vision in the right eye ( od ) of 3 months duration . the patient 's past medical and ocular history were significant only for herpes zoster ophthalmicus on the left side years prior . on examination , his treatment was initiated with 3 ranibizumab injections , administered every 5 weeks , without any impact on the amount of subfoveal fluid . subsequent treatment with a single aflibercept injection resulted in complete resolution of subfoveal fluid ( fig . the patient 's visual acuity has been stable for 15 months with no recurrence of subfoveal fluid . the association of onhd with macular threatening ppcnvm and its favorable response to anti - vegf agents is already known in the pediatric population [ 2 , 3 , 4 ] . the natural course of ppcnvm is variable and unpredictable ; however , macular threatening ppcnvm requires treatment . while the role of anti - vegf therapy as a treatment for this specific subset of choroidal neovascular membranes was not studied as part of the major neovascular age - related macular degeneration ( amd ) studies , its use for the treatment of other forms of cnv is well established . bevacizumab , ranibizumab and aflibercept are 3 anti - vegf agents used for the treatment of neovascular amd . ranibizumab and bevacizumab are monoclonal antibodies that selectively bind to vegfa [ 7 , 8 ] . aflibercept , however , is a fusion protein composed of the binding domains of vegf receptor 1 , vegf receptor 2 , and the fc portion of igg that selectively binds to vegfa , vegfb , and platelet growth factor ( pigf ) . aflibercept has been shown to have a greater affinity for vegf and a longer half - life than both ranibizumab and bevacizumab . the comparison of age - related macular degeneration treatment trials ( catt ) demonstrated equivalence in efficacy between ranibizumab and bevacizumab in the treatment of wet amd , as did the inhibition of vegf in the age - related choroidal neovascularization ( ivan ) trial . the vegf trap - eye : investigation of efficacy and safety in wet amd ( view 1 and view 2 ) trials similarly demonstrated an equivalence between ranibizumab and aflibercept in treating wet amd . inadequate response to 1 anti - vegf agent is not uncommon when treating cnv , and , on occasion , changing to an alternate anti - vegf agent has demonstrated efficacy . currently , there are no studies that have investigated the response of aflibercept in treatment - resistant peripapillary cnv , likely due to the rarity of this presentation . previous studies have concluded that aflibercept may provide an efficacious therapeutic response in cases of cnv due to amd that initially failed to respond to bevacizumab and ranibizumab . further studies are required to investigate whether aflibercept is an equally efficacious therapeutic alternative to treatment resistant peripapillary cnv . based upon our experience , an individualized treatment plan for adult patients with ppcnvm , associated with onhd , | optic nerve head drusen can be associated with peripapillary choroidal neovascularization , in both the pediatric and adult population .
these membranes can involve the macula , causing significant visual loss . herein , we present a case that required treatment with an anti - vegf agent .
the patient failed to respond to the initial agent , but subsequently responded to a change of agent .
adult patients with macular degeneration involving peripapillary choroidal neovascularization associated with optic nerve head drusen may require individualized treatment plans . |
hypertensive encephalopathy ( he ) is heralded by headache , visual disturbance , seizures , and altered mental status , all associated with severe hypertension6 ) . without prompt the most common feature of he by magnetic resonance imaging ( mri ) is hyperintensity of subcortical parietal and occipital white matter on t2-weighted views , suggestive of vasogenic edema . because such changes usually disappear upon bp stabilization , many authors refer to this state as reversible posterior leukoencephalopathy syndrome or posterior reversible encephalopathy syndrome ( pres)3,6,8,9 ) . involvement of the brainstem and cerebellum in pres has rarely been described . in this report , however , we present a case of pres where the brainstem alone is affected , accompanied by intracranial hemorrhage . a 36-year - old male with idiopathic hypertension ( duration > 6 yrs ) was admitted to our hospital for abrupt - onset headache , right facial palsy , dysarthria , and right hemiparesis that had developed three hours earlier . laboratory studies were within normal range and ophthalmologic evaluation was unremarkable . specifically , no papilledema was evident . routine chest x - ray and echocardiogram suggested severe concentric left ventricular hypertrophy , later confirmed by transthoracic echocardiography . emergency computed tomographic ( ct ) scan of the brain revealed small amount ( 7 cc ) of intracranial hemorrhage involving the left basal ganglia , and there was relative hypodensity of the brainstem ( fig . brain mri showed diffuse high - signal intensities on t2-weighted images and fluid - attenuated inversion recovery images without gadolinium enhancement in the pons and midbrain . no high signal intensities in diffusion - weighted images ( dwi ) and high signal intensities in apparent diffusion coefficient ( adc ) images , implying that the changes were not due to cerebral infarction ( fig . there were also no abnormal findings other than the small amount of hemorrhage in basal ganglia , which was confirmed already in ct ( fig . follow - up mri ( including dwi ) on day 16 of hospitalization revealed complete resolution of prior imaging aberrations involving the brainstem ( fig . as a distinct clinical entity , pres is characterized by progressive headache , visual changes , altered mental status , and seizures . most commonly pres is secondary event , triggered by paroxysmal severe hypertension of various etiologies . the spectrum of predisposing factors / conditions includes renal disease , immunosuppressive and cytotoxic drugs , collagen vascular disorders ( such as systemic lupus erythematosus ) , eclampsia , and hematologic conditions ( typically , thrombotic thrombocytopenic purpura and hemolytic - uremic syndrome)5 ) . however , regardless of the underlying cause , the pathogenesis of the primary abnormality , cerebral vasogenic edema , is still under debate . if the main cause is corrected , pres can be reversed . however , if patients with pres present with coma and/or status epilepticus , permanent neurological impairment or death may occur in some cases8 ) . generally , subcortical white matter of the parietal and occipital lobes is affected , while involvement of brainstem is rare . in our patient , reversible brainstem hypertensive encephalopathy ( rbhe ) was first recognized by chang and keane2 ) in 1999 . when the brainstem alone is affected , most patients do not exhibit focal signs or symptoms . intracerebral hemorrhage of the left basal ganglia , rather than the brainstem manifestations , was held responsible for the facial palsy , dysarthia and right - sided hemiparesis displayed in this instance . because the neurologic effects of rbhe are reversible with prompt treatment , this syndrome must be differentiated from brainstem infarction , pontine glioma , central pontine myelinolysis , and infectious encephalitis . severe hypertension , so - called " clinical - radiologic dissociation " ( signaling brainstem involvement ) , and rapid resolution of mri changes after antihypertensive treatment are pathognomonic of rbhe10 ) . the suggested etiology of rbhe is a failure of cerebrovascular autoregulation in the face of high bp , resulting in cerebral hyperperfusion , disruption of the blood - brain barrier ( bbb ) , and vasogenic edema1 ) . while physiologic hypertension usually activates sympathetic pathways to maintain the bbb via cerebral vasoconstriction , experimentally induced hypertension in animal models has shown that transient reflex sympathetic hypertension can override the bbb . at breakthrough , constricted cerebral arterioles dilate under hypertensive force , allowing parenchymal extravasation of fluid , macromolecules , and red blood cells7 ) . the posterior circulatory network , in particular , is less endowed with sympathetic innervation than anterior vessels , and thus is less capable of a protective vasoconstrictive response to a sudden increase in arterial bp . a disruption in bbb , this failure of autoregulation is marked by vasogenic ( as opposed to cytotoxic ) edema , confirmed by imaging studies . consistent with other reports of rbhe , demonstrable hyperintensity on t2-weighted images and normal dwi with increased adc values were indicative of vasogenic edema in our patient . what has yet to be explained is the predilection for brainstem ( versus cerebral ) involvement with rbhe . because the parietal and occipital lobes , as well as the brainstem , are within distribution of the vertebrobasilar artery and its branches , two tentative explanations have emerged4 ) . by allowing fluid to accumulate , the brainstem may simply absorb much of the hypertensive " tidal wave " , dissipating pressure before other parts of the brain are reached . in essence , the brainstem serves as a buffer to protecting cerebrum and the distal parieto - occipital region in the vertebrobasilar system , more distal in blood supply . another explanation is that the parietal and occipital lobes may be resistant to relatively rich sympathetic innervation via the posterior communicating artery ( pcoa ) . a well - developed pcoa , also known as fetal - type pcoa , is thought to possess the same degree of sympathetic innervation as the anterior circulation . in this manner , individuals with a fetal - type pcoa may be protected from paroxysmal malignant hypertension . consequently , it is clear that at least one of these theories is flawed and that more effort is needed to clarify the pathophysiologic mechanisms of rbhe . thorough neurologic examination , in conjunction with mri with dwi , is essential for the correct diagnosis . clinical - radiologic dissociation and rapid improvement of mri findings after antihypertensive treatment are features pathognomonic of rbhe . with prompt and proper management however , physicians must cognizant of the potential for fatality and approach it as a medical emergency . | presented here is a 36-year - old male with arterial hypertension who developed brainstem edema and intracranial hemorrhage .
magnetic resonance scan revealed diffuse brainstem hyperintensity in t2-weighted and fluid - attenuated inversion - recovery images , with an increase in apparent diffusion coefficient values .
after a reduction in blood pressure , rapid resolution of the brainstem edema was observed on follow - up .
the patient 's condition was thus interpreted as hypertensive brainstem encephalopathy . while many consider this a vasogenic phenomenon , induced by sudden , severe hypertension , the precise mechanism remains unclear .
prompt recognition and aggressive antihypertensive treatment in such patients are essential to prevent permanent or life - threatening neurologic injury . |
bilateral acute angle closure glaucoma ( aacg ) after general anesthesia with the administration of either antimuscurinic ( scopolamine and atropine ) or sympathomimetic ( ephedrine ) agents is a rarely reported event in the literature.14 other precipitating factors include aids , herpes zoster , myelodisplastic syndrome , congenital anomalies , belpharoplasty , emotional stress , and drug sensitivity reactions.59 bilateral aacg after cervical spine surgery under general anesthesia in a hypermetropic patient has been reported secondary to ephedrine administration.1 we report a case of bilateral aacg with a plateau iris syndrome after the use of glycopyrrolate during general anesthesia for cervical spine surgery . we present a case of a 59-year - old male with hepatitis b , hypertension , and benign prostatic hypertrophy treated by 5-reductase inhibitor . he was diagnosed with cervical disc disease involving c4-c5 , c5-c6 , and c6-c7 causing severe neck pain and paresthesia radiating to both upper and lower limbs . his past surgical history included surgical excision of multiple lipomas under general anesthesia with no reported complications . ophthalmic history was significant for mild bilateral hyperopia ( + 1.50d ) . on the day of surgery the patient was not premedicated . the vital signs upon induction were as follows : blood pressure 110/70 mmhg ; heart rate 80 beats / min ; o2 saturation 97% on room air . intravenous midazolam ( dormicom ; hameln pharmaceutical , germany ) 2 mg iv and ( fentanyl ; hameln pharmaceutical , germany ) intravenous fentanyl 50 mcg were administered . while awake , nasal intubation was performed after bilateral superior laryngeal nerve block , transtracheal block , and topical anesthesia . after preoxygenation , intravenous induction was administered with propofol ( diprivan ; frenius kabi , germany ) 200 mg , rocuronium ( esmeron ; organo , netherland ) 50 mg , fentanyl 250 g , midazolam 1 mg , and xylocaine ( lidocaine hydrochloride ; hameln pharmaceutical , germany ) 100 mg . dexamethasone ( dexamed ; medochemie lts , cyprus ) 16 mg was given intravenously after induction . the head was stabilized with a horseshoe head rest and the anesthesiologist made sure that no pressure was applied on the eyes or forehead . remifentanil ( ultiva ; gsk , italy ) and cisatracurium ( nimbex ; gsk , italy ) intravenous infusions were started . throughout the procedure , vital signs were maintained within the following limits : systolic blood pressure 100130 mmhg ; diastolic blood pressure 5080 mmhg ; heart rate 5070 beats/ min ; o2 saturation 99100% ; temperature 35.736.7c . four liters of lactated ringers were infused intraoperatively that lasted 5 h and 30 min . after the laminectomy was performed , the patient was reversed back to the supine position . muscle relaxants were reversed with neostigmine ( prostigmine ; valeant , switzerland ) 0.05 mg / kg ( 4.5 mg ) and glycopyrrolate ( robinul ; american regent inc , usa ) 0.01 mg / kg ( 0.9 mg ) . the patient was extubated fully awake and cooperative and was transferred to the recovery room in stable condition . in the early postoperative period , approximately 12 h following recovery from general anesthesia he developed progressive bilateral frontal headache associated with nausea that persisted despite analgesics . twenty - four hours postoperatively , he started complaining of bilateral blurring of vision along with headache at which time the ophthalmology service was consulted . there was corneal edema bilaterally with an intraocular pressure of 65 mmhg in each eye . the anterior chambers were shallow and gonioscopy revealed bilateral plateau iris occluding the trabecular meshwork 360. both irises were pigmented dark - brown . acetazolamide ( diamox ; sigma pharmaceuticals ltd , new zealand ) 500 mg po and intravenous mannitol ( 500 cc over 40 min ) were administered and the patient was instructed to instill topical antiglaucoma drops including dorzolamide hydrochloride timolol maleate ( cosopt ; merck , usa ) and bimatoprost ( lumigan ; allergan , usa ) ophthalmic solution . on follow up over the next 12 h , visual acuity improved to 20/35 bilaterally with significant decrease in corneal edema . the intraocular pressure decreased to 21 mmhg in the right eye and 14 mmhg in the left eye , respectively . the anterior chambers remained shallow , hence peripheral iridotomies at 10 and 12 oclock were performed on both eyes . the patient was returned for 1 month follow - up and his vision was 20/20 in both eyes with an iop of 13 mmhg and 15 mmhg in the right and left eyes , respectively . aacg occurs in females four times greater than in males due to the anatomically more compact anterior chamber.10 other risk factors include genetic predisposition , shallow anterior chamber depth , high hypermetropia , increased lens thickness , small corneal diameter , and increased age.1112 aacg a rare postoperative complication of ( nonophthalmic ) surgeries performed under general anesthesia . large doses of antimuscarinic agents are often administered intravenously during general anesthesia to prevent the side effects of neostigmine methylsulfate , which is used to reverse the effect of nondepolarizing muscle relaxants . this causes mydriasis that can predispose patients with shallow anterior chambers to progress to aacg especially in lightly pigmented irides.413 we postulate that two factors contributed to the formation of plateau iris - like acute angle closure and obliteration of the trabecular meshwork in our patient . first the gravitational effect , induced by the prone position during surgery is a well documented cause of increased intraocular pressure.1415 this promoted the forward shift of the lens / iris apparatus . second the tangential effect , created by the movement of the iris dilator muscles due to the mydriatic effect of glycopyrrolate toward the angle enhancing iris apposition against the irido - corneal angle [ figure 1 ] . although neostigmine has a miotic effect and could have aborted the attack , its duration of action is significantly shorter than the anticholinergic effect of glycopyrrolate.1617 glycopyrrolate is a synthetic anticholinergic muscarinic competitive antagonist with a quaternary ammonium structure of the phenyacetate drug class . glycopyrrolate is used as an adjunct to acetylcholine esterase inhibitors to antagonize their cholinergic effects . the anticholinergic effect of glycopyrrolate lasts for 812 h. in our case , the patient experienced ocular pain approximately 24 h postoperatively . this was likely due to the masking effect of the analgesics and sedatives that the patient received during the early postoperative period . schematic drawing of the summation of vector forces that lead to angle closure during mydriasis and the prone position in conclusion , this is the first case of bilateral aacg induced by glycopyrrolate ( pubmed search : bilateral angle closure glaucoma , glycopyrrolate ) . we recommend that an assessment of the anterior chamber depth should be included in the preoperative checklist of every patient undergoing surgeries in the prone position under general anesthesia . this can be easily done using a penlight illumination test for anterior chamber depth by the anesthesiologist . also , the use of topical pilocarpine administered at the end of the surgery should be considered for patients at risk in order to prevent an aacg attack . | to report a case of bilateral acute angle closure glaucoma ( aacg ) that occurred after cervical spine surgery with the use of glycopyrolate . a 59-year - old male who presented with severe bilateral bifrontal headache and eye pain that started 12 h postextubation from a cervical spine surgery .
neostigmine 0.05 mg / kg ( 4.5 mg ) and glycopyrrolate 0.01 mg / kg ( 0.9 mg ) were used as muscle relaxant reversals at the end of the surgery . ophthalmic examination revealed he had bilateral aacg with plateau iris syndrome that was treated medically along with laser iridotomies .
thorough examination of anterior chamber should be performed preoperatively on all patients undergoing surgeries in the prone position and receiving mydriatic agents under general anesthesia . |
drug - induced hypersensitivity syndrome is a severe adverse drug reaction , which often manifests as an erythematous skin eruption , fever , lymphadenopathy , peripheral blood eosinophilia , and visceral organ involvement ( 1 ) . many drugs cause hypersensitivity syndrome , including anticonvulsants , sulfonamides , dapsone , allopurinol , minocycline , and gold salts ( 2 ) . mexiletine is an antiarrhythmic agent that has been used to treat ventricular tachycardia for more than 30 yr ( 3 ) . since the first report by higa et al . ( 4 ) . in 1997 , a few cases of mexiletine - induced hypersensitivity syndrome have been reported , especially in japanese males over 45 yr of age ( 5 - 8 ) . these cases manifested with fever , rash , peripheral blood eosinophilia , elevation of liver transaminase enzymes without other organ involvement . here , we present the first case of mexiletine - induced hypersensitivity syndrome with lung involvement , which is also the first case of mexiletine - induced hypersensitivity syndrome in korea . this case manifested as eosinophilic pneumonia , in addition to fever , a papuloerythematous skin rash , peripheral blood eosinophilia , and liver dysfunction . an 82-yr - old man was admitted to the hospital with a fever and cough . the patient had been diagnosed with an arrhythmia associated with dilated cardiomyopathy 9 months earlier and had been taking mexiletine for 5 months in addition to furosemide and spironolactone , which was continued since the diagnosis . he developed a fever , cough , and sputum 1 week before admission ( fig . 1 ) . he was a retired pharmacist who lived in downtown seoul , korea . on physical examination , variable - sized , fused erythematous macules and plaques covered his entire body , including the trunk and extremities his body temperature was 38.3 , and his respiratory rate was 22 times per min . auscultation of the lungs disclosed diminished breath sounds throughout both lungs , with crackles at the bases . laboratory studies showed leukocytosis ( 13,700/l ) with eosinophilia ( 3,310/l ; 24.2% of the white blood cells ) in the peripheral blood . chest radiographs showed multiple increased opacities with a patchy distribution in both lungs ( fig . chest computed tomography ( ct ) on admission showed multiple nodular consolidations with ground - glass density in both hemithoraxes and multiple mediastinal lymphadenopathy ( fig . 3b ) . a fine needle aspiration biopsy of a lung lesion was performed and showed eosinophilic infiltration with histiocytes , and granular pneumocytes with an organizing alveolar exudate ( fig . the dermis showed extravasated red blood cells and moderate perivascular infiltration of lymphocytes and eosinophils ( fig . , he was diagnosed with type ii diabetes mellitus for the first time based on a fasting serum glucose of 183 mg / dl and hemoglobin a1c of 8.6% . the patient was diagnosed with drug - induced hypersensitivity syndrome based on the clinical findings and laboratory evidence . the mexiletine was suspected to cause theses adverse reactions and was withdrawn , while furosemide and spironolactone was continued . for the treatment of severe immune response , subsequently , his temperature decreased , with resolution of the blood eosinophilia , liver dysfunction , and cutaneous and lung lesions ( fig . four months after resolution of the adverse findings , a patch test was performed to confirm the etiologic diagnosis . mexiletine ( mexitil , boehringer ingelheim korea , seoul , korea ) , furosemide ( lasix , handok pharmaceuticals co. , seoul , korea ) , and spironolactone ( aldactone , pharmacia ltd . , uk ) at concentrations of 0 , 1 , 2 , 5 , 10 , and 20% in petrolatum was applied at the back of the patient using finn chambers on scanpor tape for 48 hr . at 30 min and 48 hr after removal of the tape , the responses were scored according to the international contact dermatitis research group guidelines ( 9 ) . weakly positive reactions were detected with 5 , 10 , and 20% mexiletine , while ten control subjects showed negative result to the test . based on clinical course and patch test , we were able to identify mexiletine as the etiologic agent for the development of drug - induced hypersensitivity syndrome . to explore the association of these events with human herpes virus 6 ( hhv-6 ) infections , we performed polymerase chain reaction ( pcr ) analysis for hhv-6 in the serum of the patient taken at the time of patch test . drug - induced hypersensitivity syndrome is the name for the severe adverse reactions to drugs as a result of systemic immune responses and is often called dress ( drug reaction with eosinophilia and systemic symptoms ) ( 10 ) . anticonvulsants such as carbamazepine and phenytoin are the most common etiologic agents causing drug - induced hypersensitivity syndrome ( 11 ) . in addition , allopurinol , sulfonamides , dapsone , and minocycline can cause these reactions . mexiletine has been reported to cause severe hypersensitivity reactions , including drug - induced hypersensitivity syndrome ( or dress ) . although mexiletine is prescribed worldwide , all previously reported cases of mexiletine - induced hypersensitivity syndrome have been japanese , suggesting a genetic predisposition ( table 1 ) . the present case is the first report in a non - japanese population . despite ethnic differences , the korean and japanese populations share much the same genetic background , and the exclusive incidence of mexiletine - induced hypersensitivity syndrome in far eastern countries implies that genetic susceptibility underlies its pathogenesis . while genetic variants associated with the development of drug induced hypersensitivity syndrome are not well defined , the human leukocyte antigen hla - b*1502 is reported to be significantly associated with the development of carbamazepine - induced stevens - johnson syndrome ( sjs ) and toxic epidermal necorlysis ( ten ) ( 12 ) . this genetic association may be ethnicity specific , in that strong association is observed in han - chinese , not in caucasians ( 13 ) . these finding can explain relatively higher incidence of the event in han - chinese than in caucasians ( 12 , 14 ) . like carbamazepine - induced sjs and ten , high incidence of mexiletine - induced hypersensitivity syndrome in far eastern countries maybe due to ethnicity specific genetic predisposition . in addition to ethnic characteristics , all reported cases have developed in relatively old males , which suggests a sex and age predilection . internal organ involvement is a specific finding of hypersensitivity syndrome , and the specific organ involvement often depends on the etiologic drug ( 1 ) . allopurinol - induced reactions frequently involve the kidney , whereas phenytoin and dapsone often cause liver dysfunction . the previous reports of mexiletine - induced hypersensitivity syndrome did not reveal the specific organ involvement , except for liver dysfunction ( table 1 ) . ours is the first report of lung involvement in mexiletine - induced hypersensitivity syndrome . in this report , we proved eosinophilic lung infiltration with not only imaging studies but also microscopic examination of the lung lesions . in many cases of drug - induced hypersensitivity syndrome , this was also true for mexiletine - induced cases ( table 1 ) , except for that reported by yagami et al . the patients developed clinical manifestations after 5 or 6 months of medication , and patch tests proved mexiletine was the causative agent . the mechanism for the immunogenicity of these drugs is not clear , although a role of reactive drug metabolites in initiating an immune response via hapten formation has been suggested ( 15 ) . recently , the involvement of viral infection in the pathogenesis of drug - induced hypersensitivity syndrome has been explored intensively . although we did not confirm the viral association in this case , some previous case studies of mexiletine - induced hypersensitivity syndrome have suggested a relationship between human herpes virus 6 and the development of systemic immune responses ( 6 - 8 ) . in conclusion , we report the first case of mexiletine - induced hypersensitivity syndrome with lung eosinophilic infiltrates . this is also the first report of these reactions in a non - japanese population . | an 82-yr - old man was presented with fever and cough accompanied by generalized erythematous rash .
he had taken mexiletine for 5 months , as he had been diagnosed with dilated cardiomyopathy and ventricular arrhythmia .
laboratory studies showed peripheral blood eosinophilia and elevated liver transaminase levels .
chest radiographs showed multiple nodular consolidations in both lungs .
biopsies of the lung and skin lesions revealed eosinophilic infiltration . after a thorough review of his medication history ,
mexiletine was suspected as the etiologic agent . after discontinuing the mexiletine and starting oral prednisolone , the patient improved , and the skin and lung lesions disappeared .
subsequently , mexiletine was confirmed as the causative agent based on a positive patch test .
drug - induced hypersensitivity syndrome is a severe adverse reaction to drugs and results from treatment with anticonvulsants , allopurinol , sulfonamides , and many other drugs .
several cases of mexiletine - induced hypersensitivity syndrome have been reported in older japanese males with manifestation of fever , rash , peripheral blood eosinophilia , liver dysfunction without other organ involvement . here
, we report a case of mexiletine - induced hypersensitivity syndrome which presented as eosinophilic pneumonia in a korean male . |
cutaneous manifestations of crohn s disease ( cd ) typically present as lesions that are contiguous with the gastrointestinal tract , such as peri - oral and peri - anal lesions [ 1 , 2 ] . vulval involvement , mostly due to distant spread of granulomata ( metastatic cd ) , is rare , especially in children [ 2 , 3 ] . here , a 10-year - old girl presented to the dermatology department at york hospital with a 12-month history of asymptomatic erythema and swelling of the vulva . the patient was a healthy - looking girl with normal height and weight for her age . peau dorange appearance , with a large skin tag in the anterior peri - anal area ( fig . 1 ) . examination of the oral mucosa , rectum , and the rest of the skin was unremarkable . the patient was treated with tacrolimus ointment 0.03% which resulted in good control of the disease . a year after the initial presentation 1vulval swelling noted in patient 1 vulval swelling noted in patient 1 a 13-year - old girl presented with a 9-month history of asymptomatic vulval swelling . the patient was diagnosed with cd at the age of 5 years and had been well - controlled on methotrexate . examination of the peri - anal skin showed fissures and skin tags ( fig . 2 ) . examination of the rest of the skin , oral mucosa , and other systems was unremarkable . biopsy of the affected vulval area showed typical features of non - caseating granulomata with negative stains and culture for organisms . the patient was treated with intralesional triamcinolone and oral metronidazole , which resulted in a clear improvement in terms of swelling after 3 months.fig . 2unilateral vulval swelling with erythema noted in patient 2 unilateral vulval swelling with erythema noted in patient 2 a 10-year - old girl presented to the dermatology department at york hospital with a 12-month history of asymptomatic erythema and swelling of the vulva . the patient was a healthy - looking girl with normal height and weight for her age . peau dorange appearance , with a large skin tag in the anterior peri - anal area ( fig . 1 ) . examination of the oral mucosa , rectum , and the rest of the skin was unremarkable . the patient was treated with tacrolimus ointment 0.03% which resulted in good control of the disease . a year after the initial presentation a 13-year - old girl presented with a 9-month history of asymptomatic vulval swelling . the patient was diagnosed with cd at the age of 5 years and had been well - controlled on methotrexate . examination of the peri - anal skin showed fissures and skin tags ( fig . 2 ) . examination of the rest of the skin , oral mucosa , and other systems was unremarkable . biopsy of the affected vulval area showed typical features of non - caseating granulomata with negative stains and culture for organisms . the patient was treated with intralesional triamcinolone and oral metronidazole , which resulted in a clear improvement in terms of swelling after 3 months.fig . 2unilateral vulval swelling with erythema noted in patient 2 unilateral vulval swelling with erythema noted in patient 2 metastatic cd in children is rare , and most present prior to the diagnosis of cd [ 1 , 2 ] . parks et al . there have only been 16 cases of vulval metastatic cd in children reported in the literature . vulval cd may present as the first and only manifestation of cd , as seen in patient 1 , or after development of the disease , even if well - controlled otherwise , as in patient 2 . the clinical presentation of vulval cd is variable and may simply manifest as diffuse edema with infiltration or ulceration . the absence of gastrointestinal symptoms often makes diagnosis difficult in children ; however , the presence of peri - anal fissures and skin tags should raise suspicion for vulval cd . the differential diagnoses for vulval swelling should include sarcoidosis , infections ( e.g. tuberculosis , cellulitis , lymphogranuloma venereum , actinomycosis , pyogenic infections , hidradenitis suppurativa , intertrigo , syphilitic lesions ) , foreign body reactions , contact dermatitis , acquired lymphangiectasia , vascular malformations , and sexual abuse [ 46 ] . biopsy of the lesion is often necessary to reach a definitive diagnosis , revealing the typical appearance of a non - caseating granulomatous inflammation as seen in cd . as there is little correlation between the activity and/or severity of skin lesions and bowel disease , treatment of the underlying cd may not be effective against cutaneous cd , as was seen in patient 2 . currently , metronidazole alone and/or topical / oral steroids seem to be the most effective treatment for metastatic cd . other beneficial therapies include dapsone , tetracycline , azathioprine , 6-mercaptopurine , sulphasalazine , and oral zinc supplementation . surgical procedures , such as vulvectomy , simple excision , curettage , and debridement , are reserved for resistant cases . tacrolimus ointment is currently licensed for use as a second - line agent in the management of atopic eczema . in children , the licensed strength is 0.03% ; however , it is increasingly used in other inflammatory conditions , including a pediatric vulval case of pemphigoid . in conclusion , vulval swelling can be the first or subsequent manifestation of cd and dermatologists should have a high index of suspicion to facilitate early diagnosis and control of the disease . | vulval involvement in crohn s disease ( cd ) is rare , particularly in children .
the clinical features include erythema , edema , ulceration , and labial skin tags .
the authors present two cases of children with vulval cd . in both cases ,
marked labial edema was the presenting feature .
in one patient the immunomodulator tacrolimus ointment 0.03% was used with success . in the second patient control
was achieved with intralesional triamcinolone in combination with systemic metronidazole . |
nosocomial infections , also called healthcare - associated infections are those infections acquired by a patients as a result of treatment in a hospital , clinic or healthcare service centre . these infections generally appear 48 hours or more after hospital admission or within 30 days after discharge . they occur because of instrumentation , increased use of antimicrobial agents , breaks in aseptic techniques and lack of hand hygiene . at any time , microorganisms often implicated in these infections include escherichia coli , pseudomonas aeruginosa , klebsiella species , staphylococcus aureus and mycobacterium tuberculosis . according to the american national nosocomial infections surveillance , more than 40% of nosocomial infections occurred in parts of asia , latin america , and sub - saharan africa . it usually ferments lactose on macconkey agar to produce pink colonies with surrounding areas of precipitated bile salts . e. coli strain will produce indole from tryptophan ; it does not produce hydrogen sulfide , urease , and can not use citrate as sole carbon source . in some hospitals , e. coli strains were found to be the highest and most frequent among the pathogenic microorganisms isolated from ten teaching hospitals in china . pathogenic strains of e. coli are responsible for three types of infections in humans ; urinary tracts infections , neonatal meningitis , and intestinal diseases . in many west african countries , nosocomial infections are abound but not much study has been done to determine the proportion of infections acquired by patients or health workers from hospital and or healthcare - providing facilities . hospitals serve a reservoir of various types of microorganisms ; some may be multiple resistant to antibiotics and the selective pressure of antimicrobial use in hospitals , therefore makes the environment a repository for these resistant strains . newman and his colleagues reported on the occurrence of nosocomial infections in korle - bu teaching hospital in accra , ghana . these studies are therefore necessary and need to be conducted in many other parts of the country in order to generate national data on these pathogenic organisms , more especially on their antibiotic resistant patterns in ghana . this study sought to determine the antibiotic resistance patterns of e. coli isolates from the premises of three hospitals in kumasi , ghana . the samples were collected from kumasi south , tafo and suntreso hospitals in kumasi , ghana . a total of 600 swabs samples of floors , benches , beds , door handles , and waste water from drainages were collected between january and june , 2010 . the swabs were put into sterile test tubes , closed tightly , and labeled appropriately . all the materials including culture media , reference antibiotics , and reagents were purchased from oxoid , basingstoke , united kingdom unless otherwise stated . the various samples collected were separately inoculated into 10 ml of nutrient broths and incubated at 37c for 24 hours . using a sterile platinum loop , each culture was separately streaked onto the surface of macconkey agar plates , labeled and incubated at 37c for 48 hours , and observed for signs of growth and colony appearance . colonies that appeared pink on the macconkey agar plates were removed with sterile inoculating wire and separately streaked onto the surface of eosin methylene blue agar plates . isolated black - colored colonies with metallic sheen were again fished out into nutrient broths and incubated at 37c for 24 hours . the various subcultures were streaked onto nutrient agar slants , incubated at 37c for 48 hours , and then kept in the refrigerator at 20c for further identification and antibiotic sensitivity studies . the e. coli isolates were screened through the various microscopic examination and biochemical reactions to confirm their identities . these included indole , oxidase , and arginine dehydrolase production , citrate utilization , nitrite reduction , fermentation of carbohydrates ( such as xylose , maltose , arabinose , glycerol , and starch ) , methyl red - voges proskauer test , and reaction triple sugar iron agar [ 11 , 12 ] . all the tests were performed on reference - typed culture of e. coli ( atcc 25922 ) . kirby - bauer disc diffusion method as recommended by the clinical and laboratory standards institute was used to determine the in vitro susceptibility of the identified e. coli isolates to gentamicin ( gm ) 10 g , ciprofloxacin ( cip ) 5 g , ceftriaxone ( cro ) 30 g , ampicillin ( amp ) 10 g , and cotrimoxazole ( sxt ) ( trimethoprim - sulphamethoxazole ) 25 g . a standardized suspension of the isolated e. coli was prepared by inoculating a colony into 10 ml peptone water and incubated at 37c for 24 hours . a sterile swab was dipped into the standardized inoculum and used to inoculate evenly the surface of already prepared mueller - hinton agar ( oxoid basingstoke , uk ) . the agar was left for 15 minutes for the surface moisture to dry . a multichannel disc dispenser ( oxoid , basingstoke , uk ) the method was replicated three times and the mean zones of inhibition compared with figures ( table 1 ) provided by the clinical and laboratories standards institute . a total of 150 ( lactose fermenter ) isolates recovered on macconkey agar ( oxoid , basingstoke , uk ) were suspected to be e. coli . e. coli isolates were identified from the various locations ( benches , floor , door handles and drainages , male , female , and pediatrics wards ) in the three hospitals ( figure 1 ) . a total of 97 isolates from the three hospitals were confirmed as e. coli . jarvis and martone reported that e. coli as the most common nosocomial pathogen in some hospitals in the united states . also , e. coli has been reported to be among the most frequent isolates in hospitals in ethiopia . among the three hospitals from which the samples or swabs were taken , e. coli isolates were widely distributed in various locations throughout the three hospitals for which samples were analyzed ( table 2 ) . about 90% of the e. coli isolates exhibited resistance to ampicillin while 6.2 and 3.1% , respectively , showed intermediate and sensitive . for cotrimoxazole ( trimethoprim - sulphamethoxazole ) , 78.4% of the isolates were resistant while 9.3 and 12.3% intermediate and sensitive responses . between 26.8 to 46.4% of the e. coli isolates also showed resistance to gentamicin , ciprofloxacin , and ceftriaxone , while 14.4 to 47.4% gave intermediate responses . ceftriaxone , ciprofloxacin , and gentamicin sensitive isolates were also in the range of 23.7 to 39.2% ( figure 2 ) . the majority of the gentamicin sensitive e. coli isolates ( 28.9% ) was isolated from the male wards followed by floor samples ( 21.1% ) as shown in table 3 . none of the drainage samples were resistant to gentamicin , while 20% each from the floor and female wards proved resistant . , 46 e. coli isolates exhibited intermediate response to ceftriaxone , 30% were from the male wards , 21.4% from floor and 2.2% from drainage samples . most of the e. coli resistant isolates ( 26.9% ) were from the benches and 19.2% from male wards while no resistant strains were recovered from door handles ( table 3 ) . ciprofloxacin - resistant e. coli isolates were recovered from floor samples ( 29% ) followed by the samples from pediatric wards ( 19.4% ) . e. coli isolates which exhibited intermediate response to ciprofloxacin ( 30% ) were in the samples / swabs from the male ward and none from door handles . majority of the e. coli sensitive isolates were from female wards ( 30.4% ) followed by male and pediatric wards samples ( 17.4% ) . the distributions of ampicillin resistant e. coli isolates were 22.7 , 20.5 , and 19.3% for male wards , floors , and benches , respectively ( table 3 ) . many of the isolates obtained were found to be resistant to more than two different classes of the reference antibiotics ( table 4 ) . majority of the e. coli isolates ( 53.6% ) were isolated from the hospital beddings while about 21% were from floor samples ( table 2 ) . most of the e. coli isolates ( 90 to 78% ) were resistant to ampicillin and cotrimoxazole , respectively ( figure 1 ) . the high occurrence of e. coli isolates in these samples could be attributed to poor hygienic conditions in these hospitals and the overcrowding in these hospitals due to inadequate number of health care facilities in the region . a total of 46.4 , 32.0 , and 26.8% of the e. coli isolates exhibited resistance to gentamicin , ciprofloxacin , and ceftriaxone , respectively , and these were similar to what was reported by yismaw and his colleagues . yismaw et al . also reported a similar resistance pattern of e. coli to gentamicin ( 47% ) , ciprofloxacin ( 33% ) , and ceftriaxone ( 26% ) . and these high levels of antibiotic resistance have been attributed to widespread abuse of these antibiotics . out of 97 e. coli isolates , 78 isolates or 80.4% exhibited multiple drug resistance to at least three different classes of the reference antibiotics used . these high numbers of resistant e. coli isolates in the hospitals are potential reservoirs of resistant genes which can easily be transferred to other pathogens . hence , there is a need to observe proper hygiene , use of effective disinfectants , and monitor the administration and prescription of antibiotics in hospitals . most of the e. coli isolates ( 80.4% ) exhibited multiple drug resistance and measures such as observation of proper personal hygiene by health staff and patients , use of effective disinfectants in reducing the possible pathogenic organisms in these hospitals , and so forth . these findings have therefore showed the need for the hospital management to be concerned about the potential of hospitalized patients becoming infected with some nosocomial infections , especially resistant strains of e. coli . | nosocomial infections are infections acquired by a patient as a result of treatment in a hospital or healthcare service providing center and symptoms occurs within a short period of hospitalization .
the study was to determine the antibiotic resistance patterns of escherichia coli isolated from kumasi - south , tafo and suntreso hospitals , kumasi , ghana .
total of 600 swabs samples from the hospitals were collected between january and june , 2010 .
the isolates were identified using morphological and biochemical means .
a total of 97 e. coli isolates were obtained from the hospitals .
beds in hospital wards had the highest number of e. coli strains ( 53.6% ) , followed by floors ( 20.6% ) while drainages had the least isolates ( 3.1% ) . majority of the e. coli isolates ( 90.7% ) exhibited resistance to ampicillin while 6.2 and 3.1% showed intermediate and sensitive respectively .
co - trimoxazole , 78.4% of the isolates were resistant while 9.3 and 12.4% exhibited intermediate and sensitive responses respectively .
e. coli isolates ( 28.6 to 46.4% ) were resistant to gentamicin , ciprofloxacin and ceftriaxone while 14.4 to 47.4% gave intermediate responses .
most isolates ( 80.4% ) exhibited multi - drug resistance .
there is a need to observe proper personal hygiene , use of effective disinfectants and proper disposal of contaminated / pathogenic materials in these hospitals to control nosocomial infections . |
the abo blood group , which was discovered at the beginning of the 20 century by karl landsteiner remains the most important blood group clinically ( 13 ) . in 1924 , this blood group was classified into four antigens ( a , b , o and ab ) and six genotypes ( aa , ao , bb , bo , oo and ab ) . it is one of the conventional blood group polymorphisms , which are important for genetic markers in linkage analysis , blood transfusion , personal identification and disease detection ( 4,5 ) . a range of techniques have been used for abo genotyping , including polymerase chain reaction ( pcr)-restriction fragment length polymorphism , pcr - single - strand conformation polymorphism , allele - specific - pcr , pcr - amplified product length polymorphism , reverse transcription - quantitative ( rt - q)pcr and dna chip ( 3,68 ) . these methods are , however , time - consuming and disadvantageous due to the requirement for labor - intensive post - amplification procedures , including restriction electrophoresis and enzyme cleavage , or the use of radioactive - labeled dna probes . therefore , a simpler , quicker and more informative method for the genotyping of the abo alleles is required . the present study aimed to improve the abo genotyping method , based on lamp , which directly uses a one - step isothermal reaction to determine the above - mentioned six genotypes . the developed technique was a powerful innovative gene amplification approach as a simple rapid tool for clinical detection and identification . peripheral blood samples were collected from 101 unrelated chinese volunteers into edta - coated tubes at the shaanxi provincial people 's hospital ( xi'an , china ) with informed consent . the study was approved by the ethics committee of the college of life sciences , northwest university ( xi'an , china ) . the abo phenotypes of all blood samples were identified by serological methods , based on the abo blood group antigens present on red blood cells and igm antibodies present in the serum . the genomic dna from the volunteers was isolated from 1 ml blood using a whole blood genomic dna isolation kit ( xi'an goldmag nanobiotech co. , ltd . two single nucleotide polymorphisms ( snps ) at nucleotides 261 and 803 , located on exons 6 and 7 of the abo gene , which cover the most polymorphic sites of the complete abo sequences , as shown in fig . 1 ( 9 ) , were selected . the primer set for lamp amplification includes a set of four primers , comprising two outer and two internal primers , which recognize six distinct regions on the target sequence , designated in fig . all oligonucleotide primers were synthesized by beijing genomics institute ( bgi ; beijing , china ) . each analysis was performed by subjecting samples of prepared blood from each individual to four lamp amplifications . two reactions used the o or b primer set and the other reactions used the non - o or non - b primer set . the amplification was performed in a final volume of 25 l , containing 0.8 m forward inner primer and backward inner primer , 0.2 m f3 and b3 primers , 15 l isothermal master mix ( imm ; optigene , horsham , uk ) and 50 ng genomic dna . the reaction conditions were optimized to ensure that the amplifications were highly specific , including assessment of primer concentration , preparation blood concentration and reaction temperature . the lamp assays were performed in 8-well strips by incubation at 62c for 40 min . simultaneously , the fluorescence intensity of the florescent dye , contained in the imm , was monitored using a genie ii system ( optigene ) . for the samples to be sequenced , a 200 bp fragment for exon 6 and a 740 bp fragment for exon 7 were amplified using the following two primer pairs synthesized by bgi : exon 6 , forward : 5-tccatgtgaccgcacgcctc-3 and reverse : 5-gggtctctaccctcggccacc-3 ; exon 7 , forward : 5-ccgtgtccactactatgtcttcacc-3 and reverse : 5-acaacaggacggacaaaggaaacag-3. the pcr products were sequenced by the bgi . peripheral blood samples were collected from 101 unrelated chinese volunteers into edta - coated tubes at the shaanxi provincial people 's hospital ( xi'an , china ) with informed consent . the study was approved by the ethics committee of the college of life sciences , northwest university ( xi'an , china ) . the abo phenotypes of all blood samples were identified by serological methods , based on the abo blood group antigens present on red blood cells and igm antibodies present in the serum . the genomic dna from the volunteers was isolated from 1 ml blood using a whole blood genomic dna isolation kit ( xi'an goldmag nanobiotech co. , ltd . two single nucleotide polymorphisms ( snps ) at nucleotides 261 and 803 , located on exons 6 and 7 of the abo gene , which cover the most polymorphic sites of the complete abo sequences , as shown in fig . the primer set for lamp amplification includes a set of four primers , comprising two outer and two internal primers , which recognize six distinct regions on the target sequence , designated in fig . 1 . table i lists the sequences of the typing primers used for the lamp reaction . all oligonucleotide primers were synthesized by beijing genomics institute ( bgi ; beijing , china ) . each analysis was performed by subjecting samples of prepared blood from each individual to four lamp amplifications . two reactions used the o or b primer set and the other reactions used the non - o or non - b primer set . the amplification was performed in a final volume of 25 l , containing 0.8 m forward inner primer and backward inner primer , 0.2 m f3 and b3 primers , 15 l isothermal master mix ( imm ; optigene , horsham , uk ) and 50 ng genomic dna . the reaction conditions were optimized to ensure that the amplifications were highly specific , including assessment of primer concentration , preparation blood concentration and reaction temperature . the lamp assays were performed in 8-well strips by incubation at 62c for 40 min . simultaneously , the fluorescence intensity of the florescent dye , contained in the imm , was monitored using a genie ii system ( optigene ) . for the samples to be sequenced , a 200 bp fragment for exon 6 and a 740 bp fragment for exon 7 were amplified using the following two primer pairs synthesized by bgi : exon 6 , forward : 5-tccatgtgaccgcacgcctc-3 and reverse : 5-gggtctctaccctcggccacc-3 ; exon 7 , forward : 5-ccgtgtccactactatgtcttcacc-3 and reverse : 5-acaacaggacggacaaaggaaacag-3. the pcr products were sequenced by the bgi . using this method , base substitutions at two snp sites in the abo gene ( nucleotides 261 and 803 ) were detected simultaneously by four primers , setting the extension reaction to distinguish the six genotypes ( aa , ao , bb , bo , oo and ab ) . in the case of haplotypes , a positive allele - specific reaction excluded the corresponding positive non - allele - specific reaction and vice versa . allele b was distinguished from the non - b primer at nucleotide 803 and allele o was distinguished from the non - o at nucleotide 261 . a summary of all possible patterns are indicated in table ii and representative data are shown in fig 2 . the observed allele frequencies were : 28.71 , 30.20 and 41.09% , for a , b and o , respectively ( calculated from : a : ( aa+ao/2+ab/2)/101 ; b:(bb+bo/2+ab/2)/101 ; o : ( ao/2+bo/2+oo)/101 ) , from which phenotype frequencies were calculated to be 43.56 , 40.59 , 7.92 and 7.92% for a , b , ab and o , respectively ( calculated from : phenotypes/101 ) . the results were compared with the phenotypes determined by serological assay and the genotypes determined by direct sequencing , and no discrepancies were observed . the abo blood group system was the first blood group system to be identified and has been used extensively as a marker in population studies , epidemiology , and forensic investigation ( 10 ) . the abo blood group is fundamental for transfusion medicine , as accurate testing of the blood donor and recipient is essential for the prevention of hemolytic transfusion reactions and hemolytic disease of the newborn ( 11,12 ) . the abo blood group is also critical for assessing the risk of developing certain malignancies ( 13,14 ) and cardiovascular disorders ( 5,15 ) . to date , several methods have been reported for abo genotyping , which rely predominantly on differentiating a , b and o at specific base substitutions . however , technical errors and several clinical conditions or diseases can lead to discrepancies between erythrocytes and sera , resulting in an incorrect genotype being determined ( 3,1618 ) . an emerging novel approach , lamp , is gaining attention as a result of its practicality , speed and usefulness in laboratories and clinical settings ( 1921 ) . lamp is a simple , rapid and accurate gene amplification technique , using a set of four specially designed primers to span six distinct regions on the target gene . the amplification procedure is simple and rapid , wherein the whole procedure can be completed in a single step by incubating all reagents ( samples , primers , dna polymerase with strand displacement activity and substrates ) in a single tube under isothermal conditions , which can be completed in < 1 h , with the dna being amplified 1010 times ( 22 ) . the primary characteristic of lamp is its advantage of reaction simplicity and higher amplification efficiency . in the present study , the dna amplification procedure was < 40 min at a constant temperature of 62c , which allowed no time loss for thermal change . the dna polymerase provides high amplification efficiency as a result of its high specificity and the presence of the target gene sequence is easily detected by judging the presence of amplified products . in addition , no denaturation of double stranded dna into a single stranded dna is required . in addition , the more sensitive signal detector instrument , genie ii , assists in the rapid processing of the data . it takes ~20 min to reach the peak , followed by another 20 min to complete the entire reaction , which is relatively quicker compared with normal pcr - based assays . it has been previously reported that the detection limit of the lamp assay was 10 times lower compared with rt - qpcr and 10 times lower compared with conventional pcr ( 22,23 ) . however , lamp systems with high sensitivity may lead to false positive results . in the present study , the blood samples from 101 chinese individuals were successfully genotyped using peripheral blood dna and no false positive reaction was observed , according to the direct sequencing . with the use of four primers designed to recognize six distinct regions , only the target snp is strictly and specifically amplified , even in coexistence with its homologous gene . these results demonstrated that the four primer sets designed were extremely specific to the two snp sites in the abo gene . also , the application of imm , including florescent dye , reduced the risk of cross contamination due to the reduction of lid opening . in conclusion , the lamp assay developed in the present study has great potential for rapid abo genotyping , which can be applied in laboratories and clinical settings . it is also envisioned that several other known snps may also be detected by this method with corresponding primer sets . considering the advantages of rapid amplification , easy detection and simple operation , lamp may offer more applications for point - of - care testing . | abo genotyping is commonly used in several situations , including blood transfusion , personal identification and disease detection .
the present study developed a novel method for abo genotyping , using loop - mediated isothermal amplification ( lamp ) .
this method allows the simultaneous determination of six abo genotypes under 40 min at a constant temperature of 62c .
the genotypes of 101 blood samples were determined to be aa ( n=6 ) , ao ( n=38 ) , bb ( n=12 ) , bo ( n = 29 ) , ab ( n=8 ) and oo ( n=8 ) by the lamp assay .
the results were compared with the phenotypes determined by serological assay and the genotypes determined by direct sequencing , and no discrepancies were observed .
this novel and rapid method , with good accuracy and reasonably cost effective , provides a supplement to routine serological abo typing and may also be useful in other point - of - care testing . |
previous reports describe patients chewing on patches , applying more than the number of prescribed patches to the skin , and applying a patch to an area with a skin abrasion all of which can lead to fentanyl toxicity . continued vigilance among healthcare providers to detect misuse of this transdermal medication is of paramount importance to prevent untoward adverse events including death . herein , we describe a fentanyl patch complication , which meets our institutional review board standards for minimal risk reporting in a de - identified manner , as provided below , and which , to our knowledge , has not been previously reported . a 60-year - old man presented to our clinic for a follow - up visit , at which time he appeared despondent . two years prior , he had been struck by a motor vehicle and fractured his first lumbar vertebra . this fracture was treated with an l1 corpectomy and an instrumented fusion from t12 to l2 . this complication coupled with the diagnosis of cancer , as outlined below , resulted in the patient being treated almost ever since with transdermal fentanyl for a chronic pain syndrome . a few months earlier , a hematologic evaluation for leukocytosis had led to the diagnosis of systemic mastocytosis with an associated clonal hematologic non - mast cell lineage disease , chronic myelomonocytic leukemia type 1 ( cmml-1 ) . the steroids were tapered slowly over months , and the patient started azacytidine in place of hydroxycarbamide to treat his cmml-1 . however , during this evaluation process and treatment for mastocytosis and cmml-1 , the patient remained on a fentanyl patch ( 100-g / h patch every 72 h ) . he had no history of a psychiatric disorder , but he had experimented with psychotropic substances in his youth and had a flat affect at baseline . when the patient presented for his second cycle of azacytidine , he appeared despondent and described shortness of breath . an accompanying friend reported that the patient had been less communicative over the preceding 4 days and had complained of shortness of breath . the patient 's heart rate was 96 beats / min , blood pressure 116/77 mm hg , spo2 94% , temperature 37.0c , and respiratory rate 16 breaths / min . the circumference of the left leg was 5 cm greater than that of his right leg , and his lungs were clear to auscultation . the results of this presentation raised concerns about a pulmonary embolus , and the patient was thought to be at high risk ( well 's score of 7 due to clinical signs of deep venous thrombosis , likely diagnosis of pulmonary embolism , and active malignancy ) . he was not treated immediately with anticoagulation due to his thrombocytopenia ( 36 10/l ) and renal insufficiency ( creatinine 2.3 mg / dl ) . a lower - extremity doppler ultrasound did not reveal occlusive thrombus and chest radiography was unremarkable . computerized tomography ( ct ) of the chest with contrast was not pursued due to renal insufficiency . however , because of declining sensorium concurrent with a dropping blood pressure of 89/45 mm hg , a ct of his head was obtained . this imaging revealed an 8-mm left frontal and parietal subacute on chronic subdural hematoma without mass effect ; this finding remained stable on subsequent scans . the patient 's worsening mental status and other symptomatology in the setting of an unclear diagnosis prompted hospitalization . shortly thereafter , the patient experienced a brief tonic seizure that resolved spontaneously followed by a second more prolonged tonic seizure that involved right gaze deviation and tonic posturing of both arms . direct laryngoscopy revealed a transparent , folded , plastic - appearing item superior to the glottis . full bronchoscopy was performed to ensure that no other foreign objects had been aspirated , and none were found . the patient had no explanation for the discovery of a fentanyl patch in his larynx , but he denied any intention to harm himself . to date , it remains unclear exactly how the patch came to be positioned in this patient 's larynx . the patient was discharged from the hospital with follow - up plans for the treatment of his hematologic conditions . this case represents an unusual and unexpected complication related to the ongoing use of a fentanyl patch . this patient apparently attempted to ingest a fentanyl patch , which became lodged within his larynx . heat can increase the absorption of fentanyl , and , perhaps , the higher laryngeal body temperature resulted in increased transmucosal absorption of the medication , hence the manifestations of overdose , despite the patient 's long - standing use of this medication . this case provides further confirmation of the need for sustained , heightened vigilance for drug adherence with transdermal fentanyl . in a systematic review of the complications of opioid medications , fentanyl was the opioid most commonly implicated in such untoward events . the most frequent cases of misuse included drug - drug interactions which potentiated narcotic effects or resulted in serotonin syndrome . other problems with fentanyl relate to the acceleration of its transdermal absorption or experimentation with alternate routes of administration . although external heat sources have been used to maximize the euphoric effects of fentanyl , other patients have suffered unintentional overdoses from hyperthermia , sun tanning , and warming blankets . patients have been reported to lick and chew or rectally insert transdermal fentanyl patches , and inject or inhale volatilized extracts from the patches . inappropriate use of transdermal fentanyl patches may be more common than currently recognized and should be considered in fentanyl - treated patients who present with signs of narcotic toxicity . the patient in this report had a near fatal event after asphyxiation with a fentanyl patch . this case represents the first report , to our knowledge , of asphyxiation with transdermal fentanyl and highlights the need for an awareness for complications with the use of narcotics , particularly of transdermal fentanyl and particularly under circumstances in which the prescribed patch is absent from the skin . | narcotics are frequently prescribed to alleviate pain in patients with serious medical illnesses such as cancer . because of their nonoral route of administration ,
fentanyl patches are now being frequently prescribed .
however , the widespread use of fentanyl patches has been associated with medication errors and misuse [ butts and jatoi : j opioid manag 2011;7:3545 ] .
the transdermal delivery of fentanyl may lead to unusual , unanticipated complications .
herein , we describe a fentanyl patch complication , which , to our knowledge , has not been previously reported . |
however , hyperinsulinism , hypopituitarism , or hereditary hepatic enzyme deficiencies are considered in patients with persistent or refractory hypoglycemia ( 1 ) . insulinoma is the most common cause of hyperinsulinemic hypoglycemia ( 1 - 4/million patients ) and the second most common ( 10%-30% ) functioning pancreatic islet cell tumor associated with multiple endocrine neoplasia type 1 ( men1 ) ( 2,3 ) after gastrinoma . in contrast , only 4%-6% of patients with insulinoma will develop men1 ( 4 - 6 ) . unlike sporadic insulinomas that usually develop after the age of 40 , men - associated insulinomas usually occur before 40 years of age and even sometimes before 20 ( 7,8 ) . nevertheless , there are rare cases of insulinoma presenting as the first sign of men1 in the pediatric population . men is characterized by the occurrence of a tumor involving two or more endocrine glands within a single patient and has an equal sex distribution ( 9,10 ) . it encompasses tumors of the parathyroids ( 95% of cases ) , pancreatic islets ( 30%-80% ) , and anterior pituitary ( 15%-90% ) . we report a girl with a newly diagnosed men1 who presented with hypoglycemia as initial presentation . in may 2013 , a 9-year - old female presented with an episode of sudden loss of balance at home and some tremor . she had experienced occasional seizure like movements early in the morning for the past 3 months . the patient therefore ate more than usual and gained 10 kg within the previous year . she was not taking any prescription medications at the time of her evaluation . on the day of the hospital visit , she had experienced generalized tonic - clonic seizure that lasted for 5 minutes early in the morning . she weighed 41 kg with body mass index ( bmi ) of 22.5 kg / m . laboratory evaluation showed elevated insulin of 142.7 uiu / ml and elevated c - peptide at 5.88 ng / ml . her serum pth level was 15 pg / ml ( normal range , 1162 pg / ml ) , serum igf-1 was 298 ( normal range , 78517 ng / ml ) , serum prolactin level was 7.5 ng / ml ( normal range , 2.7 - 19.7 ng / ml ) and serum calcium level was 9.3 mg / dl ( normal range , 8.8 - 10.8 mg / dl ) . we then began to check for diseases that could cause hyperinsulinemic hypoglycemia and conducted an image work - up to rule out insulinoma . magnetic resonance study of the pancreas revealed a 1.3 1.5 cm nodule with high signal intensity on t2 weighted images , which appeared as a well circumscribed mass at the head of the pancreas and with hyposignal intensity on t1 weighted images ( fig . 1 ) . we suspected insulinoma and performed hepatic venous sampling , collecting 8 samples at the splenic vein , the superior mesenteric vein , and the portal vein . the insulin levels for the 8 samples were 127.1 , 126.7 , 115.2 , 118.4 , 251.6 , 129.8 , 458.6 , and 199.4 uiu / ml , with the highest levels in the portal vein . ( a ) a mass with hyposignal intensity on t1 weighted images , 1.3 1.5 cm . ( b ) high signal intensity on t2 weighted images at the head of the pancreas . histopathological evaluation of the pancreatic mass was consistent with insulinoma , specifically , a well differentiated pancreatic insulinoma with a grandular growth pattern and a fibrous stroma . immediately after removal of the mass , the patient s glucose level increased to 152 mg / dl . post - operative glucose levels were consistently over 100 mg / dl and she experienced no further hypoglycemic episodes . the patient was discharged in good health with proper glucose level . four months after the patient s hospital visit , her father had a health checkup due to occasional hypoglycemia and was diagnosed with pancreatic tumor , parathyroid tumor and prolactinoma . based on his daughter s history and the presence of three different tumors , he was suspected of men . dna sequencing analyses revealed that not only did the father have a mutation in the men1 gene , the patient and patient 's younger sister also had the same mutation ( fig . 2 ) . however , the younger sister had no symptoms or signs of men1 . we have monitored the patient with regular follow - ups at the out - patient department for a year and have not detected any abnormal signs or symptoms . ( c.1121_1126delacctgcinsgggga ) was found in the patient , patient 's father and younger sister . all procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional review board . the institutional review board of the ajou university hospital reviewed and approved the present genetic study ( ajirb - med - exp-15 - 109 ) . all procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional review board . the institutional review board of the ajou university hospital reviewed and approved the present genetic study ( ajirb - med - exp-15 - 109 ) . most cases of men1 are the familial form , which is inherited as an autosomal - dominant disorder . the sporadic form develops in 8%14% of patients with men1 and molecular genetic studies have confirmed the occurrence of de novo mutations of the men1 gene about 10% of patients with men1 ( 11,12 ) . a diagnosis of men1 may be established in an individual that fulfills one of three criteria . men1 may be clinically diagnosed in an individual based on the occurrence of two or more men1-associated endocrine tumors ( 4,13 ) . a diagnosis of familial men1 can be established in individuals with one of the men1-associated tumors who are first degree relatives of patients with a clinical diagnosis of men1 . finally , a genetic diagnosis of men1 is made upon identification of a germline men1 mutation in an individual who may be asymptomatic and has not yet developed any of the serum biochemical or radiological abnormalities indicative of tumor development ( 13 ) . in our case , genetic study of men1 was not performed because insulinoma was the only manifestation and there was no familial history at the first evaluation . however , her father s diagnosis led to additional dna sequencing analysis , resulting in the diagnosis of men1 in the patient . an electronic search of the pubmed database was conducted using the keywords insulinoma and men1 . the search was limited to children and all abstracts were screened for insulinoma with men1 , revealing only four pediatric cases . the minimum age of onset was 8 for men1 insulinoma ( age range 8 - 14 years ) ( 14 ) . our case was consistent with previous cases of pediatric men1 , in which patients diagnosed with hyperinsulinism - related hypoglycemia presented with loss of consciousness , seizure or syncope ( 14 - 17 ) and were treated with surgery . in the previously reported case , one patient died due to multiple metastases . metastases occur in up to 50% of patients with men1-associated insulinomas , compared to 10% of non - men1 insulinomas , in all age groups ( 3,18 ) . the international guideline of management and therapy in men1 mutations recommends a biochemical evaluation of prolactin serum concentration from age 5 , a biochemical screen of fasting total serum calcium concentration ( corrected for albumin ) from age 8 , a biochemical screen of fasting serum gastrin concentration from age 20 , magnetic resonance imaging ( mri ) of the head every 35 years from age 5 and abdominal ct or mri every 35 years from age 20 in children diagnosed with men1 mutation ( 9 ) . a biochemical screening for the fasting serum concentration of full - length pth , yearly chest ct , yearly somatostatin receptor scintigraphy and yearly octreotide scans are also recommended . in conclusion , this case reports men1 mutation in a 9-year - old girl that showed insulinoma as the first manifestation . early clinical and genetic identification of affected individuals is helpful for monitoring them and also for genetic counseling even if the patient shows only one manifestation that is not insulinoma . | multiple endocrine neoplasia ( men ) mutation is an autosomal dominant disorder characterized by the occurrence of parathyroid , pancreatic islet , and anterior pituitary tumors .
the incidence of insulinoma in men is relatively uncommon , and there have been a few cases of men manifested with insulinoma as the first symptom in children .
we experienced a 9-year - old girl having a familial men1 mutation .
she complained of dizziness , occasional palpitation , weakness , hunger , sweating , and generalized tonic - clonic seizure that lasted for 5 minutes early in the morning . at first
, she was only diagnosed with insulinoma by abdominal magnetic resonance images of a 1.3 x 1.5 cm mass in the pancreas and high insulin levels in blood of the hepatic vein , but after her father was diagnosed with men1 .
we found she had familial men1 mutation , and she recovered hyperinsulinemic hypoglycemia after enucleation of the mass .
therefore , the early genetic identification of men1 mutation is considerable for children with at least one manifestation . |
small cell carcinoma ( scc ) is relatively common and accounts for about 20% of lung cancer . chemotherapy , not resection or radiation , is the sole therapy for scc of the lung , indicating a poor prognosis . although the majority of scc are located in lungs , the minority ( 2.54.1% ) has been reported to be from extrapulmonary organs , including esophagus , thymus , stomach , pancreas , and cervix . the occurrence of epscc in other organs is considered to be rare [ 13 ] . chemotherapy is the sole treatment for epscc and the regimens usually are similar to those for lung scc . they include the combination of either etoposide and cisplatinum , or camptothecin and cisplatinum [ 4 , 5 ] . primary liver cancers in japan comprise 94.5% hepatocellular carcinoma ( hcc ) and 3.6% cholangiocellular carcinoma . while no case of epscc originating from the liver has been reported from japan , only ten cases of primary scc of the liver have been reported worldwide [ 711 ] . here , we report a case of primary scc of the liver that was treated with carboplatin and etoposide . a 77-year - old man was admitted to the department of hepatology , osaka city university hospital , with a 3-month history of general fatigue , breathlessness , and a high serum lactate dehydrase level . abdominal magnetic resonance imaging ( mri ) indicated a hepatic mass of 10 cm in diameter in the right lobe of the liver ( fig . 1a ) that also showed invasion of the right diaphragm in gallium scintigraphy ( fig . iu / l ) , alanine aminotransferase ( 390 u / l ) , and lactate dehydrase ( 6,480 iu / l ) , neuron - specific enolase ( nse ) increased to 389 u / ml ( normal range , 010 u / ml ) . alpha - fetoprotein increased slightly to 27 ng / dl ( normal range 020 ng / ml ) . hepatitis b surface antigen ( hbsag ) and antibodies to hepatitis c virus ( anti - hcv ) were negative . nine years earlier , the patient was diagnosed with prostate cancer and was treated with radiation therapy and chemotherapy . he was a nonsmoker and not obese ( body mass index , 25.0 kg / m).fig . ( a ) mri indicates a 10-cm - sized liver mass with extrahepatic growth in s5/8 . ( b ) gallium scintigraphy shows the huge mass in the liver ( arrows ) and its invasion of the right diaphragm ( arrowheads ) . ( c ) in fdg - pet , accumulated absorption is observed in the liver mass , abdominal lymph nodes ( arrow ) , and the invading tumor in the right diaphragm ( arrowheads)table 1the results of laboratory testswbc3,100/lbun15 mg / dlhbsag()rbc399 10/lcre0.77 mg / dlanti - hcv()hb12.1 g / dlua7.2 mg / dlcea1.8 ng / mlhct35.5%na136 meq / lca 19933 u / mlplt17.6 10/lk3.9 meq / lafp27 ng / mlast64 iu / lcl94 meq / lpivka - ii16 mau / mlalt390 iu / lfbs89 mg / dlnse389 u / mlalp390 iu / lt - cho174 mg / dlpsa0.418 ng / ml-gtp447 iu / ltg117 mg / dlld6,480 iu / llap159 iu / lcrp2.00 mg / dlldh-125.2%che225 iu / lpt98%ldh-239.0%t - bil0.8 mg / dlaptt31.2 sldh-324.0%tp6.8 g / dlhpt75%ldh-48.8%alb3.8 g / dlldh-53.0% image analyses of the liver tumor . ( a ) mri indicates a 10-cm - sized liver mass with extrahepatic growth in s5/8 . ( b ) gallium scintigraphy shows the huge mass in the liver ( arrows ) and its invasion of the right diaphragm ( arrowheads ) . ( c ) in fdg - pet , accumulated absorption is observed in the liver mass , abdominal lymph nodes ( arrow ) , and the invading tumor in the right diaphragm ( arrowheads ) the results of laboratory tests we performed a target needle biopsy of this liver tumor . the microscopic view of the biopsy specimen stained with hematoxylin and eosin indicated a pathologically small , round cell carcinoma ( fig . 2 ) . immunohistochemical staining revealed that cytokeratin ( multi ) ( ae1/ae3 ) and cytokeratin cam5.2 , which represents cytokeratin 18/10/14/15/16/19 , were positive . however , ki-1 , nse , desmin , and vimentin were negative ( fig . 3 ) . microscopic findings of the tumor reveal the accumulation of small round cells that are similar to scc of the lung and the presence of cell necrosis ( * ) . the tumor cells show oval to fusiform hyperchromatic nuclei and indistinct nucleoli with frequent mitoses ( arrows ) . the tumor cells are positive for ae1/ae3 ( a ) and cam5.2 ( b ) , but are negative for ki-1 ( c ) , desmin ( d ) , nse ( e ) , and vimentin ( f ) . nse is a marker of neuroendocrine origin hematoxylin and eosin staining of the needle biopsy specimen . microscopic findings of the tumor reveal the accumulation of small round cells that are similar to scc of the lung and the presence of cell necrosis ( * ) . the tumor cells show oval to fusiform hyperchromatic nuclei and indistinct nucleoli with frequent mitoses ( arrows ) . the tumor cells are positive for ae1/ae3 ( a ) and cam5.2 ( b ) , but are negative for ki-1 ( c ) , desmin ( d ) , nse ( e ) , and vimentin ( f ) . nse is a marker of neuroendocrine origin chest radiographic examination , chest computed tomographic scan , endoscopy of both the stomach and the colon , and fluorodeoxyglucose positron emission tomography ( fdg - pet ) were performed to exclude the possibility of metastatic tumor from the lung or other extrahepatic organs . accumulated absorption of fluorodeoxyglucose was observed in abdominal lymph nodes , as well as in the liver tumors , by the fdg - pet . however , no malignant lesions were detected elsewhere in the body ( fig . we started platinum - based chemotherapy with carboplatin auc 5 on the first day and etoposide ( vp-16 ) 120 mg / m on days 13 per month . we followed up and assessed the effect of the chemotherapy by mri and fdg - pet . the assessment was carried out using the criteria of world health organization and was indicated as a stable disease . during the therapy , we used granulocyte colony - stimulating factor ( 150 g / day ) for a total of 6 days against the major adverse effects of neutropenia ( grade 4 , national cancer institute next , we treated the patient with the second - line chemotherapy regimen using 40 mg of cisplatinum on days 13/month instead of carboplatin . unfortunately , assessment showed progression of the disease . the performance status ( ps ) became ps3 using the criteria of the eastern cooperative oncology group after the second - line therapy and we selected a best supportive care approach according to the patient s wishes . epscc is a very rare malignant tumor and accounts for about 5% of all scc . duguid and kennedy first described two cases of mediastinal oat cell tumor in 1930 . since then , epscc has been recognized increasingly as a distinct clinical entity and has been reported in several organs other than the lung over the past 30 years . primary locations include the head , neck , salivary glands , thyroid , larynx , trachea , thymus , pleura , esophagus , stomach , intestines , rectum , pancreas , gall bladder , cervix , uterus , breast , prostate , urinary bladder , and skin [ 13 ] . in general , the clinical course of epscc is progressive in nature and the tumor often recurs after treatment . kim et al . analyzed 34 cases , and the median survival of epscc in their study was 14 months . in their study , the overall survival of the patients with limited disease was more favorable than those of with extensive disease . more than 50% of patients with limited disease were operated upon or received radiotherapy in combination with chemotherapy for local control , it resulting in differing survival between limited disease and extensive disease . primary scc of the liver is very rare and only ten cases have been described in the literature until now ( table 2 ) . in the three cases reported by zanconati et al . the clinical progression was rapid and death ensued between 1 and 5 months after diagnosis . , one patient who received chemotherapy survived for 13 months and the other survived for 67 months after hemihepatectomy . in a case reported by kim et al . , in which segmentectomy of the liver and adjuvant chemotherapy were performed , the patient survived with no signs of recurrence for at least 4 months . in another two reported cases , the patients received continued treatment with combined chemotherapy and survived [ 10 , 11 ] . the aforementioned cases of primary scc of the liver , in which radical operation or combined chemotherapy was performed , had a good prognosis.table 2patients with primary scc of the liverauthoragesexstage of diseasesize ( cm)positive immunohistochemical stainingnegative immunohistochemical stainingtreatmentstatus / survival ( months)ryu et al.55mextensive8cd56 , c - kit , ( ) synttf-1chemotherapyalivekim et al.53mextensive12cd56 , nse , c - kit , syn , mixed ck , emack7 , 8 , 19 , 20 , afp , cea , hepatocyte , vimentin , desmin , ttf-1segmentectomy , adjuvant chemotherapy ( cisplatin , etoposide)alivezanconati et al.56mlimited5ae1/ae3 , ck8 , 18 , 19 , nse , afps-100 protein , ceanodead/1zanconati et al.69mextensive10ae1/ae3 , ck8 , 18 , 19 , ( ) nse , chrs-100 protein , ceanodead/1zanconati et al.89mextensive6ae1/ae3 , ck8 , 18 , 19 , afp , nsechr , s-100 protein , ceanodead/1kim et al.67m12syn , cd56 , c - kitck , cea , afpchemotherapy ( cisplatin , epirubicin)alivesengoz et al.73fright hemihepatectomydead/67sengoz et al.66mchemotherapy ( cisplatin)dead/13kim et al.chr , synchoi et al.82fextensive6.7cd56 , nse , syn , chr , ttf-1 , c - kitantihepatocyte , afp , vimetin , desmin , ck7 , 19 , 20 , cea , s-100 proteinsegmentectomy , chemotherapy ( etoposide)alivethis case77mextensive10ae1/ae5 , cam5.2nse , desmin , vimentinchemotherapy ( cisplatin , etoposide)dead/3afp , alpha - fetoprotein ; cea , carcinoembryonic antigen ; chr , chromogranin ; ck , cytokeratin ; ema , epithelial membrane antigen ; nse , neuron - specific enolase ; syn , synaptophysin ; ttf-1 , thyroid transcription factor 1 patients with primary scc of the liver afp , alpha - fetoprotein ; cea , carcinoembryonic antigen ; chr , chromogranin ; ck , cytokeratin ; ema , epithelial membrane antigen ; nse , neuron - specific enolase ; syn , synaptophysin ; ttf-1 , thyroid transcription factor 1 the regimens of chemotherapy were similar between lung scc and epscc and consisted of platinum - based combination therapy . in our case , the tumor was diagnosed as an extensive disease because it had invaded the right diaphragm and metastasis to the abdominal lymph nodes was also identified . furthermore , on mri and fdg - pet , it showed no response to the cisplatin - based chemotherapy , although the serum level of nse decreased from 389 u / ml to 37 u / ml after the first chemotherapy session . scc of the liver was found to express c - kit , a stem cell marker of the liver , in choi s report . recently , it has been considered that epscc may arise from a multipotential stem cell that is capable of differentiating into scc . our and zanconati s cases were positive for ae1/ae3 , being compatible with a carcinoma derived from biliary epithelium , rather than of neuroendocrine origin . | primary small cell carcinoma ( ssc ) of the liver is very rare in japan and only ten cases have been reported worldwide .
we report herein the case of a 77-year - old man with primary scc of the liver .
he had a tumor over 10 cm in diameter which was localized in the right lobe of the liver and had invaded the right diaphragm . in laboratory tests , high serum levels of lactate dehydrase and neuron - specific enolase were observed .
a biopsy specimen showed that the tumor cells were similar in cytology to a pulmonary scc .
the patient was first treated with carboplatin and etoposide according to the therapy protocol for pulmonary scc and then with a regimen using etoposid and cisplatinum , resulting in an unfavorable outcome .
we discuss the clinical course and therapy of extra - pulmonary scc and review the literature of the cases previously reported . |
the presentation of this technological hazard may range from a mild socio - personal distress to a gross disorganization in behavior and self - care . we reported a case of two brothers , diagnosed with internet gaming addiction , who showed grossly disorganized behavior and severely compromised self - care . the condition was managed by pharmacological and non - pharmacological therapies , with sustained improvement after 6 months follow up . internet gaming addiction may cause severe personal , social , and occupational problems . despite the range of severity and various presentations of this disorder rapid and extensive proliferation of the internet has resulted in better opportunities for research , communication , and information . useful to some extent , this modern day technological wonder has largely caused decline in physical and mental well - being owing to its potential for causing addiction in the form of pornography , excessive gaming , chatting for long hours , gambling , and online shopping . goldberg in 1995 introduced the term internet addiction for pathological compulsive internet use ( 1 ) . excessive internet gaming has been described as a specific subtype of internet addiction ( 2 ) . according to some reports , up to 90% of american youngsters still , it has not been classified under main disorders as adequate research - based evidence is lacking . the presentation of internet gaming disorder may range from a mild socio - personal distress to a gross disorganization in behavior and self - care . we report two brothers diagnosed with internet gaming addiction , with grossly disorganized behavior and severely compromised self - care . messrs a and b were two unmarried brothers , belonging to a nuclear family of upper socioeconomic class of urban background of delhi . mr a is 19 years old , studying in 12 standard while mr b is 22 years old , studying in 2 year of engineering in haryana , india . both brothers were brought by their parents with the complaints of insidious onset , gradually progressive excessive online gaming , irritability , decline in studies performance , and impaired self - care for the past 2 years . the problem began when both brothers used to stay together at home and started playing online game with their virtual internet friends from different countries . due to difference in gmt ( greenwich mean time ) across all countries , they had no specific timing for games and hence the gaming interfered with their sleep and daily routine . the duration of online gaming progressed from 2 - 4 hours per day to 14 - 18 hours per day over the initial few months . the behavior and self - care of these brothers became so compromised and disorganized that while playing the games , they urinated and defecated in their clothes , did not change clothes for days , did not bathe , skipped their meals , did not pick up phones or open doors even to their parents . they were not concerned even when strangers entered the house in their presence and robbed the house . their home was robbed twice of cash and costly articles in their presence , during the last 2 months while they were preoccupied in playing online games . they shouted at parents , abuse and hit them and even locked in their rooms when stopped from playing game . the patients were admitted in view of above problems , the severity of gaming addiction . their general physical examination , systemic examination , and laboratory investigation were within normal limits . on interviewing , irritability , and craving for games the aim of the treatment was to reduce irritability , improve sleep , daily routine , and self - care along with enhancing motivation and reducing craving for online games to prevent future relapses . diagnostic psychometric assessment revealed impulse control problems , depressive cognitions , and delinquency in both brothers . fluoxetine 20 mg / day was started ( increased to 40 mg / day ) along with clonazepam 0.5 mg as required for sleep . it included limit setting , motivational interviewing , motivation enhancement therapy , activity scheduling , family and individual therapy , distraction techniques , and positive reinforcement using principles of behavior therapy . during the one month stay in the hospital , both patients improved considerably with reduced irritability and craving for online games , better self - care and hygiene , improved sleep , and interest in studies . the improvement maintained during the 6 months follow up , even after stopping fluoxetine with simple methods of behavior therapy using parents as co - therapists . , it has great technological value in research , communication , information , leisure activities , business transactions , and learning . however , there is always a dark side to new technologies . in case of internet , it turns to an addiction which is a recent concept and still under research . internet gaming addiction is the latest phenomenon in the world of internet ( 5 ) . for many adolescents , a market research company has estimated the china s worth online gaming market as $ 12 billion in 2013 . a recent review article reported prevalence estimates ranging from 0.2% in germany to 50% in korean teenagers ( 6 ) . although internet gaming disorder has not been classified under main disorders of dsm-5 , researchers have realized that internet gaming is increasingly being used by people of all ages , especially younger population , who may face severe consequences associated with compulsive use of games ( 6 ) . according to dsm-5 ( 4 ) , internet gaming disorder refers to the persistent and recurrent use of the internet to engage in games , often with other players , leading to clinically significant impairment or distress as indicated by 5 ( or more ) criteria in a 12-month period . these criteria comprise lack of control over the use of internet games , preoccupation with internet gaming , psychological withdrawal , developing tolerance for games and need for increase use of games , loss of other significant interests , use of internet games despite negative consequences , and significant decline in social and occupational domains ( 4 , 6 ) . all these signs and symptoms were observed or reported in the described case report of patients . internet gaming addiction is a disorder that is most dramatically expressed with games known as massively multiplayer online games ( mmos ) ( 7 ) and specially massively multiplayer online role - playing games ( mmorpgs ) like world of warcraft ( 8) . mmorpgs are games played by thousands of players at the same time ( massively multiplayer ) . because these games are played online , there are no spatial or temporal boundaries and they allow players to adopt various virtual roles . hence , these games are specially engineered to maximize the amount of time a player stays in the game . the same was observed in the patients where they used to play such games with virtual friends across different countries and at odd hours . the psychological consequences vary and include difficulty in real - life relationships , disturbances in sleep , work , education , socializing , attention , academics , and memory . it may include aggression and hostility , stress , and high loneliness ( 6 , 9 - 11 ) . most of these disturbances were evident in both patients . considering the shared features with addiction disorders , which are evident from the above case , internet gaming addiction could be placed alongside the main disorders in the future classificatory systems . dsm-5 needs to consider the severity classifiers for the disorder , which might present variedly depending upon the content and type of games , cultural context of gaming , and associated personality type . internet addiction is a new and emerging group of disorders in indian subcontinent ( 12 ) . it has proliferated and spread across the subcontinent , in spite of deeply knit family systems and parental supervision . systematic studies need to be undertaken in indian subcontinent to evaluate the prevalence and type of gaming addiction . crucial steps in curtaining this evolving epidemic must be taken in the form of legal limitations on sale / purchase , setting the age limit , and restricting access to online games . | introduction : the internet is considered a beneficial tool in research , communication , and information .
still , its excessive and prolonged use has the potential of causing addiction .
the presentation of this technological hazard may range from a mild socio - personal distress to a gross disorganization in behavior and self - care .
no reported study on internet gaming addiction is available from india.case presentation : we reported a case of two brothers , diagnosed with internet gaming addiction , who showed grossly disorganized behavior and severely compromised self - care .
the condition was managed by pharmacological and non - pharmacological therapies , with sustained improvement after 6 months follow up.conclusions:internet gaming addiction may cause severe personal , social , and occupational problems . despite the range of severity and various presentations of this disorder , dsm-5 lacks the severity classifier .
early identification and management may result in complete recovery . |
ocular dipping ( od ) , or inverse ocular bobbing , consists of slow , spontaneous downward eye movements with rapid return to the primary position . it has been mainly reported following hypoxic - ischemic encephalopathy , but has also been described in association with other types of diffuse or multifocal encephalopathies and structural brainstem damage . we report the case of a previously asymptomatic 66-year - old woman who presented with confusion , recent memory disturbances , and abnormal involuntary movements , followed by a coma . abnormal spontaneous vertical eye movements consistent with od developed from the fourth day after admission , and the patient died 20 days later . the precise location of damage causing od is unknown . in contrast to ocular bobbing , od has no localizing value itself , but structural brainstem damage is likely when it appears combined with other spontaneous vertical eye movements . spontaneous eye movements are useful clinical signs in coma , although they rarely have localizing value.1 the best - known exception to this rule is ocular bobbing , which consists of rapid downward conjugate movements of both eyes with a slower return to the baseline position , and is found in pontine lesions.2 several variants of these movements have been described according to the direction and speed of the drifts.3 ocular dipping ( od ) , or inverse ocular bobbing , is one of those variants . od consists of slow downward deviation and rapid upward return of the eyes to the primary position,4 and has been described in association with hypoxic insults to the brain , although other etiologies have also been reported . here we describe a case of od seen in a patient presenting with progressive neurologic impairment leading to a vegetative state and death caused by creutzfeldt - jakob disease ( cjd ) . a 66-year - old woman was admitted with a 6-week history of rapidly progressing cognitive impairment . being previously asymptomatic , her family reported that the patient showed clumsiness with progressive inability to carry out the normal activities of daily living . confusion combined with recent memory disturbances and abnormal involuntary movements of the left upper limb had developed in the patient . a cognitive examination upon admission demonstrated severe impairment of short - term memory and orientation . her behavior was inappropriate due to disinhibition , with the most prominent inappropriate behavior being continuous laughter . a bedside examination of the visual fields showed no gross abnormalities , but simultagnosia was found . an examination of eye movements demonstrated the absence of smooth horizontal and vertical pursuit , and the inability to execute voluntary visually guided saccades . an en - bloc rotation of head and trunk was needed to reach a visual target . she was unable to grab an object displayed in the center of her visual field . these findings ( peripheral visual inattention , optic ataxia , and acquired ocular motor apraxia ) were consistent with balint 's syndrome . oculocephalic maneuvers evoked normal reflex eye movements . irrigating the external ears with cold water elicited normal and symmetric responses . left - arm myoclonus , left - leg myoclonus , and continuous left - hand dystonic movements were evident during an examination . diffusion - weighted magnetic resonance imaging ( mri ) revealed mild bilateral basal ganglia and parieto - occipital cortex hyperintensities . cerebrospinal fluid analysis showed a normal cell count , glucose levels , and protein levels , but a positive result for 14 - 3 - 3 protein . a presumptive clinical diagnosis of cjd was made . genetic analysis of the prion protein gene demonstrated methionine / valine heterozygosity in codon 129 on the short arm of chromosome 20 . over the next 2 days the patient deteriorated into cortical blindness , left hemiplegia , and thereafter stupor and coma . abnormal spontaneous vertical eye movements were evident from the fourth day after admission , consisting of a conjugate slow downward deflection followed by a rapid return to the primary position . intermixed roving eye movements sometimes appeared between od cycles , but other abnormalities of vertical gaze were not seen . the intensity and frequency of abnormal spontaneous eye movements consistent with od progressively decreased until they disappeared 8 days after onset , before subsequently evolving into sustained downward deviation intermixed with occasional roving eye movements . a pathological examination demonstrated widespread spongiform changes with the presence of neuropil vacuoles , neuronal loss , and astrocytosis involving the cortical gray matter , hippocampal ca1 and ca2 sectors , amygdala , thalamus , hypothalamus , putamen , caudate , superior and inferior colliculi , substantia nigra , locus coeruleus , pontine and medullary tegmental nuclei , olivary nuclei , dentate nuclei , and molecular layer of the cerebellar cortex ( fig . 1 ) . diffuse synaptic and axonal deposits of prionic protein were evident after 3f4 antibody immunostaining . scarce neuropil threads and tau - positive neurons were found in the parahippocampal gyrus and hippocampal ca2 sector . ocular dipping is one of the spontaneous eye movements that may occur in unconscious patients.4 it is an intermittent and usually conjugate vertical eye movement consisting of a slow downward movement with a rapid return to the midpoint.5 the eyes do not elevate beyond the primary position ( fig . 2),6 and may remain in a resting downward position for several seconds before upward deviation.1 the complete cycle of movements comprising downward deviation and upward rapid recovery typically takes a few seconds . horizontal eye movements in patients with od usually cover the full range.6 the timing of the drift and return of the eyes to the primary position tends to vary , and the typical rhythmicity and small amplitudes of eye movements seen in nystagmus are lacking . cycles may be continuous or intermittent ; a cycle might start directly after the finish of the preceding cycle or after a short delay.7 the presence of a structural lesion involving the brainstem is very likely when other spontaneous vertical eye movements appear interspersed with od ( e.g. , bobbing , reverse bobbing , or reverse dipping).5,8,9 while ocular bobbing is commonly observed in association with intrinsic pontine lesions , od may occur in metabolic or hypoxic encephalopathies.10 od was initially described following anoxic brain damage , but other etiologies have also been reported ( table 1 ) . three cases of od in cjd have been reported that showed similar evolutions of this eye - movement disorder.11,12 od lasted for several days in the present case before changing into downward gaze deviation . this phenomenon has been previously described in patients with od and cjd , suggesting a complete loss of upward saccades that may be indicative of progression of the disease.11 other disorders of involuntary eye movements in cjd include periodic alternating , upbeat , centripetal , and rebound nystagmus.11 patients with cjd may also develop supranuclear vertical gaze palsy , slow vertical saccades , and skew deviation.4 this spectrum of eye - movement disorders reflects the prominent involvement of the cerebellum and brainstem in some patients with cjd . reported cases of isolated od ( i.e. , not associated with other spontaneous vertical eye movements ) appearing in cerebral hypoxia have been attributed to damage to the cerebral cortex and basal ganglia on mri or pathological investigations.10,13,14,15 the changes in intensity and frequency of od that may occur with changes in arousal and the usually intact horizontal eye movements during vestibular - ocular testing suggest that some level of pontine function is preserved in od and that the site responsible for its generation is located in the more rostral brainstem or in the cerebral cortex.6 several patients have been reported with od associated with brainstem injuries , so it has been hypothesized that structures controlling vertical eye movements are involved in the origin of od and other variants of ocular bobbing.5,8,9,16,17,18,19 moreover , reports of some patients showing multiple types of bobbing suggest a common underlying pathophysiology for this group of involuntary eye movements.8,20 since different anatomical pathways mediate upward and downward eye movements , it seems likely that these movements represent varying imbalance in the mechanisms controlling vertical gaze.4 the emergence of od usually has a poor prognosis ( e.g. , death , vegetative state , locked - in syndrome , or severe residual functional deficits ) , but some individuals have reportedly substantially improved to either complete or nearly complete recovery from their medical conditions.7,8,13,14,16 therefore , od can not be used as a sign of the prognosis in coma . | backgroundocular dipping ( od ) , or inverse ocular bobbing , consists of slow , spontaneous downward eye movements with rapid return to the primary position .
it has been mainly reported following hypoxic - ischemic encephalopathy , but has also been described in association with other types of diffuse or multifocal encephalopathies and structural brainstem damage.case reportwe report the case of a previously asymptomatic 66-year - old woman who presented with confusion , recent memory disturbances , and abnormal involuntary movements , followed by a coma .
abnormal spontaneous vertical eye movements consistent with od developed from the fourth day after admission , and the patient died 20 days later .
the pathological examination of the brain confirmed the diagnosis of creutzfeldt - jakob disease.conclusionsthe precise location of damage causing od is unknown .
in contrast to ocular bobbing , od has no localizing value itself , but structural brainstem damage is likely when it appears combined with other spontaneous vertical eye movements . |
idiopathic eruptive macular pigmentation ( iemp ) is a rare skin disorder characterized by the presence of asymptomatic , brown pigmented macules that involve the face , trunk and proximal extremities in children and adolescents . the first description of this condition was given by degos et al . , these hyperpigmented macules gradually resolve over months or years without any residual pigmentation or scarring . we report a case of a 10-year - old girl who fulfilled all the criteria for this entity . a 10-year -old girl presented with asymptomatic brown macules over the trunk and proximal extremities , of three months duration . they progressively increased in number and size over a period of one month and became stable . the cutaneous examination showed multiple dark brown , discrete , round to oval macules and mildly elevated pigmented lesions over the anterior and posterior trunk and proximal extremities sparing the palms and soles [ figures 1 and 2 ] . the individual lesion was 1 - 3 cm in diameter and the elevated lesions had a velvety appearance on the surface [ figure 3 ] . the routine blood , urine and stool examinations , liver function , renal function and thyroid function tests revealed no abnormality . biopsy from elevated lesion on back showed acanthosis , moderate papillomatosis and uniformly prominent melanin in the basal layer of the epidermis with normal number of melanocytes [ figure 4 ] . no new lesions or change in preexisting lesions was seen at six months of follow - up . dark brown discrete macules over the anterior trunk and proximal extremities characteristic macules on back velvety appearance of pigmented lesions acanthosis , papillomatosis and increased melanin in the basal layer ( h and e , 45 ) iemp is a rare skin disorder characterized by asymptomatic , brown macules involving the neck , trunk and proximal extremities . though the first case was reported around 30 years back , the exact etiology and pathogenesis is still not known . , in 1996 summarized the criteria for the diagnosis of this condition , namely ( a ) eruption of brownish - black , discrete , nonconfluent , asymptomatic macules involving the neck , trunk and proximal extremities in children and adolescents , ( b ) absence of any preceding inflammatory lesions , ( c ) no previous drug exposure , ( d ) basal layer hyperpigmentation of the epidermis with dermal melanophages without any basal cell damage or lichenoid infiltrate , and ( e ) normal mast cell counts . the youngest and oldest case reported in the literature is that of a one - year - old and a 50-year - old . the largest series of ten cases and nine cases have been described by jang et al . the differential diagnosis of iemp includes post - inflammatory hyperpigmentation , fixed drug eruption , urticaria pigmentosa , lichen planus pigmentosus and erythema dyschromicum perstans . iemp can be differentiated from these conditions by taking proper history and doing skin biopsy study . histopathologically , iemp shows acanthosis , basal layer hyperpigmentation of the epidermis with dermal melanophages without any basal cell damage or lichenoid infiltrate and normal mast cell count . some authors believe that iemp may be related nosologically to confluent and reticulate papillomatosis ( crp ) and eruptive acanthosis nigricans because both these conditions show histological findings of pigmented papillomatosis similar to our case . however , the clinical features and etiopathogenesis of these conditions are quite different . it is important to consider iemp in the differential diagnosis of pigmentary lesions as iemp is a self - resolving condition . the treatment of this condition is not required as spontaneous resolution of iemp is expected in a few weeks to few years . in our case , topical steroid was started for the first two weeks to speed up thinning of elevated velvety lesions but without any benefit . to include papillomatosis as one of the diagnostic criteria , more reports of iemp with papillomatosis | we present a case of an otherwise healthy 10-year - old girl who presented with asymptomatic brown macules over the trunk and proximal extremities , of three months duration .
the cutaneous examination revealed multiple , dark brown , discrete , round to oval macules and a few mildly elevated lesions over the trunk and proximal limbs .
the individual lesion was 1 - 3 cm in diameter and a few showed velvety appearance over the surface .
darier 's sign was negative .
the histopathological study from the velvety lesion showed acanthosis , papillomatosis and increased melanin in the basal layer .
the upper dermis showed sparse perivascular infiltrate of lymphocytes without any dermal melanophages .
it fulfilled the criteria for idiopathic eruptive macular pigmentation with additional histological finding of papillomatosis . |
according to a recently released ' the korean diabetes research report 2012 ' by korean diabetes association , one out of ten adults has diabetes disease , two out of ten have the impaired fasting glucose which is stage of diabetes , and three out of ten adults are threatened by high blood glucose . in addition , the aging society proceeds quickly , thereby the number of diabetes patients are predicted about 6 million in 2050 , approximately a 2-fold increase compared to the current number of diabetes patients . also , the incidence of acute and chronic complications associated with diabetes is expected to increase . especially diabetic nephropathy occurs more frequently among the patients suffered from diabetes for a long time . also , it is a complication that has a large impact on patient 's quality of life . a balanced diet was recommended for diabetes mellitus patient as a key component of diet therapy . on the other hand , food intake increases burden to kidney function in diabetic nephropathy patients . therefore , the patient who proceeded to diabetic nephropathy needs nutrition education to properly manage the disease and to increase the quality of life . . diabetic nephropathy occurs in 20% to 40% of patients with diabetes , and is a most likely causes of end - stage renal disease reported worldwide . continuous microalbuminuria ( 30 - 299 mg / day ) appears in the early stages of diabetic nephropathy with type 1 diabetes , and it is an indicator of nephropathy onset and the development of cardiovascular disease . a patient who had a progression from microalbuminuria to macroalbuminuria ( 300 mg / day ) has a high risk of developing end - stage renal disease in few years . according to a recent study , the deterioration of renal function could be delayed by proactive management at the initial diagnosis point , therefore , it is important to implement a personalized diet customized to individuals as soon as possible . in this case report , the nutrition education for one patient with diabetic nephropathy is discussed . the patient was a 52-year - old woman who was diagnosed with type 2 diabetes mellitus approximately 6 years ago . the patient had been taking oral hypoglycemic agents ( glimepiride ) and insulin ( glargine 18 - 20 iu before breakfast and 4 iu before bed ) to control blood glucose level . the patient 's 2 hrs postprandial blood level was normally maintained between 280 - 300 mg / dl , however , the level increased to 300 - 400 mg / dl , in recent 2 - 3 weeks and the patient was hospitalized to control high glucose level . in addition to that , the patient had been receiving medical treatment for hypertension and dyslipidemia , and regular blood tests and urine tests were performed to monitor significant changes . the patient had been diagnosed with renal failure and proteinuria one year ago , and at the time of this hospitalization , the patient was diagnosed with stage 4 chronic kidney disease , and was consulted for nutrition education of diabetic nephropathy . the patient 's height and weight were 158 cm and 81.4 kg , respectively , percent of ideal body weight was 155.5% , indicating she was severely obese . the patient preferred a salty soup and stew , and the actual amount of intake exceeded the recommendation . when eating out once a week , the patient often ate a hamburger or a noodle meal . the patient 's diet history was analyzed by the 24-hr recall method using can pro 3.0 software ( the korean nutrition society , seoul , south korea ) ( table 2 ) . the patient consumed approximately 1,840 kcal / d with a protein intake of 67.5 g , and the energy ratio from carbohydrate , protein , and fat was 61.7% : 14.4% : 23.9% , respectively . the patient did not take any nutritional supplements , and did not drink alcohol , or smoke . the patient 's physical activity was rated to mild level of a homemaker ; she participated in weight training or bowling for 2 hrs ( 3 times a week ) . - energy : 1,600 kcal ( 30 kcal / kg x 52.4 kg ideal body weight [ ibw ] ) - protein : 40 g / d ( 0.8 g / kg 52.4 kg [ ibw ] ) - potassium : 2,000 mg / d this patient revealed problematic dietary habits including excessive carbohydrate intake , excessive protein intake , and excessive potassium intake ( table 3 ) . after analysing etiology , lack of knowledge and absence of education experience were selected as main causes . therefore nutrition education for diabetic nephropathy the nutritional problems of " excessive carbohydrate intake " and " excessive protein intake " were managed by establishing adequate nutrition through a diet comprising 1,600 kcal of energy , and below 60 percent of energy from carbohydrate and 40 g of protein per day . food models and a food exchange list were configured to provide nutritional training for the proper dietary intake . the association of carbohydrate intake and blood glucose control was discussed in relation to the nutritional problem of " excessive carbohydrate intake " . also , recommended amount of rice intake was 2/3 - 3/4 bowls ( 2.3 exchanges ) , which is reduced from one bowl ( 3 exchanges ) a meal . usually , it was necessary to take a proper amount of fat for preventing malnutrition and lack of caloric intake arise when protein and carbohydrates were restricted . however the patient had dyslipidemia and limited intake of animal fat was recommended . in addition , the patient was provided with information on the importance of eating the low - salt diet and tips for how to eat the low - salt diet easily . 1 ) apply of spicy and sour flavor seasoning like pepper or vinegar , instead of salt or fermented soybean paste . 2 ) limit the intake of high - salt - containing foods , such as kimchi , and other salted and pickled foods , 3 ) consume side dishes during meals without the addition of salt , 4 ) grilled food rather than boiled was recommended and use the food 's own flavor effectively when cooking , 5 ) when salting , focus on one kind of food . the patient was instructed to limit their intake of high potassium - containing foods ( grains , potatoes , sweet potatoes , corn , soybean , green vegetables , nuts , tomatoes , kiwi , banana , melon etc . ) . to reduce potassium intake , the intake of raw vegetables was recommended . it was also recommended to remove the shell before cooking , to use leaves rather than stem and to boil vegetables in water 4 - 5 times of their volumes . the results of nutrition education after 3 months are shown in table 4 - 6 . the patient 's diet history during last 3 months was analyzed by the 24-hr recall method using can pro 3.0 software ( the korean nutrition society , seoul , south korea ) . the patient consumed approximately 1,300 kcal / d with a protein intake of 37.6 g , and the energy supply from carbohydrate , protein , and fat was 71.3% , 11.6% , and 17.1% , respectively . after receiving the nutrition education for three months , the patient 's energy intake was reduced by 500 kcal compared to three months ago . this article is a case report of a patient with chronic kidney disease caused by diabetic nephropathy . because this patient had never received any nutrition education , the patient 's food and nutrition related knowledges was poor . as a result , the patient had problems including excessive intakes of carbohydrate , protein , and potassium , which was problematic for disease management . to solve this problem , three months after the education , the patient 's blood profile data was collected from electronic medical records ( emr ) , and the patient 's dietary intake data was collected through direct interviews . after intervention , carbohydrate intake did not conform exactly to recommendation , but protein intake and limitation of high - potassium foods were fairly well complied . excessive carbohydrate intake should be avoided as far as possible owing to its blood glucose control issues . to slow the progression of kidney complications , protein intake should be limited to 0.8 - 1 g / kg ibw / d for those with microalbuminuria , and should be limited to 0.8 g / kg ibw / d for those with macroalbuminuria , and should be limited to 0.6 - 0.8 g / kg ibw / d for those with end - stage renal disease . adequate fat intake is necessary to prevent malnutrition , because a lack of caloric intake can induce the restricted protein and carbohydrate intake . dyslipidemia is one of the most common complication in patients with diabetic nephropathy and is correlated with disease progression . this patient needs to be screened for microalbuminuria to prevent the progression of diabetic nephropathy , and dyslipidemia should be treated to reduce cardiovascular mortality . the consumption of oils with saturated fatty acids and meat should be limited , and stir - fried vegetables and vegetable oil should be consumed in moderation . for strict blood pressure control , potassium is involved in the contraction and relaxation of muscles in the human body and is an essential electrolyte . however , when kidney function decreases , excess potassium can not be easily excreted and is accumulated in the body , creating a burden . therefore , potassium intake should be limited in chronic kidney disease or in the case of hyperkalemia . therefore , the intake of coarse grains and vegetables should be limited , and should be soaked in water for more than 2 hours , and then blanched in boiling water before cooking . phosphorus in combination with calcium is found in bones and teeth . in reduced renal function , the amount of phosphorus that is emitted through the kidneys decreases and the blood levels of phosphorus increase . therefore , drug therapy is required in chronic kidney disease stages and the intake of foods that contain high levels of phosphorus should be reduced . a diabetic diet entails consumption of a healthy and balanced diet . whereas a chronic kidney disease or diabetic nephropathy diet should be designed to delay the progression of kidney disease , uremia due to renal dysfunction , hypertension , edema , hyperkalemia , hyperlipidemia and to control blood glucose along with the regulation of sodium , protein , and potassium levels . thus compared to the diabetic diet , the diabetic nephropathy diet is a little more complicated and restrictive . however , a personalized diet plan and continuous monitoring are required in diabetic nephropathy patien according to the patient 's stage of disease . | in recent years , several studies have reported that the prevalence of diabetes mellitus is increasing every year , and also the acute and chronic complications accompanying this disease are increasing .
diabetic nephropathy is one of chronic complications of diabetes mellitus , and food intake which is burden to kidney function should be limited .
at the same time , diet restriction could deteriorate quality of life of patient with diabetic nephropathy . according to the results of previous studies ,
the aggressive management is important for delaying of the progression to diabetic nephropathy .
also , the implementation of a personalized diet customized to individuals is an effective tool for preservation of kidney function .
this is a case report of a patient with diabetic nephropathy who was introduced to a proper diet through nutrition education to prevent malnutrition , uremia and to maintain blood glucose levels . |
diagnostic laparoscopy is often used to identify specific intraabdominal pathology as the cause for chronic abdominal and pelvic pain . however , few studies have determined that laparoscopic adhesiolysis , as the only operative intervention , ameliorates a significant amount of chronic abdominal pain . furthermore , only anecdotal reports of the role of laparoscopic adhesiolysis in the setting of acute or chronic bowel obstruction have been published . our study was designed to investigate the role of laparoscopic adhesiolysis in the treatment of patients with chronic abdominal pain or recurrent bowel obstruction , not attributed to other obvious pathology . between september 1996 and april 1999 , hospital records of 35 patients who underwent laparoscopic adhesiolysis were retrospectively reviewed . fifteen patients , who had other major abdominal procedures in conjunction with adhesiolysis , were excluded from the study . these procedures included cholecystectomy ( 7 ) , repair of incisional hernia ( 2 ) , appendectomy ( 2 ) , gastrostomy ( 2 ) , colon resection ( 1 ) , and nissen fundoplication ( 1 ) . the extensive adhesiolysis in these 15 patients who were operated on for other specific pathologies was considered incidental . therefore , these patients were excluded from our study . after obtaining approval from the institutional review board assessment of symptomatic relief was determined by the questionnaire , and peri - operative morbidity and mortality were assessed by reviewing the inpatient and outpatient charts as well as through the review of the responses to the questionnaires . of the 20 patients who underwent adhesiolysis only , 2 patients were lost to follow - up . patients comprised 17 females and 1 male , with a mean age of 52 years ( range 35 to 78 ) . all operations were completed by 1 surgeon experienced in laparoscopy , at a major medical institution under general anesthesia . thirteen operations were undertaken for chronic abdominal / pelvic pain , and 5 for bowel obstruction . of the 5 patients with bowel obstruction , 3 were hospitalized with acute bowel obstruction ; and 2 were operated on electively for treatment of chronic , intermittent bowel obstruction . the average number of previous abdominal procedures was 2.6 ( range 1 - 4 ; table 1 ) . preoperatively , patients were worked up extensively with a combination of computerized tomography of the abdomen and pelvis , upper and lower gastrointestinal contrast studies , and upper and lower gastrointestinal endoscopies . these studies were obtained to rule out obvious intraabdominal / visceral pathology that would explain the patient 's chronic abdominal pain , intestinal obstruction , or both . only when all studies were considered negative for such processes were the patients considered for laparoscopy and adhesiolysis . prior abdominal / pelvic surgeries preoperative evaluation postoperatively , 14 of the 18 patients had complete resolution of their symptoms , and an additional 2 patients had partial resolution of their symptoms ( overall 88.9% response to adhesiolysis ) . seven of these 16 patients reported recurrence of some of their symptoms from 1 week to 6 months following their adhesiolysis . after a mean follow - up period of 11 months ( range 1 32 months ) , overall , 14 patients ( 77.8% ) reported an improvement in their quality of life and responded that they would have the adhesiolysis again . three patients continue to require intermittent use of medications for pain control . of the 18 operations performed , 3 resulted in enterotomies , 2 of which required conversion to laparotomy for resection of devitalized bowel . the 3 enterotomies were encountered in the 3 patients hospitalized preoperatively with acute bowel obstruction . the 15 patients who did not suffer enterotomies were all discharged within 24 hours after their operations . the remaining 3 patients were discharged from 10 days to 21 days following their operations . another patient who required laparotomy for bowel resection underwent a subsequent laparotomy for recurrent bowel obstruction . six other patients have been hospitalized for unrelated medical and surgical conditions ( table 3 ) . intestinal obstruction is commonly attributed to intraabdominal scar tissue , a claim that is frequently substantiated by operative findings in patients requiring surgical intervention . abdominal and pelvic pain in association with intraabdominal scar tissue are not as well understood . mueller and kresch have suggested that adhesions can be the cause of pain if they limit the movement or distensibility of peritoneum or bowel . stretching pain secondary to adhesions attached to the liver , intestine , or other organs may also contribute to chronic abdominal pain ; and the adhesions can partially or intermittently cause intestinal obstruction . one study noted that small adhesions appear to cause recurrent pain without other symptoms , whereas large adhesions produce pain in combination with symptoms indicative of intermittent bowel obstruction . enthusiasm for elective adhesiolysis is often limited by the concern about subsequent scar tissue formation following major laparotomy . although the etiology for intraabdominal scar tissue formation is likely to be multifactorial , the inflammatory response , which is decreased in laparoscopy versus laparotomy , has been considered a cause for subsequent scar tissue formation . therefore , it is possible that laparoscopic adhesiolysis would result in immediate resolution of symptoms attributed to intraabdominal adhesions , with less likelihood of subsequent recurrence of adhesions and symptoms . our operative technique includes complete lysis of all adhesions that have resulted in fixation of the small and large intestine to the abdominal wall . except in those patients with operative findings of an obvious transition from dilated to decompressed bowel , we do not routinely inspect the entire length of the small intestine , searching for interloop adhesions . we believe excessive manipulation of the small intestine may increase the risk of enterotomies . so far , with a mean follow - up of 11 months , the only patient who has required repeat abdominal surgery for recurrent symptoms is 1 of the 3 patients who required major bowel resection at the time of her initial adhesiolysis , supporting the adequacy of our technique of adhesiolysis . identification of other intraabdominal pathology through the extensive use of less - invasive preoperative testing should result in a low incidence of nontherapeutic adhesiolysis . fifteen patients excluded from our study had other major abdominal procedures performed at the time of their adhesiolysis . all of these patients were extensively evaluated preoperatively and found to have other possible sources for their chronic abdominal pain . during their operations , however , all 15 patients underwent similar extensive adhesiolysis to prevent a future operative procedure . we believe that an extensive pre - operative workup should be used before attributing symptoms of chronic abdominal pain to intraabdominal scar tissue . additionally , we believe that patients with unusual preoperative abdominal pain should undergo adhesiolysis at the time of their laparoscopy for other preoperatively detected intraabdominal pathology . as early as 1992 , several authors suggested that laparoscopy in the setting of bowel obstruction may yield inadequate enterolysis , and is likely to be dangerous . more recently , other authors have demonstrated acceptable results with laparoscopic lysis of adhesions in the setting of acute intestinal obstruction . in our study , all 3 patients who underwent adhesiolysis after hospitalization for acute bowel obstruction sustained enterotomies . one was repaired laparoscopically , but 2 required conversion to laparotomy for resection of devitalized bowel , and 1 of the 2 patients has since required another operative procedure for recurrent bowel obstruction . in contrast , the 2 patients who underwent adhesiolysis for management of chronic bowel obstruction had no operative morbidities . based on this experience , we conclude that laparoscopic adhesiolysis performed for management of acute bowel obstruction may result in a high incidence of operative complication . an overall 77.8% improvement in symptoms following laparoscopic adhesiolysis supports liberal use of diagnostic laparoscopy and lysis of adhesions in patients with chronic abdominal pain , bowel obstruction , or both , who have previously under - gone major abdominal surgery . to improve the yield of such an approach , in conclusion , laparoscopic adhesiolysis for chronic abdominal pain , recurrent bowel obstruction , or both , is safe and effective and results in minimal peri - operative morbidity . in the setting of acute bowel obstruction , | background : major abdominal operations result in random and unpredictable scar tissue formation .
intraabdominal scar tissue may contribute to recurrent episodes of bowel obstruction , chronic abdominal pain , or both .
laparoscopic adhesiolysis may provide relief of symptoms in patients with prior abdominal surgery with chronic abdominal pain or recurrent bowel
obstruction.methods:between september 1996 and april 1999 , 35 patients underwent laparoscopic adhesiolysis .
fifteen of the patients had adhesiolysis in conjunction with other major laparoscopic procedures and were excluded from the study .
twenty of the patients who underwent adhesiolysis only were retrospectively assessed for symptomatic relief as well as peri - operative morbidity and mortality.results:two of 20 patients were not available for long - term follow - up . in the 18 remaining patients ,
laparoscopic adhesiolysis was performed on 13 patients with abdominal pain and 5 patients with recurrent bowel obstruction .
the follow - up period ranged from 1 to 32 ( mean 11 ) months .
sixteen of the 18 ( 88.9% ) operations were completed laparoscopically .
two operations were converted to open for partial enterectomy .
an additional enterotomy was repaired laparoscopically .
all 3 operative complications were encountered in patients operated on during hospitalization for active bowel obstruction . no mortalities or blood transfusions occurred .
one patient required rehospitalization for nonoperative management of an intraabdominal hematoma .
fourteen of the 18 ( 77.8% ) had subjective improvement in their quality of life after operation .
only 1 patient has required repeat adhesiolysis.conclusions:laparoscopic adhesiolysis is a safe and effective management option for patients with prior abdominal surgery with chronic abdominal pain or recurrent bowel obstruction not attributed to other intraabdominal pathology .
laparoscopic intervention in patients with active bowel obstruction may increase the risk of operative complications . |
host genetic factors are major determinants of susceptibility to infectious disease in humans ( 1 ) . htlv - i is a persistent virus , infecting 10 - 20 million people worldwide . most infected people remain healthy , but 1 - 2% develops a progressive paralytic myelopathy ( htlv - i - associated myelopathy ; ham / tsp ) and a further 2 - 3% develops an aggressive t cell leukemia / lymphoma . ham / tsp is a chronic debilitating inflammatory disease of the central nervous system , characterized by axonal damage and demyelination , most pronounced in the midthoracic spinal cord . furthermore some of the self - immune diseases such as uveitis and polymiositis are found to be resulted from this virus ( 2 - 5 ) . the endemic regions affected with this virus include the south - west of japan , caribbean islands , and some regions of the usa ( 6 ) . the other parts with less prevalence of the virus are taiwan and some regions of africa and israel . mashhad in the north of iran has been recognized as a new endemic region of the virus ( 10 , 11 ) . the symptoms include weakness or dryness in one or both feet , backache and no control on urine . one - third of the patients become paralyzed after 10 years and one half of them are not able to walk ( 12 ) . on the contrary to alt in which the number of the male patients is a little more , ham affects the female disproportionately . high proviral load and being female are two factors of high risk of ham / tsp and the relative risk of ham / tsp increases when the provrial load becomes clearly more than one copy in any pbmcs ( 13 , 14 ) . both the class i mhc proteins ( hla - a , -b , and -c ) , which present viral peptides for recognition by virus - specific ctl , and class ii mhc proteins ( hla - dr and -dq ) , which present peptides to cd4 t cells , are likely to be important in the immune response to htlv - i infection ( 15 , 16 and 17 ) . the results of several previous studies have suggested associations between various hla class i or class ii alleles and susceptibility to t cell leukemia / lymphoma or ham / tsp ( 18 - 22 ) . however , small sample size , mixed ethnicity , lack of adequate controls , or lack of staging in these studies precluded a definite conclusion . if the relationship between htlv-1 infection and class ii is considered as the factor of susceptibility to disease , it may help in understanding pathogenesis of ham / tsp . the supplied peptides of axon antigens bonded to the products of mhc class ii activate cd4+on the surface of t lymphocytes and the activated cd4+can cross the blood - cerebral obstacle and identify the cell affected with virus . the activated cd4 + causes apoptosis through producing cytokins and damage to the cell affected with virus and the peripheral cells may play a role in cns ( 23 , 24 ) . both mhc class i and class ii molecules are important in determining the recognition of htlv - i peptides and for the generation of an effective immune response . the predominant cytotoxic t lymphocyte response ( ctl ) against tax protein , which is necessary for viral expression , can be restricted by a wide variety of mhc class i molecules in htlv - i infected subjects . it has been suggested that no single mhc class i allele is associated with ham / tsp ( 15 , 25 ) . in japanese htlv - i - infected subjects has been demonstrated that expression of hla - a*02 and hla cw*08 alleles reduced the proviral load of htlv-1 and consequently the risk of ham / tsp , while hla - b*5401 allele increased the proviral load and the risk of ham / tsp in htlv - i carriers . furthermore , hla - drb1 * 0101 increased the risk of ham / tsp in carriers in the absence of hla - a*02 ( 18 , 21 ) . the aim of this study was to investigate the frequency of hla - dqb1 alleles in htlv - i - infected individuals and healthy controls resident in mashhad . the studied subjects were 66 , including 16 ham / ts patients , 20 asymptomatic carriers and 30 healthy controls . sixteen of 20 ham / tsp patients were female ( 60% ) and 72% of htlv - i carriers were female . the mean age of patients was 44.1414.62 and the mean age of htlv - i carriers was 51 10.22 . all patients fulfilled established criteria for ham / tsp when they examined by neurologist and htlv - i carriers had symptoms of htlv - i - associated diseases . all of the ham / tsp patients , htlv - i carriers and healthy controls had the same ethnic background . the study protocol was approved by the ethics committee of mashhad university of medical sciences . 10 cc blood was taken from all the subjects for dna extraction and serum preparation . serum samples were screened for htlv - i antibody by enzyme linked immunosorbent assay ( elisa ) according to the manufactures ' instruction ( diapro , italy ) and reactive samples were confirmed by western blotting ( genelab diagnostic , singapore ) . dna was extracted by non - enzyme salting out method using biogen kit ( mashhad - iran ) according to manufacturer 's instruction . polymerase chain reaction with sequence - specific primers ( pcr - ssp ) method was carried out to determine hla - dqb1 alleles according to the previously published method ( 26 ) . briefly , seven alleles of hladqb1 were detected using specific primers in eight pcr reactions . this procedure currently detected dqb1 alleles including 0501 - 0504 , 0601 - 0609 , 0201 , 0301 - 0305 , and 0401 - 0402 which corresponding to the serological specificities dq4 , dq5 and dq6 alleles , whereas the dq2 , dq7 , dq8 and dq9 specificities were amplified by two primer mixes . we used at least 2 primers ( primm - italy ) for each reaction ( table 1 , 2 ) . the studied subjects were 66 , including 16 ham / ts patients , 20 asymptomatic carriers and 30 healthy controls . sixteen of 20 ham / tsp patients were female ( 60% ) and 72% of htlv - i carriers were female . the mean age of patients was 44.1414.62 and the mean age of htlv - i carriers was 51 10.22 . all patients fulfilled established criteria for ham / tsp when they examined by neurologist and htlv - i carriers had symptoms of htlv - i - associated diseases . all of the ham / tsp patients , htlv - i carriers and healthy controls had the same ethnic background . the study protocol was approved by the ethics committee of mashhad university of medical sciences . 10 cc blood was taken from all the subjects for dna extraction and serum preparation . serum samples were screened for htlv - i antibody by enzyme linked immunosorbent assay ( elisa ) according to the manufactures ' instruction ( diapro , italy ) and reactive samples were confirmed by western blotting ( genelab diagnostic , singapore ) . dna was extracted by non - enzyme salting out method using biogen kit ( mashhad - iran ) according to manufacturer 's instruction . polymerase chain reaction with sequence - specific primers ( pcr - ssp ) method was carried out to determine hla - dqb1 alleles according to the previously published method ( 26 ) . briefly , seven alleles of hladqb1 were detected using specific primers in eight pcr reactions . this procedure currently detected dqb1 alleles including 0501 - 0504 , 0601 - 0609 , 0201 , 0301 - 0305 , and 0401 - 0402 which corresponding to the serological specificities dq4 , dq5 and dq6 alleles , whereas the dq2 , dq7 , dq8 and dq9 specificities were amplified by two primer mixes . we used at least 2 primers ( primm - italy ) for each reaction ( table 1 , 2 ) . the frequency of hla - dqb1 alleles was calculated in ham / tsp patients , asymptomatic carriers and healthy control groups . the frequency of hla - dqb1 * 07 was significantly higher in patients with ham / tsp ( 75% ) compared with healthy controls ( 30% ) ( p = 0.004 , or=8.52 ) ( table 1 ) . the hla - dqb1 * 02 and dqb1 * 05 was positive in 7 ham / tsp patients , while in healthy control group 24 subjects were positive . the frequency of both hla - dqb1 * 07 and hla - dqb1 * 06 alleles in ham / tsp patients was more than the ones if they infected with more than the ones free of it if they are infected with htlv-1 ( p- value=0.0009 and rr=10.95 ) ( table 3 ) . in the present study we examined the frequency of hla - dqb1 allele in ham / tsp patients , asymptomatic carriers and healthy controls . our results indicated that the individuals with dqb1 * 07 allele are susceptible to be affected with this disease 7 times more than the ones lacking this allele , suggesting hla genes play a significant role in the susceptibility to ham / tsp disease . within african population , two antigens determined dr15 and dq1 , occurred at significantly increased frequency among htlv - i carriers compared with seronegative control subjects ( 42% versus 22% for dr15 [ odds ratio { or } = 2.7 ; 95% confidence interval { ci } = 1.0- 7.2 ] and 78% versus 53% for dq1 [ or = 3.1 ; 95% ci = 1.2 - 8.5 ] ) . asymptomatic carriers were shown to have an hla class ii allele distribution similar to that of patients with atl , and the frequencies of the alleles drb1 * 1501 , drb1 * 1101 , and dqb1 * 0602 were significantly greater in patients with atl and asymptomatic carriers than in patients with ham / tsp . in addition , haplotypes drb1 * 1101-dqb1 * 0301 and drb1 * 1501-dqb1 * 0602 were significantly increased among patients with atl compared with patients with ham / tsp ( 28 ) . we also showed that the individuals with hla - dqb1 - 2 and hla - dqb-5 are 1.5 times more susceptible to develop ham / tsp compared with the subjects who lacked these alleles , therefore , these two alleles may be considered as the protective factors . rafatpanah et al ( 19 , 20 ) demonstrated that the frequency of hla - drb1 * 01 was significantly increased in ham / tsp patients compared with carriers ( p 0.028 ; or=9.4 ) . the frequency of hla - cw*08 was also significantly increased in ham / tsp patients compared with controls ( p=0.03 ; or=13.5 ) . it has been showed that there is an association between hla class i , hla - a30 allele and htlv - i infection ( 15 , 20 ) . kitze et al showed that the ham / tsp patients with particular hla haplotypes ( a24cw7b7dr1dq5 , a2cw7b7dr1dq5 , a24cw - b52dr15dq6 , a11cw1b54dr4dq4 , and a24cw1b54dr4dq4 ) express more frequently intrathecal synthesis of antibodies against htlv-1 synthetic peptides , especially against htlv-1 env gp21 synthetic peptides ( 21 ) . an association of hla - drb1 * 0101 with disease susceptibility also was identified , which doubled the odds of ham / tsp in the absence of the protective effect of hla - a*02 ( 22 ) . in the present study , the frequency of hla - dqb1 * 07 in ham / tsp patients was high . it seems that there is a correlation between hla - dqb1 * 07 and disease susceptibility . the genotype of hla - dqb1 * 06 and 07 was more frequent in patients with ham / tsp compared with control group ( 26 ) . this results is different from the results obtained kitze et al ( 25 ) who reported that there is a higher risk to develop ham / tsp among the individuals with hla - dq-0105 haplotype . this discrepancy may be associated with the difference in the genetic background of studied population ( 27 ) . although we find an association between hla - dqb1 alleles and ham / tsp , however the study should be repeated with more sample size . furthermore , the study of other hla class i and class ii alleles should be taken into account to understand a more comprehensive role of hla alleles in disease susceptibility . | objective(s ) : htlvi-1 is the first human retrovirus with limited endemic regions in the world .
the epidemiological studies have shown that the genetic background and immune response to the virus have a significant role in htlv - i - associated diseases . among the genes
are involved in htlv - i infection , the role of human leukocytes antigen ( hla ) have been studied in different population . in the present study we examined the association between hla - dqb1 alleles and htlv - i infection in ham / tsp patients , htlv - i carriers and healthy controls in north east of iran , mashhad.materials and methods : the blood samples of 16 patients with ham / tsp , 20 htlv-1 carriers , and 30 healthy individuals were taken and dna was extracted by salting out method .
hla - dqb1 typing was performed using pcr - ssp method and the frequency of hla - dqb1 alleles were compared by fischer exact test.results : there was a significant difference between ham / tsp patients and healthy controls in the frequency of hla - dqb1 * 07 ( p=0.004 , rr=7 ) .
furthermore , we found that possession of hla- dqb1 * 02 or hla - dqb1 * 05 increased the risk of disease 1.5 times.conclusion : the data presented here suggest that both hla - dqb1 * 07 and hla - dqb1 * 06 are associated with disease development . |
laparoscopic wedge resection of the stomach is a widely accepted treatment for primary resectable gastrointestinal stromal tumors ( gists ) due to the technical efficacy of linear staplers . however , it is difficult to determine the appropriate incision line from outside of the stomach when the lesions are intraluminal . many attempts have been made to avoid unnecessary resection of unaffected gastric tissues , including endoscopic full - thickness resection ( eftr ) , classic laparoscopic and endoscopic cooperative surgery ( lecs ) , and modified lecs procedures . recently , a technique called non - exposed endoscopic wall - inversion surgery ( news ) was introduced to avoid exposure of gist to the peritoneum . in the present case , we describe , to our knowledge , the first case of news for gist of the stomach practiced in korea , with a review of the literature . the mass was discovered during gastroscopy as part of a routine health checkup and was defined as a 2.01.5 cm subepithelial tumor at the greater curvature side of the fundus base ( fig . endoscopic ultrasonography revealed that the lesion originated from the 4th muscle layer ( proper muscle layer ) with a homogeneous and hypoechoic pattern ( fig . a computed tomography scan showed that the lesion protruded into the gastric lumen , with no evidence of distant or lymph node metastasis ( fig . subsequently , 5 mm trocars were placed in the right upper , left upper , and left lower quadrants , and a 12 mm trocar was placed in the right lower quadrant . several serosal markings were made laparoscopically , and a circumferential seromuscular incision was made with electrocautery . after creating a flap , the seromuscular layers were vertically sutured in an interrupted manner using vicryl thread to invert the lesion into the gastric lumen ( fig . the lesion was removed by endoscopic submucosal dissection ( esd ) using a dual knife ( olympus , tokyo , japan ) , and the mucosal side was closed with clips . the detached lesion was removed perorally ( fig . the elapsed time from the serosal markings to endoscopic removal of the lesion was 40 minutes ( serosal markings , 2 minutes ; seromuscular incision , 9 minutes ; suture , 14 minutes ; esd with retrieval , 15 minutes ) . there were no complications , and the estimated blood loss was less than 50 ml . the surgical margin was clear and the capsule was covered with the mucosa and serosa . ceftriaxone was administered for 5 days and the patient s diet was resumed 3 days after the procedure . however , a major limitation of this technique is that gastric contents can often flow into the peritoneal cavity during the procedure , which may cause viable cancer cell seeding in the peritoneal cavity . the concept of seromuscular incision was introduced by inoue et al . , who invented the combination of laparoscopic and endoscopic approaches to neoplasia with a non - exposure technique ( clean - net ) . this technique enables full - thickness resection of the gastric wall without transmural communication and can avoid intra - abdominal infection or tumor seeding to the peritoneum . this technique has been successfully performed for subepithelial tumors such as gist and schwannoma , and in early gastric cancer . , the resected specimen should be less than 3 cm in size ; when the lesion is located in areas such as the esophagogastric junction or near the pylorus , resection of the lesion is technically more difficult . the biggest disadvantage of the news technique it is time - consuming . to overcome these limitations , endoscopic tunnelling methods , such as submucosal tunnelling endoscopic resection ( ster ) , represent other alternatives for the treatment of gastric gists . in ster , peritoneal punctures can be avoided , thereby saving time . however , a full - thickness lesion can not be obtained , occasionally resulting in incomplete removal of the capsule . furthermore , ster can not be performed in some parts of the stomach . to our knowledge , this is the first published case of news in korea . in the present case , furthermore , the time taken for the entire procedure , including the laparoscopic and endoscopic procedures , was less than 40 minutes . during the dissection procedure , the suture line was identified laparoscopically , which suggests that a spacer ( surgical sponge ) is not always necessary in news . by omitting this step , we were able to save time . in summary , this is the first case of news for gist of the stomach performed in korea . further studies are required to confirm if news can be established as a standard procedure for gastrointestinal tumors . | laparoscopic wedge resection of the stomach is a widely accepted treatment for primary resectable gastrointestinal stromal tumors ( gists ) .
however , it is difficult to determine the appropriate incision line from outside of the stomach , and many attempts have been made to avoid unnecessary resection of unaffected gastric tissues . recently
a technique called non - exposed endoscopic wall - inversion surgery ( news ) was introduced to avoid exposure of gist to the peritoneum . here
, we describe the first published case of news for gist of the stomach practiced in korea . |
congenital coarctation of the aorta is a narrowing of the descending aorta which typically is located at the ligamentum arteriosum just distal to the left subclavian artery . this condition may be undiagnosed until adult life , when the clinical presentation most often is high blood pressure ( bp ) in both or more seldom in only one of the upper extremities . other typical clinical manifestations may include headache , fatigue on exertion , and bilateral lower limb claudication . coarctation of the aorta occurs in 5 - 8% of cases of congenital heart defects . this condition may occur along with ventricular septal defect and other related heart defects , or may occur isolated . in rare cases , severe trauma and injury may lead to coarctation of the aorta . in extremely rare cases , severe atherosclerosis or inflammatory diseases of the aorta may cause narrowing of the artery leading to aortic coarctation . a 57-year - old patient was referred to our outpatient clinic by his primary care physician because the 12-lead ecg demonstrated left ventricular ( lv ) hypertrophy . twenty - two years earlier , the patient had been referred for cardiological examination due to a cardiac systolic murmur . at that time , his bp was 98/50 mmhg , and simultaneous and equal radial and femoral pulses were described . no medical or cardiovascular history or cardiovascular risk factors were present , and the patient had no signs of genetic disorders . at the present consultation , the patient confirmed the absence of any cardiovascular symptoms . transthoracic echocardiography showed a non - dilated , hypertrophic left ventricle [ figure 1a and b ] with end - diastolic interventricular septal thickness of 21 mm , end - diastolic lv posterior wall thickness of 12 mm , and an estimated lv mass of 449 g ( lv mass index 214 g / m ) . the lv ejection fraction was 50% . except for a mild aortic regurgitation ( in a normally shaped tricuspid aortic valve ) and a dilatation of the ascending aorta of 40 mm a continuous wave doppler examination from the suprasternal notch showed a peak systolic pressure gradient in the thoracic descending aorta of 80 mmhg without diastolic run - off [ figure 1c and d ] , indicating a severe obstruction at the classical site of a coarctation . multislice computed tomographic ( ct ) angiography confirmed the finding of severe coarctation of the aorta . the ct scan demonstrated that both subclavian arteries originated distal to the severe coarctation , explaining the normal bp in both arms [ figure 2 ] . moreover , a ct scan of the cerebrum revealed the vessels in the circle of willis giving rise to numerous collaterals in the brain circulation . 57-year - old male was referred to our outpatient clinic because the 12-lead ecg demonstrated left ventricular ( lv ) hypertrophy that was later diagnosed as due to congenital coarctation of the aorta . transthoracic echocardiography ( a ) apical four - chamber view and ( b ) m - mode show left ventricle hypertrophy ( arrows ) ; ( c and d ) suprasternal views show the narrowing in the thoracic descending aorta ( arrow ) and the continuous wave doppler curve without diastolic run - off ( arrow ) . 57-year - old male was referred to our outpatient clinic because the 12-lead ecg demonstrated left ventricular ( lv ) hypertrophy that was later diagnosed as due to congenital coarctation of the aorta . we report an uncommon case of congenital coarctation in a 57-year - old man without the clinical signs of coarctation . because of the uncommon location of the aortic narrowing with both the right and left subclavian arteries originating distal to the area of coarctation , the bp was equally low in both upper extremities . the present case shows that a normal brachial bp does not rule out severe coarctation and should be considered in apparently normotensive patients presenting with a systolic murmur or target organ damage , in this case severe lv hypertrophy . uncorrected coarctation of the aorta in adults predisposes to congestive heart failure , aortic dissection and rupture , stroke , cerebral hemorrhage , and infective endocarditis . therefore , an early diagnosis is important , and the present case emphasizes the use of suprasternal view as a part of a standard diagnostic echocardiography . treatment options include surgical repair or balloon angioplasty with or without stent implantation . taking the atypical location , extent , and complexity of the lesion into account , | the present case shows that a normal brachial blood pressure ( bp ) does not exclude severe coarctation and should be considered in normotensive patients presenting with a systolic murmur and/or unexplained severe left ventricular hypertrophy .
congenital coarctation of the aorta is a narrowing of the descending aorta , usually located distal to the origin of the subclavian artery , causing hypertension in the upper part of the body .
this condition may be undiagnosed until adult life where the clinical presentation most often is high bp in the upper extremities . a 57-year - old patient with severe aortic coarctation and left ventricular hypertrophy presented with normal brachial bp .
however , standard suprasternal view by echocardiography indicated coarctation .
multislice computed tomographic ( ct ) angiography revealed an uncommon location of the aortic narrowing with the right and left subclavian arteries originating below the area of coarctation , explaining the equally low bp in both upper extremities . |
stroke refers to cerebrovascular bleeding and a neural disease caused by nontraumatic
reasons and is accompanied by brain damage or functional loss of lower body muscles on the
paretic side1 , 2 . despite the development of modern medicine , economic growth , and
widening interests in health , its occurrence is increasing quickly due to unbalanced
lifestyles , environmental pollution , and excess stress in fast - paced societies1 , 2 . it
has been reported that loss of motor ability and balance due to stroke can limit some daily
living activities such as walking and may lead to secondary injury like falls . generally ,
gait in stroke patients is characterized by reduced gait parameters3,4,5 , and decreased gait function following stroke in particular is known
as the fundamental reason why patients fail to safely return to society6,7,8 . yang et al.9 reported that because
hemiplegia patients with lesions support more than 60% of the load on the non - paretic limb
during standing , it could result in an asymmetric gait pattern . they also reported that a
stroke patient group showed lower gait velocity , stride time , stride length , and cadence
compared with a group of healthy elderly . grasies10 and vattanasilp et al.11 showed that patients with stroke tend to reduce the range of motion
( rom ) of paretic lower limb joints during walking , while fonseca et al.12 reported that increased stiffness of the hip joint can
reduce energy efficiency , which results in limited walking and running movement . in
addition , turnbull et al.13 , who analyzed
the gait cycles of eight elderly hemiplegia patients for ten years , reported that the
patients showed increased double support time and decreased single support time during
walking , indicating that patients tended to walk as slowly and stably as possible to secure
stability . as reported from previous studies , the predominant characteristic of hemiplegia patients
with stroke is the difficulty with walking due to weakened lower limb muscles and imbalance . therefore , many researchers have conducted studies focusing on the recovery of gait ability
as the ultimate purpose of rehabilitation of patients with stroke14,15,16 . pilates exercise is also called contrology and it is based on the
idea of muscle control . it focuses to make a neutral spine of body to prevent excess flexion
and extension of the spine when walking upright17 ,
18 . since pilates exercise has been
shown to have positive effects on development of muscular strength and endurance and
improvement of flexibility , it has been used not only for exercise programs for healthy
adults but also for rehabilitation for the elderly19 ,
21 . moreover , unlike other exercise
programs , pilates exercise can be performed with various tools to adjust the fitness level
for the elderly , who have weaker physical strength and it can be performed at home without
having to visit a rehabilitation center22 , 23 . as pilates is reported to develop the
deep core muscles , which helps to improve the stability of spine , reduce back pain , and
control the pelvis and hip joints24,25,26,27,28,29,30 ,
it is thought to have a positive influence on gait ability , and many researchers have
actually reported the effectiveness of pilates exercise on gait ability for the elderly17 , 18 , 21 . despite the various positive effects of pilates , however , it is still not widely applied to
stroke patients . therefore , the purpose of this study was to investigate the effects of an
8-week program of pilates exercise on gait in chronic hemiplegia patients and to determine
whether or not it can be used for rehabilitation in poststroke patients . twenty poststroke participants ( age , 66.1 4.4 yrs ; height , 162.3 8.3 cm ; weight , 67.4
12.3 kg ) were recruited for this study . the exclusion criteria for the poststroke
participants included moderate / severe chronic white matter disease on mri or orthopedic and
other gait - influencing diseases such as arthrosis or history of lower - extremity joint
replacement . participants who were involved in other studies or rehabilitation programs were
also excluded from this study . the objective and requirements of this study were explained
to all participants , and written informed consent was obtained from each participant prior
to participation . the university s institutional review board approved the study
protocol . after completing participants selection , the participants were randomized into two matched
number groups : the pilates exercise group ( eg ) and control group ( cg ) . during the
intervention period , the eg performed pilates exercise , while the cg did not perform any
kind of exercises or receive any treatment . the pilates exercise program used in this study was conducted by two certified pilates
instructors and one physical therapist three times a week , 60 minutes per session , for 8
weeks . the exercise was composed of warm - up exercise , the main exercise , and cool - down
exercise . for improving core muscles stability , breathing exercises were conducted in a
sitting posture before and after the main exercise . the details of the program are provided
in table 1table 1.pilates exercise programprogramwarm - up exercise1 . breathing : 8 sets10 min2 . spine stretch side : 8 setsexercise2 . draw a sword : 8 sets40 min3 . swan : 8 sets . in order to investigate the effects of the 8 weeks of pilates exercise , a 3-d motion
analysis with 8 infrared cameras ( oqus , qualisys , sweden ) was performed twice ( a week before
and after the pilates exercise period ) . the subjects were required to wear black spandex
shorts , a dark t - shirt , and a pair of walking / running shoes during data collection . to
identify lower limb movements , 12 reflective markers were attached to the lower body . after
sufficient warm - up , each subject was asked to walk on a treadmill ( instrumented treadmill ,
bertec , usa ) , and his / her walking trials were captured with sampling rate of 100 hz . the
cameras were positioned around the treadmill for sufficient tracking redundancy and were
calibrated using the nlt ( non - linear transformation ) method . the treadmill speed was set at
each subjects preferred speed which was measured before the experiment . each subject was
recorded while walking for 30 seconds , and five strides from the middle of the recording
were used for analysis . to evaluate the asymmetric pattern of gait parameters , the asymmetry index proposed by
robinson et al.31 was
used . xparetic and xnon - paretic are the values of a gait parameters
recorded for the paretic and non - paretic limbs , respectively . to verify the effect of the 8-week pilates exercise on the gait of poststroke patients , the
two - way anova with repeated measure was used , and statistical significance was set at
=0.05 . the gait parameters and asymmetry indexes before and after the 8 weeks of exercise are
presented in tables 2 and 3table 2.kinematic gait parameters between exercise periodsvariablescontroltrainingpre - trainingpost - trainingstride length ( cm)33.25 12.9043.91 19.35stride time ( s)1.52 0.361.40 0.32stride velocity ( cm / s)21.54 3.4131.48 12.81step length ( cm)paretic17.22 4.2424.63 8.25non - paretic16.03 8.6919.28 11.28hip rom ( deg)paretic22.55 5.9122.77 6.84non - paretic26.01 10.4330.61 5.47*knee rom ( deg)paretic25.30 12.5520.38 3.08non - paretic48.39 8.8952.03 8.72*ankle rom ( deg)paretic12.14 2.8311.67 6.76non - paretic14.69 2.3919.96 6.07values are group mean standard deviation . * significant difference between pre- and
post- pilates training . significant difference between groups
( p<0.05)table 3.asymmetry indexes of kinematic gait parameters between training periods ( unit :
% ) variablescontroltrainingpre - trainingpost - trainingpre - trainingpost - trainingstep length28.2 25.733.1 35.039.3 29.237.2 33.5hip rom42.4 37.944.8 34.735.5 24.331.9 20.0knee rom67.6 51.068.1 40.871.4 48.765.9 45.4ankle rom52.1 40.150.9 47.752.2 36.148.4 21.0values are group mean standard deviation .. for the gait parameters , increased patterns were found for all variables and
statistical significances were found for stride length , gait velocity , knee rom , and hip rom
( table 1 , p<0.05 ) . for the asymmetry
indexes , insignificant improvements were found for all variables ( table 2 , p>0.05 ) . significant difference between groups
( p<0.05 ) values are group mean standard deviation . the main purpose of this study was to examine the effectiveness of an 8-week pilates
exercise on walking in poststroke patients and to provide guidance for physical therapy
whether or not the exercise can be used for rehabilitation in poststroke patients . gait in
stroke patients is characterized by reduced temporospatial variables , reduced rom of lower
extremity joints , and asymmetry in the lower extremities3,4,5 . in this study , it was proved that an 8-week pilates exercise
program effectively improved patients gait parameters . since gait speed is easy to measure and a reliable outcome of rehabilitation , it has been
widely used in studies on stroke patients3 , 30 . gait speed is increased when stride
length is increased or stride time is decreased . in this study , the pilates exercise group
showed a statistically significantly improved gait speed , whereas the control group did not
( table 1 , p<0.05 ) . the subjects in the
pilates exercise group seem to have increased their gait speed by increasing their stride
length after the exercise period ( table 1 ,
p<0.05 ) . this is probably because the pilates exercise developed the deep muscles , such
as the transverse abdominis and internal oblique that take charge of the stability of the
body and this may have helped to improve the stability of spine and the muscular strength
and flexibility of the pelvis and hip joints24,25,26,27,28,29 . unlike general pilates exercise , the
pilates exercise used in the present study included lower limb strengthening exercise . this
exercise may strengthen the quadriceps , gluteus medius , adductor magnus , gastrocnemius , and
anterior tibialis , which can help to increase stride length . the effect of strengthening the
deep muscles is also seen in the increased rom of the lower extremity joints in the pilates
exercise group after the exercise period ( table
1 , p<0.05 ) . another gait characteristic of stroke patients is that over 60% of weight is loaded on the
lower limb on the non - paretic side during walking , so they show asymmetrical gait in
temporospatial parameters9 . the present
study showed no statistical differences in the asymmetry indexes of variables in either
group . in the case of the exercise group , however , insignificantly improved symmetric
patterns were found ( from 5.3% to 10.1% ) after the exercise period ( step length , 5.3% ; hip
rom , 10.1% ; knee rom , 7.7% ; ankle rom , 7.3% ; p>0.05 , table 2 ) . the lack of statistically significant improvements in asymmetry indexes
was probably the result of a limited number of subjects or a short exercise period . in this
study , we chose eight weeks as the exercise period because many previous intervention
studies for elderly have shown the effectiveness of 8-week interventions . as pilates
exercise strengthens the deep muscles , however , it is thought to require a longer exercise
period compared with resistance training , cardiovascular exercises , or underwater exercises ,
which strengthen the superficial muscles . this issue should be examined in a follow - up
study . in conclusion , this study proved the effect of pilates exercise , which has not been used as
a means of intervention to rehabilitate motor functions of poststroke patients . the 8-week
program of pilates exercise had a positive influence on improving the gait ability of
poststroke patients , and the intervention could be applied to poststroke patients with
various levels of physical disability by adjusting the intensity of exercise . | [ purpose ] the purpose of this study was to investigate the effects of an 8-week program
of pilates exercise on gait in chronic hemiplegia patients and to determine whether or not
it can be used for rehabilitation in postsrtoke patients . [ subjects and methods ] twenty
individuals with unilateral chronic hemiparetic stroke ( age , 66.1 4.4 yrs ; height , 162.3
8.3 cm ; weight , 67.4 12.3 kg ) participated in this study and were randomly allocated
equally to either a pilates exercise group or a control group . to identify the effects of
pilates exercise , a 3-d motion analysis with 8 infrared cameras was performed .
[ results ]
for the gait parameters , improvements were found in the pilates exercise group for all
variables , and statistical significance was observed for stride length , gait velocity ,
knee range of motion and hip range of motion . for the asymmetry indexes ,
insignificant
improvements were found for all variables in the pilates exercise group .
[ conclusion ] in
conclusion , an 8-week program of pilates exercise had a positive influence on improving
the gait ability of poststroke patients , and the intervention could be applied to
poststroke patients with various levels of physical disability by adjusting the intensity
of training . |
infantile hemangioma ( ih ) is the most common benign tumor of infancy,1 affecting nearly 10% of children under 1 year old and 30% of premature babies . prematurity , older maternal age , preeclampsia , and multiple gestations have been suggested to be risk factors of the development of ih.2 approximately 60% of hemangiomas are located at the head and neck regions,3 and they present with a 2.4:1 ratio of females to males.4 their large size , facial location , and/or segmental morphology are the major risk factors associated with the development of complications including ulceration , functional impairment , and permanent disfigurement.5 as most ihs can involute spontaneously , there is still great controversy over the management of ih . however , consensus was achieved in that when the tumor gives rise to infection , ulceration , necrosis and bleeding resulting in serious disfigurement , dysfunctions and even threatening life , treatment is urgently required . the lesions that potentially impair vital function or cause life - threatening complications are described as alarming hemangiomas.6 there is no gold standard for alarming hemangioma . recombinant interferon alpha ( ifn- ) , an inhibitor of angiogenesis , has been used successfully in treating complicated ih , particularly in hemangiomas that have failed to respond to oral propranolol.7,8 however , concerns of irreversible neurotoxicity , especially spastic diplegia , handicap the application of ifn-.911 here , we present a study where we treated eleven chinese cases of alarming hemangioma with ifn-2a . the study was approved by the ethics committee at the ninth people s hospital , shanghai jiao tong university ( shanghai , people s republic of china ) . eleven consecutive infants ( nine girls and two boys ) with alarming hemangiomas in the head and neck region who failed to respond to a 2-week course of propranolol or corticosteroid therapy , and who received a subcutaneous injection of ifn- in our institution between january 2009 and december 2010 were enrolled in this study . all patients had large ( > 5 cm in diameter ) or multiple hemangiomas ( 2 sites ) in the head and neck region ; in three patients , the hemangioma caused airway obstruction . the demographic data regarding each patient s age , sex , site of lesion , and duration of treatment are shown in table 1 . the diagnosis of hemangiomas was established mainly by obtaining the patient s history , noting clinical manifestations , and performing a physical examination . all patients underwent ultrasonography , and four patients had a magnetic resonance imaging ( mri ) examination to obtain more details of the lesion ( when the diagnosis was uncertain , mri was performed ) . after informed consent had been obtained from the parents according to institutional guidelines , the patients were treated with ifn-2a for a period of 24.5 months . ifn-2a was administrated subcutaneously once daily at a dose of 310 units / m per day . periodical baseline electrocardiogram , neurologic examination , and laboratory evaluations of hepatic transaminases were performed . the size and extent of the deep - seated lesions were monitored by serial color doppler ultrasonography ; the percent change of the superficial lesions compared the pre- and posttreatment tumor size using photographs . the patients were observed at an interval of 3 weeks during the therapy course ; follow - up visits were continued for up to 2 years . the final results were assessed by two other physicians from the department of oral oncology , depending on the clinical examinations , photographs , and doppler ultrasonography taken before and after treatment ; the response to ifn-2a therapy was evaluated according to the following scale ( that was modified following achauer et al12 ) : scale 1 , poor response ( shrinkage 0%25% ) ; scale 2 , fair response ( shrinkage 26%50% ) ; scale 3 , good response ( shrinkage 51%75% ) ; scale 4 , excellent response ( shrinkage 76%100% ) . eleven consecutive infants ( nine girls and two boys ) with alarming hemangiomas in the head and neck region who failed to respond to a 2-week course of propranolol or corticosteroid therapy , and who received a subcutaneous injection of ifn- in our institution between january 2009 and december 2010 were enrolled in this study . all patients had large ( > 5 cm in diameter ) or multiple hemangiomas ( 2 sites ) in the head and neck region ; in three patients , the hemangioma caused airway obstruction . the demographic data regarding each patient s age , sex , site of lesion , and duration of treatment are shown in table 1 . the diagnosis of hemangiomas was established mainly by obtaining the patient s history , noting clinical manifestations , and performing a physical examination . all patients underwent ultrasonography , and four patients had a magnetic resonance imaging ( mri ) examination to obtain more details of the lesion ( when the diagnosis was uncertain , mri was performed ) . after informed consent had been obtained from the parents according to institutional guidelines , the patients were treated with ifn-2a for a period of 24.5 months . ifn-2a was administrated subcutaneously once daily at a dose of 310 units / m per day . periodical baseline electrocardiogram , neurologic examination , and laboratory evaluations of hepatic transaminases were performed . the size and extent of the deep - seated lesions were monitored by serial color doppler ultrasonography ; the percent change of the superficial lesions compared the pre- and posttreatment tumor size using photographs . the patients were observed at an interval of 3 weeks during the therapy course ; follow - up visits were continued for up to 2 years . the final results were assessed by two other physicians from the department of oral oncology , depending on the clinical examinations , photographs , and doppler ultrasonography taken before and after treatment ; the response to ifn-2a therapy was evaluated according to the following scale ( that was modified following achauer et al12 ) : scale 1 , poor response ( shrinkage 0%25% ) ; scale 2 , fair response ( shrinkage 26%50% ) ; scale 3 , good response ( shrinkage 51%75% ) ; scale 4 , excellent response ( shrinkage 76%100% ) . all eleven patients received the treatment for a duration of 24.5 months ( median : 3 months ) . eight patients had received medication for 3 months , one for 4.5 months , and two for 2 months . the age at initiation of ifn-2a therapy ranged from 3 days to 8 months ( median : 4 months ) . it was observed that the most apparent regression of tumors happened at 1 month after medication administration ; the tumor shrank further with the red color fading . nine patients ( 82% ) achieved scale 4 ( figures 1a , b , 2a , and b ) and two patients ( 18% ) achieved scale 3 . the adverse effects included low fever ( six cases ; 54.5% ) , diarrhea ( two cases ; 18.2% ) , and anorexia ( one case ; 9.1% ) , as well as neutropenia and high levels of aminotransferases to varying degrees , which resolved after stopping the medication . neurotoxicity such as spastic diplegia and other motor developmental disturbances were not found in this series . no patients experienced the rebound phenomenon , and no patients required the restarting of ifn or another therapy in the following 2 years . in this series of eleven infants with alarming hemangiomas treated with ifn-2a , rapid and good response to treatment was obtained with few reversible adverse effects . in addition to its antiviral effect , ifn- was also used as an inhibitor of angiogenesis given its antiangiogenic properties.13 since its efficacy in pulmonary hemangiomatosis was first reported by white et al14 in 1989 , ifn- was chosen as a therapeutic modality for hemangiomas , especially for life - threatening cases or steroids - insensitive patients . according to other reports,1517 the rate of response to ifn in hemangiomas varies from 80%100% , which is very similar to our overall response rate of 100% ; our result was as good as those found in these studies ( p>0.05 ) , and the duration time was shorter ( p<0.05 ) . the common adverse effects of ifn include influenza - like symptoms of fever , somnolence , anorexia , diarrhea or constipation , and a high level of aminotransferases ; these symptoms are always slight and they can be reversed following the discontinuation of ifn . although exceptional , neurotoxicity is still the main concern in the treatment of ih with ifn . epilepsy , spastic diplegia , and lower limb disability had been reported after ifn injection . chang et al16 first reported in 1997 that one patient who received treatment with ifn-2b developed mild gross motor delay , which improved 2 months after the cessation of therapy . the pathogenesis of ifn - related neurotoxic effects is unclear , but given its potential seriousness , many experts have limited the use of ifn- for alarming hemangiomas . according to a meta - analysis of a large sample , which was carried out by michaud et al9 in 2004 , eleven of 441 children ( 2.5% ) receiving ifn therapy for the treatment of vascular lesions developed spastic diplegia ; perhaps there were not enough patients in our study to see this outcome , or it is also possible that the short duration of therapy decreased the risk for these children . considering that the durations we used were only 24.5 months ( median : 3 months ) , we suggest that the short - term use of ifn- should be safe . the current treatments of ihs include drug therapy , cryosurgery , laser therapy , and surgical excision . oral corticosteroids ( for example , prednisolone , prednisone ) used to be the mainstay of therapy for hemangiomas , but their clinical application was limited by the adverse effects such as cushing s syndrome and growth retardation . since the impressive effect of propranolol in treating hemangioma was reported by laut - labrze et al18 in 2008 , many studies ( including our own experiences ) have confirmed its effectiveness and have reported few side effects in hemangiomas.1922 nowadays , propranolol has been our first - line medicine for treating ih , but there are still some patients with alarming hemangiomas who may be concomitant with a contraindication for propranolol such as asthma , cardiac failure , or failure to respond to this medicine . for these cases , the rapid and impressive responses , as well as the few side effects observed in this series without relapse after treatment with ifn-2a prompts us to suggest that the short - term ( < 4.5 months ) use of ifn-2a can be chosen as an alternative option for alarming hemangiomas in the head and neck region , which are resistant to corticosteroid or propranolol treatment . | objectiveto evaluate the efficacy and adverse effects of interferon-2a in the treatment of alarming infantile hemangiomas in the head and neck region.patients and methodsfrom january 2009december 2010 , a subcutaneous injection of interferon-2a was applied to eleven infants with giant multifocal or segmental hemangiomas at a dose of 3 million units / m2 per day .
all patients did not respond to propranolol or corticosteroids .
the age at initiation of interferon-2a therapy ranged from 3 days to 8 months ( median : 4 months ) .
the duration of therapy ranged from 24.5 months ( median : 3 months ) .
eight patients received medication for 3 months , one patient for 4.5 months , and two patients for 2 months.resultsnine patients had a reduction in tumor mass of 95% ; two patients tumors decreased in size by 75% .
the overall response rate was 100% .
the main adverse effects included fever , diarrhea , and anorexia , which resolved after stopping the medication .
no serious adverse effect was observed.conclusionshort-term treatment with interferon-2a can be used as a safe and effective treatment for alarming infantile hemangiomas that are resistant to propranolol or corticosteroids , and that endanger the proper functioning of the affected organ or the patient s life . |
patients with foreign bodies in their gastrointesti - nal tract are a common occurrence in emergency medicine ( 1 , 2 ) . the majority of these foreign bodies transit through the gastrointestinal system without any complication , and have more than a 90% chance of passing into the small intestine if they get to the stomach ( 1 - 3 ) . it is very likely that things the size of coins would pass through the small intestine without any complication ; however , objects larger than 2 cm in diameter are unlikely to pass through the pylorus , and objects witch are more than 6 cm in length are often caught in the pylorus easily . in the end , only 1% of ingested foreign objects manage to pierce the gastrointestinal tract ( 2 ) . we present a case of a 21-year - old female who , in the month prior to admission to our institution , had been treated multiple times in emergency departments at various hospitals referring epigastric abdominal pain and constipation . the treatment she received was based on the resolution of constipation , antacids and dietary recommendations . the patient was admitted to our emergency department after 1-month of upper quad - rant abdominal pain radiating to the left upper quad - rant , additionally she cited a weight loss of 5 kg in the last month . her symptoms had become more aggravated two days prior to admission with unquantified fever , chills and night sweats . a review of the family history revealed no significant disease . a physical examination revealed vital sings with a heart rate of 102 beats per minute , respiratory rate 16 breaths per minute , temperature of 37c , blood pressure of 110/56mmhg , the abdomen was distended , the percussion was tympanic , the bowel sounds were de - creased . additionally we found a painful , not well limited , mass adhered to deep planes in the abdominal palpation without peritoneal irritation or other alterations . a work - up started with blood chemistry , cbc , and we requested a ct of the abdomen due to clinical examination findings . the preclinical showed no elevation of acute phase reactants and no electrolyte disturbance , the ct scan evidenced an irregular , small collection in the gastric antrum and behind the left rectus muscle of approximately 30x11x16 mm , which was associated with increased density of the surrounding fat . inside this area , the end of a tubular , hypodense structure ( compatible with foreign body ) was visible coming out from the gastric lumen through the wall , which was perforated ( figure 1 and 2 ) . the findings on ct were dis - cussed with the patient who was questioned again for further information to determine the origin of the foreign body . she ad - mitted having a major depressive episode 6 months ago and attempted of suicide . she had ingested a plastic stick from a candy ( chocmelo ) ( figure 3 ) . she was referred to general surgery service who decided to take the patient immediately to the surgery room and performed an exploratory laparotomy . during the procedure , they found a perforation in the anterior wall of the stomach between the gastric body and the antrum , it was associated with a great inflammatory plas - tron generating a gastrocolic ligament edema . they therefore decided to perform a subtotal gastrectomy removing 50% of the stomach and then roux - y reconstruction . perforation of the gastrointestinal tract by purposeful ingestion of foreign bodies in adults is usually secondary to accidental ingestion which is often caused by foreign bodies included in meals ( 1 , 3 ) . predisposing factors include prostheses , patients with a history of psychosis or psychiatric disease , alcohol abuse and being in prison . objects that are frequently ingested are the teeth , toothbrushes and foreign bodies from the diet such as fish and chicken bones . the most commonly affected sites are the distal ileum , sigmoid colon or rec - tum ( 1 , 2 ) . patients with perforation of the stomach , duodenum , or large intestine , usually ingest larger objects ( 2 ) . the clinical presentation of gastric perforation by a foreign body tends to be hidden , with unspecific gastrointestinal symptoms such as chronic abdominal distension , decreased appetite , and epigastric mass sensation , usually with normal laboratory results ( 1 , 3 ) . the patient in this case had multiple visits to the doctor after the foreign body ingestion , and was treated for peptic ulcer disease and constipation . important to highlight is , the patient did not mention any foreign body ingestion until she was confronted with the scan results . enhanced ct of the superior abdomen in venous phase , which demonstrates in sagittal ( a ) and coronal planes ( b ) the tubular air filled foreign body ( white arrow ) penetrating the gastric wall ( arrow heads ) , associated with peripheral fat stranding ( curved arrow ) . enhanced ct of the superior abdomen in venous phase , which demonstrates in sagittal ( a ) and axial planes ( b ) the tip of the tubular air filled foreign body ( white arrow ) in the peritoneal fat surrounded by a fluid collection with an enhancing wall ( arrow heads ) type of candy whose stick was reportedly swallowed finally , we made a search in the literature and we surprisingly found that when there is gastric or duodenal perforation by a foreign object the clinical findings are similar to our case , for instance in the vast majority there was a slow course and latency period before presenting with the acute phase . a common finding besides gastric perforation was an inflammatory plastron or abscess , and was always treated with laparotomy and in some limited cases with minimal laparotomy plus abscess drainage and suture of the primary defect in the stomach and in two cases a patch of omentum was used ( 4 , 5 ) . in the case of our patient a subtotal gastrectomy of 50% with roux - y reconstruction was performed due to severe transmural inflammation , accompanied by multiple abscesses and a severe submucosal edema . the patient had a favorable outcome without any complications and has gained some of the lost weight . after treatment , gastric perforation by a foreign object may have a slow course rather than presenting acute abdomen . gastric perforation by a foreign object the picture may have a slow course rather than presenting acute abdomen . the realization of a proper physical examination in the emergency department is key to an accurate diagnosis . all authors passed four criteria for authorship contribution based on recommendations of the international committee of medical journal editors . | this is a case report of foreign body ingestion in a suicide attempt resulting in gastric perforation and phlegmon formation during a subsequent 6 month period that eventually required surgical intervention .
the patient had a prolonged course because she did not report a history of foreign body ingestion and the initial evaluating physicians had no suspicion about possible foreign body ingestion and may have missed important findings on physical examination .
gastric perforation by a foreign object may have a slow course rather than presenting acute abdomen .
the realization of a proper physical examination in the emergency department is key to an accurate diagnosis . |
fournier 's gangrene is a rare and often fulminant necrotising fasciitis of the perineum and genital region frequently due to a synergistic polymicrobial infection . the condition was first described as a disease of young adults of unknown cause by fournier in 1888 . others are local conditions like perianal suppurations and urinary tract infection ( uti ) complicating obstructive uropathy . the study reviewed fournier 's gangrene in relation to aetiology , presentation , management , and outcome . the study reviewed all patients managed for fournier 's gangrene in umth over a 6-year period between january 2007 and december 2012 . a written informed consent was obtained from all patients , and written permission was given by the hospital medical and ethical committee . the diagnosis of fournier 's gangrene ( figures 1 and 2 ) was made on clinical assessment . patients were resuscitated where necessary with antibiotics ( metronidazole and ceftriaxone ) , intravenous fluids , analgesics , and antitetanus prophylaxis , blood transfusions were also given . investigations carried out included packed cell volume , urinalysis , blood sugar and chemistry , wound swab and biopsy for microbial culture , and hiv screening . wound debridement was done for all patients ( some more than once ) under general or spinal anaesthesia . the definitive management took the form of healing by secondary intention , by secondary closure , skin grafting , and skin flap rotation . a total of 43 patients were seen over the study period with five excluded on account of incomplete data , leaving 38 for detailed analysis . all patients were males aged 2 weeks to 80 years , with a mean of 37.82 years . clinical features at presentation were scrotal pain and swelling in 36 ( 94.74% ) , fever in 19 ( 50.00% ) , scrotal wound discharge in 19 ( 50.00% ) , vomiting in 5 ( 13.16% ) , and dysuria in 4 ( 10.53% ) . table 2 showed predisposing conditions , with uti secondary to obstructive uropathy ( bph / urethral stricture ) in 11 ( 28.95% ) patients , peri - anal suppuration , and hiv , in 8 ( 21.05% ) each . eleven ( 28.95% ) patients were anaemic at presentation ( pcv < 30% ) . wound biopsy and culture revealed mixed organisms ( aerobe and anaerobe ) in 27 ( 71.05% ) , single isolates in 6 ( 15.79% ) , and sterile cultures in 5 ( 13.16% ) . twenty - six ( 68.42% ) had blood transfusions , 1 or 2 units in 16 ( 42.11% ) patients , while 10 ( 26.32% ) patients had 3 or 4 units transfused . twenty - eight patients ( 73.68% ) had wound debridement once or twice while 9 ( 23.68% ) patients had 3 or more serial debridements . twenty ( 52.63% ) had flap rotation for skin cover , 4 ( 10.53% ) had skin graft , while in 12 ( 31.58% ) patients skin was covered by secondary closure , and 2 ( 5.26% ) were allowed to heal by secondary intention . the average hospital stay was 4 weeks with a range of 1 to 7 weeks . there were 6 ( 15.79% ) mortalities of which 4 ( 10.53% ) were hiv positive , 1 ( 2.63% ) was diabetic , while 1 ( 2.63% ) was both diabetic and hiv positive . the causes of death were septicaemia and shock in 4 ( 10.53% ) , diabetic ketoacidosis , and acute renal failure in 1 ( 2.63% ) each . fournier 's gangrene is a rare and often fulminant necrotising fasciitis of the perineum and genital region frequently due to a synergistic polymicrobial infection . all patients are males with peak age group 3039 years . clinical features of scrotal pain and swelling , fever , and scrotal discharge and sloughing were in keeping with similar studies . systemic diseases associated with fournier 's gangrene were diabetes , hiv , and alcoholism ; however , this study did not find alcoholism to be associated with fournier 's . local conditions like peri - anal suppuration and uti the management of this condition requires urgent and aggressive resuscitative methods with broad spectrum antibiotics , which covers both aerobes and anaerobes , as well as fluids , which may include blood transfusion if necessary . all patients had serial wound debridement in keeping with the standard in the management of this condition . some authors advocate suprapubic cystostomy and diverting colostomy to prevent wound contamination , and in this we had no cause to undertake such procedures . wound closure is advocated once the wound is clean and this reduced hospital stay . in this study the majority of the patients had wound closure ( in keeping with the previous principle ) , by secondary closure , skin grafting , and flap rotation . the prognosis is good especially in children and young adults [ 1214 ] ; however , when it is associated with systemic diseases such as hiv ( figure 3 ) and uncontrolled diabetes , the prognosis is dismal as evidenced by high mortality rate in this study among hiv and diabetic patients , as opposed to findings by other authors that diabetes [ 1518 ] has no adverse effect on survival in the disease . | background .
fournier 's gangrene is uncommon but increasingly being seen over the last two decades probably due to increasing socioeconomic problems including an upsurge in hiv infection especially in the tropics .
patients and methods .
the study retrospectively reviewed all patients with fournier 's gangrene managed in umth between january 2007 and december 2012 .
results .
thirty - eight males aged 2 weeks to 80 years ( mean 37.82 ) were reviewed , with most aged 3039 years ( 13 ( 34.21% ) ) .
clinical features were scrotal pain and swelling , 36 ( 94.74% ) , fever , 19 ( 50.00% ) , and discharging scrotal wound , 19 ( 50.00% ) .
the predisposing conditions were uti secondary to obstructive uropathy in 11 ( 28.95% ) , perianal suppuration , and hiv , in 8 ( 21.05% ) patients each .
wound biopsy culture revealed mixed organisms in 27 ( 71.05% ) .
twenty - six ( 68.42% ) had blood transfusions .
thirty - seven ( 97.37% ) patients had wound debridement .
twenty ( 52.63% ) had flap rotation for skin cover .
there were 6 ( 15.79% ) mortalities , of which 4 ( 10.53% ) were hiv positive , 1 ( 2.63% ) was diabetic , and 1 ( 2.63% ) was both diabetic and hiv positive .
conclusion .
fournier 's gangrene is a fulminant synergistic necrotising fasciitis of the perineum and genitalia with poor prognosis especially when associated with hiv and diabetes , requiringprompt and aggressive management for good outcome . |
from october 13 through december 3 , 2008 , a total of 555 small mammals were trapped in morogoro , tanzania ( 6.84s , 37.65e ) . this period corresponds to the end of the dry season , when the density of m. natalensis mice is usually high ( 7 ) . sherman traps were set in habitats where these mice were expected to occur in high density ( 7 ) . dried blood samples were preserved on calibrated , prepunched filter papers . blood samples ( 1 punch 15l / rodent ) were eluted in 300 l of phosphate - buffered saline and tested for antibodies to arenaviruses by indirect immunofluorescence antibody ( ifa ) testing using morogoro virus as antigen . in addition , total rna was extracted from another punch of blood by using 300 l of avl buffer ( qiagen , venlo , the netherlands ) . the lysate , plus 300 l of ethanol , was centrifuged in a silica column ( zymo research , orange , ca , usa ) . the column was washed with 400 l of aw1 and aw2 buffers ( qiagen ) . rna was eluted with 15 l of water . a 1-step reverse transcription pcr ( rt - pcr ) selective for the morogoro virus rna polymerase ( large [ l ] ) gene was performed as described ( 6 ) ; it was based on a pan old world arenavirus rt - pcr approach ( 8) , but primers were adjusted to detect the morogoro virus ( 6 ) . a subset of the amplicons was purified and unidirectionally sequenced by using morol3359-fwd primer ( 6 ) . old world arenaviruses and 2 representatives of new world arenaviruses were used to estimate nucleotide and amino acid pairwise divergence ( p - distance ) with mega 4 ( 10 ) . we trapped 511 m. natalensis mice and 44 individuals from 7 other small mammal species ( table 1 ) . ifa results were positive for 58 blood samples from m. natalensis , 1 from l. rosalia , and 1 from m. minutoides mice ( table 1 ) . m. rosalia mice were trapped in woodlands , whereas m. minutoides mice were trapped in vegetable gardens and fallow fields . these results are consistent with recently reported results from a study in the same locality 20 years ago , in which mice from the genera lemniscomys and mus were seropositive for arenaviruses according to ifa with lassa virus as antigen ( 6 ) . in our 2008 study , the antibody prevalence for m. natalensis mice was 12.1% , which is low compared with 50% antibody prevalence reported for 2004 and 2007 ( 6 ) , suggesting high fluctuation of interannual or seasonal prevalence of morogoro virus in its host . species identification was confirmed by sequencing mitochondrial cytochrome b gene . using rt - pcr selective for the arenavirus l gene , we obtained positive results for 43 mice : 41 m. natalensis , 1 l. rosalia , and 1 m. minutoides . in total , the sequences derived from m. natalensis mice ( 286 bp used for the analysis ) showed 97.1%100% amino acid homology with the morogoro prototype l sequence ( genbank accession no . in contrast , the 2 sequences derived from the blood samples of l. rosalia and m. minutoides mice showed only 69.3% and 65.2% aa homology with the morogoro prototype l sequence . these sequences ( 320 bp ) were compared with sequences of the old world arenaviruses ( table 2 ) . the virus amino acid sequence from m. minutoides mice clustered at 93.7% homology with that of the kodoko virus , in the lymphocytic choriomeningitis clade ( figure ; table 2 ) : thus , the arenavirus of m. minutoides mice seems to be a strain of the kodoko virus originally isolated from 2 m. minutoides mice in guinea ( 11 ) . our finding supports m. minutoides mice as the true reservoir of kodoko virus in africa . lcmv , lymphocytic choriomeningitis virus ; lemn , virus sequenced from lemniscomys rosalia mice ( indicated by boldface ) ; minu , virus sequenced from mus minutoides mice ( indicated by boldface ) . strains and genbank accession numbers of the sequences used : dandenong ( 0710 - 2678 , eu136039 ) , ippy ( dak an b 188 d , dq328878 ) , kodoko ( kd42 , ef179865 ) , mobala ( acar 3080 , dq328876 ) , mopeia ( mozambique , dq328875 ) , morogoro ( 3017/2004 , eu914104 ) , lassa ( josiah , ay628202 ) , lcmv ( armstrong,,ay847351 ) , lujo ( nc_012777 ) , pirital ( vav 488 , ay216505 ) , pichinde ( an3739 , nc_006439 ) . sequences of arenaviruses in l. rosalia and m. minutoides mice have been deposited in genbank under accession nos . gu182412 and gu182413 , respectively . the amino acid sequence of the virus isolated from l. rosalia mice clusters with the ippy virus sequence ( figure ) . ippy virus was isolated in the central african republic from arvicanthis niloticus rodents ( 12 ) . for the portion of l gene sequenced ( 320 bp ) , the level of amino acid divergence between the 2 is 17.3% , higher than the level of divergence between other old world arenavirus species ( e.g. , 14.5% aa divergence between mobala and lassa viruses ; table 2 ) . thus , the arenavirus found in l. rosalia mice appears to be a new species of old world arenavirus . the genus lemniscomys is more closely related to the genus arvicanthis than to the genera mus and mastomys . neighbor - joining tree of old world arenaviruses , showing position of 2 arenaviruses found in blood samples of lemniscomys rosalia and mus minutoides mice ( boldface ) , based on the analysis of partial sequences of the rna polymerase gene . phylogeny was estimated by neighbor - joining of amino acid pairwise distance in mega 4 ( 10 ) . in high - density habitats of m. natalensis mice , where morogoro arenavirus transmission occurs , sympatric murine species do not seem to be secondary reservoirs for the virus . in contrast , 2 mouse species , l. rosalia and m.
minutoides , seem to be reservoirs of 2 other old world arenaviruses , 1 of which may be a new species . our study emphasizes the complementary nature of serologic and genetic - based approaches for arenavirus detection . because of the cross - reactivity of morogoro antigens with immune serum from individuals infected with other arenaviruses , a serology - only approach might have led to the conclusion that an extended set of hosts exists for the morogoro virus . , a genetics - only approach might never have indicated the hot spot of arenavirus around morogoro that was shown by ifa ( 6 ) . however , critically , genetics then allow cross - reactivity to be decomposed . our study demonstrates the presence of 3 old world arenaviruses in a single location . to date , only 5 old world arenavirus species and 17 new world arenaviruses have been recognized by the international committee for taxonomy of viruses ( 13 ) . although the likely presence of additional arenaviruses in africa has long been suggested ( our study illustrates that arenaviruses in africa may be highly diverse and demonstrates the efficiency of the recently developed pan old world arenavirus rt - pcr for identifying new old world arenaviruses ( 8) . to isolate and describe the new arenavirus of l.
rosalia mice and the strain of kodoko virus , additional sampling and genotyping are being conducted . in particular , determining the sequence of the s segment will further clarify evolutionary relationships within the old world group . | to determine the specificity of morogoro virus for its reservoir host , we studied its host range and genetic diversity in tanzania .
we found that 2 rodent species other than mastomys natalensis mice carry arenaviruses .
analysis of 340 nt of the viral rna polymerase gene showed sympatric occurrence of 3 distinct arenaviruses . |
cigarette smoking is a leading cause of preventable mortality . each day , at least 3800 adolescents in the usa try their first cigarette and 33% of teenagers that are daily smokers will die of a smoking - related condition . tobacco dependence is also the single most prevalent substance abuse disorder . in 2000 , 18.1% of total deaths in the usa were attributed to tobacco use , making it one of the leading causes of death , followed by poor diet and physical inactivity , which together are responsible for 15.2% of totals deaths , and 3% of total deaths were alcohol - related . some countries , such as england , have a decreasing tobacco - use trend , but even there , 27% of males and 24% of females reported smoking more than 20 cigarettes ( 1 pack ) a day . smoking is a risk factor for many health - related diseases , including cardiovascular disease , and it also affects brain function . it is a well - recognized risk factor for alzheimer disease ( ad ) ; research found that smokers are twice as likely to develop ad compared to those who never smoked . adverse effects of smoking on cognition are also known , including a decrease in visual search speed . smoking is related to preclinical changes in the brain , higher risk of cognitive decline , and increased risk of dementia [ 810 ] . even after the cessation of smoking , certain problems remain , such as impaired working memory . these problems are probably caused by the toxins inhaled in tobacco smoke , including vinyl chloride ( a risk factor for brain cancer ) , hydrogen cyanide , and arsenic . long - term , daily exposure to these toxins may result in altered vascular and neural processes , which probably result from tissue accumulation and/or assault . additionally , these changes express themselves by changes in grey matter ( gm ) and white matter ( wm ) volume and brain density . although gmv decreases linearly with age , global white matter does not decline with age ; however , local areas of relatively accelerated loss and preservation occur . as the world population ages , it is important to determine which brain changes are attributable to normal / healthy aging and which are caused by preventable behaviors such as smoking . a growing number of studies using the voxel - based morphometry technique have compared smokers to non - smokers in terms of the volume of white and grey matter [ 1519 ] . ( 2012 ) reported no differences in wm volume between smokers and non - smokers , whereas yu , zhao , and lu ( 2011 ) reported a regional wm volume increase . as with gmv , some studies reported smokers have smaller gmv in the dorsolateral prefrontal cortex ( dlpfc ) , while others found a smaller volume in the anterior cingulated cortex ( acc ) and thalamus . a recent meta - regression analysis showed that a higher number of smoking years was correlated with more gm atrophy in the right superior frontal gyrus , and more cigarettes smoked per day was correlated with more gm atrophy in the right superior frontal gyrus and acc , extending to the paracingulate gyrus . the following databases were searched in march / april 2015 : medline , embase , and psycinfo . the following string search was used : grey matter and voxel - based and smoking and cigarette . records were obtained when grey matter was found in the title of the article and the remaining terms were found in the abstract or in the title . male and female sample . studies that measured differences in grey matter . studies comparing smokers with non - smokers . studies that used voxel - based morphometry . articles that did not have full text or that could not be retrieved through our university libraries . we evaluated the quality of included articles by use of a modified version of the effective public health practice project ( ephpp ) quality assessment tool for quantitative studies . it is important to note that only 1 study was conducted in europe and the remaining ones were in the usa . all studies used cross - sectional design and only 1 study was not conducted in 2014 . there were large differences in the sample sizes : brody ( 2004 ) only included 36 participants , whereas fritz ( 2014 ) had 974 . none of the studies used power calculation ; therefore , the results need to be interpreted with caution . additionally , all of studies compared smokers to non - smokers , with some adding further groups for comparison . for example , franklin ( 2014 ) compared across sexes and hanlon ( 2014 ) compared the differences between young and long - term smokers . three of the studies had approximately the same number of smokers as non - smokers , but fritz ( 2014 ) had significantly more non - smokers and significant differences in demographics of the studied population . all 4 studies used voxel - based morphometry ( vbm ) , which is a neuro - imaging analysis technique that investigates focal differences in brain anatomy [ 1719,24 ] . brody ( 2004 ) also included hand - drawn regions of interest ( roi ) , which allows extraction of data for a specific structure . all images were produced by a tesla siemens scanner , and all studies used statistical parametric mapping ( spm ) , which increases the validity of conclusions because the same methodology is applied in each study and the results can not be attributed to the technology or methodology used . studies by fritz ( 2014 ) , franklin ( 2014 ) , and hanlon ( 2014 ) were scored as strong quality with moderate quality in terms of representativeness of the sample . brody ( 2004 ) was graded as moderate quality after scoring weak quality in the population component of the questionnaire . importantly , 3 studies reported significant ( p<0.001 ) differences between smokers and non - smokers in gmv , and fritz ( 2014 ) also found a significance difference ( p<0.05 ) . all studies corrected for family - wise error [ 1719,24 ] . decreased gmv in smokers compared to non - smokers was reported , but franklin ( 2014 ) and hanlon ( 2014 ) also noted increased gmv in some brain areas ( table 4 ) . overall , it is clear that smoking causes decreased gmv , but variations in the specific region affected were found as well . all 4 studies found decreased gmv in the ventrolateral prefrontal cortex of smokers [ 1719,24 ] , as well as loss of gmv in the dorsal - lateral prefrontal cortex . two studies found gm loss in the cerebellum of smokers . the only study to find differences in gmv in the olfactory gyrus was by fritz ( 2014 ) . hanlon ( 2014 ) found a decrease in gmv in the amygdala region in smokers . a decrease of thalamic gmv in smokers was found by franklin ( 2014 ) and hanlon ( 2014 ) , who also reported differences in the parahippocampal gyrus region . interestingly , hanlon ( 2014 ) also found decreased gmv in smokers , whereas franklin ( 2014 ) found greater gmv in the parahippocampus in smokers . although contradictory results in specific areas were found , these may be attributed to the differences in samples studied . future studies should consider differences between sexes and age groups as well as between smokers and non - smokers . two studies compared female and male smokers to non - smokers and found certain sex - specific differences . one found a decrease in smokers in both sexes in the ventromedial prefrontal cortex , while the other found reduced gmv in the thalamus and cerebellum in smokers of both sexes . fritz ( 2014 ) found gmv loss in the olfactory gyrus in male smokers , and did not find any area of increased gmv , which is a unique finding . franklin ( 2014 ) , on the other hand , found increased gmv in the bilateral hippocampus and the left putamen in male smokers . hanlon ( 2014 ) reported decreased gmv in younger smokers compared with a matched control group of non - smokers . compared with a matched control group of non - smokers , long - term smokers had changes in the amygdala ( t=6.03 , cluster size=601 , p=0.002 ) and left thalamus ( t=5.75 , cluster size=234 , p<0.000 ) . decreased gmv in the amygdala was not reported by other investigators . decreased gmv was found in long - term smokers in the insula , parahippocampus , and thalamus . interestingly , when they compared long - term smokers with their non - smoking matched control group , they found decreased gmv in the same areas : the insula and parahippocampus . in this group comparison , they also found that smokers had decreased gmv in the left occipital cortex . these results suggest either that nicotine rapidly affects brain regions or that there may be pre - existing abnormalities that lead to nicotine dependence in younger individuals . lastly , we explored a possible correlation between gmv and age of onset of smoking , cigarettes per day , the length of time smoking , and the pack - years smoked . hanlon ( 2014 ) reported a negative correlation in long - term smokers between number of pack - years and gmv in the medial prefrontal cortex . brody ( 2004 ) reported similar correlations between gmv in the prefrontal cortex and pack - years . fritz ( 2014 ) found that small clusters of reduced gmv in the middle occipital gyrus and anterior and middle cingulate cortex were correlated with number of pack - years ( r=0.192 , t=3 , 45 , p<.001 ) . lastly , franklin ( 2014 ) reported a positive correlation between gmv in the left putamen and number of pack - years in males ( r=.38 , p=.018 ) . overall , these studies reported similar results and all found lower gmv in certain brain areas in smokers compared to non - smokers . two studies also found brain areas where the gmv was actually higher in smokers than in non - smokers . lastly , 2 studies reported a negative correlation between pack - years and gmv . only 1 study found a positive correlation between number of pack - years and gmv . these studies found that smokers have lower gmv in multiple cortical and sub - cortical regions compared with non - smokers . regard , nicotine and cue - induced prefrontal activation might partially explain the atrophies observed via repeated stimulation during smoking , and this is thought to be associated with lower gmv . a decrease in gmv in the dlpfc may be associated with cognitive deficits in smokers . in the abstinent state , smokers are not able to compensate higher task loads . the prefrontal cortex also has a role in emotional processing ( e.g. , regulation ) . personality - wise , smokers with lower gmv in the pfc are more likely to be impulsive and neurotic than their non - smoking counterparts . the mpfc and vpfc are associated with reward and development , as well as maintenance of addiction . the insula also plays a role in dysfunction of emotional regulation , as well as a general role in nicotine addiction and craving . mofc is correlated with inhibition of behavior ; this effect is enhanced in females , explaining why they find it harder to stop smoking . importantly , 2 studies found lower gmv in the thalamus , which has the highest density of nicotine receptors of any brain region and is the prime target in long - term smoking . cigarette smoking also correlates with increased nicotine binding in the thalamus . however , controversy exists in that fritz ( 2014 ) and brody ( 2004 ) did not report any areas of decreased gmv in the thalamus , suggesting a role of functional abnormalities in signalling . the thalamus is associated with memory , attention , and planning , explaining why smokers tend to have worse results on cognitive tasks , including memory . the severity of compulsivity was also positively correlated with increased gmv in the putamen . in 1 study , this increase was only found in males . there were also differences found in the hippocampus and amygdala ; these areas also are linked with emotional and drug memories . however , hanlon ( 2014 ) found differences in the amygdala only when comparing young smokers with non - smokers . interestingly , this difference was lost in long - term smokers . despite these inconsistencies , although all 4 studies used the same technique , certain differences may have arisen because the technique was not used at the same place and time . also , all 4 studies were cross - sectional , so we can not know if there were any pre - existing structural differences in the brains of subjects . in younger smokers , nicotine either affects neural tissue volume very quickly or there are pre - existing abnormalities that predispose some individuals to smoking . lastly , smoking is highly prevalent in people with psychiatric disorders , and smoking can be a strong confounder in brain studies of these patients . overall , smoking causes differences in gmv in various brain areas , and these differences help explain the cognitive impairment and emotional dysregulation in smokers compared with non - smokers . there are considerable differences , not only between males and females , but also between younger and older smokers , and any therapeutic treatment must take this into account . to summarize , smoking decreases gmv in most brain areas , and this decrease is believed to be responsible for the cognitive impairment and difficulties with emotional regulation in smokers . future studies should separate physical changes of the brain from those associated with cognition , which would be useful in determining a therapeutic strategy for treating the associated pathologies of tobacco smoking . importantly , it can not be ignored that tobacco smoking may be a self - medicating phenomenon , which seeks to relieve a pre - existing pathology ; therefore , an individualized approach to treatment is advised . | although cigarette smoking is a leading cause of preventable mortality , tobacco is consumed by approximately 22% of the adult population worldwide .
smoking is also a risk factor for cardiovascular disease , affects brain processing , and is a recognized risk factor for alzheimer disease ( ad ) .
tobacco toxins ( e.g. , nicotine at high levels ) inhaled in smoke may cause disorders resulting in preclinical brain changes .
researchers suggest that there are differences in brain volume between smokers and non - smokers .
this review examines these differences in brain grey matter volume ( gmv).in march / april 2015 , medline , embase , and psycinfo were searched using the terms : grey matter and voxel - based and smoking and cigarette.the 4 studies analyzed found brain gmv decreases in smokers compared to non - smokers .
furthermore , sex - specific differences were found ; while the thalamus and cerebellum were affected in both sexes , decreased gmv in the olfactory gyrus was found only in male smokers .
age - group differences were also found , and these may suggest pre - existing abnormalities that lead to nicotine dependence in younger individuals .
only 1 study found a positive correlation between number of pack - years smoked and gmv.smoking decreases gmv in most brain areas .
this decrease may be responsible for the cognitive impairment and difficulties with emotional regulation found in smokers compared with non - smokers . |
many urologists routinely use transrectal ultrasound ( trus ) for the diagnosis and staging of localized prostate cancer . however , with the widespread use of prostate - specific antigen ( psa ) screening , there has been a shift to earlier stages and smaller volumes at the time of diagnosis . furthermore , trus is limited in the detection of hypoechoic lesions and therefore shows a low predictive value . the probability that a hypoechoic lesion contains prostate cancer varies from 3% to 52% . most research to date has focused on the diagnostic value of hypoechoic lesions on trus , and little is known about the biological significance of hypoechoic lesions in prostate cancer . there are reports that the presence of hypoechoic lesions is associated with a higher stage on presentation , such as extracapsular invasion . however , no study currently exists on the use of hypoechoic lesion status as an independent prognostic factor . in this study , therefore , we investigated the prognostic value of the presence of hypoechoic findings on trus in patients with localized prostate cancer and evaluated biochemical progression - free survival ( bpfs ) rates according to the presence of hypoechoic lesions . a total of 71 patients diagnosed with pt2n0m0 disease following radical prostatectomy ( rp ) between january 2002 and december 2008 were enrolled in the study . of the 71 patients , the enrollment was confined to patients with pt2 disease to eliminate the impact of pathologic stage on different outcomes . patients who had undergone other treatments such as radiation therapy or hormonal therapy before or after surgery were also excluded from the subject population . patients with positive surgical margins were excluded to eliminate the confounding effects of a positive surgical margin and to identify the prognostic effects of other factors being considered . patients were divided into two groups according to the presence of hypoechoic lesions on preoperative trus as interpreted by a single experienced radiologist . the group with hypoechoic lesions was labeled group 1 , whereas the group without hypoechoic lesions was labeled group 2 . preoperative and postoperative characteristics including pathologic t2 substage , preoperative serum psa levels , gleason scores on biopsy , and prostatectomy specimens were compared between the two groups . microscopic extension of malignant cells , tumor involvement percentage , and perineural invasion were also examined . the pathological stage was recorded on the basis of american joint committee on cancer prostate cancer staging , 7th edition . patients were followed up and the psa level was assessed at regular intervals of about 3 months after rp during the first 2 years . biochemical failure was defined as the first occurrence of two consecutive rises in the psa level of more than 0.2 ng / ml . each variable was compared by using student 's t - test for continuous data and the chi - square test for categorical data . univariate and multivariate cox proportional hazard analyses were used to determine relevant prognostic indicators of biochemical progression . in these analyses , patients were stratified according to the psa level ( 9 or < 9 ml ) . cutoff points for the variable psa level were chosen to separate the patient populations by a median value . the bpfs rate was estimated by using the kaplan - meier curve , which compared each potential prognostic factor by using the log - rank test . among the 71 enrolled patients , 35 had hypoechoic lesions and 36 had nonhypoechoic lesions on trus . nonhypoechoic lesions consisted of either isoechoic regions or unidentifiable lesions , and hyperechoic lesions were excluded . preoperative baseline characteristics were identical between the two groups ( table 1 ) . when group 2 was divided according to clinical stage , 14 of the 36 patients had clinical t2 disease ( 38.88% ) , and the others had clinical t1 disease . as for postoperative parameters such as the gleason score of the prostatectomy specimen , the percentage of tumor involvement , and the presence of perineural invasion , there were no significant differences between the two groups ( table 2 ) . the median follow - up period was 44.49 months in group 1 and 38.81 months in group 2 . the bpfs rate over the first 24 months was 97.0% in group 1 and 97.1% in group 2 . however , divergence after 48 months significantly widened , to 75.3% vs. 91.7% , respectively . group 1 had an overall shorter progression - free survival period than did group 2 ( fig . 1 ) . during the follow - up period , clinical failure was observed in 4 cases . in group 1 , l - spine metastasis was observed in two cases at 45 and 54 months after the operation and urethrovesical anastomosis site recurrence was observed in one case at 35 months after rp . one case of l - spine metastasis was observed at 38 months after the operation in group 2 . to assess the prognostic value of each variable , univariate and multivariate analyses were carried out with the cox proportional hazard model . in the univariate analysis , preoperative psa level and the presence of hypoechoic lesions had prognostic significance ( table 3 ) . age , body mass index , prostate volume , pathologic gleason score , and pt2 substage did not have prognostic significance . as shown in table 3 , however , preoperative psa level and presence of hypoechoic lesions , which were shown to be significant in the univariate analysis , were not of statistical significance in the multivariate analysis . few studies have examined the potential utility of hypoechogenicity , a trus - related indicator of potentially cancerous lesions in the prostate , as a prognostic factor . we chose to focus on the prognostic value of hypoechoic lesions because , considering that only 3% to 52% of prostate cancers show hypoechoic lesions , its value as a diagnostic marker is limited , and we thought it appropriate to focus instead on its value for evaluation of disease progression . furthermore , ohori et al . noted that hypoechoic cancers were more likely to show extraprostatic extension , to have a poorly differentiated component , and to be nondiploid compared with isoechoic cancers . however , these studies showed only that hypoechoic lesions were related to more advanced stage disease and did not focus on its value as a prognostic factor . we restricted the subject population to patients with stage pt2n0m0 disease ; furthermore , to control the effects of bpfs , patients with positive postsurgical margins were excluded . . showed no significant difference in bpfc for t1c tumors that were visible on sonography . however , they included all hypoechoic , isoechoic , and hyperechoic lesions that were visible on sonography as cases and thus did not exclusively examine hypoechoic lesions , as was done in the present study . preoperative psa , gleason score , and tumor - node - metastasis stage are well - known prognostic parameters [ 7 - 9 ] . caso et al . , in their study on postprostatectomy biochemical recurrence in each of the substages in pathologically confirmed t2 lesions , stated that the substages of t2 were of significance only on univariate analysis and that the most important factors were psa and the status of the surgical margins . however , in our study , the univariate analysis differed in that only preoperative psa and the presence of hypoechoic lesions were correlated with the prognosis of prostate cancer . as shown in fig . 1 , no significant difference in bpfs was observed 30 months after the operation , but a subsequent divergence in bpfs became evident later . considering that gleason 's score and other parameters such as perineural invasion and the percentage of tumor involvement did not differ significantly between the two groups during this period , it is possible that there are other factors yet to be isolated . we assume the reason prostate cancer with hypoechoic lesions has a worse prognosis than other prostate cancers may be because hypoechoic prostate cancers have molecular markers related to prognosis and nondiploid dna . a recent study showed that cases positive for the antibodies s0456 , ep1972 - 1 , s0725 m , and s5073 , which are directed against the protein products of the genes hey2 , stmn1 , cyp4z1 , and cdh1 , had poorer prognosis than did those that were negative for these antibodies . although the study did not deal with hypoechoic lesions on trus , the authors speculated that such molecular markers may be detected in prostate cancer with hypoechoic lesions . in addition , the absolute volume of the tumor can influence the detection rate of hypoechoic lesions , and the volume itself may be a prognostic factor on trus . also , because it has already been shown that digital rectal examination ( dre ) palpation is a prognostic factor , we think it will be relevant to study its relationship with hypoechoic lesions on trus . regrettably , this study did not examine the tumor volume or dre palpation findings . in the current study , univariate analysis and kaplan - meier curves showed that hypoechoic lesions were of prognostic significance for prostate cancer . nevertheless , the statistical significance observed in the univariate analysis and kaplan - meier curves suggest that the presence of hypoechoic lesions on trus images may hold at least some importance as a prognostic factor for prostate cancer . second , we did not review the dna findings through dna analysis and molecular marker analysis to support our hypothesis on the biochemical significance of hypoechoic lesions . further studies involving larger subject populations appear to be necessary to fully evaluate the significance of the presence of hypoechoic lesions as a prognostic factor . localized prostate cancers that present preoperatively with hypoechoic lesions on trus were associated with worse prognostic characteristics than were prostate cancers with no hypoechoic lesions . however , such sonographic findings were shown to have no value as a prognostic factor . to further certify the results of this study and to investigate the associated underlying biological mechanisms , a larger - scale study on this subject is needed . | purposethe purpose of this study was to investigate the value of hypoechoic lesions on transrectal ultrasound ( trus ) as a prognostic factor for patients with localized prostate cancer.materials and methodsthe patients consisted of 71 patients with pt2n0m0 disease following radical prostatectomy between 2002 and 2008 .
the group with hypoechoic lesions was labeled group 1 , whereas the group without hypoechoic lesions was labeled group 2 .
the presence of hypoechoic lesions on preoperative trus was analyzed as a prognostic factor along with several parameters , including preoperative factors and pathologic factors .
the biochemical progression - free survival ( bpfs ) rate was compared between the two groups according to the presence of hypoechoic lesions on trus.resultsa total of 35 patients had hypoechoic lesions on trus , whereas 36 had no hypoechoic lesions .
preoperative baseline characteristics were not significantly different between the two groups . in the univariate analysis ,
bpfs showed significant differences according to the presence of hypoechoic lesions on trus and the preoperative prostate - specific antigen level .
the bpfs rates over the first 24 months were 97.0% in group 1 and 97.1% in group 2 ; however , the difference in the bpfs rate over 48 months significantly widened to 75.3% compared with 91.7% , respectively . despite this finding , no significant independent prognostic factor for bpfs
was found on multivariate analysis in this patient cohort.conclusionsthe presence of hypoechoic lesions on trus may suggest worse prognostic characteristics in pt2 prostate cancer .
further studies involving larger subject populations are needed to corroborate the significance of the presence of hypoechoic lesions as a prognostic factor . |
hepatitis c virus ( hcv ) is the most common blood - borne infection and a major cause of chronic liver disease , cirrhosis , and primary hepatocellular carcinoma and one of the leading indications for liver transplant . the current standard therapy for chronic hcv ( pegylated - interferon- ( pegifn- ) combined with ribavirin ) has limited efficacy ( about 50% ) , is costly , and involves severe medical and psychiatric side effects . recently introduced protease inhibitors , telaprevir and boceprevir , are effective in hcv1 and hcv2 while their antiviral activity is limited in hcv3 and hcv4 . therefore , search for biological markers to predict the response to antiviral treatment is of importance for both patient well - being and health care expense . hcv genotypes predict more favorite response among hcv1 and hcv4 ( in comparison with hcv2- and hcv3- infected patients [ 1 , 2 ] ) . the value of currently used assessment of allelic variants of the il28b gene encoding ifn3 predicts antiviral response in hcv1 and hcv4 and is attenuated , but relevant also in hcv2 and hcv3 , especially in patients not achieving rapid virological response . assessment of expression of interferon - stimulated genes ( ifn - sgs ) in the liver ( but not in plasma ) predicted antiviral response independently from il28b polymorphism [ 4 , 5 ] . these studies suggest the inverse correlation between antiviral response and concentrations of proteins production of which is encoded by ifn - sgs . ifn - sgs induce rate - limiting enzyme of pteridines biosynthesis , guanosine triphosphate cyclohydrolase i ( gtpch ) . ifn - induced activation of gtpch in humans might be assessed by measuring of plasma , serum , saliva , urine , and spinal fluids concentrations of neopterin , a stable water - soluble byproduct of the first and rate - limiting reaction of pteridines biosynthesis catalyzed by gtpch . the present study explored the possibility that pretreatment plasma neopterin concentrations ( as a marker of the expression of the ifn gene that encodes gtpch ) predict the response to antiviral therapy by pegifn combined with ribavirin . neopterin concentrations were evaluated in 260 hcv patients treated by peginterferon- ( ifn- ) alpha ( pegasys or pegintron ) ( subcutaneous injections , 120 to 180 g / week ) in combination with ribavirin ( 1,000 to 1,200 mg / day ) . the study was approved by the tufts medical center irb , and written consents were obtained for participation in the study . blood samples were protected from light , centrifuged to obtain plasma , and frozen at 80c before blinded assay by sandwich elisa using commercially available kits ( american research products , inc . , neopterin concentrations were reported as nanomoles per liter ( nmol / l ) . the sustained virological response ( svr ) was defined as undetectable serum hcv rna ( < 51 iu / ml ) 24 weeks after completion of treatment . patients were considered nonresponders if they had only a minimal decrease of < 2 log10 iu from their baseline levels after completion of 24 weeks of treatment . patient characteristics , including gender , race , and hcv status , were compared between svr and nonresponders using chi - square tests . since distribution of neopterin levels was found to be highly skewed , neopterin concentrations were summarized with the median and 25th to 75th percentiles , and the distribution of neopterin was compared between svr and nonresponders using the wilcoxon rank - sum test . logistic regression was used to compute unadjusted odds ratios and 95% confidence intervals for the relationship of neopterin and response and for hcv status and response . multiple logistic regression was also used to test for an interaction between neopterin level and hcv status and estimate adjusted odds ratios of neopterin and response for each hcv subgroup . considering that neopterin plasma concentration higher than 16 nmol / l predicted high mortality rate in 6-year follow - up study of community dwellers , neopterin was categorized as less than versus at least 16 nmol / l for the logistic regression analyses to simplify the interpretation of the results . analyses were done using the sas system for windows version 9.2 ( copyright 20022008 by sas institute inc . , cary , nc , usa ) . 83% of patients were american caucasians and 27% afro - americans , hispanic , and asians . as expected from the literature , the response rate was higher in patients with hcv2 and hcv3 genotypes ( 57% ) than in patients with hcv1 and hcv4 genotypes ( 27% ) ( unadjusted odds ratio 3.6 , 95% ci : 1.86.7 ; p < 0.0002 ) . responders were slightly younger ( 51.8 9.6 ) than nonresponders ( 54.1 8.2 ) ( p = 0.04 ) . there were no differences in plasma neopterin concentrations between females ( median ( q1q3 ) = 20.8 ( 13.836.8 ) ) and males ( median ( q1q3 ) = 19.2 ( 11.934.8 ) ) ( p - value = 0.21 , wilcoxon rank - sum test ) . mean and median neopterin concentrations were higher in nonresponders than in svr ( table 1 ) . the overall rate of response to antiviral treatment in studied patients was lower ( 32% ) than reported in the literature ( 50% ) . response rate correlated with neopterin levels . among patients with neopterin levels of < 16 nmol / l response rate was 51% for all genotypes , 42% for hcv1 and hcv4 subset , and 74% for hcv2 and hcv3 subset . nmol / l had the lowest rate of response ( 21% for all genotypes , 19% for hcv1 and hcv4 subset , and 38% for hcv2 and hcv3 subset ) ( table 2 ) . therefore , both neopterin concentration and hcv genotype emerged as factors that appear to have ( unadjusted ) associations ( p < 0.5 ) related to response to antiviral therapy . our data was further analyzed by a multivariable logistic regression model with neopterin ( categorized at < 16 versus 16 nmol / l ) , hcv genotype ( subset of hcv1 and hcv4 versus hcv2 and hcv3 ) , and the interaction term . nmol / l was about twofold higher than in patients with neopterin concentrations of 16 nmol / l for all genotypes and for the subsets of hcv1 and hcv4 patients and hcv2 and hcv3 patients ( table 2 ) . there was no difference between odds ratios for hcv1 and hcv4 versus hcv2 and hcv3 patients ( p = 0.61 ) . to the best of our knowledge this is the first observation of a negative relationship between the pretreatment neopterin concentrations and response to antiviral therapy . mean and median pretreatment neopterin concentrations were higher in nonresponders than in svr patients . multivariable modeling revealed that rate of response to treatment was twofold higher among patients with pretreatment neopterin levels < 16 nmol / l than in patients with pretreatment neopterin levels 16 the negative relationship between pretreatment neopterin and response to antiviral therapy was not observed previously because ( most likely ) of rather small number of studied patients . neopterin concentrations in humans reflect the activity of gtpch , the enzyme encoded by ifn - sgs . high pretreatment neopterin plasma concentrations might suggest the preactivation of the endogenous ifn system induced by chronic hcv infection . one of the causes of a resistance to antiviral therapy in patients with high pretreatment neopterin concentrations might be the refractory state of the preactivated endogenous ifn signaling pathways to further stimulation by antiviral therapy [ 4 , 5 ] . since our study was not designed to include patients naive to ifn - alpha treatment , they were exposed to both hcv and ifn - alpha . thus , there were almost two times more patients in hcvi and hcv4 subset with neopterin levels > 16 nmol / l than with < 16 the prediction of the response to antiviral treatment could become important for future therapies with hcv protease or polymerase inhibitors because patients with a preactivated endogenous ifn system would be exposed to direct antivirals without an effective protection against resistance development provided by coadministration of pegifn-/ribavirin [ 2 , 5 ] . considering the wide use of il28b polymorphism for predicting of antiviral response , future studies of correlation between il28b and neopterin test might be of importance for clinical practice . the results of our study suggest that the evaluation of pretreatment concentrations of neopterin might be used as a marker to predict the response to antiviral therapy in hcv patients . neopterin test is cost - effective , helpful in both hcv1 and hcv4 and hcv2 and hcv3 genotypes , and less invasive than liver biopsy ( in comparison with genotype analyses of liver ifn - sgs ) [ 4 , 5 ] . | predicting the efficacy of antiviral treatment of hepatitis c virus ( hcv ) is of importance for both patient well - being and health care expense .
the expression of interferon - stimulated genes ( ifn - sgs ) in the liver was suggested as a marker of response to anti - viral therapy .
ifn - sgs encode the guanosine triphosphate cyclohydrolase 1 ( gtpch ) , a rate - limiting enzyme of pteridines biosynthesis .
neopterin , a stable byproduct of gtpch - catalyzed reaction , is used as a marker of interferon - induced gtpch activation .
we hypothesized that assessment of neopterin concentrations might predict the response to antiviral therapy .
neopterin concentrations were evaluated in 260 hcv patients treated by pegylated interferon combined with ribavirin .
mean and median pretreatment neopterin concentrations were lower in patients with sustained virological response than in nonresponders .
the rate of response was twofold higher among patients with pretreatment neopterin levels < 16 nmol / l than in patients with neopterin levels 16 nmol / l , even after controlling for hcv genotype status .
our study suggests that the pretreatment level of neopterin might be used in routine clinical practice as rapid and cost - effective marker to predict the response to antiviral therapy in hcv patients . |
left ventricular pseudoaneurysm is a rare condition because in most instances ventricular free - wall rupture leads to fatal pericardial tamponade . rupture of the free wall of the left ventricle is a catastrophic complication of myocardial infarction , occurring in approximately 4% of patients with infarcts , resulting in immediate collapse of the patient and electromechanical dissociation . in rare cases the rupture is contained by pericardial and fibrous tissue , and the result is a pseudoaneurysm . the left ventricular pseudoaneurysm contains only pericardial and fibrous elements in its wall - no myocardial tissue . because such aneurysms have a strong tendency to rupture , this disorder may lead to death if it is left surgically untreated . in this case report , we present a patient who underwent successful repair of a left ventricular pseudoaneurysm , which followed a myocardial infarction that was caused by occlusion of the left circumflex coronary artery . although repair of left ventricular pseudoaneurysm is still a surgical challenge , it can be performed with acceptable results in most patients . left ventricular pseudoaneurysm ( lvp ) is a very rare condition because in most instances ventricular free - wall rupture leads to fatal pericardial tamponade ( 1 ) . myocardial infarction ( mi ) is the most common cause of false aneurysms of the left ventricle ( 2 , 3 ) . rupture of the free wall of the left ventricle is most often catastrophic complication of mi , occurring in approximately 4% of patients with infarcts resulting in immediate collapse of the patient ( 4 ) . in addition , it may be associated with mitral valve replacement , previous unsuccessful ventriculotomy , trauma , inflammation , tumor invasion , and apical venting ( 5 ) . lvp develop when pericardium surrounds the rupture in combination with thrombus and inflammation and thus prevents the development of a hemopericardium . it contains only pericardial and fibrous elements in its wall , with no myocardial tissue . lvp may remain silent unless it gives rise to hemopericardium , once the hemopericardium develops , it may result in cardiac tamponade and sudden death ( 6 ) . because such aneurysms have a strong tendency to rupture , this disorder may lead to death if it is left surgically untreated ( 7 ) . in this case report , we present a patient who underwent successful repair of a lvp , which followed a myocardial infarction that was caused by occlusion of the left circumflex coronary artery . a 57-year - old male patient was admitted to another hospital with chest pain that had started 7 days previously . during coronary angiography , selective left coronary injection with showed occlusion of the distal left circumflex artery.(figure 1 ) . the ventriculography is shown in figure 2 , demonstrating what appears to be an aneurysm . coronary angiography : occlusion of the left circumflex artery in its distal portions ventriculography : left ventricular pseudoaneurysm in the inferobasal wall . echocardiography showed lv dysfunction with an ejection fraction of 0.35 and akinesia of the inferior wall . on this echo it became apparent that the patient had a large lvp measuring around 5x5 cm on the inferobasal wall , communicating through a narrow neck of 2,2 cm in diameter ( figure 3 ) . echocardiography : large left ventricular pseudoaneurysm in the inferobasal wall intraoperatively , a large non ruptured posterior pseudoaneurysm was seen to communicate through a the neck which measured 2x3 cm in diameter . the lvp was resected , and the defect in the inferior wall of the left ventricle repaired with a dacron patch ( figure 5 ) . intraoperative finding : opened left ventricular pseudoaneurysm rapair of defect with dacron patch the postoperative course was uneventful . an echocardiogram on the third postoperative day showed improvement in ejection fraction to 0.50 , and the repair site was clearly seen ( figure 6 ) . follow - up visit , the patient was in nyha class i. postoperative echocardiography after pseudoaneurysm repair lvp is rare with a prevalence of 0.05% ( 8) , and usually develops in patients having their first mi ( 9 ) . inferior and posterolateral mi are responsible for 82% of the lvp developing after mi . usually , lvp is located inferoposterior due to occlusion of the circumflex artery , but it can be found in the apical region due to anterior mi . mi rarely results in lvp formation because ruptures in the anterior wall generally leads to hemopericardium or tamponade ( 10 , 11 ) . lvp may remain clinically silent and be discovered during routine clinical investigations , or can present with chest pain , congestive heart failure , arrhythmias , or embolism . the development of heart failure is related to an non contracted and dyskinetic region , with dilatation of the pseudoaneurysm sac during systole . cardiac catheterization with left ventriculography has been the gold standard for establishing the diagnosis , and is necessary before surgery to evaluate the need for concomitant bypass grafting ( 13 ) . there is strong indication for surgery in lvp ( 15 ) since untreated pseudoaneurysm have a 30% to 45% risk of rupture ( 16 ) . the general consensus is that surgery is indicated for all patients as soon as the diagnosis is established , unless the surgical risk is prohibitive . if a pseudoaneurysm is diagnosed within 2 to 3 months after mi , emergency surgery should be performed because of the high risk of rupture . if the diagnosis is made years after mi , the necessity and urgency of surgery depends on the symptoms . resection , if necessary , combined with bypass grafting is the treatment of choice in symptomatic patients , but the operative risk is high due ( 7%29% ) to the underlying cardiac pathologies ( 17 ) . | introduction : left ventricular pseudoaneurysm is a rare condition because in most instances ventricular free - wall rupture leads to fatal pericardial tamponade .
rupture of the free wall of the left ventricle is a catastrophic complication of myocardial infarction , occurring in approximately 4% of patients with infarcts , resulting in immediate collapse of the patient and electromechanical dissociation . in rare cases
the rupture is contained by pericardial and fibrous tissue , and the result is a pseudoaneurysm .
the left ventricular pseudoaneurysm contains only pericardial and fibrous elements in its wall - no myocardial tissue . because such aneurysms have a strong tendency to rupture , this disorder may lead to death if it is left surgically untreated.case report : in this case report , we present a patient who underwent successful repair of a left ventricular pseudoaneurysm , which followed a myocardial infarction that was caused by occlusion of the left circumflex coronary artery . although repair of left ventricular pseudoaneurysm is still a surgical challenge , it can be performed with acceptable results in most patients . |
intra - articular glenoid fractures are extremely rare and may be associated with other injuries . traditionally open reduction and internal fixation has been recommended in displaced intra - articular glenoid fractures . however open reduction is difficult and it may not be possible to address the associated intra - articular soft tissue injuries . we are presenting our case where a 52 year old man presented with type 3 intra - articular glenoid fracture . arthroscopy assisted percutaneous fixation technique can be a valuable adjunct for the surgeon in dealing with not only the fracture but also the associated soft - tissue injuries . however their significance lies in the fact that they can lead to instability and arthritis if not treated adequately . the principles of treatment of these fractures are still evolving with a lot of focus being on arthroscopic fixation in the recent years . a 52 year old right hand dominant male patient , welder by occupation , presented with pain in right shoulder following a fall directly on the right shoulder . the procedure was performed with the patient in a lateral decubitus position as this facilitated simultaneous arthroscopic as well as fluoroscopic evaluation . the surgeon , the assistants and the scrub nurse were positioned posterior to the patients shoulder . the monitor was positioned on the opposite side at the foot end . the c - arm image was placed in a lateral position across the shoulder with the beam parallel to the floor . the affected limb was positioned in about 40 degree abduction and 20 degree flexion using a traction system to facilitate arthroscopic evaluation . however the traction was kept to minimum to allow manipulation of the arm during fracture reduction pre - operative antero - posterior radiograph showing ideberg type iii glenoid fracture arthroscopic view showing the displaced glenoid fracture arthroscopic view after reduction and fixation of the fracture intra - operative fluoroscopic view during fixation of the fracture fluoroscopic view of the final fixation illustration for technique of arthroscopic reduction and percutaneous fixation of intra - articular glenoid f racture through a standard posterior viewing portal initial diagnostic arthroscopy was performed and the fracture pattern evaluated . a 2 mm k - wire was passed percutaneously in a superior to inferior direction just adjacent to the neviaser portal and drilled into the fractured superior glenoid fragment . this k - wire was used as a joystick to dis - impact the fragment and restore the articular surface under direct arthroscopic vision . an arthroscopic probe introduced through an anterior once a satisfactory reduction was achieved , the k - wire was advanced further into the glenoid to obtain provisional fixation . a neviaser portal was then created and a guide wire was passed from superior to inferior direction through the centre of the fracture fragment . the correct placement of the wire was confirmed fluoroscopically . after drilling over the guide wire , definitive fixation and compression of the fracture the fracture reduction was again confirmed under both arthroscopic and fluoroscopic visualization . the k - wire used for provisional fixation was then removed and portals closed with simple sutures . the operated limb was put in sling and mobilization was started as tolerated by the patient . the patient was lost to follow up after one month , by which time he was pain free and had a range of movement of 90 degree of forward elevation and abduction . there is a clear consensus on the need for surgical treatment of displaced intra - articular glenoid fractures . an articular step - off of greater than 5 mm or instability mandates surgical intervention . if not treated optimally , these fractures can result in chronic instability or post - traumatic arthritis . although surgical treatment of displaced glenoid fractures give good and predictable functional outcome , the traditionally described open reduction and internal fixation is difficult and may be associated with several complications . open surgery not only involves extensive soft tissue dissection but may also require partial removal of clavicle to gain adequate exposure for screw fixation . the scarring associated with open surgery leads to poor cosmesis and difficult second surgery if required [ 7 , 8 ] . open surgery may cause weakness of external or internal rotation and anterior or posterior instability if the healing of soft tissues is not adequate . open surgery is also known to be associated with complications like blood loss , long post - operative recovery , damage to subscapularis insertion and axillary nerve injury [ 7 , 8 ] . lastly with open surgery it may not be possible to address the associated intra - articular soft tissue injuries . carro et al first reported the use of arthroscopy in fixation of glenoid rim fractures . since then a few reports have been published on arthroscopy assisted fixation of different types of intra - articular glenoid fractures . presently arthroscopy is being used for the glenoid rim fractures involving greater than 15 - 25% of the articular surface . a few reports have described the use of arthroscopy in treatment of ideberg type iii fractures where the fracture line is relatively transverse , which facilitates screw fixation in superior to inferior direction . different methods of fixation have been described including k - wires , cancellous screws and suture anchors [ 2 , 7 ] . arthroscopy assisted technique not only facilitates accurate reduction with minimal soft tissue trauma but also allows evaluation and treatment of the other associated intraarticular soft tissue injuries . percutaneous screw fixation through the superior and posterior approach does nt put any neurovascular structures at risk . however this technique is associated with learning curve and requires adequate skills and understanding of both arthroscopic and trauma surgery . arthroscopic technique is relatively contraindicated in the presence of associated injuries like capsular ruptures and humeral avulsion of glenohumeral ligaments . the possible complications described with this technique include compartment syndrome due to fluid extravasation , anterior interroseous syndrome and injury to neurovascular structures due to incorrect portal placement [ 10 , 13 ] . in conclusion arthroscopy assisted fixation of intra - articular glenoid fractures is still evolving as a surgical technique , but can be a valuable adjunct for the surgeon in dealing with not only the fracture but also the associated soft - tissue injuries . arthroscopy assisted fixation of these fractures provides an exciting option but one must understand that this technique is associated with a steep learningcurve . | introduction : intra - articular glenoid fractures are extremely rare and may be associated with other injuries .
traditionally open reduction and internal fixation has been recommended in displaced intra - articular glenoid fractures .
however open reduction is difficult and it may not be possible to address the associated intra - articular soft tissue injuries .
a few reports of arthroscopic assisted fixation of these fractures have been recently published .
we are reporting a case of ideberg type 3 glenoid fracture and its treatment.case report : we are presenting our case where a 52 year old man presented with type 3 intra - articular glenoid fracture .
the fracture was fixed percutaneously under simultaneous arthroscopic and fluoroscopic guidance.conclusion:intra-articular glenoid fractures are uncommon and difficult to treat .
arthroscopy assisted percutaneous fixation technique can be a valuable adjunct for the surgeon in dealing with not only the fracture but also the associated soft - tissue injuries . |
to report a case of choroidal excavation accompanied by vogt - koyanagi - harada disease ( vkh ) . a 54-year - old japanese woman who was complaining of bilateral blurring of vision associated with headache underwent optical coherence tomography ( oct ) , fluorescein angiography , and indocyanine green angiography as well as a routine ophthalmological examination . oct of the left eye revealed the presence of a unilateral choroidal excavation under the fovea and subretinal fibrin over the site of the excavation . treatment successfully resolved vkh symptoms with gradual resolution of subretinal fibrin and fluid ; however , the choroidal excavation remained . our results suggest that choroidal excavation can be induced by choroidal inflammation caused by vkh . due to the increased availability of optical coherence tomography ( oct ) imaging , the entity of focal choroidal excavation has gained interest in recent years . it has been well - described in healthy individuals with otherwise normal eyes [ 1 , 2 , 3 , 4 ] . focal choroidal excavation has been defined as an area of choroidal excavation in the macular area detected with oct without the existence of a posterior staphyloma or scleral ectasia . we report a case of unilateral choroidal excavation in a patient with vogt - koyanagi - harada disease ( vkh ) . a 54-year - old japanese woman presented with bilateral blurring of vision associated with headache that had started 2 weeks earlier . her general family medical history and her personal medical history , including her history of ocular disease , were unremarkable . the best - corrected visual acuity on presentation was 0.6 in the right eye and 0.1 in the left eye . slit - lamp biomicroscopy showed bilateral anterior chamber cells and posterior synechiae , and fundus examination showed bilateral disc swelling with exudative retinal detachment ( fig . fluorescein angiography detected bilateral multifocal leakage with pooling of dye in the subretinal space in the late phase ( fig . 1d ) . a spectral - domain oct ( cirrus hd - oct 4000 ; carl zeiss meditec inc . ) image of the eyes showed the bilateral presence of subretinal fluid and pigment epithelial detachment . moreover , only in the left eye was unilateral choroidal excavation detected under the fovea , and the contour of the retinal pigment epithelium appeared to be conforming to the shape of the fibrin ( fig . thus , our patient was treated with intravenous pulse methylprednisolone followed by oral prednisolone ( initial dose of 40 mg / day ) with tapering over a course of 6 months . treatment successfully resolved the vkh symptoms , and serial oct showed a gradual reduction in size and a subsequent disappearance of the subretinal fibrin and fluid ( fig . d ) . however , 1 month after having started treatment , the eye was left with an area of choroidal excavation at the fovea despite a normal contour in the right eye ( fig . 2d ) . there was a good recovery of visual acuity , with 1.2 and 0.9 in the right and the left eye , respectively . since then , many reports have been published , discussing the association between choroidal excavation and central serous chorioretinopathy [ 2 , 3 , 4 ] . however , the current case of choroidal excavation associated with vkh is the first report in which a preexisting choroidal inflammation caused these conditions . concerning the pathogenesis of choroidal excavation in our case , it has been speculated that subretinal fibrin might exert a direct pressure effect on the choroidal layer by disrupting its integrity . our case suggests one of the possible mechanisms of developing choroidal excavation as a result of ocular inflammation . it is likely that the inflammation induced focal choroidal atrophy , and thinning could also contribute to the development of the choroidal excavation . a further study should be warranted to elucidate the clinical course and possible mechanism of choroidal excavation associated with vkh . in conclusion the pathogenesis of choroidal excavation still remains to be addressed ; however , the current case highlights the fact that choroidal excavation can be induced by choroidal inflammation caused by vkh . the authors have no proprietary or commercial interest in any of the material discussed in this article . | purposeto report a case of choroidal excavation accompanied by vogt - koyanagi - harada disease ( vkh).methodsa 54-year - old japanese woman who was complaining of bilateral blurring of vision associated with headache underwent optical coherence tomography ( oct ) , fluorescein angiography , and indocyanine green angiography as well as a routine ophthalmological examination.resultsfundoscopy showed papilloedema and serous retinal detachment in both eyes .
fluorescein angiography detected bilateral multifocal leakage with pooling of dye in the subretinal space .
indocyanine green angiography showed patches of hyperfluorescence and hypofluorescent spots bilaterally .
a diagnosis of vkh was reached soon afterwards .
oct of the left eye revealed the presence of a unilateral choroidal excavation under the fovea and subretinal fibrin over the site of the excavation .
treatment successfully resolved vkh symptoms with gradual resolution of subretinal fibrin and fluid ; however , the choroidal excavation remained.conclusionsthis case is the first report of choroidal excavation associated with vkh .
our results suggest that choroidal excavation can be induced by choroidal inflammation caused by vkh . |
bardet - biedl syndrome ( bbs ) is an autosomal recessive disorder characterized by central obesity , mental impairment , rod - cone dystrophy , polydactyly , hypogonadism in males , and renal abnormalities.1,2 the causative genes have been identified as bbs1 - 14 genes that encode proteins possibly linked to cilia function , but more than 20% of patients have no mutations found.3 the diagnosis is made only by the clinical phenotype with the presence of at least three major symptoms , however , it is often difficult partly because of age - dependent development of some symptoms . in the western countries , the prevalence of this disease ranges from 1/13,500 to 1/160,000.3 by contrast , only a few japanese patients have been reported in the english - language literature.46 renal fibrosis is one of the most devastating symptoms , ultimately leading to chronic renal failure requiring hemodialysis.7 the incidence of renal dysfunction or anomalies in previous reports varies considerably ranging from 20% to universal occurrence.2,7 an early detection of such abnormalities may be important for patients and guardians to prepare them . it may also be useful for prompt correct diagnosis of bbs , since the diagnosis of this disease is based on the accumulation of major symptoms as described above . we now report that two japanese patients with bbs had normal bun and creatinine level but elevated levels of cystatin c , a sensitive marker of glomerular filtration rate ( gfr ) . a 20-year - old man ( patient 1 ) had mental retardation ( minimental state examination 23 ; normal > 24 ) , rod - cone dystrophy , central obesity ( height 158 cm , weight 63 kg , and bmi 25.2 ) and hypogonadism since the age of 5 years . his blood pressure was 131/85 mmhg , and his heart rate was 61 beats / min . . a 16-year - old boy ( patient 2 ) , the younger brother of patient 1 , had polydactyly in addition to the symptoms described above ( height 165 cm , weight 93 kg , and bmi 34.2 ) . his blood pressure was 128/61 mmhg , and his heart rate was 77 beats / min . the symptoms of patients and probable autosomal recessive inheritance fulfilled the diagnostic criteria for bbs5 . after obtaining informed consent , ( tartu , estonia ) . the dna chip ( version 5 ) covered 305 mutations from 14 genes causative for bbs and related diseases ( bbs1 , bbs2 , bbs3 , bbs4 , bbs5 , bbs6 , bbs7 , bbs8 , bbs9 , bbs10 , bbs12 , phf6 , alms1 , and gnas1 ) , but identified no pathological alterations . nevertheless , because about one fifth of patients with clinically definite bbs have no identifiable mutations as described above and because the chip covered only mutations previously reported to be pathogenic , these results could not rule out the possibility of a diagnosis of bbs in our family . to detect morphological renal abnormalities , the patients underwent abdominal ct scans and abdominal sonography , with no apparent anomalies . blood and urine tests routinely performed in japan failed to identify any obvious abnormalities ( table 1 , upper rows ) . other laboratory data of the elder and younger patients included normal blood sugar levels ( 78 mg / dl and 81 mg / dl , respectively ) , normal total cholesterol levels ( 144 mg / dl and 131 mg / dl , normal 120220 mg / dl ) , unelevated triglyceride levels ( 28 mg / dl and 72 mg / dl , normal 30150 mg / dl ) , negative serum crp , and negative urine occult blood or glucose . the results showed elevated cystatin c concentrations in both patients and microalbuminuria in the elder patient ( table 1 , lower rows ) . cystatin c levels of the age- and sex - matched controls were also examined , the result of which showed 0.86 mg / l for an elder control and 0.91 mg / l for a younger control . we describe abnormal levels of serum cystatin c in two patients with bbs ( table 1 ) . cystatin c is a plasma protein with a molecular weight of 13.4 kda and belongs to the cysteine protease inhibitors.8 it is constantly synthesized in all types of cells , excreted into plasma , and filtered completely by the glomeruli . measurement of cystatin c more sensitively detects mild gfr abnormalities than that of creatinine , a more common but less sensitive marker of gfr,8 probably because the lower molecular weight of creatinine ( 113 da ) facilitates its easier filtration in the glomeruli . in addition to the sensitivity , cystatin c is a more reliable marker than creatinine for detection of chronic renal disease , since creatinine levels are affected by many extra - renal patient - related factors such as muscle mass and consumption of cooked meat that is a source of creatinine.8 our patients had only mild increases in cystatin c. nevertheless , because cystatin c levels age - dependently increase with decreasing gfr , the values of our young patients seem sufficiently high for their ages.8 a urine albumin level increased only in the elder patient . patients with bbs occasionally manifest proteinuria,7 suggesting that patients had not only decreased gfr but also increased protein leakage . urine albumin is used to detect early phases of diabetic or hypertensive nephropathy.9 because neither of our patients showed apparent proteinuria , the elder patient may be in an early phase of protein leakage . in diabetes mellitus , timely treatment with an angiotensin - converting enzyme inhibitor , independently of rise in arterial blood pressure , is considered if improvement of glycaemic control and moderate decrease of dietary protein intake for 612 months have failed to reduce the albumin excretion rate.9 screening programs for microalbuminuria and early intervention can substantially modify the natural history of diabetic renal involvement and disease and possibly reduce the incidence of end - stage renal failure.9 in bbs , although such intervention has not been tested yet , we may consider similar protective methods for renal dysfunction . in conclusion , patients who have bbs with apparently normal kidney functions may have abnormal levels of cystatin c , facilitating an early detection of kidney dysfunctions that might be helpful for prompt correct diagnosis of bbs . however , because our study is based on the results of the small number of patients , conclusion must await further studies . | bardet - biedl syndrome ( bbs ) is an autosomal recessive disorder characterized by central obesity , mental impairment , rod - cone dystrophy , polydactyly , hypogonadism in males , and renal abnormalities .
the causative genes have been identified as bbs1 - 14 . in the western countries , the prevalence of this disease ranges from 1/13,500 to 1/160,000 , while only a few japanese patients have been reported in the english - language literature .
the incidence of renal dysfunction or anomalies in previous reports varies considerably ranging from 20% to universal occurrence .
we here report that two japanese patients who had bbs with normal bun and creatinine levels had elevated levels of cystatin c , a sensitive marker of glomerular filtration rate .
a urine albumin level increased only in the elder patient .
thus , cystatin c may be useful for detecting renal abnormalities in patients with an apparent normal renal function . because this disease is diagnosed by accumulation of symptoms ,
such a sensitive marker might help early diagnosis of bbs . |
the term vitamin d resistant rickets was first used in 1937 by albright et al . , to describe form of rickets requiring doses of vitamin d far in excess of those required for healing of nutritionally deficient rickets . vitamin d dependent rickets ( vddr ) ii is a very rare autosomal recessive form of rickets , with fewer than 50 known affected kindreds . the majority of the patients were the children of consanguineous marriages and have suffered early onset of rickets with few exceptions . there have been considerable differences in the degree of resistance to 1,25-dihydroxyvitamin d and apparently satisfactory responses have been reported in some cases . we are describing a case of 15-year - old boy who was referred to endocrinology clinic with progressive bowing of legs . the patient was noted by his parents to have abnormal legs which became increasingly evident when the patient began to walk . he had been seen in the orthopedic clinic ; but in spite of persistent calcium supplement , the bowing of legs was progressive and he had been found to have other features suggestive of rickets . then he was referred to endocrinology outpatient department ( opd ) at the age of 15 years , where he was seen by one of the author of this case report . he was born out of a nonconsanguineous marriage and was the eldest among his six siblings . there was no history suggestive of any malabsorption disorder , hypocalcemia or hypercalcemia , and no history of chronic liver disease or renal disease . the patient 's younger sister who was 9-year - old , also had similar history of progressive bowing of legs since she started walking . physical examination revealed a well - nourished boy whose height was 140 cm ( <3 percentile ) . there was moderate bowing of all leg bones and widening of wrist , knee , and ankle joints bilaterally . figures 1 and 2 shows deformity in the limbs of both the cases . deformity in the upper limbs in both the cases deformity in the lower limbs in both the cases radiological studies of long bones of both the patient and his sister showed cupping , fraying , widening of metaphysis , osteopenia , and bowing . figures 36 shows the radiological changes including cupping , fraying , widening of metaphysis , and osteopenia in both the cases . radiological changes including cupping , fraying , widening of metaphysis , and osteopenia in upper limbs in the patient radiological changes including cupping , fraying , widening of metaphysis , and osteopenia in upper limbs in the patient 's sister radiological changes including cupping , fraying , widening of metaphysis , and osteopenia in lower limbs in the patient radiological changes including cupping , fraying , widening of metaphysis , and osteopenia in lower limbs in the patient 's sister on biochemical studies , the serum calcium level and serum phosphorus level were within normal range for both the patient and his sister . the serum alkaline phosphate level were markedly increased for both of them , 25-hydroxyvitamin d was low and 1,25 dihydroxyvitamin d was strikingly raised in both . twenty - four hour urinary calcium was high for the patient and low for his sister . biochemical parameters their serum electrolytes and arterial blood gas analysis were within normal range . no abnormalities of fat malabsorption , acidosis , and liver or renal function could be demonstrated . his parents or other siblings did not show any clinical , radiological , or biochemical abnormalities suggestive of rickets . with the above clinical , radiological , and biochemical parameter ; familial vitamin d resistant rickets was diagnosed . but , interestingly in both the cases described above in spite of having all the features of rickets , serum calcium level was persistently normal . physical examination revealed a well - nourished boy whose height was 140 cm ( <3 percentile ) . there was moderate bowing of all leg bones and widening of wrist , knee , and ankle joints bilaterally . figures 1 and 2 shows deformity in the limbs of both the cases . deformity in the upper limbs in both the cases deformity in the lower limbs in both the cases radiological studies of long bones of both the patient and his sister showed cupping , fraying , widening of metaphysis , osteopenia , and bowing . figures 36 shows the radiological changes including cupping , fraying , widening of metaphysis , and osteopenia in both the cases . radiological changes including cupping , fraying , widening of metaphysis , and osteopenia in upper limbs in the patient radiological changes including cupping , fraying , widening of metaphysis , and osteopenia in upper limbs in the patient 's sister radiological changes including cupping , fraying , widening of metaphysis , and osteopenia in lower limbs in the patient radiological changes including cupping , fraying , widening of metaphysis , and osteopenia in lower limbs in the patient 's sister on biochemical studies , the serum calcium level and serum phosphorus level were within normal range for both the patient and his sister . the serum alkaline phosphate level were markedly increased for both of them , 25-hydroxyvitamin d was low and 1,25 dihydroxyvitamin d was strikingly raised in both . twenty - four hour urinary calcium was high for the patient and low for his sister . no abnormalities of fat malabsorption , acidosis , and liver or renal function could be demonstrated . his parents or other siblings did not show any clinical , radiological , or biochemical abnormalities suggestive of rickets . with the above clinical , radiological , and biochemical parameter ; familial vitamin d resistant rickets was diagnosed . but , interestingly in both the cases described above in spite of having all the features of rickets , serum calcium level was persistently normal . the patient and his sister both exhibited many of the classic clinical and biochemical features of rickets including progressive bowing of legs ; widening of wrist , knee , and ankle joints ; moderate enlargement of costochondral junctions with markedly raised serum alkaline phosphatase ; low 25-hydroxyvitamin d ; and strikingly raised 1,25-dihydroxyvitamin d. in view of the striking increases in serum 1,25-dihydroxyvitamin d and the absence of evidence of poor nutrition , gastrointestinal malabsorption or noteworthy hepatic or renal disease , we attribute the clinical findings in our patient to impaired responsiveness of target organs to 1,25-dihydroxyvitamin d. both were treated with daily dose of oral calcium up to 3 g and 60,000 iu of vitamin d once weekly and asked for follow up after 3 months . on follow - up investigations , patient 's 25-hydroxyvitamin d and 1,25-dihydroxyvitamin d level were 26.02 and 254.0 , respectively ; and for his sister the level were 30.83 and 190.1 , respectively . unfortunately the patient refused further evaluation , and it is not known whether the skeletal lesions also responded to vitamin d. finally , the mode of inheritance of the disorder in our patient is unknown . in fact , it has not been determined whether the defect is hereditary or acquired . there have been several reports of the sporadic occurrence of vitamin d dependent rickets with onset in late childhood . it is not known whether the defect in these patients is similar to the one in our patient . vddr ii is a hereditary disease of target organ resistance to 1,25-dihydroxyvitamin d which is a biologically active metabolite of vitamin d. the characteristic clinical features of this disease are rickets , hypocalcemia , hypophosphatasia , secondary hyperparathyroidism , and elevated serum levels of alkaline phosphatase activity and 1,25-dihydroxyvitamin d. no appropriate guidelines for treatment of patients with vddr ii are available . the success of the treatment is variable and depends on the degree of hormone resistance . when some vdr function is present , a pharmacologic rather than physiologic dose of calcitriol or alphacalcidol can improve calcium absorption and heal rickets . | rickets is softening of bones due to defective mineralization of cartilage in the epiphyseal growth plate , leading to widening of ends of long bones , growth retardation , and skeletal deformities in children .
the predominant cause is deficiency or impaired metabolism of vitamin d. the observation that some forms of rickets could not be cured by regular doses of vitamin d , led to the discovery of rare inherited abnormalities of vitamin d metabolism or vitamin d receptor .
vitamin d dependent rickets ( vddr ) is of two types : type i is due to defective renal tubular 25-hydroxyvitamin d 1- hydroxylase and type ii is due to end - organ resistance to active metabolite of vitamin d. typical signs are observed from the first month of life .
the patient with rickets described below had markedly increased serum alkaline phosphatase and 1,25-dihydroxyvitamin d. we attribute these abnormalities to impaired end - organ responsiveness to 1,25-dihydroxyvitamin d. |
adenomatoidodontogenic tumor ( aot ) is a slow growing lesion , constituting only 2.2% to 7.1% of all odontogenic tumors and 0.1% of jaw tumors , with a predilection for the anterior maxilla of young females in the second decade of life [ 14 ] . patients are usually referred to dentists with complaints of impacted teeth within the lesion , usually a canine . the lesion may be associated with the coronal portion of the tooth or extend to the root [ 14 ] . aot is composed of odontogenic epithelium in a variety of histoarchitectural patterns , embedded in a mature connective tissue stroma and characterized by slow but progressive growth . some authors describe it as a true benign , non - aggressive , non - invasive neoplasm , while others conceptualize it as a developmental hamartomatous odontogenic growth [ 16 ] . however , large tumors that involve serious loss of bone and thin the bone dangerously are often treated by insertion of a drain or by marsupialization . marsupialization decreases intracystic pressure and promotes shrinkage of the cyst as well as bone fill [ 79 ] . the author report a case using surgical and orthodontic approaches to preserve the impacted canine due to extensive aot . an 11-year - old boy presented with a swelling of the right side of his face for one month . physical examination showed a painless and circumscribed swelling of the right maxillary , but skin color was normal . panoramic radiograph demonstrated a well - defined unilocular radiolucent lesion at the apices of the roots of the right maxillary from the lateral incisor to the first molar . due to the expansive growth there was deviation of the roots of right maxillary lateralis , first and second premolar ( fig . 1a ) , and of the roots of right mandibular canine and first premolar ( fig therefore , we planned marsupialization of the lesion through the extracted socket of deciduous canine to create a window allowing continuous drainage of the tumor content . we treated the patient by marsupialization under local anesthesia , extracting the deciduous canine affected by the tumor . finally , we inserted a vaseline gauze into the cyst cavity to keep it open and to achieve hemostasis . panoramic radiographs were taken at three month intervals until the tumor - associated teeth erupted . after six months , there was further occlusal movement of the developing tooth with reduced radiolucency . the root formation of maxillary canine had continued , and bone formation was evident in the tumor ( fig . 2 ) . follow - up examination revealed occlusal movement of the developing tooth bud , but no apparent reduction in the radiolucency . so we performed enucleation and curettage , exempting the impacted canine , 12 months after marsupialization and decompression ( fig . six months after marsupialization , a multibracket appliance was placed in the maxillary arches , and to reinforce anchorage , a nance appliance was placed . a small orthodontic button , threaded with soft twisted ligature wire of 0.012-inch gauge , was bonded during the partial enucleation and curettage . after 20 months of traction , the canine erupted and orthodontic treatment was finished after 37 months . although we did orthodontic treatment only at the maxillary arch , class i occlusion was achieved with an acceptable interincisal relationship . we continued to observe the patient , and the tumor did not recur as of one year postoperatively ( fig . microscopic examination revealed an extremely vascular encapsulated lesion showing multivariate patterns of cellular arrangements ranging from sheets of polygonal cells arranged in ductal patterns , rosettes to solid sheets of cells . in the center of these ducts , the solid lobular masses showed numerous spindle to columnar hyperchromatic cells with interspersed deposits of eosinophilic hyaline - like material . , the most striking pattern is that of various sizes of solid nodules of columnar or cuboidal epithelial cells forming nests or rosette - like structures with minimal stromal connective tissue ( fig . we took a preventive approach to preserve the developing canine . therefore , we planned marsupialization of the lesion through the extracted socket of deciduous canine to create a window allowing continuous drainage of the tumor content . we treated the patient by marsupialization under local anesthesia , extracting the deciduous canine affected by the tumor . finally , we inserted a vaseline gauze into the cyst cavity to keep it open and to achieve hemostasis . panoramic radiographs were taken at three month intervals until the tumor - associated teeth erupted . after six months , there was further occlusal movement of the developing tooth with reduced radiolucency . the root formation of maxillary canine had continued , and bone formation was evident in the tumor ( fig . 2 ) . follow - up examination revealed occlusal movement of the developing tooth bud , but no apparent reduction in the radiolucency . so we performed enucleation and curettage , exempting the impacted canine , 12 months after marsupialization and decompression ( fig . six months after marsupialization , a multibracket appliance was placed in the maxillary arches , and to reinforce anchorage , a nance appliance was placed . a small orthodontic button , threaded with soft twisted ligature wire of 0.012-inch gauge , was bonded during the partial enucleation and curettage . after 20 months of traction , the canine erupted and orthodontic treatment was finished after 37 months . although we did orthodontic treatment only at the maxillary arch , class i occlusion was achieved with an acceptable interincisal relationship . 4 ) . we continued to observe the patient , and the tumor did not recur as of one year postoperatively ( fig . microscopic examination revealed an extremely vascular encapsulated lesion showing multivariate patterns of cellular arrangements ranging from sheets of polygonal cells arranged in ductal patterns , rosettes to solid sheets of cells . in the center of these ducts , the solid lobular masses showed numerous spindle to columnar hyperchromatic cells with interspersed deposits of eosinophilic hyaline - like material . , the most striking pattern is that of various sizes of solid nodules of columnar or cuboidal epithelial cells forming nests or rosette - like structures with minimal stromal connective tissue ( fig . current convention classifies aots into three main types : follicular ( or pericoronal ) , extrafollicular ( or extracoronal ) , and peripheral ( or extraosseous / gingival ) . in a recent retrospective study , radiographically , this lesion usually surrounds an unerupted tooth and is seen as a corticate radio - lucency with small radiopacities , but there are cases where the lesion has no radiopaque component , as in our case , and in such a case , a dentigerous cyst is the preferred differential diagnosis . however , an aot often appears to envelop the crown as well as the root as shown in the picture of this case [ 16 ] . when deciding treatment methods , the age of patient , anatomical structures , the region of lesion and the size of cyst should be considered . surgical enucleation or curettage is the usual treatment modality for aot associated with impacted teeth and/or complete removal of the tooth buds . marsupialization , decompression , and the partsch operation is a treatment in which a pouch - like surgical window on the wall of the cyst is incised , the contents of the cyst evacuated , and the continuity between the cyst and oral cavity , maxillary sinus , or nasal cavity is maintained . after marsupialization , the reduction of tumor size should be carefully monitored , and if needed , immediate surgical removal should be performed [ 711 ] . usually , the tumors do not exceed 1 to 3 cm in greatest diameter , and while usually asymptomatic , may be associated with cortical expansion as in the present case . to the best of our knowledge , this case of large aot with the sequential surgical approaches and the preservation of impacted tooth is rare in the published literature [ 112 ] . we performed the orthodontic treatment to bring the involved tooth into the arch for eruption . traction on an impacted tooth with an immature root often causes root resorption , root deformation , and pulpitis . in the present case , the root length of the impacted canine was less than three - fifth that of a normal root , and the root apex was open . observation of the impacted tooth is necessary after creating a space for tooth spontaneous eruption . we applied the orthodontic button bonding and orthodontic traction after tooth did not erupt further . therefore , careful observation and orthodontic treatment during the optimal period is necessary in a growing patient with an impacted tooth and tumor . it should be emphasized that careful diagnostic procedures and adequate interpretation of clinical and radiographic findings will lead to a correct diagnosis . to preserve the involved tooth , the tumor size and the position of tooth further validation of recurrence of aot and prognosis of saved tooth needs large clinical studies . | the present report describe the surgical therapy , clinical course , orthodontic treatment and morphological characteristics of an adenomatoid odontogenic tumor in the maxilla of an 11-year - old patient .
the cystic tumor filled the maxillary sinus and involved a tooth .
marsupialization was accompanied by partial enucleation and applied traction to the affected tooth by a fixed orthodontic appliance .
healing was uneventful and no local recurrence was observed during a 1-year period of follow - up control . |
the description of the external morphology was based on the air - dried material observed under a dissecting microscope . the specimen used in this study was deposited in the lichen herbarium of korean lichen research institute ( kolri ) in sunchon national university , korea . specimens from natural history museum and institute , chiba ( cbm ) , japan were also examined for comparison purposes . chemical analysis was made by hplc method ( yoshimura , 1994 ) using ymc - pack ods - a column and eluent solvent of meoh : h2o : h3po4 (= 80 : 20 : 1 , v / v / v ) . thallus tightly adnate , margine lobate , center subcrustoseareolate , lobes sublinear , 0.2~1.2 mm wide . external morphology : thallus saxicolous , subcrustose , more or less lobate at the center with clearly lobed margins , 2~6 cm broad , pale yellowish green ( fig . 1a ) ; lobes subirregular , variable 0.4~1.1 mm wide , sparingly branched , flat to more or less convex , contiguous to subimbricate ( fig . 1b ) ; upper surface continuous , emaculate , shiny , moderately isidiate , the isidia subglobose to cylindrical , darkening at the tips , unbranched ( fig . apothecia initially aspicilioid but soon emergent and sessile , the disk brown , 0.5~0.8 mm in diameter ; spores 5~6 9~11 m . chemistry : medulla k+ yellow ; sticitic acid , norstictic acid and usnic acid ( fig . 2 ) habitat and ecology : scattering on the rock surface of exposed splash zone along sea coastal lines with other lichens such as xanthoria and caloplaca sp . distribution : it is the most widespread species in the genus on the world level and occurs commonly on sandstones in south africa , south west africa , brazil , uruguay , australia , hong kong , taiwan , japan and india . east asian specimens ( taiwan , japan and korea ) were mainly found along sea coast . , on seaside rock ( splash zone ) , hur 06 - 0001 ; japan , wakayama - ken , higashi - muro - gun , koza - cho , moritozaki point , 5 m alt . , on seaside rock ( supertidal zone ) , harada 16130 . ohshima island ( yashiro island ) yamaguchi - ken , ohshima - gun , touwa - cho , yun , hokibaba point , 6 m alt . remarks : this species is easily recognized by chemistry ( stictic acid ) and the presence of isidia . only two species of k. microscopica and k. saxeti are isidate , but the former has no sticitic acid ( k- ) . thallus tightly adnate , margine lobate , center subcrustoseareolate , lobes sublinear , 0.2~1.2 mm wide . upper surface continuous , emaculate , often pruinosed . lower surface with rhizoid or forming lamellae . external morphology : thallus saxicolous , subcrustose , more or less lobate at the center with clearly lobed margins , 2~6 cm broad , pale yellowish green ( fig . 1a ) ; lobes subirregular , variable 0.4~1.1 mm wide , sparingly branched , flat to more or less convex , contiguous to subimbricate ( fig . 1b ) ; upper surface continuous , emaculate , shiny , moderately isidiate , the isidia subglobose to cylindrical , darkening at the tips , unbranched ( fig . apothecia initially aspicilioid but soon emergent and sessile , the disk brown , 0.5~0.8 mm in diameter ; spores 5~6 9~11 m . chemistry : medulla k+ yellow ; sticitic acid , norstictic acid and usnic acid ( fig . 2 ) habitat and ecology : scattering on the rock surface of exposed splash zone along sea coastal lines with other lichens such as xanthoria and caloplaca sp . together distribution : it is the most widespread species in the genus on the world level and occurs commonly on sandstones in south africa , south west africa , brazil , uruguay , australia , hong kong , taiwan , japan and india . east asian specimens ( taiwan , japan and korea ) were mainly found along sea coast . , on seaside rock ( splash zone ) , hur 06 - 0001 ; japan , wakayama - ken , higashi - muro - gun , koza - cho , moritozaki point , 5 m alt . , on seaside rock ( supertidal zone ) , harada 16130 . ohshima island ( yashiro island ) yamaguchi - ken , ohshima - gun , touwa - cho , yun , hokibaba point , 6 m alt . remarks : this species is easily recognized by chemistry ( stictic acid ) and the presence of isidia . only two species of k. microscopica and k. saxeti are isidate , but the former has no sticitic acid ( k- ) . | karoowia saxeti was recorded during the lichen field expedition in southern part of korea in 2006 .
the lichen was found on the rock surface along coastal line .
this species was easily recognized by chemistry ( k+ yellow ) and the presence of isidia .
thallus was saxicolous , subcrustose , more or less lobate at the center with clearly lobed margins , 2~6 cm broad and pale yellowish green .
thalli lobes were irregular , variable , up to 1.0 mm wide , not branched , flat to more or less convex and contiguous to subimbricate .
upper surface of the thalli was continuous , emaculate , moderately isidiate .
the isidia was subglobose to cynlindrical , darkening at the tips and unbranched .
low surface of the thalii was black with a spongy rhizoidal and lamellar layer .
hplc analysis proved the presence of stictic acid ( k+ yellow ) , norstictic acid and usnic acid .
this is the first record of the species in south korea . |
several cases of desmoplastic ameloblastoma ( da ) of the maxilla that extended into the maxillary sinus have been described,[15 ] but there has been no report of da occupying the entire sinus . here , we report a rare case of a da lesion that filled the entire maxillary sinus . the patient was a 29-year - old japanese female who visited the department of oral and maxillofacial surgery at mie university hospital with a chief complaint of swelling around the upper left premolars . the swelling had persisted for 1 month without subjective symptoms such as pain before she was referred to our hospital by a local dentist . at the initial examination , there was no buccal numbness , tenderness , nasal congestion , or eye manifestation . palpation of the oral cavity indicated the presence of a bone - like and hard , but painless , mass [ figure 1 ] . a panoramic x - ray captured an image of a mixture of ill - defined radiolucency and radiopacity that extended from the swollen area to the maxillary sinus , and revealed root divergence between the upper left first premolar and second premolar , but the absence of periapical resorption [ figure 2 ] . a computed tomography scan showed that a lesion containing bone - like tissues occupied almost the entire maxillary sinus . the lesion extended from the alveolar process of the premolars to the anterior region of the outer wall of the maxillary sinus , the palatine process , the lateral wall of the nasal cavity , and close to the floor of the orbit . the bone wall was relatively well preserved , but a part of the lesion had entered the nasal cavity [ figure 3 ] . the lesion showed heterogeneous isointensity on t1-weighted mri and hypointensity on t2-weighted magnetic resononce imaging [ figure 4 ] . the oral cavity at the initial examination showing a painless mass around the upper left premolars a panoramic x - ray captured an image of a mixture of ill - defined radiolucency and radiopacity that extended from the swollen area to the maxillary sinus , and revealed root divergence between the upper left first premolar and second premolar a ct scan showed that a lesion containing bone - like tissues occupied almost the entire maxillary sinus mr image showing heterogeneous isointensity on t1-weighted mri and hypointensity on t2-weighted mri the tumor was pathologically diagnosed as ameloblastoma based on biopsy results . however , based on the patient 's request and her age , removal of the tumor and curettage of the bone around the tumor , and extraction of # 11 , # 12 , # 13 , and # 14 were performed under general anesthesia . the tumor had adhered to the bone and occupied almost the entire maxillary sinus , but did not reach the floor of the orbit or the posterior wall of the maxillary sinus . histopathological findings from isolated tissues showed that the tumor parenchyma had a fiber architecture , which was similar to the enamel organ , with small alveolar or trabecular structures , and spread in the abundant interstitium consisting of scar - like fiber tissues with a few cellular components . the patient was followed up in the outpatient department after discharge , but a ct scan performed at 4 months postoperatively revealed the presence of residual and recurrent tumor in the area of the upper left lateral incisor . therefore , removal and curettage were performed again and the upper left lateral incisor was extracted . the subsequent course has been benign and the patient has been followed up in the outpatient department as of 12 months postoperatively . histopathological view showing that the tumor parenchyma had a fiber architecture with small alveolar or trabecular structures , and spread in the abundant interstitium consisting of scar - like fiber tissues with a few cellular components . ameloblastoma is the most common odontogenic epithelial tumor , accounting for 1118% of all odontogenic tumors , and da accounts for 412% of ameloblastomas . the most common site is from the anterior teeth to the premolars in both the maxilla and mandible , unlike other types of ameloblastoma , which typically occur in the mandibular molars . the size is relatively small and the longest diameter is generally 2 cm or less.[610 ] the majority of ameloblastomas show radiolucency on x - ray , while approximately 50% of da cases have a mixture of radiolucency and radiopacity . da is a histologically solid tumor without capsule formation , and is characterized by abundant collagen fiber formation in the interstitium . yoshimura et al . reported that da lesions were generally smaller than other ameloblastoma lesions because da growth might be inhibited by collagen fibers . however , the da lesion in our case occupied almost the entire maxillary sinus , which suggests that collagen fibers are unlikely to inhibit da growth . there are several reports of resection and curettage for treatment of da , but the risk of recurrence is higher in these procedures compared to total resection,[79 ] with recurrence in 6 of 19 cases treated with removal and curettage.[379 ] da with extensive spreading to the maxillary sinus is relatively common,[15 ] but a case with the lesion occupying almost the entire sinus , as in our case , is rare . da generally grows slowly , but once it enters the maxillary sinus the growth may be accelerated because there are no tissues to interfere with growth . the prognosis is good with rare recurrence when extended resection is applied in cases of da that spread to the maxillary sinus , but recurrence has been reported after removal and curettage , as in our case . extended resection is the first line therapy for a case in which the tumor has entered and occupied the maxillary sinus . if removal and curettage are requested by the patient or performed for other reasons , wide removal of the lateral wall of the nasal cavity is required to allow detection of recurrence and inspection of the inside of the maxillary sinus from the opening of the nasal cavity using a fiberscope . therapy should be selected based on the quality of life of patients , and the risk of recurrence following removal and curettage should be disclosed to the patient . recurrence may be detected relatively easily based on radiographic characteristics , and therefore follow - up with an x - ray examination such as a ct scan is important . | we report a rare case of desmoplastic ameloblastoma lesion that filled the entire maxillary sinus .
the patient visited our hospital with a chief complaint of swelling around the upper left premolars .
a panoramic x - ray captured an image of a mixture of ill - defined radiolucency and radiopacity from the swollen area to the maxillary sinus . computed tomography ( ct ) and magnetic resononce imaging ( mri ) showed that the lesion occupied almost the entire left maxillary sinus and
had entered the nasal cavity .
a pathologic diagnosis of ameloblastoma was made after biopsy , and the tumor was removed and the marginal bone curetted under general anesthesia .
a ct scan at 4 months postoperatively indicated the presence of residual and recurrent tumor in the area of the upper left lateral incisor , and removal and curettage were performed again .
recurrence may be detected relatively easily based on radiographic characteristics , and therefore follow - up with an x - ray examination such as a ct scan is important . |
the genomes of higher organisms are littered with repetitive sequence elements , and evidence for how this came to be is accumulating through a combination of bench work and bioinformatics . long interspersed nuclear elements ( lines or l1s ) are retrotransposons that have generated integrated dna copies of themselves through rna intermediates . intact l1 rnas encode two proteins , orf1p and orf2p , which together associate with l1 rna and direct its nuclear importation , reverse transcription to dna , and integration at a random site within the host genome [ 1 - 3 ] . sequence analyses show a succession of l1 families in mammalian genomes , each family expanding over time before being relegated to the status of fixed dna by host - defense mechanisms and perhaps by direct competition from newer , more competent l1s . in humans , this history is traced in order through the inactive l1pa5 , l1pa4 , l1pa3b and l1pa2 families and the currently active l1pa1 family . in the mouse , the a , gf and tf families are currently active . although typically regarded as genetic baggage , martin vingron and his colleagues ( zemojtel et al . ) estimate in a recent paper in bmc genomics , that the mouse genome has approaching 5,000 intact active l1s in the diploid nucleus this is a timely reminder of both the harmful and potentially beneficial effects of l1 elements to cause functional changes in the genome . catalog examples of mouse transcripts that have incorporated portions of line sequences embedded in their genomic loci . although such incorporation into exons ' exonization ' and the related phenomenon of the co - option of transposon sequences for functional purposes ' exaptation ' have been described previously ( reviewed in ) , the new work from vingron 's team provides an update on the prevalence of l1 exonization within the mouse transcriptome . in most examples of exonization described by the authors , the l1 sequence provides a new start site of transcription ( figure 1 ) and provides exonic sequence followed by a gu splice donor site . in other examples , however , lines provide entire exons or ag splice acceptors with downstream transcript end points . contributions of single l1-derived splice sites creating chimeric l1/non - l1 exons were found less frequently . a hypothetical gene locus is diagrammed ( a ) before and ( b , c ) after insertion of an l1 in antisense orientation . ( b ) in one of these , the l1 sequence provides a novel transcription start site , an alternative first exon ( ex1 ' ) and a splice donor site . ( c ) in the second , an entire new exon ( ex3.1 ) with splice sites on either side is derived from the inserted l1 . , the l1 sequence is oriented in antisense with respect to the mrna ( figure 1 ) . first is the apparent potential of the antisense promoter in the orf1p sequence to initiate transcription , as was observed for 17 cdnas in this analysis . second is the presence of a greater number of functional donor and acceptor splice sites on the antisense strand compared with the sense strand , totaling 18 ( a - type l1s ) and 22 ( f - type l1s ) functional antisense splice sites versus four functional splice sites in the sense orientation . third is the repeated use of particular splice sites : sa -154 in the antisense 5 ' untranslated region and sd + 52 in antisense orf1p were used in 13 and 16 cdnas , respectively ( sa ( splice acceptor ) and sd ( splice donor ) numbers refer to the distance in nucleotides from the beginning of the orf1p coding sequence in sense - oriented l1mda2 ) . finally , there is a relative prevalence of antisense intragenic l1 insertions , which are found 1.7 times more frequently than sense insertions . it has been proposed that this last observation is the result of rapid selection against sense - oriented l1s that interrupt gene loci . disruption of gene function by premature polyadenylation may be one reason an intragenic l1 insertion is selected against , and aauaaa sites in the sense direction of murine l1s outnumber those in the antisense orientation by a ratio of 9:2 using the m13002 l1mda2 sequence as a reference . perhaps more importantly , sense - oriented orf2 sequence interferes with transcriptional elongation , resulting in profoundly compromised transcript levels . disrupted transcription in the absence of true exonization can create hypomorphic and null alleles , but these are only two of many potential sequelae of an intragenic l1 insertion . allelic changes resulting in new functions by creating a novel transcription start or end site , or in the case of antisense l1s , both a premature polyadenylation site and a new transcript initiation site ( a scenario described as ' gene breaking ' ) . exonized repetitive sequences can also contribute to protein - coding sequence . give the example of guanylate - binding protein 5a ( encoded by gbp5 ) , which is predicted to have a 174-amino - acid carboxy - terminal extension derived from an exonized l1 . because of the activity of murine l1s , comparison across inbred mouse strains reveals many polymorphic l1 insertions ( david symer , personal communication ) . this observation , coupled with the genetic tractability of the mouse , will make it instrumental in our understanding of the functional aspects of endogenous l1s . interestingly , cell context is emerging as an important factor in the exonization of transposon sequences , with tissue- and tumor - specific transposon - derived cdnas being identified . as yet , the functional consequences of such exonizations are not well understood , but recognition that exonization might depend on cellular context lends special significance to the annotations of predicted intronic l1 splice sites by zemojtel et al . as similar projects are undertaken in the human genome , experimentalists with an interest in a particular locus in a given cell type or tumor context will have a new tool for predicting alternative l1-containing transcripts , even in the absence of expressed sequence tags indicating splice - site usage . in addition to changes to an mrna that result from transposon insertion , pressure created by acquisition of a novel function ( neofunctionalization ) may act on transposon sequences over evolutionary time . it has been proposed that transposon exonization is a prelude to sequence exaptation , and that alternative splicing of the exon initially allows either its loss or functional co - option [ 16 - 18 ] . selective divergence of exonized sequence from the l1 consensus is not appreciable in the examples given by zemojtel et al . : that is , an exonized l1 sequence segment is equally similar to a consensus l1 as is the entirety of the l1 containing it ( our unpublished analysis ) . thus , the status of these relatively young murine l1 sequences may be similar to that of recently exonized alu sequences in primates in that there is no appreciable sequence co - option . neofunctionalization of more ancient transposon sequences is , however , being increasingly recognized from examinations of mammalian gene structure . examples include an alternatively spliced exon in poly(rc)-binding protein 2 ( pcbp2 ) that is borrowed from a silurian period sine ( short interspersed nuclear element ) transposon ; the recombination - activating gene 1 ( rag1 ) , which may be derived from a transib dna transposon ; the primate set domain and mariner transposase fusion gene ( setmar ) related to the mariner - like hsmar1 transposon ; and the derivatives of tf1/sushi ltr retrotransposons , the mar gene family , which includes an essential gene for mammalian development , paternally expressed gene 10 ( peg10 ) . we expect that , along with identifying already neofunctionalized sequences , studies of recent exonization events will enhance our understanding of mobile element exaptation . in summary , the recent paper by vingron and colleagues provides an updated view of the mouse genome and transcriptome with respect to already exonized l1 sequences and intronic l1s with the potential to become part of processed transcripts . this work furthers our understanding of the complex relationships between mammalian genes and the retroelements within them . | long interspersed nuclear elements ( lines ) are among the most successful parasitic genetic sequences in higher organisms .
recent work has discovered many instances of line incorporation into exons , reminding us of the hazards they pose to genes in their vicinity as well as their potential to be co - opted for the host 's purposes . |
the modern concept of decompression for traumatic brain injury ( tbi ) was introduced by harvey cushing before world war i . the monro - kellie hypothesis dictates that the amount of space within the skull is constant ; therefore , when the pressure is raised death occurs by herniation when the capacity for adjustment by fluid shifts from the cerebrospinal fluid and vascular compartments are already maximized . increasing the skull size by removing bone and opening the dura delays or prevents these limits from being reached . however , in the 90 years since cushing made these observations , medical , radiographic , and surgical advances in the management of tbi have obviated the need for an aggressive surgical approach in all but a minority of cases . in spite of the ability to control intracranial pressure ( icp ) elevation in most cases with removal of mass lesions , osmotic diuretics , ventricular drainage , sedative / hypnotic agents , and prevention of hypercapnea , occasional cases occur in which icp elevation accelerates in spite of maximal conservative medical therapy , and then so - called heroic measures are employed . these are considered at the ' option ' level in the american association of neurological surgeons criteria for management of severe brain injury because no large randomized trial has proven their efficacy . in the pediatric population , ruf and colleagues as well as taylor and associates have addressed the issue of using decompressive craniectomy as a more formal part of a head injury protocol before going to other ' option ' therapies once icp elevation is affirmed . bifrontal decompressive craniectomy is an aggressive approach described by kjellberg and prieto before the era of modern neuroimaging with computed tomography . this approach is particularly useful in the pediatric population , in which diffuse injury without mass lesions and with icp elevation is relatively common . hemicraniectomy represents a large cranial and dural decompression , often associated with removal of mass lesions such as subdural hematoma or traumatic intracerebral hematoma . bitemporal decompressions are unilateral or bilateral bony decompressions designed to take the pressure off the temporal lobes to prevent uncal herniation , and have been used in other cranial conditions such as pseudotumor cerebri . gower and coworkers reported 40% mortality and 50% favorable outcome in a study of subtemporal decompression for icp control in 10 patients with closed head injury who had failed medical therapy , including barbiturate coma . cerebellar decompression for mass lesion is a standard neurosurgical response to any process in the posterior fossa ( hemorrhage , tumor , infection , or stroke ) that threatens cerebellar tonsillar herniation . the paper by ruf and colleagues purports to be a pilot study employing decompressive craniectomy in a standardized approach following development of medically refractory icp in the pediatric population . of the six cases presented , three involve bifrontal craniectomies : two unilateral and one cerebellar . the patients underwent surgery between hospital days 1 and 6 and had icp as low as 20 and as high as 70 mmhg . glasgow outcome scale findings are not provided ; however , at least four of the patients appeared to have no more than a mild disability . they randomly assigned 27 patients to craniectomy or medical management alone and found that the craniectomy patients obtained lower icp and better outcomes . in the control group only 14% of children had a favorable outcome , as indicated by 6-month glasgow outcome scale scores . that study suggested ( as statistical significance was not met because of the small numbers ) that aggressive early decompressive craniectomy may benefit this patient group . polin and colleagues explored the use of decompressive bifrontal craniectomy in victims of tbi . this group used a cohort control matching protocol employing the traumatic coma databank to match subjects based on age , icp , radiographic findings , and admission glasgow coma scale score . in a conditional logistic regression analysis comparing all 92 control patients with the craniectomy population , those investigators detected a significant influence of the operation on favorable outcome ( wald = 6.097 ; p = 0.014 ) . medical management alone carried a 3.86-fold greater risk for unfavorable outcome than did decompressive craniectomy . a pediatric subgroup was identified that appeared to benefit from the procedure ( p = 0.025 ) . the authors further identified a subgroup of patients who received surgery within 48 hours and who never had sustained icp elevation over 40 mmhg . the pediatric patients in this subset had favorable outcomes in 8 out of 10 cases , with statistically improved outcomes compared with control individuals . we think it unlikely that decompressive craniectomy will become a commonplace management scheme for tbi . standard medical management allows control of icp while preserving the ability to conduct a neurologic examination . the role of decompression as compared to that of other ' option ' therapies , such as hypothermia and barbiturate coma , is still evolving . the advantage of decompressive craniectomy over these other therapies is the rapid and generally permanent decline in icp , maintenance of neurologic status , and even the ability to obtain a neurologic examination after the procedure is performed . the disadvantages are the need for at least two surgeries ( one to replace the bone flap ) and the theoretical development of bifrontal contusions after decompression . decompressive hemicraniectomy and duraplasty for evacuation of mass lesions and management of unilateral hemispheric swelling is more widely accepted in head injury management . most surgeons have first hand experience with delayed cerebral swelling after removal of a subdural hematoma , presumably caused by venous infarction and/or cerebral contusion . some will remove the bone flap prophylactically after such operations and others the paper by ruf and colleagues provides more ammunition for the argument that decompressive craniectomy is a safe and effective method of icp reduction in severe tbi with associated icp elevation refractory to standard management . however , this approach remains a second tier strategy recommended only at the option level . for this scheme to become more prevalent , a large - scale multicenter trial such as that being planned by coplin and colleagues would be necessary . | more frequently than adults , pediatric victims of severe traumatic brain injury experience diffuse severe cerebral edema without mass lesions .
these patients require methods to reduce intracranial pressure quickly and reliably .
surgical decompression provides rapid relief of increased intracranial pressure and is an alternative to maximal medical therapy for these individuals .
based on previous trials , most of which are anecdotal but now include attempts at case controlled and cohort matched investigations , ruf and colleagues describe a series of six pediatric patients treated with a prospectively implemented protocol of decompressive craniectomy for severe traumatic brain injury .
the heterogeneous approaches presented ( which include hemicraniectomy , bifrontal craniectomy , and suboccipital craniectomy ) undermine the applicability of the results .
however , this report , coupled with similar papers , does highlight the need for a true controlled trial of this modality to examine whether craniectomy can emerge as more than a second line option for the management of increased intracranial pressure . |
epidermal nevus syndrome ( ens ) is characterized by epidermal nevi associated with abnormalities involving the nervous , skeletal and other systems . rarely , hypophosphatemic rickets has also been observed in association with epidermal nevi . phosphatonins including fibroblast growth factor-23 ( fgf-23 ) , which may be secreted by an epidermal nevus . the congenital nevomelanocytic nevus ( cnn ) , commonly known as based on diameter , cnn are characterized as small ( < 1.5 cm ) , medium ( 1.5 - 19.5 cm ) and giant ( > 20 cm in adolescents and adults ) . studies report lifetime risk of developing a melanoma for patients with a large cnn ranging from 6.3% to 12.2% while for small cnn , risk rates have been reported between 0.8% and 4.9% . ens and linear sebaceous nevus have been associated with various abnormalities including hypophosphatemic rickets , but only one case of giant hairy nevus associated with hypophosphatemic rickets has been reported until date . we report here a case of giant cnn associated with severe hypophosphatemic rickets , probably due to secretion of fgf-23 . a 10-year - old boy presented with a difficulty in walking and progressive deformity of the lower limbs since 2 years of age . history of delayed milestones started walking at 2 years of age , history of poor height gain and history of difficulty in getting up from the squatting position . no history of seizures , carpopedal spasms , periodic muscle weakness , dental abscess , hearing loss , pain abdomen , hematuria , polyuria , diarrhea and pain abdomen . he had been on treatment with oral vitamin d and phosphate supplementation irregularly . on examination , his skin was remarkable for the presence of few hairy nevi , largest one covering his entire back and shoulders [ figure 1 ] . investigations revealed serum calcium 8.7 mg / dl ( normal 8.1 - 10.4 mg% ) , serum phosphate 2.1 mg / dl ( normal 2.1 - 4.5 mg% ) and serum alkaline phosphatase 2685 u / l ( normal 0 - 18 years : 240 - 840 iu ) . 24 h urine collection showed creatinine , calcium and phosphate excretion of 0.12 g , 0.01 g and 0.17 g respectively . serum intact parathormone levels was 127.7 pg / ml and serum 25(oh ) vitamin d levels was 69 ng / ml . urine examination for glucose and amino acids was negative and ruling out any possibility of proximal renal tubular acidosis . 99m - tc methylene - diphosphonate whole body scintigraphy revealed diffusely increased radiotracer uptake in the entire axial and peripheral skeleton , more prominent in calvarium , mandible and bilateral costochondral junctions suggestive of metabolic bone disease . serum fgf-23 levels were found to be raised ( 171 u / l ) [ figures 13 ] . patient was diagnosed as a case of cnn with hypophosphatemic rickets and started on phosphate supplement and calcitriol . giant hairy nevus on the back of patient with small nevi over left thigh 99m - tc methylene - diphosphonate whole body scintigraphy x - ray of both knees showing rachitic changes x - ray both hands with wrists showing rachitic changes hypophosphatemic rickets constitutes a group of disorders in metabolic bone disorders due to the defective renal phosphate resorption . acquired forms of hypophosphatemic rickets have been reported to be associated with various tumors including mesenchymal tumors , hemangiomas and soft - tissue tumors . however , the combination of hypophosphatemic rickets with ens or giant hairy nevus is rarely reported . other skin lesions that can occur in ens are vascular nevi , hypopigmented macules and caf au lait macules . the central nervous system abnormalities in patients with ens include seizures , hemiparesis , developmental delay , mental retardation , abnormal cerebral gyration , underdeveloped temporal lobe and sensorineural deafness . surgical excision of the nevus has been reported to improve or cure the metabolic derangement . injection of the supernate from homogenized portion of excised tissue into experimental animals has been shown to induce excessive phosphaturia suggestive of the causative role of epidermal nevus . the nature of the phosphaturic factor in ens is not well - understood , but elevated circulating fgf-23 levels has been reported in one patient with hypophosphatemic rickets . this case illustrates the rare association of hypophosphatemic rickets with giant hairy nevus and it also highlights the significance of clinical and biochemical examination of children with epidermal nevi . this association is hence important to recognize so that early surgical correction can be planned and permanent disability can be avoided . | the association of multisystem pathologic conditions and epidermal nevi , known as the epidermal nevus syndrome , includes disorders of bone , central nervous system , eye , kidney , vasculature and skin . rarely , congenital nevomelanocytic nevus also known as hairy nevus has also been reported in association with hypophosphatemic rickets .
studies suggest that phosphaturia , caused by circulating factors , called phosphatonins may be secreted by an epidermal or hairy nevus .
we report here , a rare case of hypophosphatemic rickets associated with a giant hairy nevus in a 10-year - old boy . |
ganciclovir , a drug against cytomegalovirus ( cmv ) infection , is generally well tolerated , but can cause neurotoxicity such as encephalopathy . although ganciclovir - induced encephalopathy has been described in several reports , a literature search revealed that ganciclovir concentrations in the blood or cerebrospinal fluid were previously measured in only 3 patients with encephalopathy . prompt and accurate diagnosis is thus sometimes difficult , and is derived solely from accumulated clinical information of definite cases , since ganciclovir concentrations , not routinely measured , become available after several days or a few weeks . here , we summarize clinical information of all patients with definite ganciclovir - induced encephalopathy including our own patient , who had severe symptoms , with the highest reported trough concentration of ganciclovir in the blood , and underwent therapeutic dialysis with complete recovery . encephalopathy can be caused by neurotoxicity with prophylactically or therapeutically administered drugs such as acyclovir , ganciclovir , and their prodrugs , valacyclovir and valganciclovir . the drugs are structurally similar nucleoside analogues , but their effects on neurons are poorly understood . acyclovir - induced encephalopathy is more widely known than ganciclovir - induced encephalopathy , possibly because acyclovir is used against herpes virus infection , which is more common than cytomegalovirus ( cmv ) infection , for which ganciclovir is used . ganciclovir was also reported to be effective against hepatitis b infection , but has rarely been used for this indication recently . although ganciclovir - induced encephalopathy has been documented previously , a literature search revealed that ganciclovir concentrations in the blood or cerebrospinal fluid ( csf ) have been reported in only 3 patients [ 1 , 2 , 3 ] . previous reports on patients with such definite ganciclovir - induced encephalopathy have suggested that the trough concentration of ganciclovir in the blood is important . here , we summarize clinical information of patients with definite ganciclovir - induced encephalopathy including our own patient , who had severe symptoms , with the highest reported trough concentration of ganciclovir in the blood , and underwent therapeutic dialysis . a 55-year - old man started to receive hemodialysis because of diabetic renal failure 2 years previously . he underwent renal transplantation 1.5 years previously , and had been receiving immunosuppressants since then . eight months after transplantation , the serum creatinine level increased to 4.4 mg / dl . he had cmv enteritis with occult blood in the stool and an elevated cmv pp65 ( c7-hrp ) antigen level in blood mononuclear cells . intravenous ganciclovir ( 150 mg / day ) was administered for 11 days , followed by valganciclovir ( 450 mg / day ) . because the enteritis was very severe , ganciclovir and valganciclovir two days after starting valganciclovir , he had unsteady gait , but could walk unaided . on the next day , the patient needed assistance with walking . his consciousness was mildly disturbed ( e3 , v5 , and m6 on the glasgow coma scale ) . two days later , he was found on the floor after falling , without major injuries . nine days after starting valganciclovir , his level of consciousness worsened ( e3 , v3 , and m5 ) , and he could not receive oral drugs , including valganciclovir . encephalitis was unlikely , since no meningeal signs or fever was noted ; the cell count was normal ( 0.33 cells/l ) in the csf , and the protein concentration marginally elevated ( 54 mg / dl ) . cmv , herpes simplex virus , varicella - zoster virus , and epstein - barr virus dna was later found to be negative in the csf . because of the risk of further falls , hemodialysis using a vps-15 ha membrane , a vitamin e - coated polysulfone membrane ( asahi kasei kuraray medical , japan ) was performed twice in 2 days . his consciousness improved considerably after the first session of dialysis ( e3 , v4 , and m6 ) and was completely restored on the next morning after the second session ( e4 , v5 , and m6 ) . the trough levels of ganciclovir in the serum and csf were retrospectively measured and are shown in table 1 . generally , ganciclovir is well tolerated , but caution is required in patients with renal impairment . additionally , the severe symptoms in our patient may have been attributed to high doses of ganciclovir or valganciclovir for treatment of severe cmv enteritis . although the trough blood ganciclovir concentration in our patient was the highest reported to date , his csf ganciclovir concentration was the second highest among the 4 patients reported to date in the literature . such discrepancies between the csf data and blood data may be explained by other factors , including penetration rates ( how much ganciclovir passes through the blood - brain barrier ) , which are reported to vary among individuals . however , csf concentrations may not necessarily reflect the severity of encephalopathy . as an extreme example , 1 previous patient with an undetectable level of ganciclovir in the csf ( patient 2 in table 1 ) still had disturbed consciousness . we speculate that the severe symptoms in our patient might have been attributed to peripheral nervous system involvement , which may be more sensitive to blood ganciclovir concentrations . although definitive conclusions must await further studies , blood trough concentrations of ganciclovir may be more closely related to symptom severity than csf concentrations . however , a fall , as observed in our patient , can cause devastating complications , an extended hospital stay , or both . in such patients dialysis also has a positive effect on the function of the transplanted kidney . in summary , our experience suggests that therapeutic dialysis is a safe and effective treatment for encephalopathy as well as for a damaged transplanted kidney . the measurement of ganciclovir concentrations in the csf may not be feasible for the management of encephalopathy in individual patients because it is not routinely performed , and because several days to several weeks are required for the results . nonetheless , measurement of ganciclovir concentrations can play an important role in confirming the diagnosis and evaluating disease severity . we believe that accumulated knowledge on such patients with confirmed encephalopathy will lead to prompter and more accurate diagnoses . | backgroundganciclovir , a drug against cytomegalovirus ( cmv ) infection , is generally well tolerated , but can cause neurotoxicity such as encephalopathy .
although ganciclovir - induced encephalopathy has been described in several reports , a literature search revealed that ganciclovir concentrations in the blood or cerebrospinal fluid were previously measured in only 3 patients with encephalopathy .
symptoms usually include confusion and disturbed consciousness , which mimic cmv encephalitis .
prompt and accurate diagnosis is thus sometimes difficult , and is derived solely from accumulated clinical information of definite cases , since ganciclovir concentrations , not routinely measured , become available after several days or a few weeks.case presentationhere , we summarize clinical information of all patients with definite ganciclovir - induced encephalopathy including our own patient , who had severe symptoms , with the highest reported trough concentration of ganciclovir in the blood , and underwent therapeutic dialysis with complete recovery.conclusionour summary of patients with definite encephalopathy could lead to prompt and accurate diagnoses . |
the usefulness of constitutional diagnoses of humans using the skin of the hand is well established in medicine . examples include the dichotomy of hippocrates , the quartering method of hall , the three constitution theory of sigauard , the cosmic dual - force fifty people principle ( ) of huang di nei jing ( ) , and three docha theory popularized in india ( 1 ) . however , it is very difficult to standardize traditional diagnosis methods because they are dependent on qualitative judgments of inspectors themselves . a constitutional diagnosis using human skin is typically performed via palpation . through sasang constitutional medicine , humans can be distinguished based on properties of the skin , including its texture , roughness , hardness and elasticity ( 2 ) . the constitutional skin status has previously been reported as follows . in dongeusoosebowoon ( 3 ) , the properties of different types of human skin were categorized as :
in sasangyolam ( 4 ) , ancient korean doctors also described the constitutional skin status :
we inspect skins . the skin status of soyangins is slippery and thin , but occasionally some soyangins have a thick skin . the skin of tes is thick and stiff ; but tes occasionally have a soft skin . the skin status of soyangins is slippery and thin , but occasionally some soyangins have a thick skin . the skin of tes is thick and stiff ; but tes occasionally have a soft skin . the skin of ses is buoyant and soft . a recent questionnaire given to doctors of oriental medicine is presented in table 1 . among the factors in this table , elasticity was used as the determining factor to distinguish between the te and se types of constitutions in several previous research sources ( 35 ) and several qualitative clinical studies ( 68 ) . however , research on quantitative measurements of skin elasticity for constitutional diagnoses is lacking . table 1.questionnaire survey for doctors of oriental medicinewhat are the major factors of skin for a constitution diagnosis?factorpercentage thickness ( thick , thin)89.2 tactile sensation ( slippery , soft , rough)89.2 elasticity ( high , low)70.3
questionnaire survey for doctors of oriental medicine in this study , a system that uses a compression method to measure the elasticity of hand skin was designed and its measurement repeatability was evaluated . the difference in the elasticity of the hand skin between te and se subjects was also investigated . before fabricating the measurement system , the force required by a doctor of oriental medicine to grip the skin of a human hand was measured for inclusion in the design of the system based on previous work ( 9 ) ( figure 1
figure 1.measuring device and its design to test the muscular strength of finger grasping ; ( a ) a device with amplifier ; ( b ) a device ; ( c ) a design drawing . ) . measuring device and its design to test the muscular strength of finger grasping ; ( a ) a device with amplifier ; ( b ) a device ; ( c ) a design drawing . the concept of the system for measuring the elasticity of human skin utilized a mechanical technique that involved direct contact with the human hand based on the method used by doctors of oriental medicine during a palpation assessment ( figure 2 ) . figure 3 shows the proposed system and figure 4 shows a schematic of its contact component . the equipment ( figure 3 ) consisted of a compression tube that made contact with the skin ( solid line ) , a laser sensor that measured the displacement before and after the compression step ( dotted line ) , a motor that controlled the motion of the compression tube ( dot dashed line ) and a controller with a pump for compression and a valve for handling any leaks ( double dot dashed line ) . the laser sensor was selected to minimize dispersion of the hand skin and to prevent damage to the skin . a carrying jig ( figure 5 ) was fabricated to ensure perpendicular contact between the sensor tip and the hand . the jig was tilted as required to maximize the flatness of the contact point . table 2.specifications of the designed systemcomponentspecificationlaser sensor ( zx - ld40 , omron)diffusional reflection type , dc power detection length : 40 10 mm resolution : 2 m wavelength : 650 nm power : 1 mwvalvethree - way solenoid valvepump12 v , dc powerdaq ( usb , national instrument)14-bit , 48 ks / s multifunction i / o and ni - daqmx
figure 5.jig to hold the hand under analysis . ( a ) hand placeholder ; ( b ) tilting screw for the vertical direction ; ( c ) tilting screws for the x and y directions on the horizontal plane .
a qualitative judgment of doctors of oriental medicine during a palpation assessment . the measuring system for the elasticity of hand skin . ( a ) hand placeholder ; ( b ) tilting screw for the vertical direction ; ( c ) tilting screws for the x and y directions on the horizontal plane . the measured data were transferred to a personal computer ( pc ) using a usb - type daq ( data acquisition ) device . basic subject details ( including their name , age and gender ) were recorded , and the measurement time and the compression time of the pump were controlled , as shown in figure 6
figure 6.(a ) the control component ; ( b ) control software .. ( a ) the control component ; ( b ) control software . the grasping force for a person using the thumb and index finger as measured 10 times using the device shown in figure 1was 10 n , with an accuracy of 1% . the compression force of the proposed system was designed to be the same as this grasping force . the diameter of the contact probe was 8 mm , and hence the compression pressure was maintained at 2000 kpa . ue denotes the immediate deformation induced by the compression and uv indicates the extra deformation caused by the viscoelasticity of the skin . uf is the total deformation , which equals ue + uv . ur denotes the immediate recovery of the skin upon removal of the compression . in this study , the elasticity was the major characteristic facilitating a constitution diagnosis between the te and se subjects . therefore , the quotient of ur / uf was adopted , which corresponded to the elasticity of the skin and is known to be independent of the skin thickness ( 1013 ) . first , the measurability of the proposed system was tested . a commercial rubber plate of known elastic constant was used as the reference material . having shown a similar value the company suggested our system was acceptable to measure the elastic properties of subjects ( 14 ) . using the proposed system , the measurement repeatability for human skins was tested using a male subject . the elasticity was measured five times per day and the long - term stability was assessed over a period of 1 week . table 3 lists the measurement results averaged value of five times measurements per day . the relative repeatability error ( rre)defined as the ratio between the sd and the average value of the elasticity was 2% for one measurement and 2.9% for the long - term test . table 3.measurability of the designed systemtime123456rre for one measurementrre for long - term measurementelasticity0.6690.6450.6630.6690.6980.6462%2.9%
measurability of the designed system two male subjects an se type and a te type , as determined through pretesting and diagnoses of their constitutions by doctors of oriental medicine in kiom whose specialty were sasang constitution were selected for a comparison of the elasticity of the human hand for a quantitative diagnosis using the proposed system . the temperature and humidity of the subjects hands were made consistent before each measurement , since the mechanical properties of human skin are typically affected by both these factors . the measurement region was defined as an area comprising the width between the index finger and the ring finger of the left hand and the height between the three middle fingers of the right hand , which were overlain onto the middle point of the middle finger bone of the left hand ( figure 8) . this area was chosen because a doctor of oriental medicine typically palpates this region when performing a constitution diagnosis . nine contact points in the region were defined to find the optimum contact point for a quantitative palpation measurement : their coordinates were defined from the top of index finger , top of the middle finger , top of the ring finger to bottom of the ring finger ( table 4 ) . ( top is the point which is 1 cm below the end of each finger and bottom is the point at which the thumb finger and index finger meet each other as shown in figure 8)
figure 8.inspection regions of the back of left hand . table 4.rre of elasticity values for se and te typesposition(t , r)(m , r)(b , r)(t , l)(m , l)(b , l)(t , i)(m , i)(b , i)se type3.37.210.63.97.812.13.110.712.5te type2.03.312.53.54.05.02.64.55.7r , ring finger ; l , long finger ; i , index finger ; t , top ; m , middle ; b , bottom . rre of elasticity values for se and te types r , ring finger ; l , long finger ; i , index finger ; t , top ; m , middle ; b , bottom . each data point was the averaged value of 10 times measurements at each contact point . the elasticity of the skin on the back of the hand was higher for the te subject than for the se subject , which is in good agreement with the qualitative measurements of a doctor of oriental medicine and several previous studies ( 35 ) . the measurement repeatability was highest along the top line irrespective of the constitution , which is due to differences in the microstructure of the two skin types , which itself is due to variations in the viscoelasticity along the lower lines and the resulting lower repeatability ( 15 ) . the measurement repeatability was higher for the te subject than for the se subject since the latter had a more uneven skin that resulted in wider dispersion of the laser beam on the skin surface ( 6 ) . figure 9.comparison of the elasticity values between an se type and a te type along ( a ) the index finger line , ( b ) the middle finger line and ( c ) the ring finger line . comparison of the elasticity values between an se type and a te type along ( a ) the index finger line , ( b ) the middle finger line and ( c ) the ring finger line . table 5 lists the clinical data of elasticity from the two constitutions using the proposed system . each data point was the averaged value of 10 times measurements collected from five te and three se male subjects using the top of the ring finger as contact point . despite the presence of variations in the characteristics of the subjects with each type of constitution ( e.g. age , height and weight ) , the elasticity was uniformly higher in tes than in ses with an acceptable level of uncertainty ; this tendency is in good agreement with findings reported in the literature ( 35 ) .
table 5.clinical data of elasticity for te and se typestese1234512345elasticity0.6970.7120.6880.6910.7030.5360.5540.5440.5560.537
clinical data of elasticity for te and se types in conclusion , a system for measuring the elasticity of human skin was constructed using a compression tube and a laser sensor for the purpose of constitutional diagnoses . the elasticity was higher for the te type than for the se type with an acceptable level of uncertainty , which is consistent with the findings of previous studies . it can be concluded that the proposed system is suitable as a quantitative constitutional diagnosis method for distinguishing between te and se subjects with an acceptable level of uncertainty . | the usefulness of constitutional diagnoses based on skin measurements has been established in oriental medicine .
however , it is very difficult to standardize traditional diagnosis methods . according to sasang constitutional medicine ,
humans can be distinguished based on properties of the skin , including its texture , roughness , hardness and elasticity .
the elasticity of the skin was previously used to distinguish between people with tae - eumin ( te ) and soeumin ( se ) constitutions . the present study designed a system that uses a compression method to measure the elasticity of hand skin and evaluated its measurement repeatability .
the proposed system was used to compare the skin elasticity between se and te subjects , which produced a measurement repeatability error of < 3% .
the proposed system is suitable for use as a quantitative constitution diagnosis method for distinguishing between te and se subjects with an acceptable level of uncertainty . |
during 20072014 , we collected 27 fecal and 24 intestinal samples from pigs with suspected pedv or tgev infections ; the pigs came from swine farms in northern italy ( po valley ) , which contains the regions of piemonte , lombardia , emilia romagna , and veneto ( technical appendix figure 1 ) . clinical signs included watery diarrhea in sows and a death rate in piglets of 5%10% , lower than is typical with pedv or tgev infections . samples were submitted for testing by electron microscopy , pedv elisa , viral isolation , pan - cov reverse transcription pcr ( rt - pcr ) , and rt - pcr for prcv and tgev ; selected positive pan - cov samples were sequenced ( 1214 ) ( technical appendix ) . results of electron microscopy showed that 25 ( 49% ) of the 51 samples contained cov - like particles , but all samples were negative for viral isolation . although only 38 samples ( 74% ) were positive by pan - cov rt - pcr , 47 ( 92% ) were positive by the pedv elisa ( table 1 ) ( 12,13 ) . of the 38 pan - cov positive samples , 18 were selected for partial rna - dependent rna polymerase ( rdrp ) , spike ( s1 ) ( 14 ) , and membrane ( m ) sequencing ( table 1 ) . all samples were negative for prcv and tgev by rt - pcr , ruling out co - infection with pedv and tgev or prcv ( 15 ) . * cluster i represents strains circulating from 2007 through mid-2009 ; cluster ii represents strains circulating from mid-2009 through 2012 ; and cluster iii represents strains circulating since 2014 . em , electron microscopy ; m , membrane ; pan - cov rt - pcr , pan - coronavirus reverse transcription pcr ; pedv , porcine epidemic diarrhea virus ; prcv , porcine respiratory coronavirus ; rdrp , rna - dependent rna polymerase ; s1 , spike ; tgev , transmissible gastroenteritis virus ; + , positive ; , negative ; na , not tested or sequenced . samples selected for whole genome sequencing . on the basis of the partial sequences from rdrp and the s1 and m genes , the strains from italy clustered into 3 temporally divided groups , suggesting 3 independent virus entries . cluster i represents strains circulating from 2007 through mid-2009 ; cluster ii represents strains circulating from mid-2009 through 2012 ; and cluster iii represents strains circulating since 2014 ( technical appendix figure 2 , panels a c ) . cluster i was identified in emilia romagna ( n = 1 ) , lombardia ( n = 5 ) , and veneto ( n = 1 ) . cluster ii was identified in emilia romagna ( n = 1 ) and lombardia ( n = 8) . cluster iii was identified in emilia romagna at 2 swine farms . to help explain the temporal clustering , a single s1 gene segment was sequenced from clusters i and ii ( pedv / italy/7239/2009 and secov / italy/213306/2009 , respectively ) . because of the recent outbreak of pedv in europe , the 2 positive samples from cluster iii ( pedv / italy/178509/2014 and pedv / italy/200885/2014 ) were sequenced ( figure 1 , panel a ) . a ) analysis performed on the basis of the nucleotide sequence of the complete spike ( s1 ) gene of 4 representative strains from the 3 clusters and b ) whole genome of 2 positive strains from clusters i and ii . cluster i represents strains circulating from 2007 through mid-2009 ; cluster ii represents strains circulating from mid-2009 through 2012 ; and cluster iii represents strains circulating since 2014 . the strains from this study are represented in blue ; strains from china are green ; strains from north america are red ; and strains from europe are purple . pedv , porcine epidemic diarrhea virus ; prcv , porcine respiratory coronavirus ; tgev , transmissible gastroenteritis virus ; secov , swine enteric coronavirus . one strain from each cluster was selected for whole genome sequencing ( technical appendix ) . unfortunately , the whole genome was obtained from only clusters i and ii ( pedv / italy/7239/2009 and secov / italy/213306/2009 , respectively ; figure 1 , panel b ) . recombination analysis was conducted on the 2 whole genomes and was not detected in pedv / italy/7239/2009 . recombination was detected in secov / italy/213306/2009 at position 20636 and 24867 of pedv cv777 and at position 20366 and 24996 of tgev h16 ( figure 2 ) , suggesting the occurrence of a recombination event between a pedv and a tgev . the complete s gene of secov / italy/213306/2009 shared 92% and 90% nt identity with the prototype european strain pedv cv777 and the original highly virulent north american strain colorado 2013 , respectively , and the remaining genome shared a 97% nt identity with the virulent strains tgev h16 and tgev miller m6 . whole - genome analysis of pedv / italy/7239/2009 showed that it grouped with the global pedv strains ( 6 ) and shared 97% nt identity with pedv strains cv777 , dr13 virulent , and north american s - indel strain oh851 ( table 2 ) . potential recombination points in the secov strains in study of swine enteric coronaviruses in italy . the potential parent strains h16 ( tgev ) and cv777 ( pedv ) are shown in teal and purple , respectively . pedv , porcine epidemic diarrhea virus ; tgev , transmissible gastroenteritis virus ; secov , swine enteric coronavirus . * cluster i represents strains circulating from 2007 through mid-2009 ; cluster ii represents strains circulating from mid-2009 through 2012 . ger , germany ; orf , open reading frame ; prcv , porcine respiratory coronavirus ; pedv , porcine epidemic diarrhea virus ; secov , swine enteric coronavirus ; tgev , transmissible gastroenteritis virus during 20072014 , most ( 92% ) samples collected from the po valley in italy were positive for pedv by elisa ; only 72% were positive by pan - cov pcr . however , because we were investigating the presence of pedv or tgev in samples with clinical signs of diarrhea , the high occurrence of pedv may not reflect the actual prevalence of pedv in italy . the increased percentage of pedv found in samples tested by elisa , compared with the proportion found by pcr , may be explained by the number of ambiguous bases in the pan - cov primers ; the ambiguous bases severely reduce the efficiency of the reaction . the swine enteric cov strains from italy in our study , including the recombinant strain , were reported in pigs with mild clinical signs , indicating that pedv and secov have been circulating in italy and likely throughout europe for multiple years but were underestimated as a mild form of diarrhea . to understand the evolution of pedv in italy , the partial rdrp , s , and m genes cluster i ( 2007mid 2009 ) resembles the oldest pedv strains ; cluster ii resembles a new tgev and pedv recombinant variant ; and cluster iii , identified from 2 pig farms in northern italy in 2014 , resembles the pedv s - indel strains identified in germany , france , belgium , and the united states . the > 99.3% nt identity of the s1 gene within cluster iii and in previously identified strains could suggest the spread of the s - indel strain into europe . however , directionality of spread can not be determined because of a lack of global and temporal pedv sequences . although our findings could indicate 3 introductions of pedv in italy , the results more likely suggest the high ability of natural recombination among covs and the continued emergence of novel covs with distinct pathogenic properties . further investigation is needed to determine the ancestor of the secov strain or to verify whether the recombinant virus was introduced in italy . recombinant secov was probably generated in a country in which both pedv and tgev are endemic , but because the presence of these viruses in europe is unclear and secov has not been previously described , it is difficult to determine the parental strains and geographic spread of secov . future studies are required to describe the pathogenesis of secov and its prevalence in other countries . technical appendix . additional methods , tables , and figures from study of swine enteric coronaviruses in italy . | porcine epidemic diarrhea virus ( pedv ) has been detected sporadically in italy since the 1990s .
we report the phylogenetic relationship of swine enteric coronaviruses collected in italy during 20072014 and identify a drastic shift in pedv strain variability and a new swine enteric coronavirus generated by recombination of transmissible gastroenteritis virus and pedv . |
lumbar spondylolysis , a defect in the pars interarticularis , is a common cause of low back pain in adolescents and young adults . it occurs in 6% of the general population and has been reported more commonly in men . spondylolysis commonly occurs at the fourth and fifth lumbar vertebrae , accounting for more than 95% of total cases of spondylolysis . symptomatic pars lesions appear to be particularly a clinical problem in adolescents , especially adolescent athletes . conservative treatment is commonly considered first in most patients , but those who remain symptomatic may benefit from operative treatment . when the source of back pain is the pars defect itself , direct repair of spondylolysis seems to be most effective and appears to be more logical than posterior spinal fusion in the patients without disc degeneration or spondylolisthesis . multilevel spondylolyses are rare , varying between 1.2% and 5.6% of lumbar spondylolysis cases , and majority involve 2 levels , l4 and l5 . so for , to our knowledge , only 11 cases of 3-level lumbar spondylolyses have been reported in the existing english literature . in this paper , we reported 3 cases of 3-level lumbar spondylolyses in young adults and review the management choices made in these cases . this study obtained the approval of the medical ethics committee of our hospital ( general hospital of armed police force , beijing , china ) . case 1 , a 22-year - old male , presented with low back pain for 2 years . he did not complain of radicular pain , numbness , and concomitant claudication in his lower extremities . he had a history of lumbar injury dropped down from 2 meters high 2 years ago . motor , sensory , and tendon reflex were all normal in his 2 lower limbs . lumbar radiography and computed tomography ( ct ) scan showed left l3 and bilateral l4 and l5 spondylolyses without any slippage . before admission to our hospital , the patient had underwent a 3-month course of conservative treatment with physiotherapy and nonsteroidal anti - inflammatory drugs in a local clinic , but these therapies did not relieve his low back pain . because ct scans have showed terminal - stage findings in the isthmic lysis areas , no abnormality of the posterior arches such as dysplasia and spina bfida was found , surgical indication for left l3 and bilateral l4 and l5 direct isthmic repair via a pedicle screw case 2 , a 22-year - old male , was admitted with low back pain for 14 months . pain was originated from an acute lumbar heavy blow 14 months ago , and increased gradually . one month ago , he felt numbness in his right hip and right lateral thigh . motor , sensory , and tendon reflex were all normal in his 2 lower limbs . radiographs and ct scans showed bilateral l3l5 spondylolyses without any slippage ( figures 1 and 2 ) . after his lumbar injury , he was sent to a local hospital , and was diagnosed with l3l5 bilateral spondylolyses by plain radiography . since then , he has undergone conservative treatment with bracing to protect lumbar spine , physiotherapy , and oral nonsteroidal anti - inflammatory drugs in a local clinic , but these therapies did not relieve his low back pain . after he underwent a 4-month course of conservative treatment , further ct scan showed terminal - stage findings in the l3l5 bilateral isthmic lysis areas . surgical indication for bilateral l3l5 direct isthmic repair via a screw hook technique was recommended . case 3 , a 23-year - old man , was admitted with low back pain for 6 months . in the beginning a month ago , he sprained his waist carelessly , which aggravated his back pain . since then , he has undergone conservative treatment in a local hospital , but conservative treatment did not relieve his back pain motor , sensory , and tendon reflex were all normal in his 2 lower limbs . because mri showed l5/s1 disc degeneration , we needed to identify whether this disc was a pain - generating disc . the result of discography showed l5/s1 disc disruption with pain reproduction , which indicated the l5/s1 disc as the one of the back pain sources . because ct scan had shown terminal - stage findings in the l3l5 bilateral isthmic lysis areas , accordingly , surgical indication for bilateral l3 and l4 direct isthmic repair and l5/s1 interbody fusion was recommended . three cases of 3-level lumbar spondylolyses were diagnosed and subsequently direct isthmic repair in 2 cases and a combined surgery of isthmic repair and interbody fusion in 1 case were recommended for the 3 patients preoperatively based on clinical findings consistent with imaging study . case 1 underwent a surgery of direct isthmic repair in 5 lytic defects . under general anesthesia , conventional posterior midline approach to lumbar spine was used to exposure l3l5 spinous processes , vertebral laminae , and facet joints . first , a 6.0 45 mm pedicle screw was inserted to involved vertebra under fluoroscopic guidance . second , the involved lysis area was curetted , freshened , and grafted with autologous iliac bone . finally , sublaminar hook was placed , and connected through a short rod under compression with corresponding pedicle screw . the total surgical time was 3 hours with 300 ml of blood loss . a lumbar - sacral brace was used for 3 months after surgery . surgical procedure in case 2 was the same as case 1 . the total surgical time was 3 hours with 500 ml of blood loss . postoperatively , the symptoms of low back pain and numbness in right hip and right lateral thigh disappeared . four pedicle screws were placed in l5 and s1 vertebrae bilaterally , then left laminectomy was performed to allow a cage placement ( 10 26 mm ) filled with autogenous local bone derived from laminectomy between the decorticated endplates of l5 and s1 , and finally 2 rods were connected with 4 pedicle screws under compression . the total surgical time was 3.5 hours with 400 ml of blood loss . after surgery , a brace was placed for 3 months , and symptom of low back pain was almost completely disappeared . case 1 has undergone a follow - up of 2 years , and his low back pain was almost completely disappeared . at 6 months after surgery , bone healing was found in all 5 lytic defects . at 8 months after surgery in case 2 , bone healing was found in all 6 lytic defects . during a 1-year follow - up period , he was pain - free . at 2-year follow - up in case 3 , his low back pain had not recurred , and bone fusion was found between l5 and s1 vertebral bodies and in all 4 isthmi of l3 and l4 according to the evaluation of lumbar radiographs and ct scans . the surgery for the 3 patients was successfully performed and their symptoms were obviously relieved and lumbar function was markedly improved . the alleviation of back pain and improvement of lumbar function was assessed by the change in the degree of pain with a self - assessment of pain by an 11-point visual analog scale ( vas , 010 ) pain scale and the oswestry disabiligy index ( odi , version 1.0 , 0100 ) . lumbar spondylolysis is a common disease , in more than 90% of cases located in l5 . a pars defect develops into a chronic nonunion , and becomes bridged by tissue composed of a combination of fibrous , cartilaginous , or osseous material . in this circumstance , the origin of chronic low back pain could be in the scar and connective tissue rich in nociceptive nerve endings that bridges the gap of a pars defect . extra load exerted on the motion segment may cause disc degeneration , which is therefore an accompanying disorder of spondylolysis . the prevalence of progressive disc degeneration in the involved level is markedly increased in the adult spondylolytic patients who often appear low back pain later in life , after an asymptomatic childhood . the pathology of lumbar spondylosis was considered being congenital failure of fusion of 2 ossification centers or a hyperflexion injury at birth , but spondylolysis had never been founded in embryos , fetus and at birth . following wiltse 's proposal in 1957 , the pathology of spondylolysis was shifted to a consensus of fatigue fracture of the pars interarticularis with a strong hereditary basis . for now , 2 factors can explain isthmic lysis , both genetic and mechanical . no specific genetic variation was identified , but it would seem that a genetic predisposition to this pathology may exist . yamada et al reported 3 cases of lumbar spondylolysis in juveniles from the same family . the highest incidence was reported in native residents in greenland up to 54% . from a mechanical point of view , heavy work and repeated injuries seem to favor the appearance of lumbar spondylolysis . a number of studies have described the association of sports activities with spondylolysis , and all of them support the stress fracture theory . traumatic spondylolysis can be diagnosed early with the use of isotope bone scan or single photon emission computed tomography scan . preoperative ct scan is very important to evaluate the degree of sclerosis in the bony margins of the isthmic defect . the obvious osteosclerosis was shown in all the isthmic defect margins in the 3 patients by ct scan , which indicated that direct isthmic repair was necessary . preoperative lumbar mri is imperative to evaluate the state of intervertebral disc . in our case 3 , due to l5/s1 disc degeneration , an additional lumbar discography was used to indicate this disc as a painful disc . this result finally determined the indication for fusion surgery at the l5/s1 segment instead of a direct isthmic repair in l5 . there are many types of direct repair methods , including scott 's wiring , buck 's screwing , louis butterfly plate , and screw hook technique ( pedicle screw and hook rod system ) . from clinical aspects , screw hook technique allows for fixation of the defects in the pars interarticularis with rigid implants and exerts force along the lamina to effectively suppress the defect motion , which is critical for better bone healing . the precondition of direct defect repair is normal signal intensity in the involved disc shown in t2-weighted mri . if not , lumbar fusion should be considered . in the present cases 1 and 2 , the patients were young with normal discs and normal posterior arches , so l3l5 direct isthmic pair was reasonable . in the case 3 , because mri showed both the l3/4 and l4/5 discs normal and the l5/s1 disc degeneration with disruption and pain reproduction in discography , accordingly a combined surgery of bilateral l3 and l4 direct isthmic repair and l5/s1 interbody fusion was performed for the young patient . surgical treatment varies between fusion , direct isthmic repair , and combined management associating 2 procedures at different levels . success of management of multilevel spondylolyses depends on the choice of appropriate treatment for every patient . we reported here 3 cases of 3-level lumbar spondylolyses with good clinical and radiological results . hook technique is a simple and safe procedure for the motion segment with normal disc . although our clinical results are satisfactory , all 3 patients are young and the duration of their follow - up periods has not been long . therefore , further observation of these patients clinical course and radiological results at the segments treated as well as adjacent segments is needed . | abstractthree - level lumbar spondylolyses are extremely rare .
so far , only 11 cases were reported in the literature .
treatment of multilevel spondylolyses has not been consistent .
conservative treatment is commonly considered first in most patients , but those who remain symptomatic may benefit from operative treatment .
we report here 3 cases of 3-level lumbar spondylolyses that were treated successfully with direct isthmic repair in 2 cases and a combined surgery of isthmic repair and interbody fusion in 1 case .
our clinical results indicated that direct defect repair using the screw
hook technique is a simple and safe procedure for the motion segment with normal disc .
if the involved disc shows degenerative change , fusion surgery should be consideredsurgical treatment of multilevel spondylolyses varies between fusion , direct isthmic repair , and combined management associating 2 procedures at different levels .
the success of management of the 3 patients with 3-level spondylolyses depends on the choice of appropriate treatment for every patient . |
fat at birth is unique to humans among primates , suggesting that a recently evolved genetic component accounts for this difference . body fat accumulated during intrauterine development in humans is thought to serve as an energy source to support growth of the large human newborn brain in the early neonatal period . as such , subcutaneous however , high or low body fat at birth is associated with increased morbidity in the first year of life as well as an increased susceptibility to poor metabolic and/or cardiovascular health later in life . while maternal fuels such as glucose and triglycerides impact fetal fat accretion , genetic factors also contribute . a locus between ccnl1 and lekri on chromosome 3 ( 3q25.31 ) was previously shown to be associated with birthweight , but our recent genome - wide association study ( gwas ) performed in a multi - ancestry cohort of newborns revealed this locus was much more strongly associated with newborn sum of skinfolds ( p=1.52 10 ) , a measure of newborn adiposity , than with birthweight ( p=5.72 10 ) . the goal of the present study was to determine whether this same locus is associated with adiposity at later points during childhood . the hyperglycemia and adverse pregnancy outcome ( hapo ) study was an international multi - center epidemiologic study that examined levels of maternal glucose tolerance and risk of adverse pregnancy outcomes . briefly , eligible women underwent a 75 g oral glucose tolerance test between 24 and 32 weeks gestation . using standardized methods and procedures , maternal height , weight , and blood pressure cord blood was collected for measurement of newborn glucose , c - peptide and dna extraction . using standardized methods and equipment , neonatal anthropometric measurements were obtained within 72 h of birth , including head circumference , birth length , birthweight and skinfold thickness measured at the flank , triceps and subscapular regions . hapo participants and their offspring from the belfast , northern ireland center were invited to participate in the hapo family study in which offspring were examined at the ages of 2 and 6 years . measurements included weight , height , head circumference , mid - arm circumference , and triceps , subscapular , and suprailiac skinfold thickness . for genetic analyses , individual skinfold measurements and their sum examining newborn size , hapo newborns from four ancestries were genotyped using illumina genomewide single nucleotide polymorphism ( snp ) arrays ( illumina , inc . , san diego , ca , usa ) . details of genotyping platform selection , genotype calling algorithms , quality control and imputation procedures , and estimating population substructure were previously reported . we examined the association of four snps at this locus with sum of skinfolds , a measure of adiposity , among belfast hapo offspring at 2 and 6 years of age using linear regression analyses ( snptestv2 ) with an additive model , adjusting for ancestry ( principal components 1 and 2 ) , newborn gender , gestational age at delivery , parity , and maternal age , body mass index ( bmi ) , height , mean arterial blood pressure , smoking status and alcohol intake at the time of oral glucose tolerance test . all other analyses were conducted in sas 9.3 ( sas institute , cary , nc , usa ) . genotype and phenotype data were available at birth and age 2 for 293 children and at birth and age 6 for 350 children ( table 1 ) ; 270 children were common between the two cohorts . four snps at the chromosome 3q25.31 locus that are in strong linkage disequilibrium ( lowest pairwise r=0.93 ) , rs10049088 , rs1482853 , rs17451107 and rs900400 , were previously shown to be the snps most highly associated with sum of skinfolds in a cohort of hapo newborns . the association and direction of effect between one of these snps , rs900400 , and sum of skinfolds as well as individual skinfold thicknesses in the cohorts of 2- and 6-year - olds from the belfast hapo family study are shown in table 2 . a positive association was observed between rs900400 and newborn sum of skinfolds among the 293 children in the cohort of 2-year olds ( p=4.8 10 ; =0.025 ) , and 350 children in the cohort of 6-year olds ( p=2.8 10 ; =0.024 ) . in contrast , at age 2 years and 6 years no association was observed between sum of skinfolds and rs900400 ( p=0.06 , =0.015 at age 2 ; p=0.86 , = 0.002 at age 6 ) . although rs900400 demonstrated a marginal , albeit non - significant , association with sum of skinfolds at age 2 years , the direction of effect was opposite to that observed in the newborns . similar analyses were performed examining the association of rs900400 with measurements of the flank / suprailiac , triceps and subscapular skinfolds ( table 2 ) . a positive association was observed between rs900400 and individual skinfold measurements at birth among the 293 children in the cohort of 2-year olds ( triceps , p=3.4 10 ; subscapular , p=2.0 10 ; flank , p=5.0 10 ) , and 350 children in the cohort of 6-year olds ( triceps , p=1.8 10 ; subscapular , p=5.0 10 ; flank , p=1.0 10 ) . for the suprailiac and subscapular skinfold thicknesses , an association with rs900400 was not seen at either age 2 ( p=0.14 and p=0.52 , respectively ) or age 6 ( p=0.70 and p=0.98 , respectively ) . however , in the cohort of 2-year olds , rs900400 was weakly associated with triceps skinfold thickness at age 2 ( p=0.03 ) . . there was no evidence for association of rs900400 with triceps skinfold thickness at age 6 ( p=0.97 ) . excess adiposity at birth , which is recognized as a risk factor for peri- and postnatal complications as well as childhood obesity and adverse metabolic health outcomes during adulthood , is influenced by both environmental and genetic factors . multiple maternal factors influence the intrauterine environment , including maternal bmi , height , blood pressure , nutrition , alcohol consumption , smoking and socioeconomic background , with maternal metabolic factors also having an important impact on fetal adiposity . in addition to maternal metabolism , fetal genetics also plays an important role in fetal fat accretion . we and others have previously used gwas to identify genes associated with birthweight and/or newborn sum of skinfolds . a highly significant and reproducible finding was the association of snps within the chromosome 3q25.31 locus with newborn adiposity as reflected by newborn sum of skinfolds or ponderal index . in this report , we now demonstrate that association of this locus with measures of adiposity is no longer evident at ages 2 and 6 years , consistent with the recent observation that this locus is no longer associated with birthweight by age 2 months . association of this locus with sum of skinfolds , driven primarily by skinfold thickness at the triceps , approached significance in the cohort of 2-year olds , but this association was in the opposite direction to that observed in newborns . in the cohort of 6-year olds , there was no evidence of association of rs900400 with any of the individual skinfolds . together with the results of previous studies , these new findings suggest that genetic variation within the 3q25.31 locus contributes to fetal fat accretion but not to early childhood adiposity . as in newborns , both low and normal birthweight newborns with rapid postnatal weight gain during the first 2 years of life have higher body fat and lower lean body mass and , during adulthood , higher body weight and fat . prevention of rapid postnatal growth in such individuals may prevent development of an obese adult phenotype . genetic variation is another important determinant of childhood adiposity . through gwas and related approaches , association of variants within 22 different genetic loci with childhood bmi or body weight has been demonstrated , but snps in the chromosome 3q25.31 locus have not been reported . consistent with that , meta - analyses performed by the early growth genetics ( egg ) consortium ( www.egg-consortium.org ) in european ancestry children failed to demonstrate association of rs900400 with childhood obesity ( defined as bmi 95 percentile ; p=0.90 ) . similarly , a previous analysis of data from the giant consortium showed no evidence of association of the 3q25.31 locus with adult bmi . despite the presence of high - quality genotype and phenotype data , our study had certain limitations . we have examined a small cohort of offspring from only one hapo ancestry and , as a result , our power to demonstrate an association at age 2 and 6 years was limited . thus , we can not rule out an association of snps at the chromosome 3q25.31 locus with early childhood adiposity ; however , if this locus is associated with childhood adiposity , the association is much weaker than that observed during fetal life and does not alter our conclusion that the chromosome 3 locus primarily influences fetal fat accretion . similarly , we were not able to assess directly whether this locus is associated with measures of obesity in older children and adolescents , but previous studies of the genetics of childhood obesity have failed to demonstrate an association . in summary , we have demonstrated that snps within the chromosome 3q25.31 locus , which exhibit strong association across multiple ancestry groups with measures of newborn adiposity , do not have a clear association with early childhood adiposity among european ancestry hapo offspring . | increased newborn adiposity is associated with later adverse metabolic outcomes .
previous genome - wide association studies ( gwas ) demonstrated strong association of a locus on chromosome 3 ( 3q25.31 ) with newborn sum of skinfolds , a measure of overall adiposity . whether this locus is associated with childhood adiposity
is unknown .
genotype and sum of skinfolds data were available for 293 children at birth and age 2 , and for 350 children at birth and age 6 from a european cohort ( belfast , uk ) who participated in the hyperglycemia and adverse pregnancy outcome gwas .
we examined single nucleotide polymorphisms ( snps ) at the 3q25.31 locus associated with newborn adiposity .
linear regression analyses under an additive genetic model adjusting for maternal body mass index were performed . in both cohorts , a positive association was observed between all snps and sum of skinfolds at birth ( p=2.3 104 , =0.026 and p=4.8 104 , =0.025 ) . at the age of 2 years , a non - significant negative association was observed with sum of skinfolds ( p=0.06 ; = 0.015 ) . at the age of 6 years
, there was no evidence of association ( p=0.86 ; =0.002 ) .
the 3q25.31 locus strongly associated with newborn adiposity had no significant association with childhood adiposity suggesting that its impact may largely be limited to fetal fat accretion . |
seasonal affective disorder ( sad ) was first time described as syndrome of recurrent episodes of depression that occur annually ( usually in winter season at same time each year ) by rosenthal et al . in 1984 . diagnostic and statistical manual of mental disorders , 4 edition , text revision ( dsm - iv - tr ) describes sad not as a separate mood disorder but as specifier referring to the seasonal pattern of major depressive episodes that can occur within major depression or bipolar disorders . the specifier within seasonal pattern can be applied to pattern of major depressive episodes in bipolar affective disorders i , bipolar affective disorders ii and major depressive disorder ( recurrent ) . the international classification of diseases , 10th revision ( icd-10 ) gives only provisional diagnostic criteria for sad on the grounds that its status is best regarded as uncertain , and its diagnostic criteria available in research domain of icd-10 manual are three or more episodes of mood ( affective ) disorder must occur with onset within same 90-day period of year , for three or more consecutive years . remission also occurs within a particular 90-day period of the year and seasonal episodes substantially outnumber any non - seasonal episodes that may occur. although original description of sad included most people with diagnosis of bipolar affective disorder ( bpad ; most common bpad ii ) rather than recurrent major depressive disorder , who used to switch into hypomania ( or mania ) in summer season . however , subsequent research into treatment strategies for sad almost exclusively focused on it as a subtype of recurrent depressive disorder as most of clinical trials involving sad focused on either bright light therapy ( blt ) , anti - depressant drug treatments , beta - blockers , vitamins and psychotherapy . there is negligible data on role of mood stabilizers in management of sad ( winter depression ) . here , we describe response of 30 patients of recurrent major depressive disorder ( seasonal pattern winter ) ( winter sad ) to lamotrigine , who failed to respond to different anti - depressant treatment previously . patients of sad ( winter depression ) fulfilling dsm - iv - tr criteria for major depressive disorder , recurrent , with seasonal pattern ( winter season ) , who failed to respond or responded partially to different anti - depressants were assessed from hospital records . the case records and assessment was done by different members of the resident staff , but most of them were recorded by two of the authors . they had already been assessed for mania / hypomania symptoms in current episode or in past ( particularly mania / hypomania in summer season ) using routine clinical interview and mini - international neuropsychiatric interview ( mini ) . those having history of mania or hypomania and other axis i disorders were not taken up for this study . selection criteria for this study :
patients having the onset of depression in autumn / winter lasting for whole of winter season and early spring.patients in whom progress was routinely monitored using hamilton depression rating scale ( ham - d).patients whose treatment was augmented with lamotrigine in addition to their routine anti - depressant medications.patients having minimum of three consecutive seasonal mood episodes.patient having a stable dose of other medications for minimum of 8 weeks and these doses were not changed during lamotrigine augmentation .
patients having the onset of depression in autumn / winter lasting for whole of winter season and early spring . patients in whom progress was routinely monitored using hamilton depression rating scale ( ham - d ) . patients whose treatment was augmented with lamotrigine in addition to their routine anti - depressant medications . patient having a stable dose of other medications for minimum of 8 weeks and these doses were not changed during lamotrigine augmentation . these patients had been treated with lamotrigine augmentation for their partially responding or non - responding depressive episode . they were assessed routinely at baseline , at 2 weeks , at 4 weeks and at 8 weeks of lamotrigine augmentation . more than 50% decrease in ham - d score from baseline was taken as response and a final score of less than 8 was taken as remission . lamotrigine was started at dose of 25 mg per day and gradually increased to 200 mg by 8 weeks with weekly increment of 25 mg . lamotrigine was stopped in some patients owing to development of rash . in total , 30 patients who had completed follow - up for minimum of 8 weeks were assessed for this study . mean / average and the deviations were calculated using statistical package for social sciences version 16 ( spss-16 ) . single tailed t - test was used to study the difference of means to assess the therapeutic response and pre / post analysis of change . thirty patients met the selection criteria , having a complete follow - up with fully maintained case sheets . the sample included 9 males and 21 females with a mean age of 37.14 11.31 years ( 22 to 56 years ) . before the initiation of lamotrigine , the mean ham - d score was 20.93 4.93 , suggesting an ill state of most of these patients . other variables , treatment history and treatment response are noted in table 1 . sociodemogarphic and clinical variables the mean ham - d scores with standard deviation at start of treatment at 2 weeks , at 4 weeks and , at 8 weeks are 20.93 4.93 ( range = 14 - 35 ) , 19.63 5.82 ( range = 9 - 36 ) , 11.27 5.32 ( range = 3 - 23 ) and 9.57 6.16 ( range = 2 - 23 ) , respectively . the difference in ham - d scores at 2 weeks of treatment was not significant compared to scores at baseline ( t = 0.93 , df = 58 , p = 0.177 ) . however , there was significant difference in treatment outcome as per ham - d scores at 4 weeks of treatment compared to baseline scores ( t = 7.29 , df = 58 , p < 0.01 ) and this significant difference was maintained at 8 weeks of treatment ( t = 7.88 , df = 58 , p < 0.01 ) compared to start of treatment ( zero weeks ) . an average decrease of 46.25% in ham - d score was achieved around 4 week and it was sustained to a further decrease in score by 54.27% by 8 week . the mean time for responders to achieve an approximate 50% reduction on ham - d score was 4.2 1.2weeks at a mean dose of 150 mg / day of lamotrigine . the mean dose of lamotrigine at 8 weeks was 200 mg / day with a 54.27% decline in ham - d score and 15 ( out 30 ) showed remission ( less than 8 score ) . the difference in treatment response in different age - groups , gender groups and in groups of patients with different primary anti - depressant medication was not assessed because of small study group . a few adverse effects were documented which included sedation ( seven patients ) , headache eight patients ) , fatigue ( one patient ) and benign skin rash ( one patient ) . although first descriptions of sad presented it as more prevalent condition associated with bpad , however subsequent research into its therapeutics failed to focus it as such . till now , most of the therapeutic research has failed to highlight it as bpad and there only few studies focusing on use of mood stabilizers in this condition . this retrospective , non - blinded , open - label , non - comparative study in natural settings is an attempt to highlight role of mood stabilizers in sad . this study proved significant improvement in depressive symptoms of sad patients ( winter depression ) with lamotrigine augmentation . these were the patients who had previously shown poor response to anti - depressant ( medication ) alone treatment . the role of early morning blt in winter depression may be actually an intervention based on social rhythm therapy which has been proven as effective strategy to deal with bipolar disorder patients because early morning blt in winter depression invariably promotes concept of chronotherapeutics in management of sad . lamotrigine approved for the maintenance treatment of bpad i has also shown some efficacy for the treatment of bipolar depression . limited data is available suggesting efficacy of lamotrigine in major depressive disorder ( mdd ) ( unipolar depression ) and these studies do not support lamotrigine use in unipolar depression robustly . in view of above findings and results of our study , the nosology and therapeutics of winter depression ( and other forms of depression not responding adequately to anti - depressant treatment ) needs to be reviewed as sad being a type of bipolar spectrum disorder even in absence of hypomania or mania symptoms . the limitations of this study include the small sample size , lack of controls and randomization . in future , this study needs to be replicated with better scientific design and these limitations need to be addressed . this study brings to light the fact that sad needs to be looked as type of bipolar disorder for therapeutic purposes . | background : many therapeutic options have been evaluated and tried for seasonal affective disorder ( sad ) including bright light therapy ( blt ) , anti - depressants , beta - blockers and psychotherapy , but the data supporting use of mood - stabilizing agents is just handful in spite of this condition being understood most frequently to be associated with bipolar affective disorder ii ( bpad ii ) .
so we planned to study role of lamotrigine ( mood stabilizing agent ) in sad.materials and methods:30 patients of sad who were prescribed lamotrigine in addition to antidepressant medications for a minimum of 8 weeks and were assessed for severity using ham - d were selected retrospectively from the hospital records for this study .
ham - d scores at 2 , 4 and 8 weeks were compared to baseline scores.statistics analysis : single tailed t - test was used to study the difference of means to assess the therapeutic response and pre / post analysis of change .
statistical significance was set at p < 0.05.results:though no significant difference was seen in ham - d scores at 2 weeks of treatment compared to baseline , but results were statistically significant at 4 and 8 weeks of treatment with lamotrigine augmentation of antidepressant medications.conclusion:we conclude that lamotrigine augmentation was found to be effective treatment strategy for managing winter depression phase of seasonal affective disorder . |
alternatively , bioplastics are polyesters synthesized by bacteria under unbalanced growth conditions ( 2 ) . poly hydroxyalkanoate ( pha ) , the most known source of bioplastics , is a potential candidate for substitution of petrochemical plastics , because of its biodegradability properties . biodegradable polymers are made from renewable resources , and thus do not lead to depletion of finite resources ( 3 ) . these biopolymers have many desirable physical and chemical properties of conventional synthetic polymers ( 4 ) . to this point , high production costs have limited the use of biopolymers ; however , if these costs be reduced , there would be a widespread economic interest ( 5 ) . the phb biosynthetic pathway includes three enzymatic reactions , catalyzed by three distinct enzymes . in the first reaction , b - ketoacyl coa thiolase ( encoded by the phba gene ) condenses two acetyl - coa molecules into acetoacetyl - coa . the second reaction is the reduction of acetoacetyl - coa to ( r)-3-hydroxybutyryl - coa by an acetoacetyl - coa dehydrogenase ( encoded by the phbb gene ) . finally , p ( 3hb ) polymerase ( encoded by the phbc gene ) polymerizes the ( r)-3-hydroxybutyryl - coa monomers into phb ( 7 ) . only a few bacteria such as alcaligenes latus , bacillus megaterium , ralstonia eutropha , and pseudomonas oleovorans have been used for the production of pha . r. eutropha is a non - spore - forming , gram - negative bacterium and the most common bacterium for pha production ( 2 ) . natural pha - producing bacteria usually harbor native machinery for polymer degradation and are often hard to lyse , making the recovery of pha difficult ( 2 ) . the use of recombinant escherichia coli for pha production is beneficial in some points as fast growth , high cell density , ability of using several cheap carbon sources , and easy purification ( 8) . our objective was cloning and expression of the phb operon of r. eutropha h16 to e. coli bl21 , and then phb production from the recombinant bacteria . dried culture of r. eutropha h16 ( dsm 428 ) was purchased ( dsmz , gmbh ) . r. eutropha was cultured on nutrient broth ( 8% w / v ) at 30c for 24 hours . nutrient agar containing 5 g peptone , 3 g meat extract and 15 g agar was dissolved in 950 ml distilled water ; the final ph was adjusted at 7.3 . distilled water was added up to 1 l and then the final solution was autoclaved . these strains were cultured on luria - bertani ( lb ) medium ( 9 ) at 37c for 16 hours . the total genomic dna of r. eutropha was extracted ( 9 ) . the desired fragment ( 3851 bp for phbcab genes ) was amplified by designed primers which possessed cutting sites on their 5 ' ends for bamhi and hindiii restriction enzymes . the sequence of phb bamhi - forward primer was gccggatccatggcgaccggcaaa and the one for phb hindiii - reverse primer was gccaagctttcagcccatatgcaggcc . the phusion master mix kit with gc buffer ( bio lab , new england ) was used for amplification of this fragment . the thermo - cycler program was as follows : 98c for three minutes , then 30 cycles of 98c for 15 second , 65c for one minute , 72c for two minutes , and finally 72c for 10 minutes . the pcr product and pet-28a vector were digested by bam hi and hind iii restriction enzymes at 37c for 16 hours and they were purified from the gel . purification was performed according to silica bead dna gel extraction kit ( fermentas , ca ) . afterwards , ligation of the pcr product and vector was performed by t4 ligase at 16c for 16 hours . the transformation was performed according to green and sambrook s guideline ( 9 ) . to prove the successful cloning of pcr products , the plasmid dna was extracted from some bacterial clones and digested with bam hi and hind iii ( fermentas , ca ) overnight at 37c and the lb medium ( supplemented with 30 g / ml kanamycin ) , inoculated with an overnight culture of recombinant cells , was incubated at 37c until reaching the optimized optical density . afterwards , isopropyl l - beta - d - thiogalactopyranoside ( iptg ) was added at a final concentration of 0.4 mm and the incubation continued for eight hours at 37c with shaking at 150 rpm . the smear was air - dried and stained with a 3% sudan black b solution ( 3 gram w/100 mlv in 70% ethanol , sigma ) for 10 minutes . the sample was stained with safranin ( 5% w / v in distilled water , sigma ) for 10 seconds , washed again with distilled water , and dried and observed under oil immersion lens ( 10 ) . dried culture of r. eutropha h16 ( dsm 428 ) was purchased ( dsmz , gmbh ) . r. eutropha was cultured on nutrient broth ( 8% w / v ) at 30c for 24 hours . nutrient agar containing 5 g peptone , 3 g meat extract and 15 g agar was dissolved in 950 ml distilled water ; the final ph was adjusted at 7.3 . distilled water was added up to 1 l and then the final solution was autoclaved . these strains were cultured on luria - bertani ( lb ) medium ( 9 ) at 37c for 16 hours . the total genomic dna of r. eutropha was extracted ( 9 ) . the desired fragment ( 3851 bp for phbcab genes ) was amplified by designed primers which possessed cutting sites on their 5 ' ends for bamhi and hindiii restriction enzymes . the sequence of phb bamhi - forward primer was gccggatccatggcgaccggcaaa and the one for phb hindiii - reverse primer was gccaagctttcagcccatatgcaggcc . the phusion master mix kit with gc buffer ( bio lab , new england ) was used for amplification of this fragment . the thermo - cycler program was as follows : 98c for three minutes , then 30 cycles of 98c for 15 second , 65c for one minute , 72c for two minutes , and finally 72c for 10 minutes . the pcr product and pet-28a vector were digested by bam hi and hind iii restriction enzymes at 37c for 16 hours and they were purified from the gel . purification was performed according to silica bead dna gel extraction kit ( fermentas , ca ) . afterwards , ligation of the pcr product and vector was performed by t4 ligase at 16c for 16 hours . the transformation was performed according to green and sambrook s guideline ( 9 ) . to prove the successful cloning of pcr products , the plasmid dna was extracted from some bacterial clones and digested with bam hi and hind iii ( fermentas , ca ) overnight at 37c and the lb medium ( supplemented with 30 g / ml kanamycin ) , inoculated with an overnight culture of recombinant cells , was incubated at 37c until reaching the optimized optical density . afterwards , isopropyl l - beta - d - thiogalactopyranoside ( iptg ) was added at a final concentration of 0.4 mm and the incubation continued for eight hours at 37c with shaking at 150 rpm . the smear was air - dried and stained with a 3% sudan black b solution ( 3 gram w/100 mlv in 70% ethanol , sigma ) for 10 minutes . the sample was stained with safranin ( 5% w / v in distilled water , sigma ) for 10 seconds , washed again with distilled water , and dried and observed under oil immersion lens ( 10 ) . in r. eutropha , the lengths of phbc , phba and phbb genes were respectively 1770 bp , 1182 bp and 741 bp . a pair of primers was designed for amplifying the phbcab genes , which include the beginning of the phbc gene to the end of the phbb gene and the hindiii and bamhi restriction site sequence was added to the ends of the primers . the pcr product was checked by 1% agarose gel and a 3851 bp fragment was seen ( figure 1 ) . the pet-28a recombinant vector was constructed as described above ; it is about 9200 bp . after transformation of the pet-28a recombinant vector including the desired insert into e. coli , a number of the single colons were taken from the selective medium ( lb - kanamycin ) . the transformation was confirmed with colony pcr , digestion of extracted plasmid ( figure 2 ) , and sequencing . after the digestion , the pcr product ( 3851 bp ) and the pet-28a vector ( 5369 bp ) were separated . production of phb was confirmed by sudan black b staining under a light microscope ( figure 3 ) . pha - producing genes exist in various bacteria . although these genes are dispersed on chromosome in some organisms , they are in tandem in other bacteria such as r. eutropha h16 . although the capacity of r. eutropha to produce and accumulate polymers is well - known , the use of these kinds of bacteria has some limitations . hence , many efforts have been accomplished to create recombinant bacteria and use economic carbon sources . in a report by galehdari et al . ( 11 ) they separately amplified the phbb , phba and phbc genes from the extracted azotobacter genome and cloned the fragments in pcr2.1-topo cloning vector with subsequent transformation of e. coli dh5. in their study , three types of recombinant e. coli were created and none of them could produce phb . in our study , the whole operon of phb was extracted and an expression vector was constructed ; then , the production of phb was confirmed in the recombinant bacteria . many other reports used phb genes from r. eutropha and a. latus for production of phb in e. coli ( 12 , 13 ) . various metabolic and fermentation methods have been used in some bacterial strains for phb production . the use of a recombinant system harboring the phb synthesis genes can produce phb in higher concentrations compare to natural pha - producing bacteria ( 2 ) . the high - yield production of phb in natural pha - producing bacteria can be reduced by high activity of intracellular depolymerase . to overcome this bottleneck , metabolically - engineered e. coli strains ( without dehydrogenase ) harboring heterologous pha synthesis intensive efforts are being made to reduce the cost of production by means of bioprocess designing and metabolic engineering of the production strains ( 2 ) . in this study , we successfully cloned and expressed the recombinant pet-28a containing the phb - biosynthesis genes . phb granules were observed in e. coli by sudan black b staining under the light microscope . in sudan black b staining , lipid inclusion granules were stained blue - black or blue - grey , whilst the bacterial cytoplasm was stained light pink . | background : poly 3-hydroxybutyrate ( phb ) , a class of poly hydroxyalkanoates ( phas ) , is a group of bacterial storage polymers , produced by various microorganisms in response to nutrient limitation .
phas are biodegradable polymers which could be a good substitute for current petrochemical plastics .
phb has been synthesized during three enzymatic steps including three genes.objectives:our aim was phb production from recombinant bacteria.materials and methods : ralstonia eutropha was cultured and its genomic dna was extracted .
the phbcab operon was amplified using designed primers .
the fragment was cloned into pet-28a expression vector and then transformed into escherichia coli bl21 .
sudan black staining was used to show the production of phb.results:the extracted recombinant plasmid was digested with restriction enzymes .
separation of the desired fragment from the vector was performed to prove the correct insertion of the pcr products into the vector . the colony pcr and
sequencing results confirmed the successful transformation .
the production of phb was confirmed by sudan black b staining under a light microscope.conclusions:various metabolic and fermentation methods have been used in some bacterial strains for phb production .
the use of a recombinant system harboring phb synthesis genes can produce phb in higher concentrations compare to natural pha - producing bacteria .
the present study was one of the most important and basic steps of designing a recombinant e. coli that can produce phb . |
during the shock state , understanding the mechanisms of acidosis , its hemodynamic and inflammatory consequences as well as the best therapeutic approach remain an ongoing debate . in the previous issue , schotola and colleagues provide , for the first time , new and en - lightening data on the consequence of acidosis in isolated human failing myocardium . over the past two decades , the mortality rate from a shock state has decreased ; for instance , in septic shock from 30% to around 20% . this improvement stems from many factors , including early management , more aggressive resuscitation with specific goals ( volemic expansion , targeted main arterial pressure , blood transfusion , and so forth ) and a better identification of prognostic factors such as acidosis . as a major metabolic consequence of shock states , acidosis is also known to be a high predictor of in hospital mortality . both a cause and a consequence , this acidosis impairs cardiac and vascular function through various cellular and molecular mechanisms . intracellular acidosis , which reduces myofilament sensitivity to ca , is thus one of the crucial factors involved in myocardial dysfunction . a low ph value also induces vessel hyporeactivity mediated by a number of factors such as nitric oxide , peroxynitrite , activation of katp channels and modification of catecholamine signaling . although it has long been known that cardiovascular function is impaired by acidosis , the bulk of the studies have been mostly experimental , and only a few human studies have been relevant on this subject [ 8 - 10 ] . in the present study by schotola and colleagues , these trabeculae were mounted in a chamber in which the development of isometric force was recorded and the tissues superfused with a hepes solution at ph 7.20 and 7.40 . the response to incremental doses of isoproterenol , a b mimetic agent , was also recorded . their major finding was a reduction in cardiac contractility at ph 7.20 and a rightward shift of the ph 7.20 curve compared with the 7.40 curve in response to increasing doses of isoproterenol . therefore , without providing actual new pathophysiological information regarding cardiac depression in acidotic patients , this study definitely confirms the deleterious effects of a moderate and common acidosis on the failing human heart . obviously , these experimental conditions ( that is , ex vivo fragments of myocardium , artificial organic acidosis ) are far from the clinical situation furthermore , given that the hemodynamic consequences of common mild acidosis on altered myocardium are important , physicians should be alarmed in the presence of severe acidosis . in shock patients , hemodynamic treatment in order to treat acidosis should be a primary goal for the physician . finally , it would be of interest , albeit ethically complex , to determine whether this mild acidosis has the same impact not only on preserved human myocardium but also on both preserved and altered arterial vessels . the main treatment must involve the correction of the underlying disease at the origin of acidosis . however , buffering severe acidosis by sodium bicarbonate is known to be associated with severe deleterious effects . bollaert and colleagues demonstrated that sodium bicarbonate infusion in acidotic rats decreases the intracellular ph . moreover , sodium bicarbonate infusion increases carbon dioxide , which is highly diffusible in cells ( hco3 + h<= > h2co3 and h2co3 < = > co2 + h2o ) . carbon dioxide increases dramatically and exacerbates cardiovascular dysfunction . another deleterious effect is that hypocalcemia is worsened by bicarbonate infusion , which probably also impairs cardiovascular function . a final example is hydric and sodium overload , which often occurs during sodium bicarbonate infusion . two small randomized , controlled clinical studies describe the inefficiency of this treatment in restoring the hemodynamic balance in critically ill patients . other treatments such as carbicarb , an equimolar solution of sodium bicarbonate and sodium carbonate , or tham ( trometamol ; tris - hydroxymethyl aminomethane ) , a biologically inert amino alcohol of low toxicity that buffers carbon dioxide and acids in vitro and in vivo , have also been studied for the treatment of metabolic or respiratory acidosis , although not in shock state patients . for all of these reasons , in fact , the surviving sepsis campaign guidelines only recommend against its use for ph 7.15 . currently , there are no relevant published studies regarding the effect of bicarbonate therapy for ph < 7.15 . nevertheless , while the underlying disease remains the main course of treatment , there is an urgent need to research a new symptomatic approach to acidosis management . | acidosis is one of the major consequences of hemodynamic instability in shock state patients directly associated with multiple organ failure evolution and death .
most studies on the hemodynamic consequences of acidosis have been experimental , nonhuman studies with severe acidosis , and thus far from the most common clinical situations .
schotola and colleagues offer a new approach to human failing myocardium where the authors highlight , ex vivo , the deleterious hemodynamic consequences of mild acidosis .
their work strengthens the current view of the urgent need to discover new efficient and nondeleterious therapy for the treatment of acidosis . |
cerebral palsy ( cp ) comprises a group of movement and posture disorders resulting from
nonprogressive , permanent damage to the immature brain1 . motor impairment is the main manifestation of cp , with consequent
effects on the biomechanics of the body2 . children with cp exhibit impaired muscle coordination , difficulties in the organization of
sensory information , and functional limitations3 . approximately half of all children with cp have upper limb
dysfunction4 , which includes weakness ,
associated mirror movements , decreased velocity , overactive reflexes , muscle contractures ,
altered biomechanics , disuse , sensory impairment , and hypertonia5 , 6 . these upper limb
impairments lead to difficulties in reaching , grasping , and manipulating objects . deficiencies in one or more of these basic functions hinder the performance of activities of
daily living and therefore exert a negative impact on independence and quality of life7 . adequate treatment planning is imperative and requires extensive knowledge of all upper
limb dysfunctions . a clinical assessment combined with objective , quantitative upper limb
measures can provide the necessary insights7 . however , most measures are subjective and use a straightforward
scoring system . the main disadvantage of qualitative outcome measures is that they provide a
subjective description of upper limb performance based on the opinion of the rater , who
visually scores the range and quality of movement during the execution of tasks . moreover ,
some outcome assessments have been criticized for not being sensitive enough to detect
clinically meaningful changes in upper limb function following an intervention8 . in a recent study , santos et al . reported
that no consensus has been reached on the most appropriate scale or on which scale has
greater clinical applicability in this population9 . thus , quantitative measures are needed to provide a more detailed ,
objective description of upper limb movement patterns . such measures can provide an
objective description of upper limb performance based on technical measurements and
calculations ( e.g. , joint angles , movement duration , and velocity ) . three - dimensional ( 3d )
movement analysis is a powerful tool for quantitative assessment of movement in all degrees
of freedom7 . a number of authors have
recommended the use of kinematics for objective , quantitative analysis of upper limb
movements in children with cp10 . motion analysis is considered the gold standard for evaluating lower limb function during
gait in individuals with cp11 . upper limb
motion analysis is more technically challenging due to the noncyclical nature of upper limb
use and the complexity of shoulder joint motion12 . in addition to joint kinematics , spatiotemporal variables , such as
duration , velocity , smoothness , and trajectory of movement , can provide important
quantitative information on the quality of upper limb motion13 . the aim of the present study was to perform a review of the literature on objective upper
limb movement measures for children and adolescents with cp with a focus on describing
methods for the assessment of kinematics , spatiotemporal variables , and/or angular joint
movements . methodological reflections are included in this report to promote standardization
of a protocol for 3d analysis of upper limb movements in children and adolescents with
cp . a systematic review of the literature was performed with searches in the virtual health
library network and the medline , pedro , lilacs , scielo and pubmed databases using
combinations of the following key words : upper limb , three - dimensional analysis , kinematics ,
and cerebral palsy . the articles retrieved were evaluated by two blinded researchers using
the following inclusion criteria : 1 ) type of study , controlled clinical trial ; 2 ) outcome ,
3d or kinematic evaluation of the upper limbs of children / adolescents with cp ; and 3 )
publication between 2010 and 2015 . the selected articles were evaluated , scored , and qualified using the physiotherapy
evidence database ( pedro ) scale , which has 11 items . item 1 is not scored , whereas the other
10 items receive a score of either 0 or 1 . the purpose of this scale is to evaluate the methodological quality ( table 2table 2.characteristics of the studies included in reviewarticlen of subjectssample characteristicsinterventionkinematic processingkinematic analysis112children 611 yearscerebral palsy(hemiplegic , diplegic ,
quadriplegic)eg : 6 without trunk restraintcg : 6 with trunk restraintsystem : positional data ( x , y , z ) recorded with an
optotrak 3020 ( 100 hz ; northern digital , waterloo , on , canada ) for 5 to 8
seconds.markers : fingertip , thumb , first metacarpal head , radial styloid ,
mid - forearm , lateral epicondyle , ipsilateral and contralateral acromions , sternum ,
and lateral iliac spine.trials : 7 to 13 trials ( bad trials discarded).kinematics analysis : trajectories and angles . results : smoother arm trajectories and greater elbow extension were observed at
the post - intervention assessment in most children , but deterioration in elbow
extension for reaches was observed at follow - up . trunk displacement was reduced at
the post- intervention assessment and at follow - up.220children 410 yearscerebral palsy ( hemiplegic)eg : 10 bimanual treatmentcg : 10 unimanual treatmentsystem : 3-d kinematic analysis with eight infrared cameras ; all
markers digitized at a rate of 120 hz with a low pass filter ( 6 hz ) using vicon
software.markers : reflective markers placed at mid - point of both wrists . trials :
7 to 10 trials.kinematic analysis : time . bimanual coordination using
normalized movement overlap time and goal synchronization.movement strategies :
experimental setup with a loop handleresults : significantly greater reduction in
goal synchronization time in the experimental group.316children 814 yearscerebral palsy(hemiplegic and
quadriplegic)eg : 8 lycra arm splint usage for three monthscg : 8
no interventionsystem : seven - camera vicon 370 motion analysis system ( oxford
metrics , oxford , uk ) operating at 50 hz.markers : 3d position of markers
throughout movement trials analyzed using customized model developed with vicon
body buildersoftware ( oxford metrics , oxford , uk).trials : three
successful trials of each task analyzed.kinematics analysis : time and jerk . the 3d movement substructures of the
wrist joint center ( wjc ) were calculated from 3d positional data using a custom
jerk analysis computer software ( labview , national instruments corporation ,
austin , tx , usa).movement strategies : reach forwards , reach forwards to an
elevated position , reach sideways to an elevated position , and hand to mouth and
down.results : significant improvements in the experimental group regarding
movement time , normalized jerk , and jerk index in the primary and secondary
movements . 416children 815 yearscerebral palsy ( hypertonic)eg : 8 - lycra arm splint usage combined with goal directed training
for three monthscg : 8 - no interventionsystem : seven - camera vicon 370 motion analysis system ( oxford
metrics , oxford , uk).markers : reflective markers placed on upper limb and trunk ;
3d position of markers throughout movement trials analyzed using a customized
model developed with the vicon bodybuilder software ( oxford metrics ,
oxford , uk).trials : three successful trials of each task analyzed.kinematics analysis : angle - range of motion . the
movement trials were analyzed using a customized model developed with the vicon
bodybuilder software ( oxford metrics , oxford , uk).the data were filtered using a
woltring spline with a mean standard square error ( msse ) of 20 . movement
strategies : reach forward to an elevated position , reach sideways to an elevated
position , supination/ pronation , and hand to mouth.results : significant
improvements from baseline angles.58children 815 yearscerebral palsy ( hypertonic)eg1 : 4 - botulinum toxin injectioneg2 : 4- muscle lengthening
surgery system : vicon optoelectronic system with six cameras.markers :
rigid supports provided with three markers ( tripods ) used to measure trunk , arm ,
forearm , and hand motions.trials : four successful trials of each segment.kinematics analysis : angle - range of motion ( rom ) and
mean angles for the trunk / table , arm / trunk , forearm / arm , and hand / forearm . recommendations from the international society of biomechanics.movement
strategies : hand to mouth and moving a cup on a table.results : significant rom
and mean angle changes between the pre- and post - therapeutic conditions
( homolateral analysis).eg : experimental group ; cg : control group ) of randomized controlled clinical trials , giving priority to internal
validity ( whether the results published in the study have sufficient information ) as well as
clinical and statistical relevance , so that interpretation of the findings is clear and
other researchers can reproduce the study . all divergences regarding classification of the
studies analyzed based on the pedro scale were discussed and evaluated by two blinded raters
until a consensus was reached on the score of each study . thus , five articles addressing 3d analysis of the upper limbs of
children and adolescents with cerebral palsy ( fig .
1fig . 1.flowchart of studies included in the review ) were considered methodologically adequate ( minimum of three points on the pedro
scale ) and were included in the present systematic review ( table 1table 1.pedro scale scores of each study ) . flowchart of studies included in the review all studies selected were controlled clinical trials and employed one or more upper limb
evaluation methods . the methods and results of the 3d analysis the following information was extracted from each study : authors and year of
publication , sample size , sample characteristics , methods employed , and outcomes ( table 2 ) . current clinical methods of upper limb evaluation are performed in terms of function , motor
control , sensory impairment , dexterity , tone , and degree of fixed versus dynamic deformity
as well as both passive and active range of motion . in higher functioning children , the
quality of upper limb movement during functional tasks is determined using available
clinical scales19 . a strategy level assessment. a
large number of kinematic variables are used to reflect the characteristics of the reaching
motion . by quantifying specific kinematic variables , key components can be identified and
the influence of motor impairment on the reaching motion can be carefully analyzed . consequently , specific kinematic parameters with large effect sizes can provide therapists
with a sensitive way to measure the effectiveness of treatment and analyze the influence of
different levels of motor dysfunction on upper arm control during activities that require
various degrees of accuracy . a better understanding of this information can offer insights
for the evaluation of treatment and the progression of a wide variety of motor disorders ,
such as those that occur with cp20 . the samples in the studies analyzed in the present systematic review were predominantly
made up of children with spastic hemiparetic cerebral palsy , which confirms an observation
made by body21 . children with hemiparesis
have limitations regarding the use of the affected upper limb and two - hand coordination ,
which exerts a negative impact on activities of daily living and participation at school , in
the community , and in family life . mean age ( eight years ) was also a common factor in the
studies analyzed . as the present review was restricted to clinical trials , all studies had two groups : an
experimental group subjected to a particular intervention and a control group that did not
undergo the intervention . analyzing the kinematic variables , it is clear that there is no
consensus on the data collection , processing , and analysis procedures or the reporting of
the results . the vicon optoelectronic motion analysis system ( oxford metrics , oxford , uk )
was used in four of the five studies , but the number of cameras employed differed . the
optotrak 3020 ( 100 hz ; northern digital , waterloo , on , canada ) was employed in the other
study . differences among the studies also occurred with regard to placement of the makers
( five segments were included , the trunk , scapula , humerus , forearm , and hand , and four
joints were considered , the scapulathoracic ( scapula ) , humerothoracic ( shoulder ) , elbow , and
wrist joints , and the number of trials . in the present review , a variety of mechanical models , numbers of segments , joint degrees
of freedom , and marker configurations were encountered , with no consensus on a standardized
assessment pattern . only the study conducted by fitoussi et al . 18 used the recommendations on the international society of
biomechanics ( isb ) regarding the definition of joint coordinate systems and rotation
sequences22 . this observation was also
described in a study by ellen jaspers in 2011 , who reported that most studies on upper limb
( up ) kinematics in typically developing children and children with cp have not yet
incorporated the isb guidelines . moreover , there is no general consensus on which tasks
should be assessed23 . in the following section on kinematic analysis , characteristics are presented for the
different tasks , including spatiotemporal characteristics , joint kinematics ( joint angles ) ,
trajectories of movement , and jerk analysis as well as contextual influences of
interventions . the differences in spatiotemporal characteristics between the experimental
group and control group during reach to touch and reach to grasp were studied in
articles by hung ya - ching el al.15 and
elliot et al16 . schneiberg et al.14 compared the
differences between pre - intervention and post - intervention assessments for three - dimensional
arm and trunk trajectories and elbow angles and overall trend analysis ; the effect size for
time period indicated smoother arm trajectories and greater elbow extension at the
post - intervention assessment in most children . the other articles analyzed used kinematic
evaluation focused on angular data of different joint segments and also found satisfactory
results with the treatment protocol offered . in the studies analyzed , the evaluation of kinematics was effective for a discussion of the
findings , but we believe that the methodogical differences between the studies likely
inconsistent results and therefore , exert an impact on the clinical interpretation . we
suggest , based on the present review , that authors of future clinical trials should try to
use standardized patterns . standardization of the protocol for 3d upper limb movement
analysis will provide the foundation for comparable , reproducible results and eventually
facilitate the planning of treatment interventions for children and adolescents with
cerebral palsy . several clinical trials involving children and adolescents with cerebral plays have
benefitted from the use of objective measurements of upper limb movements , with
spatiotemporal and angular parameters used in the majority of them . however , there is a lack
of consensus regarding the biomechanical model and which tasks to analyze . the findings of
the present systematic review underscore the need for standardization of 3d upper limb
movement analysis . | [ purpose ] the aim of the present study was to perform a review of the literature on
objective measures of upper limb movements in children and adolescents with cerebral palsy
and describe the methods used to investigate upper limb kinematics in this population .
[ materials and methods ] an extensive database search was performed using the keywords
kinematics , upper limb , and cerebral palsy .
a total of 146 papers were identified , but
only five met the inclusion criteria .
[ results ] no consensus was found regarding the data
collection , processing , and analysis procedures or reporting of the results . [ conclusion ]
standardization of the protocol for 3d upper limb movement analysis will provide the
foundation for comparable , reproducible results and eventually facilitate the planning of
treatment interventions . |
it stopped for a thousand years and , because much of the knowledge of antiquity was lost during those years , might actually be said to have gone backwards . when science was reborn in the renaissance , beginning in the 1400s , less was known about the world in general and the living world in particular than was known 1,200 years earlier . for example , the workings of the heart and blood vessels were far better ( if still imperfectly ) understood in 150 ad than they were when leonardo da vinci first began his dissections ( e.g. , 8) . when the knowledge of antiquity was rediscovered during the renaissance , it was initially taken as gospel to be taught rather than a starting point from which further inquiry could continue . during dissections , a professor would stand and read from an anatomy book from antiquity ( by galen ) and the students were meant to find in the body being dissected those features that were mentioned in the ancient text . the problem , though , a problem that seems silly in retrospect , was that the knowledge of antiquity was not perfect . if the students saw something in a body that was not in the text ( such as a hint as to which direction blood flowed ) , that observation was to be discarded . fortunately , beginning in the late renaissance , scholars ( professors and graduate students ) began to add to and improve ancient knowledge rather than simply taking it as the complete and revealed truth . the training of graduate students began to involve having them do new science , searching for yet - to - be discovered truths ( while necessarily mastering both what is already known and the methods with which scientists search for the truth ) . but this new form of simultaneous learning and discovery was never extended to the rest of education . nor was it extended to the ways in which scholars engage the public . as a result , most science education proceeds exactly in the way that it would have at the end of the dark ages . in too many instances , a teacher or professor stands in front of students and asks them to look to the world to see what is already known . this dissection is literal ( and hence remarkably similar in appearance to the end of the dark ages ) . a cat , for example , or a fetal pig , is set out on a table and the students gather around to dissect the animal and , in doing so , see what the book says should be there , inside . if something in the cat deviates from what is in the book because of , say , a congenital deformity , the student with the deviant cat is asked to look at a neighbor s cat . our dark ages approach to science education is problematic because much of what we know to be true today will prove to be wrong ( the appendix , for example , long held to be vestigial , appears to have an important functional role ; 17 ) . it is problematic because most of what is knowable is not yet known . even by conservative estimates , the majority of insect species , be they deadly , beneficial , or otherwise , are not yet named ( 18 ) . more fungal species were recently found in the dust inside north american houses than there are named species of fungi in north america ( 1 ) . most importantly , it is problematic because , like math , the key attribute of science that is useful to the average person in his or her life is not the facts ( which nonetheless need to be grasped ) but , instead , the scientific process and the general rules science offers for laying hold of the unknown features of the world . many of the most important challenges facing humanity today , challenges of public health ( e.g. , flu and vaccination , the overuse of antibiotics ) , global change , or even agricultural sustainability , are challenges in which key decisions are made by stakeholders ( citizens ) who are not scientists , stakeholders who need to understand how science works ( and , surveys indicate , do not ) . we take a step that is 600 years overdue : we integrate citizen science into the classroom . education reforms since the mid - nineteenth century have been slowly paving the way for citizen science in classrooms . first was a shift from memory culture and studies of classics and languages to adding science to the classroom curriculum in the mid-1800s ( 7 ) . then , in the early 1900s , john dewey emphasized that classroom science should have real - world focus . by the 1960s , there were reforms to emphasize hands - on experiences , science literacy for all , and the development of critical thinking and reasoning skills . the current ideal is inquiry - based education , in which teachers aim to have students re - discover , on their own , what is known ( e.g. , 11 ) . such an approach is a simulation that teaches the process of science , but its lack of authenticity makes it fall short of the revolution for which we might hope , a real renaissance . citizen science is science in which the public or classrooms participate in the scientific process , whether in collecting data , generating hypotheses or analyzing data . citizen science is science that students and teachers can be involved in long after they leave school . it is science that allows anyone to be part of discoveries and , simultaneously , to learn about how science works ( while still learning the facts ) . in the last years , citizen science has become recognized as a key component of how we understand the world . recent studies , for example , show that two - thirds of the field - based discoveries about monarch butterflies involved the public ( 16 ) . in ornithology , half of what is known about migratory birds and climate change is based on data from bird watchers , even though citizen science is not explicitly credited in most scientific papers ( 5 ) . in addition to producing new knowledge , citizen science has been viewed as science education in informal settings ( 2 ) . citizen science produces social capital , which includes increased public understanding of science ( 3 , 9 ) , greater scientific thinking ( 19 , 10 , 15 ) , greater personal agency ( 6 ) , and political participation leading to more accountability and industrial compliance with regulatory agencies ( 4 , 12 , 13 , 14 ) . but the trickle of projects into classes is useful , but we need something more comprehensive . here , we offer the hypothesis we ourselves have begun to test , and that we hope might be more generally considered , namely that through engaging children , their teachers , and the public in learning about science by doing science ( real science , science that yields new truths , science that is published in peer - reviewed journals ) , one can simultaneously improve the scientific knowledge of children and the public , make new discoveries , and engender a culture in which children and adults are willing and able to facilitate future discoveries . , for example , teachers are poorly paid , have large class sizes and must work in a framework in which very few of the minutes of the day are flexible . with our hypothesis in mind ( but also those barriers ) , we have begun to work with teachers to co - create lesson plans and modules that allow teachers to incorporate citizen science directly into the classroom . we are working with teachers on real science about root microbes , belly button microbes , face mites , mammals in backyards , fossils , and more . as we do , we have simultaneously begun to study how to best craft these modules so as to empower teachers to pursue discoveries that by definition are unpredictable , even within the context of standardized school environments that are regulated by the need to meet curricular goals and benchmarks . finally , we are studying how each of these projects scales , which ones spread easily from classroom to classroom and country to country , which fail to do so , and why . we began this work in k12 classrooms ( middle schools in particular ) , and soon many of the modules were being used in university classrooms . we are now extending our reach to university classrooms , where citizen science can be built upon into papers led by individual classes ( www.studentsdiscover.org ) . in the end , what we hope for is something far more radical than what we could ever achieve on our own : a reinvention of science education in schools , undergraduate classes , and informal settings . the scope of such an endeavor is perhaps best noted in the context not of what we have so far achieved but instead in the context of what we have collectively failed to achieve . here , let us return to the example of the dead cats . all around the world cats this is particularly tragic if one remembers that most of what is knowable is not yet known , even with regard to cats . new discoveries await in the bodies of cats , discoveries students could be making but are not , likely because neither they nor their teachers have even considered this as an option . the most interesting of these discoveries are the ones we can not anticipate , but there are some we can anticipate . among the most challenging diseases of humans , and mammals in general , to study are rare congenital diseases . collectively these diseases affect many individuals , but the genetic under - pinnings of these diseases are hard to understand because , in order to know which genetic variants might cause one of these diseases , one needs to study the bodies and genes of many afflicted individuals . a simple answer exists . when students study cat dissections , if they were to look for cats with congenital problems , document those cats , and take tissue samples of those cats ( which they or someone else could sequence ) , we could start to understand the origin of such diseases . instead , most rare congenital disorders are not well understood and will not be for decades , and nothing new is learned from the millions of dead cats . there are barriers to implementing this example , but they are surmountable with the citizen - science approach . historically , having a citizenry aware of the scientific process might have been a luxury . one could argue that most important decisions made with regard to science were made by relatively few stakeholders : the powerful few . increasingly , however , the big decisions with regard to climate change , public health , water resources , and agriculture are being made by everyone who votes or chooses what to purchase . as a result , the future of the life we depend on very much depends on democratizing not only scientific knowledge but also science itself . a great deal more than the pursuit of beautiful science depends on our ability to fulfill the final step in the renaissance . | at the end of the dark ages , anatomy was taught as though everything that could be known was known .
scholars learned about what had been discovered rather than how to make discoveries .
this was true even though the body ( and the rest of biology ) was very poorly understood .
the renaissance eventually brought a revolution in how scholars ( and graduate students ) were trained and worked .
this revolution never occurred in k12 or university education such that we now teach young students in much the way that scholars were taught in the dark ages , we teach them what is already known rather than the process of knowing .
citizen science offers a way to change k12 and university education and , in doing so , complete the renaissance .
here we offer an example of such an approach and call for change in the way students are taught science , change that is more possible than it has ever been and is , nonetheless , five hundred years delayed . |
a 73-year - old indian female patient presented with rapidly progressive painless swelling of face , mainly localized in the parotid and submandibular region bilaterally for the duration of one year . the patient had a history of fever for the most recent two months , with unexplained weight loss ( weight at the time of presentation was 35 kg ) . physical examination revealed the patient to be moderately built and poorly nourished with signs of anemia . the spleen was also palpable 10 cm below the costal margin , whereas the liver was just barely palpable . further systemic examination including that of the respiratory , cardiac , and central nervous systems was normal . extraorally , she had a diffuse firm swelling of both the parotid and submandibular glands ( fig . 1a ) , and a rubbery consistency of the cervical lymph nodes along with those of the submental , submandibular , and jugulodiagastric groups . intraorally , two soft , non - tender swellings of about 23 cm were seen in the buccal vestibule in the region of the left upper and lower second molar . a routine hemogram showed pancytopenia with a hemoglobin level of 8.8 gm / dl , a total leukocyte count of 2.510/mm and platelet count of 1.0310/l . a lactate dehydrogenase level of 621 iu / l was noted and tests for human immunodeficiency virus ( hiv ) i and ii were found to be non - reactive . high resolution ultrasonography and color doppler sonography studies confirmed the enlargement of the bilateral parotid and submandibular glands , and also the buccal and lingual lymph nodes ( figs . the cervical group of lymph nodes revealed similar enlargement of multiple nodes belonging to ia , ib , iia , and iib levels along with the pre- and post - auricular and supraclavicular group of lymph nodes . ultrasonography of the abdomen confirmed the enlargement of the spleen , which measured 17 cm . contrast - enhanced computed tomography confirmed the diffuse symmetrical enlargement of the parotid and submandibular glands ( figs . 3a and b ) , while asymmetric thickening of the subglottic larynx and right aryepiglottic fold were evident with narrowing of the subglottic lumen . the ocular adnexa of the left orbit were involved , presenting as a bulky lacrimal gland . fine needle aspiration cytology ( fnac ) from the right parotid and submandibular glands , buccal vestibule , and tongue nodule showed a monomorphic population of lymphoid cells with the absence of reed - sternberg cells , which was suggestive of non - hodgkin 's lymphoma . incisional biopsy of the right submandibular lymph node was performed , which revealed diffuse infiltration by sheets of a monomorphic population of moderately large cells , with moderate cytoplasm and large round vesicular nuclei having prominent nucleoli . 4b ) and were immunonegative for cd10 , cd3 , cd5 , cd23 , and cyclin d1 . the mib-1 labeling index ( for proliferation marker ki-67 ) was approximately 10 - 15% . diagnosis of nhl - diffuse large b - cell type was concluded based on fnac and biopsies of the submandibular glands , parotid glands , and lymph nodes , supported by immunohistochemical positivity for cd20 marker . non - hodgkin 's lymphoma arises from a lymphocyte progenitor and comprises a heterogeneous group of highly diverse malignancies.2 25 - 40% of nhls are extranodal in origin4 and usually manifest in the gastrointestinal tract , followed by the head and neck region.5 nhl mostly occurs in the pediatric age group in the head and neck region;6 however , it may be seen in an older age group , such as in the present case of a 73-year - old female . the etiological factor for primary lymphoma of the salivary gland region is unclear.3 oral lymphomas are frequently seen with acquired immune deficiency syndrome ( aids ) . in certain individuals , it might serve as the first presentation of aids.7 the present case was seronegative for hiv . the most common presentation of primary oral and paraoral lymphoma is a painless local mass with superficial ulceration.7 in the present case , patient presented with progressive painless swelling of the face involving mainly the parotid and submandibular glands . lymphoma of the ocular adenexa is the most common in those aged over 60 years . orbital lymphoma can involve the lacrimal gland , extraocular muscles , orbital fat , eyelids , and conjunctiva.8 in the present case , involvement of the larynx , orbit , and oropharynx were suspected based on the history and later confirmed by imaging . based on the morphology , cell lineage , and immunohistochemical findings , the present case was categorized as aggressive nhl of diffuse large b - cell type . to determine the prognosis and to guide therapy for nhl the ann arbor staging system9 is one of the most widely used systems , and includes physical examination , hematological tests , imaging studies , and selective biopsies.10 according to the ann arbor system , stage iveb ( stage iv : diffuse or disseminated foci of involvement of one or more extralymphatic organs or tissues ; e : extranodal organ involvement ; b : presence of systemic symptoms like fever and loss of weight ) was ascribed . all ipi parameters were found to be positive in this case , thus categorizing our patient as a high risk case . staging of salivary gland lymphoma plays a major role in management and enables more favorable prognosis.11 nhl is associated with significant morbidity . early stages of nhl ( minimal lymph node involvement ) are more manageable with a greater prospect of long - term disease - free survival , whereas advanced stages ( widespread in the lymph nodes ) of the disease have a lower prognostic index . such patients are also vulnerable to infectious diseases that may involve multiple organ systems ( e.g. central nervous system , liver).12 a diagnostic dilemma often occurs for oral physicians when these lymphomas occur at extranodal sites.13 the present case is disseminated nhl with predominant involvement of the salivary glands . though the involvement of both nodal and extranodal sites was present , the patient had complained mainly of enlargement of the salivary glands . since nhl constitutes only 1.7% of salivary gland malignancies,14 a clinical diagnosis of lymphoma is rarely suspected at initial presentation . in conclusion , the present case emphasizes the importance of imaging and prognostic markers for staging , which is essential for management . | non - hodgkin 's lymphoma ( nhl ) constitutes a group of malignancies those arises from cellular components of lymphoid or extranodal tissues .
the head and neck is the most common area for the presentation of these lymphoproliferative disorders .
primary involvement of salivary glands is uncommon .
this report described a case of a 73-year - old female patient who presented with involvement of both nodal and extranodal sites , with predominant involvement of salivary glands .
the tumor staging worked up along with imaging , histopathological , and immunohistochemical findings were discussed .
computed tomographic images showed the involvement of waldeyer 's ring , larynx , orbit , and spleen .
this report described imaging and prognostic tumor markers in diagnosing , treatment planning , and prognosis . |
acute myocardial infarction ( ami ) results from total coronary artery occlusion , usually due to thrombus formation on complicated atherosclerotic plaque . the patients with ami have higher mortality rates , especially during the first 30 days . platelets play an important role in development , destabilization , and rupture of the atherosclerotic plaque , as well as in formation of platelet - fibrin plug at the complicated atherosclerotic plaque . platelet count is associated with increased risk of ami and short- and long - term mortality after ami [ 58 ] . lymphocytes play a dominant role in chronic inflammation of atherosclerosis , and lower lymphocyte count is associated with increased cardiovascular risk and mortality in ami . platelet / lymphocyte ratio ( plr ) has been reported as a novel marker of long - term mortality in patients with non - st - elevated ami . in the present study , we tested the hypothesis that plr is associated with in - hospital cardiovascular mortality in patients with st - elevated ami ( stemi ) . records of patients with ami who were admitted to the coronary care unit between january 2009 and november 2011 were evaluated retrospectively . we consecutively evaluated 645 patients who were diagnosed with stemi and excluded 4 patients with intracranial hemorrhage because of the intra - venous thrombolytic treatment ( streptokinase , tissue plasminogen activator , or tenecteplase ) and 5 patients without eligible laboratory results . a diagnosis of stemi was defined as > 30 minutes of continuous typical chest pain and st - segment elevation 2 mm in 2 contiguous electrocardiography leads within 12 hours of symptom onset or within up to 18 hours if there was evidence of continuing ischemia or hemodynamic instability . from medical records , we obtained demographic information , cardiovascular history and risk factors for coronary artery disease ( cad ) , and treatment received during the in - hospital period . patients who had been treated with antihypertensive drugs or those whose baseline blood pressure exceeded 140/90 mmhg were diagnosed with hypertension ( ht ) . diabetes mellitus ( dm ) was defined as fasting blood sugar level above 126 mg / dl or the use of anti - diabetic medications . the admission glomerular filtration rate ( gfr ) was estimated by the simplified mdrd ( modification of diet in renal disease ) equation . renal failure was defined as a glomerular filtration rate ( gfr ) < 60 ml / min / m . ventricular tachycardia or ventricular fibrillation were defined at least 24 hours after the beginning of the symptoms , advanced heart failure was defined as killip classification 2 , and cardiovascular death was defined as death due to ami , heart failure , or arrhythmia . complete blood counts and biochemical values were evaluated retrospectively from blood samples obtained by antecubital vein puncture upon admission to the emergency department . total and differential leukocyte counts were determined with the beckmancoulterlh 780device ( beckman coulter ireland inc . the high plr group ( n=212 ) was defined as having values in the highest tertile ( plr > 144 ) , and the low plr group ( n=424 ) was defined as having values in the lower 2 tertiles ( plr 144 ) . quantitative variables are expressed as the mean value sd or median ( interquartile range ) , and qualitative variables are expressed as percentages ( % ) . a comparison of parametric values between high and low plr groups was performed using the t test or the mann - whitney u - test . categorical variables were compared by the likelihood - ratio test or fisher s exact test . a backward stepwise multivariate logistic regression analysis , which included variables with p<0.1 , age 70 , female sex , renal failure ( gfr < 60 ml / min / m ) , time of chest pain , not receiving thrombolytic treatment , nlr>4.1 , and plr>144 were entered into the model . all statistical studies were carried out with the spss program ( version 17.0 , spss , chicago , il , usa ) . records of patients with ami who were admitted to the coronary care unit between january 2009 and november 2011 were evaluated retrospectively . we consecutively evaluated 645 patients who were diagnosed with stemi and excluded 4 patients with intracranial hemorrhage because of the intra - venous thrombolytic treatment ( streptokinase , tissue plasminogen activator , or tenecteplase ) and 5 patients without eligible laboratory results . a diagnosis of stemi was defined as > 30 minutes of continuous typical chest pain and st - segment elevation 2 mm in 2 contiguous electrocardiography leads within 12 hours of symptom onset or within up to 18 hours if there was evidence of continuing ischemia or hemodynamic instability . from medical records , we obtained demographic information , cardiovascular history and risk factors for coronary artery disease ( cad ) , and treatment received during the in - hospital period . patients who had been treated with antihypertensive drugs or those whose baseline blood pressure exceeded 140/90 mmhg were diagnosed with hypertension ( ht ) . diabetes mellitus ( dm ) was defined as fasting blood sugar level above 126 mg / dl or the use of anti - diabetic medications . the admission glomerular filtration rate ( gfr ) was estimated by the simplified mdrd ( modification of diet in renal disease ) equation . renal failure was defined as a glomerular filtration rate ( gfr ) < 60 ml / min / m . ventricular tachycardia or ventricular fibrillation were defined at least 24 hours after the beginning of the symptoms , advanced heart failure was defined as killip classification 2 , and cardiovascular death was defined as death due to ami , heart failure , or arrhythmia . complete blood counts and biochemical values were evaluated retrospectively from blood samples obtained by antecubital vein puncture upon admission to the emergency department . total and differential leukocyte counts were determined with the beckmancoulterlh 780device ( beckman coulter ireland inc . the high plr group ( n=212 ) was defined as having values in the highest tertile ( plr > 144 ) , and the low plr group ( n=424 ) was defined as having values in the lower 2 tertiles ( plr 144 ) . quantitative variables are expressed as the mean value sd or median ( interquartile range ) , and qualitative variables are expressed as percentages ( % ) . a comparison of parametric values between high and low plr groups was performed using the t test or the mann - whitney u - test . categorical variables were compared by the likelihood - ratio test or fisher s exact test . a backward stepwise multivariate logistic regression analysis , which included variables with p<0.1 , was performed to identify independent predictors of in - hospital cardiovascular mortality . age 70 , female sex , renal failure ( gfr < 60 ml / min / m ) , time of chest pain , not receiving thrombolytic treatment , nlr>4.1 , and plr>144 were entered into the model . all statistical studies were carried out with the spss program ( version 17.0 , spss , chicago , il , usa ) . a total of 636 patients ( 505 men and 131 women ) were enrolled into the present study . no differences were found between the groups regarding thrombolytic and other treatments received during the in - hospital period . tobacco use , ht , dm , and chd history were not significantly different between the groups . the rate of male patients ratio was lower in the high plr group ( 73% vs. 82.8% , p=0.004 ) . the patients in the high plr group were older ( 63.712.1 vs. 61.412.0 , p=0.022 ) . baseline platelet and neutrophil levels were significantly higher in the high plr group than in the low plr group ( 9.6 [ 3.225.1]10/mm
vs. 7.3 [ 2.218.4]10/mm , p<0.001 ; 245 [ 121779]10/mm
vs. 215 [ 43419]10/mm , p=0.001 ) , whereas the baseline lymphocyte level was significantly lower in the high plr group than in the low plr group ( 1 , 2 [ 0.43.7]10/mm
vs. 2.4 [ 0.69.1]10/mm , p=0.001 ) . neutrophil - to - lymphocyte ratio ( nlr ) was higher in high plr group ( p<0.001 ) ( table 2 ) . the high plr group had a significantly higher incidence of in - hospital cardiovascular mortality than the low plr group ( 12.7% vs. 5.9% , p=0.003 ) . advanced heart failure ( killip class 2 ) was more frequent in patients with high plr values ( 18.9% vs. 12.3% , p=0.026 ) . independent predictors of in - hospital cardiovascular mortality were determined by backward stepwise multivariate logistic regression . chest pain duration more than 6 hours , female sex , not receiving thrombolytic treatment , renal failure , age 70 years , nlr > 4.1 , and plr > 144 were found to be associated with increased in - hospital cardiovascular mortality in a logistic regression analysis ( table 4 ) . plr > 144 was found to be an independent predictor of in - hospital cardiovascular mortality in multivariate analyses ( hazard ratio : 2.16 , 95% confidence interval : 1.164.0 , p=0.014 ) . an plr value of 144 was determined as an effective cut - off point in stemi of in - hospital mortality , with a sensitivity of 51% and a specificity of 69% ( area under the curve=0.59 , 95% confidence interval 0.500.67 ) ( figure 1 ) . in this study we show that high plr at admission to hospital is an independent predictor of early cardiovascular mortality in patients with ami . older age , renal failure , and not treated with thrombolytic treatment are other independent predictors of mortality . to our knowledge this is the first study to investigate the relationship between plr and mortality in stemi . atherosclerotic cad is still the most common cause of mortality and morbidity in developed countries . activated platelets precipitate to produce inflammatory substances from endothelial cells and leucocytes that cause monocyte adhesion and transmigration , and thereby increase the inflammatory process and progression of atherosclerotic plaque . furthermore , these activated adhesion molecules and chemokines increase the activation of leucocytes , and produce reactive oxygen molecules and matrix metalloproteinase that cause plaque destabilization in atherosclerotic plaque . ami usually occurs as a result of coronary artery occlusion due to complication of an atherosclerotic plaque . platelets play a dominant role in pathogenesis of acute coronary syndromes by formation of platelet - fibrin complexes . platelet count was found to be associated with development of ami and presence of cad . gary et al . concluded that higher platelet volume may change blood viscosity and increase inflammation . healy et al . reported that expression of cd-49 and plasma myeloid protein in platelets is increased in patients with st - elevated mi . in addition , it was found that platelet count is associated with short- and long - term mortality in patients with st - elevated and non - st - elevated ami , and unstable angina pectoris [ 2022 ] . showed a relationship between platelet count and mortality in patients with recurrent ami in the first year after primary percutaneous intervention . in addition , fibrinogen levels and platelet counts are positively correlated and related to inflammation in ami patients . these findings suggest that platelets are one of the most important components of cad and cardiovascular events . lymphocytes are an important part of chronic inflammation in the atherosclerotic process . in ami , lymphocytes infiltrate to the ischemic and reperfused myocardium and express interleukin-10 , which may play a significant role in transmigration of mononuclear cells , and induce the expression of tissue inhibitor of metalloproteinase-1 . recent studies showed that higher plr is related to presence of cad and is correlated with c - reactive protein and fibrinogen levels . reported that plr above 170 is an independent predictor of long - term mortality in non - st - elevated ami patients . in our study , we found that high plr ( above 144 ) is an independent predictor of in - hospital mortality in patients with stemi who received thrombolytic treatment . complications of ami , including heart failure , shock , and ventricular rupture , are more frequent in older ami patients . in the present study , neutrophils may cause plaque rupture as a result of stimulating the release of proteolytic enzymes , superoxide radicals , and arachidonic acid derivates , and exacerbates the inflammatory condition . microvascular obstruction due to neutrophil - platelet plug , vasoconstriction due to thromboxanes , and vasoactive molecules may cause no - reflow and cause further myocardial injury . these high inflammatory processes appear to be responsible for high rates of heart failure and mortality . nlr was higher in the high plr group and was strongly related to cardiovascular mortality in our population , in line with results of previous studies . in multivariate analyses , we found that nlr was not an independent predictor and that plr is an independent predictor of mortality . patient long - term survival and cardiac conditions could not be assessed because the patient records and the coronary angiography results of patients were not known . anti - platelet treatment before ami is an important factor affecting in - hospital mortality , but our data were not able to demonstrate previous antiplatelet use . ami is the most important cause of mortality ( especially in the first month ) and morbidity worldwide . this study showed that high plr is an independent predictor of in - hospital cardiovascular mortality in patients with stemi . complete blood count analysis is a routine and inexpensive method that may be useful for the identification of high - risk patients . plr and other inflammatory markers and clinical findings might be helpful in identifying high - risk patients and treatment strategies . | backgroundplatelet - to - lymphocyte ratio ( plr ) is a new prognostic marker in coronary artery disease .
we aimed to evaluate the relationship between plr and in - hospital mortality in patients with st - elevated acute myocardial infarction ( ami).material / methodsthe present study included 636 patients with st - elevated ami .
the study population was divided into tertiles based on their admission plr .
patients having values in the third tertile was defined as the high plr group ( n=212 ) and those having values in the lower 2 tertiles were defined as the low plr group ( n=424).resultsrisk factors of coronary artery disease and treatments administered during the in - hospital period were similar between the groups .
male patient ratio was found to be lower in the high plr group ( 73% vs. 82.8% , p=0.004 ) . in - hospital
mortality was increased in the high plr group when compared to the low plr group ( 12.7% vs. 5.9% , p=0.004 ) .
the plr > 144 was found to be an independent predictor of in - hospital cardiovascular mortality ( hr : 2.16 , 95% ci : 1.164.0 , p=0.014).conclusionsthis study showed that plr is an independent predictor of cardiovascular mortality in patients with st - elevated ami . |
direct coronary stent implantation is an elegant technique for coronary artery revascularization.1 however , calcified coronary lesions , often seen in older patients suffering from diabetes mellitus , renal failure and hypertension , are challenging to deal with , as they require optimal lesion preparation prior stenting for avoiding stent underexpansion which is related to in - stent restenosis , target lesion revascularization and subsequent stent thrombosis.2 several strategies and technologies have been developed to address the problem of heavily calcified coronary lesions . these include simple dilatation using standard non - compliant balloon , cutting balloon and plaque modification using rotational atherectomy . we report on the management of an underexpanded bare - metal stent in a patient with heavily calcified lesion not amenable to high - pressure balloon - dilatation . a 72-year old man suffering from progressive angina over the past 8 weeks presented to our chest pain unit . he had previously documented insulin - dependent diabetes , alimentary obesity , hyperlipidemia and arterial hypertension . an ambulatory performed myocardial perfusion scintigraphy revealed a reduced tracer - uptake in the apex , left posterior and antero - lateral wall during physical examination ( 100 watt - cycling ) . coronary angiography , which was performed via right radial access using a 5f sheath , revealed a 50% stenosis of the left anterior descending artery ( lad ) and ramus posterolateralis sinistra ( rpls ) while the right coronary artery ( rca ) had a critical 90% stenosis ( fig . due to the patients symptoms and the angiographic findings we decided to perform a percutaneous coronary intervention ( pci ) . the patient received 600 mg clopidogrel , 500 mg aspirin and 5000u heparin followed by primary pci and direct stenting of a bare - metal stent ( bms ) ( coroflex blue 3.5 mm/8 mm , b. braun , melsungen , germany ) with 18 atm for 30 sec ( fig . post - pci angiography revealed a 75% stenosis in the mid - portion of the stent ( fig . 1c ) . a subsequent dilatation with a semi - compliant balloon ( pantera 3,5/10 mm with [ biotronik , berlin , germany ] 18 atm over 30 sec ) , a non - compliant balloon ( quantum 3,5/8 mm [ boston scientific , natick , usa ] with 20 atm over 30 sec ) and a cutting - balloon ( 3,0/10 mm [ boston scientific , natick , usa ] with 18 atm over 30 sec ) could not expand the stent further ; pointing out the heavily calcified nature of this lesion . due to the fact that an underexpanded stent is a predictor for worse clinical outcome we decided on rotablation . additionally we introduced a 5f sheath in right femoral vein and inserted a transient pacemaker lead . after passing across the stenosis with the 0.009 rotawire we ablade the heavily calcified stenosis as well as the stent struts ( stentablation ) ( fig . all ablations were performed with a 1.75 mm burr with at least 150,000 rpm and ablation times < 30 sec without a decrease in rotational speed of > 5,000 rpm . the procedure was free of complications and we continued with dilatation with a non - compliant balloon ( quantum 3,5/8 mm with 20 atm over 30 sec ) and a cutting - balloon ( 3,0/10 mm with 16 atm over 30 sec ) . with complete expansion of the balloons the procedure was continued with implantation of a drug - eluting stent ( taxus libert 4.0/12 mm [ boston scientific , natick , usa ] with 16 atm over 30 sec ) ( rotastenting ) ( fig . finally , there was timi 3 without evidence of dissection or residual stenosis ( fig . 2c ) . following uneventful hospital stay without evidence of myocardial necrosis the patient was discharged after 3 days on 100 mg aspirin , 75 mg clopidogrel , 5 mg bisoprolol , 5 mg of ramipril and 40 mg simvastatin with a recommendation for dual antiplatelet therapy of 1 year without any change in his extra - cardiovascular medications . a routine coronary angiography performed 6 months after index - pci revealed a good result with a mild ( 25% ) restenosis ( fig . 2d ) . direct stenting is the implanation of stents in coronary lesions without predilatation.1 from animal restenosis models , direct stenting without the need for predilatation appears to reduce vessel trauma , in particular as a result of less endothelial denudation , resulting in less neointimal hyperplasia subsequently.1 pci of calcified and complex lesions has been associated with lower success rates , an increased frequency of acute complications , and higher restenosis rates than pci of simple lesions.2 as seen in our case , delivering the stent may be difficult and stent expansion may be inadequate in heavily calcified lesions , resulting in smaller acute gain compared to non - calcified lesions.2 it is widely accepted that achieving postprocedural residual stenosis is a major determinant of restenosis during follow - up and optimal stent expansion is a crucial factor in minimizing the risk of stent thrombosis pointed out by the fact that only 22% of patients that experienced subacute stent thrombosis have an acceptable pci result as assessed by ivus.2,3 a variety of strategies and technologies have been developed to address the problem of an underexpanded stent . the postit trial revealed that in case of using only the stent delivery balloon over 70% of patients did not achieve optimal stent deployment.4 use of non - compliant balloon to achieve full distension in resitant lesions is a reasonable first - step . however , focal points of resistance within a lesion result in non - uniform balloon expansion and characteristic dog - boning with overexpansion in the more compliant segments . in this non - uniform expansion may cause vessel dissection and rupture acutely as well as restenosis due to deep - wall injury in the follow - up . cutting - balloon , designed to score the vessel longitudinally rather than causing uncontrolled plaque disruption , have been used successfully in the treatment of undilatable lesions.5 in our case , none of these techniques were successful in reducing the underexpansion , demonstrating the nature of the heavily calcification , which was not assumed on initial fluoroscopy . thus , despite the existence of limited data,6 we decided to rotablade the remaining calcification and the underexpanded stent struts to avoid aforementioned complications . high - speed rotational atherectomy preferentially cuts hard plaque , increases plaque compliance and thereby renders the lesion more amenable to balloon dilatation.7 the rotablator is able to ablate inelastic tissue selectively while maintaining the integrity of elastic tissue due to the principle of differential cutting . these particles are small enough to pass through the coronary microcirculation and ultimately undergo phagocytosis in the liver , spleen , and lung.7 the procedure performed in our case was uneventful with no dissection , slow - flow , heamodynamic compromise or myocardial necrosis . we had applied a transient pacemaker via the right femoral vein to overcome possible conduction disturbances when handling in the right coronary artery . several observational studies have confirmed that rotational atherectomy prior to stent deployment in severely calcified lesions does facilitate stent delivery and expansion , but incidence of restenosis remains unsatisfactory ( 23% ) when bms are used.8 there is limited information about rotational atherectomy followed by des implantation , but initial results seem promising.9 a comparison of bms ( n = 84 ) and des ( n = 213 ) after rotablation with cardiac death and recurrent myocardial infarction being defined as primary endpoint and binary restenosis as secondary endpoint revealed lower rates for primary endpoint in des group ( 2.3% versus 7.1% ; p = 0.04 ) during a follow - up of 1300 days.10 despite our procedural success and good midterm result , there are no data on long - term follow - up after stentablation and rotastening . thus , it should be emphasized that a better lesion preparation is needed to avoid stent underexpansion in undilatable lesions . | calcified coronary lesions are challenging to deal with , as they require optimal lesion preparation .
direct stenting in this scenario is associated with risk of stent - underexpansion , which is related to in - stent restenosis , target lesion revascularization and stent - thrombosis .
we report on the interventional management of an underexpanded bare - metal stent not amenable to high - pressure balloon dilation and cutting - balloon .
by using rotablation we could abrade the underexpanded stent struts and the calcification with subsequent implantation of a drug - eluting stent .
follow - up of 6 months revealed good results without evidence of significant restenosis .
our clinical experience and case reports in the literature suggest that this strategy might be an option for underexpanded stents not amenable to conventional techniques . |
attempts have been made to introduce technologies associated with ltp at atmospheric pressure into medical practice for various situations , and ltp s feasibility for use has been demonstrated in hemostasis , wound care , and anti - cancer therapy . translational studies of the basic technology for ltp at atmospheric pressure have remarkably proceeded at the max planck institute for extraterrestrial physics ( gerching , germany ) , leibniz institute for plasma science and technology greifswald e.v . ( inp greifswald e.v ; greifswald , germany ) , the national institute of advanced industrial science and technology ( aist ) of japan , nagoya university , and drexel university . now , its commercial viability has been studied at companies such as terraplasma gmbh , neoplas tools gmbh , and cinogy technologies gmbh . relevant products are steriplas formerly known as microplaster manufactured by adtec plasma technology co. , ltd . an example describing the clinical benefit of steriplas is that it can be used to control bacterial infection in chronic wounds and to eradicate infected microorganisms , providing new clues for solving issues related to the increase in bacteria that are resistant to multiple antibiotics . for hemostasis , different types of ltp equipment are being developed by aist , nagoya university and drexel university that will be used for clinical trials . indeed , the discovered advantages of ltp use may have an impact on changing the basic approaches to and concepts for hemostasis and minimally invasive surgery . this review describes the clinical benefits of ltp for hemostasis and ltp s underlying mechanisms . increasing the safety of surgery is closely linked with the availability of energy devices for hemostasis , such as high - frequency coagulation equipment ( hfce ) , laser coagulation equipment , ultrasonic coagulation equipment , and high temperature plasma coagulation equipment . their basic mechanism of inducing hemostasis is tissue ablation due to generated heat , and bleeding point shrinkage is induced by cauterized tissue . many efforts have been made to reduce the occurrence of associated the heat injuries , such as nerve paralysis and cartilage damage , which occur near the cauterized tissue with hemostatic electro - surgical equipment . however , based on the general concept of energy devices , it can be hard to establish new hemostatic instruments that do not cause heat injury . because ltp can stop blood flow by sealing the bleeding point without inducing heat injuries , it can be distinguished as a new energy device in surgery . importantly , the mechanism by which ltp stops bleeding is analogous to that of surgical hemostats , which is why it is feasible to use it to reduce heat injury , resulting in decreased invasiveness ( table 1 ) . based on results from a series of basic studies in plasma science , we have succeeded in developing ltp coagulation equipment that has a minimal risk for burn injury by reducing the plasma current that flows through the tissue . because the basic safety and essential performance requirements of a ltp coagulator are different from those of other energy devices , we are working with a group to make a consensus document for low - energy ionized gas coagulation equipment . the mechanisms underlying blood coagulation by ltp treatment were revealed by a series of studies by aist , nagoya university , drexel university , and others . we have summarized the effects on ltp equipment developed by each institute . an essential point is whether blood coagulation is confined to the blood coagulation system or extended to other blood components with or without hemolysis . drexel university reported that their equipment forms blood clots as a result of the coagulation of platelets and clotting proteins ( table 2 category i ) , while the nagoya and aist equipment formed clots from the other serum proteins such as albumin , fetuin , and immunoglobulin ( table 2 category ii ) . moreover , the aist equipment formed a membrane like clots from all of the blood components , including erythrocytes ( table 2 category iii ) . ltp treatment with the nagoya and aist equipment extended to other blood components in the coagulation system , in contrast to ltp equipment by drexel university and surgical hemostats that activate coagulation proteins . indeed , results of an experiment with albumin and immunoglobulin showed that the nagoya and aist equipment allowed protein aggregation . blood is composed of erythrocytes , leukocytes , platelets , and plasma . the difference between serum and plasma is based on the presence or absence ( decrease ) of coagulation proteins ( fibrinogen , prothrombin , factor v , factor viii ) , and they have in common that they contain proteins not involved in coagulation , such as albumin and immunoglobulin ( albumin comprises about 65% [ w / w ] of serum , and immunoglobulin comprises less than 20% [ w / w ] of serum ) . furthermore , ltp treatment can form clots that more stable than those formed by the activation of the coagulation system because of the coagulation materials from red blood cells . the vulnerability of clots is based on leaking the liquid components of red blood cells ( more than 45% of the blood s volume ) upon hemolysis , while they are stable when coagulated to membrane like clots by ltp treatment . we sought to establish a control method for blood clot formation in order to develop ltp coagulation equipment . our most recent studies demonstrated that the efficiency of clot formation was linked to the current flowing through the solution , described as the plasma current . albumin aggregation appeared where the ltp flare touches , over the threshold of the plasma current . based on this information , we then sought to determine the plasma current that could form a stable clot from protein solutions without rupturing ( fig . 2 ) . every second , so values that are too small can be brought to a suitable value by adjusting the discharge voltage . results from a series of experiments demonstrate that the plasma current value depends on the value of the discharge voltage and that the current value can be controlled arbitrarily by adjusting the discharge voltage . additionally , immobilization is dependent on a length of 10 mm between the sample and discharge tube ; a helium gas flow rate of 2 l / min ; and a 50 mg / ml sample of albumin ( sigma - aldrich , st . interestingly , an aggregation formed during plasma treatment returned into a solution when the discharge voltage was stopped at 6.3 kv ( fig . 3-a1 to -a6 and -b1 to -b6 ) , while the aggregation maintained its form when the discharge voltage was stopped at 7.4 kv ( fig . 3-e1 to -e6 and -f1 to -f6 ) . these results suggest that , when using albumin at a concentration of 50 mg / ml , a threshold value for clot formation exists between 6.3 kv and 7.4 kv . it is important to note that various proteins and concentrations have their own discharge voltage thresholds to form stable clots . we are developing a new plasma equipment system that will establish the ideal clot formation by measuring the plasma current and providing feedback so that the user can adjust the discharge voltage . we expect that the new system will be used in the field of surgical hemostasis , regenerative medicine , and/or drug development in the future . | low temperature plasma ( ltp ) coagulation equipment , which avoids causing burn injuries to patients , has been introducing into minimally invasive surgery .
the mechanism by which this equipment stops bleeding is to directly occupy the injury with the formed blood clots , and different from the mechanism of the common electrical hemostatic devices that cauterize the tissues around the bleeding to stem the blood flow .
a noteworthy point is that ltp treatment with our equipment is not confined only to the blood coagulation system , but it has significant effects on the other blood components to form clots with or without hemolysis , and that there is a plasma current threshold that determines whether the treatment makes stable clots . in this review ,
we introduce the clinical benefits of ltp current and describe the clot formation it facilitates . |
briefly , we injected 12 ng of morpholino into 4-cell stage x. laevis embryos to knock down rfx2 expression ; the morpholino sequence has been previously reported . we then prepared 100 animal caps ( ectodermal explants of stage 10 x. laevis embryos , dissected with forceps ) , both for control samples and rfx2 morphants , and cultured them until stage 20 . the stage of animal caps was estimated by comparison against embryos from the same clutch . total rna was collected using the trizol method , and then processed using a non - strand - specific illumina rna - seq library preparation kit with poly - a enrichment ( truseq v2 ) . we sequenced these libraries in a 2 50 bp paired - end configuration using an illumina hiseq 2000 . the x. laevis genome project was ongoing when we collected these data , so for this study we used a draft genome sequence ( jgi version 6.0 genome scaffolds ; available at ftp://ftp.xenbase.org/pub/genomics/jgi/xenla6.0/ ) and annotation ( oktoberfest version of putative transcripts , mainly derived from rna - seq de novo assembly and then confirmed against jgi version 6.0 genome scaffolds ; see http://www.marcottelab.org/index.php/xenla_oktoberfest for more details ) . all scaffolds and transcripts are available at xenbase ( ftp://xenbaseturbofrog.org/sequence_information/uta/ ) and our supplementary website ( http://www.marcottelab.org/index.php/chungkwon2013_rfx2 ) . because it is easier for gene - level expression analysis , we conducted rna - seq mapping against putative transcripts rather than the whole genome . using bowtie1 ( version 0.12.7 ) , we mapped our rna - seq reads to the oktoberfest models ( which contain 25,537 putative transcripts for each gene ) using the longest transcript model for each locus . then we used edger to identify differentially expressed genes , focusing on genes with greater than 2-fold difference and a false discovery rate less than 0.05 . one of the challenges in x. laevis rna - seq analysis is the presence of homoeologs , i.e. duplicated genes that arise as a result of allotetraploidy . using an allowance of 2 mismatches within a 50-bp read ( the -v 2 option in bowtie1 ) we used two datasets for this test : ( 1 ) 827 gene pairs previously identified by a variety of labs and curated at xenbase using an -a/-b gene name suffix , and ( 2 ) 2218 assembled est pairs identified as involved in a trio relationship with xenopus tropicalis
. as shown in fig . 1 , 6875% of reads we were particularly interested in the differential expression between wild - type embryos and rfx2 morphants . thus , in order to maximize the expression signals in our analysis , we allowed for all possible hits in mapping with the -a option ( i.e. interchangeably mapped reads would be counted twice ) , and then conducted differential expression analysis . ultimately we found no major differences in differential analysis between these approaches ( data not shown ) . out of 24,089 x. laevis transcripts detected in our rna - seq experiments , 3209 transcripts were down - regulated in the rfx2 knockdown condition , and 1523 transcripts were up - regulated . to perform functional network analysis using humannet , we converted these gene lists to human orthologs ( based on ensembl version 69 ) . note that initial orthology assignments are already captured by the x. laevis oktoberfest transcript gene names , because as part of the transcript set construction , all x. laevis protein sequence candidates were compared to the reference proteome of five different species ( human , mouse , zebrafish , chicken , and x. tropicalis ) for the purpose of assigning gene names consistent with the human orthologs . for homoeologs , if only one of two duplicated genes was determined to be significantly differentially expressed but not the other , we still assigned the corresponding human gene as being differentially expressed . after converting all x. laevis genes into human orthologs , we identified 2750 human candidate genes transcriptionally regulated by rfx2 . the detailed description of our chip - seq sample preparation has been previously reported . briefly , we injected mrna encoding gfp - tagged rfx2 into 4-cell stage x. laevis embryos and then pulled down the tagged protein with -gfp antibody ( ab290 ) from 600 whole embryos ( stage 20 ) . before immunoprecipitation , we cross - linked rfx2-genomic dna complexes with 1% formaldehyde and fragmented them with a branson 450 sonifier ( expected fragment size was from 200 to 500 bp ) . as a control , we injected gfp messenger rnas alone and conducted the same immunoprecipitation procedure . dna fragments were extracted with phenol chloroform and purified with a qiaquick pcr purification kit ( qiagen ) . sequencing libraries were prepared with a standard illumina genomic library construction kit ( truseq ) and sequenced with an illumina hiseq 2000 in 1 50 bp configuration . briefly , we injected 12 ng of morpholino into 4-cell stage x. laevis embryos to knock down rfx2 expression ; the morpholino sequence has been previously reported . we then prepared 100 animal caps ( ectodermal explants of stage 10 x. laevis embryos , dissected with forceps ) , both for control samples and rfx2 morphants , and cultured them until stage 20 . the stage of animal caps was estimated by comparison against embryos from the same clutch . total rna was collected using the trizol method , and then processed using a non - strand - specific illumina rna - seq library preparation kit with poly - a enrichment ( truseq v2 ) . we sequenced these libraries in a 2 50 bp paired - end configuration using an illumina hiseq 2000 . the x. laevis genome project was ongoing when we collected these data , so for this study we used a draft genome sequence ( jgi version 6.0 genome scaffolds ; available at ftp://ftp.xenbase.org/pub/genomics/jgi/xenla6.0/ ) and annotation ( oktoberfest version of putative transcripts , mainly derived from rna - seq de novo assembly and then confirmed against jgi version 6.0 genome scaffolds ; see http://www.marcottelab.org/index.php/xenla_oktoberfest for more details ) . all scaffolds and transcripts are available at xenbase ( ftp://xenbaseturbofrog.org/sequence_information/uta/ ) and our supplementary website ( http://www.marcottelab.org/index.php/chungkwon2013_rfx2 ) . because it is easier for gene - level expression analysis , we conducted rna - seq mapping against putative transcripts rather than the whole genome . using bowtie1 ( version 0.12.7 ) , we mapped our rna - seq reads to the oktoberfest models ( which contain 25,537 putative transcripts for each gene ) using the longest transcript model for each locus . then we used edger to identify differentially expressed genes , focusing on genes with greater than 2-fold difference and a false discovery rate less than 0.05 . one of the challenges in x. laevis rna - seq analysis is the presence of homoeologs , i.e. duplicated genes that arise as a result of allotetraploidy . using an allowance of 2 mismatches within a 50-bp read ( the -v 2 option in bowtie1 ) , we evaluated how many reads were mapped interchangeably between homoeologs . we used two datasets for this test : ( 1 ) 827 gene pairs previously identified by a variety of labs and curated at xenbase using an -a/-b gene name suffix , and ( 2 ) 2218 assembled est pairs identified as involved in a trio relationship with xenopus tropicalis
. as shown in fig . 1 , 6875% of reads we were particularly interested in the differential expression between wild - type embryos and rfx2 morphants . thus , in order to maximize the expression signals in our analysis , we allowed for all possible hits in mapping with the -a option ( i.e. interchangeably mapped reads would be counted twice ) , and then conducted differential expression analysis . ultimately we found no major differences in differential analysis between these approaches ( data not shown ) . out of 24,089 x. laevis transcripts detected in our rna - seq experiments , 3209 transcripts were down - regulated in the rfx2 knockdown condition , and 1523 transcripts were up - regulated . to perform functional network analysis using humannet , we converted these gene lists to human orthologs ( based on ensembl version 69 ) . note that initial orthology assignments are already captured by the x. laevis oktoberfest transcript gene names , because as part of the transcript set construction , all x. laevis protein sequence candidates were compared to the reference proteome of five different species ( human , mouse , zebrafish , chicken , and x. tropicalis ) for the purpose of assigning gene names consistent with the human orthologs . for homoeologs , if only one of two duplicated genes was determined to be significantly differentially expressed but not the other , we still assigned the corresponding human gene as being differentially expressed . after converting all x. laevis genes into human orthologs , we identified 2750 human candidate genes transcriptionally regulated by rfx2 . briefly , we injected mrna encoding gfp - tagged rfx2 into 4-cell stage x. laevis embryos and then pulled down the tagged protein with -gfp antibody ( ab290 ) from 600 whole embryos ( stage 20 ) . before immunoprecipitation , we cross - linked rfx2-genomic dna complexes with 1% formaldehyde and fragmented them with a branson 450 sonifier ( expected fragment size was from 200 to 500 bp ) . as a control , we injected gfp messenger rnas alone and conducted the same immunoprecipitation procedure . dna fragments were extracted with phenol chloroform and purified with a qiaquick pcr purification kit ( qiagen ) . sequencing libraries were prepared with a standard illumina genomic library construction kit ( truseq ) and sequenced with an illumina hiseq 2000 in 1 50 bp configuration . similar to the rna - seq data analysis , we conducted chip - seq analysis to discriminate between homoeolog genes . we applied a more stringent criteria for chip - seq read mapping , requiring uniquely mapped reads to the genome scaffold ( jgi version 6.0 ) and a maximum of 2 mismatches within the seed sequence ( i.e. the -m 1 -n 2 options in bowtie1 ) . for peak calling , we used macs ( version 1.4.2 ) with default options . we initially determined significant rfx2-bound peaks by using a false discovery rate ( fdr ) cutoff ( < 0.05 ) reported by macs . however , as shown in fig . 2 , only a few peaks demonstrated an fdr above 0.05 if the fold enrichment of the peak was greater than 20 , so we included these peaks as well in our further analysis . for each peak , we assigned the closest protein - coding gene as its target gene , so long as it was within 10 kb . most of these peaks were located less than 1000 bp from the transcript start site of their assigned gene , suggesting that , if anything , our criteria for associating chip - seq peaks to target genes were over - generous . out of 29,448 peaks identified in total , 6646 peaks were selected for further study that exhibited either an fdr < 5% or a fold - enrichment > 20 , and 5024 of those peaks were assigned to their neighboring genes . as with our rna - seq data analysis , we converted the 5024 x. laevis target gene ids to human genes , collapsing duplicated genes into a single human ortholog based on their names . this analysis resulted in a final set of 911 putative directly bound rfx2 target genes that also showed significantly differential gene expression after rfx2 knockdown . a list of all 911 genes is available in supplemental file 1 in our previous report . | recently , using the frog xenopus laevis as a model system , we showed that the transcription factor rfx2 coordinates many genes involved in ciliogenesis and cell movement in multiciliated cells ( chung et al . ,
2014 ) . to our knowledge , it was the first paper to utilize the genomic resources , including genome sequences and interim gene annotations , from the ongoing x. laevis genome project . for researchers who are interested in the application of genomics and systems biology approaches in xenopus studies , here
we provide additional details about our dataset ( ncbi geo accession number gse50593 ) and describe how we analyzed rna - seq and chip - seq data to identify direct targets of rfx2 . |
already back in 1850 , ignatz semmelweis was able to demonstrate in a spectacular manner that hand hygiene could prevent infections , but since then very few studies have been able to attest to the importance of hand hygiene in everyday practice . it is therefore all the more remarkable that in two studies of simple design , it has been possible to furnish proof of the influence of hand hygiene prior to insertion of peripheral venous catheters on the incidence of complications . both studies were conducted as practical exercises within the framework of the training course for infection control nurses in austria . using a questionnaire , hans hirschmann had the persons placing peripheral venous catheters record anonymously the following data : patient data , data and time of insertion , localization of insertion site , professional status of person placing the catheter ( physician , nurse , medical student ) , place catheter fitted ( or , ward , outpatient department ) , type of skin antisepsis ( exposure time to an alcohol - based skin antiseptic < 15 s or > 15 s ) , type of hand hygiene practiced before placement of the catheter ( no hygienic measure , handwashing , hygienic hand disinfection with an alcohol - based product , donning of non - sterile disposable gloves ) and , finally , the reason for catheter placement . on removing the peripheral venous catheter the person doing so now entered the following information on the same questionnaire : date and time of removal , reason for removal as well as complications ( redness , swelling , pain , fever of unknown origin , pus at insertion site , other reason ) . for the first study , 1148 questionnaires were completed in an austrian hospital . on the basis of the average consumption of peripheral venous catheters ( approx . 600 per week ) a data registration quota of approx . each patient received on average 1.4 peripheral venous catheters during their hospital stay , calculated on the basis of the number of patients and consumption of venous catheters . evaluation of the questionnaires revealed that there was a sharp increase in the incidence of complications in line with an increasing duration of the indwelling period of between 24 and 96 hours . the unexpected but conspicuous finding of this study was that in the case of catheters with an indwelling period of more than two days there were highly significantly lower complication rates in those cases in which hand disinfection was carried out or gloves donned before catheter placement . conversely , there was a higher rate of complications in those cases in which the hands were washed or hand hygiene measures dispensed without before placement . the findings of the first study gave rise , under the aegis of euridiki ( european interdisciplinary committee for infection prophylaxis ) , to the initiation of a further analogous study , so as to verify these remarkable findings regarding the influence exerted by hand hygiene prior to insertion of peripheral venous catheters on the incidence of complications . this study was also carried out as part of the training course for infection control nurses in parallel at three austrian hospitals , with the aforementioned questionnaires being completed and evaluated for a total of 1132 peripheral venous catheters . overall , 379 separate complications were recorded , with more than one complication being seen per catheter ( table 1 ( tab . 1 ) ) . the proportion of peripheral venous catheters implicated in complications was 24% . using uni- and multivariate analyses , various factors implicated in the complication rates 2 ) ) . there was a sharp rise in the relative risk of complications the longer the catheter was in place . for the period between 49 - 72 h and more than 72 h , the complication rates were significantly higher than those in the 0 - 24 h period . this finding lends credence to the demand that the duration of the indwelling period be limited in general to 2 - 3 days . catheters placed in the or during the patient s hospital stay showed a significantly lower risk of complications than those inserted on wards , or even in the outpatient department . the likely explanation for this is that already when entering the or sluice , hand hygiene measures are taken that have a positive effect on the complication rates . univariate analysis showed a significantly higher relative risk for venous catheter complications in patients older than 70 years compared with younger patients , but this was not the case for the multivariate analysis . is all probability this was due to the fact that in the case of patients younger than 70 years , only in 5% of cases did the duration of the catheter indwelling period exceed 72 h , whereas this was longer than 72 h for 13.8% of the catheters in the case of patients older than 70 years . as regards the role of hand hygienic measures prior to catheter insertion , it was possible to fully confirm the results of the first study . conductance of hygienic hand disinfection or donning of disposable gloves , as compared with normal hand washing or omission of hand hygienic measures , led to markedly lower complication rates , which proved to be significant in the uni- as well as the multivariate analysis . the most plausible explanation for this positive effect exerted by the wearing of disposable gloves or conductance of hygienic hand disinfection prior to catheter placement is that there was no recontamination during repalpation , as often seen , of the prepared venepuncture site . the study reported here was one of the chief reasons why the guideline drafted by the robert koch institute ( rki ) prevention of vascular - associated infections assigned hygienic hand disinfection prior to insertion of peripheral venous catheters to category i a ( recommendation based on well - designed experimental or epidemiological studies ) . specialist for hygiene ; head of austrian agency for health and nutrition safety , institute for microbiology and hygiene . gnther wewalka studied medicine at the university of vienna and received his doctoral degree there in 1971 . first he became assistant doctor at the institute for hygiene , and then changed to the professorship for chemotherapy of the 1 . medicinal university clinic until he went back to the institute of hygiene where he habilitated in 1981 . in 1987 he was appointed head of the federal bacteriological - serological analysis institute ( today : austrian agency for health and nutrition safety , institute for medicinal microbiology and hygiene ) in vienna . apart from this he is hospital hygiene consultant for the city of vienna , as an internationally respected hospital hygienist he is advisor for several hospitals , also a board member of the austrian society for hygiene , microbiology and preventive medicine ( ghmp from 2002 - 2004 chairman thereof ) , member of the task force influenza pandemieplan , member of the national committee for the eradication of polio and much more . the european task force on legionella - infections ( ewgli ) as well as all national associations and committees are highly benefiting from his special knowledge in this area . specialist for hygiene ; head of austrian agency for health and nutrition safety , institute for microbiology and hygiene . gnther wewalka studied medicine at the university of vienna and received his doctoral degree there in 1971 . first he became assistant doctor at the institute for hygiene , and then changed to the professorship for chemotherapy of the 1 . medicinal university clinic until he went back to the institute of hygiene where he habilitated in 1981 . in 1987 he was appointed head of the federal bacteriological - serological analysis institute ( today : austrian agency for health and nutrition safety , institute for medicinal microbiology and hygiene ) in vienna . apart from this he is hospital hygiene consultant for the city of vienna , as an internationally respected hospital hygienist he is advisor for several hospitals , also a board member of the austrian society for hygiene , microbiology and preventive medicine ( ghmp from 2002 - 2004 chairman thereof ) , member of the task force influenza pandemieplan , member of the national committee for the eradication of polio and much more . the european task force on legionella - infections ( ewgli ) as well as all national associations and committees are highly benefiting from his special knowledge in this area . | using two studies of a simple design it has been possible to furnish proof of the influence of hand hygiene prior to insertion of peripheral venous catheters on the incidence of complications . in the first study detailed data were collected anonymously for each patient on the procedure used for catheter insertion or on any complications .
data were collected for around 64% of patients in one hospital .
evaluation of the questionnaires revealed that there was a significant increase in the incidence of complications in line with an increasing duration of the indwelling period of between 24 and 96 hours .
the unexpected finding of this evaluation study was that in the case of catheters with an indwelling period of more than two days there were highly significantly lower complication rates in those cases in which hand disinfection was carried out or gloves donned before catheter placement .
the second study , based on the former , documented the cases giving rise to complications .
the proportion of peripheral venous catheters implicated in complications was 24% . here ,
too , there was a sharp rise in the risk of complications in line with the duration of the indwelling period .
catheters placed in the or during the patient s hospital stay showed a significantly lower risk of complications than those inserted on wards , or even in the outpatient department .
conductance of hygienic hand disinfection or the wearing of disposable gloves resulted in significantly lower complication rates compared to normal handwashing or omission of a hand hygiene measure .
the most plausible explanation for this positive effect exerted by the wearing of disposable gloves or conductance of hygienic hand disinfection prior to catheter placement is that there was no recontamination during repalpation , as often seen , of the prepared venepuncture site . |
a young male of 28 years of age presented with increased talkativeness , irritability , agitation , grandiose beliefs , decreased need for sleep for 1 month . he had a similar episode in past ( 8 years back ) ; though treatment details were not available for last episode , there was however no history suggestive of any significant side effects . there was no history of any psychiatric illness in the first and second degree blood relatives . the patient was diagnosed with bipolar affective disorder ( currently , manic episode with psychotic symptoms ) . in view of extreme agitation , he was given injectable haloperidol 10 mg and promethazine 50 mg intramuscularly in the emergency room . the next day patient had developed fever ( 101f ) along with muscle rigidity , altered consciousness , and fluctuating blood pressure and had raised creatinine phosphokinase ( cpk ) levels . the liver function tests were with in normal limits and the total leucocyte count was raised ( 12,800/mm ) with polymorphonuclear leukocytosis . the patient was diagnosed with neuroleptic malignant syndrome ( nms ) and offending drug was withheld . he was started on amantadine ( 100 mg / day ) , which was later on increased up to 400 mg / day . the symptoms of nms had been resolved in the next 4 - 5 days . however , with improvement of nms , his manic symptoms worsened and he had become more aggressive for which antipsychotic olanzapine was started at a dosage of 10 mg / day which was subsequently increased to 20 mg / day ( after 2 days ) . the patient had again developed fever with muscle rigidity , fluctuation in blood pressure and raised the cpk level . the patient was again started on amantadine on which he improved in next 3 - 4 days but with re - emergence of manic symptoms . in view of high propensity to nms , patient was given modified electroconvulsive therapy ( mect ) for control of his manic symptoms . he was given a total of eight mects , on which he had shown gradual improvement . after 2 weeks of resolution of nms , mood stabilizer lithium was started ( 600 mg / day ) and was gradually increased to 900 mg / day . antipsychotic quetiapine was also started in a low dose ( 50 mg / day ) and slowly increased to 500 mg / day over a period of 3 weeks . the patient had shown significant improvement and was discharged on lithium 900 mg / day and quetiapine 500 mg / day 5 weeks from admission . with the wide spread use of atypical antipsychotics the incidence of nms has been decreasing progressively and it has been estimated that 0.01% to 0.02% of patients develop this fatal adverse reaction on antipsychotics . nonetheless , clinician should remain vigilant particularly in patients more susceptible to development of nms . several factors such as agitation , physical exhaustion , dehydration , and pre - existing neurological deficits have been correlated with the incidence of nms . in the index case , rapid escalation of dose of olanzapine to 20 mg / day within 3 days and also the presence of extreme agitation that could have lead to dehydration , could have contributed to the development of nms . after resolution of nms , restarting antipsychotics could result in development of nms again in as many as 30% of patients . however , use of precautions like restarting antipsychotic only after 2 weeks of resolution of symptoms , use of atypical antipsychotics , gradual titration of dose , maintenance of adequate hydration could further decrease this possibility . in the index case , patient had initially developed nms on administration of intramuscular haloperidol and than developed nms on oral olanzapine . the case report also gives the message that when antipsychotics are restarted in a known case of nms , the dose should be gradually increased . in the index case , on one hand there was a need to control the aggressive disruptive behavior with aggressive pharmacotherapy and on the other hand , a recent episode of nms demanded judicious escalation in the dose of olanzapine . also , this report highlights that despite developing serious side effect on haloperidol and olanzapine , the patient tolerated quetiapine well , with no adverse reaction . this suggests that , patients who develop , nms on one atypical antipsychotic can still tolerate other atypical antipsychotics well . the patient was a young male , which itself is a potential risk factor for neuroleptic malignant syndrome . typical or first generation antipsychotics have high propensity to develop nms , which was again a risk factor . injectable preparations are more likely to develop nms and the risk further increases if given in bolus form or rapidly escalating dosing . in this patient , injectable preparation of haloperidol in bolus dose and rapid escalation of olanzapine ( 10 mg / day to 20 mg / day within 3 days ) might have contributed to the development of nms . extreme physical exhaustion and dehydration due to physical exhaustion were again , possibly contributors to the development of nms . quetiapine was started in a very low dose and gradually escalated with intensive monitoring for the side effects . the patient tolerated quetiapine well and his manic symptoms , including the aggressive disruptive behavior were also controlled well . existing literature , also reports relatively more cases of olanzapine - induced nms among other atypical antipsychotics . even though nms is also reported with quetiapine , it can be a good choice as an antipsychotic in patients with olanzapine induced nms . | neuroleptic malignant syndrome ( nms ) is a rare , severe and life threatening condition induced by antipsychotic medications .
it is commonly encountered with the use of first generation antipsychotics , however cases of nms have been reported with the use of second generation antipsychotics like olanzapine , risperidone , paliperidone , aripiprazole , ziprasidone , amisulpride , quetiapine and clozapine , though the incidence of such reports is rare .
due to decreased use of first generation antipsychotics , nms is reported less frequently now a days . in this case
report- we highlight the management issues of a patient suffering from bipolar affective disorder , who had developed nms following intramuscular injection of haloperidol , which was withdrawn and olanzapine was given later on .
the patient had again developed nms with olanzapine . finally the patient was managed with modified electroconvulsive therapy and discharged on lithium carbonate and quetiapine . |
herpes simplex virus-1 ( hsv-1 ) and hsv-2 which are dna viruses of alphaherpesvirinae subfamily and herpesviridae family , are the aetiological agent of hsv infections . these infections are among the infections most frequently encountered by humans , worldwide because humans are their only natural reservoirs , and no vectors are involved in their transmission . although , these viruses can infect both orofacial and pubic areas , hsv-1 predominates in the orofacial region while hsv-2 in the pubic region . it is a common worldwide affliction on which neither public health procedures , vaccines , nor antiviral chemotherapy have yet had a significant clinical impact . herpes labialis is a benign infective condition associated with the formation of vesiculo - ulcerative around the mouth which is often preceded by prodromal symptoms including pain , tingling and burning . although herpes labialis is generally associated with mild morbidity , frequent and/or severe recurrences remains a significant problem that impairs quality of life and impacts on healthcare consumption . rare complications like perioral scarring and depigmentation after healing of lesional areas may also occur . herpes labialis is usually caused by reactivation of the nonreplicating dormant hsv-1 and sometimes hsv-2 in the trigeminal nerve ganglia . however , it is the amplification of the preexisting activation that makes the condition , clinically visible . it has been reported that approximately one - third of patients who had initial hsv-1 viral infection undergo these recurrences at a rate of 14 recurrences per year which decrease after 35 years . on reactivation , the dormant virus in the trigeminal ganglion resumes multiplication then moves down the trigeminal nerve to the site of initial inoculation to infect the epithelial cells causing a herpes labialis and this is considered as ganglion trigger theory . the other , the skin trigger theory proposed by hill and blythe , holds that virus is continuously shed from neuronal endings and lesions develop when the susceptibility of the skin is sufficiently permissive for the development of a clinically apparent infection . this attests to the existing controversy concerning the mechanism of development of recurrent hsv infections . investigators have not fully elucidated the triggers that allow the virus to emerge from its dormant condition to cause a recurrence . nevertheless , several factors have been identified , such as ultraviolet light of both natural and artificial source as in sunlight and tanning beds , lip chapping , lip trauma or abrasion , fever , menstruation , fatigue , overexposure to wind , extremes of temperature , immunosuppression , dental procedures , iatrogenic trauma , dietary factor , upper respiratory tract infection , digestive problems , traveler 's diarrhea , decompression of the trigeminal nerve , pregnancy , physical and emotional stress . the diagnosis of herpes labialis is usually based on case history , clinical appearance and the location of the lesions in immunocompetent patients while confirmatory laboratory diagnosis in form of viral culture , polymerase chain reaction , serology , direct fluorescent antibody testing , or tzanck test may be necessary in immunocompromised patients . however , prompt recognition of herpes simplex infection and early initiation of therapy are of utmost importance in the management of the disease as prompt topical or oral antiviral therapy are quite effective in decreasing the severity and duration of herpetic episodes and contributes to the prevention of recurrence of herpes labialis . the review of the literature did not reveal any report of the prevalence of herpes labialis infection among both undergraduate and postgraduate dental healthcare providers . hence the objective of this study was to determine the prevalence and risk factors of self - reported herpes labialis among nigerian dental health providers the protocol for this study was reviewed and approved by the ethics and research committee of university of benin teaching hospital , benin city , nigeria . this cross - sectional study was conducted among nontobacco using final year dental students and dentists undergoing postgraduate training ( house officers and residents ) at university of benin teaching hospital , benin city , nigeria in june 20014 . all the final nontobacco dental students and dentists undergoing postgraduate training were included because of their small number . however , it was only those present during data collection that were assessed . the demographic information , lifetime and period ( previous year ) experience of the herpes labialis , perceived triggers and action taken during the last episode were obtained using a self - administered questionnaire . the questionnaires were administered to the undergraduates and postgraduates at a regular scheduled class and postgraduate seminar respectively . the data obtained were subjected to descriptive and binary regression statistics using statistical package for the social sciences ( spss version 17.0 , chicago , il , usa ) . in the binary regression analysis , lifetime experience of herpes labialis was the dependent variable while demographic characteristics were the independent variables . the protocol for this study was reviewed and approved by the ethics and research committee of university of benin teaching hospital , benin city , nigeria . this cross - sectional study was conducted among nontobacco using final year dental students and dentists undergoing postgraduate training ( house officers and residents ) at university of benin teaching hospital , benin city , nigeria in june 20014 . all the final nontobacco dental students and dentists undergoing postgraduate training were included because of their small number . the demographic information , lifetime and period ( previous year ) experience of the herpes labialis , perceived triggers and action taken during the last episode were obtained using a self - administered questionnaire . the questionnaires were administered to the undergraduates and postgraduates at a regular scheduled class and postgraduate seminar respectively . the data obtained were subjected to descriptive and binary regression statistics using statistical package for the social sciences ( spss version 17.0 , chicago , il , usa ) . in the binary regression analysis , lifetime experience of herpes labialis was the dependent variable while demographic characteristics were the independent variables . the majority of the participants were > 28 years , male , single , postgraduate healthcare workers , those without self - reported chronic medical condition and negative family history of herpes labialis [ table 1 ] . the lifetime prevalence was significantly associated with marital status , professional status and family history of herpes labialis . however , in binary regression , it was only marital status and family history of herpes labialis that were the determinants of this lifetime prevalence [ table 2 ] . a total of 6 ( 85.7% ) of participants that reported herpes labialis in the last 12 months had it , once while 1 ( 14.3% ) of them had it , 4 times [ table 3 ] . the participants reported more than one perceived trigger factors and the most common trigger factors reported for the last episode of herpes labialis were fever ( 61.9% ) , malaria ( 28.6% ) , fatigue ( 28.6% ) and stress ( 28.6% ) [ table 4 ] . the actions taken by participants for the last episode of herpes labialis were using drugs without prescription ( 14.3% ) , application of lubricant ( 23.8% ) , nothing ( 57.1% ) and could not remember ( 4.8% ) [ table 5 ] . demographic characteristics of the participants lifetime prevalence of herpes labialis among the participants the frequency of herpes labialis among the participants in the last 12 months perceived triggers for the last episode of herpes labialis among the participants action taken by the participants during the last episode of herpes labialis the prevalence of hsv infection worldwide has increased over the last several decades making it , a major public health concern . in this study , the lifetime prevalence was 22.1% . this falls within the lifetime seroprevalence of 2080% . this is lower than 52.5% reported among turkish nursing and midwifery students , 30.2% among ghanaian and south african health science undergraduates about four decades ago and 26.4% among jordanian university students . this lower lifetime prevalence in present study may be due to the fact that all the dental healthcare providers in this study were nontobacco users . the socioeconomic status , race , and culture which are correlated with hsv infection may have differed in participants in this study with the compared studies thereby explaining the difference in the lifetime prevalence . the lifetime prevalence was significantly associated with marital status , professional status and family history of herpes labialis . however , the determinants of lifetime prevalence of herpes labialis were only marital status and family history of herpes labialis . this indicates that marital relationship and relationship in family increases contact and possibly the infectivity potential as both herpes viruses are transmitted across epithelial mucosal cells , as well as through skin interruptions . they then migrate to nerve tissues , where they persist in a latent state until activation by appropriate trigger . the higher prevalence of fever and malaria in married participants and those with positive family history of herpes labialis which were the dominantly reported triggers in this study may be an additional explanation [ table 4 ] . a noted common characteristic of herpes labialis is recurrence which may be frequent or infrequent . it has been reported that approximately one - third of patients who had initial hsv-1 viral infection undergo recurrences at a rate of 14 recurrences per year which then decrease after 35 years . in this study , the annual prevalence of herpes labialis was 7.4% and the majority experienced it once while a few , more than once in the last 12 months . report that stated that most patients experience < 2 episodes of herpes labialis per year while 510% may experience 6 occurrences per year . this also indicates that herpes labialis occurs only in a subset of patients that have suffered primary hsv infection . antibodies to hsv-1 and hsv-2 increase with age starting in childhood and adolescence respectively reaching 5080% in different socioeconomic status at the age of 30 years . in the absence of cure and vaccine to prevent or eliminate the herpes infection at the moment , recurrence of herpes viral infection , most commonly as herpes labialis will occur in the presence of appropriate triggers because herpes virus have unique ability the virus to establish latency and undergo subsequent recurrence . the most common trigger factors reported by the participants for the last episode of herpes labialis in this study were fever , malaria , fatigue and stress . it is not surprising that fever topped the reported trigger factors as infections that manifest as fever are very common in developing country like nigeria . malaria which is a specific and common fever causing condition was the second most common reported trigger among the participants . it has been reported that malaria can contribute to hsv-1 reactivation in the oral cavity by profoundly affecting the host immune system by mediating at the same time immunosuppression and immune hyper - activation . the rating of fatigue and stress as the third and fourth common triggers respectively were noted and thereby confirms the widely documented stressful nature of dentistry . the higher state anxiety and increased daily hassles and stressful life events have been found to influence herpes labialis and the suggested biologic mechanism is through the modulations of t - lymphocyte function . treatments are available to reduce viral reproduction and shedding , prevent the virus from entering the skin , and alleviate the severity of symptomatic episodes . the treatment can be episodic or suppressive , depending upon the frequency and severity of episodes . in episodic therapy , it is essential that patients recognize prodromal symptoms for immediate self - medication . in this study , although further assessment of the drugs were not done but they are likely analgesics and antibiotics which are the most common self - medicated drugs among dental healthcare providers which would have been taken to control associated pain and prevent secondary bacterial infection . the use of lubricant will help in reducing discomfort associated with the condition and may also be helpful in preventing perioral scarring which is a rare complications of herpes labialis . however , the usual mildness of symptoms and the self - limiting nature of the condition may explain why more than half ( 51.7% ) of the participants that had herpes labialis did nothing . although the findings of this study may be limited by the fact that it is self - reported and could have be influenced by recall bias , assessment of prevalence using this method is acceptable in diseases with classical clinical presentation such as herpes labialis and can serve as baseline data which be compared with findings of other epidemiological studies that used the same study model . data from this study revealed herpes labialis as a significant problem among the studied population . the reduction of fever inducing infections , stress and fatigue which were major triggers will help decrease herpes labialis among this group . | introduction : the epidemiology of herpes labialis has been relatively neglected .
the objective of this study was to determine the prevalence and risk factors of self - reported herpes labialis among nigerian dental health providers.materials and methods : this cross - sectional study of final year dental students and dentists undergoing postgraduate training at university of benin teaching hospital , benin city , nigeria was conducted in june , 2014 .
the demographic information , lifetime and period ( previous year ) experience of the herpes labialis , perceived triggers and action taken during the last episode were obtained using a self - administered questionnaire.results:the annual prevalence of herpes labialis was 7.4% while the lifetime prevalence was 22.1% .
the lifetime prevalence was significantly associated with marital status , professional status and family history of herpes labialis . however , in binary regression , it was only marital status and family history of herpes labialis that emerged as the determinants of this lifetime prevalence .
the most common trigger factors reported by the participants for the last episode of herpes labialis were fever , malaria , fatigue and stress .
the actions taken by participants for the last episode of herpes labialis were using drugs without prescription ( 14.3% ) , application of lubricant ( 23.8% ) , nothing ( 57.1% ) and could not remember ( 4.8%).conclusion : data from this study revealed that one out of fourteen and one out of five every studied dental healthcare providers had experienced herpes labialis in the last 12 months and their lifetime respectively .
the reduction of fever inducing infections , stress and fatigue which were major triggers will help decrease herpes labialis among this studied group . |
the etiology of folliculitis is complex and in a given case several factors may contribute including infection , physical irritation , occlusion , other skin diseases and drugs . among drugs , however , the role of the native glucocorticoid , cortisol , as a regulator / dampener of potential inflammatory reactions in the hair follicles is unknown . here we report a case of treatment - resistant folliculitis which resolved after recognition and treatment of low cortisol due to adrenal insufficiency . a 40-year - old man was admitted to our clinic with folliculitis which he had suffered from for at least 2 years . besides genital condyloma he had a medical history of psychological problems , tiredness , low libido and lower back pain . as a supplement to body building , he had used anabolic steroids a short period of time more than 15 years before the debut of folliculitis . three years before the debut of folliculitis , he was involved in a traffic injury , accelerating all his symptoms . this led to an abuse of cocaine and amphetamine for 4 years , whereafter he was diagnosed with attention deficit and hyperactivity disorder and treated with methylphenidate . at this time clinically , he presented a superficial folliculitis with inflamed red hair follicles with surface pustules . the skin changes were found on the scalp , face , upper trunk , thighs and pubic area . at first , the patient was treated with long - term courses ( up to 6 months ) of oral tetracycline supplemented with regimes of topical antifungals ( ketoconazole shampoo 2% ) and , on separate occasions , short regimes of topical glucocorticoid ( hydrocortisone-17-butyrate and betamethasone with clioquinol , respectively ) . all initiated treatments were found to be remarkably insufficient in this patient with little or no effect on clinical findings . a skin biopsy from the back of the upper trunk was performed which showed suppurative folliculitis , primarily involving the infundibular portions of the hair follicle . periodic acid - schiff stain revealed numerous oval yeast - like organisms , thus compatible with malassezia furfur folliculitis ( fig 1 , fig 2 ) . systemic antifungal treatment included itraconazole 100 mg per day for 2 weeks with no clinical response . treatment with fluconazole , at first 150 mg every week for 8 weeks , followed by 300 mg every week for 8 weeks , showed some response , but with persisting folliculitis in the beard area . courses of systemic glucocorticoids given by the patient 's general practitioner allegedly showed good effect . however , such treatment was tapered or discontinued at the follow - ups in our clinic . two years after admission to our clinic , the patient was admitted to the department of endocrinology , odense university hospital , odense , denmark . blood tests showed low testosterone ( 3.8 nmol / l ) , low testosterone / sex hormone - binding globulin ( 0.09 ) and low luteinizing hormone ( 0.6 ui / l ) compatible with hypogonadotropic hypogonadism . also the cortisol level was low ( spot cortisol 74 nmol / l ) , with adrenocorticotropic hormone being low in the normal reference interval . several factors were suspected to have caused suppression of the pituitary gland ( use of amphetamine / cocaine , anabolic steroids , traffic injury , and use of morphine ) and therefore the exact time of onset could not be said . at first , he was given testosterone for 1.5 months without any observable effect on his skin symptoms . however , when he received both testosterone and hydrocortisone his folliculitis resolved completely in less than a month , and still after 2 years there has been no severe relapse ( fig 3 ) . pituitary insufficiency can cause isolated or multiple affection of hormonal production . in this patient , both the level of testosterone and cortisol was low . normalizing the level of testosterone did not have any effect on his skin , but shortly after hydrocortisone substitution his folliculitis resolved . it is well known that acneiform eruptions can be side effects to both systemic and strong topical glucocorticoid treatment . systemic glucocorticoid suppresses the hypothalamus - pituitary - adrenal ( hpa ) axis resulting in a reduction in endogenous cortisol production and thereby low circulating cortisol level . topical glucocorticoid also suppresses the hpa axis , although at a physiological level , and only pathologically when exceeding accepted safety guidelines . to our knowledge , it is unknown whether the low level of endogenous cortisol plays a role in the pathogenesis of acneiform eruptions during glucocorticoid treatment besides the possible direct effect of the glucocorticoid drug . studies on the direct effect of topical glucocorticoids on the development of acneiform eruptions suggest that acne is provoked by inducing rupture of the follicle where sebum seeps into the dermis . also keratinization and suppuration of follicular epithelium has been suggested as pathogenesis of glucocorticoid - induced acneiform eruptions . however , these studies are few and it remains unclear whether the previously described physiological suppression of the hpa axis is involved in the pathogenesis of topical glucocorticoid - induced acneiform eruptions . in conclusion , this case report suggests that low levels of cortisol may play a role as modifier of the inflammatory component of folliculitis and thus the pathogenesis of at least certain types of folliculitis . the authors report no conflicts of interest . there was no funding of this work . | a report on a 40-year - old patient with recalcitrant , suppurative folliculitis is presented .
after years of unsuccessful treatment with conventional therapies , the patient was diagnosed with adrenal insufficiency with a low level of circulating cortisol .
a few weeks after the patient was subjected to substitution therapy with hydrocortisone , his folliculitis resolved .
we discuss the role of plasma cortisol level in the pathogenesis of folliculitis . |
although individuals younger than 40 years of age account for only 3% of all patients with coronary heart disease ( chd)1 and also myocardial infarction ( mi ) mainly occurs in individuals older than 45 years old , the young are not completely immune from these cardiac diseases.2 the causes of mi among patients aged less than 45 years can be divided into four groups : 1 ) atheromatous coronary artery disease ( cad ) ; 2 ) non - atheromatous coronary artery abnormalities ; 3 ) hypercoagulable states ; and 4 ) mi secondary to substance misuse.2 cigarette smoking appears to be the most common risk factor for heart disease,35 and a positive family history of cad ( defined as the occurrence of premature cad in a first - degree relative ) is a major risk factor for mi in young individulas.6 the prevalence of a positive family history among these patients ranges from 14% to 69%.1 siblings of a young patient with mi have up to a tenfold increased risk of developing cad,7 and approximately half of young patients with mi have single - vessel coronary disease.4 we herein introduce a very young patient with extensive premature cad without congenital heart abnormality , hypercoagulable state , substance misuse , and traditional risk factors ( except for a positive family history of premature cad ) who underwent coronary artery bypass grafting ( cabg ) at tehran heart center . the patient illness had started one month before admission with an onset of acute mi . he was 71 kg in weight and 180 cm in height , which meant that his body mass index ( bmi ) was in safe limits ( 21.91 kg / m ) . risk factors such as diabetes , smoking , obesity , and dyslipidemia were not seen in his history , but his family history for chd was positive . his father had died at 38 years of age because of sudden cardiac death and his mother was a known case of ischemic heart disease . the patient had no history of the use of legal or recreational drugs , and his family history was negative for any hereditary or metabolic disorders . the results of laboratory tests conducted on admission were as follows : normal complete blood count ( white blood cell [ wbc ] = 6600 / mm , red blood cell [ rbc ] = 5.39 10 / mm , hemoglobin [ hgb ] = 16.1 mgr / dl , and hematocrit [ hct ] = 45.7% ) ; normal hepatic transaminases ( alanine aminotransferase [ alt ] = 29 iu / l and aspartate aminotransferase [ ast ] = 20 iu / l ) ; normal - range blood serum electrolytes ; total cholesterol of 126 mg / dl ; triglyceride of 92 mg / dl ; high - density lipoprotein ( hdl ) of 26 mg / dl ; low - density lipoprotein ( ldl ) of 84 mg / dl ; very low - density lipoprotein ( vldl ) of 18.4 mg / dl ; ldl / hdl ratio of 3.2 ; and cholesterol / hdl ratio of 4.8 . additionally , creatine kinase mb ( ckmb ) and troponin on the day before surgery were 5.41 ng / ml and less than 3 the patient s blood group and rh was o positive . on physical examination , the patient s blood pressure was 105/80 mmhg with a heart rate of 100 beats per minute . in heart auscultation , echocardiography demonstrated a left ventricular end diastolic volume ( ldedv ) of 96 cc , left ventricular end systolic volume ( lvesv ) of 48 cc , and ejection fraction ( ef ) of 42% . furthermore , there was an abnormal septal motion , hypokinesia , in the septal wall and the mid - portion of the anteroseptal wall . three other coronary arteries , i.e. the left anterior descending artery , diagonal 1 artery , and right coronary artery , had severe stenosis ( figures 1 & 2 ) . the left circumflex coronary artery was patent , and the ef based on angiography was 45% . two days after surgery , laboratory tests revealed ckmb of 4.74 ng / ml and troponin of 437.7 mcg / l . on postoperative electrocardiography , the st segment was slightly elevated in leads ii , iii , avf , v5 , and v6 . the patient was discharged from the hospital in good healthy condition five days after surgery . postoperative follow - up of the patient , conducted one year later , showed that he was still symptom free and that he had no traditional risk factors other than a positive family history of premature cad . fortunately , its incidence is not common in individuals younger than 45 years of age . however , the disease carries significant morbidity , psychological effects , and financial constraints for the person and the family when it occurs at a young age . the protection offered by young age has been gradually eroded by the increased prevalence of risk factors for chd in adolescents such as smoking , obesity , and lack of physical activity.2 the risk factors of cad are no different between individuals younger or older than 40 years old , but the increased incidence of a positive family history of cad and lipid abnormalities in younger individuals with early onset coronary atherosclerosis renders them unique.8 about 40% of young cad patients have a first - degree relative with premature atherosclerosis.9 although for a long time a family history of ischemic heart disease has been deemed a main risk factor a risk factor for developing cad in patients,10 , 11 there are two different viewpoints about this concept : some researchers strongly believe that dominancy of a family history of cad in a family is accompanied by other risk factors like hypertension and hyperlipidemia12 , 13 whereas others maintain that a family history is an independent risk factor and its presence is not necessarily related to the other factors.14 in our patient , the only detectable traditional risk factor was a positive family history of premature cad . he was a normotensive , non - diabetic , non - smoking , and non - hyperlipidemic patient . also , he had no congenital heart disease and hypercoagulable state , and nor was he a drug abuser . emotional stress and aggressive nature in the young age group are thought to be related to the prevalence of cad.15 the cardia study offered an explanation for the association between aggression and chd mortality.16 acute physical or emotional stress increases shear forces and thus causes a previously non - significant plaque to rupture , triggering acute mi.17 the classic presentation of worsening angina culminating in mi is rare in younger patients . the first onset of angina that rapidly progresses to fully evolved mi is often the case in patients less than 45 years of age.2 in our patient , mi was the first presentation of his coronary problems too . as secondary prevention , antiplatelet agents such as aspirin and clopidogrel should be used as per the guidelines for adults . statins should invariably be prescribed in all patients with mi insofar as their clinical effects extend beyond lipid lowering . statins are believed to stabilize plaques in patients with atheromatous chd , thereby improving their outcome and reducing recurrent events.2 in patients with established mi , exercise stress testing could well be a useful tool for risk stratification . echocardiographic assessment of the lv function should be done in all patients . however , angiographic assessment has a defining and leading role for deciding about the next step in a patient management program.2 it is advisable that cabg be offered to patients with triple - vessel disease , complex coronary artery abnormalities , and impaired lv function . cabg is believed to confer better results in young patients : survival rates of 92% at five years and 86% at ten years , which are significantly better than 75% and 58% for patients over a positive family history of cad can be deemed a very important risk factor for developing premature cad and patients with this predisposing risk factor should be treated more conservatively and diagnostic measures must be considered more frequently when there is a possibility of premature cad . | although coronary artery disease ( cad ) is not common among individuals younger than 4045 years of age , a small percentage of this age group needs to undergo surgical revascularization because of cad . why some people are at higher risk of developing premature cad is not clearly known .
increased number of traditional risk factors or genetic predisposition may play significant roles in this regard.a 22-year - old man with a negative history for all traditional risk factors except for a family history of premature cad referred to our center due to an episode of myocardial infarction of one month s duration .
he had no congenital heart disease and no hypercoagulable state , and there was a negative history of drug abuse.his coronary angiography showed extensive cad .
he underwent coronary artery bypass grafting and he left the hospital in good healthy condition .
one year after surgery , his follow - up showed that he was symptom free and he still had no new traditional risk factor .
it seems that a positive family history of premature cad is an important and independent risk factor for developing premature cad and individuals with this type of history should be treated more cautiously . |
are generally caused by inadequate production due to suppression of bone marrow by hiv infection through abnormal cytokine expression and alteration of the bone marrow microenvironment . we present a series of bone marrow abnormalities in hiv infected children who presented with anemia . a 7-year - old boy presented with pain in limbs since two years , recurrent otorrhea since one year , cough since four months , breathlessness since eight days and edema of feet since two days . he was diagnosed as having pulmonary tuberculosis ( tb ) two months back and was on direct observed therapy ( dots ) for same . on examination he had severe pallor with anasarca and clubbing grade iii with generalized papular dermatitis with left ear purulent discharge and oral thrush . systemic examination revealed cardiomegaly with gallop rhythm , hepatosplenomegaly and decreased air entry in left infrascapular region . hemogram showed severe anemia ( hemoglobin = 1.9 gm / dl ) with thrombocytopenia ( 30,000.cumm ) , normal wbc count and esr of 130 mm at end of one hour . x - ray chest showed left midzone and lower zone haziness and sputum for afb on smear was positive . he was treated with iv antibiotics , antituberculous therapy , blood transfusion and dobutamine infusion ; however he succumbed to his disease after seven days of admission . a three and a half year old girl presented with fever , cough and breathlessness since one year and skin dermatitis since six months . both parents were hiv infected and mother had died due to tb three months back . the child along with elder sister were diagnosed hiv infected recently by two different hiv elisa kits . on examination , she was malnourished , had severe pallor with chalky white nails , chronic papular dermatitis and generalized lymphadenopathy . her investigations showed anemia ( hemoglobin = 3.1 gm / dl ) with normal wbc and platelet count . she was treated with blood transfusion and advised regarding antiretroviral therapy which was refused due to non - affordability . a 7-year - old boy presented with injury to right elbow 25 days back while playing following which after 10 days , he developed pain in the right elbow with swelling and went to a doctor who diagnosed it to be a fracture and a plaster was applied . after two days , he had fever which subsided with sulfamethoxazole / pyrimethamine . at that time , subsequently increasing pallor was noticed was the past eight days . on examination , he was pale , had tachycardia with bilateral basal crepitations , cardiomegaly and hepatosplenomegaly with healed herpetic lesion over right groin . hiv elisa positive and confirmed by western blot test . a bone marrow aspiration showed erythroid hyperplasia with increased plasma cells and biopsy showed myelofibrosis . no organisms were grown on bone marrow culture and it was negative for tel / amli or mll translocations or monosomy 7 . a 7-year - old boy presented with pain in limbs since two years , recurrent otorrhea since one year , cough since four months , breathlessness since eight days and edema of feet since two days . he was diagnosed as having pulmonary tuberculosis ( tb ) two months back and was on direct observed therapy ( dots ) for same . on examination he had severe pallor with anasarca and clubbing grade iii with generalized papular dermatitis with left ear purulent discharge and oral thrush . systemic examination revealed cardiomegaly with gallop rhythm , hepatosplenomegaly and decreased air entry in left infrascapular region . hemogram showed severe anemia ( hemoglobin = 1.9 gm / dl ) with thrombocytopenia ( 30,000.cumm ) , normal wbc count and esr of 130 mm at end of one hour . x - ray chest showed left midzone and lower zone haziness and sputum for afb on smear was positive . he was treated with iv antibiotics , antituberculous therapy , blood transfusion and dobutamine infusion ; however he succumbed to his disease after seven days of admission . a three and a half year old girl presented with fever , cough and breathlessness since one year and skin dermatitis since six months . both parents were hiv infected and mother had died due to tb three months back . the child along with elder sister were diagnosed hiv infected recently by two different hiv elisa kits . on examination , she was malnourished , had severe pallor with chalky white nails , chronic papular dermatitis and generalized lymphadenopathy . her investigations showed anemia ( hemoglobin = 3.1 gm / dl ) with normal wbc and platelet count . she was treated with blood transfusion and advised regarding antiretroviral therapy which was refused due to non - affordability . a 7-year - old boy presented with injury to right elbow 25 days back while playing following which after 10 days , he developed pain in the right elbow with swelling and went to a doctor who diagnosed it to be a fracture and a plaster was applied . after two days , he had fever which subsided with sulfamethoxazole / pyrimethamine . at that time , subsequently increasing pallor was noticed was the past eight days . on examination , he was pale , had tachycardia with bilateral basal crepitations , cardiomegaly and hepatosplenomegaly with healed herpetic lesion over right groin . hiv elisa positive and confirmed by western blot test . a bone marrow aspiration showed erythroid hyperplasia with increased plasma cells and biopsy showed myelofibrosis . no organisms were grown on bone marrow culture and it was negative for tel / amli or mll translocations or monosomy 7 . the common bone marrow abnormalities in hiv infected adults reported are marrow hypocellularity , myelodysplasia and poor marrow recovery . dysmegakaryocytopoiesis and dyserythropoiesis have been frequently reported . similarly in our patients , dyserythropoiesis and dysmegakarytopoiesis were seen individually . similarly , our first patient had aids and had a hypoplastic marrow on examination and his disease was fatal . however , the most characteristic and early bone marrow abnormality seen is in the megakaryocytes which may be responsible for early sclerosis of the bone marrow . however , such abnormalities were not seen in our patients . plasma cells are also numerous and activated implying an immune response as was seen in patient 3 . mechanisms leading to these changes include direct hiv effect on marrow progenitor cells , effect of drugs and other infective diseases along with alteration in il-6 and g - csf and malignancies . the hiv - ic subtype which is commonly present in indian population can directly infect cd34 + hematopoietic progenitors . this is supported by an african study which showed that hiv - infected children with severe anemia had 33% fewer cd34 + hematopoietic progenitors and 35% less erythroid progenitors in their bone marrow than uninfected children . they found that proportion of more mature erythroid precursor cells in bone marrow or peripheral blood ( reticulocytes ) did not differ between the two groups , suggesting that hiv - uninfected children had less efficient later stages of erythropoiesis than hiv - infected children suggestive that there is less dyserythropoiesis and apoptosis in hiv - infected children . similarly in our case series , dyserythropoiesis was seen in only one patient whereas other forms of marrow suppression were seen in patients who died . for treatment of these cytopenias , optimal treatment of hiv infection supportive care of anemia includes use of erythropoietin in addition to red blood cell transfusion . therapy for neutropenia includes use of myeloid growth factors g - csf and gm - csf . art in these patients may have a variable response as has been reported earlier . in our patients , those with advanced disease succumbed to their illness whereas the one with dyserythropoiesis did well on art . | bone marrow abnormalities in hiv infected adults include hypocellularity , myelodysplasia and poor marrow recovery .
data in children is limited .
we report a series of three hiv infected with varied bone marrow abnormalities .
first child was a 7-year - old boy with pulmonary tuberculosis , anemia , thrombocytopenia and bone marrow examination showed hypoplastic marrow .
he succumbed to his disease within seven days of hospitalization .
second child was a three and a half year old girl who had severe anemia and her bone marrow examination showed dyserythropoiesis .
third child was a 7-year - old boy who had splenic abscesses and pancytopenia and bone marrow examination showed myelofibrosis with increased plasma cells .
he also succumbed due to a fatal pulmonary bleed .
thus , advanced hiv disease in children can lead to bone marrow suppression in form of hypoplasia or myelofibrosis which can be fatal . |
the variable pulse of the magnetic stimulation device enables a diagnosis of various diseases that are difficult to diagnose or treat [ 1 , 2 ] . the human body absorbs the magnetic pulse of the magnetic stimulation device and forms a local eddy current [ 35 ] . the temperature increase varies according to the treatment or diagnostic processes because the formation of an eddy current depends on the magnetic pulse intensity and human immunological characteristics [ 2 , 6 , 7 ] . therefore , more sophisticated treatment and diagnosis can be realized by appropriately controlling the pulse intensity and subsequent increase in temperature . the existing sinusoidal - stimulation treatment pulse forms are unable to appropriately address diverse treatments and diagnoses because different intensities , pulse widths , and pulse forms are needed for each treatment and diagnosis . the magnetic stimulation device has a large stimulation coil capacity because the stimulation frequency must vary according to its purpose . it forms a magnetic field in pulse form and generates an eddy current in the human body . this performance requires a power supply , high - voltage resistance , high repetition , high - speed switching element , and wide range of control techniques . therefore , the limitation of the treatment and diagnosis based on a sinusoidal pulse form can be overcome by controlling the pulse intensity , width , and form of the magnetic stimulation device where necessary . this paper proposes a new sequential discharge method to freely change the pulse width . in this method , the at80s8535 one - chip microprocessor technology of the avr system and pfn were combined to actively superpose one , two , three , and four - stage circuits and produce high - voltage pulse forms with diverse pulse widths . figure 1 shows a schematic diagram of the magnetic - stimulation device , which consists of the stimulation coil part , power supply , and controller . the long cylindrical form was wound with a coil in a loop type to efficiently deliver the current pulse discharged from the capacitor . continuous operation of the stimulation device can result in heating of the refrigerant in the stimulation device and stimulation coil , as well as a spatial change in penetrability due to the effect on the overall temperature distribution . the most important part of the high - voltage flyback converter is that it has a high turn ratio between the primary and secondary sides to generate a high voltage . this parasitic capacitance generates parasitic resonance of the converter current and voltage under the transient state , increases the current stress in the switching device , and limits the converter switching frequency . therefore , a soft - switching technique , zero - current switching ( zcs ) , was employed in this study to reduce the effect of parasitic capacitance of the secondary side . irg4ph50ud and ei40 ( tdk ) most of the existing stimulation pulse forms for diagnosis and treatment are sinusoidal , which limits the range of treatments . this limitation in the treatment and diagnosis based on the sinusoidal pulse form can be overcome by controlling the pulse intensity , width , and form of the magnetic stimulation device where necessary . multiple energy pulses in a magnetic stimulation device result in deeper penetration and produce better results than a single energy pulse at the same average output . figure 1 shows a sequential discharge control type stimulation device , to which diverse pfn methods were applied . when the scr sc is turned on , the energy is charged in the capacitor of pfn . if s1 , s2 , s3 , and s4 are turned on sequentially for meshes 1 , 2 , 3 , and 4 , respectively , the device begins the operation . the energy stored in the capacitor of the pfn is transferred to the stimulation coil for its action . the stimulation coil can work in a range of ways as a single or multiple - mesh circuit . this circuit has the desired current pulse when the charged energy is transferred to the stimulation coil . equation ( 1 ) shows the energy stored in the capacitance c
( 1)eo=12cvo2 . the power consumption of a magnetic stimulation device can be expressed as
( 2)p = ft(e) ,
where ft is the pulse train frequency , e is the energy dissipated per pulse , and is the capacitor charger efficiency
( 3)e=12i=1ncvci2(t=0)12i=1ncvci2(ttp ) . it is assumed that the capacitor charger is turned off or contributes a negligible amount of charge during the pulse . the stimulating coil temperature is proportional to square of the coil current integrated over the pulse duration , which is sometimes called the load integral
( 4)stimcoil=0ttpi2dt=0tpi2dt+tpttpi2dt . a single - mesh pfn generates sinusoidal pulses but a multiple - mesh pfn generates square wave pulses with similar peak and average powers . the at80s8535 one - chip microprocessor technology of the avr system and pfn were combined to actively superpose 1 ~ 4 stage circuits and to produce high - voltage pulse forms with a range of pulse widths . the power characteristics of the stimulation treatment pulse were examined according to the trigger signal delay applied to the switch at each stage by applying a wide range of superposition pulses to the magnetic stimulation device , which is used widely in industry and medicine . figure 2 shows an scr time control circuit , which consists of an avr one - chip microprocessor . the control circuit has four parts : ( 1 ) a keyboard that inputs the time control , ( 2 ) a lcd device that indicates the input time state , ( 3 ) an avr microprocessor ( atmel ) , which is the core of the control circuit , and ( 4 ) an amplification circuit that turns on the scr . the delay data inputted via the keyboard is transferred to the avr , which outputs a range of signals according to the predefined program . one signal from the avr is the lcd display signal , and the other is the trigger signal , which triggers the scr in the pulse - power - switching circuit according to the desired delay time . the variable range for scr1-scr2 , scr2-scr3 , scr3-scr4 , and scr4-scr5 was 0 ~ 500 s in 100 s increments . the energy stored in the capacitor of each pfn circuit was applied to the stimulation coil through the switching of the scr . the energy stored in the capacitor of each pfn circuit was applied sequentially with a specific delay . the current waveform of the stimulation coil was measured while changing the delay of the trigger conducting the angle of each scr from 0 to 500 s . the current and voltage were measured using a high - voltage probe of ( probe x 6,000 v , lecroy ) and a rogowski current waveform transducer ( cwt , penmuk ) . assuming no loss from the resonance or discharge circuit , there will be no change in vc at the start and end of the discharge . on the other hand , a loss is generated due to the electric resistance of the magnetic field generation coil and wiring , which causes a decrease in discharge completion voltage . with this voltage drop , the power loss of the discharge circuit can be calculated using ( 5 ) . however , the power capacity of the high - voltage power that charges the discharge capacitor must be greater than the power loss . c was 100 f and 2000 v , and l was 100 h . the scr for the discharge operation was a semikron skt760 exclusive module , and parts with sufficient current capacity and withstand voltage were used for high - voltage , high - current circuit wiring . the initial discharge voltage vi and discharge end voltage ve were 1,000 v and 760 v , respectively . therefore , the power loss can be calculated using the following equation :
( 5)ploss=12cf[(ini)2(end)2 ] .
when vi was 1,000 v , a time - dependent magnetic field of 1 t appeared at a point 50 mm from the stimulation generation coil . even when the scr was switched during the discharge operation , there was no voltage or current that exceeded the ratings of the components around the scr . figures 3(a ) idea , 3(b ) test show the current pulses when s1 , s2 , s3 , and s4 were triggered simultaneously . the delay time was 0 s , and the pulse width was 240 s . figures 4(a ) idea , 4(b ) test present the current pulses of the stimulation coil after the simultaneous triggering of s1 and s2 and the subsequent triggering of s3 ( 50 s delay ) and s4 ( 100 s delay ) . figures 5(a ) idea , 5(b ) test give the current pulses after triggering s1 at 0 s without delay , s2 ( 50 s delay ) , s3 ( 100 s delay ) , and s4 ( 150 s delay ) . the pulses had four flat stages with a pulse width of 960 s . figures 6(a ) idea , 6(b ) test show the current pulses after the simultaneous triggering of s1 , s2 , and s3 without delay and the triggering of s4 ( 50 s delay ) . figures 7(a ) idea , 7(b ) test present the current pulses after triggering s1 at 0 s without delay and the simultaneous triggering of s2 , s3 ( 50 s delay ) , and s4 ( 100 s delay ) . the pulses had three convex stages with a pulse width of 720 s . figures 8(a ) idea , 8(b ) test give the current pulses after the simultaneous triggering of s1 and s2 and of s3 and s4 ( 50 s delay ) . they had two thick stages with a pulse width of 480 s . in figure 9 , the number of triggered scrs and the delay time led to multistage superposition , which altered the stimulation voltage . a multidischarge method was implemented , in which the stimulation coils were driven in sequence via multiple switching control . the limitation of the existing simple sinusoidal pulse form could be overcome by changing the intensity , pulse width , and pulse form . a new magnetic stimulation device was proposed via multidischarge application , in which diverse treatment current pulses were generated from the stimulation coil by changing the delay for triggering the scr using an avr one - chip microprocessor . a wide range of changes in the magnetic field intensity , pulse width , and pulse form control were obtained according to the turn - on time of the stimulation coil and the number of meshes of the pfn . using at80s8535 of the atmel system , the turn - on delay of the stimulation coil could be controlled in real time within the range of 0 ~ 150 s . when the turn - on delay of the stimulation coil , from 0 to 200 s , was applied sequentially to superpose the current pulses , the peak of the stimulation coil pulse was 1 ~ 2.7 times higher than that when the stimulation coil was discharged once , and the pulses were controlled in the pre- , mid- , and postpulse forms . the pulse width was controlled within the range of 240 ~ 960 s . the rise and fall times of the pulses can be changed considerably at the first , second , third , and fourth stages . the one - chip microprocessor technology and pfn were combined to actively superpose the one four - stage circuits and produce high - voltage pulse forms with diverse pulse widths . overall , it appears that the limitation of treatments and diagnoses can be overcome by applying a range of pulses to the magnetic stimulation device . | treatment and diagnosis can be made in difficult areas simply by changing the output pulse form of the magnetic stimulation device
. however , there is a limitation in the range of treatments and diagnoses of a conventional sinusoidal stimulation treatment pulse because the intensity , width , and form of the pulse must be changed according to the lesion type .
this paper reports a multidischarge method , where the stimulation coils were driven in sequence via multiple switching control .
the limitation of the existing simple sinusoidal pulse form could be overcome by changing the intensity , width , and form of the pulse . in this study ,
a new sequential discharge method was proposed to freely alter the pulse width .
the output characteristics of the stimulation treatment pulse were examined according to the trigger signal delay applied to the switch at each stage by applying a range of superposition pulses to the magnetic simulation device , which is widely used in industry and medicine . |
inadequate knowledge of tooth morphology and canal systems may pose significant problems during root canal treatment . to ensure the long - term prognosis of a tooth undergoing root canal treatment , it is imperative to assess the anatomy of the root canals and their numerous variations before initiating root canal treatment .the root canal anatomy of the mandibular lateral incisor usually has a single root with a single canal . among the variations , although a high incidence of a lingual canal has been reported , the majority of these canals will join and exit in a single foramen in 70% of the cases . the most common variation found in the mandibular lateral incisor is the presence of a second canal ( lingual ) . table 1 highlights various studies published on the root canal anatomy of mandibular lateral incisors . a microscope is the best tool in visualizing intricate dental anatomies otherwise not visible to the naked eye . the benefits of root canal procedures completed with a microscope include :
magnified imageincreased precisionimproved illuminationimproved visualization improved illumination improved visualization on a thorough literature search it was observed that there has been no in - vitro or clinical case reports of a mandibular lateral incisor with three canals . the present case report discusses the successful endodontic management of a three - canalled mandibular lateral incisor . a 58-year - old woman was referred to the department of conservative dentistry and endodontics with the chief complaint of pain in her lower front teeth region . dental history revealed dull , continuous pain in the left mandibular lateral incisor ( teeth # 23 ) for the past 1 month . on clinical examination , tooth # 23 had a large proximal restoration and was tender on percussion ( fig 1a ) . palpation of the labial and lingual aspect of the teeth did not reveal any tenderness . no response was elicited in the tooth with the electronic pulp tester ( ept ) ( parkel electronics division , farmingdale , ny ) and thermal ( heat and cold ) pulp vitality testing methods ( dentsply maillefer , ballaigues , switzerland ) . a pre - operative radiograph revealed large proximal restoration close to the pulp space with periodontal ligament widening related to the left mandibular lateral incisor . based on clinical and radiographic findings , a diagnosis of pulpal necrosis with symptomatic apical periodontitis was made for tooth # 23 . tooth # 23 was anesthetized with 1.8 ml ( 30 mg ) 2% lignocaine containing 1:200,000 epinephrine ( xylocaine ; astrazeneca pharma ind ltd , bangalore , india ) followed by rubber dam isolation . after access cavity preparation using a round carbide no # 2 ( mani inc , toshigi - ken , japan ) , one labial and one lingual canal was identified in tooth # 23 , but on examination under surgical operating microscope ( seiler revelation , st louis , mo ) , an additional canal was located between the labial and the lingual canal ( fig 1b ) . this additional canal was initially negotiated using a c+ file iso # 8 ( dentsply maillefer , ballaigues , switzerland ) . the working length was determined in all three canals using an apex locator ( root zx ; morita , tokyo , japan ) and was later confirmed by a radiograph . coronal orifice opening was performed using gates - glidden drills no.2 and no.1 followed by cleaning and shaping with 2% stainless steel hand k - files up to iso # 30 ( mani inc , toshigi - ken , japan ) using a crown - down technique . calcium hydroxide paste ( rc cal , prime dental products pvt ltd , mumbai , india ) was used as an intracanal medicament for a period of one week . on the next appointment , the patient was asymptomatic . a master cone radiograph was taken to confirm the working length ( fig 1c ) . the canals were then dried with absorbent points ( dentsply maillefer , ballaigues , switzerland ) , and obturation was performed using cold lateral compaction of gutta - percha ( dentsply maillefer , ballaigues , switzerland ) and ah plus resin sealer ( maillefer , dentsply , konstanz , germany ) ( fig . 1d ) . the tooth was then restored with a posterior composite resin core ( z350 ; 3 m dental products , st paul , mn ) . tooth # 26 that was also endodontically treated simultaneously had one buccal and one lingual canal . endodontic treatment for tooth # 26 was performed similar to that of tooth # 23 . failure to identify extra canals is one of the most common reasons for the failure of endodontic treatment . according to a recent study conducted by song et al . multiple angulated pre - operative radiographs can help us identify complex root canal anatomies of the root canal system and thereby reduce the incidence of missed canals during routine endodontic therapy . use of higher investigation tools such as cone beam computed tomography ( cbct ) has also been suggested for better understanding of the aberrations in the root canal anatomy . even though use of cbct involves less radiation than conventional ct , the radiation dose is still higher than regular conventional intraoral radiographs . in our case report this additional canal was termed as the mid - labio - lingual ( mll ) canal . suggested the use of cbct and surgical microscope to successfully diagnose various aberrations in the root canal anatomy . reported that in 60% of the cases , bilateral symmetry of variation is usually observed . he also stated that as the aberration increases , it is more likely to be bilateral in occurrence . in the present case report , all the three canals joined in the apical third of the root canal and exited as a single apical foramen . this pattern of root canal configuration is classified as type - i canal pattern according to a study conducted by gulabivala et al . and type- xviii canal pattern based on a study performed by sert and bayirli . many mandibular incisors have two canals , which may merge into one canal before reaching the apex . in rare cases , separate foramina may form . in a radiographic study of 364 specimens , benjamin and dowson reported that 41.4% of the mandibular incisors had two separate canals ; of which only 1.3% had two separate foramina . they suggested that manual exploration of the root canal system with an endodontic file or explorer is a reliable way to identify the exact configuration of the root canal , especially the number of foramina . studied the root canal morphology of 100 mandibular incisors and showed two additional canal configurations other than vertucci s classification . type 6 was a newly defined canal configuration in which two separate canals leave the pulp chamber , a new tiny canal leaves the lingual canal in the middle third and comes to the midline , goes down to the apical third , and all of the canals merge together and constitute one canal joining at the apex . after leaving the pulp chamber as a wide single canal , division occurs into two canals in the middle third . these canals then rejoin into a single canal that splits again and exits as three separate foramina . showed that mandibular incisors possess a flat root that is longest in the labio - lingual direction , and furcate and ribbon - like canals occasionally appear in the center of the root . therefore , the problem exists for instrumentation of the labio - lingual wall of ribbon - like root canals and also clinically it is almost impossible to discriminate between separate canals and ribbon - like canals . therefore , authors suggest the use of circumferential filing rather than circular filing to prevent incomplete cleaning and shaping of the root canal system . the present case report describes the endodontic management of a mandibular lateral incisor with three root canals . it highlights the importance of the dental operating microscope in detecting extra canals for successful endodontic treatment . | this case report presents endodontic management of a mandibular lateral incisor with three canals using surgical dental operating microscope .
this study describes the root canal variation of mandibular lateral incisor and highlights the importance of surgical operating microscope in detecting an unusual canal morphology . |
the incidence of fungal liver abscess is rare compared to pyogenic or amebic liver abscess . routes of exposure of bacteria can occur by biliary tree , portal vein , hepatic artery , direct extension , and cryptogenic abscess . a 65-year - old female patient admitted with a complaint of upper abdominal pain for 15 days , more on the right hypochondrium and epigastric region , associated with a history of nausea and vomiting . she was a known case of diabetes mellitus for 5 years , on oral hypoglycemic drugs . respiratory , cardiovascular , central nervous system , and musculoskeletal system found to be normal . routine blood investigations such as complete blood count and renal and liver function tests were normal . ultrasound abdomen showed 7.15 cm 4.43 cm ill - defined echo texture lesion with internal anechoic area seen in segment vii and v of the liver [ figure 1 ] . we are not sure whether we are dealing with chronic liver abscess or infected hydatid cyst ; hence , we proceeded with contrast computed tomography ( ct ) abdomen and immune assay for igg antibodies against hydatid cyst ( echinococcus ) . contrast ct abdomen showed enlarged liver of 20.8 cm with ill - defined hypoechoic collection with air fluid level of size 13 cm 10 cm 7 cm noted in the right lobe of liver with enhancing walls suggestive of liver abscess [ figures 2 and 3 ] . however , serum enzyme - linked immunosorbent assay ( elisa ) against echinococcus igg - positive ( 0.78 od ) ( reference interval - negative < 0.3 , positive > 0.3 ) . the patient was started on antibiotics and albendazole for hydatid cyst . we are not sure with diagnosis whether synchronous hydatid cyst with pyogenic liver abscess or hydatid cyst becomes infected . gram stain showed many pus cells and fungal filaments branching septate hyphae , suggestive of candida albicans and culture and sensitivity were also suggestive of c. albicans . later , we placed pigtail catheter inside the abscess cavity and the cavity started resolving [ figure 4 ] . ultrasound abdomen showed 7.15 cm 4.43 cm ill - defined echo texture lesion with internal anechoic area seen in segment vii and v of the liver axial computed tomography abdomen showed enlarged liver with hypodense fluid collection contrast computed tomography abdomen showed enlarged liver of 20.8 cm with ill - defined hypo echoic collection with air fluid level of size 13 cm 10 cm 7 cm noted in the right lobe of liver with enhancing walls suggestive of liver abscess ultrasound abdomen with pigtail catheter inside the abscess cavity with resolving abscess hydatid cyst occurs due to infection with echinococcus granulosus . after ingestion of parasite embryo , it releases an oncosphere which penetrate the mucosa of intestine . larvae of echinococcus reach portal venous system through intestine and spread to various organs such as liver , lung , spleen , brain , muscle , and other parts . ultrasound abdomen mostly diagnoses hydatid cyst , but when the diagnosis is uncertain , we need ct abdomen or magnetic resonance imaging ( mri ) abdomen to fetch diagnosis . when imaging fails to identify the lesion or when the lesion is doubtful , we need serological examination , which is confirmatory . following serological test used for the diagnosis of hydatid cyst . they are complement fixation test , indirect hemagglutination test , latex agglutination test , elisa , indirect immunofluorescence antibody test , immunoelectrophoresis , and immunoblotting . sensitivity and specificity of elisa vary from organ to organ , in which hydatid cyst is involved . hydatid cyst liver carries higher sensitivity ( 90% ) compared to hydatid cyst of the lung ( 75% ) . elisa for igg carries higher sensitivity ( 90% ) compared to elisa for igm ( 85% ) or ige ( 80% ) antibodies . ultrasound abdomen shows calcification of the cyst wall with double echogenic shadow due to pericyst . mri abdomen shows mixed low signals on t1-weighted images whereas mixed high signals on t2-weighted images with septations . mostly , hydatid cysts with immunocompromised status are more prone to develop liver abscess following hydatid cyst . the occurrence of abscess in hydatid cyst creates diagnostic difficulty when seropositive for hydatid cyst , but imaging fails to identify hydatid cyst or serology positive for hydatid cyst , but aspirate shows negative for hydatid . in our case , there was a diagnostic difficulty because imaging failed to identify typical hydatid cyst , but seropositive for hydatid cyst . with extensive search on pubmed , this is the first case reported with hydatid cyst with fungal liver abscess created diagnostic difficulty . the previous description of fungal abscess mostly associated with liver malignancies or hematological malignancies . fungal liver abscess following hydatid cyst was treated with pair and medical management such as albendazole with antifungal agents . this case created diagnostic difficulty whether we are dealing with liver abscess or hydatid cyst . sometimes , it may be possible that concurrent occurrence of hydatid cyst with liver abscess or hydatid cyst became infected and mimic like liver abscess . immunocompromised states with hydatid may be more prone for fungal liver abscess compared to pyogenic liver abscess . this kind of cases can be managed with initially pair followed by pigtail for proper resolution . | liver abscess is mostly either pyogenic or amebic .
fungal and mycobacterial liver abscesses are rare and mostly associated with immunosuppression .
the occurrence of fungal liver abscess with hydatid cyst was never reported previously .
this case created diagnostic difficulty , whether we are dealing with liver abscess or hydatid cyst .
sometimes , it may be possible that concurrent occurrence of hydatid cyst with liver abscess or hydatid cyst become infected and mimic like liver abscess . |
a 64-year - old man was admitted to the hospital for resection of a sigmoid colon adenocarcinoma . he had no medical antecedents . renal ultrasound demonstrated a small rounded lesion in the centre of the left kidney ( fig . color - coded duplex sonography demonstrated intralesional flow , with a resistance index of 0.69 . heterogeneous lesional enhancement was seen on contrast enhanced computed tomography ( ct ) ( fig . 2 ) ; the lesion was isodense on to the renal parenchyma on pre - contrast scans . mri was performed , showing a lesion isointense to the renal cortex on t1-weighted images ( tr 7.7/te 4.2 msec ) ( fig . 3 ) and predominantly hyperintense on t2-weighted images ( tr 4.3/te 60 msec ) ( fig . 4(a , b ) ) . the latter also demonstrated small intratumoral hypointense strands , fanning out from the medial border of the lesion . 3d contrast - enhanced mr - angiography ( fig . 5 ) in the coronal plane demonstrated lesional enhancement , slightly less than the renal cortex . the lesion that is slightly hyperechoic compared to the renal parenchyma and doppler spectrum demonstrates intralesional flow with a normal resistance pattern ( resistance index 0.69).figure 2
contrast - enhanced ct , venous phase . a heterogenous lesion is seen in the sinus of the left kidney.figure 3
t1-weighted ( te 4.2 msec / tr 7.7 msec ) image , axial plane . the tumor is hypointense compared to the renal cortex.figure 4
( a ) t2-weighted ( te 60 msec / tr 4.3 msec ) image , coronal plane . the lesion abuts the renal pelvis and is predominantly hyperintense ; some intralesional hypointense strands are present , fading out from the medial border of the tumor . ( b ) heavily t2-weighted image ( te 378 msec / te 4.3 msec ) . the tumor is less intense than the content of the renal pelvis ; the intralesional hypointense strands are seen more clearly.figure 5
3d contrast - enhanced mr - angiography , coronal plane , corticomedullary phase . the lesion that is slightly hyperechoic compared to the renal parenchyma and doppler spectrum demonstrates intralesional flow with a normal resistance pattern ( resistance index 0.69 ) . ( a ) t2-weighted ( te 60 msec / tr 4.3 msec ) image , coronal plane . the lesion abuts the renal pelvis and is predominantly hyperintense ; some intralesional hypointense strands are present , fading out from the medial border of the tumor . ( b ) heavily t2-weighted image ( te 378 msec / te 4.3 msec ) . the tumor is less intense than the content of the renal pelvis ; the intralesional hypointense strands are seen more clearly . the lesion is slightly hypovascular compared to the renal cortex . at the time of the resection of the sigmoid because of the central location of the lesion and the strong suspicion of malignancy , in the presence of a normal contralateral kidney , partial nephrectomy was not attempted . on section , a well - circumscribed dark brown nodule with a diameter of 2.6 cm was noted within the renal medulla . no vessel wall was seen surrounding the nodule . beneath the lesion a normal pelvis was observed . 5 m sections for hematoxylin and eosin staining revealed a dilated intrarenal vein , containing papillary proliferations lined by a monolayer of benign - looking endothelial cells associated with a thrombus ( fig . a portion of the vessel wall is visible ( arrow ) ( hematoxylin - eosin , magnification 5 ) . ( b ) the papillae are lined by a monolayer of benign - appearing endothelial cells ( hematoxylin - eosin , magnification 25 ) . ( c ) around the papillary mass , a vessel wall is seen ( arrow ) ( masson s trichrome , magnification 10 ) . a portion of the vessel wall is visible ( arrow ) ( hematoxylin - eosin , magnification 5 ) . ( b ) the papillae are lined by a monolayer of benign - appearing endothelial cells ( hematoxylin - eosin , magnification 25 ) . ( c ) around the papillary mass , a vessel wall is seen ( arrow ) ( masson s trichrome , magnification 10 ) . masson first described this lesion in a hemorrhoidal vein in 1923 as a neo - plastic process consisting of papillary hyperplasia of the endothelial cells , with a consequent obliteration of the vascular lumen , followed by degenerative changes . since then the tumor is commonly known as masson s tumor . less than 200 cases have been reported , describing a predilection for skin and head and neck region . the only two previously reported cases from the genitourinary tract are a renal lesion , clinically presenting with hematuria and a lesion in the penis . the overall prevalence of the lesion is higher in women , suggesting a possible hormonal influence . three forms of peh have been described : a pure or primary form occurring within dilated vascular spaces , a mixed or secondary form occurring within a pre - existing vascular lesion ( e.g. hemangioma or pyogenic granuloma ) , and a rare third form which is extravascular and arises in a hematoma . the specific interest of this lesion is that it should be distinguished from malignancies to avoid radical surgery . in retrospect , analysis of the spectral curve obtained by duplex sonography shows a normal resistance pattern , which is more likely to be found in benign masses . in malignant lesions a low - resistance arterial flow pattern the characteristics on mri ( hypointense on t1-weighted and hyperintense on t2-weighted images ) are atypical as well . one could suggest the presence of fibrovascular stalks or an intralesional thrombus ; however , this could not be demonstrated on pathological examination . since no radiological examination can rule out the presence of malignancy , surgery is usually warranted . on pathological examination , the process has well - defined features which might be mistaken for angiosarcoma by a pathologist who is not familiar with this entity . | in 1923 masson described a neo - plastic process consisting of papillary hyperplasia of the vascular endothelial cells , with a consequent obliteration of the vascular lumen , followed by degenerative changes .
he introduced the term vegetant intravascular hemangioendothelioma. however , these days it is more commonly known as papillary endothelial hyperplasia ( peh)[1 ] .
although relatively rare , there are numerous accounts of peh in literature , describing its predilection for the head and neck region .
our case report describes the finding of a peh within the kidney ; a site previously described only once in the literature . |
focal cortical dysplasia ( fcd ) is the most commonly encountered developmental malformation causing refractory epilepsy . malformation of cortical development ( mcd ) is malformative lesions of the brain resulting from developmental aberration of normal processes that take place mostly during the first two trimesters of pregnancy and involving cells participating in the formation of the normal cerebral cortex . neuronal migration disorder is regarded as an old terminology because not all mcds are caused by neuronal migration anomaly . there are heterogeneous groups of focal or diffuse malformations depending on the causes and timing of the defect in the developmental processes . the incidence of mcds is variable according to the development and application of high resolution mri . there is increasing tendency in the incidence of mcds because of the advancement of this technique.1,2 it is the most common etiology of the cryptogenic and probable symptomatic epilepsy . it comprises 25 to 40% of the refractory childhood epilepsies.3 75% of patients with mcds will have epilepsy at some time in their life.4 both genetic and environmental factors play in the genesis of mcds ( table 1)5 . recently , whole exom sequencing demonstrated that mutations of wd repeat domain 62 was the cause of wide spectrum of severe cortical malformation including microcephlay , pachygyria , lissencphaly , schizencephaly , polymicrogyria , and hypoplasia of corpus callosum.6 another whole exom sequencing also identified de novo somatic mutations of pik3ca , akt3 , and mtor genes in focal brain areas.7 there is no general consensus on the classification of mcd because a particular defect in the cortical development may be responsible for more than one morphological subcategory of mcds and one morphological subtype of mcd may arise from more than one mechanism for its formation . the most commonly used classification is barkovich classification.8 it has four categories based on the major stages of brain development . they are malformation due to abnormal neuronal and glial proliferation , malformation due to abnormal neuronal migration , malformation due to abnormal cortical organization including later neuronal migration , and unclassified malformations . however , with the application of this system on the classification of fcd , fcd should be subdivided into two subcategories . fcd without balloon cells belongs to the category of malformation due to abnormal cortical organization including later neuronal migration and fcd with balloon cells belongs to the category of abnormal neuronal and glial proliferation . ictal discharges and interictal spikes originated from fcd area where dysmorphic neurons were located.9 seizures also started from the cortical area characterized by dysmorphic neurons but not balloon cells.10 cytomegalic neurons demonstrated abnormal electrophysiological properties.11 there is imbalance between glutamergic excitatory and gabaergic inhibitory inputs.12,13 nr2a and nr2b subunits are increased in fcd area.14 since the first distinctive and characteristic focal pathology was described,15 numerous classification schemes have been presented . tassi et al16 proposed a new simplified classification based on the pathological characteristics with some other aspects including mri findings and clinical considerations . the distinction was based on the presence of cytological abnormalities such as giant neurons , dysmorphic neurons , and balloon cells . palmini et al17 further refined the terminology of classification of fcd with continuing criteria of histopatholgical findings . recently ilae proposed the new classification.18 in this system , fcd was classified into three entities ( table 2 ) . the whole mark of type i fcd is the cortical dyslamination and that of type ii is the presence of dysmorphic neuron with or without balloon cells in addition to the cortical dyslamination . if there is another lesion other than type i or type ii pathology , it is categorized into fcd type iii . they are focal increase of cortical thickness , blurring of gray - white matter junction , increased signal in t2-weighted or flair imaging , and increased signal from the cortical surface to the ventricle ( fig . the final characteristic finding is called transmantle sign . thin slice section and concomitant use of t2 and flair imaging the diagnostic sensitivity is increased along with the severity of pathology of fcd ( table 3).19 thirty - seven percent of the patients with type i fcd had normal mri while only 15% with fcd type ii had negative mri.16,1922 the thick gray matter , blurring gray and white matter junction , and increased t2 or flair signal are more frequently associated with type ii fcd pathology . however , most mri findings could not differentiate type i from type ii pathology because of significant overlapping of imaging findings between fcd type i and type ii.23 cortical thickness and blurring of gw junction were more common in isolated fcd than in fcd type iii . and however , the most severe pathological presentation can be found in the patients with negative mri . the proportion of negative mri in the patients with pathologically proven fcd ranges from 23% to 73%.2426 ictal spect and fdg - pet can be critical for localizing the seizure focus , especially in mr - negative patients . fdg - pet and subtraction spect are valuable in the diagnosis of mr - negative neocortical epilepsy.2732 for focal cortical dysplasia , the diagnostic sensitivity of fdg - pet and ictal spect ranges from 69% to 98% and 48% to 64% , respectively.21,3338 the proportion of fcd in surgical series ranges from 9% to 71% depending on the slection criteria of different centers.16,19,22,3436,3942 our series40 included only neocortical epilepsy patients . in this series the relative poor outcome of fcd compared with benign brain tumor or temporal lobe epilepsy ( tle ) with hippocampal sclerosis can be noticed . whereas approximately 80% of patients became seizure free after surgical treatment for mesial tle related to hs or lesional epilepsy such as primary brain tumor or vascular malformations,43,44 the efficacy of surgical treatment for fcd was consistently less favorable , with approximately 3375% of individuals becoming seizure free.16,36,39,45 the relative poor prognosis can be explained by that fcd is often invisible on mri which leads to the difficulty to define epileptogenic zone . the other factor affecting the relative poor surgical outcome is that even after the removal of all visible lesions on mri , residual microscopic lesion can still be epilepstogenic , which means that dysplastic tissues tend to be more extensive than is apparent on mri.21,46 evidence indicates that even patients with mri abnormalities who have resective epilepsy surgery for fcd have worse surgical outcomes than those of patients who have surgery for other focal lesional epilepsy syndromes.40 the complete resection of fcd is invariably associated with better surgical outcome ( table 4).19,20,22,36 although mri increases our confidence in the localization of epileptogenic foci and allows surgical resection to be performed without preoperative invasive studies , our series47 demonstrated that complete resection guided by areas of ictal onset , persistent pathological delta slowing , > 1/sec frequent spikes , and intermittent fast activity ( hfo ) detected by intracranial eeg was very useful leading to the complete resection even in the patients with negative mri . the importance of complete resection indicates that seizures may originate from periphery of fcd as well as the center of fcd . there is an inherent difficulty in identifying the epileptogenic zone in mr - negative fcd patients , which often results in incomplete resection . however , with careful interpretation of other studies including functional neuroimaging and concordant results among these studies , surgical treatment can benefit patients with mr - negative fcd . the positive prognostic effect of severe pathological features has been documented in previous reports , which predominantly included patients with identifiable lesions on mri.2,16,45,48 our series19 also identified that the patients with severe pathological features have a higher chance of becoming seizure free after surgery regardless of mri results . the prognostic role of pathological severity may be related to the completeness of surgical resection . although the epileptogenic zone in fcd does not always correspond to the area with the most severe pathological features , it is generally accepted that the epileptogenicity of fcd is usually associated with its pathological severity . from this point of view neuroimaging development , especially high resolution mri , can increase the detection rate of mcd , which can make us treat the patients surgically . fdg - pet and ictal spect can be valuable in the localization of fcd , which may be especially useful in the patients with normal mri . surgical treatment is a option for refractory epilepsy with fcd and complete resection of fcd area is the major prognostic factor . complete resection of early ictal onset zone and resection which includes the area with pathological delta waves and frequent interictal spikes predict good surgical outcome . pathologic characteristics are important not only for the correct diagnosis but also for prediction of surgical prognosis . | focal cortical dysplasia ( fcd ) is the most commonly encountered developmental malformation that causes refractory epilepsy . with advances in neuroimaging techniques , in particular mri ,
recent studies have revealed a higher prevalence of fcd than previously estimated and have improved the preoperative identification and classification of these abnormalities .
however , mri frequently does not show any abnormalities in patients with pathologically proven fcd .
in this situation , functional neuroimaing such as fdg - pet and ictal spect can be helpful .
fcd is thought to be intrinsically epileptogenic , because the dysplastic tissues contain aberrant neural networks that are highly susceptible to abnormal excitation .
the response to the medical treatment of epilepsy has been documented as consistently poor .
therefore , surgical resection has been an important alternative treatment for patients with intractable epilepsy related to fcd .
incomplete resection of fcd has been consistently known to be a poor prognostic factor . however , the complete removal of fcd is often difficult because the demarcation of the lesion is frequently poor , and dysplastic tissues tend to be more extensive than is apparent on mri .
evidence indicates that even patients with mri abnormalities who have resective epilepsy surgery for fcd have worse surgical outcomes than those of patients who have surgery for other focal lesional epilepsy syndromes .
careful planning of evelauation using intracranial electrodes is necessary for successful epilepsy surgery . |
they normally measure 2 to 3 mm and evolve quickly to crusted purpuric necrotic lesions . plc presents papules with characteristic signs of fine scaling , and resolution with postinflammatory hypopigmentation without scarring may occur . in general , pl is more common in the first ten years of life , and it is believed that 19 to 38% of cases occur in the pediatric age group . there are several hypotheses about its pathogenesis , including dermatitis mediated by immune complexes [ 37 ] . it has also been considered a lymphoproliferative disease triggered by antigen stimuli such as viruses or other infectious agents because clonality and prominent cd30 positivity has been demonstrated , especially in some histological variants [ 3,711 ] . the objective of this study is to describe the clinical and histological characteristics of pl in the pediatric age in a reference pediatric dermatology center in south brazil , with the aim of correlating history , clinical and microscopic findings with the classification of disease type ( pleva or plc ) . a retrospective descriptive observational study evaluated clinical and histological data from patients less than 15 years old diagnosed with pl seen at a specialized pediatric dermatology division of a public hospital in south brazil from 1986 to 2010 . medical records of pl patients were reviewed for the following variables : gender , age at start of signs or symptoms , history of infections in the six months before lesions , medication history , family history of similar lesions , disease duration , skin lesion distribution , treatments , associated symptoms , and pigment alterations and their duration after improvement . two researchers reviewed photographic documentation , when available , to confirm diagnosis and classify the disease into the two clinical forms pleva or plc . cases were classified as plc when there were residual hypochromic lesions , erythematous papules , and exfoliation with signs of fine scaling , and pleva when there was necrosis , hematic crusts , and the presence of atrophic scarring or associated fever . patients who had undergone skin biopsies had their slides reviewed and the following histological parameters evaluated . in the epidermis : acanthosis , spongiosis , lymphocyte exocytosis , parakeratosis , necrotic keratinocytes and scale crust . and in the dermis : papillary edema hemorrhage , perivascular lymphocytic infiltrate and atypical lymphocytes . these criteria were evaluated for the presence or absence in each case , and when present as discrete , moderate , or accentuated in an attempt to differentiate between plc and pleva . cases that presented a moderate or accentuated epidermal or dermal inflammatory component ; and or frequent necrotic keratinocytes ; and or scale crust were classified as the acute form ( pleva ) . cases with more subtle histological alterations or with their absence were classified as the chronic form ( plc ) . the summary measurements used in the descriptive statistics were mean , standard deviation , median , minimum and maximum values , and frequencies depending on type of variable studied . differences between ages were studied using the mann - whitney test considering a significance level of 5% . twenty - nine pl cases were evaluated ; median age was 96 months ( 22 to 178 months ) . age at the start of symptoms had peaks at 8 years , followed by 12 and 14 years . mean time between start of symptoms and diagnosis was 1.15 years ( 1 month to 10 years ) . the comparison between gender and age at start of symptoms , median age at the start in males was 8.3 years ( 1 to 14.1 years ) and in females 8.8 years ( 1.6 to 14.8 years ; p=0.5 ) . the most frequently observed lesions were papules ( n=27 ) , hypopigmentation and scaling ( n=19 ) and fine scaling ( n=13 ) . there was also erythema ( n=12 ) , crusts ( n=12 ) , hyperpigmentation ( n=5 ) , necrosis ( n=4 ) , and purpuric lesions ( n=3 ) . classification by lesion distribution was of a central form , where lesions were found on the trunk and proximal limbs in 14 ( 48% ) , followed by diffuse ( generalized lesions ) in 13 ( 45% ) , and peripheral , where only the extremities presented lesions , in 2 ( 7% ) cases . as for symptoms , 15 ( 52% ) patients were asymptomatic , 13 ( 45% ) had itching , and one fever . clinical classification revealed 4 pleva ( figure 2a and 2b ) and 25 plc ( figure 2c and 2d ) . histological evaluation was possible in 14 patients ; six ( 43% ) presented histology consistent with the chronic form ( plc ) , four ( 28.5% ) with the acute form ( pleva ) , and four ( 28.5% ) presented histology with characteristics of both forms and were classified as mixed . comparing histology and clinical diagnoses showed that the six cases with plc histology also had the same clinical diagnosis . the four mixed histology cases clinically presented as plc . in the four acute histology ( pleva ) cases , one was clinically classified as plc ( figure 3a and 3b ) . of the 18 followed up , improvement was seen in 15 , of which 11 had recevied erythromycin or tetracycline and four were treated with moisturizing cream until returning after biopsy , when they presented disease remission without the need for specific treatment . mean evolution time to improvement in these 15 patients was seven months ( 1 to 96 months ) . three cases still had lesions at last evaluation and their mean follow - up time was 15 months . pityriasis lichenoides is an uncommon skin disease with few studies on its clinical and histological presentation , especially in the pediatric age . mean age at the start was 8 years , with peaks at 8 , 12 , and 14 years . it predominated in males ( 69% ) , agreeing with literature where values range from 53% to 60% . this dermatosis is believed to be seasonal , predominantly in autumn and winter , as seen in 62% of cases in this study ; ersoy - evans et al . , the question exists whether there really are fewer cases in the warm months , or whether exposure to the sun could be an improvement factor for symptoms and consequently fewer patients seek for medical attention in these months . another possibility is that viral infections , which are prevalent during cold months , could be triggers . most patients presented with papules in the first evaluation , followed by residual hypopigmentation and fine scaling . necrotic lesions , which are feature of pleva , were observed in 4 cases , which is less than in the literature . in lesion distribution literature reports a predominance of the diffuse form ( skin lesions spread in the entire body ) in 70% of cases . it must be stressed that classification by lesion distribution is observer dependent , considering the highest lesion concentration , allowing a patient with the central form to have some peripheral lesions . the commonest symptom was itching , but most patients were asymptomatic , differently to ersoy - evans et al . , who reported that most patients had pruritus . symptom evaluation could have been underestimated due to the nature of the retrospective study ; another possibility is the question of a subjective symptom , causing variations between different populations . follow - up was abandoned in 38% of patients ; this also occurred in vitiligo patients in an earlier study at the same service , probably reflecting a characteristic peculiar to the type of population seen in this center . in most cases where evaluative follow - up was possible , there was clinical improvement and erythromycin or tetracycline treatment was effective , therefore this is the treatment of choice due to its anti - inflammatory effect and immunological control . as in the clinical study , some studies show a predominance of pleva , in 57.3% of patients , others show plc in 72% . this probably reflects the diverse range of clinical presentations of the disease , which can characteristically exhibit lesions in different stages of evolution . there was one case where clinical and histological findings disagreed ; this probably occurred due to the choice of lesion submitted for biopsy , which presented more accentuated erythema and scaling . the microscopic aspect actually showed the characteristics of the evolution phase of the lesion that was analyzed and not necessarily the disease of the patient as a whole . this reinforces the need to associate clinical and histological parameters in classifying the disease , it being advisable to not base pl classification just on microscopic aspects . pityriasis lichenoides in the pediatric age group begins around 8 years of age and is more frequent in boys . plc was prevalent and a delay in diagnosis was seen reinforcing the need for knowing the clinical characteristics of this dermatosis . disease seasonality could have implications in physiopathology , but needs evaluation with a larger number of cases for confirmation . cutaneous biopsy can be very valuable in definitive diagnosis , however morphological findings depend directly on the evolutionary phase of the lesion chosen for analysis . | background : pityriasis lichenoides ( pl ) is a lymphoproliferative disease of unknown origin ; its diagnosis is based on clinical characteristics and confirmed by histology.objectives:to describe clinical and histological features of pl in 29 pediatric patients.materials and methods : retrospective descriptive study of children ( patients less than 15 years old ) diagnosed with pl between 1986 and 2010 at a reference service in pediatric dermatology from south brazil.results:twenty-nine pl cases were found by chart review in 24 years .
mean age of diagnosis was 8 years ( 22 to 178 months ) and a mean time of diagnosis was 13.8 months ( 1 to 120 months ) .
twenty cases ( 69% ) were male .
seasonal correlation was found with colder months in 62% of cases ( p<0.01 ) .
clinical diagnosis was pityriasis lichenoides chronica ( plc ) in 25 cases , and pityriasis lichenoides et varioliformis acuta ( pleva ) in four .
itching was the main reported symptom occurring in 13 ( 45% ) .
fourteen cases had been histologically evaluated . in six ,
microscopic findings were consistent with plc , in four consistent with pleva , and four biopsies exhibited mixed characteristics of both forms .
concordance between clinical and histological diagnosis was seen in most cases.conclusion:pl occurs in children and young adults , more commonly in males , and during cold months .
plc was the more frequent clinicohistologic form , and necrotic lesions characterized pleva .
associating clinical and histological findings is important for differentiating between plc and pleva diagnosis . |
suction blister epidermal grafting ( sbeg ) is a simple and effective way of surgical repigmentation in cases of vitiligo , especially when areas such as lip and eyelids are involved . the major problem faced during the procedure is the time taken for the formation of blisters . temperature at the suction site is one of the factors affecting the blister formation time . unna was the first to observe and document blistering of intact skin with suction cups . the first in - vitro separation of epidermis from dermis using suction was done by blank and miller in 1950 . the first in - vivo suction blister formation was demonstrated by slowey and leider in 1961 . falabella first used this technique for transplantation of viable epidermis in achromic lesions of the skin . gupta et al . developed a modified suction device using 5 ml , 10 ml and 20 ml syringes with a three - way stop cock and a latex tubing from the drip set to connect the suction syringe with the negative pressure producing syringe of 50 ml . this was in turn attached to a manometer on the third vent of the three - way . subsequently , in another study , gupta et al . demonstrated the usefulness of the modified suction apparatus without using a manometer , where they standardised the height of the pressure column of the suction syringe with the amount of negative pressure generated [ figure 1 ] . wood 's lamp and infrared lamp have been used previously for faster induction of suction blister formation . we have used a hair dryer to raise the surface temperature at the site of suction blistering and to reduce the blister formation time . ( a ) suction apparatus , ( b ) hair dryer , ( c ) infrared thermometer total seven patients with vitiligo involving both the angles of mouth and adjacent lower lip , without the involvement of other body areas were enrolled . all the patients had stable vitiligo lesions , i.e. , patients reporting no new lesions , no progression of existing lesions and absence of koebner phenomenon during the past 1 year . the patients having progressive lesions , active herpes labialis , keloidal tendency and those on corticosteroids or psoralen plus ultraviolet a ( puva ) therapy 2 weeks prior to the surgery were excluded . after taking consent , suction syringes were applied on both the thighs of all the patients . on the right thigh , blisters were raised as per the procedure standardised by gupta et al . without using a manometer . on the left thigh , similar procedure was used , but a hair dryer ( philips hp 8100 , 1000 w ) was used additionally to raise the surface temperature of the skin to 44c . the minor operation theatre room where surgeries were performed the hair dryer was blown , once every 10 min , for 1 min from a distance of 1 feet to raise the surface temperature to the desired level . the surface temperature was recorded using an infrared thermometer once in 10 min ( i.e. , after blowing hair dryer ) from the intervening skin between two suction syringes . the time taken for the formation of the recipient site was dermabraded including 23 mm of perilesional normal skin till punctate papillary bleeding was observed . the blisters were cut along their borders with curved iris scissors parallel to the skin surface . the roof was everted over a glass slide in such a way that the dermal surface faced upward . then , it was placed and spread over the recipient site . for graft fixation , surgical glue , all the patients were started on topical puvasol ( topical psoralen application followed by solar exposure as a source of ultraviolet a ) after sbeg and followed up after 2 months . the patients were instructed to apply diluted ( 1:20 ) topical 8-methoxy psoralen followed by a sun exposure of 56 min every day between 9 and 11 am . total seven patients with vitiligo involving both the angles of mouth and adjacent lower lip were studied [ table 1 ] . there were four females and three males . two patients had a family history of vitiligo . the mean time taken for formation of blister on the right thigh ( without raising the surface temperature ) was 121.1 6.2 min and the mean time taken for blister formation on the left thigh ( surface temperature raised with the help of a hair dryer ) was 69.6 5.4 min . the clinical pictures taken after 55 min showed partial blister formation on the right thigh whereas the left thigh showed well - formed , unilocular , dome - shaped blisters at the same time with few haemorrhagic blisters most likely due to heat - induced vasodilation [ figure 2 ] . the decrease in blister formation time on the left thigh , where surface temperature was raised with the help of a hair dryer was statistically significant as compared to the right thigh . profile of patients and the time taken for the formation of blisters blister formation on both the thighs after 55 min all the patients were started on topical puvasol after sbeg and followed - up for 2 months . all of them showed uniform repigmentation of the grafted sites , with no colour mismatch from the surrounding skin [ figure 3 ] . baseline and follow - up pictures there were no adverse effects noted during the procedure apart from heat - induced mild discomfort while blowing the hair dryer . in none of the patients , the procedure had to be abandoned because of any adverse event . total seven patients with vitiligo involving both the angles of mouth and adjacent lower lip were studied [ table 1 ] . there were four females and three males . two patients had a family history of vitiligo . the mean time taken for formation of blister on the right thigh ( without raising the surface temperature ) was 121.1 6.2 min and the mean time taken for blister formation on the left thigh ( surface temperature raised with the help of a hair dryer ) was 69.6 5.4 min . the clinical pictures taken after 55 min showed partial blister formation on the right thigh whereas the left thigh showed well - formed , unilocular , dome - shaped blisters at the same time with few haemorrhagic blisters most likely due to heat - induced vasodilation [ figure 2 ] . the decrease in blister formation time on the left thigh , where surface temperature was raised with the help of a hair dryer was statistically significant as compared to the right thigh . profile of patients and the time taken for the formation of blisters blister formation on both the thighs after 55 min all the patients were started on topical puvasol after sbeg and followed - up for 2 months . all of them showed uniform repigmentation of the grafted sites , with no colour mismatch from the surrounding skin [ figure 3 ] . baseline and follow - up pictures there were no adverse effects noted during the procedure apart from heat - induced mild discomfort while blowing the hair dryer . in none of the patients , the procedure had to be abandoned because of any adverse event . as this is a left - right comparison study , i.e. , self - controlled study , the time - independent confounding variables are eliminated . one of the major drawbacks of suction blister grafting is the time taken for the formation of blister . they are size of the suction cups or diameter of the suction syringe , site of blister formation , age of the patient , negative pressure , intradermal injection of saline , temperature at the suction site , pathological variations due to underlying disease states such as cutis laxa , ehler - danlos syndrome ( eds ) and corticosteroid therapy as well as other manoeuvres such as starting puva therapy 2 weeks before the suction blistering procedure . gupta and kumar used 2 , 5 , 10 , 20 and 50 ml syringes as suction cups and noted the difference in suction blister induction time . they concluded that suction blister induction time is directly proportional to the diameter of the suction syringe / cup . koga found abdomen and thighs as the most suitable donor sites though the blister formation time was approximately 45 hr . gupta et al . observed the blister formation time to be the least when anterolateral thigh was taken as the donor site . another study showed that there is no significant difference in the suction blister formation time over the flexor aspect of the forearm and the anterolateral thigh . blister formation is more time - consuming and difficult in young patients as compared to the elderly patients because of weak dermoepidermal adherence in the latter . gupta and kumar demonstrated that the suction syringes with larger diameter require lower negative pressure ( ideally 300 to 400 mmhg ) and if the size of suction syringe is 1 cm , then the negative pressure can be raised up to 500 mmhg . intradermal injection of normal saline or local anaesthetic can reduce the blister formation time by causing intradermal oedema thereby hastening the accumulation of fluid at dermoepidermal junction . pathological conditions such as cutis laxa and eds require longer time for suction blister induction , whereas atrophy induced by corticosteroid therapy may reduce the suction blister induction time by weakening the dermoepidermal junction . other manoeuvres such as pre - treatment of suction blister site with puva for about 2 weeks , increases the suction blister induction time by causing photosclerosis and thereby reducing the extensibility of the skin . van der leun et al first reported the facilitating effect of temperature on the formation of blister . the optimum temperature described for formation of blister in various studies is 40c 45c . he stated that the optimal temperature for maximal activity and stability of tyrosinase are 35c45c and at higher temperatures it becomes inactive . demonstrated faster blister formation using infrared lamp of 150 w to achieve a surface temperature of 40c which reduced the blister induction time by 55% . selected anterolateral aspect of bilateral thighs as the donor site and exposed one of the thighs of each patient to a wood 's lamp for 20 min , without the ultraviolet tubes touching the skin . this improved the speed as well as quality of blister formation , possibly by increasing the surface temperature at suction site . we took the help of a hair dryer to raise the surface temperature of the suction site and an infrared thermometer to read the surface temperature of the skin . heat - induced protein denaturation and influence of temperature on viscosity are the possible mechanisms by which heat reduces the blister formation time . highly viscous bond is present in the lamina lucida and constitutes the weakest link in the structures of dermoepidermal junction , thus facilitating separation at this level . hair dryer is a very simple instrument , easily available , and well affordable and the time saved during the procedure is quite significant . suction blister grafting has a high success rate of repigmentation in vitiligo involving the angles of the mouth but the time taken for the formation of blisters is a major roadblock . external application of controlled heat with a simple and low cost device like hair dryer can reduce the blister formation time significantly without any significant adverse effects and compromise in the final pigmentary outcome . | background : suction blister epidermal grafting ( sbeg ) is a simple and effective way of surgical repigmentation in vitiligo .
the major problem faced is the time taken for the formation of blisters .
temperature at the suction site is one of the factors affecting the blister formation time.aims and objectives : to reduce the blister formation time in sbeg by increasing the surface temperature to 44c.materials and methods : this is a left - right comparison study .
total seven patients with lip vitiligo involving both the angles of lips were enrolled .
suction syringes were applied on both the thighs of all the patients . on the right thigh
, blisters were raised as per the procedure standardised by gupta et al . on the left thigh ,
similar procedure was used , but a hair dryer was used additionally to increase the surface temperature of the skin to 44c . the time taken for the formation of
well - formed , dome - shaped , unilocular blister was noted.results:the mean time taken for the formation of blister on the right thigh was 121.1 6.2 min and on the left thigh was 69.6 5.4 min .
all the seven patients were started on puvasol after sbeg .
there was complete repigmentation of the grafted sites in all the patients after 2 months.conclusion:hair dryer is easily available , affordable and simple to use and the time saved during the procedure is quite significant . |
recent developments in optical coherence tomography ( oct ) technology have now enabled clinicians to visualize vascular flow within the retina and choroid and around the optic disc [ 1 , 2 ] . optical coherence tomography angiography ( octa ) detects blood flow by analyzing signal decorrelation or phase deviations between ultra - high speed scans . while octa may be potentially useful in assessing retinal or choroidal vessels , anterior segment vasculature imaging is still currently limited to slit - lamp photography or invasive angiography techniques , which expose patients to potential adverse reactions . the first commercially available octa system ( angiovue , optovue inc . , fremont , ca , usa ) uses spectral - domain technology , an 840 nm laser , and the split - spectrum amplitude - decorrelation algorithm ( ssada ) to improve the signal - to - noise signal of flow detection . recently , a swept - source oct system ( deep range imaging oct , topcon , tokyo , japan ) has been developed for faster scans and deeper penetration . however , the octa functions in both of these systems were designed and optimized specifically for the retina , choroid , and optic disc vascular network . therefore , in this proof of concept study we investigated the technique of adapting this octa device intended for retinal vessel imaging , modified to image corneal vascularization secondary to contact lens use , and discuss the limitations and potential benefits of this relatively new octa system . in this pilot cross - sectional study , we analyzed 10 eyes of 10 subjects ( 5 male , 5 female ; mean 24 2 years of age ) with evidence of corneal vascularization ( daily contact lens wear , more than 5 years ) but otherwise normal examination on slit - lamp evaluation at the singapore national eye center with octa imaging from 1st to 30th of october 2015 . our study followed the principles of the declaration of helsinki , with ethics approval obtained from our local institutional review board . all scans were performed by a trained technician using the swept source dri oct ( triton , topcon , tokyo , japan ) which uses a wavelength - sweeping laser with a center wavelength of 1050 nm and a tuning range of approximately 100 nm . function to obtain 3 3 mm scans , where 100,000 a - scans are acquired per second with optical axial resolution of 8 m and lateral resolution of 20 m . this was performed without the anterior segment lens as the default focus of the system was designed for the retina and choroid . the eye tracking function was disabled and manual adjustments to the xyz and focal length had to be made until two end - points were achieved : ( 1 ) the focus of the corneoscleral surface was clearly seen on the b - scan and ( 2 ) the vessels of interest were in focus on the red free image . en face oct images were examined and correlated with the depth of corneal vascularization and scans from the cornea were taken in four quadrants to obtain 360 degrees of limbal scans . all scans were obtained with a minimum signal strength index of 50 and above . for the proof - of - concept phase of the study , all subjects had octa scans in four quadrants of the cornea limbus ( superior temporal and nasal ; inferior temporal and nasal ) by a trained operator using the modified technique described . the quality of the scan images was assessed using the signal strength index ; and image quality score was assessed using a recognized system that is 0 to 4 ( 0 , no vessel discernible ; 1 , poor vessel delineation ; 2 , good vessel delineation ; 3 , very good vessel delineation ; 4 , excellent vessel delineation ) on 2 scans per quadrant , performed by two independent masked assessors ( ma , cy ) . we calculated the kappa coefficient ( ) value for the repeatability of scans using the image quality score , where 0.2 was considered slight , 0.210.40 weak , 0.410.6 moderate , 0.610.8 substantial , and 0.811.0 almost perfect in agreement . in this preliminary study , we analyzed scans from 10 eyes ( 4 scans per eye from each quadrant ) with corneal vascularization . overall we found substantial repeatability of scans in all quadrants in terms of image quality score ( mean image quality score 2.7 0.7 ; = 0.75 ) . there was no significant difference in image quality scores comparing quadrants ( superior temporal : 2.9 0.6 , superior nasal : 2.8 0.4 , inferior temporal : 2.5 0.9 , and inferior nasal : 2.4 1.0 ; p = 0.276 ) . however , we noted the highest percentage of poor image quality scores ( score < 1 ) in the inferior nasal quadrant ( 20% ) and inferior temporal quadrants ( 10% ) . we found that the swept - source octa system used here was able to image the anterior segment vasculature at various depths , with a feature to overlay the octa image over the color photograph , figure 1 . in this preliminary study , we describe a novel application of octa technology designed for retinal scans , to achieve noninvasive imaging of anterior segment vasculature by modifying the scan technique . as octa is still not widely used in the clinical setting , the purpose of this clinical pilot study was to describe a scan technique using this swept - source octa system and report its repeatability in terms of image quality . we had previously described the technique of adapting a commercially available spectral - domain octa system for the anterior segment . the ssada octa system obtains 3 to 6 mm scan cubes at a 70 khz a - scan rate with lateral and axial resolutions at 15 m . however , this technique has a relatively poor axial resolution ( ~15 m ) due to signal averaging , which limits the identification of vessels with smaller caliber or diameters , still suffering from image distortions despite an in - built motion correction , and has a limited field of view . the swept - source octa system used in this study has purported advantages of a better penetration of the deeper layers of the eye , a faster scanning speed ( 100 khz a scan rate ) , and wider field of view . specific to the macula and disc scans , the swept - source octa used here has a registration and tracking system allows for serial scans and monitoring , which is not currently available for the anterior segment . our initial scans performed in this study may suggest that the scans provide better penetration and enhanced resolution of small vessels , but this requires direct comparative studies between octa systems used to scan the same eyes in future studies . despite these potential benefits , our early experience with this system revealed that each scan still required 4 - 5 seconds , and the images also suffered from significant motion artefacts as seen in our illustrated figure . our observations from this early work suggest that octa may provide a promising noninvasive imaging alternative to fa or icga , both of which have been well - described for detecting areas of vascularization in the anterior segment [ 8 , 9 ] . we recognize the limitations of our preliminary cross - sectional study , adapting the use of this novel octa system for the cornea and anterior segment . a large prospective study of various corneal pathologies with comparisons to other octa systems , slit - lamp photography , or icga would have been ideal to evaluate this octa technology . nevertheless , we present promising results that suggest this rapid , noninvasive octa system has the potential to develop further for imaging corneal vascularization , which may aid in further understanding of its role in various corneal , conjunctival , and scleral diseases in the future . | purpose . to describe a novel technique of adapting a swept - source optical coherence tomography angiography ( octa ) to image corneal vascularization
. methods . in this
pilot cross - sectional study , we obtained 3 3 mm scans , where 100,000 a - scans are acquired per second with optical axial resolution of 8 m and lateral resolution of 20 m .
this was performed with manual xyz focus without the anterior segment lens , until the focus of the corneoscleral surface was clearly seen and the vessels of interest were in focus on the corresponding red - free image .
en face scans were evaluated based on image quality score and repeatability .
results .
we analyzed scans from 10 eyes ( 10 patients ) with corneal vascularization secondary to contact lens use in 4 quadrants , with substantial repeatability of scans in all quadrants ( mean image quality score 2.7 0.7 ; = 0.75 ) .
there was no significant difference in image quality scores comparing quadrants ( superior temporal : 2.9 0.6 , superior nasal : 2.8 0.4 , inferior temporal : 2.5 0.9 , and inferior nasal : 2.4 1.0 ; p = 0.276 ) and able to differentiate deep and superficial corneal vascularization .
conclusion .
this early clinical study suggests that the swept - source octa used may be useful for examining corneal vascularization , which may have potential for clinical applications such as detecting early limbal stem cell damage . |
recently , 1,25-dihydroxyvitamin d3 ( 1,25(oh)2d3 ) , the active form of vitamin d , has been recognized as a new player in modulation of the immune system . despite its critical role in the immune system , however , impaired vitamin d3 status has been reported amongst various populations.1 as an immunomodulatory factor , vitamin d3 affects various types of cells involved in a plethora of immune responses , including monocytes , macrophages , dendritic cells and both the t and b lymphocytes.2 indeed , a critical role has been described for vitamin d3 in different autoimmune diseases , such as multiple sclerosis , rheumatoid arthritis , psoriasis and autoimmune blistering diseases.37 however , there is a lack of in - depth research on the roles of vitamin d3 in viral hepatitis . during recent years , some studies have focused on the effect of vitamin d3 in hepatitis c virus ( hcv ) infection , as well as in infection with hepatitis b virus ( hbv ) . since the vitamin d receptor ( vdr ) is necessary for the effects of vitamin d3 , it is expected that polymorphisms of the vdr genetic sequences may also contribute to the pathogenesis of several diseases.8 since vdr is expressed on both t and b cells,9 it is especially likely that the function of these cells could be influenced by vitamin d3 level . multiple studies have shown that vitamin d3 level is significantly correlated with the suppressor function of t cells.10 several in vitro and in vivo studies of murine models , as well as patient - based clinical studies , have indicated involvement of the vitamin d signaling pathway ( both vitamin d3 level and vdr status ) related to the regulatory t cells ( tregs ) and their function . it has been concluded that vitamin d3 acts on antigen presenting cells ( apcs ) and t cells to induce peripheral tolerance via promotion of tregs.11 prietl et al.12 demonstrated that vitamin d3 supplementation is associated with a significant increase in the tregs population . thus , vitamin d could inhibit t helper ( th)1 cells and th17-associated cytokines , while promoting th2 cells and also expanding the tregs.1316 although , in hbv infection immune responses are not the main player ; nonetheless , these could lead to development of other diseases , to seroclearance or chronicity . additionally , it seems that immune cell differentiation and activation are strongly influenced by the disease course . it was recently hypothesized that both tregs and regulatory b cells ( bregs ) may function as a barrier in hbv seroclearance.17 however , the presence of tregs are essential to prevent hbv flare.18 all these reported data are in line with the purported crucial role of tregs in hbv infection . investigation of the beneficial role of vitamin d in hbv infection was first reported by luong and nguyen,19 and several other studies followed thereafter . some of the subsequent studies have showed a lower level of vitamin d3 in patients with chronic hbv ( chb ) , and these have mainly been presented during the most recent years . indeed , some authors have suggested that the decreased level of this vitamin may be the cause of abnormal findings on liver function tests ( lfts ) and/or the characteristic elevation in viral load observed in patients with chb . however , other authors have reported not finding any correlation between viral load and vitamin d3 level in hbv - infected patients.20 due to the existence of conflicting results from the different studies , we sought to perform a study in which we measured and analyzed the level of vitamin d3 in patients with three different clinical statuses of hbv infection and to compare these data with the same from selected healthy controls ( hcs ) . additionally , we made efforts to include some critical parameters , including levels of alanine transaminase ( alt ) , aspartate transaminase ( ast ) , platelet count ( plt ) and hbv dna . recently , mohamadkhani et al.21 showed that there is a negative correlation between vitamin d3 levels and viral load in iranian patients , with an acceptable population ( n = 173 ) . distinctively , however , we attempted to evaluate the association of plasma vitamin d3 and the different chb phases amongst an iranian population in the present study . eighty - four patients with chb who presented to the shahid labafinejad hospital in tehran , iran from may 2015 to february 2016 were included in the study . the patients were divided among three groups : inactive carriers ( n = 28 ) , treated ( n = 34 ) , and new ( treatment - nave ) cases ( n = 22 ) . the exact definitions of these groups are shown in table 1 . additionally , 32 hcs were included to compare their vitamin d3 levels and some other factors with the three hbv - infected patient groups . the inclusion criteria used for selection of hcs are presented in table 1 . since the available first - line treatment for hbv patients in iran was changed to tenofovir during the past years , individuals in the treated group only received tenofovir for at least 1 year , at a dose of 300 mg daily . patients with any other treatments were not included in the treated group . because of the influence of 25-hydroxyvitamin d3 from sunlight during different seasons , all of the samples used in this study were collected during autumn and winter . in addition to the vitamin d3 levels , alt , ast , plt , hbv dna and body mass index ( bmi ) were recorded for every individual ( table 2 ) . in this study , in fact , the results of measured hbv dna within the past 3 months were considered as trustworthy to include in the study . during the patient selection for study , any patient with any other liver diseases that were not associated with hbv , such as bone disorders , autoimmune diseases , cancer , any co - infections ( human immunodeficiency virus , hcv ) , and any patient taking vitamin d3 supplements during the past 3 months were excluded to minimize the effects of other parameters . in addition , the number of male patients enrolled in the study was considerably higher than that of female patients ( 63 vs 21 ) , which was due to the general higher proportion of infected males . alt and ast were measured using ifcc ( g.t kit ; pars azmoon company ) . vitamin d3 level measurement was performed using chemiluminescence ( roche kit ; elecsis company ) . the measured vitamin d3 levels were categorized as deficient , insufficient or sufficient according to findings of less than 10 ng / ml , between 10 ng / ml and 20 ng / ml , and more than 20 ng / ml , respectively . spss version 16 ( ibm corporation , usa ) was used for all statistical analyses . a p - value of less than 0.05 was considered to indicate statistical significant differences between groups . alt and ast were measured using ifcc ( g.t kit ; pars azmoon company ) . vitamin d3 level measurement was performed using chemiluminescence ( roche kit ; elecsis company ) . the measured vitamin d3 levels were categorized as deficient , insufficient or sufficient according to findings of less than 10 ng / ml , between 10 ng / ml and 20 ng / ml , and more than 20 ng / ml , respectively . spss version 16 ( ibm corporation , usa ) was used for all statistical analyses . a p - value of less than 0.05 was considered to indicate statistical significant differences between groups . the levels of vitamin d3 were significantly higher in male patients than in female patients ( 41.25 vs 28.85 , p < 0.01 ) . comparison of the vitamin d3 levels between the three hbv - infected groups and the hcs showed no significant association . although there was no significant association found between the vitamin d3 levels in the different groups , the mean vitamin d3 levels were different . as expected , the mean level of vitamin d3 was highest in the hcs and lowest in the new cases ( new case [ 29.82 ] < inactive carrier [ 32.91 ] < treated [ 39.56 ] < hcs [ 44.88 ] ) . furthermore , no significant association was found to exist between the categorized levels of vitamin d3 ( fig . although there was no significant association between vitamin d3 levels among the different groups , the mean level of vitamin d3 in any of the three hbv - infected groups was lower than that in the hcs . it seems that treatment , which clinically improves patient status , could also elevate vitamin d3 towards a normal level . inactive carriers , who have better clinical status compared with new cases , showed a higher mean level of vitamin d3 . these results indicated a possible correlation between the clinical health status of hbv - infected patients and their vitamin d3 level . after analyzing the hbv dna levels and vitamin d3 levels in the three group of hbv - infected patients , no significant association was found between these two parameters , specifically for the inactive carriers ( p = 0.171 ) , the treated patients ( p = 0.192 ) and the new cases ( p = 0.369 ) . both alt and ast levels were significantly lower in the female patients than in the male patients ( alt : 25.03 vs 37.56 , p < 0.001 ; ast : 23.78 vs 34.07 , p < 0.004 ) . in contrast , there was no significant association between the alt or ast levels and vitamin d3 in any of the hbv - infected groups . as described earlier , vitamin d3 is strongly associated with immune responses . considering the involvement of immune responses in determination of clinical status of individuals infected with hbv , it is expected that the level of this vitamin is varied during the pathogenic course of hbv infection . several other studies have shown a significant decline of this vitamin in chb patients , which was not confirmed in the present study . this finding may simply reflect the limited number of cases in each of our study groups . however , it is possible that the decreased levels of vitamin d3 detected in our chb patients , which was similarly reported in previous studies , may not be related to immune responses directly but it could affect those responses . generally , it is accepted that liver disease , such as hbv infection , can cause an impaired absorption of vitamin d , which is not directly related to the immune system . in fact , it could possibly be connected to impaired bile acid production or gut edema associated with portal hypertension.22 due to the dependence of vitamin d3 level on sunlight , it is generally accepted that in autumn and winter , the level of vitamin d3 in plasma decreases . although vitamin d3 levels of the chb groups and the hcs were all measured during the same seasons ( autumn and winter ) in this study , the overall results of measurement in the two other seasons that we did not assess may be different . additionally , amongst the iranian population , the level of vitamin d3 has been reported to be generally lower than the mean global value.23,24 because our samples were taken from an iranian population , the results may be influenced by this issue . moreover , because the hcs were not selected according to a sex - matching approach and a higher proportion of male patients were present in the study groups ( those with higher vitamin d3 level ) , the mean levels of vitamin d3 in the hcs may have been governed by the female patients , in contrast to the three other groups examined . accordingly , all of these potentially confounding factors could have impacted the mean level of vitamin d3 among the hcs so that it was less than its true level . considering the fact that vitamin d3 causes inhibition of th1 and th17 cells , which represent two important arms of immune responses during hbv infection , and also increases the risk of hbv flare related to promoted hbv - specific immune responses , it appears that vitamin d3 contributes to regulation of immune responses . this could lead to lower liver damage , because of declined cytotoxic and non - cytotoxic actions of cd4 + and cd8 + cell - associated cytokines . from the th2 and tregs promotion , which leads to decreased hbv - specific immune responses ( ifn- and tnf- ) , an elevation in viral load could occur . according to our previous studies , high levels of anti - hbv cytokines or low levels of these cytokines could lead to hbv flare and hbv reactivation , respectively.18,25 it seems that vitamin d3 contributes to prevention of hbv flare via a mechanism involving increase in tregs population and promotion of their functions . thus , vitamin d3 supplementation could represent a therapeutic option for chb patients with hbv flare . we believe that vitamin d3 has other effects on the hbv - specific immune responses , which have not yet been recognized . based on our current knowledge about the effects of vitamin d3 on t cell function and the critical roles of t cells during hbv infection , an increase in vitamin d3 level is likely to help in reversing hbv flare , whilst its role in elevation in viral load was not confirmed in the current study , neither has it been confirmed by others . | abstractbackground and aims : during recent years , the relationship between vitamin d levels and chronic hepatitis b ( chb ) infection has attracted many researchers attention . however , the results relating to the association of vitamin d levels and hbv infection have been conflicting and there remains a lack of knowledge about the effects of antiviral treatments on vitamin d level.methods : eighty - four patients with chb were assessed and divided into three groups : inactive carriers ( n = 28 ) , treated ( n = 34 ) , and new ( treatment - nave ) cases ( n = 22 ) . thirty - two healthy controls ( hcs ) were included to enable comparison with the chb groups .
the levels of vitamin d3 were measured and statistically compared among the various groups.results : male subjects had higher levels of vitamin d3 ( 41.25 vs 28.85 , p < 0.01 ) .
no association was found among any of the groups when compared with the hc group . despite the significant association ,
the hcs demonstrated a higher level of vitamin d3 , which was lower in the treated group , the inactive carrier group , and the new cases group ( new case [ 29.82 ] < inactive carrier [ 32.91 ] < treated [ 39.56 ] < control [ 44.88 ] ) .
the hbv dna levels were not associated with vitamin d3 levels in the inactive carriers ( p = 0.171 ) , the treated groups ( p = 0.192 ) , and the new cases ( p = 0.369 ) . moreover ,
the alanine transaminase and aspartate transaminase levels were not associated with vitamin d3 levels for any of the hbv - infected groups.conclusions : vitamin d3 contributes to the clinical statues of chb patients .
there is also a possible correlation between clinically healthy chb patients and vitamin d3 level . |