Datasets:

anumafzal94

/

10k-pubmed-4096

like 0

peroxisome proliferator activator receptor gamma ( ppar ) is a member of the nuclear receptor superfamily and is a ligand - activated transcription factor that regulates genes responsible for some very important biological functions including : cell growth , differentiation and metabolism and acts as dietary lipid sensor . the ppar gene is located on the human chromosome 3p25 - 24 and consists of nine exons and as a result of alternative splicing and promoter usage produces four isoforms ; ppar1 , ppar2 , ppar3 and ppar4 . primer extension studies have confirmed that ppar4 mrna is present in adipose tissue suggesting that the ppar4 isoform has a role in adipocyte biology . ppar plays critical roles in regulating lipid and carbohydrate metabolism ( energy balance ) , adipocyte differentiation , proliferation and insulin sensitivity and create a relationship between environmental factors and metabolic processes of the organism . ppar also plays roles in macrophages by enhancing foam cell formation and suppressing inflammatory cytokine production . since ppar is a nuclear transcription factor regulating multiple genes involved in energy production , glucose and lipid metabolism it may be a promising candidate gene for several major common diseases including cardiovascular disease , cancer , diabetes , inflammation and polymorphisms in this receptor may influence the pathology of these diseases . the ppar gene has been reported to be associated with various metabolic disorders including diabetes , obesity , dyslipidemia , insulin resistance , metabolic syndrome and coronary artery disease ( cad ) . several ppar2 gene single nucleotide polymorphisms ( snps ) have been reported to be associated with diabetes , obesity , dyslipidemia , insulin resistance , metabolic syndrome and cad . several genetic variations of the ppar gene have been found in the activation function domain 1 , deoxyribonucleic acid binding domain and ligand binding domain ( lbd ) of the receptor and confer some conformational changes in protein structure that may affect transcriptional activity . among several genetic variants of the ppar gene , two polymorphisms pro12ala of the exon b ( rs1801282 ) and the c1431 t silent substitution ( rs3856806 ) in the 6 exon are the most frequently occurring snps and have been associated with various diseases and extensive studies have been undertaken to assess the effects of these polymorphisms on many aspects of human physiology . the c1431 t polymorphism is also known as the c161 t or his477his was identified in 1998 by meirhaeghe et al . , and has been studied in relation to bone metabolism , metabolic syndrome , cad , obesity and glucose intolerance . the pro12ala protein polymorphism is due to a cca - to - gca missense mutation and was identified by yen et al . it is associated with type-2 diabetes mellitus , insulin resistance , obesity and metabolic disorders . in addition , numerous studies have demonstrated rare alleles of these two common variants play a role in the complex pathogenetic mechanism of major diseases supposed to be useful markers to evaluate the connection between ppar and metabolic derived disorders . given the pivotal roles of ppar in regulating metabolism several studies in various ethnic populations including , caucasians , mexican - americans , african - americans , asian , eastern asian , european , hispanic and non - hispanic have been conducted to determine allelic frequencies and genotypic distribution . there have been no studies of the distribution of c1431 t polymorphism in an iranian population and there is some controversy about the frequency of pro12ala polymorphism . therefore , the present study was designed to explore the distribution of these two common variants of ppar gene in iranian population and compare the finding with other populations . a number of 160 healthy individuals were analyzed to evaluate the frequency of ppar alleles and genotypes in a healthy iranian population . a total of 160 healthy volunteer subjects comprised of 70 males and 90 females , mainly people of iranian descent ( primarily persian ) , were selected randomly from all parts of mashhad as a second largest city in iran and enrolled in this study . a health questionnaire , including questions such as name , ethnicity , family history , age , sex and dietary habits , was provided to each participant . blood was taken in accordance with the world health organization protocol for blood donation and the healthy state of the all the participants was determined by medical history , physical examination and blood chemistry tests . subjects were excluded from the study if they had a history of congestive heart disease , liver and/or renal disease , endocrinological abnormalities and alcohol consumption or were under medications that altered blood pressure , glucose or lipid metabolism . the clinical and biochemical characteristics of the all the individuals enrolled into the study were normal at baseline . the protocol was approved by the ethics committee of the mashhad university of medical science and informed consent was obtained from all participants . genomic deoxyribonucleic acid ( dna ) was extracted from whole blood using the flexigene dna isolation kit ( qiagen ) . c1431 t and pro12ala polymorphisms of the ppar gene were determined by a predesigned taqman snp genotyping assay ( applied biosystems ) . oligonucleotides used for allelic discrimination assays for pro12ala and c1431 t were as follows : context sequences for pro/12ala ( [ vic / fam ] ) ( applied biosystems i d : c_1129864_10 ) : aactctgggagattctcctattgac[c / g ] cagaaagcgattccttcactgatacpro12 probe context sequences for c1431 t ( [ vic / fam ] ) ( applied biosystems i d : c_11922961_30 ) : context sequences for pro/12ala ( [ vic / fam ] ) ( applied biosystems i d : c_1129864_10 ) : aactctgggagattctcctattgac[c / g ] cagaaagcgattccttcactgatacpro12 probe context sequences for c1431 t ( [ vic / fam ] ) ( applied biosystems i d : c_11922961_30 ) : acctcagacagattgtcacggaaca[c / t ] gtgcagctactgcaggtgatcaagac1431 probe the reaction was performed in 25 l final volume with real - time polymerase chain reaction ( pcr ) using 96-well plates on an abi 7500 real time pcr system ( applied biosystems ) . the pcr conditions were 95c for 10 min and 40 cycles of 92c for 15 s and 60c for 1 min . individual genotypes identification was analyzed by sds software version 1.3 ( applied biosystems ) . for genotyping quality control , duplicate samples and negative controls were included to ensure the accuracy . allele frequencies of two snps were computed using genotype data obtained from these healthy controls and were compared with those reported in other populations . the statistical significance of the differences between genotypic distributions in populations was tested by the chi - square ( ) or fisher 's exact test using the spss 16.0 statistical package . allelic and genotypic frequencies for both polymorphisms of ppar gene were in hwe ( p 0.05 ) [ table 1 ] . the genotypic distribution of the c1431 t ppar polymorphism were 0.869 for cc , 0.119 for ct and 0.013 for tt and allelic frequencies were 0.93 for c and 0.07 for t respectively [ table 1 ] . for another pro12ala variant of ppar , genotypic distributions and allelic frequencies were , 0.813 for cc , 0.181 for cg and 0.06 for gg and 0.903 for c and 0.097 for g respectively [ table 1 ] . differences in allelic frequencies and genotype distribution of the polymorphisms between iranian population and those reported for other populations are shown in tables 2 and 3 respectively . allelic and genotypes frequency of studied population comparison of allelic and genotypic frequencies of ppar c1431 t variant between our population and others comparison of allelic and genotypic frequencies of ppar pro12ala variant between our population and others the present study represents the examination of the ppar gene c1431 t and pro12ala polymorphisms distribution in iranian healthy population and comparison with other populations . several studies have demonstrated these two common polymorphisms of ppar gene have a relationship with some major diseases . this current study is part of another study dealing with patients with metabolic syndrome and cads ( unpublished data ) ; many studies have showed these two common variants of ppar are associated with decreased risk of cad and ms in various populations . on the other hand , c1431 t polymorphism has not been studied in our population before , so this is why we selected these two common variants to evaluate in our population . allelic and genotypic frequencies of ppar c1431 t polymorphism in our population showed significant differences from other populations listed in table 2 except for two reports from european , one from italy , two in african - american , and one from sub - saharan african population . allelic but not genotypic frequencies in one report from european , one from caucasian , one from hispanic and one from indian showed significant differences from what we found in our iranian population . in all the populations the frequency of rare allele homozygote 's ( tt ) was low ( 0 - 7% ) , but there was one exception for a chinese population that showed more than 12% frequency that it might be due to small sample size . in general , chinese and other asian populations showed a higher frequency than others . in this case , our data was different from those of asian populations and was similar to those in australian , european and caucasian . with respect to pro12ala polymorphism , comparison of allelic and genotypic frequencies between our data and other studies listed in table 3 shows no significant differences with most of them . however there were some significant differences with two reports from china ( p = 0.00 ) , one from korea ( p = 0.041 ) , one from asia ( p = 0.00 ) , and a few reports from europe including , italy ( p = 0.003 ) , slovenia ( p = 0.017 ) , the czech republic ( p = 0.004 ) , france ( p = 0.00 ) and in an african - american population ( p = 0.00 ) as well . one report from europe and one within a caucasian population showed significance differences in allelic but not genotypic frequencies with our results . as shown in table 3 , the cc ( ( pro / pro ) genotype was the predominant form in all populations . data are presented in table 3 shows some inconsistency among different studies in the distribution of the g ( 12ala ) allele that might be due to the difference in racial and ethnic groups . the highest distribution of the g ( 12ala ) allele belongs to european and caucasian populations and the least is relate to chinese and african - american populations . most of the population in iran is genetically close to caucasian and their ancestors were the aryans who had migrated from central asia to iran . the main reason for the significant differences between our data and other populations results from iran as a country with an ethnically diverse population including pars , turk , kurd , tajik , turkmen , baloch and special religious such as muslims , zoroastrians , jews , christians and assyrians . however , iran is located along the ancient silk road and connected asia to europe and during the course of history , iranian population has encountered foreigners including macedonians , arabs , turks and mongols on various occasion . therefore , the population living in this country might be mixed due to contacting with others and the immigration of some people from neighboring nations . several studies have been undertaken on the association between the pro12ala and c1431 t mutations with numerous diseases such as cardiovascular disease , cancer , diabetes , inflammation on various populations and the results showed controversy . the controversial findings related to these polymorphisms may be attributable to genetically differences in populations . therefore , it is necessary to study in different populations to reach a general consensus in this field . an important limitation in our study further association study with a larger population base is needed to confirm our results and may be useful in understanding these snps roles in pathology of the main disease in the future . statistical differences in the distribution of two common polymorphisms of ppar gene between iranian population and others showed the importance of studying these snps in relation to some major diseases . regards to iranian different genetic with some other populations in asia and other continents , it seems that our study confirms this difference concerning the two common ppar polymorphisms .

background : peroxisome proliferator activator receptor gamma ( ppar ) is a nuclear transcription factor regulating multiple genes involved in cell growth , differentiation , carbohydrate and lipid metabolism and energy production . several genetic variations in the ppar gene have been identified to be associated with diabetes , obesity , dyslipidemia , insulin resistance , metabolic syndrome and coronary artery disease . the present study was designed to explore the distribution of two common single nucleotide polymorphisms of the ppar gene ( c1431 t and pro12ala ) in an iranian population.materials and methods : genotype frequencies for these two polymorphisms were compared for 160 healthy iranian individuals with reports from other populations . the genotyping was performed using real - time polymerase chain reaction.results:the genotype distribution of the c1431 t ppar polymorphism was 0.869 for the cc genotype , 0.119 for the ct genotype and 0.013 for uncommon tt genotype . allelic frequencies were 0.93 for c and 0.07 for t allele respectively . for the pro12ala polymorphism of ppar gene , genotypic distributions and allelic frequencies were , 0.813 for cc , 0.181 for cg and 0.06 for gg and 0.903 for c and 0.097 for g respectively . allelic and genotypic frequencies for both polymorphisms of ppar gene were in hardy - weinberg equilibrium.conclusions:iran is a country with an ethnically diverse population and a comparison of allelic and genotypic frequencies of ppar c1431 t and pro12ala polymorphisms between our population and others showed significant differences .

multiple treatment modalities exist for the repair of oroantral communications , including the use of local and free flaps , tissue expansion , allogenic tissues , and biomaterials2 . fresh human amniotic membrane ( ham ) has been used in reconstructive surgery for nearly a century2 . due to its low immunogenicity and minimal inflammation , scarring , and enhancement of epithelialization oral and maxillofacial surgeons have used it in the healing of gingival wounds3 , in vestibuloplasty , and in the prefabrication of flaps 456 . kruse et al.7 advocated the use of a multilayered application of ham for deep corneal defects . we evaluated the use of multilayered ham as a grafting material in a patient for the repair of an oroantral communication . a 29-year - old female patient had undergone removal of a grossly decayed upper right second molar tooth . the patient reported back to the department after 3 days with a complaint of nasal regurgitation of food and liquids . on clinical examination , oroantral perforation the size of the oroantral communication was measured at about 4 to 6 mm in diameter.(fig . 1 ) a confirmatory mirror test was performed over the extraction site , which revealed a communication between the oral cavity and the right antrum.(fig . 2 ) typically , a persistent oroantral communication of this size would have been repaired with a buccal advancement flap in our department . for this case , a donor mother was identified who was to undergo cesarean section in the department of obstetrics and gynaecology in chigatere hospital ( davangere , india ) . the donor was screened for infections such as hiv and hepatitis b surface antigens , and other routine investigations were carried out . the intended use of the am was explained to the patient , and consents were obtained for the procedure . the repair of the oroantral communication in our patient was planned a day after the donor 's cesarean section . in the operating room during the cesarean , the placenta was collected in a tray by the obstetrician and handed over to the oral and maxillofacial surgeon . in the same operating room , the oral and maxillofacial surgeon then carefully separated the am from the chorion of the placenta under sterile aseptic conditions in the presence of the obstetrician . the am was cleared of all blood clots and gross tissue attachment with copious amounts of tap water.(fig . 3 ) the membrane was stored overnight in a large bottle containing 85% of glycerol and 5 ml of gentamicin 80 mg / ml and stored in refrigerator at a temperature of 4. on the next day , just prior to its application over the extraction socket of the recipient patient , the membrane was soaked in normal saline for a period of 10 minutes.(fig . 4 ) this method of preparing and preserving the am has been described by kesting et al.2 for the application of closing oroantral communications in minipigs . for our procedure , the am was then folded in layers and applied over the extraction socket and secured with sutures.(fig . 5 , 6 ) the patient was followed up after 3 days , 5 days , and 7 days , during which we observed a surrounding area of granulation tissue . the treatment of oroantral fistulas has evolved over a long period of time with various modalities , including bone grafts , tissue transfer , flaps , and even stem cells . considering all methods , the closure of oroantral communications can be divided into four groups : local flaps , pedicled flaps ( e.g. , a flap from the tongue ) , free flaps , and biomaterials2 . biomaterials seem to offer an ideal treatment modality but no known biomaterial has been able to fulfill the complexity of biocompatibility and integration . in addition , incomplete coverage and the formation of scars are complications associated with oroantral communications , which further complicate their treatment . the ham is a thin semitransparent tissue forming the innermost layer of the fetal membrane and was first introduced as a dressing in 1910 by davis8 . the am consists of an epithelial monolayer , a thick basement membrane , and an avascular stroma . the am contains no blood vessels or nerves ; instead , the nutrients it requires are supplied directly by diffusion out of the amniotic fluid and/or from the underlining decidua . it is the innermost layer , nearest to the fetus , and consists of a single layer of cells uniformly arranged on the basement membrane . the support provided to the fetus throughout gestation by the basement membrane provides testimony to the structural integrity of this remarkable membrane . the compact layer of stromal matrix adjacent to the basement membrane forms the main fibrous skeleton of the am . the collagens of the compact layer are secreted by mesenchymal cells situated in the fibroblast layer . interstitial collagens ( types i and iii ) predominate and form parallel bundles that maintain the mechanical integrity of am . collagens type v and vi form filamentous connections between interstitial collagens and the epithelial basement membrane . the ham and its extracellular matrix contain components such as growth factors and antimicrobial peptides which make it an ideal scaffold material , and unlike other biomaterials , it is cheap to obtain . these peptides also induce the migration of epithelial cells , the reinforcement of basal cell adhesion , and the induction of epithelial differentiation . moreover , harvesting am is a simple procedure and does not require any special arrangements . ham is also known to have low immunogenic characteristics making it a suitable tissue for transplantation , and clinical signs of acute rejection have only rarely been observed when ham has been used as graft material . kesting et al.2 evaluated the use of multilayer ham as a grafting material for the repair of oroantral fistulas in minipigs . the result of this experiment provided evidence for the use of ham as a simple and effective method for the closure of such communications . sharma et al.9 suggested that am can be favorable graft materials for vestibuloplasty , promoting healing and preventing relapse . sham and sultana10 described the role of am in biological wound healing in a buccal mucosal defect in an operative case of leukoplakia . in another study by ahn et al.11 , the quantification of epidermal growth factor ( egf ) in am and the effect of the am - collagen complex on full - thickness skin defects was examined in rats . the concentration of egf in fresh , deep frozen , and freeze - dried am was evaluated by elisa . egf receptor ( egf - r ) immune - staining was performed in freeze - dried am . three full - thickness skin defects ( 28 mm in diameter ) were made on the dorsal surface of sprague - dawley rats . the control group was covered by vaselin gauze while the am - collagen complex and terudermis was grafted onto the two other defects . the grafted sites were retrieved at 3 days , 1 week , 2 weeks , and 4 weeks after the operation . h&e and factor viii immunohistochemical staining was performed to evaluate the microscopic adhesions , structural integrity , and micro - vessel formation . it was concluded that the egf concentration of the fresh , deep frozen , and freeze - dried am showed similar levels and that egf - r staining was observed in the epithelial layer of the freeze - dried am . egf and egf - r were well - preserved in the freeze - dried am . the am attached to collagen acted as an excellent biologic dressing with a similar effect as terudermis . the am showed anti - inflammatory activity and healing was completed at 4 weeks after the full - thickness skin defect11 . in our case , the ham proved to be an excellent scaffold layer for covering the defect of an iatrogenic oroantral communication . the membrane enhanced wound healing and complete functional and esthetic rehabilitation was achieved with no noticeable complications . biological substitutes such as hams can be efficient scaffolds for promoting the repair of oroantral communications . its ease of availability , cost - effectiveness , simple preparation , and simple storage requirements facilitates its application in most conventional dental and maxillofacial units . we have found this method to be a good alternative to the conventional methods in the treatment of oroantral communications .

the amniotic membrane is the innermost layer of fetal membrane and is attached to the chorion in the placenta . this membrane has been used for nearly a century in varied fields such as ophthalmology , reconstructive surgery , and burn treatment . in this case report , we used a human amniotic membrane to repair an iatrogenic oroantral communication that occurred during the extraction of the patient 's right upper second molar . a splint was given after the perforation was covered with human amniotic membrane and healing was clinically evaluated at various intervals . the outcome of the study revealed that the human amniotic membrane was an efficient graft material for repairing the defect caused by an iatrogenic oroantral communication following tooth extraction .

acquired chloridorrhea ( acd ) is a rare disorder presenting with chloride - rich diarrhea , severe volume depletion , metabolic alkalosis , hypochloremia , hypokalemia , hyponatremia , acute renal failure , and low urinary chloride excretion . this array of derangements is also seen in congenital chloridorrhea ( ccd ) , a neonatal disorder that generally incurs death by the third decade of life . although ccd has been described 100 times in the literature [ 2 , 3 ] , the acquired form is still elusive and may be seen with severe intestinal stress or surgery . a 58-year - old african american male presented with profuse diarrhea and severe dehydration after right hemicolectomy , extensive distal ileal resection , ileostomy , and colostomy placement post - small bowel incarceration 9 weeks before . ileosteal output approximated 3 l of watery stool per day despite diphenoxylate with atropine and loperamide therapy . he reported salt craving but denied vomiting , diuretic use , pain , or persistent childhood diarrhea . his vital signs were temperature 98.8 f , respiratory rate 20 , pulse 89 , and blood pressure 97/71 mmhg . on examination as shown in table 1 , initial laboratory values demonstrated hyponatremia , hypochloremia , hypocalcemia , hyperphosphatemia , hypomagnesemia , acute renal failure , and surprisingly , metabolic alkalosis . urine studies revealed low sodium and chloride excretion in urine suggesting gastrointestinal origin of the metabolic alkalosis . stool studies for clostridium difficile toxin , fecal leukocytes , fecal ova , and parasites were negative . hiv elisa ( human immunodeficiency virus enzyme linked immunosorbent assay ) for 1 and 2 were nonreactive . after initial fluid replacement with normal saline , he developed hypokalemia ( potassium 2.8 meq / l ) . over several days , he received 24 l of fluid and nutrient and electrolyte replenishment , but continued to have high ostomy output . short bowel syndrome likely exacerbated nutritional deficiencies and increased gastric motility , thereby promoting high ostomy output . table 1.relevant laboratory studieslabpresentation ( some values are after hydration)2 months post - operationunitsserum studiessodium129140meq / lpotassium3.74.0meq / lchloride68105meq / lbicarbonate4128meq / lcalcium6.69.8mg / dlblood urea nitrogen10311mg / dlcreatinine10.61.2mg / dlphosphorus6.2mg / dlmagnesium1.31.4mg / dlhemoglobin10.410.6g / dlph7.545po279mmhgpco252.9mmhgbase excess21.8mmol / lalkaline phosphatase298122u / last4528u / lalt8437u / ltotal protein7.66.5albumin4.13.3ferritinx352b12150.6spot urine studiescreatinine122.9mg / dlsodium<20meq / lpotassium87.6meq / lchloride<20meq / lfecal studies ( ileostomy source)consistencywateryvolume34 lph6.0 to 6.5 -sodium11964meq / lpotassium910meq / lchloride10073meq / losmolarity307346mosm / kgpotassium decreased to 2.8 meq / l after initial fluids.our lab does not report urinary sodium < 20.our lab does not report urinary chloride < 20.the ph ( 6.06.5 ) in the fecal ( and ileal collections ) represents a low bicarbonate concentration , where naturally a higher hco3 concentration would be expected in fecal fluids . the ph ( 6.06.5 ) in the fecal ( and ileal collections ) represents a low bicarbonate concentration , where naturally a higher hco3 concentration would be expected in fecal fluids . , he improved with intravenous sandostatin ( octreotide ) and omeprazole which reduce gut motility and gastric hydrochloric acid losses . at discharge , hydration status , electrolyte abnormalities , and pre - renal failure normalized ( table 1 ) , but he required two readmissions for similar , albeit less severe relapses . after surgical re - anastomosis , pathology reported only mild ileal and colonic mucosal inflammation and hyperemia . two months post - operatively , the diarrhea resolved completely , electrolytes normalized , he was gaining weight , and octreotide and omeprazole were successfully discontinued . ccd was first recognized in 1945 , but only recently have the causative cld gene and its defective gene product , dra ( down - regulated in adenoma ) , been characterized [ 5 , 6 ] . dra is a chloride bicarbonate ( or hydroxide ) ( cl / hco3 ) membrane transporter anion exchanger found in distal ileal and colonic brush borders . all reported cases of ccd demonstrate fecal chloride > 90 meq / l with half of the cases exhibiting fecal chloride concentrations greater than the sum of fecal potassium and sodium [ 3 , 7 ] . 1.(a ) normal jejunal effluent enters the ileum and hydrogen - sodium transporters secrete hydrogen ions and reabsorb sodium and water . this promotes luminal water formation leaving luminal chloride concentrations unchanged ( hence relatively concentrated ) . normal dra transporters ( 1 ) absorb chloride , and ( 2 ) secrete hco3 ( or oh ) ( kere ) which reacts with protons , thereby neutralizing ph and forming water to be absorbed distally . dysfunctional dra can not absorb chloride or secrete bicarbonate resulting in loss of chloride- , acid- , and water - rich fluid to the environment . additionally , hyponatremia and hypochloremia develop despite avid yet insufficient renal retention , contraction alkalosis , and elevated aldosterone secretion promoting renal potassium losses . ( a ) normal jejunal effluent enters the ileum and hydrogen - sodium transporters secrete hydrogen ions and reabsorb sodium and water . this promotes luminal water formation leaving luminal chloride concentrations unchanged ( hence relatively concentrated ) . normal dra transporters ( 1 ) absorb chloride , and ( 2 ) secrete hco3 ( or oh ) ( kere ) which reacts with protons , thereby neutralizing ph and forming water to be absorbed distally . dysfunctional dra can not absorb chloride or secrete bicarbonate resulting in loss of chloride- , acid- , and water - rich fluid to the environment . additionally , hyponatremia and hypochloremia develop despite avid yet insufficient renal retention , contraction alkalosis , and elevated aldosterone secretion promoting renal potassium losses . renal insufficiency due to volume contraction is common [ 7 , 8 ] though other associated renal lesions have been described . although ccd is a disease of the young , diagnosis may be delayed if the patient copes by increasing salty food consumption . however , severe disease states are unlikely to be assuaged by diet alone , making milder or clinically silent mutations in otherwise healthy persons likely . unfortunately , neither heterozygous phenotypes nor mutations manifesting with bowel stress ( i.e. bowel resection ) are known . in contrast to ccd , our previously healthy adult patient presented with acquired chloridorrhea . acquired and congenital cases differ in that acd ( i ) responds partially to potassium replacement , ( ii ) may have small quantities of chloride in the urine rather than zero often reported in ccd , ( iii ) appears to be associated with bowel resections and ostomies , and ( iv ) can be transient and reversible with surgical correction of the bowel abnormality . in 1954 , ariel reported the first case of acd in a 66-year - old male post - colectomy with colostomy presenting with copious , chloride - rich diarrhea and hypochloremic , hypokalemic alkalosis , hypokalemia , and metabolic alkalosis . twenty years later , bieberdorf et al . demonstrated that perfusing normal colons with a chloride - poor solution rich in non - absorbable ions reproduced diarrhea and electrolyte changes found in chloridorrhea , demonstrating an inducible , complex defect requiring more than potassium repletion alone . other reports of acd include that of a 39-year - old crohn 's patient with intestinal transplantation and ileostomy and three infants with intestinal obstruction and ostomy placements [ 8 , 14 ] . ostomies are not uncommon , but the rarity of chloridorrhea suggests an underlying genetic predisposition evident only with significant bowel stress . yang et al . demonstrated in animal models that chronic intestinal inflammation promotes extensive cytokine release resulting in reduced dra expression , altered epithelial permeability and electrolyte transport , and induction of intestinal chloride loss and associated electrolyte abnormalities . our tissue sample was processed in columbus , ohio , usa . reverse transcription polymerase chain reaction ( rt pcr ) for dra expression was not available at the facility . to continue to produce large volume ( diarrheal ) fluid , there is a need for high deliveries of na and cl to the ileum . this , in turn , requires good splanchnic blood flow and adequate extracellular fluid ( ecf ) . much like a cholera patient , ecf expansion during treatment paradoxically can worsen the volume of diarrhea . the treatment of ccd and acd has been generally disappointing , though acd can be transient . marx et al . reported that addition of proton - pump inhibitor ( ppi ) therapy improved the symptoms in a crohn 's patient with acd . the ppi blocks gastric hydrochloric acid and chloride secretion , thereby reducing luminal losses to the environment when dra is dysfunctional . octreotide ( sandostatin ) is useful in nonspecific treatment of different forms of secretory diarrhea ( including verner morrison syndrome and ccd ) because of its antimotility and inhibitor effects on small intestinal secretion . while ppi ( omeprazole ) and octreotide therapy improved our patient 's clinical status until he received corrective surgery , after surgery his disease resolved and further medication was no longer necessary in summary , acd presents with profuse , chloride - rich diarrhea and a surprising contraction metabolic alkalosis rather than metabolic acidosis often associated with typical diarrhea . acd and cld may represent a disease spectrum , resulting from insult to the same gene product , dra . the available literature suggests that chronic intestinal inflammation and reduction of dra expression in genetically susceptible persons post - bowel resection and ostomy placement may result in acd . although acd is rare , it is likely under - recognized in post - bowel resection patients , and requires accurate identification in order to implement appropriate treatment

a 58-year old male with a history of small bowel resection and ileostomy presented with severe dehydration and high ostomy output . laboratory investigation indicated hypochloremia , hypokalemia , hyponatremia , metabolic alkalosis , chloride - rich diarrhea , acute renal failure , and low urinary chloride excretion . due to striking similarities to congenital chloridorrhea ( ccd ) reported in neonates , we empirically diagnosed acquired chloridorrhea ( acd , chloride diarrhea ) . this is a rare disorder resulting in profuse chloride - rich diarrhea and classic metabolic derangements affecting adults with chronic intestinal inflammation , often in association with bowel surgery . in this report , we review the relevant literature and discuss the genetic defects likely contributing to both the congenital and acquired forms of chloridorrhea .

the prevalence of major depression in primary care practice is 4.8% to 9.2% rendering mood disorders to be the most important psychiatric illness in primary care settings . though some psychiatrists believe that psychotic depression is uncommon , studies continue to demonstrate that 16% to 54% of depressed patients have psychotic symptoms ; delusions occur without hallucinations in about half to two thirds in adults with psychotic depression , while hallucinations are unaccompanied by delusions in 3% to 25% of those patients . major depression with psychotic features seems to present a distinct disorder from major depression without psychotic features ; the presence of psychosis , independent of depression or level of general psychopathology , is predictive of response to antidepressants monotherapy , supporting such distinction . the continuous performance test has been used to demonstrate deficits in core attentional functioning in schizophrenia , mania , and major depression [ 36 ] . some authors have demonstrated attentional performance to be poor particularly in psychotic depression and schizophrenia rather than in depression lacking psychosis , providing another asset to strengthen the similarity of psychotic depression with schizophrenia rather than nonpsychotic depression . deficits in sustained attention in continuous performance test are shown to represent stable vulnerability indicators for schizophrenia and state - dependant indicator for major depression . the wisconsin card sorting test ( wcst ) , a widely used neuropsychological index of prefrontal cortical function , demonstrated depressed patients to have significant deficits on multiple wcst measures compared to healthy individuals . these deficits were correlated with the severity of depression and were less severe than those demonstrated by patients with schizophrenia , providing neuropsychological evidence for significant prefrontal cortical dysfunction in depression [ 911 ] . though wcst has been utilized to assess frontal lobe functions in schizophrenia and depression , specific emphasis on wcst performance in major depression with psychotic features subtype is lacking . our work attempts to utilize wcst as potential differentiating tool between schizophrenia and psychotic depression . 60 patients aged between 18 and 50 yrs were randomly recruited from the outpatient psychiatric service of alexandria university hospital . the study was approved by the ethics committee of alexandria faculty of medicine and patients signed a written consent form . diagnosis was made by structured clinical interview ( scid i for dsm iv ) in conformity with criteria of dsm iv ( diagnostic and statistical manual of mental illness in its 4th edition ) [ 12 , 13 ] . only patients scoring 4 or more on the clinical global impression for severity cgi - s scale were included so that only severe cases were recruited . to minimize the effect of medications on wcst performance , only patients who were not taking their medication for at least 1 week before presenting or being brought by a family member to the outpatient service patients having chronic debilitating diseases , mental retardation , and handicap rendering assessment unreliable were excluded . subjects included 30 patients with schizophrenia and 30 patients with major depression with psychotic features chronic course . all were rated on the brief psychiatric rating scale ( bprs ) , a valid and reliable questionnaire to assess some demographic data as well as duration of illness and wcst computerized version 128 card produced by psychological assessment resources par inc . diverse measures on the wcst were assessed including number of administered trials , completed sets , percentage of correct answers and errors , percentage of perseverative errors , number of trials to achieve the first completed category , and number of failed categories [ 16 , 17 ] . data were analyzed using pc with statistical package for social sciences spss version 13 ; the 0.05 was used as cutoff value for statistical significance . to assess comparison between schizophrenic and depressed patients regarding the whole set of parameters measured by the wcst the bonferroni correction could be applied by setting the level of significance at 0.01 , instead of 0.05 , for each wcst parameter assessed . parametric testing was used to compare between independent groups as regards means and frequencies for various parameters . both schizophrenic and psychotically depressed patients who participated in our study showed no statistical difference in terms of gender distribution , age , duration of illness , severity as assessed by cgi - s , and finally bprs as a general psychometric tool commonly applied to mental illness ( table 1 ) . as regards the different parameters assessed by the wcst , no statistical difference could be found apart from percentage of perseverative errors which was the only parameter to show statistical difference ( p < 0.05 ) ( table 2 ) . the application of bonferroni adaptation to the significance level for the whole set of items included in the wcst eliminates such difference ( table 3 ) . the wcst is one of the most widely used psychological testing tools to assess executive functioning such as problem solving , decision making , inhibitory control , and working memory . wcst performance was consistently found to be lower in patients with schizophrenia ; however , it does not seem to be specific to that disorder , because schizophrenia is characterized by a broad base of cognitive impairment , with varying degrees of deficit in all ability domains , as measured by standard clinical tests . since the wcst assesses various functions , it is difficult to differentiate its part in working memory from problem - solving capacity or other executive functions . therefore , it is not surprising that patients with unipolar depression performed poorly on the wcst . in one systemic review , 14 out of 15 studies demonstrated impairments of executive functioning in major depression . several brain regions in addition to the prefrontal cortex were shown to affect performance on the wcst . the disturbances in prefrontal areas that were demonstrated may be a necessary but not sufficient condition for a poor wcst performance . authors found that the performance of patients with chronic schizophrenia improved on the wcst when they received explicit card - by - card instructions . they concluded that patients with schizophrenia were unable to learn the wcst , suggesting unremediable deficits that were probably linked to a prefrontal dysfunction ; they also proposed that their failure did not result from not knowing but from not doing ; in other words , the necessary information was received but was not used to change behaviour . the patients were able to learn to perform other , nonprefrontal tasks , suggesting that the performance deficit on the wcst was not due to inattention or lack of effort . such improvement in wcst performance in schizophrenic patients has been also shown in recent studies [ 2022 ] . to integrate these notions , the model shows a failure in acute schizophrenia to integrate stored memories of past regularities of perceptual input with ongoing motor programs . some authors reported that there was no evidence of transfer of training effects across problem - solving tests , despite the similarity in the cognitive demands imposed by the instruments patients tested on . some authors found improvements after monetary reinforcements ; others found greater improvement after instructions without monetary reinforcement . studies reported by bellack et al . revealed that performance improved on the wcst when they combined monetary reinforcement with detailed instructions [ 24 , 27 ] . these findings indicate that some patients with schizophrenia may be able to learn the wcst , suggesting that their although the frontal lobe hypothesis of schizophrenia has a venerable history , we have seen that there are still gaps in our understanding of the precise nature of the deficit involved , as well as the reversibility of this deficit through reinforcement . though many authors tackled the poor wcst performance in schizophrenia and depressed patients with potential clinical applications for that but literature evaluating wcst in the subtype of psychotic depression is scarce and whether wcst can serve as a potential differentiation tool aiding diagnosis was not evoked in the literature . our study is limited by small sample so that extrapolation and generalization of the results are difficult and a definite need for replication on larger numbers to support our findings . although there were high numerical differences between the 2 groups , they were not significant , probably due to the low power / low sample size . another weak point is attributed to the fact that patients were not drug nave even if they were off medication for at least 1 week when presenting to the outpatient service , spontaneously or with a family member , before recruitment . , wcst could not serve as additional tool helping in differential diagnosis . due to limitations of our study , more studies are needed on larger samples and medication nave patients to explore this area .

background . differentiating between schizophrenia and major depression with psychotic features often reveals diagnostic dilemma . both share psychotic features and severe impairment in occupational functions . severe psychomotor retardation , not uncommon in psychotic depression , may simulate negative symptoms of schizophrenia . our work aims at utilizing wisconsin card sorting test ( wcst ) performance as a potential differentiating neurocognitive tool . subjects and methods . 60 patients were recruited randomly from the outpatient service at alexandria university hospital : 30 patients with schizophrenia and 30 patients with chronic psychotic depression . they were subjected to clinical global impression for severity ( cgi - s ) scale and wisconsin card sorting test ( wcst ) 128 card computerized version . results . both groups were balanced in terms of gender distribution , severity and duration of illness . the study compared all parameters of wcst . only perseverative errors showed mild significant difference ( p < 0.05 ) that disappeared when applying bonferroni adaptation , setting significance level at 0.01 instead of 0.05 . conclusion . performance on wcst is similar in schizophrenia and severe depression with psychotic features in most of the measured parameters and hence could not serve as a supplementary tool differentiating between both diagnoses in our study .

it has been well established that alcohol use or cigarette smoking or both are the most significant risk factors for the development of head and neck squamous cell carcinomas ( hnsccs ) . however , nearly every head and neck oncologist has come across patients , most of them young , with little or no tobacco or alcohol consumption ( up to 20% in some cases ) . sturgis and cinciripini demonstrated decreasing incidence rates for tobacco - associated oral , pharyngeal , and laryngeal cancers since the mid-1980s , and these rates trailed the declines in smoking prevalence by 10 - 15 years . on the other hand , oropharyngeal cancer is not demonstrating a similar decline . shiboski et al . found a dramatic rise in the incidence rates of oropharyngeal cancer in adults younger than 45 years of age in the us ( 2% per year for base - of - tongue cancer and 4% per year for tonsil cancer ) . as far back as 1982 , the presence of human papillomavirus ( hpv ) antigens in 36% of pathologic specimens of laryngeal cancers was demonstrated . since then , several hundred papers on this topic have been published . hpv genomic dna was detected in 26% of all hnsccs , whereas approximately 50% of oropharyngeal cancers contained the hpv genome . by contrast , in a multinational study , only 18% of oropharyngeal tumors were hpv , indicating that this proportion varies with geography and sexual behavior ( history of performing oral sex and oral - anal contact ) . some studies found that patients who had sexual intercourse at an early age and more than six oral sexual partners in their lifetime had a fivefold risk of having hpv in their tumor compared with patients with no oral sexual partners . also , a significant racial difference in hpv positivity was found in a clinical trial of induction chemotherapy followed by concurrent chemoradiation therapy between white patients ( 35% ) and black patients ( 4% ) . several studies demonstrated an improved prognosis for patients with hpv tumors versus patients with hpv tumors with ( chemo)radiation treatment . other studies found the same results in both patients treated with radiation or surgery and radiation [ 15 - 18 ] . investigating the correlation between hpv infection and p53 mutation in hnsccs , found that patients with p53 mutations had a history of heavier smoking in comparison with patients with hpv infection , who conversely had a more advanced stage at diagnosis . in a paper from our institution , we analyzed a homogenous group of surgically treated oropharyngeal cancers with or without postoperative radiotherapy according to commonly accepted pathologic risk factors . patients were divided into three groups according to hpv , tp53 ( tumor protein p53 ) , and p16 status . patients harboring high - risk hpv showed a significant improvement in terms of survival and occurrence of relapse and a lower incidence of smoking - related second primary tumors , independently of tumor stage and delivered treatment ( surgery alone or surgery and postoperative radiotherapy ) , thus confirming that hpv tumors represent a distinct disease among oropharyngeal cancers . in contrast , p53 mutation and p16 status seemed to lack prognostic significance in the absence of hpv infection . detected hpv-16 in 22 of 68 ( 32% ) lymph node metastases in patients with hnscc and found that all hpv-16 lymph nodes were metastases from the oropharynx . goldenberg et al . found a correlation between patients with cystic lymph node metastases and the presence of hpv dna . the quoted retrospective analyses must be interpreted with caution because of possible confounding data . for example , schwartz et al . analyzed hpv infection and survival in oral cancers , but 31.5% of their patients had an oropharyngeal tumor ( tonsil and base of the tongue ) . nevertheless , the association between hpv status and prognosis seems to be indisputable , with a better disease - specific survival for patients with hpv oropharyngeal cancers in comparison with hpv patients , whereas disease - specific survival was similar for hpv or hpv patients with nonoropharyngeal cancer . some authors even demonstrated a worse prognosis for hpv patients with laryngeal and hypopharyngeal carcinomas in comparison with hpv patients . hence , the matter seems to be restricted to oropharyngeal cancer , and the diagnosis of hpv positivity should enter as a routine test for these patients . the most clinically useful test , in situ hybridization , is available in only a few centers which is unfortunate , even if p16 immunohistochemistry may serve as a reasonable surrogate . another possible bias in the interpretation of the results of some studies is due to the staging of the presented patients , as some authors used the ajcc - uicc ( american joint cancer committee / union internationale contre le cancer ) stage grouping . it is well known that in stage iii there are t1-n1 and t3-n0 tumors , and in stage iva there are t1-n2 and t4a - n0 , and these are clearly different tumors . looking to those papers reporting t stage , we may realize that although overall tnm ( tumor , node , metastasis ) stage does not differ by hpv status , hpv tumors are more likely than hpv tumors to have a lower t stage , whereas advanced t stage is a significant risk factor for recurrence and death , independently of hpv status . some historic papers on results of radiation therapy for oropharyngeal tumors demonstrated that vegetating tumors ( t1-t2 ) are more curable than infiltrating tumors ( t4 ) . . demonstrated that patients with p16 oropharyngeal tumors are less likely to have a persistent viable tumor in neck lymph nodes after ( chemo)radiotherapy and hypothesized that a post - treatment planned neck dissection may perhaps be avoided in p16 patients . in conclusion , several authors indicate that the impact of hpv status must be evaluated in prospective clinical trials and included as a stratification factor to avoid potential confusion . the current ajcc - uicc staging system for oropharyngeal cancer needs to be modified in order to better reflect different prognoses for patients with hpv or hpv tumors and those with vegetating or infiltrating tumors .

human papillomavirus ( hpv ) is detected in a subset of patients with head and neck squamous cell carcinoma , most frequently in tumors in the waldeyer 's ring ( palatine tonsil and base of tongue ) . several studies suggest that patients with hpv - positive tumors have better survival with either concurrent chemoradiation therapy or surgery followed by radiation compared with hpv - negative patients . however , some possible confounding clinicopathologic variables may challenge the validity of this statement , for example , some authors used the tnm ( tumor , node , metastasis ) grouping stage while others used the primary tumor ( t stage ) , and other studies have demonstrated that tumors with advanced t stage were less likely to be infected with hpv . a large clinical trial with stratification of patients according to all known tumor prognostic factors is crucial to solve the question .

data for this analysis were obtained from routine monitoring programs in danish broilers and swine . approximately 450,000 broiler and chicken samples and 830,000 swine and pork samples are tested each year . a detailed description of sample collection methods and numbers of samples is available ( 4 ) . broiler flocks have been tested for salmonella since 1989 and for campylobacter since the end of 1995 . initially , flocks were tested for salmonella by the collection of 16 fecal samples ; however , since june 2000 , five sock samples the collector walks through the poultry house ; the socks absorb fecal samples ) have been collected . antemortem samples are obtained 23 weeks before slaughter by collecting five pairs of sock samples per flock ( 4 ) . before november 2000 , postmortem salmonella sampling was conducted by examination of five pooled swab samples each consisting of 10 neck - skin samples per flock . after november 2000 , postmortem sampling came from batches of poultry parts . because of this change , we excluded postmortem data ( after november 2000 ) from analysis . broiler flocks are monitored for campylobacter by examination of cloacal swabs from 10 birds per flock or batch at slaughter . since june 1995 , swine herds have been continuously monitored for salmonella by serologic testing of meat juice ( 10 g of muscle tissue are collected from the neck , diaphragm or tenderloin of the animal . this sample is placed into a container consisting of an upper coffee - filter like part to hold the meat and a lower tube - like part . the container is frozen overnight at 20c and subsequently allowed to thaw at 4c for 24 hours , causing release of the meat juice into the lower part of the tube . this juice is then tested for salmonella antibodies ) samples from each herd producing > 100 finishers ( pigs 3050 kg ) per year . in july 2001 , this requirement changed to herds producing > 200 finishers per year . the number of samples taken is dependent on herd size . based on serologic results , level 1 herds have no or few seroreactors ( animals that test positive for salmonella ) , and no intervention is required . level 2 herds have a higher proportion of seroreactors , and the herd owner must seek advice on reducing the prevalence of salmonella . level 3 herds have a large proportion of seroreactors , and the herd owner must seek advice and slaughter under special hygienic conditions . since july 1993 , salmonella in pork has been measured by monthly samples of cuts of meat from slaughterhouses . data were divided into two periods : before ( p1 ) and after ( p2 ) withdrawal of antimicrobial growth promoters . to account for factors such as seasonality , equal time periods were used for comparison ; however , periods varied from 12 to 36 months , depending on availability of data . although the voluntary discontinuation on purchasing antimicrobial growth promoter - containing feed for broilers was initiated on february 15 , depletion of feed stocks may have taken several weeks . to account for this and for the uneven withdrawal of antimicrobial growth promoters in pigs , data from 1998 ( broilers ) and period 1 and 2 refer to the time periods before ( p1 ) and after ( p2 ) the withdrawal of antimicrobial growth promoters . for this analysis , the mean prevalence of positive flocks ( broilers ) , the percentage of herds classified as level 2 or level 3 ( swine herds ) , and the percentage of positive samples ( pork ) were obtained by month for p1 and p2 . using these data , the mean prevalence for p1 and p2 were calculated and differences in means were evaluated by a t test by using sas version 8.0 ( sas institute , inc . , the prevalence of salmonella and campylobacter in broilers and swine between 1995 and 2001 is shown in the figure . prevalence of salmonella and campylobacter in danish broiler flocks , chicken meat , swine herds , and pork products , 1995-2001.the arrow indicates february 15 , 1998 the date of the voluntary stop of agp use in broilers . the bar indicates the time period during which antimicrobial growth promoters were withdrawn from use in swine herds . the mean percentage of broiler flocks testing positive for salmonella during p1 ( before withdrawal ) was 14.4% ( range 3.7% to 33.6% ) for antemortem examination and 17% ( range 8.1% to 38.8% ) for postmortem ( table 2 ) p2 samples averaged 2.4% ( range 0.2% to 5.8% ) and 4.9% ( range 0.7% to 24.9% ) , respectively . a comparison of means showed that the prevalence of salmonella was significantly lower in the period following withdrawal of antimicrobial growth promoters for both antemortem ( p<0.0001 ) and postmortem samples ( p<0.0001 ) . the average percentage of broiler flocks testing positive for campylobacter during p1 was 35.3% ( 11.4% to 64.%8 ) and p2 was 40.8 ( 18% to 77% ) . no statistical difference existed in the mean prevalence between the two periods ( p=0.2470 ) . before withdrawal of antimicrobial growth promoters . the percentage of swine herds classified as level 2 or level 3 during p1 was 5% ( 4.2% to 6.2% ) and 3.3% ( 2.5% to 4.4% ) for p2 . a comparison of means showed that the average percentage of swine herds classified as level 2 or 3 was significantly lower in the period following the withdrawal of antimicrobial growth promoters ( p<0.0001 ) . the percentage of salmonella isolated from fresh pork samples dropped from 1.1% ( 0.5% to 1.8% ) in p1 to 0.8% ( 0.4% to 1.5% ) in p2 . although the change is small , the period following the withdrawal of antimicrobial growth promoters was significantly lower ( p=0.0290 ) . contrary to concerns that withdrawal of antimicrobial growth promoters would cause an increase in pathogen load , we found a decrease in salmonella prevalence in broilers , chicken , swine , and pork and no change in the prevalence of campylobacter in broilers . two observational studies found that penicillin given to swine increased total bacterial and enterobacteriaceae counts ( 5,6 ) . other experiments found that avoparcin increased salmonella shedding in broilers and excretion rates had a dose - response effect with increasing concentrations of avoparcin ( 7,8 ) . a series of experiments in broilers showed that avoparcin , nitrovin , tylosin , flavomycin , and lincomycin caused increased shedding of salmonella in most experiments , while virginiamycin and bacitracin had little or no effect and sodium arsenilate decreased shedding ( 911 ) . holmberg et al . found that both avoparcin and monensin reduced shedding of s. infantis in broilers but a combination of the two increased shedding ( 12 ) . showed that flavophospholipol and salinomycin decreased salmonella shedding in broilers but had no significant effect on the shedding of c. jejuni ( 13 ) . our study is unique because we included a large sample of animals under natural conditions , included both animals and products , and examined the combined effect of many antimicrobial growth promoters . first , our analysis can not elucidate the impact that withdrawal of an individual antimicrobial growth promoter had on a particular pathogen or in a particular species . in addition , since avoparcin was withdrawn in 1995 , any immediate effects seen from its discontinued use will be demonstrated in p1 of our study instead of p2 . despite a change in sampling methods for broilers in june 2000 and swine herds in july 2001 , both changes increased the sensitivity of sampling , in theory leading to a higher prevalence . since this change occurred during p2 , it would tend to bias our results toward the null ; thus , including these samples gives our study a more conservative result . finally , our study only describes the prevalence of salmonella and campylobacter after the withdrawal of antimicrobial growth promoters . effects such as productivity , changes in therapeutic antimicrobial drug use and economic impact are described in another study ( 14 ) . our findings only show a temporal relationship between withdrawal and reduction , and one should be cautious not to infer causality . the fact that the decrease was seen before and during the use of antimicrobial growth promoters suggests that other factors play a role . the most obvious of these factors is the effect of the ongoing surveillance and control programs in food - producing animals . programs in broilers and swine , described each year in the annual report on zoonosis ( 4 ) , have been in effect since the late 1980s and mid-1990s and have made a substantial impact on reducing the prevalence of salmonella in primary food production . what is clearly shown from this analysis is that salmonella and campylobacter rates have not increased in food animal carriers since antimicrobial growth promoters were withdrawn in 1998 . this finding , combined with evidence that the withdrawal has taken place without remarkably noticeable effects on the productivity in broilers ( 15 ) and swine , is of particular importance in light of the emerging problem of antimicrobial drug - resistant human pathogenic organisms , which are associated with the use of antimicrobial growth promoters .

the use of antimicrobial growth promoters in danish food animal production was discontinued in 1998 . contrary to concerns that pathogen load would increase ; we found a significant decrease in salmonella in broilers before and after slaughter of swine and pork and no change in the prevalence of campylobacter in broilers .

the kingdom of bhutan is a mountainous land - locked country in the eastern himalayas , lying between the tibetan plateau in the north and the indian plains in the south . it covers an approximate area of 38,394 km , spanning roughly 150 km north to south and about 300 km east to west , with an elevation ranging from about 160 m above sea level in the south to more than 7500 m above sea level in the north . the population enumerated in 2005 is 634,982 persons , of whom 333,595 are male and 301,387 are female.1 according to the world bank , the gross national income per capita was usd 2020 in 2009.2 bhutan started its modern health system in 1961 with two hospitals , two doctors , and two nurses . during that period , the prevalence rates for tuberculosis and leprosy was up to 15 per 1000 population , and about 80% of the female population had goiter . other diseases , such as diarrhea , venereal disease , and malaria were also rampant.3,4 bhutan became a signatory to the alma - ata declaration in 1978 . since then , bhutan has ascribed the utmost importance to the health of its people . in addition , bhutan adopted gross national happiness ( gnh ) , which puts the happiness of the population at the core of developmental policies . article 9 of the constitution of bhutan prescribes that the state shall strive to promote those conditions that will enable the pursuit of gross national happiness . this noble philosophy has been debated in greater detail in various international seminars led by the centre for bhutan studies and attracted much international attention.5 happiness varies across individuals and cultures,6 despite being an ultimate goal for individuals in all human societies . this concept is embedded in most religions and cultures , but in contemporary times , the pursuit of happiness has been translated into an unwavering pursuit of economic growth.7 the concept of health and well - being has been the subject of discussion for a long time , and numerous studies have been conducted on this subject.813 in recent years , psychologists and social scientists have made strides in research on subjective well - being , and some of the major achievements have been the development of models and measurement of subjective well - being.1418 despite much progress , it has been highlighted that there is a need for more studies on the subject of health and happiness.11,19 further , despite the increasing amount of literature on health and well - being , happiness as a national goal has not always been pursued . the fourth king of bhutan , his majesty jigme singye wangchuk , in 1974 , realizing the mismatch in the trajectory of growth - oriented market economics as a developmental philosophy , formulated the concept of gnh . to this end , development should serve the total well - being of the people and economic development is only the means to achieve it.20 in bhutan , happiness is considered as a public good , and it is the responsibility of the government to create an enabling environment for the pursuit of gnh , as enshrined in the constitution.21 gnh in bhutan is based on four principles , ie , sustainable and equitable economic development , conservation of the environment , preservation and promotion of culture , and good governance . the centre for bhutan studies , as mandated by the royal government of bhutan , has developed a gnh index under nine domains ( figure 1).21 as part of the government initiative of the gnh index , the centre for bhutan studies conducted a survey based on these domains in december 2007march 2008 in 12 districts of bhutan.22 this article reviews the current state of bhutan s health and gnh , as indicated by both objective and subjective measurements . as far as we know , this is the first such report on the health status of bhutan . this research may be of use for health planners , policymakers , and future researchers in this field . for the conventional objective indicators , the literature was searched using terms bhutan and health and combinations of these two terms . we searched in the directory of open access journals , google scholar , pubmed , open j - gate , sciencedirect , and the social science research network . we also searched various web publications and reports maintained at the national portal of bhutan ( http://www.bhutan.gov.bt/government/index_new.php ) , ministry of health website ( http://www.health.gov.bt/ ) , and the centre of bhutan studies website ( http://www.bhutanstudies.org.bt/ ) . in addition , we manually searched the reports , including consultancy assignment reports and reviews done for the ministry of health at the ministry of health library and within the ministry . news reports and aide - memoire were also examined . for the subjective evaluation of health , we focused on the gnh indicator survey results conducted by the centre of bhutan studies ( available at http://www.grossnationalhappiness.com/ , accessed and downloaded on january 21 , 2010 ) . we mainly reviewed two domains of the gnh , namely health and psychological well - being . this gnh survey was carried out from december 2007 to march 2008 in 12 districts and included 950 respondents . the methodology and survey tools , including the findings from other domains , can be viewed at the above mentioned website . the literature was selected based on relevance and information extracted and reviewed by the first author , which was further examined and reviewed by the other authors . despite availability of ample information about health and well - being in general , our search yielded a paucity of published information on health and gnh in bhutan . hence , official websites , government and international reports , and consultancy reports constituted the bulk of the information discussed in this paper . article 9 of the constitution of bhutan states that the state shall provide free access to basic public health services in both modern and traditional medicine . this constitutional responsibility is delivered through a three - tiered health system , ie , primary , secondary , and tertiary levels that provide preventive , promotive , and curative services via 31 hospitals , 178 basic health units , and 654 outreach clinics scattered throughout all 20 districts and 205 subdistricts of bhutan.23,24 these broad - based health systems are required , considering that 69.1% of the bhutanese population lives in rural areas . there are no private medical facilities , and all treatment , including referrals to facilities outside the country , is provided free by the government . currently , the government is spending about 5.7% of its total planned budget on health.25 this has resulted in a noticeable result for all health indicators ( table 1).23,24,26 bhutan eliminated iodine deficiency disorder in 200327 and leprosy in 1997 , and achieved universal childhood immunization in 1991.24 in 2004 , bhutan became the first country in the world to ban the sale of tobacco.28 the incidence of malaria also decreased from 12,591 cases in 1999 to 972 cases in 2009.29 bhutan has already achieved some of its millennium development goals , including access to improved water and sanitation , and is on track to achieve the remaining goals.30,31 these achievements were commended by the international community , when the 5th world health assembly awarded its prestigious sasakawa health award to the monggar health services development project in 1997 , and when the world health organization awarded its fiftieth anniversary award for primary health care to bhutan in 1998.32 although the royal institute of health sciences currently focuses on training nurses , paramedics , and public health practitioners , there are future plans to upgrade this into a nursing and medical college to meet the human resources required in bhutan.33,34 these achievements were also acknowledged during the joint bhutan - danish international development agency health sector review.35 sources of happiness for the bhutanese population varied from financial security to travelling abroad ( figure 2).36 on a 10-point scale ( 1 = not a very happy person , 10 = a very happy person ) , the average happiness score was 6.2 for bhutan residents . both good health and access to the health infrastructure and facilities are considered important sources of happiness.36 in a gnh indicator survey , 25.5% of respondents reported their health as excellent / very good , 64.1% reported it as good , and 66.3% of men and 58.5% of women reported not having any mental or physical illness during the 30 days preceding the survey . conversely , 10.7% of men and 13.4% of women reported illness lasting 14 days or more during the same time period . long - term disability was reported by 12.6% of rural respondents and 4.4% of urban respondents . happy life years , calculated as the product of life expectancy and happiness score , resulted in 40.7 years for bhutan.37 for government performance in the 12 months preceding the survey , ratings of excellent were given by 73% of respondents for improving education , 72% for improving health services , 67% for protecting the environment , 57% for providing electricity , 49% for providing roads , 38% for fighting corruption , 38% for creating jobs , and 37% for reducing the income gap between rich and poor.38 traditional bhutanese medicine , known as gso - ba - rig - pa , is well integrated into the modern health care system.33 this form of traditional buddhist medicine , currently practiced in tibet , mongolia , and bhutan , dates back about 2500 years.39 in bhutan , this traditional service is available in all districts . in most districts , these two systems are located in the same hospital and people can choose either type of service to use . the survey showed that 78.1% of respondents consulted an astrologer for matters related to them and their family , with 13% of respondents consulting an astrologer as a first contact during an illness.37 other culturally related health determinants included in the gnh survey were consumption of alcohol and chewing of doma ( areca nut and betel leaf with a dash of lime giving a red color when chewed ) . alcohol and doma are an integral part of bhutanese tradition and culture , and are served during most ceremonies and rituals . these traditionally valued commodities may be consumed in excessive amounts causing untoward health effects . as per the annual health report , alcohol is one of the top ten causes of death in bhutan.24 the gnh indicator survey showed that 61.5% of respondents reported consuming alcohol at some point of time , with 17.7% of drinkers reporting that they had been drinking most of the time in the previous 12 months . in a similar manner , 75.8% reported chewing doma at some point in time , of whom 22.7% reported chewing doma on a daily basis . in contrast , only 17.6% of respondents reported having smoked tobacco at some point in their lives . this indicates that health risk behaviors which are culturally acceptable are more prevalent than those that are culturally proscribed . income has a strong correlation with happiness , although studies from developed countries show that income has a saturation point and does not correlate with an increase in income.40 in economic terms , bhutan has progressed from being one of the poorest countries in the 1980s to becoming one of the middle income economies of the world,41 with an annual average growth rate of 7.5% in its gross domestic product.42 however , bhutan is still a poor state , with 23.2% of the population living below the poverty line , and per capita consumption of usd 24 per person per month.42 the socioeconomic disparity is evident , with the richest 20% of the national population consuming 6.7 times more than the poorest 20% . there is also an increasing trend of mental disorders , with increasing numbers of young people suffering from stress and anxiety - related disorders.43 the gnh indicator survey found that disparities prevail in all categories of socioeconomic status for most variables measured . the survey report showed that male gender , higher educational level , strong family bonds , good health , lack of suicidal tendency , and participation in sporting and religious activities , were some of the factors contributing to happiness . while women have a longer life expectancy , men are found to be healthier , less disabled , and happier than women . these finding are in general consistent with those of other studies.18 there is no pharmaceutical company in bhutan , and medicines are centrally procured and distributed to the remote health centers every year . the availability of over 90% of essential drugs is maintained throughout the year.44 the health trust fund was created in 1997 to sustain accessibility of these essential services by the people , with a current fund accumulation of usd 23.7 million.45 this would augment the funding requirement for sustainable supplies of essential drugs and vaccines to fulfill the constitutional mandate of providing free health care . sustainable development is defined as development that meets the needs of the present without compromising the ability of future generations to meet their own needs , encompasses social , economic , and environmental dimensions.46 the values generated from these important concepts can be used for active promotion of health and pursuit of happiness . environmental preservation is one of the foundations of gnh , and in bhutan , the constitution mandates that a minimum of 60% of land area must have forest coverage . ecological degradation , ecological knowledge , and afforestation variables are measured under the environmental diversity domain . for sustainable and healthy development promoting happiness of the nation , all four dimensions of the gnh needs to be addressed in a balanced and integrated manner , and measured periodically as a developmental yardstick bhutan s strides in improving the health and happiness of its population , as suggested by various indicators , is commendable . the gnh indicator survey was taken when the country was in transition to full parliamentary democracy , and these baseline indicators can be used as a developmental yardstick . despite the achievements , as indicated by both subjective and objective measures , much still needs to be done to improve gnh in bhutan . this includes elimination of poverty , narrowing the socioeconomic gap , fighting emerging and re - emerging infectious diseases , and halting the increasing trend of mental and lifestyle - related diseases . therefore , the manner in which the health system is remodeled to address these challenging issues within the context of the growing expectations of the modern bhutanese population will affect happiness indicators , and how bhutan strives for economic growth without compromising the well - being of its people could epitomize the modern developmental paradigm .

worldwide , contemporary measures of the success of health development programs have been mostly in terms of the reduction of mortality and morbidity as well as increasing longevity . while these goals have yielded much - needed health improvements , the subjective outcomes of these improvements , as experienced by individuals and the communities , have not been considered . bhutan , under the overarching policy of gross national happiness , has provided due consideration to these subjective indicators . here , we report on the current status of health and happiness in bhutan as revealed by conventional objective indicators and subjective gross national happiness indicators . the current literature on health in bhutan in relation to the gross national happiness survey conducted by the centre of bhutan studies has been reviewed . bhutan has made great strides within a short period of modernization , as shown by both objective and subjective indicators . tremendous challenges lie ahead to achieve the ultimate goal of health and happiness , and how bhutan articulates its path to modernization may be a lesson for the rest of the world .

victims of chemical assault burns suffer from significant and devastating long - term psychological and physical effects . between 12 and 44% of all burn assaults are attributed to chemical agents [ 13 ] . worldwide , chemical assault occurs most commonly in developing countries , where there are limited medical resources and poor law enforcements . interestingly , in the uk , although relatively less common , several high - profile cases in recent years have amplified the awareness of chemical assault burns in the developed world . hong kong , often regarded as the capital of asia , paradoxically , offers a unique cultural and geographic infrastructure that increases the incidence of chemical assaults compared to their counterparts . its geographic relation with the developing mainland china results in a high influx of cross - border burns victim transfer , facilitates easier access to chemical agents , and in some cases , promotes cross - border second marriages that can lead to domestic disputes and violence . secondly , the high population density in hong kong is associated with relatively high rates of domestic crime . it is concerning that despite the reduction in the overall number of assault cases in hong kong , the incidence of chemical assaults is increasing . over a ten - year period , pwh had treated 31 cases of acid assault burn . the aim of this case report is to raise awareness the unique protocol , which emphasises the urgent surgical intervention in the acute management of chemical burns that have been developed in prince wales hospital in hong kong . this report describes a case of an acid assault burn suffered by a 16-year - old girl . the acid was thrown at her face , but she raised her arms and turned away to limit the facial damage . she sustained an 8% tbsa burn of which 6% was deep dermal to full thickness . the burn involved the face , posterior scalp and multiple patches over her back and upper limbs ( fig . she was initially taken to the nearest hospital , which commenced primary resuscitation with immediate lavage . the extent of her injuries , which included airway compromise and chemical assault , fitted the criteria for transfer to a burns centre for definitive care ( table 1 ) . she was primarily seen in the emergency department and the severity of injuries was assessed ; immediate lavage was continued . her burn injuries matched the criteria for urgent examination under anaesthesia ( eua ) , which included confluent areas of discoloured skin greater than 20 cm on the face and 100 cm on the trunk or limbs ( table 1 ) . she was taken immediately from the emergency room to the operating theatre for an eua . tangential test shaves were performed in all burn areas confirming that the burns were deep , and thin layers of tissue were removed until there was active bleeding ( lacuna - like or punctate bleeding ) ( fig . this was followed by application of porcine skin to the wound bed to assess the suitability for grafting . at day three to five one year after the incident , her wounds had healed well with minimal hypertrophic scarring on the trunk and limbs . the burns on the face that had been shaved also healed with minimal hypertrophic scarring , but two linear tracks of hypertrophic scar developed in two areas of burn that were thought to be too narrow for initial tangential shave . these hypertrophic areas were attributed to where the acid had run off , and they were subsequently treated with minor revision surgery . the conventional acute treatment of chemical burns consists of immediate and continuous water lavage for two to three days , followed by , often within one week , excisional surgery and grafting [ 811 ] . outcomes from this approach were often poor with a disproportionate need for reconstructive procedures compared to thermal burns . hypertrophic scarring is often the sequelae from conventionally treated acid burns , a feature of prolonged chemical inflammatory stimulation to a wound . this was inadvertently , but successfully demonstrated in our case by the dense scar that formed in the areas not shaved urgently . data from our centre showed that even burns that were excised as early as day two or three post - burn produced less than desirable outcomes , thus the rational for immediate surgical intervention were postulated . a retrospective study conducted at our centre compared the need for reconstruction post - acute management of chemical burns , between urgent ( within 48 h ) , conventional ( within one week ) and delayed ( after one week ) surgery . however , it failed to show a significant difference in reconstructive needs between the urgent and conventional group ; nevertheless , the urgent group displayed subjective outcome improvement and without any adverse effects ( fig . the nature of chemical injuries is that they produce a leathery - like tissue response that mandates careful tangential shaving , rather than other debridement modalities such as versajet or dermabrader , which often markedly tears tissues . tangential shaving removes sequential ultra thin slices of dermis until the appearance of lacuna - like or punctate bleeding , which indicate the presences of dermal elements . this technique maximally preserves healthy and viable tissue , whilst reducing the chemical load . in acid burns , the depth of tissue damage is often deeper than they appear , and is governed by acid concentration and duration of contact . our experience has been that we usually shave to the depth of the dermal papillae , which often presences as a lacuna of oxygenated blood that had mingled with the inflammatory fluid at the dermis - adipose tissue interface ; we refer to that as lacuna - like bleeding . this bleeding is not as profuse as we might see in a partial thickness thermal burn shaved to punctate bleeding , which represents an intact deep dermal layer . we appreciate the viability of tissues at the acute setting may be more difficult to access , but with careful tangential shaving only down to lacuna - like or punctate bleeding , we achieve reduction in chemical load with minimal risk of over - debridement . the aim is to reduce the chemical load , but not eliminate it , which is why the lavage is continued . using porcine skin to test the bed prior to definitive grafting has been a useful adjunct and we have occasionally had to remove some further tissue before the definitive graft . the principle first - aid in thermal burns is : removal of heat source and promotion of cooling ; whilst chemical burns is : dilution . however , the practicality of continuous lavage for extended periods of time to achieve adequate dilution , for chemical burns of the face , is not always feasible . there are a number of research limitations in the analysis of the efficacy of urgent surgical interventions for chemical burns ; they include small sample sizes , patient variability i.e. severity and location of the burn , and issues with ethical approval . whilst an rct would be ideal , it would be ethically questionable . having said that , the conventional treatments have evolved and are not based on scientific evidence . prospective studies involving a trial of both interventions i.e. conventional versus urgent shaving , on an individual patient may be an alternative . this could be applied for industrial burns in anatomical locations of low aesthetic impact . on the whole , early shaving of chemical burns reduces the progression of continuing corrosive acid tissues damage where simple lavage may fail to prevent , and shaving tangentially minimises excessive removal of viable and healthy tissues . the lack of hypertrophic scarring and need for further reconstructive surgery demonstrated in this case report highlighted the benefit of urgent surgical intervention , as described in our protocol for the acute management of chemical burns tangential shaving to lacuna - like or punctate bleeding optimally preserves viable and healthy tissues , whilst removing residual acid - load . our protocol for acute management of chemical burns has shown benefits in reducing hypertrophic scaring and the need for further reconstructive surgery , as demonstrated by this case report and previous retrospective comparative studies . trying to prove the benefit of urgent shaving in terms of an rct would be ethically challenging . in the meantime , primum non nocere ( do no harm ) , requires urgent reduction of dermal acid load , as lavage alone is not enough .

highlightsa case report highlighting a unique protocol for the acute management of chemical burns in hong kong.urgent ( < 48 h ) shaving of chemical burns removes residual chemical load and prevents progressive continuing acid corrosion.shaving tangentially to lacuna - like or punctate bleeding , optimally preserves healthy and viable tissues.delay in surgical interventions had been associated with higher incidences of hypertrophic scarring and need for further reconstructive surgery.trying to prove benefit in terms of an rct is however ethically challenging .

a 56-year - old man was observed in the emergency room ( er ) 4050 min after the onset of acute de - novo stabbing , pulsating and diffuse headache with subsequent appearance ( within few minutes ) of dysarthria , postural instability with retropulsion , mild objective vertigo and vomiting , acral paresthesias of upper limbs , minimal confusional state without loss of consciousness or seizures . neurological examination was relevant for reagent anisocoria ( left smaller than right ) , slight speech disorder ( dysarthria ) , retropulsion , moderate bilateral incoordination at the index - nose test , absence of fever and meningeal signs . blood pressure ( bp ) was unstable with recurrent hypertensive crises ( 200/120 mmhg ) during observation , in the absence of definite previous history of hypertension as well as of diabetes , headache , or cardiovascular problems . electrocardiographic monitoring excluded paroxysmal arrhythmias , while cardiac enzymes and creatine - kinase were negative . in the er , he was started on intravenous ( i.v . ) nimodipine ( 2 mg / hour ) with progressive normalization of bp values within 4 h. urgent brain computerized tomography ( ct ) was negative for hemorrhage and focal lesions . considering the unstable bp and the low nihss ( national institutes of health stroke scale ) score ( =3 ) at presentation , i.v . thrombolysis for possible brainstem ischemia was excluded , and the patient was put on antiplatelet therapy with salicylic acid ( i.v . 250 mg for 24 h , followed by oral administration ) as for a minor ischemic events . under i.v . salicylic acid , headache severity gradually decreased over the next 3 h , leaving only a slight diffuse , pulsating pain which remitted over the next 6 h. all the neurological signs and symptoms had completely recovered within 12 h. in order to investigate the vertebro - basilar ( vb ) district , the patient also underwent urgent brain ct - angiography with maximum intensity projection ( mip ) , multiplanar ( mp ) and three - dimensional ( 3d ) reconstructions , with the detection of left persistent primitive hypoglossal artery ( ppha ) as a large vessel originating from the internal carotid artery ( ica ) at the c2 vertebral level , entering the posterior cranial fossa through an enlarged hypoglossal canal and thus joining the lower portion of the basilar artery ( fig . 1 ) . the study was then completed through 3d volume - rendering ( vr ) reconstructions for a better definition of the anatomical details ( fig . 1 ) . collateral findings were represented by bilateral vertebral artery hypoplasia together with a small saccular aneurysm ( not - surgical ) of the anterior communicating artery , confirmed by digital subtraction angiography ( dsa ) which revealed no additional vascular abnormalities . brain magnetic resonance ( mr ) with mr - diffusion weighted imaging ( mr - dwi ) was performed 24 h after onset of symptoms and did not show recent ischemic lesions . the electroencephalogram performed 12 h after admission did not record epileptic / focal abnormalities . uncommon causes of stroke ( thrombophilia , patent foramen ovale and other relevant metabolic risk factors for stroke ) were excluded during the course of the observation.fig . 1a axial brain ct - angiography , b , c mip and 3d - reconstruction ct - angiography showing left ppha ( arrows ) . d three - dimensional - vr ct - angiography showing ppha ( arrow ) entering the posterior cranial fossa through an enlarged hypoglossal canal and thus joining the lower portion of the basilar artery , and in e ppha ( arrow ) as a large vessel originating from the internal carotid artery at the c2 vertebra level a axial brain ct - angiography , b , c mip and 3d - reconstruction ct - angiography showing left ppha ( arrows ) . d three - dimensional - vr ct - angiography showing ppha ( arrow ) entering the posterior cranial fossa through an enlarged hypoglossal canal and thus joining the lower portion of the basilar artery , and in e ppha ( arrow ) as a large vessel originating from the internal carotid artery at the c2 vertebra level the patient was then discharged with ramipril ( 5 mg per day ) plus oral salicylic acid ( 100 mg per day ) and at the 6-month control no further episode of headache with or without neurological symptoms was reported . headache associated to vb signs and symptoms , once excluded critical conditions , could suggest at least four possible diagnoses : ( 1 ) basilar - type migraine , ( 2 ) posterior reversible encephalopathy syndrome ( pres ) , ( 3 ) headache attributed to benign ( or reversible ) angiopathy of the central nervous system , and ( 4 ) headache attributed to transient ischemic attack ( tia ) or minor stroke , whose diagnostic criteria are summarized in table 1.table 1diagnostic criteria for basilar - type migraine , posterior reversible encephalopathy syndrome ( pres ) , headache attributed to benign ( or reversible ) angiopathy of the central nervous system , and headache attributed to transient ischemic attack ( tia)basilar - type migraine migraine with aura symptoms clearly originating from the brainstem and/or from both hemispheres simultaneously affected , but no motor weakness(a ) at least 2 attacks fulfilling criteria b d(b ) aura consisting of at least two of the following fully reversible symptoms , but no motor weakness : dysarthria , vertigo , tinnitus , hypacusia , diplopia , visual symptoms simultaneously in both temporal and nasal fields of both eyes , ataxia , decreased level of consciousness , simultaneously bilateral paraesthesias(c ) at least one of the following : ( 1 ) at least one aura symptom develops gradually over 5 min and/or different aura symptoms occur in succession over 5 min ( 2 ) each aura symptom lasts 5 and 60 min(d ) headache fulfilling criteria b d for 1.1 migraine without aura begins during the aura or follows aura within 60 min(e ) not attributed to another disorderposterior reversible encefalophathy syndrome ( pres ) acute or subacute neurologic presentation of headeache , nausea , vomiting , altered mental function , seizures , stupor , visual disturbancesradiological hallmarks : reversible bilateral subcortical and cortical edema with a predominantly posterior distribution ( parieto - occipital ) at fluid - attenuated inversion recovery ( flair ) mri imagingheadache attributed to benign ( or reversible ) angiopathy of the central nervous system ( a ) diffuse , severe headache of abrupt or progressive onset , with or without focal neurological deficits and/or seizures and fulfilling criteria c and d(b ) strings and beads appearance on angiography and subarachnoid hemorrhage ruled out by appropriate investigations(c ) one or both of the following : ( 1 ) headache develops simultaneously with neurological deficits and/or seizures ( 2 ) headache leads to angiography and discovery of strings and beads appearance(d ) headache ( and neurological deficits , if present ) resolves spontaneously within 2 monthsheadache attributed to transient ischemic attack ( tia ) ( a ) any new acute headache fulfilling criteria c and d(b ) focal neurological deficit of ischemic origin lasting < 24 h(c ) headache develops simultaneously with onset of focal deficit(d ) headache resolves within 24 h diagnostic criteria for basilar - type migraine , posterior reversible encephalopathy syndrome ( pres ) , headache attributed to benign ( or reversible ) angiopathy of the central nervous system , and headache attributed to transient ischemic attack ( tia ) according to the current criteria of the international classification of headache disorders2nd ed . ( ichd - ii ) , our case potentially fulfills only some of the diagnostic criteria for basilar - type migraine ( 1.2.6 ) : headache , dysarthria , vertigo ( with onset / worsening in few minutes ) , ataxia , decreased level of consciousness and simultaneous bilateral paraesthesias . however , the neurological symptoms have lasted over 60 min and were associated with de - novo headache ( first episode ) , thus excluding the above hypothesis ( table 1 ) . the second diagnosis we have considered , is pres , a rare and still poorly understood condition characterized by acute or subacute headache ( usually thunderclap type ) , nausea , vomiting , altered mental function , seizures , stupor and/or visual disturbances , with the radiological hallmarks of reversible bilateral subcortical and cortical edema with a predominantly posterior distribution ( parieto - occipital ) at fluid - attenuated inversion recovery ( flair)-mr sequences . pres has been described in association with hypertensive encephalopathy , immunosuppressive and cytotoxic medications , puerperal eclampsia , collagen disease , renal failure , thrombotic thrombocytopenic purpura , human immunodeficiency virus infection , acute intermittent porphyria , and organ transplantation . in our case , the lack of the typical mr findings and the negative electroencephalogram tend to rule out this diagnosis . headache attributed to benign ( or reversible ) angiopathy of the central nervous system ( ichd - ii 6.7.3 ) . in our case , despite the complete reversibility of all neurological signs , the lack of the radiological hallmarks strings and beads and the full headache recovery within 12 h , excludes this nosological entity ( table 1 ) . the last possible and more suitable diagnosis is that of headache attributed to transient ischemic attack ( tia)ichd - ii 6.1.2 in fact , headache occurs frequently in patients with acute cerebrovascular disorders with a frequency according to different studies ranging from 7 to 65% . several authors have stressed the greater incidence of headache among patients with ischemic events , particularly vb infarcts , due to the anatomical relationship between the posterior circulation and the trigeminal system . although relatively less frequent during tia , sudden and acute headache of unknown cause , associated to dizziness or loss of balance , may represent a warning sign of vb failure . the most common symptoms of extracranial vertebral artery involvement are represented by dizziness , blurred vision and imbalance , while vertigo is more typical of intracranial vertebral artery disease . on the other hand , tia due to basilar artery failure produces , more frequently , dizziness , double vision , dysphagia , slurred speech and unilateral / bilateral weakness . symptoms and signs due to tia ( either carotid or vb ) must resolve by definition within 24 h but sometimes they may be very brief lasting few minutes probably due to sudden and temporary bp failure . in this perspective , sacco et al . have suggested to review the ichd - ii diagnostic criteria for 6.1.2 in the agreement with the new definition of tia proposed by the american heart association study group . accordingly , tia is now defined as a transient episode of neurological dysfunction caused by focal brain , spinal cord or retinal ischemia , without acute infarction thus reducing the importance of the traditional temporal criterion for the definition of tia ( duration < 24 h ) . as a consequence , brain - mr imaging becomes now the crucial recommended tool for tia diagnosis . besides the above conditions discussed in the differential diagnosis versus the most probable hypothesis of headache attributed to transient ischemic attack ( tia ) or minor stroke , we can also exclude ichd - ii 10.3.2 ( headache attributed to hypertensive crisis without hypertensive encephalopathy ) , due to the presence of long - lasting focal neurological signs . in the present case , de - novo acute headache and transient ischemia in the posterior circulation are associated with the evidence of ppha , a rare vascular anomaly of the posterior circulation that ensures a pathological anastomosis between carotid and basilar system . at the intracranial level , four embryonic arteries ( trigeminal , otic , hypoglossal and proatlantal ) participate to the vb development : once completed , these vessels gradually regress , but in some cases they may persist . the detection is often fortuitous during angiographic examination . the trigeminal artery is generally associated with disorders of the 3rd , 4th , 5th and 6th cranial nerves , while the otic artery may cause acoustic or facial nerves palsy . the hypoglossal artery may lead to 12th nerve palsy , glossopharingeal neuralgia or vascular disorders in the posterior circulation . it originates as a branch of the cervical part of the ica between c1 and c3 levels , passes through the hypoglossal canal and joins the lower portion of the basilar artery after a tortuous course . consequently , any significant alteration of the blood flow in the proximal ica may affect the posterior circulation with possible reversible vb symptoms . less frequent is usually associated to ischemic lesions . from a pathogenetic point of view , it seems therefore reasonable to consider , in our case , the particular vulnerability of the posterior circulation due to the ppha , the associated vascular abnormalities , and its possible secondary , transient , hemodynamic failure during hypertensive phases . our clinical picture may be classified as a real tia of the posterior circulation , also considering the complete clinical recovery within 24 h and the absence of ischemic lesions ( including lacunar events ) on mr investigations . moreover , the headache presented by the patient , meets the ichd - ii diagnostic criteria for headache attributed to transient ischemic attack ( tia)subgroup 6.1.2 . in conclusion , the persistence of carotid - basilar anastomoses , although rare entities , must be considered not only in patients with isolated or combined cranial nerve deficit , but also in the presence of cerebrovascular events involving the vb system . their association with other vascular abnormalities ( hypoplasia ) can confer increased vulnerability to other factors ( hypertension ) as in the present case .

we report the case of a 56-year - old man with acute onset of de - novo stabbing , pulsating and diffuse headache with subsequent appearance ( within few minutes ) of posterior fossa symptoms ( vomiting , postural instability , anisocoria , incoordination , dysarthria , retropulsion ) lasting 912 h. recurrent hypertensive crises were detected during the acute observation in the emergency room , even in the absence of previous history of hypertension . once subarachnoid hemorrhage and focal lesions ( vascular and non - vascular ) were excluded , brain computerized tomography - angiography and digital subtraction angiography disclosed the presence of left persistent primitive hypoglossal artery with bilateral vertebral artery hypoplasia and a slight aneurysmal dilation of the anterior communicating artery . brain magnetic resonance study performed 24 h after onset of symptoms was negative for recent ischemic lesions . the clinical features of this rare vascular condition are discussed as a possible cause of magnetic resonance ( diffusion weighted imaging ) negative vertebro - basilar transient ischemic attack .

filariasis is a unusual parasitic disease in romania , last known report ( a case of lymphatic filariasis ) dating from 2005 , and in the entire world is rare too , excluding western africa [ 1 ] . therefore , suspicion of a such disease , especially in the emergency department is extraordinary and may seem to require a very specialized assessment , including the specific circulating antigens determination [ 2 ] and extended performance imaging examination . we present a male patient case ( 32 years old ) admitted in ed - county hospital craiova ( s- w romania region ) with migratory burning pain , initially in the right cervical area , then on the left frontal and upper orbital area , temporal , and the left upper eyelid , irritation , pruritus and swelling . apparently , the onset of symptoms was a few day , but six months ago he accused sudden , transient , both knee swelling , local pain , functional stiffness , with spontaneously remission after three days . the patient was classified as a green emergency triage priority , being assigned on the consultation area . at the starting point , the first diagnostic suspicion was represented by trigeminal neuritis , being also consider a conjunctivitis . the local examination provided by the emergency physician identified an inflammatory trace of 10 cm . it can feel an elastic and renitent cord with spontaneous and induced by palpation mobility . at that moment the eye examination was normal , and seeing was not affected . by surgical excision on the left upper eyelid a microfilaraemic parasite of 17 cm . length has been extracted ( fig . 1 ) and that seemed to be filaria . biological material was sent to the parasitological laboratory for specific identification of type , suspicion beings loa considering the dimensions of the parasite , the estimated age of the infection has been approximate at 1 year . the patient was subsequently taken over by the department of infectious diseases , for further investigation and therapy ( doxicicline , nonsteroidal anti - inflammatory therapy and albendazol ) no other subcutaneous determination or any clinical element identified as lymphatic damages has found , given that this type of damage is common in filariasis . later , the patient reported a trip to antalya ( turkey ) 1 year ago , where he was stung by mosquitoes on the back , neck and arms , but the area is not know as a specific one for this type of parasite . no others members of the family or touristic group has reported symptoms . in this situation , a detailed investigation detected that at the approximately moment of the contact , the patient worked as a member in a building team , developing activities at colentina hospital ( bucharest ) in a specific parasitological compartment for tropical diseases . it is very possible that the contamination occurred in this context , that involves a lots of aspects regarding work security and environment protection in this circumstances . the peculiarities of the case was the simplicity of the diagnosis due to the parasite mobility finding ( the key element ) for a disease that is basically found only in tropical areas , and the uncertain moment and specific place of the contamination which is not determined yet . in the same time we suspected that the first inflammatory reaction ( the knee oedema ) has been in context , though any node or joint inflammation were not observed after , and inflammatory tests remains normal . however , the complexity of the subject is related to the possibility that this localization is not the only one ( even if multiple affectations are uncommon but it remain possible to identify microfilaria into the soft structures of the knee ) , and the investigation and medical surveillance has to be systematic and long term extended ( minimum 2 years has been recommended by the parasitology specialist because of the further medical and epidemiological implications , and the medical history of the patient ) . a knee mri , specific blood tests and systemic inflammatory reaction study are in progress at this moment , and all the workers involved in operations at the colentina hospital are evaluated too . subcutaneous filariasis is a variant expression of infestation spinning relatively easier than lymphatic form revealed , especially if specified epidemiologic element . parasite mobility finding was the key element of an extremely quick and easy diagnosis for a disease that is basically found only in tropical areas . the peculiarity of the case is the simplicity of the emergency diagnosis and the complexity of the further medical and epidemiological implications .

a 32 year old male patient presented to the ed craiova with migratory , burning pain , to the right cervical and left upper eyelid . sudden , transient , bilateral knee swelling six months ago . an inflammatory trace and a renitent cord can feel at this level , with spontaneous mobility . a microfilaraemic parasite was surgically extracted from upper eyelid . mobility of the parasite was the key element of an extremely quick and easy diagnosis for a very rare disease but the specific circumstances of the contamination remains unclear . even uncommon , multiple determinations are possible requiring systematic and long term investigation and medical surveillance .

pulmonary alveolar proteinosis ( pap ) is characterized by accumulation of surfactant proteins in the alveoli due to defective surfactant clearance by alveolar macrophages . the clinical course of the disease is variable , ranging from respiratory failure to spontaneous resolution . a crazy - paving pattern is suggestive of , but not specific , to pap . lung biopsy ( by open - lung surgery , video - assisted thoracoscopic surgery or tblb ) is the gold standard for the diagnosis of pap . a 54-year - old male , non - smoker , non - alcoholic , known diabetic and hypertensive , presented with fever , dry cough , and progressive breathlessness for one month . initial evaluation in a different hospital confirmed hypoxia and pft ( pulmonary function tests ) was suggestive of a restrictive pattern . he was labeled as having interstitial lung disease and was discharged on oxygen and steroids . ct chest showing and # x0022 ; crazy pavement and # x0022 ; appearance his symptoms worsened gradually and he presented to our institution on high flow oxygen and was found to be pao2 - 42 on fio2 of 1 . patient was admitted in icu , blood gases showed type i respiratory failure with a pao2 of 53 mm of hg on fio2 of 0.6 . the chest x - ray [ figure 1b ] showed bilateral reticular shadows affecting the lower zones ( left > right ) . after counseling , a repeat bronchoscopy with tblb was done , which showed pulmonary alveolar proteinosis on histopathology ( pas stain was strongly positive ) [ figure 2 ] . as the patient was deteriorating , it was decided to treat him with whole lung lavage ( wll ) . chest x - ray at presentation pas stain positivity on histopathology patient was intubated with a double - lumen endotracheal tube for wll . the left lung was lavaged first with 15.5 l of warmed ( at 37c ) normal saline using aliquots of 500 ml . it had characteristic opaque , milky appearance with dense sediments on standing , which were strongly positive for pas stain . characteristic milky effluent with sediments patient 's oxygen requirement decreased to 2 - 3 liters / min post - extubation . abg showed ph-7.44 , pao2 - 62 on fio2 of 0.4 , and paco2- 44 . blood samples were sent to university of cleveland ( usa ) for anti - gm - csf antibody titers , which were reported to be highly positive , so recombinant gm - csf was started . the patient was discharged on n - acytyl cystine nebulization and rgm - csf therapy for 3 months . his chest x - ray [ figure 4b ] after 8 months was almost normal . his oxygen saturation on room air was found to be 92% , and he was carrying out his routine activities including work without getting breathless . pulmonary alveolar proteinosis ( pap ) is a rare disorder , in which lipoproteinaceous material accumulates within alveoli . pap occurs in three clinically distinct forms : genetic , auto - immune ( also called idiopathic or primary ) , and secondary . the genetic form comprises a heterogeneous group of disorders caused by mutations in the genes encoding surfactant protein b or c or the receptor for gm - csf . primary pap is associated with presence of anti- gm - csf antibodies preventing uptake of surfactant proteins by alveolar macrophages resulting in their accumulation . secondary pulmonary alveolar proteinosis develops in association with conditions involving functional impairment or reduced numbers of alveolar macrophages . such conditions include some hematologic cancers , inhalation of inorganic dust or toxic fumes and certain infections . less common symptoms include fever , chest pain , or hemoptysis , more so in the presence of secondary infections . the signs on physical examination can be unremarkable , but there are inspiratory crackles , cyanosis , and digital clubbing in a small percentage of patients . in uncomplicated cases , the chest radiograph usually reveals bilateral ill - defined nodular or confluent pattern , suggestive of pulmonary edema but without other radiographic signs of left - sided heart failure . high - resolution ct shows patchy , ground - glass opacification with superimposed interlobular septal and intralobular thickening , a pattern commonly referred to as crazy paving . pft can be normal but typically shows a restrictive ventilatory defect with a disproportionate and severe reduction of the carbon monoxide diffusing capacity . the impairment of gas exchange is secondary to filling of the alveoli with phospholipoproteinaceous material leading to ventilation and perfusion mismatch . clinical and radiographic findings often suggest the diagnosis of pap in suspected cases , while findings on examination of a bal specimen can establish the diagnosis . there are also large , acellular , eosinophilic bodies in a diffuse background of granular material that stains with pas as well as elevated levels of surfactant proteins . on light - microscopy , the architecture of the lung parenchyma is found to be preserved unless there is infection . current therapy for all types of pap remains wll , although for the congenital form of the disorder , successful lung transplantation has been reported . therapy for secondary pulmonary alveolar proteinosis generally involves wll and the treatment of the underlying condition . primary pap has been treated successfully since the early 1960s by wll , and this procedure remains the standard of care today . the median duration of clinical benefit from lavage has been reported to be 15 months . patients usually respond to one procedure of wll ( both lungs ) , but a few may require repeated wll . several prospective phase 2 trials of gm - csf therapy for idiopathic pulmonary alveolar proteinosis have been undertaken . the study conducted by seymour et al , evaluated the effectiveness of gm - csf in pap , the results have been encouraging , but the mechanism of the effect of gm - csf treatment is not entirely clear .

pulmonary alveolar proteinosis represents a rare syndrome characterized by the accumulation of proteinaceous phospholipid - laden material in the alveoli . this leads to impaired gas exchange and arterial hypoxemia of varying degrees . the diagnosis is confirmed by lung biopsy . sequential whole - lung lavage ( wll ) first described in 1963 is the standard of care . we report a case of a male diagnosed of having pulmonary alveolar proteinosis ( pap ) on transbroncial lung biopsy ( tblb ) . he was treated with sequential wll ( left followed by right , left being more involved on chest x - ray ) followed by recombinant gm - csf , with good result .

the alternation of day and night , a consequence of the rotation of the earth on its axis , means that organisms experience dramatic yet rhythmic and hence predictable environmental change . the circadian clock is an endogenous timekeeping mechanism that enables organisms not simply to respond as they experience environmental change but , importantly , to anticipate and prepare for coming change . this ability to coordinate with the environment enhances fitness in bacteria , plants , and animals . any fitness advantage accruing from circadian clock function has multiple potential bases because the circadian clock regulates many aspects of biology , including , in plants , basic metabolism , hormone signaling , and responses to biotic and abiotic stresses [ 2 - 4 ] . the molecular mechanisms of the circadian clock in eukaryotes studied to date , including fungi , flies , mammals , and plants , are rooted in coupled transcription - translation feedback loops ( ttfls ) . initially these were thought to be relatively simple loops , but it has become clear that most eukaryotic circadian oscillators are based on multiple interlocked ttfls . although eukaryotic clocks share this common architecture of multiple interlocked ttfls , the transcription factors constituting ttfls are largely distinct among plants and animals and fungi . thus , efforts to manipulate the circadian clock in order to improve plant performance will require enhanced understanding of the oscillatory mechanism in plants . excitingly , the last several years have witnessed tremendous advances in our understanding of the mechanism of the plant circadian clock . this report will describe some recent advances that pertain directly to the roles of transcriptional regulation in the oscillator mechanism . the initial model of the plant circadian clock was a negative feedback loop in which the prr gene , toc1 , was posited to encode a positive regulator of two genes encoding myb transcription factors , cca1 and lhy , which themselves encode repressors of toc1 expression . over the next several years , a number of new interlocking loops were characterized and integrated into the clock model , primarily through analysis of mutants and of gene expression data . cca1 hiking expedition ( che ) is a tcp transcription factor that binds specifically to the cca1 promoter as a transcriptional repressor . che was identified through a yeast - one - hybrid screen of a library of arabidopsis transcription factors . a variety of in vitro and in vivo studies confirmed that che binds to the cca1 promoter as a repressor . this relationship is reciprocal , as cca1 binds to the che promoter to repress transcription . this study also established via chromatin immunoprecipitation ( chip ) studies that toc1 binds to the cca1 promoter . experimental and modeling studies supported a morning loop in which cca1/lhy positively regulates prr7 and prr9 , which encode repressors of cca1 and lhy . modeling also predicted an evening loop in which a hypothetical component , y , possibly including gigantea ( gi ) , activated toc1 , which repressed y . a set of three evening - peaking clock components , including early flowering 3 ( elf3 ) , elf4 , and lux arrhythmo ( lux , also called phytoclock 1 ( pcl1 ) [ 12 - 16 ] , were shown to assemble into a so - called evening complex ( ec ) . lux is a dna - binding protein and recruits the ec , which functions as a transcriptional repressor , to targets that include prr9 and lux itself [ 16 - 20 ] . this negative autoregulation of the ec allowed a refinement of the model of the arabidopsis clock , replacing hypothetical component y with the ec . a second set of studies revisited the long - standing interpretation of toc1 as an activator of cca1 and lhy expression , initially proposed because in a loss - of - function toc1 mutant background mrna accumulation of cca1 and lhy was diminished . moreover , the three toc1-related prrs , prr9 , prr7 , and prr5 , were established as transcriptional repressors whose overlapping expression patterns served to provide sequential and extended repression of toc1 transcription throughout the day . thus , the role of toc1 as a transcriptional activator was called into question . recent studies have established unambiguously that toc1 , like its prr relatives , is a transcriptional repressor . genome - wide chromatin immunoprecipitation sequencing ( chip - seq ) identified toc1 targets , which included morning - phased ( cca1 , lhy , prr9 , and prr7 ) and evening - phased ( gi , elf4 , and lux ) clock genes . toc1 binding peaked antiphase to target gene expression , and experimental manipulation of ( either elevated or reduced ) toc1 expression affected target gene expression consistent with repression by toc1 . a second study showed that toc1 bound the cca1 promoter in vitro and in vivo . transient overexpression of toc1 allowed the identification of both upregulated and downregulated genes , leaving open the possibility that toc1 may also function , directly or indirectly , as a transcriptional activator . although both toc1 and its three prr relatives share repressor function , there are intriguing differences among them ; the repressor function of prr9 , prr7 , and prr5 requires a co - repressor , encoded by members of the topless / topless - related ( tpl / tpr ) gene family , whereas the repressor function of toc1 seems to be intrinsic . another recent demonstration of co - repressor function in the clock mechanism is that cca1 and lhy recruit the cop10-det1-ddb1 ( cdd ) complex to the toc1 and gi promoters and that det1 ( de - etiolated1 ) serves as a transcriptional co - repressor necessary for cca1- and lhy - mediated inhibition of toc1 and gi transcription . the characterization of toc1 , prr9/prr7/prr5 , and the ec as transcriptional repressors was integrated into a new model of the clock as a three - component repressilator , a ring oscillator consisting of three repressors , cca1/lhy , the ec , and prr9/prr7/prr5/toc1 . although this model is quite attractive and does a very good job in matching a variety of experimental data , it is clearly an oversimplification . for example , toc1 , prr9 , prr7 , and prr5 are pooled into a single repressor , and cca1 and lhy are pooled as a second repressor for example , cca1 and lhy can be distinguished by their temperature response , with lhy more important than cca1 for clock function at higher temperatures and cca1 more important than lhy at lower temperatures . similarly , among ec components , elf3 and elf4 show dampened transcript cycling in the cold , whereas lux cycling maintains a robust cycling amplitude . toc1 and the prrs are all transcriptional repressors , but they exhibit temporally distinct expression patterns , and mutants defective in prr function display different phenotypes most obviously toc1 mutants have a short period whereas prr7 and prr9 mutants have a long period and the double prr7 prr9 mutant has an extremely long period at high temperatures but has a wildtype period at low temperatures [ 32 - 34 ] . a second oversimplification is that the model fails to incorporate post - transcriptional control , which is becoming increasingly prominent in the plant clock . among the prrs , prr5 has been shown to interact with toc1 and this interaction regulates toc1 phosphorylation and nucleocytoplasmic partitioning . considerable recent work emphasizes a role for alternative splicing in plant clock function [ 36 - 42 ] . toc1 and prr5 show clock - regulated proteasomal degradation mediated by interaction with the f - box protein zeitlupe ( ztl ) [ 44 - 46 ] . a second prominent feature of the repressilator model is , as noted by david somers , a dearth of activators . of course , a repressor of a repressor is formally an activator . in this sense , cca1 and lhy could be activators of prr7 and prr9 by virtue of repression of the ec , itself a repressor of prr7 and prr9 . nonetheless , it seems unlikely that the plant clock ttfl would function without transcriptional activators . indeed , several recent studies have defined roles for several transcriptional activators in the plant oscillator mechanism . although cca1 is a repressor , it can also function as a transcriptional activator when transiently expressed in protoplasts . indeed , in the cca1 - 11 lhy-21 double - mutant background , cold induction of the three c - repeat binding factor ( cbf ) genes is diminished , implicating cca1 and lhy as transcriptional activators of these targets . a second example of activation of gene expression is by light - regulated wd1 ( lwd1 ) and lwd2 . the lwd1 lwd2 double mutant has a significantly shortened period , and the expression of multiple clock genes is greatly reduced . chip experiments established that lwd1 binds directly to the prr9 , prr5 , and toc1 promoters , implicating it as a transcriptional activator of these genes . lwd1 and lwd2 expression is greatly attenuated in a prr9 mutant , suggesting that prr9 may be an activator of their expression . however , direct interaction of prr9 with the lwd1 and lwd2 promoters has not been demonstrated and , given the determination that the prrs are repressors , it may be that this positive regulation of lwd1 and lwd2 by prr9 is indirect , via the repression of a repressor . cca1 and lhy are members of a larger clade of myb transcription factor genes , including eight reveille ( rve ) genes , and most of these rves show circadian - regulated expression . three of these , rve1 , rve2 ( also called circadian 1/cir1 ) , and rve7 ( also called early - phytochrome - responsive1/epr1 ) , chiefly play roles in clock output pathways [ 52 - 54 ] . however , rve8 ( also called lhy - cca1-like5/lcl5 ) seems to function more centrally in the clock oscillator . rve8 binds to the toc1 promoter , where it is associated with increased acetylation of histone h3 , which is associated with increased transcription . rve8 also binds to the evening element ( ee ) in the prr5 promoter to activate prr5 transcription . the four remaining rves ( rve3 , 4 , 5 , and 6 ) also bind to the ee , raising the possibility of functional redundancy among them . indeed , mutants defective in rve4 or rve6 function have little effect on period length but , when combined in either double- or triple - mutant combinations , enhance the long - period phenotype of rve8 - 1 . earlier work had identified an ee - binding activity present in wildtype plant extracts in the afternoon , which had been suggested as a potential activator of evening - phased clock genes , such as prr5 and toc1 . this recent work strongly suggests that rve4 , rve6 , and rve8 constitute this afternoon - phased activator of prr5 and toc1 as well as of other evening - phased clock genes , including gi , elf4 , and lux , and apparently of the morning - phased prr9 . rve8 expression increases in the prr5 prr7 prr9 triple mutant , and prr5 binds directly to the rve8 promoter . thus , rve8 ( and presumably rve4 and rve6 ) and prr5 ( and possibly prr7 and prr9 ) constitute a negative feedback ttfl . very recently , two lnk transcription factors , lnk1 and lnk2 , have been shown to activate transcription of afternoon - peaking clock - regulated genes , including the critical clock genes prr5 and the ec component elf4 , as well as the clock regulated f - box protein gene fkf1 that plays a critical role in flowering time . toc1 and prr9/7/5 each bind to the lnk1 and lnk2 promoters , and lnk mrnas accumulate to increased levels in toc1 and in prr7 prr9 mutants . thus , the lnks and the prrs form negative feedback loops in which the lnks activate prr transcription , and the prrs feed back to repress lnk transcription . although somers 's dearth of activators has been at least partially redressed by the identification of lwds as transcriptional activators of prr9 , of rve8 ( and rve4 and rve6 ) as transcriptional activators of toc1 , prr5 , and other ee - regulated genes , and of lnks as transcriptional activators of prr5 and elf4 , a number of key questions remain . are there transcriptional activators of these two critical clock genes ? moreover , although these two genes are typically pooled in our consideration and in our models , they can be distinguished on a number of grounds . as mentioned above , the expression of cca1 and lhy differs in response to temperature , contributing to temperature compensation of the clock , but it remains unclear how this is effected . this report has focused on transcriptional regulation but included a partial enumeration of some of the levels of post - transcriptional regulation employed by the plant circadian clock . one emerging area is the role of nucleocytoplasmic partitioning in the regulation of clock protein function . as mentioned above , prr5 regulates not only the phosphorylation of toc1 but also the nuclear import and subnuclear localization of toc1 , with an obvious implication for toc1 as a transcriptional repressor . two recent papers extend this mode of regulation , via subnuclear and nuclear - cytoplasmic partitioning , to a second clock component , gi . the circadian clock is not unusual in employing regulatory mechanisms that include transcriptional and post - transcriptional aspects , but the implications for complexity and the challenges of assembling a complete and nuanced model of the clock mechanism are quite obviously significant . while the challenges are great , the rewards will be commensurate . plant biologists face the daunting challenge of providing increased agricultural production in the face of a declining agricultural landmass that is being altered by resource depletion , pollution , and a changing climate . impaired circadian function reduces plant growth and fitness , offering the hypothesis that optimizing circadian function will enhance crop productivity , particularly in crops grown over broad latitudinal ranges . greater refinement of our understanding of the circadian clock mechanism is necessary to inform manipulation of the circadian clock towards the goal of enhancing agricultural productivity .

the circadian clock allows organisms to temporally coordinate their biology with the diurnal oscillation of the environment , which enhances plant performance . accordingly , a fuller understanding of the circadian clock mechanism may contribute to efforts to optimize plant performance . one recurring theme in clock mechanism is coupled transcription - translation feedback loops . to date , the majority of plant transcription factors constituting these loops , including the central oscillator components circadian clock associated 1 ( cca1 ) , late elongated hypocotyl ( lhy ) , and timing of cab2 expression 1 ( toc1 ) , and the related pseudo - response regulators ( prrs ) , are transcriptional repressors , leading to a model of the clock emphasizing repressive interactions . recent work , however , has revealed that a subset of the reveille ( rve ) family of myb transcription factors closely related to cca1 and lhy are transcriptional activators in novel feedback transcription - translation feedback loops . other recently identified transcriptional activators that contribute to clock function include light - regulated wd 1 ( lwd1 ) and lwd2 and night light - inducible and clock - regulated transcription factors night light - inducible and clock - regulated1 ( lnk1 ) and lnk2 . collectively , these advances permit a substantial reconfiguration of the clock model .

interest in dental esthetics has increased rapidly during the last few decades , among both patients and dentists.1 because the focus of many adults has shifted toward esthetics , it becomes a primary consideration for patients seeking prosthodontic treatment . when planning treatment , dentists have to understand beauty , harmony and proportion , as perceived by society.2 anterior occlusion relationships , malocclusions and posterior occlusion relationships are intraoral parameters that can affect facial appearance . dental appearance is one of the most important aspects of facial attractiveness and encompasses not only tooth color , but also the position , shape , size and related aspects of teeth , such as gingival morphology and upper lip height during rest position and smile.3 - 5 one of the most important aspects of dental and facial esthetics is the display of anterior teeth . esthetic is assessed by viewing the patient from the front in dynamic states , like conversation , facial expressions and smiling . the aspect of maxillary anterior teeth plays an important role not only in dental esthetics , but also in facial esthetics.6 the maxillary central incisor is considered to be the primary reference tooth , more important than the rest of the anterior teeth in regards to the visible coronal tooth structure.7,8 for esthetic purposes , the maxillary anterior teeth must be in proportion to facial morphology.9 - 11 many authors emphasized the need for achieving width - to - length proportions in the smile that harmonize with the face , and the golden proportion was suggested as guideline . the ideal maxillary central incisor should be approximately 0.8 width , compared with length , but it has been reported to vary between 0.72 and 1.24.12 - 15 a higher width - to - length ratio means a squarer tooth , and a lower ratio indicates a longer appearance . it has been suggested that the width - to - length ratios of the maxillary anterior teeth were not affected by gender15 . however , significant gender differences in width - to length ratios were recorded in other previous studies.13,16,17 in one study , male subjects exhibited from 0.5 to 1 mm larger tooth width than female subjects.18 restorative dentistry frequently entails correction of tooth size discrepancies associated with various lengths and/or widths.19 consequently , tooth dimensions may be an important aspect of esthetic reconstruction . proper diagnosis of tooth size in each patient is critical when planning treatment for esthetic restorative dentistry.7 currently , the perception of attractiveness is extremely influenced by media , including movies , television commercials and fashion magazines . they all entered in our life bringing facial " standards " that should convey perceptions of beauty , healthiness and fitness , mixed with feelings of social achievement , intelligence , richness and happiness . a beautiful face seems the key to success.20 - 22 consequently , dentists should have a deep understanding of those quantifiable and objective facial characteristics considered " attractive " by the public.23 - 26 the aims of this study were to ( 1 ) determine whether celebrities considered to be beautiful differ in the width - to - length ratio of the maxillary central incisor from non - celebrities of the same age and race , and ( 2 ) compare gender differences in the width - to - length ratio of the maxillary central incisor during smiling . all of the subjects had all anterior teeth present with no caries , extreme occlusal wear , extrusion , obvious deformities or tooth mobility . they were assigned to two groups , i.e. the control and experimental group , and two different groups of adults were analyzed . the control group consisted of 40 adults ( 20 male and 20 female ) aged 25 to 39 years ( mean age 33.23.8 years ) , selected according to criteria of dentofacial normality , with normal occlusion , no crowns , porcelain laminate veneers or composite resin restorations in the anterior maxillary segment , and no mandibular or craniocervical disorder . anterior tooth images of the subjects ( non - media group ) were taken in a frontal view with all subjects in maximum smiling position . each subject was seated in a dental chair with the head upright and with the occlusal plane of the maxillary teeth parallel to the floor . digital photographic equipment ( ixus 210 is ; canon inc . , tokyo , japan ) was used . the images recorded were acquired with the software driver for the digital camera of a personal computer ( xnote t290 ; lg electronics inc . , gumi , korea ) , translated to joint photographic experts group ( jpeg ) format and stored in database software . the experimental group consisted of 40 celebrities ( 20 male and 20 female ) , selected on the basis of their soft - tissue facial appearance . the selected celebrities ranged in age from 25 to 39 years ( mean age 28.96.2 years ) . facial photographs of the media group were collected from the internet websites ( www.naver.com , www.google.co.kr ) . the collected photographs were with smiles showing maxillary anterior teeth from the front and with the resolution of 96 dpi or over ( fig . the mesiodistal and incisogingival dimensions of the maxillary central incisor were measured using a computer program for analysis , measurement and edition of photographs ( photoshop 7.0 ; adobe systems inc . the width and length was measured at the widest mesial - distal portion and longest apical - coronal portion of the tooth ( fig . 3 ) . the same investigator measured 80 photographs 5 times with the same method for accuracy , and the mean value was used for analysis . shapiro - wilk 's test was used and revealed normal distribution of the measures in width - length ratio . the independent t - test the student 's t - test was performed to determine gender differences in the width - to - length ratio of each group . for the width - to - length ratios of maxillary central incisor , mean values , standard deviations and significant differences between the two groups are listed in table 1 . descriptive statistics ( mean and standard deviation ) were computed separately in the media and non - media groups . comparisons between mean values computed in media versus non - media groups were performed using the student 's t - test . the media group ( 0.770.13 ) had significantly lower width - to - length ratio of maxillary central incisor than non - media group ( 0.880.06 ) . table 2 shows that no significant gender differences were found in the width - to - length ratio of the maxillary central incisor in media group . in non - media group , there were marked differences between male and female subjects ( table 3 ) . when the mean width - to - length ratio of the maxillary central incisor was compared for gender differences in all subjects , the data revealed that the mean width - to - length ratio of men was significantly higher than the corresponding value for women ( table 4 ) . the maxillary anterior teeth are closely related to the jaw and facial appearance , which are important for esthetics and significant in terms of dental anatomy and physical anthropology . the size and form of the maxillary anterior teeth are important for both dental and facial esthetics . the maxillary anterior teeth should be put in optimal dentolabial relations , in harmony with the overall facial appearance . the most influential factors contributing to harmonious anterior dentition are the size , shape and arrangement of the maxillary anterior teeth , particularly the maxillary central incisors , as viewed from the front.9 - 11,14 in a previous study on the shapes and sizes of teeth , sterrett et al . analyzed the width , length and width - to - length ratio of the maxillary anterior teeth and investigated gender differences . they found significantly increased maxillary anterior teeth width and length measures in caucasian males , compared to females.13 they also reported that , in caucasians , the mean width - to - length ratio of the three anterior maxillary tooth groups was 0.81.13 gender variations in the dimensions of the anterior teeth have been noted , with men showing wider anterior teeth than women.6,13,15,17 in turkish population , hasanreisoglu et al . , reported that the dimensions of the central incisors varied by gender.7 they reported that , overall , men 's teeth were bigger than women 's . gillen et al.15 reported that the maxillary anterior teeth of men were wider and longer than those of women . owens et al.6 measured the width of the maxillary central incisor in several racial groups and reported variations in most of them , with men again having wider central incisors than women . in a study by brisman,14 the width - to - length ratio of 0.75 was preferred when a variety of tooth shapes were assessed by dental students and patients . however , most of the studies have been focused on teeth of western population , whereas studies in koreans have been scarce . therefore , in order to help with diagnosis and treatment planning , the ratio of maxillary anterior teeth of korean adults was investigated . in the present study , we evaluated the ratio by measuring the maxillary central incisor of korean adults because , when considering the number of subjects , it was difficult to make a direct comparison between koreans and westerners . analyzing esthetics of facial appearance involves different methods , such as directly measuring with a caliper , measuring on photographs , cephalometry analysis and usage of computer images . in the present study , photographs were used . the recent advancement of using a computer program that immediately imports images taken with a digital camera is convenient and free of the burden of directly measuring on human bodies . also , using such a program makes it possible to enlarge a photograph by its own magnification power . the present study in korean adults revealed that the ratio of maxillary central incisor was 0.72 to 1.24 . the ratio for the media group was 0.77 , whereas that of the non - media group was 0.88 , and the difference between the two was statistically significant . the celebrities showed similar results to the esthetic criteria ( golden ratio 0.8).7 it appeared that the maxillary central incisor of the non - media group showed a more square - like form , due to the teeth having shorter length and/or greater width than those of media group . in terms of selecting the subjects , the celebrities were chosen in order to exclude subjectivity in evaluating one 's physical appearance . the result could be attributed to their previous dental treatment , as they need to be seen more beautiful for their professions . in terms of gender difference , the values for men were greater than in women , as shown in other studies . considering the fact that both male and female celebrities are shown to the public with such ratio , in esthetic restoration of a maxillary central incisor , gender should not be important , provided that the ratio is close to 0.8 and fits one 's facial appearance . based on the result , the ratio of maxillary central incisor should be a very important clinical indicator in esthetic restoration of maxillary anterior teeth . because the values of the tooth width and length were measured by anterior tooth images , a little difference was found between the actual and measured values of the maxillary central incisor . this discrepancy was created by the curvature of the arch and angulation of the maxillary anterior teeth in relation to the frontal plane of the photograph . additional research in a larger sample size , selected more systematically , is needed before extrapolating our results to the general population . the media group had lower width - to - length ratio of maxillary central incisor than non - media group . the width - to - length ratio of the maxillary central incisor of men was greater than those of women significantly .

purposewe aimed to identify a more esthetic width - to - length ratio by analyzing maxillary central incisor of korean adult population . information regarding tooth ratio in the korean population may be useful to clinicians when restoring anterior teeth.materials and methodsa total of 40 men and 40 women were included in this study . the non - media group included 40 non - celebrities , who were healthy and 25 to 39 years old , with normal dentofacial appearance . the media group consisted of 40 celebrities selected only on the basis of their soft - tissue facial appearance . the facial photographs of 40 celebrities were collected from the internet websites . the width and length of the maxillary central incisor were measured using adobe photoshop 7.0 , a software for analysis , measurement and edition of photographs . data were analyzed statistically using the independent t - test at 5% statistical significance level.resultsthe mean ratio for the media group was 0.77 , whereas that of the non - media group was 0.88 . the difference between the two groups was statistically significant . no significant gender differences were found in the width - to - length ratio in media group . in non - media group , however , there were significant differences between female and male.conclusionafter analyzing maxillary anterior teeth of korean adults , our results were in accordance with the general western standards of esthetics . a dentist restoring the natural look and beauty of teeth will have to consider those standards .

muscular dystrophies with an autosomal recessive mode of inheritance comprise of a genetically heterogeneous group of disorders . among these , miyoshi myopathy ( mm ) is an early - adult onset , autosomal recessive form of distal muscular dystrophy , characterized by predominant involvement in the calf muscles and highly elevated serum creatine kinase ( ck ) levels ( 1 ) . mm has been known to be caused by mutations in the dysferlin gene ( dysf ) on chromosome 2p13 ( 2 ) . mutations in the same gene were also identified in patients with limb - girdle muscular dystrophy type 2b ( lgmd2b ) ( 3 ) , and distal anterior compartment myopathy ( 4 ) . these diseases caused by mutations in dysf are known by the term ' dysferlinopathy ' . although mm patients and their mutations in the dysf gene have been found from all over the world , only a few cases have been reported in korea ( 5 - 8 ) . considering that there have been many reports of mm among japanese population ( 9 ) , the incidence of mm might be underestimated in korea since both countries are geographically and ethnically related with each other ( 10,11 ) . in the present study , we performed clinical and genetic analysis of three korean patients with mm and found that all patients had compound heterozygous mutations in the dysf gene . three unrelated and non - consanguineous patients with clinical features of mm were evaluated ( table 1 ) . all the patients experienced early adulthood onset of slowly progressive muscle weakness , which preferentially involved muscles in the lower extremities . patients 1 and 2 had a history of steroid medication under the presumptive diagnosis of polymyositis according to the muscle biopsies and both showed transient responses . the genomic dna was extracted from the peripheral blood leukocytes using a wizard genomic dna purification kit according to the manufacturer 's instructions ( promega , madison , wi , u.s.a . ) . all the coding exons as well as the flanking introns of the dysf gene were amplified using the primer sets designed by the authors ( primer sets available on request ) . a polymerase chain reaction was performed with a thermal cycler ( model 9700 , applied biosystems , foster city , ca , u.s.a . ) using the following conditions : 32 cycles of denaturation at 94 for 30 sec , annealing at 60 for 30 sec , and extension at 72 for 30 sec . after the amplicon ( 5 l ) treatment with 10 u shrimp alkaline phosphatase and 2 u exonuclease i ( usb corp . , cleveland , oh , u.s.a . ) , direct sequencing was performed with the bigdye terminator cycle sequencing ready reaction kit ( applied biosystems ) using a abi prism 3,100 genetic analyzer ( applied biosystems ) . three unrelated and non - consanguineous patients with clinical features of mm were evaluated ( table 1 ) . all the patients experienced early adulthood onset of slowly progressive muscle weakness , which preferentially involved muscles in the lower extremities . patients 1 and 2 had a history of steroid medication under the presumptive diagnosis of polymyositis according to the muscle biopsies and both showed transient responses . the genomic dna was extracted from the peripheral blood leukocytes using a wizard genomic dna purification kit according to the manufacturer 's instructions ( promega , madison , wi , u.s.a . ) . all the coding exons as well as the flanking introns of the dysf gene were amplified using the primer sets designed by the authors ( primer sets available on request ) . a polymerase chain reaction was performed with a thermal cycler ( model 9700 , applied biosystems , foster city , ca , u.s.a . ) using the following conditions : 32 cycles of denaturation at 94 for 30 sec , annealing at 60 for 30 sec , and extension at 72 for 30 sec . after the amplicon ( 5 l ) treatment with 10 u shrimp alkaline phosphatase and 2 u exonuclease i ( usb corp . , cleveland , oh , u.s.a . ) , direct sequencing was performed with the bigdye terminator cycle sequencing ready reaction kit ( applied biosystems ) using a abi prism 3,100 genetic analyzer ( applied biosystems ) . patient 1 was a 45 yr - old male patient who had presented with progressive weakness in both lower extremities for the previous 17 yr . he noticed difficulty in running and atrophy of the lower leg muscles at 27 yr of age . the muscle weakness and atrophy progressed . a neurological examination showed bilateral motor weakness and symmetric atrophy of the entire lower extremity muscles , which were more severe on the distal part than on the proximal part . marked atrophy of the lower leg muscles with relatively spared pelvic girdle and upper thigh muscles resulted in a stalk - leg appearance . he had been diagnosed of having a polymyositis at the age of 28 yr as a result of a muscle biopsy of the medial gastrocnemius showing myopathic changes with inflammatory cell infiltration . his 43 yr - old younger sister was affected in the same way in her early thirties and found it difficult to walk up and downhills . since then , the muscle weakness worsened so that walking was still possible but only for short distances using a cane . she also had difficulty in holding her baby due to extended weakness of her upper extremity muscles . patient 2 was a 30 yr - old female who presented with difficulty in stair walking and pain in her low back and knee . difficulty in climbing stairs developed at 26 yr of age and this difficulty in walking gradually worsened so that she could not climb stairs without the support of her upper extremities . a neurological examination showed atrophy of both calf muscles , decreased strength of the lower extremity muscles , and an absent tendon reflex . she could not stand on her tip - toe , but standing on her heels was possible . the emg revealed the myopathic changes in gastrocnemius , rectus femoris , and biceps brachii muscles . a muscle biopsy without immunohistochemial stain from the biceps brachii suggested a diagnosis of inflammatory myopathy . magnetic resonance imaging of her lower leg disclosed symmetric fatty degeneration and decreased muscle volume of the posterior compartment muscles in both lower legs . the anterior and lateral compartment muscles had either a normal or a relatively normal signal intensity and morphology . patient 3 was a 37-yr - old man with quadriparesis who first became aware of periodic weakness in his lower extremities at the age of 18 yr . he noticed difficulties in standing and climbing stairs at the age of 21 and could not walk by himself by the age of 33 . an examination at the age of 37 showed incomplete quadriparesis and he could walk with a four - point crutch . his older sister developed lower extremity weakness and atrophy at the age of 18 yr and could not walk by the age of 36 . direct sequencing analysis identified five heterozygous mutations in the dysf gene including three novel mutations ( fig . patient 1 and his sister had compound heterozygous mutations of a novel c to t transition ( c.2494c > t ) in exon 24 resulting in a nonsense mutation ( gln832x ) along with a previously reported missense mutation ( c.2997g > t ; trp999cys ) . the gln832x mutation was also found in the patient 2 with a novel missense mutation ( c.2974c > t ; trp992arg ) . patient 3 had two mutations including a novel a to t transversion ( c.3307a > t ) in exon 30 , which resulted in a nonsense mutation ( lys1103x ) , and a previously reported insertion mutation ( c.4200dupc ) in exon 39 resulting in a frame shift mutation ( ile1401hisfsx8 ) . three novel mutations ( gln832x , trp992arg , and lys1103x ) were not detected in 100 control chromosomes . patient 1 was a 45 yr - old male patient who had presented with progressive weakness in both lower extremities for the previous 17 yr . he noticed difficulty in running and atrophy of the lower leg muscles at 27 yr of age . the muscle weakness and atrophy progressed . a neurological examination showed bilateral motor weakness and symmetric atrophy of the entire lower extremity muscles , which were more severe on the distal part than on the proximal part . marked atrophy of the lower leg muscles with relatively spared pelvic girdle and upper thigh muscles resulted in a stalk - leg appearance . he had been diagnosed of having a polymyositis at the age of 28 yr as a result of a muscle biopsy of the medial gastrocnemius showing myopathic changes with inflammatory cell infiltration . his 43 yr - old younger sister was affected in the same way in her early thirties and found it difficult to walk up and downhills . since then , the muscle weakness worsened so that walking was still possible but only for short distances using a cane . she also had difficulty in holding her baby due to extended weakness of her upper extremity muscles . patient 2 was a 30 yr - old female who presented with difficulty in stair walking and pain in her low back and knee . difficulty in climbing stairs developed at 26 yr of age and this difficulty in walking gradually worsened so that she could not climb stairs without the support of her upper extremities . a neurological examination showed atrophy of both calf muscles , decreased strength of the lower extremity muscles , and an absent tendon reflex . she could not stand on her tip - toe , but standing on her heels was possible . the emg revealed the myopathic changes in gastrocnemius , rectus femoris , and biceps brachii muscles . a muscle biopsy without immunohistochemial stain from the biceps brachii suggested a diagnosis of inflammatory myopathy . magnetic resonance imaging of her lower leg disclosed symmetric fatty degeneration and decreased muscle volume of the posterior compartment muscles in both lower legs . the anterior and lateral compartment muscles had either a normal or a relatively normal signal intensity and morphology . patient 3 was a 37-yr - old man with quadriparesis who first became aware of periodic weakness in his lower extremities at the age of 18 yr . he noticed difficulties in standing and climbing stairs at the age of 21 and could not walk by himself by the age of 33 . an examination at the age of 37 showed incomplete quadriparesis and he could walk with a four - point crutch . his older sister developed lower extremity weakness and atrophy at the age of 18 yr and could not walk by the age of 36 . direct sequencing analysis identified five heterozygous mutations in the dysf gene including three novel mutations ( fig . patient 1 and his sister had compound heterozygous mutations of a novel c to t transition ( c.2494c > t ) in exon 24 resulting in a nonsense mutation ( gln832x ) along with a previously reported missense mutation ( c.2997g > t ; trp999cys ) . the gln832x mutation was also found in the patient 2 with a novel missense mutation ( c.2974c > t ; trp992arg ) . patient 3 had two mutations including a novel a to t transversion ( c.3307a > t ) in exon 30 , which resulted in a nonsense mutation ( lys1103x ) , and a previously reported insertion mutation ( c.4200dupc ) in exon 39 resulting in a frame shift mutation ( ile1401hisfsx8 ) . three novel mutations ( gln832x , trp992arg , and lys1103x ) were not detected in 100 control chromosomes . this study identified five different mutations in three korean mm patients , and all patients had compound heterozygous mutation in the dysf gene . the c.2997g > t ( trp999cys ) mutation is reported to be one of the most frequent mutations found in japanese mm patients , and has been associated with a significantly later onset and a relatively mild form of mm ( 9 ) . the age at onset in patient 2 with the c.2997g > t mutation was delayed compared with the other patients , but was earlier than the mean age at onset reported elsewhere ( 9 ) . the c.4200dupc mutation ( ile1401hisfsx8 ) , which was found in two patients with mm or lgmd2b , appeared in the dysferlin sequence variations in the leiden muscular dystrophy pages . the c.2494c > t ( gln832x ) mutation was novel and was found in 2 unrelated patients , which might be due to a possible founder effect in the korean population . however , it will be necessary to perform haplotype analysis and collect more data on mm patients in korea to address this issue . some patients with mm can be easily misdiagnosed as having an inflammatory myopathy because inflammation is frequently observed in patients with mm and the inflammatory changes found in patients with mm are indistinguishable from those observed in patients with inflammatory myopathy ( 12 ) . indeed , two patients in this study had previously been suspected of having a form of inflammatory myopathy based on the muscle biopsy findings . ( 13 ) reported that the presence of inflammation is not an exclusion criterion in muscular dystrophy related to a dysferlin deficiency , while the muscle biopsies of mm or lgmd2b patients generally demonstrates signs of a dystrophy with a dysferlin deficiency . it is possible that some mm patients have been erroneously diagnosed with polymyositis based on the absence of dystrophic features and the presence of inflammation in the muscle biopsies . therefore , mm should be considered when making a differential diagnosis of patients exhibiting distal myopathy and muscular inflammation on muscle biopsies , and dysf gene analysis should also be considered .

miyoshi myopathy ( mm ) is an autosomal recessive distal muscular dystrophy caused by mutations in the dysferlin gene ( dysf ) on chromosome 2p13 . although mm patients and their mutations in the dysf gene have been found from all over the world , there is only one report of genetically confirmed case of mm in korea . recently , we encountered three unrelated korean patients with mm and two of them have previously been considered as having a type of inflammatory myopathy . the clinical and laboratory evaluation showed typical features of muscle involvement in mm in all patients but one patient initially had moderate proximal muscle involvement and another showed incomplete quadriparesis with rapid progression . direct sequencing analysis of the dysf gene revealed that each patient had compound heterozygous mutations ( gln832x and trp992arg , gln832x and trp999cys , and lys1103x and ile1401hisfsx8 , respectively ) among which three were novel . although mm has been thought to be quite rare in korea , it should be considered in a differential diagnosis of patients exhibiting distal myopathy .

bee venom pharmacopuncture ( bvp ) is a new type of treatment combining the efficacy of acupuncture and the pharmacological actions of the venom that is artificially extracted and refined from live honey bees ( apismellifera ) . bvp has been used to treat degenerative and rheumatoid arthritis [ 2 - 5 ] and spine disorders [ 6 - 9 ] . however , several types of allergic responses can occur during the treatment period ; especially , anaphylactic shock , which is fatal to people who are hypersensitive to bee venom , is an obstacle faced by korean doctors who use bvp . thus , sweet bee venom ( sbv ) was developed to reduce these allergic responses . enzymes , known as allergens , are eliminated through a protein separation technique , so only melittin is left in sbv . melittin is the dominant component of bee venom ; melittin constitutes 40% 50% of bee venom s dried weight and has strong anti - inflammatory and analgesic actions [ 10 , 11 ] . sbv has been reported to have fewer allergic responses than bvp ; for that reason , sbv treatment is considered to be as effective , or better , than bvp treatment [ 12 , 13 ] . also studies using several toxicity tests have shown sbv to be safe [ 14 - 19 ] . until now bvp has been administered intramuscularly , intracutaneously or into acupoints . however , in our opinion , intravenous injection should be possible if sbv is a safe medium . thus , we conducted a single - dose toxicity test of sbv administered intravenously in sprague - dawley ( sd ) rats , and we report the results here . twenty - four sd rats of each gender were obtained from a specific pathogen - free facility ( orientbio inc . , gyeong- gi , korea ) at 5-weeks of age and were used after a week of quarantine and acclimatization . the animals were housed in a room maintained at 20.0 23.0 under a relative humidity of 42.8% 68.9% . the room was illuminated with artificial lighting from 07:00 to 19:00 hours and 10 15 air changes per hour . three animals were housed in suspended stainless - steel wire - mesh cages and were allowed sterilized tap water and commercial rodent chow ( teklad certified irradiated global 18% protein rodent diet 2918c , harlan laboratories , inc . , u.s.a . ) . the protocol of this study was approved by the institutional animal care committee of biotoxtech , co. ( oh chang , korea ) . sbv was prepared using a freeze dryer ( fd 8508 , ilshin lab co. ltd . , korea ) by ginseng & venom ( g & v ) co. ( wonju , korea ) and was stored at 20. a high - performance liquid chromatography ( hplc , agilent 1100 series , agilent technologies ltd . twenty healthy male and 20 healthy female rats were selected by average weights , and 5 rats of each gender were assigned to 1 of 4 groups : control ( normal saline ) , low dosage ( 0.1 ml / animal ) , medium dosage ( 0.5 ml / animal ) , and high dosage ( 1.0 ml / animal ) . in a pilot study , no mortalities had been observed at a dosage of 1.0 ml / animal of sbv in male and female sd rats ; based on that results , we set the high dose at 1.0 ml / animal . the control group was administered 1.0 ml / animal of normal saline ( lot no . all animals were observed for clinical signs at 30 minutes , 1 hour , 2 hours , 4 hours and 6 hours after the injection of sbv . clinical signs were observed daily from the injection day to 14 day after the first injection . the body weight of each rat was measured at the initiation of treatment and at 3 days , 7 days and 14 days after the injection . blood samples were drawn from the abdominal aorta by using a syringe needle under ether anesthesia . blood samples were collected into tubes containing ethylenediaminetetraacetic acid ( edta ) and were analyzed by using a blood counting analyzer ( advia 120 , siemens , germany ) to determine the red blood cell count ( rbc ) , hemoglobin concentration ( hgb ) , hematocrits ( hct ) , mean corpuscular cell volume ( mcv ) , mean corpuscular hemoglobin ( mch ) , mean corpuscular cell hemoglobin concentration ( mchc ) , platelet count ( plt ) , white blood cell count ( wbc ) , wbc differential count , reticulocyte ( reti ) count , prothrombin time ( pt ) and active partial thromboplastin time ( aptt ) . for the serum biochemistry analysis , blood samples were centrifuged at 3,000 rpm for 10 minutes and analyzed using an auto - analyzer ( 7180 , hitachi , japan ) . serum biochemistry parameters , including alanine aminotransferase ( alt ) , aspartate aminotransferase ( ast ) , alkaline phosphatase ( alp ) , gamma glutamyl transpeptidase ( ggt ) , blood urea nitrogen ( bun ) , creatinine , total bilirubin , total protein , albumin , albumin / globulin ratio ( a / g ratio ) , total cholesterol , triglycerides ( tg ) , phosphorus , glucose , calcium , chloride , sodium and potassium , were examined . tissue was obtained from the injection site on all animals and was then fixed with 10% neutral buffered formalin solution . the sections were stained with hematoxylin & eosin ( h&e ) stain , and bone tissue was decalcified with calci - clear - rapidtm ( national diagnostics , u.s.a . ) for microscopic examination . data on the weights and from the hematology and serum biochemistry results were tested by using a statistical analysis system ( sas , version 9.3 , sas institute inc . if the variance was homogeneous , the data were subjected to a one - way analysis of variance ( anova , p < 0.05 ) . if a significant difference was observed between the groups , the data were analyzed by using the multiple comparison procedure of the dunnett s test ( p < 0.05 , p < 0.01 ) . if the variance was not homogeneous , the data were analyzed by using the kruskal - wallis test ( p < 0.05 ) . no clinical signs were observed in male and female sd rats during the observation period . caudal congestion was observed in male and female rats in the experimental groups from 30 minutes to 6 hours after injection , but it was not observed the next day or after . this symptom seemed to have occurred at the administration of sbv ( table 1 ) . compared to the control group , the weights of the experimental groups showed no significant changes . no significant change in hematology was observed in any of the groups ( table 2 ) , and no meaningful change in serum biochemistry was observed in any of the groups ( table 3 ) . significant changes were minimal and were found not to be dose dependent . during necropsy , no abnormal macroscopic appearances were observed in either the control experimental groups . perivascular infiltration of inflammatory cells into the lateral vein at the injection site was observed in the male control group and in the female high dosage group , but those changes were minimal and seemed to be due to the injection ( table 4 ) . the concept of blood vessels has been studied in oriental medicine [ 20 , 21 ] , and the intravenous injection of mountain ginseng pharmacopuncture is currently being used by korean medical doctors . bvp possesses strong analgesic and anti - inflammatory actions by stimulation of the hypothalamic - pituitary - adrenal axis to increase the secretion of adrenocortical hormone . . however , bee venom contains enzymes with molecular weights greater than 10,000 such as phospholipase a2 ( pla2 ) and hyaluronidase . these proteins act as antigens , causing allergic reactions , which presently limits its clinical use . administration of bvp without a full understanding of its allergic responses , especially anaphylactic shock , puts practitioners and patients at great risk . sbv was developed to replace dangerous bee venom with a safe material and to guarantee its effects [ 22 , 23 ] because sbv is pure melittin obtained through a protein separation technique using gel filtration [ 12 , 24 - 26 ] . in previous studies , the ld50 of sbv in sd rats was over 30 mg / kg , and the maximum dose of sbv in beagle dogs was found to be over 9 mg / kg through single - dose toxicity tests . also , no significant changes were observed at doses below 0.14 mg / kg in sd rats , and no direct side effects of sbv were observed at a dose of 0.56 mg / kg in beagle dogs through a 4-week repeated - dose toxicity test , and the no observed adverse effect level of sbv was found to be approximately 0.07 mg / kg in male and female sd rats based on a 13-week repeated - dose toxicity test with a 4-week recovery period [ 16 - 19 ] . whether intravenous injection of sbv is possible is controversial . however , in our opinion , the use of sbv should be safe , so we conducted an intravenous single - dose toxicity test of sbv in sd rats . our objective was to investigate the influences of intravenous injection of sbv in sd rats . in the present study , no significant changes were observed in the weights or in the results of the hematology , biochemistry , necropsy and histopathological examinations in sd rats . because no mortalities were observed in this study , the lethal dose of mgp is judged to be above 1.0 ml / animal in sd rats . this study is the first attempt to evaluate the safety of intravenous sbv injection , and further studies on this subject are needed . the results of this study suggest that the lethal dose of sbv is above 1.0 ml / animal in sd rats and that intravenous injection of sbv in sd rats is safe . s.d . , standard deviation ; n , number of animals ; rbc , red blood cell ; hgb , hemoglobin ; hct , hematocrit ; mcv , mean corpuscular volume ; mch , mean corpuscular hemoglobin ; mchc , mean corpuscular hemoglobin concentration ; plt , platelet ; reti , reticulocytes ; wbc , white blood cell ; neu , neutrophils ; lym , lymphocytes ; mono , monocytes ; eos , eosinophils ; baso , basophils ; pt , prothrombin time ; aptt , activated partial thromboplastin time . significantly different from control by dunnett 's t - test : * p < 0.01 . alt , alanine aminotransferase ; ast , aspartate aminotransferase ; alp , alkaline phosphatase ; ggt , gamma glutamyl transpeptidase ; glu , glucose ; bun , blood urea nitrogen ; crea , creatinine ; t - bil , total bilirubin ; t - chol , total cholesterol ; tg , triglycerides ; tp , total protein ; alb , albumin ; a / g ratio , albumin / globulin ratio ; p , phosphorus ; ca , calcium ; na , sodium ; k , potassium ; cl , chloride .

objectives : anaphylactic shock can be fatal to people who become hypersensitive when bee venom pharmacopuncture ( bvp ) is used . thus , sweet bee venom ( sbv ) was developed to reduce these allergic responses . sbv is almost pure melittin , and sbv has been reported to have fewer allergic responses than bvp . bvp has been administered only into acupoints or intramuscularly , but we thought that intravenous injection might be possible if sbv were shown to be a safe medium . the aim of this study is to evaluate the intravenous injection toxicity of sbv through a single - dose test in sprague - dawley ( sd ) rats.methods:male and female 6-week - old sd rats were injected intravenously with sbv ( high dosage : 1.0 ml / animal ; medium dosage : 0.5 ml / animal ; low dosage : 0.1 ml / animal ) . normal saline was injected into the control group in a similar method . we conducted clinical observations , body weight measurements , and hematology , biochemistry , and histological observations.results:no death was observed in any of the experimental groups . hyperemia was observed in the high and the medium dosage groups on the injection day , but from next day , no general symptoms were observed in any of the experimental groups . no significant changes due to intravenous sbv injection were observed in the weights , in the hematology , biochemistry , and histological observations , and in the local tolerance tests.conclusion:the results of this study confirm that the lethal dose of sbv is over 1.0 ml / animal in sd rats and that the intravenous injection of sbv is safe in sd rats .

congenital heart disease encompasses a variety of lesions that may include communication / s between the left and the right side of the heart . such communications may cause volume overload in the short and medium term , possibly resulting in heart failure , or irreversible complications in the long term such as eisenmenger 's syndrome . previously , such defects ( typically atrial ( asd ) and ventricular septal defects ( vsd ) and patent ductus arteriosus ( pda ) ) were closed surgically . over the last decade , a vast variety of devices have been developed to close such defects through the transcatheter route . we report one patient who had self - limiting haemolysis after implantation of an amplatzer perimembranous vsd device . our patient was born via normal vaginal delivery at 38 weeks gestation after an uneventful preganacy . at the routine 6 week visit , she was noted to be failing to thrive and a 3/6 systolic murmur was noted . diuretics were commenced and she throve . at 4 years of age , she was admitted to the paediatric surgical ward with fever , abdominal pain and vomiting . surgical exploration of the abdomen under antibiotic cover was normal , as was an echocardiogram at this time . fever persisted and a repeat echocardiogram showed tricuspid valve endocarditis with a large vegetation that eventually eroded part of the valve resulting in significant regurgitation . the endocarditis was treated with antibiotics and transcatheter closure of the vsd was done successfully using a 14 mm amplatzer perimembranous vsd device at 5 years of age . one week after discharge , she was readmitted due to jaundice and dark coloured urine . haemoglobin was 9.5g / dl , liver function tests were deranged ( bilirubin 80umol / l ; direct bilirubin 12umol / l ; gamma gt 80 u / l ; alt 58 u / l ; alkaline phosphatase 707 u / l , with urobilinogen in the urine . viral studies , inclujding cmv , ebv , hepatitis a and b , were all negative . she was discharged home as after two weeks as her jaundice cleared and her liver function tests improved . haemolysis has been documented after amplatzer device closure of pda,1 asd,2 and vsd.3 the one reported case after vsd closure resulted in transient renal failure.3 hemolysis has also been associated with the use of amplatzer devices to close paravalvar mitral valve leaks after mitral valve replacement.4 conservative treatment is usually sufficient but reintervention of some form may occasionally be necessary , such as intradevice coil deployment in order to completely eliminate any degree of residual left to right shunting.5

over the last few years , a vast variety of devices have been developed to close various septal defects through the transcatheter route . haemolysis has been documented after amplatzer device closure of patent ductus arteriousus , atrial septal defect , and ventricular septal defect . we report one patient with self - limiting haemolysis after implantation of an amplatzer perimembranous vsd device .

bacterial elimination from the root canal system holds the key to a successful endodontic treatment . the primary determinant to achieve this and to prevent future encroachment of bacteria is a thorough and meticulous technique . when these measures are taken into account success rate has been shown to be as high as 94% [ 2 , 3 ] . this was well demonstrated in a study by chugal et al . , who showed that , for every 1 mm loss of working length , in teeth with apical periodontitis , failure rate increases by 14% . these include errors in length ( i.e. , overfill and underfill ) , errors in cleaning and shaping ( i.e. , ledge formation , apical transportation , perforations , and instrument fracture ) , and errors in quality of obturation ( i.e. , voids , lack of uniform and continuous taper , and lack of homogeneity ) . certain errors have undoubtedly been revealed to have a significantly negative impact on the final outcome . underfill has been shown to reduce success rate to a mere 68% [ 57 ] . similarly , overfill also contributes to failure and has been shown to reduce success rate to as low as 76% [ 68 ] . instrument separation has also been shown to reduce the success rate by up to 14% when compared to those in which there was no instrument separation [ 5 , 9 ] . however , in this case percentage of failure depends on the degree of debridement that was achieved prior to instrument separation . the aim of this study is to determine the most common endodontically treated tooth and the most common error produced during treatment and to note the association of particular errors with particular teeth . this will help practitioners to determine which steps of the endodontic procedure requires greater diligence , in order to substantially improve the quality of their work and ensure better long term viability of the treatment . teeth treated with both conventional and rotary filing systems by postgraduate trainees from 2011 to 2014 were recruited into this study . inclusion criteria are as follows : ( 1 ) patients aged between 12 years and 65 years , ( 2 ) all permanent maxillary and mandibular teeth , ( 3 ) teeth prepared with conventional stainless steel files , and ( 4 ) root canal treatment performed by postgraduate trainees . exclusion criteria are as follows : ( 1 ) teeth with open apices , ( 2 ) teeth with blocked canals , ( 3 ) external root resorption , ( 4 ) lateral root resorption , ( 5 ) periapical pathology ( such as cysts and tumors ) , and ( 6 ) advanced periodontal conditions / perio - endo lesions . all the root canal treated teeth that fulfilled the inclusion criteria were included in this study , after approval by the institutional ethical review committee . all teeth treated with conventional files were prepared using the crown down technique and were obturated using lateral condensation technique . k - files were used to shape the canals in the following sequence : # 55 , # 50 , # 45 , # 40 , # 35 , and # 30 . working length was deemed acceptable if it was within 02 mm of the radiographic apex as determined by a periapical radiograph taken using a paralleling technique . for the purposes of our study overfill was defined as extrusion of root canal filling material ( gutta - percha ) beyond the radiographic apex . underfill was defined as root canal filling material ( gutta - percha ) more than 2 mm short of the radiographic apex . instrument separation was defined as when instrument fracture occurred at any point during the procedure and was irretrievable . herbert schilder in 1967 defined overextension and underextension of the root canal filling as solely the matter of its vertical dimension being beyond or short of the root apex . according to his definition the overfilled canal is one which was well filled in three dimensions but exhibited surplus filling material past the apex . the underfill root canal was defined as one which fails to fill the circumference of the apical foramen in one or more dimensions , leaving voids for stagnation of fluids , recontamination , and persistence of infection . however , as it was unfeasible to assess root canal treatments in three dimensions in our setting , the terms overfill and overextension as well as underfill and underextension are used interchangeably in this study . the periapical radiographs ( taken with a paralleling technique ) of these teeth were stored in digora optime and were grouped into two categories : treatment with a procedural error , treatment without a procedural error . teeth in each group were evaluated for presence or absence of procedural errors ( i.e. , overfill , underfill , ledge formation , perforations , apical transportation , and/or instrument separation ) and the most frequent tooth to undergo endodontic treatment was also noted . radiographs were assessed by two assistant professors and in case of difference in opinion the relevant x - ray was shown to the professor of the department and his opinion was taken as final . data was analyzed using spss version 21 . chi - square test was used to test the p value . a total of 1748 root canal treated teeth were assessed , out of which 1059 ( 61.1% ) belonged to females and 674 ( 38.9% ) to males . however , this female predisposition was not statistically significant ( p > 0.05 ) . out of the total sample , 940 were maxillary teeth ( 53.8% ) and 808 were mandibular teeth ( 46.2% ) . in males the mean age was 32.8 14 and in females the mean age was 33.4 12.3 ( see figure 1 ) . out of the total number of cases , 574 ( 32.8% ) contained a procedural error ( see figure 2 ) , out of which 397 ( 22.7% ) were overfilled , 155 ( 8.9% ) were underfilled , 16 ( 0.9% ) had instrument separation , and 7 ( 0.4% ) had apical transportation ( see figure 3 ) . the most frequently treated tooth was the right permanent mandibular first molar ( 11.3% ) , followed by the left permanent mandibular first molar ( 10.0% ) , right permanent maxillary first molar ( 7.0% ) , and left permanent maxillary first molar ( 6.5% ) . the least commonly treated teeth were the permanent mandibular third molars ( 0.1% ) , followed by the right permanent mandibular lateral incisor ( 0.9% ) and left permanent mandibular central incisor ( 1.1% ) ( see figure 4 ) . the most frequent tooth to possess an error was the right permanent mandibular first molar ( 20.2% ) , followed by the left permanent mandibular first molar ( 14.3% ) , right permanent maxillary first molar ( 9.1% ) , and left permanent maxillary first molar ( 8.9% ) ( see figure 5 ) . overfill tends to occur more frequently in 1020 years ' age group , whereas underfill was less frequently observed in this age group compared to the other groups . however , after removing outlying groups ( < 10 and > 60 ) , these relationships were found to be statistically insignificant . similarly , underfill tends to occur more frequently in 5060 years ' age group , whereas overfill was less frequently observed in this age group compared to the other groups . however , after removing outlying groups ( < 10 and > 60 ) , these relationships were also found to be statistically insignificant ( see table 1 ) . canines were the least affected by procedural errors ( 86.6% normal cases ) , followed by the incisors , which when compared to the canines had a much higher rate of overfill ( 17.4% versus 7.7% ) . molars were by far the most affected tooth group showing the greatest percentage of errors in each category and showing a meager 54.1% normal cases . underfill occurred more frequently in posterior tooth groups ( premolars and molars ) when compared to anterior tooth groups ( incisors and canines ) . instrument separation was seen more than twice as frequently in molars as compared to the next most frequent groups ( canines ) ( see table 1 ) . in general , mandibular teeth had more errors as compared to maxillary teeth and this relationship was seen to be statistically significant ( p = 0.001 ) . the mandibular right quadrant , in particular , showed the most errors ( see table 2 ) . however , there was no significant statistical relationship when right and left teeth were compared ( p = 0.757 ) . the right permanent mandibular first molar was particularly prone to errors , showing a greater overall percentage of errors than any other tooth , and was the only tooth in which errors superseded the acceptable cases ( see figure 6 ) . percentage of overfill and underfill in individual teeth has been elaborated in figures 7 and 8 . instrument separation and apical transportation showed the greatest predisposition to the right permanent mandibular first molar ( see figures 9 and 10 ) . an alarmingly large minority ( 32.8% ) of cases possessed a procedural error . this indicates a need for practitioners to be more meticulous with their technique . lamentably , at present not enough effort the most common error by far was overfill ( 22.7% ) ( see figure 11 ) . in particular , mandibular molars had a larger incidence of overfill when compared to their maxillary counterparts . specifically , the right permanent mandibular first molar was the most susceptible to this error ( see figure 7 ) . the general trend showed that incidence of overfill remains relatively constant in all age groups ( after excluding low frequency outlying groups < 10 and > 60 ) but was noted to be somewhat higher in the younger age group ( 1020 years ) ( see table 1 ) . this may be due to inadequate length determination or overinstrumentation . on average molars have the shortest roots as compared to other tooth groups , making them more susceptible to this type of error . therefore , it is perhaps unsurprising that canines proved to be least affected by this type of error . incisors and premolars had a similar incidence of overfill ( see table 1 ) . these findings may be attributed to the variations in root morphology present between these different tooth groups , canines having the longest roots , making them less susceptible to overfill . various studies have demonstrated that this procedural accident has a negative effect on the prognosis of overall treatment outcome [ 79 ] . although not acceptable , gutta - percha is relatively inert and if extruded beyond the apex has a minimal effect on the healing of the periapical tissues . conflicting results in numerous studies have made this a controversial topic ; therefore , to be on a safe side one should show due diligence and avoid this error altogether . the next most common error was underfill ( see figure 12 ) which accounted for 8.9% of the total cases . there was little difference in this error when mandibular and maxillary teeth were compared ( see table 2 ) . however , molars were the primary contributors to the rate of error in this category , with the right permanent mandibular first molar being the most affected ( see figure 8) . the general trend showed that incidence of underfill was observed to increase with age ( after excluding low frequency outlying groups < 10 and > 60 ) and was noted to be lower in the younger age group ( 1020 years ) when compared with the oldest age group ( 5060 ) ( see table 1 ) . literature regarding underfill is far clearer in its condemnation and shows the highest failure rates in teeth filled more than 2 mm short of the radiographic apex [ 14 , 15 ] . this error may be produced by inadequate length determination , inadequate filling technique , use of inflexible files , variations in canal morphology such as excessive curvature and narrow canals ( particularly in molars ) , inadequate irrigation between each filing , and so forth . furthermore , sclerotic canals and pulp stones may play a role in increased incidence of underfill in the older age group . instrument separation and apical transportation did not contribute much to the overall percentage of errors observed in our sample ( 0.9% and 0.4% , resp . ) . the few cases where instrument separation occurred were more prevalent in the mandible , in particular the right permanent mandibular first molar ( see table 2 and figure 9 ) . the insignificance of these errors shows that the practitioners are taking adequate steps to avoid such errors . anterior teeth were shown to be significantly less prone to errors than their posterior counterparts . interestingly , amongst incisors , central incisors were much more likely to possess an error than lateral incisors . in posterior teeth premolars compared to left molars , right molars were more prone to have errors ( see table 2 ) . most remarkably , the right permanent mandibular first molar was seen to have the highest number of errors in each category ( see figures 7 , 8 , 9 , and 10 ) . predictably , permanent mandibular first molars are the most common teeth to undergo endodontic treatment followed by permanent maxillary first molars ( see figure 4 ) . this may be related to their early eruption and favorable morphology ( pits and fissures ) for plaque retention . this finding is of significant importance as it may show an inability for early detection of a lesion or inadequate prophylaxis on part of the practitioner . poor community awareness may also play a role which results in patients reporting to the dentist only when they experience severe pain , leading to progression of the disease process to the extent that endodontic treatment is required . in developing countries like pakistan patient 's low income and lack of education ( particularly awareness as regards oral health ) thus , early detection of any disease process is often not possible and delays preventive treatment , leading to more cases of endodontic treatment . furthermore , less expertise , lack of specialist practice , and an abundance of roadside quacks also contributed to patient 's poor previous dental experience , making them reluctant to seek early dental treatment . least common teeth to undergo root canal treatment were third molars ( see figure 4 ) . this is perhaps due to the fact that third molars show the highest degree of morphological variation . this increases the complexity and expertise required for successful treatment . in addition , these teeth often have limited value in mastication / occlusion . this may be due to smooth labial and lingual surfaces of these teeth which are less susceptible to caries . practitioners should show greater care to maintain accuracy of the working length throughout the procedure , as by far errors in length accounted for the vast majority of errors . special care should be taken when working on molars , which had a significantly higher error rate when compared to anterior teeth or premolars . emphasis must be placed on community awareness programs to reduce the incidence of caries progressing to the point of requiring endodontic treatment . high risk patients should be provided with prophylactic treatment ( such as fissure sealants and fluoride therapy ) and regular routine checkups .

introduction . the aim of this study is to determine the most common endodontically treated tooth and the most common error produced during treatment and to note the association of particular errors with particular teeth . material and methods . periapical radiographs were taken of all the included teeth and were stored and assessed using digora optime . teeth in each group were evaluated for presence or absence of procedural errors ( i.e. , overfill , underfill , ledge formation , perforations , apical transportation , and/or instrument separation ) and the most frequent tooth to undergo endodontic treatment was also noted . results . a total of 1748 root canal treated teeth were assessed , out of which 574 ( 32.8% ) contained a procedural error . out of these 397 ( 22.7% ) were overfilled , 155 ( 8.9% ) were underfilled , 16 ( 0.9% ) had instrument separation , and 7 ( 0.4% ) had apical transportation . the most frequently treated tooth was right permanent mandibular first molar ( 11.3% ) . the least commonly treated teeth were the permanent mandibular third molars ( 0.1% ) . conclusion . practitioners should show greater care to maintain accuracy of the working length throughout the procedure , as errors in length accounted for the vast majority of errors and special care should be taken when working on molars .

fibromyalgia ( fms ) is a chronic pain syndrome in which pathogenesis is complex and cure is not known . it affects approximately 10 million adults in the united states with an estimated 90% of diagnoses being reported in women . sequelae of fms include physical and psychological distress , loss of work productivity , reduced quality of life , and increased use of health resources . annual expenditures for the diagnosis and treatment of fms are estimated at approximately $ 20 billion , thus presenting a significant burden to patients , their families , and society [ 2 , 3 ] . a major theory is that inflammatory mediators lead to complex neuroendocrine aberrations of the hypothalamic - pituitary - adrenal ( hpa ) axis . altered levels of cytokines have been associated with symptoms of pain , fatigue , and distressed mood in multiple conditions including painful peripheral neuropathies , hepatitis c , cardiovascular disease , and cancer [ 3 , 5 , 6 ] . thus , it is theoretically plausible that these nonspecific inflammatory mediators may also contribute to the symptoms of pain , fatigue , and distressed mood in fms . to date , results of studies examining the association of cytokine alterations with fms and its symptoms have been mixed [ 79 ] . although researchers have suggested fms as being an inflammatory state related to a dysregulated immune system or altered stress response , the pathophysiological role of cytokines continues to remain unclear [ 9 , 10 ] . because there are no diagnostic markers for fms as well as no identified etiology for the development of fms , researchers are still searching for mechanistic signs to identify those who already have or those who are at risk for developing fibromyalgia . t helper lymphocytes are defined by expressing the cell surface molecule known as cd4 and are subdivided further based on the cytokines that they produce . the discovery of the th1 and th2 paradigm was a pivotal breakthrough in the field of immunology . this balance and counterbalance of inflammatory mediators were delineated and ultimately led to fundamental additions to the knowledge base of cytokine biology we understand today . although th subsets have expanded far beyond the initial discovery to include th17 , th9 , tfh and others probably yet to be discovered , we can still use the th1 and th2 paradigm to better understand inflammation at both the bench and bedside . th1 immune responses are historically associated with antitumor and antiviral responses , whereas th2 are associated with humoral immune responses . however , for example these helper t cell derived cytokines are being examined in disease states such as schizophrenia , depression , and chronic pain . the purpose of the secondary data analysis in this study was to examine cytokine profiles in women in diagnosed with fms and to determine if relationships existed among the secreted cytokines detected in the plasma and to determine if any unique cytokine patterns that emerge correlate with disease symptoms . two separate studies were conducted : one preliminary and one for validation . both were approved by the institutional review board of virginia commonwealth university . our preliminary study involved 42 females , whereas the validation study was comprised of 63 females . inclusion criteria included age 18 , female , diagnosis of fms as defined by the 1990 american college of rheumatology ( acr ) criteria , no known major psychiatric or neurological conditions that would interfere with study participation , and an ability to understand and sign the consent form . the 1990 acr criteria for fibromyalgia require that an individual has both a history of chronic widespread musculoskeletal pain ( more than 3 months ) and the finding of 11 of 18 possible tender points upon physical examination . both studies were completed prior to the publication of the 2010 revised fms diagnostic criteria . exclusion criteria included presence of other systemic rheumatologic conditions , being immunocompromised ( e.g. , diagnosis of hiv / aids ) , receiving corticosteroid treatments , being treated for cancer , and/or being pregnant . self - reported diagnosis of fms was confirmed by the participant 's primary physician or rheumatologist . in both studies , study participants completed self - report form to collect data regarding age , race / ethnicity , marital status , length of time since diagnosis of fms , socioeconomic status and psychiatric , medical and medication history . the 10-item pss measures the degree to which the individual perceived events in her life over the previous month to be stressful . the bpi assesses pain severity ( bpi - s ) and pain interference ( bpi - i ) using 010 numeric scales for item rating ; higher scores indicate increased pain / interference . pain severity indicates the intensity of the pain experienced , while pain interference measures the degree to which pain interferes with activities of daily living . in widespread testing , the cronbach 's alpha reliability ranges from 0.71 to 0.91 . fatigue was measuredusing the brief fatigue inventory ( bfi ) , a simple , 9-item scale that taps into a single dimension of fatigue severity and the interference fatigue creates in daily life . the bfi has demonstrated excellent reliability in clinical trials , ranging from 0.82 to 0.97 . depression was measured using the center for epidemiological studies depression scale ( ces - d ) . the ces - d is a 20-item self - report instrument comprised of four factors assessing cognitive and affective components of depression . this instrument has very good construct validity , internal consistency , and test - retest reliability . blood was centrifuged for separation of plasma , and all specimens were aliquoted immediately , frozen , and stored at 80 until all samples were collected . plasma levels of cytokines such as interleukin ( il ) 1beta ( il-1 ) , il-2 , il-4 , il-5 , il-6 , il-7 , il-10 , il-12p70 , il-13 , il-17 , g - csf , gm - csf , ifn- , and tnf as well as chemokines such as cxcl8 ( il-8 ) , ccl2 ( mcp1 ) , and ccl4 ( mip1 ) were analyzed using the 17-plex bio - rad ( bio - rad ; hercules , ca ) cytokine , chemokine , and growth factor assay kit per manufacturer 's protocol . all data are presented as the mean + / standard error of the mean ( sem ) . post hoc analysis of plasma cytokine levels was performed to determine if patterns appeared that were not specified a priori . given the fact that the patients were of only two races , analysis was first performed to determine if differences existed in the cytokine levels of caucasian women with fms versus african american women with fms . using mann - whitney u tests , 16 of the 17 cytokines assayed displayed no statistical difference among race ( data not shown ) and were thus used for further analysis . power analysis was performed to ensure a 95% confidence level with a confidence interval of 15% . results from this analysis indicated that an appropriate n for cytokines would be equal to or greater than 21 . we then eliminated three more cytokines for further analysis given that the n of patients with detectable levels was below 21 . the values for our fms patients are presented in table 2 . due to the fact that at study initiation normal controls were not collected , we used plasma values reported in the literature [ 2230 ] . while we acknowledge this weakness , we are confident that the analyses are still powerful and will warrant further examination into cytokine deviations present in fms . in order to move forward in the study , we only looked at cytokines that were at least 2x greater in difference than 2sems of the mean . thus , il-4 , il-5 , il-13 , and gcsf were further examined . upon further scrutiny of the remaining 4 cytokines , a stark pattern began to emerge in that these cytokines are associated with th2 immunity . to confirm these findings , these patients were recruited for a different study and thus were completely independent of the subjects enrolled in the initial study . given the drastic differences observed in the original data set for il-4 , il-5 , il-13 , and gcsf , these cytokines were further scrutinized in the independent validation data set . using the aforementioned criteria , we confirmed that il-4 , il-5 , and il-13 are indeed suppressed in patients with fms ( table 4 ) . upon the observation that patients with fms had suppression in th2 cytokines , we began to explore the potential relationship between th2 immunity and the psychometrics obtained from the individuals . while no correlations proved significant among cytokine levels and fatigue , depression , or stress ( data not shown ) , there is a trend towards significance when we compared th2 cytokine levels and pain ( p = 0.07 , spearman 's ) as shown in figure 1 . although not classified as an immune disease by nature , our group as well as others has reported cytokine and immune alterations in patients with fms [ 3 , 7 , 9 , 15 , 23 ] . given the fact that disease etiology is still uncertain , further research is needed in the field to help uncover exact disease pathology in hopes to provide better therapeutic options the millions of fms patients worldwide . the purpose of this analysis was to examine cytokine alterations in patients with fms that were not determined a priori . comparing the observed cytokines in the plasma of these patients we noticed a stark decrease in the amount of th2 cytokines produced ( il-4 , il-5 , and il-13 ) as those values reported by other groups in the literature . we extended our analyses to include a secondary , independent data set and once again this unique cytokine signature was observed . to examine a potential underlying cause for the th2 suppression , we then correlated cytokine levels to pain , stress , fatigue , and depression which are all symptoms shared in the fms spectrum . when pain and th2 levels were compared we observed a trend that approached statistical significance . interleukin 4 , the classic th2 cytokine has been shown to have both anti - inflammatory and analgesic properties in murine models of mechanical as well as having lower gene expression and serum levels in patients with widespread pain syndromes . il-13 exhibits analgesic properties in a murine model of l. major infection , whereas little is reported in regard to il-5 's ability to combat pain . thus , our preliminary findings suggest that further research into the th1-th2 imbalance in fms and its implication in pain are certainly warranted .

fibromyalgia ( fms ) is a chronic pain syndrome with a complex but poorly understood pathogenesis affecting approximately 10 million adults in the united states . the lack of a clear etiology of fms has limited the effective diagnosis and treatment of this debilitating condition . the objective of this secondary data analysis was to examine plasma cytokine levels in women with fms using the bio - plex human cytokine 17-plex assay . post hoc analysis of plasma cytokine levels was performed to evaluate patterns that were not specified a priori . upon examination , patients with fms exhibited a marked reduction in th2 cytokines such as il-4 , il-5 , and il-13 . the finding of this pattern of altered cytokine milieu not only supports the role of inflammation in fms but also may lead to more definitive diagnostic tools for clinicians treating fms . the th2 suppression provides strong evidence of immune dysregulation in patients with fms .

angiogenesis is a hallmark for tumorigenesis , and vascular endothelial growth factor ( vegf ) is a crucial mediator for this process . vegf binds to its receptors , vegf receptor 1 ( vegfr1 ) and vegf receptor 2 ( vegfr2 ) to trigger cell proliferation , migration and metastasis [ 2 , 3 ] . agents blocking the vegf axis have been successfully used as anti - cancer therapies . among various approaches to targeting angiogenesis , inhibiting vegf ligand and receptor interactions to prevent vegf from binding to its receptors , aflibercept ( vegf trap ; regeneron pharmaceutical and sanofi - aventis pharmaceuticals ) was developed for sequestering circulating vegf . aflibercept is a soluble protein that fuses the second immunoglobulin ( ig ) domain of the vegfr1 and the third ig domain of the vegfr2 to the fc domain of human ig g1 . antitumor activities of aflibercept have been demonstrated in preclinical studies and in recent clinical trials [ 614 ] . in clinical studies , aflibercept has been administered via an intravenous ( iv ) or subcutaneous ( sc ) route . tew et al reported a phase i study using an aflibercept sc formulation of 25 mg / ml in patients with refractory solid tumors . in that study , the maximum tolerated dose ( mtd ) of aflibercept was not reached due to the volume of the drug to be administered via the sc route . to achieve the sc administration of a higher dose of aflibercept , a new formulation of 100 mg / ml was generated and tested along with the iv formulation in a separate phase i study . it was determined that the sc dose should be 4 mg / kg every 2 weeks because of the similar bioavailability of aflibercept via the sc and iv routes . lockhart et al reported on the toxicity data , pharmacokinetic profile and efficacy results of the iv formulation of aflibercept , and a dose of 4 mg / kg administered every 2 weeks was recommended for further phase ii or iii trials . here , we report our experience with the toxicity , pharmacokinetic profile and efficacy of the new 100 mg / ml sc formulation of aflibercept administered sc at 4 mg / kg every 2 weeks . the study was a phase i clinical trial evaluating aflibercept iv and sc formulations in patients with refractory solid tumors at vanderbilt university medical center and memorial sloan - kettering cancer center . the same eligibility criteria were used for the iv and sc cohorts , and were reported previously . lyophilized aflibercept ( 200 mg ) in a 20-ml glass vial was reconstituted under sterile conditions by addition of 2.3 ml water for sc injection to ultimately produce a concentration of 100 mg / ml . aflibercept 4.0 mg / kg was administered sc every 2 weeks using a 0.3 or 1.0 ml syringe with a fixed 29-gauge needle . dose reduction to 3.0 mg / kg and/or 2.0 mg / kg was allowed for protocol specified toxicity . the body sites for injections were rotated between the anterior abdominal wall , the deltoid region and the anterior thigh . to ensure uniformity of drug absorption , all patients received the first injection to the anterior abdominal wall . plasma concentrations of free aflibercept and aflibercept : vegf complexes ( bound aflibercept ) were measured by direct enzyme - linked immunosorbent assay ( elisa ) methods , as previously published . the limits of quantitation of free aflibercept and bound aflibercept were 31 ng / ml and 44 ng / ml , respectively . immunogenicity testing was performed by measuring the presence of anti - aflibercept antibodies via elisa 2 months after the last dose of aflibercept . patients were observed on a regular basis for toxicities which were graded by the national cancer institute common terminology criteria for adverse events ( version 3.0 ) . tumor response was assessed by recist criteria every two cycles by magnetic resonance imaging ( mri ) or computed tomography ( ct ) . patients continued in the study until disease progression , unacceptable toxicity or consent withdrawal occurred . descriptive statistics including median , minimum , maximum and percentage were used in this study . a total of 13 patients were screened for the sc cohort ; 10 patients were enrolled and received 4 mg / kg of aflibercept every 2 weeks . of the 10 patients receiving 4 mg / kg every 2 weeks , 8 were female . median treatment duration was 30 days with the maximal duration being 184 days . two of the 10 patients received 1113 doses of aflibercept.table 1patient demographic and clinical characteristicscharacteristicn = 10no . ( % ) age , years median58 range3775gender female8 ( 80% ) male2 ( 20%)performance status ( ecog ) 05 ( 50% ) 14 ( 40% ) 21 ( 10%)tumor type ovary5 ( 50% ) liver3 ( 30% ) breast1 ( 10% ) headhead and neck1 ( 10%)prior chemotherapy median2.5 range112treatment duration ( days ) median30 min : max15 : 184number of doses administered 2 doses3 ( 30.0% ) 4 doses4 ( 40.0% ) 610 doses1 ( 10.0% ) 1113 doses2 ( 20.0% ) patient demographic and clinical characteristics the safety - evaluable population was defined as patients who received at least one dose of aflibercept . among 10 patients treated at 4 mg / kg every 2 weeks , 9 patients ( 90% ) experienced a treatment - emergent event that was possibly related to aflibercept . the common toxicities attributed to aflibercept at 4 mg / kg every 2 weeks were fatigue , dysphonia , hypertension , nausea , myalgia , and arthralgia ( table 2 ) . two patients experienced severe adverse events ( sae ) ( hypertension and abdominal pain ) possibly related to aflibercept . among the patients taking sc aflibercept , no deaths designated as possibly related to the drug were observed , and no patients were discontinued from the study due to treatment - related toxicity.table 2common adverse events and severe adverse events ( grade 3/4 ) possibly related to aflibercept sc 4 mg / kgadverse eventpatients ( n = 10)all gradegrade 3/4no . % general disorder and administration site7 ( 70%) fatigue7 ( 70%) early satiety1 ( 10%) edema peripheral1 ( 10%)musculoskeletal and connective tissue disorder7 ( 70%) arthralgia4 ( 40%) myalgia4 ( 40%) back pain2 ( 20%) joint stiffness1 ( 10%) muscle spasms1 ( 10%) muscular weakness1 ( 10%) musculoskeletal pain1 ( 10%) pain in extremity1 ( 10%)respiratory , thoracic and mediastinal disorders7 ( 70%) dysphonia7 ( 70%) nasal dryness2 ( 20%) dyspnea1 ( 10%) dyspnea on exertion1 ( 10%) nasal congestion1 ( 10%) cough1 ( 10%) pharyngolaryngeal pain1 ( 10%)gastrointestinal disorders5 ( 50%) nausea4 ( 40%) constipation2 ( 20%) abdominal pain1 ( 10%) diarrhea1 ( 10%) glossodynia1 ( 10%) oral pain1 ( 10%)*vascular disorder5 ( 50%)1 ( 10% ) hypertension5 ( 50%)1 ( 10%)metabolism and nutrition disorder4 ( 40%) anorexia2 ( 20%) decreased appetite2 ( 20%)skin and subcutaneous tissue disorder4 ( 40%) rash3 ( 30%) dry skin2 ( 20%) erythema1 ( 10%) nail disorder1 ( 10%) onychoclasis1 ( 10%)nervous system disorder3 ( 30%) headache3 ( 30%)*renal and urinary disorder1 ( 10%) proteinuria1 ( 10%)common adverse event is defined by that the frequency of the adverse event of all grades in that class is 15% or greater * typical side effects associated with the angiogenesis inhibitors common adverse events and severe adverse events ( grade 3/4 ) possibly related to aflibercept sc 4 mg / kg common adverse event is defined by that the frequency of the adverse event of all grades in that class is 15% or greater * typical side effects associated with the angiogenesis inhibitors we examined toxicities possibly related to inhibition of vegf . hypertension was seen in 5 out of 10 patients with one subject experiencing grade 3 hypertension . the same subject also developed grade 1 proteinuria , as confirmed by 24 h urine collection . pk data of sc aflibercept at 4 mg / kg every 2 weeks were collected from 7 patients who had received at least 2 doses of aflibercept and completed by day 22 . at the steady state , the mean plasma concentrations of the free aflibercept and bound aflibercept were 8.69 g / ml and 4.49 g / ml , respectively ( fig . 1 ) . the free / bound ratios at steady state was 1.74 , indicating an excess of free over bound aflibercept at sc dose levels of 4.0 mg / kg every 2 weeks . the first group demonstrated a pk profile with a cmax around 20 g / ml and t 1/2 ranging between 7 and 9 days , while the second group showed a cmax rround 35 g / ml . 1mean free and bound aflibercept sc ( n = 7 ) and iv ( n = 6 ) at 4 mg / kg concentration at steady state mean free and bound aflibercept sc ( n = 7 ) and iv ( n = 6 ) at 4 mg / kg concentration at steady state treatment efficacy was assessed in 5 patients who received at least one dose of aflibercept and had at least one post baseline assessment . among 5 evaluable patients , 2 demonstrated stable disease . a 69-year - old woman with papillary serous carcinoma of the ovary had stable disease for 203 days . she was previously treated with multiple lines of chemotherapy including carboplatin , paclitaxel , liposomal doxorubicin , gemcitabine , and topotecan . the second patient was a 58-year - old woman with granulosa cell tumor of the ovary , and she had stable disease for 50 days . the benefit of depleting of vegf by aflibercept has been demonstrated in preclinical studies and early phase clinical trials [ 614 ] . currently , multiple phase iii clinical trials using the aflibercept iv formulation in combination with other agents are ongoing . a dose of 4 mg / kg administered iv every 2 weeks has been recommended for future clinical trials . here , we report the toxicity , pk data and efficacy of the new sc formulation of aflibercept at 100 mg / ml from a phase i study . the sample size of 10 patients is adequate to assess toxicity of the new formulation , and the toxicities were found to be tolerable and reversible . hypertension of any grade was seen in 5 patients ( 50% ) in the sc group , compared with 5 ( 71.4% ) out of 7 patients receiving intravenous aflibercept at 4 mg / kg . moreover , grade 3 and 4 hypertension was seen in 1 ( 10% ) out of 10 patients receiving sc aflibercept , compared with 3 ( 42.9% ) out of 7 patients receiving iv aflibercept . grade 3 and 4 proteinuria possibly related to aflibercept were see in 1 out 10 sc patients and 1 out 7 iv patients , respectively . pk data of aflibercept suggest adequate depletion of free circulating vegf . at steady state , plasma concentrations of free aflibercept were higher than bound aflibercept indicating maximum ligand blockade and were generally similar to iv aflibercept administered at the same dose . furthermore , the mechanisms contributing to two distinct pk profiles of sc aflibercept need to be further explored . tumor control ( stable disease ) was seen in two out of five evaluable patients . for future development , the sc route of aflibercept delivery may provide advantages over iv formulations , including time and resource conservation . sc administration may allow self - administration by patients at home , sparing the need for intravenous access , for specialized nursing care and a reduction in visits to the physician s office . based on our study , further investigation of sc aflibercept in combination with chemotherapy

summarytargeting angiogenesis is a valid anti - cancer strategy . aflibercept is designed to sequester circulating vascular endothelial growth factor ( vegf ) by preventing vegf from binding to its receptors . this phase i study was to evaluate a new formulation of subcutaneously administered aflibercept in patients with advanced solid tumors . here we report our experience with the toxicity , pharmacokinetic profile and efficacy of the new 100 mg / ml subcutaneous ( sc ) formulation of aflibercept administered at a dose of at 4 mg / kg every 2 weeks .

the pilot observational study by weber - carstens and colleagues provides important contributions to a mechanistic explanation of the puzzling and complex phenomena of icu - acquired weakness ( icu - aw ) . earlier findings from this research group suggested that icuaw is primarily a myopathy and confirmed that initial pathology manifests , on average , 7 days after icu admission among the most severely ill [ 2 - 4 ] . in the current subanalysis with 40 of the original 52 subjects , multiple factors were examined for association with myopathy : molecular ( il-6 , c - reactive protein ( crp ) , and insulin growth factor binding protein ( igfbp)-1 ) ; serum osmolarity ; medication use ( norepinepherine , dobutamine , hydrocortisone , aminoglycosides , analgesics , sedatives and neuromuscular blocking agents ) ; and multisystem factors ( simplified acute physiology ( saps-2 ) and sequential organ failure assessment ( sofa ) scores ) . the authors suggest systemic , inflammatory - mediated pathology is the most significant risk factor for icu - aw . while il-6 had a significant contribution to the statistical model , the hazard ratio of 1.006 indicated a higher il-6 ( > 230 picograms / ml ) is little better than chance in predicting inexcitable muscle membranes ( see figure 7 in ) . crp , the second inflammatory biomarker , was not associated with abnormal muscle excitability ( p = 0.075 ) . . it may simply be that there are insufficient numbers of results to derive a meaningful cox regression equation - allowing a reasonable 10 samples per factor / covariate , a sample size of 160 would provide more value to the statistical model ( 16 covariates ; see table 2 in ) . the authors also report a hazard ratio for norepinepherine similar to that for il-6 . along with the relative differences in the presence of septic shock and organ dysfunction in table 1 in among participants with / without inexcitable muscle membrane , this finding lends support to oxidative stress or the interaction of oxidative stress and pro - inflammatory biomarkers as risk factors for myopathy in icu patients . multiple measures and more complex clinical data , such as a heterogeneous sample as in this report , make it difficult to derive important conclusions from small samples . building a framework to identify icu - aw early and to evaluate efficacy of treatments is essential . between 25 and 50% of patients who receive mechanical ventilation for 7 or more days experience neuromuscular abnormalities and these abnormalities can result in weakness and impaired function years after discharge from the icu . in the united states , from 1997 to 2006 , the number of icu patients who received mechanical ventilation and were subsequently discharged to home has decreased while transfers to long - term acute care increased significantly without concomitant changes in survival . for older adults discharged with new or additional dependency in daily activities after hospitalization , less than 31% return to prehospital function . determining interventions that alter muscle pathology and associated dysfunction among patients who experience prolonged mechanical ventilation , whether from a mechanistic or a holistic perspective , has the potential to reduce the duration of mechanical ventilation and length of hospital stay . the role of il-6 and other cytokines in muscle dysfunction is not yet clear . in healthy adults , very high levels yet il-6 is also associated with proteolysis and myosin loss . among patients with chronic inflammatory conditions / diseases , the sources of il-6 - muscle versus leukocyte - may also be important to muscle pathology . developing understanding of basic pathology and establishing predictive biomarkers will provide the opportunity for new hypothesis testing . in this exploratory report of risk factors associated with abnormal responses to direct muscle stimulation , molecular to multisystem levels of covariates were examined . future studies will be more compelling when focused on single - level , inter - related pathways . investigations related to molecular cascade interactions are providing insight into the genetic , signaling , bioenergetic , and metabolic processes that contribute to muscle health and disease . understanding of molecular determinants of common diseases encountered in the critically ill can provide the rationale for selection of therapeutic targets . if a serum il-6 value > 230 picograms / ml is confirmed in future studies as an early indicator of muscle dysfunction , then the efficacy of prevention and treatment strategies may be measured rapidly and inexpensively by il-6 . observational data like this report provide important information with which to calculate effect size and determine promising biologic pathways for future investigations . results also suggest that the timing of interventions to prevent icu - aw may need to occur earlier than typically occurs in many settings as serum il-6 and muscle stimulation responses were abnormal quite early in the majority of patients who went on to manifest icu - aw . crp : c - reactive protein ; icu - aw : icu - acquired weakness ; igfbp : insulin growth factor binding protein ; il : interleukin ; saps : simplified acute physiology ; sofa : sequential organ failure assessment . cw has received research and travel funding from hill - rom . 2007 - 2009 . samantha razavi , rn and jeffrey ruf , rn reviewed the literature and assembled articles for this commentary .

a pilot observational study by weber - carstens and colleagues contributes to a mechanistic explanation of the puzzling and complex phenomena of icu - acquired weakness ( icu - aw ) . the authors suggest systemic , inflammatory - mediated pathology is the most significant risk factor for icu - aw . while this finding is somewhat equivocal , it provides important direction for future investigations and illustrates the challenges of interpreting significance in small observational studies .

zno is one of the most important wide band gap ( 3.37 at room temperature ) semiconductors because of its promising potential applications in room temperature uv lasers , sensors , solar cells , transparent electrodes , and piezoelectric actuators . in recent years , regulating the shape of semiconductor nanostructures has been a subject of intensive research because it provides an effective strategy for tuning the electronic , magnetic , optical , and catalytic properties of a semiconductor . orthorhombic pb3o2cl2 ( mendipite ) nanobelts were synthesized via a solventless thermolysis of a single - source precursor in the presence of capping ligands by sigman et al . . venugopal et al . also fabricated single crystalline nanobelts via laser ablation assisted chemical vapor deposition ( cvd ) method . it is worthy to mention that s. h. yu group successfully synthesized single - crystal cugeo3 nanobelts with a layered mesostructure via a simple hydrothermal route . organic hybrid nanobelts / nanotubes with highly ordered lamellar mesostructures and tunable interlayer distances in nonpolar solvents . then , layered structures combined with belt - like morphology would provide opportunities for developing new types of nanostructures that are doped with different elements . in this paper , we show that periodic layered zinc acetate nanobelts can be synthesized by a facile hydrothermal solution method . in addition , one - dimensional structured zno nanoparticle aggregate was obtained by calcination of the precursor in air . zno can be used as photocatalytical semiconductor due to a band gap , which can be activated by uv - irradiation . under uv - irradiation , holes and electrons are yielded which possess an oxidation potential large enough to generate oh radicals or o2 . in this paper , all chemicals were analytical grade and used as received without further purification . in a typical synthesis , 4.0 g zinc acetate , 3.6 g ctab , and 180 g deionized water were added into a 200 ml beaker . under vigorous magnetic stirring , ammonia ( 25 wt% ) then , the solution were transferred to a teflon - lined stainless steel autoclave and sealed tightly . the autoclave was kept in an oven with temperature 50 c for 24 h. white gel - like precipitation was found deposited on the bottom of the teflon cup . after filtration , the precipitate was washed ( three times ) thoroughly with distilled water and ethanol to remove any alkaline salt and surfactants that remained in the final products and dried at room temperature in air for 12 h. paper - like products formed on the filter paper . thermal treatments were carried out at 300 c in air for 1 h. the as - prepared samples were characterized by field emission scanning electron microcopy ( sem ) ( sem : sirion 200 feg ) , transmission electron microscopy ( tem ) ( jeol 2010 , accelerating voltage of 200 kv ) , selected - area electron diffraction ( saed ) ( jeol 2010 , accelerating voltage of 200 kv ) . x - ray diffraction spectra ( xrd ) ( philips xpert - pro , cu k ( 0.15419 nm ) radiation ) , and infrared spectroscopy . aqueous suspensions employed in photocatalytic experiments usually contained 3 g lof as - synthesized zno nanoparticles and a 10 mg lconcentration of methyl orange . the zno suspensions with methyl orange were illuminated continuously with light from a 30 w mercury lamp ( 2,537 ) . 1 ) . the average width of the nanobelts was 100200 nm , and their lengths ranged from 10 to 30 m . temperature higher than 80 c only resulted in the formation of microwhiskers or sheetlike structures . ph value higher than 9 or lower than 7 results in no precipitates in solution . low angle xrd pattern of as - synthesized zinc acetate nanobelts is shown in fig . 2 . the strongest diffraction peak at 2 = 6.7 corresponds to an interlayer d - spacing of 1.32 nm ( the 001 diffraction of layered structure ) and another diffraction peak at 2 = 4.4 accords with the other interlayer d - spacing of 1.91 nm ( the 001 diffraction of layered structure ) . the peaks at 8.8 , 13.3 , and 20.1 can be attributed to the second and third order diffraction of ( 00l ) plane of zn(oh)x(ch3coo)y zh2o , respectively . since it is convenient to introduce ions , such as n , mg , cd , mn , to the interlayer spacing by ionic exchange reaction , this hierarchically structured zinc acetate as precursor of zno looks promising future for fabricating functional electrical device . 3 ) was also measured to give information of the ch3coo group and oh group within the interlayer . the broad absorption band at 3,420 cm can be assigned to the oh group and water . h stretching band . the absorption band at 1,550 cm originates from the antisymmetric coo stretching vibration . the bands at 1,340 and 1,010 cm can be assigned to the deformation and rocking modes of the ch3 group [ 16 - 19 ] . the difference between antisymmetric coo stretching vibration band and symmetric coo stretching vibration band is 160 cm . this large difference means that coo is in monodentate state rather than free group state . it is suggested that the coordination of the coo groups to zinc cations for layered zinc acetate is monodentate . in another word , scale bar : 0.5 m low angle xrd pattern of as - synthesized zinc acetate nanobelts ir spectrum of as - synthesized zinc acetate nanobelts zno was obtained by calcinations of the above precursor in air at 300 c . xrd pattern demonstrates that the produced product shows a high - quality wurtzite zno structure , as shown in fig . the average crystallite size for zno nanoparticle was also determined from the linewidth broadening of the xrd peak corresponding to ( 002 ) reflection , using the debye the value of crystal size is 20 nm , which is consistent with the result of tem observation . xrd pattern of zno nanoparticle aggregate obtained by thermal treatment at 300 c in air tem images of one - dimensional zno nanoparticle aggregate . scale bar : 50 nm methyl orange ( c14h14n3 so3na ) is one of the representative azo class of dyes , which are the most important class of synthetic organic dyes used in the textile industry and are also common industrial pollutants . 6 suggests that the functional group responsible for the characteristic color of the mo dye is broken down . since the power of uv lamp we used is very low ( only 30 w ) , nanoparticle aggregates present high photocatalytic degradation efficiency to methyl orange . the reason is as follows : it is known that the photocatalytic activity of zno is strongly dependent on the growth direction of the crystal plane . after calcinations , the polar ( 001 ) zn planes of zno emerge on the surface of aggregate . an increase of polar zn ( 0001 ) or o ( 0001 ) faces leads to a significant enhancement of photocatalytic activity of zno . 1 ) . the average width of the nanobelts was 100200 nm , and their lengths ranged from 10 to 30 m . temperature higher than 80 c only resulted in the formation of microwhiskers or sheetlike structures . ph value higher than 9 or lower than 7 results in no precipitates in solution . low angle xrd pattern of as - synthesized zinc acetate nanobelts is shown in fig . 2 . the strongest diffraction peak at 2 = 6.7 corresponds to an interlayer d - spacing of 1.32 nm ( the 001 diffraction of layered structure ) and another diffraction peak at 2 = 4.4 accords with the other interlayer d - spacing of 1.91 nm ( the 001 diffraction of layered structure ) . the peaks at 8.8 , 13.3 , and 20.1 can be attributed to the second and third order diffraction of ( 00l ) plane of zn(oh)x(ch3coo)y zh2o , respectively . since it is convenient to introduce ions , such as n , mg , cd , mn , to the interlayer spacing by ionic exchange reaction , this hierarchically structured zinc acetate as precursor of zno looks promising future for fabricating functional electrical device . 3 ) was also measured to give information of the ch3coo group and oh group within the interlayer . the broad absorption band at 3,420 cm can be assigned to the oh group and water . h stretching band . the absorption band at 1,550 cm originates from the antisymmetric coo stretching vibration . the bands at 1,340 and 1,010 cm can be assigned to the deformation and rocking modes of the ch3 group [ 16 - 19 ] . the difference between antisymmetric coo stretching vibration band and symmetric coo stretching vibration band is 160 cm . this large difference means that coo is in monodentate state rather than free group state . it is suggested that the coordination of the coo groups to zinc cations for layered zinc acetate is monodentate . in another word , scale bar : 0.5 m low angle xrd pattern of as - synthesized zinc acetate nanobelts ir spectrum of as - synthesized zinc acetate nanobelts xrd pattern demonstrates that the produced product shows a high - quality wurtzite zno structure , as shown in fig . the nanoparticle size measured from the tem image is 1025 nm . the average crystallite size for zno nanoparticle was also determined from the linewidth broadening of the xrd peak corresponding to ( 002 ) reflection , using the debye scherrer equation . the value of crystal size is 20 nm , which is consistent with the result of tem observation . xrd pattern of zno nanoparticle aggregate obtained by thermal treatment at 300 c in air tem images of one - dimensional zno nanoparticle aggregate . methyl orange ( c14h14n3 so3na ) is one of the representative azo class of dyes , which are the most important class of synthetic organic dyes used in the textile industry and are also common industrial pollutants . 6 suggests that the functional group responsible for the characteristic color of the mo dye is broken down . since the power of uv lamp we used is very low ( only 30 w ) , nanoparticle aggregates present high photocatalytic degradation efficiency to methyl orange . the reason is as follows : it is known that the photocatalytic activity of zno is strongly dependent on the growth direction of the crystal plane . after calcinations , the polar ( 001 ) zn planes of zno emerge on the surface of aggregate . an increase of polar zn ( 0001 ) or o ( 0001 ) faces leads to a significant enhancement of photocatalytic activity of zno . in summary , hierarchically structured zinc acetate nanobelts were successfully synthesized via a mild hydrothermal method . the zinc acetate nanobelts possess layered structure with two interlayer d - spacings ( 1.321.91 nm ) . nanobelt precursors are 100200 nm in width , 1020 nm in thickness , and possess length up to 30 m . the layered zno acetate nanobelts were successfully converted to one - dimensional structured zno nanoparticle aggregate through simple thermal treatment of the above - mentioned precursor at 300 c . photocatalytic experiment indicated that uv / one - dimensional zno nanoparticle aggregate process could be efficiently used to degrade azo class of dyes , such as mo . authors acknowledge the support from the national key project of fundamental research for nanomaterials and nanostructures ( grant no .

we were successful in synthesizing periodic layered zinc acetate nanobelts through a hydrothermal solution process . one - dimensional structured zno nanoparticle aggregate was obtained by simple thermal annealing of the above - mentioned layered zno acetate nanobelts at 300 c . the morphology , microstructure , and composition of the synthesized zno and its precursors were characterized by transmission electron microscopy ( tem ) , x - ray diffraction ( xrd ) , and infrared spectroscopy , respectively . low angle x - ray diffraction spectra reveal that as - synthesized zinc acetate has a layered structure with two interlayer d - spacings ( one is 1.32 nm and the other is 1.91 nm ) . sem and tem indicate that nanobelt precursors were 100200 nm in width and possesses length up to 30 m . calcination of precursor in air results in the formation of one - dimensional structured zno nanoparticle aggregates . in addition , the as - prepared zno nanoparticle aggregates exhibit high photocatalytic activity for the photocatalytic degradation of methyl orange ( mo ) .

a 57-year - old male patient presented with redness , excessive watering and foreign body sensation in both eyes , along with painful swelling and skin ulcers around both eyes over the past two days . however , the patient gave history of playing holi with dry colors three days back . he was febrile for the past two days and had not sought any medical care . on examination , there was conjunctival chemosis and small corneal epithelial abrasions , along with bilateral periorbital ulcerative lesions with superficial gangrene formation [ fig . 1 ] . skin over the face and neck regions was stained pink due to exposure to the colors . laboratory investigations included hemogram , erythrocyte sedimentation rate ( esr ) , blood sugar , enzyme linked immunosorbent essay ( elisa ) for human immunodeficiency virus ( hiv ) , and blood culture . patient was started on intravenous broad - spectrum antibiotic therapy , which included ciprofloxacin , cefotaxime and metronidazole . topical ciprofloxacin eye drops and artificial tear substitutes were prescribed along with application of mupirocin ointment over the ulcers . over the next two days , patient was afebrile but he developed deep - seated ulcers extending up to the orbital septum . repeated debridements of the necrosed tissue with irrigation of the ulcer bases with 5% povidone iodine solution was done . over the next five days intravenous antibiotics were continued for the next 14 days along with daily dressings of the wound . as a result of scarring , patient developed bilateral cicatricial ectropion of all four lids . to prevent exposure keratopathy , temporary tarsorrhaphy was performed and patient was discharged on oral ciprofloxacin for the next seven days . full - thickness skin grafting was done to reconstruct the anterior lamina of both the upper and lower lids . a thorough excision of the scar tissue was done and the lids were reconstructed with donor skin from the postauricular area and inner upper arm . in addition , on the right side , the scar tissue that was extending till the upper cheek area was excised thoroughly and the area covered with split skin graft . the final outcome was mild ectropion of lower lids and mild lagophthalmos and lid lag . however , there was no corneal exposure and the patient was kept on tear substitutes subsequently . the colors used during holi include various synthetic dyes like malachite green , auramine , methyl violet , rhodamine and orange ii . these are often mixed in a base material like starch or wheat flour . at times , even mica dust is added to them to increase their shine . use of mica dust can lead to multiple microtrauma of skin and predispose to infections . also , use of contaminated starch or wheat flour can further increase the chances of skin or ocular infections . we believe that these factors led to bilateral periorbital necrotizing fasciitis in our patient . dada et al .1 have reported ocular injuries due to ] holi colors . in our case report , the patient also developed mild corneal epithelial abrasions and conjunctival chemosis due to exposure to the colors . necrotizing fasciitis usually occurs after trauma , especially in diabetics , chronic alcoholics and immunocompromised patients.2 it is an uncommon but severe soft tissue infection causing cutaneous gangrene and suppurative fasciitis . it frequently involves the groin , lower extremities and abdomen3 but occasional case reports of periorbital necrotizing fasciitis following trauma by wooden splinters4 and head trauma5 have been reported . although streptococcus and staphylococcus are the most common infective agents , the necrotic base of ulcers may also develop secondary infection by a combination of various facultative and anaerobic organisms . this emphasizes the importance of an early diagnosis and a prompt , extensive intravenous antibiotic therapy along with repeated surgical debridement . lid reconstruction surgeries may be required for complications like severe cicatricial ectropion and exposure keratopathy . in india , holi colors are prepared on a small scale and lack any quality checks . alternatives like vegetable dyes prepared from various plant extracts have been developed in the indian toxicology research centre and national botanical research institute . use of such non - toxic colors should be encouraged , and doctors should caution people against using synthetic dyes such as holi colors .

holi festival is celebrated in india traditionally by applying colors on one another . various ocular adverse effects of these colors have been reported including conjunctivitis and corneal abrasion . we report a case of bilateral periorbital necrotizing fasciitis , following exposure to holi colors . general physicians might encounter more such cases after exposure to holi colors . in india , these colors are prepared on a small scale and lack any quality checks . use of such toxic colors should be discouraged , and all doctors should caution people against using synthetic dyes . this case report highlights the need to put manufacturing of holi colors under guidelines of the food and drug cosmetic act and the bureau of indian standards .

higher ambient temperatures increase replication cycles of foodborne pathogens and prolonged seasons may augment the opportunity for food handling mistakes . in 32% of investigated foodborne outbreaks in europe , temperature misuse is considered a contributing factor . although seasonal temperature variation is a well - known phenomenon in the epidemiology of enteric infections , simple analytical tools for examination , evaluation , and comparison of seasonal patterns are limited . the objectives of this paper are to outline the notion of seasonality ; to define characteristics of seasonality ; and , to assess seasonal pattern and the effect of one environmental factor ( ambient maximum temperature ) on the salmonellosis morbidity . in order to better understand any potential impact of season and warmer temperature in particular on salmonellosis as enteric infections in r. macedonia , we investigated the relationship between ambient maximum temperature and weekly reports of confirmed cases of salmonella in skopje between 1998 and 2008 . data on notified cases of salmonella infection for the period 1998 - 2008 were obtained from the national surveillance centre , i.e. , institute for public health of r. macedonia for the capital city of skopje and countrywide . the maximum mean weekly temperatures for the study period were obtained from national hydro - meteorological office . the following age groups were also modelled : young children ( 06 years ) , children ( 714 years ) ; adults ( 1559 years ) ; and the elderly ( 60 + years ) . we investigated the epidemiological characteristics of salmonellosis at the national level and city of skopje using retrospective research as the primary method of research . we created seasonal indices for monthly distribution of reported cases for skopje and the entire country . this technique allowed us to assess any short - term effects of temperature on disease using statgraphics centurion software . skopje , the capital , is the most populous macedonian city . according to an official estimate from 2009 , 20.5% of the total population registered in the country ( 2,052,722 ) lives in skopje . during the period 1998 - 2008 , nationally , 3,890 salmonella human cases were registered ; 1,951 ( 50.1% ) males and 1,939 ( 49.9% ) females . s. entiritidis with 90% and s. typhimurium with 8% are predominant serovars causing human infections in the r. macedonia . 1,085 salmonella cases were reported in skopje for the same period with an average of 8.2 patients per month ( 28% of the total national average ; about 29 patients per month ) . specific morbidity distribution of salmonellosis ( rate per 100,000 ) in skopje and countrywide are shown as follows ( figure 1 ) . reported salmonella cases in humans in macedonia and skopje 1998 - 2008 ( mb/100.000 ) . while a decreasing tendency was registered at the national level , the analysis for skopje showed increasing tendency of salmonella incidence . the salmonellosis morbidity rate for skopje in 1998 was 8.3/100,000 ; in 2000 , the rate was 24.6/100,000 and in 2008 was 41.2/100,000 . the analysis of specific salmonellosis morbidity by age groups in skopje showed higher morbidity among 0 to 6 year old children with 646.1/100,000 and lowest among adults from 30 to 39 years old with 90.3/100,000 ( table 1 ) . at the national level , the higher morbidity was registered also among 0 to 6 years old children with 622.1/100,000 but the lowest was recorded among the elderly 60 years and above with 97.8/100,000 . specific salmonelosis morbidity ( per 100,000 ) by age groups for skopje and macedonia during the period 1998 - 2008 the highest values of the seasonal index for salmonella cases were registered in the summer months , i.e. june with 160.1% , july with 188.6% , august with 171.3% and september with 182.5% . the lowest reported salmonella cases were registered in february with 20.7% ( figure 2 ) . seasonal indexes for reported salmonella cases in macedonia and skopje for the period 1998 - 2008 -distribution by months furthermore , in skopje , the seasonal index for salmonella cases showed two peaks in the summer months ( september with 201.6% , and june with 130.5% ) . the largest percentage of outbreaks of salmonellosis in the review period , were registered in the months with the highest seasonal index . a total of 42 outbreaks of salmonellosis or an average of 5 outbreaks per year was registered for the same period with a total 6,015 exposed persons . in these outbreaks , according to data obtained from epidemiological surveys , 1,871 persons ( 31.1% from total number of exposed ) were registered as salmonella cases and 608 patients were hospitalized ( 32.4% from total registered patients ) . the estimated correlation coefficient ( 0.54 ) , indicates a moderately strong relationship between the monthly number of reported salmonella cases for skopje , and the average monthly maximum temperature at p < 0.05 . the 1 month lag time shows pearson correlation coefficient = 0.51 and 2 month lag shows pearson correlation coefficient = 0.49 . our investigation indicates that higher and sustained temperatures for longer periods of time are likely to lead to increasing cases of salmonellosis . the 1 month lag time of rising salmonella cases suggests that temperatures might be influential earlier in the production phase . the largest increase of air temperature in the next decades for the republic of macedonia is expected in the summer season , associated with a strong decrease in precipitation , due to climate change . it is anticipated that there will be a corresponding rise in the incidence of salmonellosis . the plot of poisson distribution with 95% confidence limits , between the monthly number of reported salmonella cases for skopje , and average monthly maximum temperature for the period 1998 - 2008 has been estimated ( figure 3 ) . plot of fitted poisson regression model for skopje the estimated rate ratio for skopje is 1.052 , which means that under conditions of increasing maximum monthly mean temperature of 1c , salmonellosis incidence will increase 5.2% per month . the canadian study showed that , for alberta , the log relative risk of salmonella weekly case counts increased by 1.2% for every degree increase in weekly mean temperature . in our study under conditions of increasing maximum monthly mean temperature for 1c , the salmonellosis incidence increase for 5.2% per month . similar higher ambient temperatures have been associated with 5 - 10% higher salmonellosis notifications for each degree increase in weekly temperature . in other 10 european countries , for ambient temperatures above 5c , the estimated change in incidence above a common 6c threshold ranged from 0.3% in denmark to 12.5% in england and wales . the strongest effects were found for temperatures 1 week before the onset of illness rather than the longer lag of 1 month found in the australian study . a significant positive association between mean temperature of the previous month and the number of salmonellosis notifications in the current month , with the estimated increases for a 1c in temperature ranging from 4% to 10% in five australian cities were reported . in our study , food poisoning by salmonellosis , was positively associated with ambient maximum temperature in the previous month , i.e. , for each increase in temperature for 1c resulted in 5.2% increase in salmonellosis notifications in the current month . in the uk , the monthly incidence of food poisoning was most strongly associated with the temperatures occurring in the previous two to five weeks . the time lag of 1 month of rising salmonella cases suggests that temperatures might be influential earlier in the production phase . roughly one - third of the transmission of salmonellosis ( population attributable fraction ) in england and wales , poland , the netherlands , the czech republic , switzerland and spain can be attributed to temperature influences . in our investigation the higher and sustained temperatures for longer periods of time are likely to lead to increasing cases of salmonellosis . indeed , an analysis of foodborne illnesses from england and wales showed that the impact of the temperature of the current and preceding week has decreased over the past decades , indicating that the potential risk from elevated temperatures related to climate change can be counteracted through concerted public - health action . the incidence of salmonella cases in the macedonian population varies seasonally . during the review period , the highest values of the seasonal index for salmonella cases were registered in the summer months , i.e. june , july , august and september . an understanding of how specific environmental factors influence human disease may improve disease forecasting ; enhance the design of integrated warning systems ; advance the development of efficient adaptation action plans ; and , underline the need for implementing adaptation measures now .

background : higher temperatures have been associated with higher salmonellosis notifications worldwide.aims:the objective of this paper is to assess the seasonal pattern of salmonella cases among humans.material and methods : the relationship between ambient maximum temperature and reports of confirmed cases of salmonella in the republic of macedonia and skopje during the summer months ( i.e. june , july , august and september ) beginning in 1998 through 2008 was investigated . the monthly number of reported salmonella cases and ambient maximum temperatures for skopje were related to the national number of cases and temperatures recorded during the same timeframe using regression statistical analyses . the poisson regression model was adapted for the analysis of the data.results:while a decreasing tendency was registered at the national level , the analysis for skopje showed an increasing tendency for registration of new salmonella cases . reported incidents of salmonellosis , were positively associated ( p<0.05 ) with temperature during the summer months . by increasing of the maximum monthly mean temperature of 1 c in skopje , the salmonellosis incidence increased by 5.2% per month.conclusions:the incidence of salmonella cases in the macedonian population varies seasonally : the highest values of the seasonal index for salmonella cases were registered in the summer months , i.e. june , july , august and september .

the medical records of all children < 16 years of age diagnosed with on over a 5-year period ( 20102015 ) were retrospectively reviewed . the clinical diagnosis of on was made on the basis of acute or subacute visual loss of 2 weeks or less , an afferent pupillary defect , color vision defect with or without optic nerve swelling , field defects , with an abnormal visual evoked potential ( vep ) , and magnetic resonance imaging ( mri ) brain scans . in younger children ( < 4 years ) , diagnosis of on was made when the child was neither able to fix nor follow to light ( which child could do before ) , acute in onset , fundus examination suggestive features of papillitis ( if present ) and final diagnosis was made after an abnormal mri brain scan and vep , for confirming the diagnosis of on . other optic neuropathies , such as traumatic , toxic , hereditary , were excluded from the study . color vision testing was done using pseudoisochromatic ishihara plates and central fields were done using bjerrum 's screen . information about age , sex , initial best - corrected visual acuity ( va ) , treatment , final best - corrected va , mri , and associated systemic conditions was recorded . in all cases , the recovered va was the final va . mri brain was done for all cases . on was classified as unilateral or bilateral . patients were considered to have bilateral on if involvement of both eyes occurred within 2 weeks of each other . all children received intravenous corticosteroids followed by oral corticosteroids in tapering doses , adjusted according to the age and weight of the child . the study was conformed to local laws and was compliant with the principles of the declaration of helsinki . mean ( standard deviation ) and frequency ( percentage ) were used to describe the summary data . wilcoxon signed - rank test was used to compare the mean difference of va between baseline and follow - up visits . the statistical analysis was done using statistical software stata 11.1 ( texas , usa ) . mean ( standard deviation ) and frequency ( percentage ) were used to describe the summary data . wilcoxon signed - rank test was used to compare the mean difference of va between baseline and follow - up visits . the statistical analysis was done using statistical software stata 11.1 ( texas , usa ) . we found 62 eyes of 40 children diagnosed as on , fulfilling the inclusion and exclusion criteria , who presented within the study period . the mean age of presentation was 11.15 3.24 years , ranging between 1 year and 15 years of age . patients with demyelinating lesions on mri were followed up for longer period ( 35 years ) . thirty - five eyes ( 57% ) presented with va < 20/200 ; 10 eyes ( 16% ) presented with va better than 20/40 . after treatment , 53 eyes ( 86% ) achieved va better than 20/40 ; 7 eyes ( 11% ) still had va < 20/200 . mean logarithm of the minimum angle of resolution ( logmar ) va at presentation was 1.14 0.93 , which after treatment recovered to 0.10 0.26 at final visit , this was statistically significant with p < 0.001 . comparison of visual acuity at initial visit and visual acuity at final visit twenty - two children ( 55% ) presented with bilateral simultaneous involvement of optic nerve . fundoscopy revealed papillitis in 38 eyes ( 61% ) ; 24 eyes ( 39% ) were diagnosed with retrobulbar neuritis . three eyes of three children had recurrent episodes of on ( two of them had papillitis ; one had retrobulbar neuritis ) . , two cases were idiopathic while one case was later on diagnosed to have nmo with positive aquaporin-4 antibodies ( nmo - igg ) . mri brain was abnormal in 26 children ; 14 children showed only isolated optic nerve enhancement , 3 children showed demyelinating foci in frontal lobe , and 3 children had similar foci including parietooccipital lobe [ fig . 1 ] . cerebrospinal fluid ( csf ) examination could not be done in all cases of on since parents did not consent for the invasive procedure and due to financial constraints . mri of a child with optic neuritis showing multiple t2 hyperintense lesions involving parietooccipital lobe one child with mri brain suggestive of meningitis later was diagnosed with tuberculous meningitis ; one was diagnosed with acute disseminated encephalomyelitis following csf analysis ; one case had associated bilateral maxillary sinusitis , and one had septicemia with normal brain scans . in our series , four children were diagnosed as ms , showing demyelination of various structures of brain including periventricular white matter , subcortical structures , internal capsule , thalamus , and structures of optic pathway including optic chiasm , optic tracts , and optic radiation [ fig . 2 ] . of the four children , one of them developed transverse myelitis with urinary incontinence , 4 weeks after the episode of on . , three of the patients in our series can be classified as clinically isolated syndrome and one of them with relapsing remitting ms . mri of a child diagnosed with ms showing demyelination including visual pathway three cases of ms presented with unilateral on ; one case showed bilateral involvement . none of these cases developed recurrence of any ocular involvement during their follow - up . flash vep was also done in seven cases of on , in children who had presenting va better than 20/40 and normal mri scan . on in adults has been analyzed extensively through the on treatment trial . an indian study done in adults with on showed female preponderance ( 70% ) , papillitis ( 53.5% ) , and bilateral presentation ( 19.3% ) . baseline median logmar va was 1.6 0.8 , which improved to 0.2 0.6 , with approximately 64% of eyes retaining va of 20/40 or more . on in children differs from that in adults and the data available are limited from the region . in our study , we described the clinical characteristics , neuroimaging findings , and visual outcome of pediatric on in south indian population . comparison of various features of pediatric optic neuritis in our study with the previous studies compared to data in previous studies , there were few differences in results of our study . the rate of involvement of girls was 67% in our study versus 43%60% in studies done previously , disc swelling was present in 61% of children in our study versus 42%67% in previous studies , and preceding febrile illness was present in 18% of children in our study versus 28%66% in other studies . the prevalence of ms was 10% in our study and 4% in another study done by hwang et al . found that bilateral on was associated with an increased risk of ms , regardless of the age at presentation . contrary to it , a systematic review and meta - analysis done by waldman et al . suggested that presentation ( bilateral or unilateral ) is not a factor in the development of ms . age and presence of brain lesions outside visual system on mri were the key variables in determining the risk of ms . they also suggested that the increased risk of ms in older children might be attributable to differences in immune system . in our study , we had four cases of ms , all of them aged above 10 years , three cases presented with unilateral on . ten mri scans showed brain lesions outside visual system , while only four of them were diagnosed as ms . reported the largest childhood series of on to date with the longest period of follow - up . they found a greater risk of developing ms in those patients who had sequential or recurrent on , compared with those patients who had a single episode of on occurring in either one eye or both eyes simultaneously . in this study , among three recurrent cases , none of them were diagnosed as ms . comparison of reported multiple sclerosis cases in previous studies with the place of the study where it was carried out the dissimilarities in the findings can be attributed to differences due to varied period of follow - up , different races , geographical distribution of the population as many of these studies were done in different parts of the world . it is , therefore , possible that in our population , on in children could harbor some different characteristics from those reported previously . no case series of pediatric on were available from indian population ; hence , we could not compare our data within similar ethnic population . the present study was conducted with the aim of understanding the clinical picture of pediatric on in india . there were few limitations of our study , first that we could not perform csf analysis in all cases and second that the period of follow - up was minimal , so we could not assess rate of conversion to ms . we found that the clinical profile of pediatric on in the indian scenario was similar from that reported in the western population . however , the percentage of on associated with ms was lower than the western population but higher than that reported from other asian countries . bilateral involvement was more common , papillitis was frequent , association with ms was low , lower recurrence rate , and with good visual prognosis were the characteristics of on in children in india . bilateral involvement was more common , papillitis was frequent , association with ms was low , lower recurrence rate , and with good visual prognosis were the characteristics of on in children in india .

purpose of the study : the purpose of this study was to report clinical features , neuroimaging , and visual outcome in pediatric optic neuritis ( on ) in indian population.materials and methods : this is a retrospective study of children up to the age of 16 years , diagnosed with on , that presented at pediatric and neuroophthalmology clinic of a tertiary eye care center , in south india , within the period of 20102015.results:we identified 62 eyes of 40 children diagnosed as on within the study period . the mean age was 11.15 3.24 years ( 115 years ) with mean follow - up of 13 months . in this series , there was female preponderance ( 67% ) . mean logarithm of the minimum angle of resolution visual acuity at presentation was 1.14 0.93 , which after treatment recovered to 0.10 0.26 at final visit ( p < 0.001 ) . involvement was bilateral in 22 children ( 55% ) and recurrent in 3 eyes of 3 children . preceding febrile illness was reported in seven cases ( 18% ) . four ( 10% ) cases were diagnosed as multiple sclerosis ( ms ) , one with neuromyelitis optica , and one with acute disseminated encephalomyelitis . one case was associated with tuberculous meningitis , 1 with septicemia , and 1 with bilateral maxillary sinusitis . neuroimaging studies of optic nerve in 14 children demonstrated isolated optic nerve enhancement . magnetic resonance imaging brain revealed white matter t2 hyperintense lesions separate from optic nerve in ten cases , of which four cases were diagnosed as ms.conclusions:bilateral presentation was common , association with ms was low . papillitis was more frequent than retrobulbar neuritis and prognosis was good in pediatric on in indian population .

the internet is a technology that facilitates accessing various kinds of information resources and information exchange easily via an inexpensive and safe way . although a standardized definition of internet addiction has not been uniformly agreed upon , some researchers define the internet addiction as having less ability to control enthusiasm for internet activities , losing the importance of the time without being connected to the internet , extreme nervousness and aggressive behaviour when deprived , and progressive deterioration in work , and social and family functionings [ 1 , 2 ] . researchers point that the internet addiction may be seen at every age in both sexes and begin at earlier ages than other addictions . prevalence statistics of internet addiction among adolescents vary widely from 2% to 20% across cultures and societies for this reason , the internet addiction may cause physical and social problems as well as psychological disturbances . a number of studies have underlined the unfavorable effects of internet addiction on physical and mental well - being and most of the adolescents with internet addiction were also reported to have another psychiatric disorder [ 7 , 8 ] . mood disorders , substance use disorders , attention - deficit hyperactivity disorder ( adhd ) , disruptive behaviour disorders , anxiety disorders , sleep disorders , eating disorders , and epileptic seizures are some proven internet addiction - related clinical situations . others have argued that the internet addiction is actually a behaviour pattern which plays role in some of the negative cognitions that compensate for failed areas of life just as seen in depression . in this context , excessive use of the internet can be seen as a rewarding behavior , and through learning mechanisms , it may be used as an insufficient strategy to cope with some negative feelings . temperament traits of novelty or sensation seeking are reported to be significantly higher in substance users than in nonusers . most authors agree that these traits increase the risk of drug addiction in general , presumably because of an increased tendency to experiment with drugs . in studies investigating the temperament features of adolescents with internet addiction , it was revealed that students with internet addiction were easily affected by feeling , emotionally less stable , imaginative , absorbed in thought , self - sufficient , experimenting , and preferred their own decisions . adolescents with internet addiction were also shown to have higher scores on neuroticism and psychoticism temperament categories than those of the control group . however , to our knowledge , there is not a study in the literature addressing the correlation between affective temperament profiles and the internet addiction . the first aim of this study was to investigate internet addiction and the relevance to the sociodemographic properties among a sample of turkish adolescent population . second , it was aimed to compare the affective temperament profiles and emotional and behavioural characteristics of adolescents with or without the internet addiction . the study population included high school students attending erzurum ataturk high school in turkey in the 2010 - 2011 academic year ( n = 325 ) . the study sample included 303 students who were present in classes on the day when data were collected , who agreed to participate in the study , and who filled in the questionnaires completely ( response rate = 93.2% ) . the ethical committee approval was obtained from the institute of health sciences of ataturk university . the students who were given information about the study and who accepted to participate in the study were included . also , approval was obtained from the directorate of school education , affiliating with the ministry of education . four instruments were used to collect data : a sociodemographic characteristics data form , internet addiction scale , the strengths and difficulties questionnaire , and the temperament evaluation of memphis , pisa , paris , and san diego autoquestionnaire . we developed a 12-item sociodemographic questionnaire with items pertaining to age , sex , grade , average monthly household income , extent and type of internet use ( e.g. , where do you use the internet ? ) , and presence of the computer in the home . the ias is a self - report instrument consisting of 31 items ( e.g. , i have attempted to spend less time on the internet but i have been unable to do so . ) based on the diagnostic and statistical manual of mental disorders , fourth edition , substance dependence criteria , and 2 additional criteria recommended by griffiths . the ias is a highly reliable and internally consistent measure ( cronbach = .95 ) . the scale was translated into turkish , and psychometric properties of the turkish version of the scale were evaluated among high school students revealing a highly significant test - retest reliability . an interitem reliability reduced the initial scale from 31 to 27 items ( with cronbach of .94 ) . scale items are rated on a 5-point likert scale ( 1 , never ; 2 , rarely ; 3 , sometimes ; 4 , frequently ; 5 , always ) , with higher scores representing greater internet addiction . a cutoff score of 81 ( 3 27 items ) was suggested as indicative of internet addiction . the sdq was developed to determine adolescents ' areas of strengths and problematic behaviours . the tool contains 25 questions which asks about behavioural characteristics , some of which are positive , and some of which are negative . these questions are listed under five subheadings : ( 1 ) conduct problems ; ( 2 ) hyperactivity - inattention ; ( 3 ) emotional symptoms ; ( 4 ) peer problems ; and ( 5 ) prosocial behaviour . the validity and reliability of the turkish version of sdq was performed by gvenir et al . with an acceptable internal consistency ( cronbach 's alpha = 0.73 ) . the autoquestionnaire version of the temperament evaluation of memphis , pisa , paris , and san diego ( temps - a ) is a self - report instrument developed by akiskal et al . . the complete questionnaire measures affective temperamental traits , present in the subject 's whole life , represented in five dimensional scales : depressive , cyclothymic , hyperthymic , irritable , and anxious . in this study , the turkish version was used . statistical package for social sciences software ( spss 15 , chicago , il , usa ) was used for the analysis . pearson 's chi - square test was used to analyze the differences in means and proportions between groups . spearman 's or pearson 's correlation tests were used to evaluate the association between the ias and the subscales of the sdq and the temps - a . a p value of < 0.05 was considered significant . a total of 210 boys ( 69.2% ) and 92 girls ( 30.8% ) completed the scale and questionnaires . of the sample , 20 ( 6.6% ) the proportion of boys who were classified as internet addicts was 6.2% . for girls , the corresponding proportion was 7.6% ; the difference was not statistically significant . having a computer in the home was found to be significantly related with internet addiction . table 1 lists the baseline subject characteristics by the presence or absence of internet addiction . the mean ias scores were significantly higher in adolescents who had a computer in home than those who had not ( p < 0.001 ) . additionally , students who had been using internet for more than two years were found to score higher on the ias than those who had been using internet for two years or less ( p < 0.001 ) . the ias scores were also significantly higher in adolescents who had been using the internet in home than in those who had been using the internet in other places ( p < 0.001 ) . the prevalence rate of anxious temperament for internet addicts was 15% , whereas that for nonaddicts , it was 2.8% ( p temperament subtypes and their distribution in terms of the internet addiction status are shown in table 2 . the mean ias scores were found to be higher in adolescents with anxious temperament ( 63.9 25.3 ) than those without anxious temperament ( 47.9 18.1 ) ( p < 0.05 ) . presence or absence of other temperament subtypes was not associated with significantly different scores on the ias . according to pearson 's correlation coefficient , significant correlations were detected between internet addiction and dysthymic ( r = 0.199 ; p < 0.01 ) , cyclothymic ( r = 0.249 ; p < 0.01 ) , hyperthymic ( r = 0.156 ; p < 0.01 ) , irritable ( r = 0.254 ; p < 0.01 ) , and anxious ( r = 0.205 ; p < 0.01 ) temperaments . adolescents with and without internet addiction were also compared according to their temps - a and sdq scores ( table 3 ) . although no difference was observed in temps - a scores , students with internet addiction scored higher on conduct problems ( p < 0.05 ) and total difficulties ( p < 0.05 ) subscales of sdq than students without internet addiction . moreover , there was a positive and statistically significant correlation between ias and conduct problems ( r = 0.146 ; p < 0.05 ) , hyperactivity - inattention ( r = 0.133 ; p < 0.05 ) , emotional symptoms ( r = 0.138 ; p < 0.05 ) , and total difficulties ( r = 0.160 ; p < 0.01 ) . in the present study , the prevalence of internet addiction was found to be 6.6% , which is similar with the rate found in other studies evaluating similarly aged students [ 22 , 23 ] . according to our findings , the risk of becoming an internet addict increases with the increase in the accesibility of internet . additionally , internet use with a duration of more than two years was also found to be related to increased internet addiction risk . in our study , presumably because of low participation rates in girls , there was no significant difference between boys and girls according to ias scores . contrary to our finding , turkey statistical institute has stated that computer and internet use was more prevalent among boys than in girls in 2010 data . other studies from turkey have also shown that boys were more prone to the effects of harmful internet use [ 17 , 25 ] . in a study which evaluated 535 primary school students using child behavior checklists , adhd scores have been found to be higher in adolescents with internet addiction than in those without . additionally , yen et al . , evaluating 2793 college students , revealed that there was a relationship between the internet addiction and attention deficit hyperactivity disorder ( adhd ) . they have also shown that the most prominent relation between the internet addiction was with attention deficit symptom cluster . similarly , in the present study , internet addiction scores were found to be positively related to attention deficit and hyperactivity scores . according to the rewarding withdrawal syndrome , because of the d2 receptor deficiency , children with adhd have marked tendency to predisposition for pathological gambling , substance and alcohol use , and impulsive and compulsive behaviours . the internet addiction , according to the reward deficiency hypothesis , may function as an unnatural reward and may accompany adhd symptoms by this way . dependent personality traits have been shown to be related with impulsivity , novelty seeking , psychoticism , and social relation problems in several studies [ 29 , 30 ] . landers and lounsbury evaluated 117 undergraduate students and found that the internet usage was negatively related to three of the big five traits , agreeableness , conscientiousness , and extraversion as well as two narrow traits ; optimism and work drive , and positively related to tough - mindedness . in a study conducted among college students in turkey , psychoticism was shown to be the only personality dimension related to establishing new relationships and having internet only friends . moreover , extroversion was the only personality dimension that is related to maintaining long - distance relationships and supporting daily face - to - face relationships . in our study , a positive and highly significant correlation was found between the internet addiction scores and depressive , cyclothymic , hyperthymic , irritable , and anxious temperament scores . furthermore , the frequency of anxious temperament was found to be significantly higher in students with internet addiction than those without . behavioural addictions demonstrate the core features of physical and psychological addictions such as mental rumination , mood variability , tolerance , withdrawal , interpersonal conflict , and relapse . according to the self - medication hypothesis , the patients usually use the substances to change their unwanted temperament status , to reduce their unbearable anxiety , and to cope with cognitive impairments . this can be seen in the internet addiction , which is also a behavioral addiction . namely , repeating efforts to get online may be a way of decreasing the severity of withdrawal symptoms such as anxiety . additionally , the explanation of increased internet addiction frequency in individuals with anxious temperament may be related to self - medication hypothesis . adolescents who are deprived of emotional and psychological support have been reported to be under increased risk for internet addiction . morahan - martin and schumacher revealed that 22.7% of the internet users had trouble with peer and family relations and had difficulty in work and school activities because of the internet usage . in our study sample , total strength scores and conduct problems scores of the sdq have been found to be significantly higher in the students with internet addiction . also , there was a positive correlation between the internet addiction scores and total difficulties , conduct problems , hyperactivity - inattention , and emotional symptoms scores . according to these findings first , since the sample of this study included students of a high school , the results of the study can not be generalized to the larger population in turkey . second , the sample size was modest to draw definite conclusions . also , high school education was not mandatory in turkey when this study was conducted . families in the east and southeast of turkey invest more in the education of their sons than their daughters . finally , the cross - sectional research design of the present study could not confirm causal relationships of temperament profiles and behavioural problems with internet addiction . according to the findings of the present study , internet addiction is a relatively common phenomena among the adolescents . there is a relation between the internet addiction and attention deficit and hyperactivity symptoms and also with anxious temperament . furthermore , behavioural problems are more frequent in adolescents who have problematic internet use . because of the cross - sectional nature of this study , it is not possible to define the direction of the causality of the results . there is a need for further prospective studies evaluating the temperament features of adolescents who are at risk for the internet addiction in larger study populations .

the purpose of this study was to investigate the association of affective temperament profiles and emotional and behavioural characteristics with internet addiction among high school students . the study sample included 303 high school students . a sociodemographic characteristics data form , internet addiction scale ( ias ) , the strengths and difficulties questionnaire , and the temperament evaluation of memphis , pisa , paris , and san diego autoquestionnaire were used to collect data . of the sample , 6.6% were found to be addicted to internet . having a computer in the home ( p < 0.001 ) and using the internet for more than two years ( p < 0.001 ) were found to be related to higher scores on the ias . the prevalence rate of anxious temperament for internet addicts was more than that for nonaddicts ( p < 0.001 ) . dysthymic ( r = 0.199 ; p < 0.01 ) , cyclothymic ( r = 0.249 ; p < 0.01 ) , hyperthymic ( r = 0.156 ; p < 0.01 ) , irritable ( r = 0.254 ; p < 0.01 ) , and anxious ( r = 0.205 ; p < 0.01 ) temperaments ; conduct problems ( r = 0.146 ; p < 0.05 ) , hyperactivity - inattention ( r = 0.133 ; p < 0.05 ) , emotional symptoms ( r = 0.138 ; p < 0.05 ) , and total difficulties ( r = 0.160 ; p < 0.01 ) were found to be correlated with ias scores . according to these findings , there is a relation between the internet addiction and affective temperament profiles , especially with anxious temperament . furthermore , emotional and behavioural problems are more frequent in adolescents who have problematic internet use .

it has been well documented that exercise is an effective health behavior that not only prevents various health problems , but also promotes healthy lifestyles ( 1 ) . in addition , in many areas , the physical and psychological benefits from regular physical activity in reduction of mortality and morbidity in both general and clinical populations are sufficient justification for the inclusion of exercise in healthcare programs ( 2 ) . the u.s . surgeon general s report on physical activity reduces the risk not only of premature mortality , but regular physical activity is also important for mental health and overall quality of life ( 3 ) in spite of important health benefits brought about by physical activity , many people are not sufficiently active in their daily lives in order to benefit their health ( 4 , 5 ) . physical activity is estimated to cause 1.9 million deaths globally and more than 60% of adults do not engage in sufficient levels of physical activity which are beneficial to their health ( 4 ) . findings from a national survey among iranian adults revealed more than 80% sedentariness and 44.4% lack of exercise in their free time ( 5 , 6 ) . to improve our limited understanding of physical activity behavior , health professionals have been encouraged to examine the exercise behavior of individuals using contemporary psychosocial theories ( 7 ) . one of the most promising of these theories is the transtheoretical model ( ttm ) of behavior change ( 8) . the ttm postulates that people change behavior cyclically in five stages that integrate current behavior with their intention to maintain or change behavior . the five stages of motivational readiness to change physical activity behavior are as follows : precontemplation includes those not participating in regular physical activity and not intending to change in the next 6 months.contemplation includes those not participating in regular physical activity but intending to do so in the next 6 months.preparation includes those not participating in regular physical activity but actively making small changes to do so.action includes those who have actively engaged in regular physical activity for less than 6 months.maintenance includes those who have actively engaged in regular physical activity for 6 months or more ( 9 ) . precontemplation includes those not participating in regular physical activity and not intending to change in the next 6 months . contemplation includes those not participating in regular physical activity but intending to do so in the next 6 months . preparation includes those not participating in regular physical activity but actively making small changes to do so . action includes those who have actively engaged in regular physical activity for less than 6 months . maintenance includes those who have actively engaged in regular physical activity for 6 months or more ( 9 ) . these constructs include self - efficacy ( a person s confidence to participate in a specific behavior in the midst of difficult situations ) , decisional balance ( the pros and cons of changing ) , and 10 processes of behavior change classified as experiential processes of change and behavioral processes of change ( 10 ) . therefore , it is imperative to determine the external validity of those research findings before adopting findings across nations and cultures ( 11 ) . so this study was designed and carried out with the aim of examining the applicability of transtheoretical model ( ttm ) on exercise among office staff of yazd city . a total of 220 offices employees with mean age of 348.68 years were selected from all the administrative offices in yazd city . considering 22 variables , a total of 220 official personnel were selected from all the administrative offices in yazd . initially , after listing all of the offices , 8 were randomly selected and 30 employees from each office were included in the study . validity of the questionnaire was acceptance with content validity and reliability of the method of implementation pilot projects and calculated with alpha cronbach ( alpha=0.81 ) . these questionnaires examined the exercise behavior of offices employees and the ttm constructs relating to exercise behavior . the first survey instrument was designed to collect information on 1 ) basic demographics 2 ) stages of change 3 ) self efficacy 4 ) decisional balance 5 ) process of change . in order to measure exercise behavior , the stage of exercise behavior change questionnaire was developed and modified by marcus et al ( 13 ) . in this questionnaire , stage of exercise behavior change was assessed using 5-item , dichotomous scale ( yes/no ) related to regular exercise behavior and intentions . regular exercise was defined as exercising 3days ( preferably all ) of the week for at least 20 min each time . self - efficacy for exercise was measured using a four - item instrument developed by bandura ( 14 ) participants responded by using a five point likert scale of not at all confident until always true . decisional balance ( pro & con scores ) was measured using a 43-item inventory developed by sechrits ( 15 ) that evaluated the perceived pros and cons to exercise behavior . participants were asked to evaluate each statement based on their own circumstances , using a four point likert scale of strongly agree until strongly disagree . to assess the participants behavioral / cognitive activities relating to exercise behavior change , questionnaire developed by nigg was used in this study ( 16 ) . regarding ethics , purpose and nature of research were explained to all of the employees under study and all processes were served with formal permission of the officials . in this study 152 males ( 69.1% ) and 68 females ( 30.9% ) with an average age of 348.68 years were selected . according to the results , 20% of the subjects were in precontemplation stage , 40% in contemplation stage , 13.6% in preparation stage , 7.3% in action stage and 19.6% of the subject were in maintenance stage . according to results this study , all constructs of model had significant correlation with the behavioral change stages . correlation coefficient for constructs of model was self efficacy r=0.40 , cognitive processes of change r= 0.44 , behavioral processes of change r = 0.55 , r = perceived benefits r= 0.32 , for perceived barriers r=0.31 , and between this behavioral processes of change ( table 1 ) . the results on the relationship between sex and stage of change showed that in maintenance phase , only 23 percent of men and 9.3 percent were women . according to the results of this study , older individuals were more in the maintenance stage as compared to younger individuals , as amount of physical activity increases with increase in age . also , it was higher self efficacy , processes of change and decision balance increased in people with higher age ( table 2 ) . the relationship between education and stage of change was significant ( p=0.001 ) and with progress the stages from precontemplation until maintenance decreased in uneducated . this study on the relationship between educational level and self efficacy showed that people with higher education level had higher mean score than people with lower education . there was a significant relationship between income and concepts of ttm ( self efficacy , processes of change ( cognitive and behavioral process and stages of change ) as among higher income people , 30.4 percent were in maintenance stages , while in lower - income people only 11.1 percent were in maintenance stage . regarding amount of working hours per week and its relation to stages of change , this research proved that 23.5 percent of people who worked less than 35 hours per week were in maintenance stage , while 18 percent of those who worked more than 35 hours per week were in maintenance stage . all structures ( self efficacy , behavior change processes , cognitive processes of change and perceived benefits ) had significant positive relationship with preparation for exercise , and so with progress people in stages of change increased all structures of ttm ( except cons ) ( table 3 ) . the government employees sitting behind the desk are relatively immobile and suffer from numerous diseases and problems like debility , obesity , and lethargy in mind , thought and daily affair . the results of this study showed that the majority of people ( more than half ) were in precotemplation and contemplation stages and minority of people were in action stage but in a study by nigg et al . also in kim et al study in south korea , most of the participants were in maintenance stage ( 19 ) . this contradiction can be due to the influence of seasonality on physical activities . as the level and motivation to engage in physical activities tends to increase in spring and summer ( 20 ) , and the present study was undertaken in spring , the prevalence of individuals who initiated physical activities or who intended to do so may be overestimated . and the other reason that the comparison of the finding is sometimes difficult is the reason that concept of the stages , assessment formats and definition of pa significantly varies between studies ( 21 ) . women were more than men in precontemplation and contemplation stages , while in the maintenance stage ; women were less as compared to men . this result is in line with findings and matches with laforg and kim studies ( 19 , 22 ) . according to the results of this study , older individuals were more in the maintenance stage as compared to younger individuals , while studies by kerneay ( 23 ) showed that people with higher age were in contemplation stage . in this regard , wong and colleagues ( 24 ) showed that there is increase in inactivity rate with increasing age . but other studies like the gupta study have shown that women and men who are concerned about the effects of old age participate in weight loss programs more than the other people ( 25 ) . results of this study prove that there were significant relationships between income and variables like self efficacy processes of change ( cognitive and behavioral process ) . results of this study confirmed results of boutle and colleagues in their study ( 26 ) . the results of this study showed that most people who spent time work during the week had opportunities for participation in sports , but it is likely that they did not have a desire to exercise because of daily fatigue . on the other hand , belief that the public actually working is considered the exercise can be effective in this situation . this study showed that in people with higher income , 30.4 percent were in maintenance stage , while lower income people , only 11.1 percent were in maintenance stage . boutle and colleagues showed the same result that the amount of physical activity in individual with higher social economic status was more than people with higher income were in maintenance stage ( 26 ) . this study showed the relationship between education and stage of change as more people with higher education were in action and maintenance stages . these results match with other studies by dumith and wood ( 27 , 28 ) . one probable reason for higher self efficacy in higher educated people is that education enhances the level of thinking and people are more familiar with pros and cons of exercise , thus they increase efforts to exercise in order to enhance positive effects of exercise on their physical and mental health and decrease negative effects of exercise . correlation analysis results between the concepts of ttm stages of change model correlation were significant ( except cons ) . the findings of the study match those by harry and kim ( 19 , 29 ) . the study findings indicate that the ttm is usefull in understanding the physical activity behavior of staff . in sum , most of the participants in this study were in the precontemplation and contemplation stages . it seems we need to develop strategies and programs to increase exercise activities in office staff .

background : transtheoretical model is identified as a comprehensive model for behavior exercise . the aim of this study was to check the situation of stage of change in exercise behavior of office personnel of yazd city using transtheoretical model.methods:in a cross - sectional study , 220 office personnel selected from administrative offices of yazd through two - stage cluster - sampling method . the instrument for data collection was a questionnaire that included demographic variables and constructs of transtheoretical model . the reliability and validity of the instruments were examined and approved by experts . the data was analyzed using spss soft ware.results:152 males ( 69.1% ) and 68 females ( 30.9% ) with an average age of 348.68 years were selected . sixty percent of the subjects were in precontemplation and contemplation stages and only 7.3% were in action stages . significant differences were found between ttm constructs and stages of change ( p=0.000 ) . the results also showed significant differences between components of decisional balance and behavioral process and cognitive process with the stages of change . we found that behavioral process of change and self efficacy were the most important variables for improving levels of exercise.conclusion:most of the participants were in the precontemplation and contemplation stages and most problems were related to behavioral process and self efficacy . therefore , strategies and programs are needed to be taken into account to improve exercise among the staff .

amisulpride is a substituted benzamide that , at low doses , selectively blocks d2 and d3 presynaptic dopamine receptors , enhancing dopaminergic transmission in frontal cortex and limbic areas . many clinical studies versus placebo , tricyclic antidepressants and selective serotonin reuptake inhibitors showed amisulpride antidepressant effect , supporting its safety and rapid onset of action . the proposed mechanism of action of substituted benzamides implies a selective modulation of the dopaminergic system in the mesocorticolimbic area , important for cognitive processing of internal and external cues , related to survival . the compound is very selective for mesolimbic d2 and d3 receptors and therefore has a dual mechanism of action , which is associated with two different indications . based on experimental data , amisulpride is the drug of choice for dopaminergic transmission disorders , both in depression and in schizophrenia . preliminary research findings suggest that adjunctive amisulpride to fluvoxamine may be a potential strategy for an early onset of ssri activity in the treatment of major depressive disorder . however , dyskinesia and dystonias of jaw associated with serotonin specific reuptake inhibitors ( ssri ) treatment have also been reported . fluvoxamine induced complex movement disorders , mandibular dystonia and dyskinesia have also been noted over the years . a 56-year - old female presented to the schizophrenia foundation hospital ( scarf ) outpatient services with a seven - year on and off history of sub syndromal anxiety and depressive symptoms related to marital stressors and a one - month exacerbation of symptoms following her son 's marriage . patient was diagnosed as a case of mixed anxiety and depression as per international classification of diseases ( icd)-10 criteria . treatment was initiated with escitalopram 10 mg for a week and discontinued due to gastritis . subsequently patient was started on amisulpride 50 mg / day and hiked to 100 mg when she gradually reported improvement in mood in 6 weeks . during the next follow up at week 12 of 100 mg amisulpride therapy , she was first noticed to have orofacial dyskinetic movements and amisulpride was discontinued . however , patient was prescribed fluvoxamine 25 - 50 mg for 8 weeks because of worsening of anxiety and depressive symptoms . during her subsequent hospital visits , patient reported progressively severe dyskinetic movements of the face , neck , right forearm , wrist , and fingers and opisthotonic posturing of the chest . she was evaluated in detail and diagnosed with dyskinesia ( drug induced ) as per icd-10 . a score of 4 on the naranjo adverse drug reaction probability scale indicates a possible cause of dyskinesia related to amisulpride . there was no past or current history of substance use or neurological disorder , or any family history of movement disorders or any previous antipsychotic use . magnetic resonance imaging ( mri ) done did not reveal any abnormal finding . to treat drug - induced dyskinesia , two months later , tardive dyskinesia persisted and there was no improvement in dyskinetic movement . this case highlights and aims to raise awareness that low dose amisulpride causes dyskinesia contrary to the reports of higher doses of amisulpride and movement disorders . the risk factors for tardive dyskinesia in our patient were old age , female gender , diabetes mellitus , exposure to amisulpride and fluvoxamine . tardive dyskinesia in our patient had appeared after initiating treatment with amisulpride and worsened with fluvoxamine and had persisted and remained unchanged despite the withdrawal of both drugs from treatment regimen . all previous cases have reported development of tardive dyskinesia 8 - 24 months after the patients were started on amisulpride . in contrast , this case is unique because of the occurrence of movement disorder within 3 - 4 months of treatment with low dose amisulpride for depression . the implications of this case have been to create awareness that low doses of amisulpride can possibly trigger dyskinetic movements and may worsen further to more complex movements in combination or in monotherapy with fluvoxamine .

in recent years , there has been an increasing trend to use amisulpride in the treatment of dysthymia and also as an adjunct treatment in patients with major depression . at low doses ( 50 mg ) , amisulpride preferentially blocks presynaptic auto receptors , enhances dopamine release , and therefore acts as a dopaminergic compound able to resolve the dopaminergic hypo activity that characterizes depression . based on experimental data , amisulpride is the drug of choice for dopaminergic transmission disorders , both in depression and in schizophrenia . this case highlights the development of dyskinesia in a depressed patient treated with low dose amisulpride and fluvoxamine .

in korean industry that traditionally causes pneumoconiosis has been mainly metal and coal mining ( 1 ) , so the miners were engaged in a public surveillance system but tunnel drillers were not some years ago . silica is a major component of rock and sand , and tunnel drillers have potential exposure to silica ( 2 ) . but cases have been rarely reported in korea . accordingly , since we found a case that a worker who had been working in the drilling process of the tunnel excavation for 20 years from 35 to 55 yr old , a 67- years- old men showed silicosis displaying various clinical aspects such as pneumonia , pulmonary edema , secondary infection along with a suspicious finding of cancer , herein we report the case . in april 2010 , a 67- years- old men referred to donga university hospital , south korea complaining of continual cough for 8 yr . the symptoms were more aggravated at night . the forced vital capacity ( fvc ) was 80% and forced expiratory volume in one second ( fev1 ) 96% , fev1/fvc ( % ) was 83% , indicating nearly within normal range . he was recommended to visit hospital monthly . in december 2011 , on his chest x - ray , diffuse nodular opacity was seen ( fig . , peribronchial tumor infiltration was showed on bronchus intermedius and lymphohematogenous metastasis were showed in both lungs . 2 ) . diffuse nodular opacity was seen on chest x - ray peribronchial tumor infiltration was showed on bronchus intermedius and lymphohematogenous metastasis were showed in both lungs . multiple metastatic lymphadenopathy also showed above mentioned area in positron emission tomography - computed tomography ( pet ct ) showed hypermetabolic bilateral mediastinal and perihilar lymph nodes and multiple nodules in both lungs . the bronchial washing test gave negative results for acid - fast bacillus ( afb ) , afb pcr ( polymerase chain reaction ) , afb culture test and microscopic cytology . biopsy of lungs showed that malignant neoplasm was not found while fibrosis , anthracosis and silicosis were observed . carcinoembryonic antigen ( cea ) was 1.58 ng / ml , which was at the normal level . silicotuberculosis was suggested on rml and bll in january 2012 , he was admitted complaining of cough and chilling sense . on chest pa and ct , focal lobar pneumonia with distal bronchopneumonia , associated with mild pulmonary edema was observed in both lungs . the patient was diagnosed with pneumonia and silicosis , and was discharged since the dyspnea symptom was somewhat improved in november 2013 , he was admitted complaining of fever for 10 days . 3 ) . on chest ct , increased extent of well - defined centrilobular nodules with perilymphatic distribution , indicating aggravated state of pneumoconiosis was observed on both lungs . multifocal patchy consolidation with ground glass opacity and ill - defined nodules were shown in rml and bll , which indicating silicotuberculosis , multifocal pneumonia or reactive lymphadenopathy ( fig . the patient was diagnosed with pneumonia , tubercuosis and silicosis , and was discharged since the a symptom was somewhat improved increased extent of well - defined centrilobular nodules with perilymphatic distribution , indicating aggravated state of pneumoconiosis was observed on both lungs . and multifocal patchy consolidation with ground glass opacity and ill - defined nodules were shown in rml and bll , which indicating silicotuberculosis , multifocal pneumonia or reactive lymphadenopathy in july 2015 , small opacity was observed throughout the whole lung in plain chest radiographic images , interpreted to be pneumoconiosis ( ilo classification t / q , 2/3 , tb ) ( fig . 5 ) . although the tunnel drilling causes silicosis by generating crystalline free silica , the actual reports of the occurrence in korea could not be found in any search . in addition , there have been only few reports in pubmed . for all tunnel workers , the geometric mean exposure to total dust was 3.5 mg / m ( gsd = 2.6 ) , respirable dust was 1.2 mg / m(gsd = 2.4 ) , and alpha - quartz was 0.035 mg / m ( gsd = 5.0 ) , respectively ( 3 ) . the mean exposure to respirable dust and alpha - quartz in tunnel workers varied from 1.23.6 mg / m3 ( respirable dust ) and 0.0190.044 mg / m ( alpha - quartz ) depending on job task performed ( 4 ) . latency and progressing pattern of silicosis vary according to concentration of inhaling dust and the accumulated exposure amount of dust ( 5 ) . in this case , the symptoms started 39 yr after first exposure and the latency of radiologic change was 48 yr . a japanese study , in the tunnel worker the incidence rate of progression was 42 per 1,000 person - years with a median time to progression of 17 years . the mean durations of progression from category 1 to category 4 and category 2 to category 4 were 14.55 and 10.65 years , most patients ( 86% ) had radiographic change from category 1 or 2 directly to category 4 ( 6 ) . the prevalence of tuberculosis is 101 per 100,000 in 2014 in korea and highest rate in oecd ( 7 ) . crystalline silica was classified as group i by the international agency for research on cancer ( iarc ) ( 8) . if patients with silicosis smoke , the relative risk of lung cancer was 4.47 times higher ( 9 ) . the smr s of workers with dust exposure for lung cancer was 188 ( 10 ) . therefore , we must check up the retired person who worked in the tunnel in their lives . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors .

author reports a case of 67- years- old men referred to donga university hospital silicosis who had worked in tunnel drilling where presumably had been exposed to high concentration free silica for almost 20 yr . this report is considered the first in korea to the best of our knowledge since no cases on silicosis could be reported in this occupation in reviewing various literature sources in korea . the physician s first impression was lung cancer since the ct findings . however , it turned out to be pneumonia and silicosis . it was eventually diagnosed with silicosis and pneumonia , and tuberculosis . the patient is suffering from various clinical courses for long time .

the average man in poland lives 8 years less than the average woman , and displays a lower health awareness . in the age group 4549 , 107 women occur for each 100 men , and this trend indicates an increase in the subsequent age groups . the major causes of death in poland include cardiovascular diseases , carcinomas ( in particular tobacco - related ) [ 36 ] and deaths due to external causes , such as accidents , injuries or poisoning . in global terms , cancer constitutes the third major cause of death , and the second major cause in poland , also posing one of the most challenging health , economic and social problems of the 21 century [ 2 , 7 ] . the analysis of the epidemiological situation in the field of carcinomas requires , among other things , conducting an incidence analysis of this group of diseases . morbidity , also referred to as incidence , reflects the number of newly registered cases of a given disease in a specified period ( a year ) when converted ( usually ) to per 10 thousand or 100 thousand individuals in the population examined . the monitoring of incidence trends allows the identification of changes over time and prompt reaction to the growing needs in certain medical specialisations ( e.g. oncology ) or treatment methods , and to the needs related to prophylaxis and health promotion . in 2008 , poland was a european country characterised by an averagely low incidence and generally high mortality due to malignant tumours . the incidence was lower as compared to most eu-15 countries , but the mortality was much higher , which appears alarming . this situation results , among other things , from the relatively low level of the demographic old - age of the polish society as compared to the european union . however , the vital - statistics trend which has prevailed since the end of the 20 century , manifested through the dropping birth rate , is likely to lead to the gradual ageing of the society . this may , in consequence , contribute to an increased incidence of malignant tumours in the future . in 2006 - 2010 , the national cancer registry indicated a gradual increase in the incidence of malignant tumours among men , from 64,092 thousand in 2006 to 70,024 thousand in 2010 . in the same period , the number of deaths due to malignant tumours among men oscillated around 52 thousand [ 2 , 6 , 7 ] . the aim of this study was to analyse the malignant - tumour incidence in the male population of poland in the period 20062010 . the study material comprised data obtained from the national cancer registry and the central statistical office , available on their websites . the register covers the incidence of carcinomas in the polish population , which are coded in accordance with the international statistical classification of diseases and related health problems ( icd revision 10 , c00-d09 ) . this data is presented chronologically in annual reporting periods , and is broken down by gender , age and voivodeship . this kind of information is collected in the register on the basis of cancer - notification forms ( mz / n-1a ) . their analysis makes use of basic statistical indicators such as absolute numbers , percentages , crude rates and standardised rates . the epidemiological analysis employed absolute numbers , percentages , and also standardised and crude incidence rates , along with the cumulative risk of cancer by age , domicile and cancer type . the crude incidence ( death ) rate reflects the risk of contracting ( dying of ) a malignant tumour , and determines the number of registered incidence ( death ) cases due to a given cancer ( cancer group ) per 100 thousand people in a given year . the standardised incidence ( death ) rate ( by age ) reflects the risk of contracting ( dying of ) a malignant tumour , and determines the number of incidence ( death ) cases that would occur in a given population if its age structure were the same as in the standardised population , when converted per 100 thousand people . the standard global population was assumed as the population for the purpose of standardised rates . the population structure by gender and by 5-year age group was presented using data provided by the central statistical office ( cso ) , based on the results of the 2011 national census . a gradual increase in the crude and standardised incidence rates was recorded in the reporting period , together with a visible percentage increase in the male population aged 45 and more ( society ageing ) and a relatively constant number of men in the entire population ( table 1 , fig . 1 ) . incidence of malignant cancers in poland in 20062010 depending on the age incidence of malignant tumours , number as a total in the population and percentage in the group of 45 years and above amongst men in poland in 20062010 own study [ basing on 7 ] the incidence of carcinomas is strongly age - dependent . the incidence rate displays an exponential dependence on age between the fourth and seventh decade of life ( fig . the number of deaths due to malignant tumours in poland for the last five decades has increased by nearly 2.4 times . in the analysed period , it amounted to 463,521 thousand , including 260,531 thousand deaths among men , which accounted for 56.2% of all deaths due to malignant carcinomas in the discussed period ( table 2 ) . mortality due to malignant tumours amongst men in poland in years 20062010 [ basing on 7 ] lung cancer is the most - common type of cancer among men , in terms of frequency , accounting for around one - fifth of all incidence cases ( 22.1% ) . it is followed by prostate cancer ( 12.5% ) , colorectal cancer ( 12.2% ) and bladder cancer ( 6.7% ) . malignant skin cancer , stomach cancer , kidney cancer , laryngeal cancer , pancreatic cancer and leukaemia are also among the ten most frequent carcinomas contracted by men . lung cancer constitutes the most frequent cancerous cause of death among men ( over one - third , i.e. 31.7% , of all deaths ) . colorectal cancer constitutes 10.8% of all deaths due to cancer , and prostate cancer 7.5% . stomach cancer , bladder cancer , pancreatic cancer , kidney cancer , leukaemia and brain cancer are also among the major cancerous causes of death ( table 3 ) . incidences of falling ill and deaths at men , as concerns 10 major malignant tumours in 20062010 [ basing on 7 ] the five - year relative survival rate of male patients with malignant tumours , diagnosed in 20002002 and 20032005 , is shown in table 4 , [ 12 , 13 ] . the highest increase is observed in the five - year survival rates of men suffering with prostate cancer , followed by bladder cancer and colorectal cancer , while a slight downward trend involves male patients with brain cancer and pancreatic cancer . the indicator of 5-year relative survival of patients with malignant neoplasms in poland in men diagnosed in 20002002 and 20032005 [ basing on 12 and 13 ] cancer detectability among men differs in particular voivodeships of poland . however , the types of most frequently recorded types of malignant tumours correspond to the national trends . the voivodeships with the largest numbers of registered carcinomas ( over 34% of all notifications ) in the analysed period included the lskie , mazowieckie and wielkopolskie voivodeships . the highest standardised incidence rates and the highest cumulative risk of cancer were recorded in the wielkopolskie , dolnolskie and pomorskie voivodeships , while the highest mortality rates involved the kujawsko - pomorskie , warmisko - mazurskie and pomorskie voivodeships ( table 5 ) . the incidence of falling ill and deaths according to provinces amongst men in the period of 20062010 [ basing on 7 and 11 ] within the last thirty years , the incidence of malignant tumours in poland has soared . since the beginning of the 21 century , we have noted a gradual ceasing of this trend , and in the recent decade the incidence curve has < i > plateau < /i > ed . in the analysed period , from 2006 to 2010 , the malignant - tumour incidence among the male population indicated a slow but steady growth , while the death rate dropped slightly at the end of 2010 [ 2 , 7 ] . the incidence of malignant tumours in poland is lower than the eu average , but mortality is around 20% higher among men . the five - year survival rate of patients with malignant tumours within the first decade of the 21 century grew from 32.9% to 37.3% among men , and from 51.2% to 53.5% among women . this growth might reflect an increased efficiency of cancer treatment in poland , but there is no specific evidence to prove this hypothesis . the difference in the 5-year survival rate among men and women stems , among other things , from the fact that organic carcinomas with poor prognosis , i.e. lung cancer , laryngeal cancer and oesophageal cancer , constitute over one - third of all cancer - incidence cases among men . these trends require further thorough monitoring and an increased efficiency of oncologic care in our country . the incidence risk grows with age , with peak values between the age of 55 and 79 . . the risk of contracting cancer grows with age , and a considerable increase is observed from the fourth decade of life [ 2 , 6 , 7 , 14 ] . such a trend in the incidence change curve indicates the occurrence of specific cancer - risk factors associated with different stages of life . this data should be taken into account when planning any studies on cancer - risk factors related to human activity in various decades of life , and also when planning and establishing prophylactic programmes . the epidemiological projections for the coming years are not optimistic , given the progressing ageing of society . this contributes to premature deaths among both women and men [ 2 , 10 , 11 , 15 ] , exerting an influence on the socioeconomic situation of polish families and on the condition of public finances . for decades , such a situation has been triggered , among other things , by a low level of knowledge of pro - health behaviour , including oncologic prophylaxis in the female and male populations [ 1619 ] . the continuously high incidence and mortality rates due to cancer in poland require profound changes in the financing , planning , organisation , implementation and monitoring of the efficiency of various activities undertaken by the government administration ( and mainly by the ministry of health ) in the field of public - health improvement . it should be noted that the plans in the multiannual national cancer control programme are being realised in 20062015 . the main goals of the programme include preventing further growth in the incidence rate of cancer , and achieving average european early - cancer detection and treatment - efficiency rates . having inspected the implementation of the national cancer control programme objectives by the minister of health in 20092013 , the supreme audit office has assessed their efficiency in a negative way . as revealed by the said inspection , the programme goals determined by the act have not been achieved , and the early cancer detection and treatment - efficiency rates are still very far from the european average [ 20 , 21 ] . other comprehensive programmes must be undertaken in the future , with a view to promoting modern prevention , diagnostic and therapeutic methods . the measures to be taken must provide for raising the social awareness of pro - health behaviour , including oncologic prophylaxis , by making better use of human resources available within the healthcare system . this is both the most essential and the cheapest way to conduct system activities oriented towards improving the state of health of the population [ 22 , 23 ] . in 2010 , the most - frequent malignant tumours in poland include tracheal cancer , bronchial cancer and lung cancer , followed by prostate cancer and colorectal cancer [ 2 , 7 ] . there are screening test programmes , financed from public resources , which allow the detecting of colorectal cancer , breast cancer and cervical cancer . however , these measures are obviously insufficient , which often leads to late diagnosis of cancer at an advanced 3 or 4 stage [ 24 , 25 ] . the distribution of the incidence of malignant tumours among men by voivodeship also forms an interesting element of the analysis . over one - third of all cancer - incidence cases are attributable to three out of sixteen voivodeships ( i.e. lskie , mazowieckie and wielkopolskie ) , which are altogether inhabited by around 34% of the entire polish population . these findings require further examination , as the regional differences observed may be caused by differences in the infrastructure of healthcare systems , communication , interest on the part of local - government bodies in the protection of citizens health , such demographic features as age and education , and access to various sources of information . the analysis of death rates by voivodeship also requires an in - depth analysis in the context of improving the healthcare system efficiency . in conclusion : the incidence rate of malignant tumours in the male population in 20062010 indicated a slow but steady growth . the incidence rate of cancer grows with age , with peak values between the age of 55 and 79 . the upward trend starts with the fourth decade of life , and most incidence cases occur after the age of 60 ( 70% of new indecencies ) . in the analysed period , the most common types of malignant tumours in poland have been lung cancer , followed by prostate cancer and colorectal cancer . this trend has not changed for the last decade as regards the first two cancer types mentioned , whereas colorectal cancer has gone up from fifth to third position in the analysed period . the conditions of reporting and mortality due to malignant tumours by voivodeship should be subject to separate analyses , in the context of shaping the regional and national health policy .

in the period 20062010 , the national cancer registry indicated a gradual increase in the incidence of malignant tumours among men , from 64,092 thousand in 2006 to 70,024 thousand in 2010 . in the reference period , the number of deaths due to malignant tumours among men oscillated around 52 thousand.the aim of this study was to analyse the incidence of malignant tumours in the male population of poland in the period 20062010.the study material comprised data obtained from the national cancer registry and from the central statistical office , available on the websites of these institutions.the malignant - tumour incidence rate among the male population in 20062010 showed a slow but steady growth , while the death rate dropped slightly at the end of 2010 . the hypothesis that the cancer - incidence risk grows with age has been proven , and a substantial increase in this risk is observed from the fourth decade of life . the most common malignant tumours in poland in the analysed period included lung cancer , followed by prostate cancer and colorectal cancer.future prophylactic and educational programmes should be addressed to men prior to reaching the age of increased cancer risk .

q - switched 1064 nm neodymium - doped yttrium aluminium garnet ( qs 1064 nm nd : yag ) laser has gained much popularity in the treatment of pigmented skin lesions and tattoos . it works on the principle of selective photothermolysis , generating ultra - short pulses of high energy and peak power , with an additional photoacoustic effect . the most frequently encountered adverse reactions with this laser are hypopigmentation and hyperpigmentation , and rarely textural changes and scarring . we are presenting a case report of successful reversal of qs 1064 nm nd : yag laser - induced hypopigmentation with ultraviolet b ( uvb ) targeted phototherapy ( tpt ) . a 29-year - old male patient of fitzpatrick skin type v approached us for tattoo removal treatment . he had a 6-month - old black tattoo of size 3 7 cm on the dorsum of his left hand [ figure 1 ] . he was treated with qs 1064 nm nd : yag ( ) ( dual- pulsed q - switched nd : yag spectra laser , lutronic corporation ) laser machine . the parameters used were 3 mm spot size , 2 hz pulse rate and 3j fluence in the first session . the subsequent sessions were scheduled at 1 month interval and the fluence was gradually increased to 8j . patient had a very good response to the treatment with 85% clearance of the tattoo but reported to us with depigmentation at 4 weeks after the 6 session of laser treatment [ figure 2 ] . patient was then subjected to targeted uvb phototherapy twice a week starting on the same day , using tpt device ( lumera : targeted phototherapy , daavlin company ) , which delivered uvb radiations at a dosage of 100 mj / s , at a full lamp output of 100 mw / cm . the starting duration of therapy was 4 s and gradually increased by 1 s at every session , depending on the response to previous session . patient started showing re - pigmentation after two sessions and a very good response was seen after six sessions at 9 s duration of phototherapy [ figure 3 ] . the energy delivered at 9 s with the lumera system was 275 mj / cm . black coloured tattoo on the dorsum of left hand depigmentation following treatment with qs 1064 nm neodymium - doped yttrium aluminum garnet laser repigmentation following targeted ultraviolet b phototherapy pigmented lesions of skin respond to laser and light of wavelength ranging from 290 nm to 1200 nm , as melanin absorbs light of this wavelength . the qs laser has a special property of generating ultra - short ( nanosec ) range of pulses with high peak power . the qs lasers such as nd : yag , ruby and alexandrite are preferred to treat pigmentary lesions , although long pulsed laser such as diode is also useful . these lasers function on the principle of selective photothermolysis and also produce photoacoustic effect by generating shock waves that cause explosion of the targets such as melanin and ink particles , which are later gradually removed from the site through circulation . the resultant effects include dermal and epidermal melanosome rupture , melanosome rupture in melanocytes and destruction of dermal melanophages . as in any aesthetic treatment the most commonly occurring side effects are hypo and hyperpigmentation , the risk being higher in darker skin types . hypopigmentation occur as small white macules matching the laser spot size and shape , within weeks of treatment . the risk of hypopigmentation appears to be directly proportional to the number of treatment sessions and fluence . however , these side effects can be avoided by using the right fluence tailored to individual patient . a test patch in the covered area may be helpful to decide the appropriate fluence . only a slight sensation of warmth in the treated area is enough to produce the effect and avoid side effect at the same time . histological features of laser induced hypopigmentation include marked decrease in melanin with only slight decrease in basal epidermal melanocytes . treatment of hypopigmentation in a dark skinned patient can cause much psychological distress and is challenging . different treatment options previously reported to be effective include topical medication such as psoralen with ultraviolet a phototherapy puva and narrow band ultraviolet b nb - uvb phototherapy , 308 nm excimer laser and fractional resurfacing . phototherapy helps in re - pigmentation by stimulation of melanocyte - stimulating hormone ( msh ) , increased melanocyte proliferation , and melanogenesis . uvb radiation causes increased msh receptor activity by redistributing msh receptors from internal pools to the external surface , with a resultant increase in cellular responsiveness to msh.[1113 ] tpt induces all these effects in a more aggressive way , because of delivery of super - erythemogenic doses of radiation . furthermore , since it specifically targets the affected skin , it avoids many of the side effects of conventional phototherapy . it is , therefore , particularly suitable for management of laser induced , which is a localized form of hypopigmentation . the qs 1064 nm nd : yag laser treatment was used in our patient for pigmentary skin condition like tattoo . though , good clinical response was seen , it led to hypopigmentation as side effect . tpt was chosen to treat the hypopigmentation because of the above advantages of this treatment modality . narrow band uvb , excimer laser and fractional lasers have been reported to be effective in treating post laser hypopigmentation . however , to the best of our knowledge , only one case of tpt in qs laser induced hypopigmentation has been reported before . this case report , therefore , represents the second documented use of tpt in qs nd : yag laser induced hypopigmentation . tpt appears to be a suitable alternative in the treatment of laser induced hypopigmentation , because of its effectiveness and rapid response needing fewer treatment sessions with minimal side effects . the success of tpt suggests that the melanocyte damage caused by qs nd : yag laser is reversible and temporary .

q - switched 1064 nm neodymium - doped yttrium aluminium garnet ( qs 1064 nm nd : yag ) laser plays an important role in the treatment of pigmentary skin disorders , including tattoos . although it has high efficacy and safety , adverse effect like hypopigmentation may occur causing anxiety to patients . we present a case report of qs 1064 nm nd : yag laser induced hypopigmentation which was successfully treated with ultraviolet b targeted phototherapy , with rapid and satisfactory re - pigmentation .

a 54-year - old man was admitted to the hematology department , robert - bosch - hospital , stuttgart , germany , in early 2010 , with fever ( 39.5c ) , chills , and minor dyspnea that had lasted for 3 days . four years earlier , he had received a stem cell transplant for acute myeloid leukemia , which was in first complete remission after myeloablative conditioning with total body irradiation , 12 gy , and cyclophophamide , 120 mg / kg bodyweight . the post - transplant course was complicated by grade 3 graft - versus - host - disease of the skin and gut , multiple infectious episodes , chronic renal failure ( creatinine level 3 mg / dl , glomerular filtration rate 25 ml / min , urea level 80 mg / dl ) , repeatedly occurring cytomegalovirus replications , and later on extensive chronic graft - versus - host - disease , necessitating continuous immunosuppressive therapy ( tacrolimus , steroids ) , and anti - infective prophylaxis ( dose - adjusted levofloxacin , 125 mg / d , posaconazole , 3 200 mg / d ) , respectively . after admission , chest radiograph revealed no abnormal findings . blood cultures were drawn , and the patient was given empiric antimicrobial drug therapy with intravenous ( iv ) imipenem / cilastatin ( 500 mg/8 h ) and full - dose levofloxacin ( iv 2 250 mg / d ) the same day . the computerized tomography scan revealed a large infiltrate in the right upper lobe . in the initially drawn blood cultures , gram - negative rods were cultivated after 165 h. f. tularensis was suspected on the basis of biochemical identification , and the isolate was sent to the reference laboratory for tularemia for confirmation ( bundeswehr institute of microbiology , munich , germany ) . subsequently ( day 8 after admission ) , the antimicrobial drug therapy was extended to doxycycline ( iv 2 100 mg / d ) . examination of smears originating from the positive blood cultures revealed bacteria that presented as pleomorphic , faintly staining , gram - negative coccobacilli . an aerobic , slow - growing bacterium was recovered from chocolate agar after a 2-day incubation at 37c in an atmosphere of 5% co2 . presumptive identification of the isolate with the gram - negative card on the vitek 2xl instrument ( biomrieux , nrtingen , germany ) indicated f. tularensis . the isolate was sent to the national reference laboratory for tularemia for confirmation and further characterization . the presumptive phenotypic identification of the f. tularensis strain was confirmed by real - time pcr that targeted francisella - specific 16s rdna sequences ( francisella lightmix kit ; tip molbiol , berlin , germany ) , a type b specific real - time pcr that targeted the 23s rdna gene , as well as 23s rdna sequencing . molecular analysis of the 23s rdna sequence and phenotypic determination of macrolides susceptibility ( etest ; biomrieux ) revealed that the isolate represented a strain of f. tularensis holarctica biovar i. antimicrobial drug susceptibility testing was performed according to the current recommendations of the clinical and laboratory standards institute ( 7 ) by using the commercially available , ce - certified micronaut - s - microtiter broth dilution testing system ( merlin , bornheim , germany ) and gave results characteristic for all f. tularensis strains ( table ) . although the strain was susceptible for levofloxacin , according to clinical and laboratory standards institute standards , the mic of 0.25 mg / l was at least twice as high when compared with 69 other f. tularensis subsp . holarctica strains ( 0.031 , n = 11 ; 0.062 , n = 54 ; 0.125 , n = 4 ) ( 7 ) . multilocus variable number of tandem repeats analysis ( 8) demonstrated that the strain clustered with 10 additional german f. tularensis strains from which 3 were isolated from hares found in an area < 20 km from the patient s home . * clsi , clinical and laboratory standards institute ; s , susceptible ; r , resistant . because infection with f. tularensis or other francisella species is relatively infrequent in nature , informative examples of infection in immunocompromised persons are rare . provide a comprehensive review of f. tularensis infections in this patient collective , most of which occur in patients who have had a solid organ transplant or who have aids ( 9 ) . only 2 cases of tularemia caused by f. tularensis in stem cell or bone marrow transplant patients have been reported to date ; 1 patient died because of severe neutropenia ( 10 ) . in the patient described here , tularemia was acquired while he was undergoing prophylaxis with levofloxacin , a potential active agent against f. tularensis . this failure of anti - infective prophylaxis was most probably related to the reduced levofloxacin concentration caused by renal - based dose adaption rather than because the strain had developed fluoroquinolone resistance . although the strain isolated from the blood stream of the patient was susceptible to levofloxacin by an approved microdilution broth assay , heterogeneous resistance against fluoroquinolones could not be completely ruled out for methodologic reasons . it has been well documented that f. tularensis can easily be rendered ciprofloxacin - resistant because of single nucleotide polymorphisms of the quinolone - resistant determining region of gyrase a , but such strains have so far never been isolated from patients with clinical cases ( 11 ) . although doxycycline is not considered the drug of choice for severe tularemia , treatment with iv doxycycline for 16 days was successful for this patient . thus , doxycycline might be a useful alternative for treating cases in which aminoglycosides or fluoroquinolones can not be applied or may have failed . careful and comprehensive survey and questioning of the patient did not definitely reveal the route of infection . the only potential risk factor mentioned was mowing the lawn of his garden close to a forest about 9 days before onset of symptoms . although it remains unproven , this hypothesis is consistent with the molecular epidemiologic results , demonstrating that identical or nearly identical genotypes were found near the patient s home .

we describe a case of human tularemia caused by francisella tularensis subsp . holarctica in a stem cell transplant recipient with chronic graft - versus - host disease who was receiving levofloxacin prophylaxis . the infection was characterized by pneumonia with septic complications . the patient was successfully treated with doxycycline .

a 73 year - old patient with mild hemophilia b ( factor ix clotting activity 12% ) was referred to our department due to a left renal tumor incidentally discovered during ultrasonography performed as follow - up two years after prostate cancer brachytherapy . on admission abdominal and pelvic ct scans revealed a multilocular tumor in the lower left kidney pole ( 57x52x52 mm ) with a solid mass of 3.5 cm in diameter ( figure 1 ) . other abdominal and chest imaging showed no abnormalities . twelve hours before surgery , he was transfused with 4200 units of factor ix concentrate ( octanine , octapharma ag , switzerland ) , with the same dose administered one hour prior to the procedure . on october 3 of 2014 , the procedure was performed with the patient positioned on his right side . following urinary catheterization , a veress needle was introduced close to the umbilicus and an intraperitoneal pressure of 14 mmhg was created . the descending colon was dissected and the fat renal capsule subsequently cut for access to the left renal artery . the artery was then clipped with polymeric clips ( hem - o - lok xl ( teleflex , usa ) and cut in between . the same was done for the renal vein . the kidney was excised , placed into a hemobag ( covidien , usa ) and removed through a small incision between the two ports . a plastic drain was placed into the kidney bed and the abdominal wall was closed with layers of sutures . peritoneal drainage was kept in place for two days with no significant output of blood or serous fluid . substitution therapy was continued for 9 days with the level of factor ix clotting activity at 90130% of the normal value on days 13 , 6574% on days 46 and 3040% on days 79 . the postoperative course was uneventful and the patient was discharged on 10 day after surgery . histopathological investigation revealed renal carcinoma , clear cell type ( g2 ) , limited to the parenchyma , without capsule infiltration or angioinvasion . no abnormalities were revealed in ultrasonography and ct scans . computed tomography scan revealed a left kidney tumor mass . hemophilia b ( christmas disease ) is a congenital bleeding disorder resulting from factor ix deficiency . hemophilia b patients undergoing surgical procedures are at a high risk of severe bleeding complications unless surgery is performed after adequate correction of the diathesis . secure hemostasis in hemophilia b patients is achieved with transfusions of factor ix coagulation factor concentrate , either recombinant or plasma - derived . desirable preoperative activity is 6080% of the normal value and should be maintained until complete wound healing , usually through 710 days . on days 13 the recommended value is 6080% , on days 46 4060% and 3040% on days 710 . minimally invasive procedures in patients with hemophilia , apart from well - known benefits such as reduced postoperative pain , fewer complications , better cosmetic effect , shorter hospitalization , quicker convalescence and return to professional activity , also contribute to shorter duration of substitution therapy . the first laparoscopic nephrectomy was performed by clayman et al . in 1990 . since then , the procedure has been performed in an increasing number of urologic centers [ 4 , 5 ] . there are only few reports in the literature of urinary tract operations in patients with congenital coagulation disorders [ 6 , 7 ] ; nonetheless , there have been none of laparoscopic nephrectomy in a hemophilia patient . we present the first case of laparoscopic nephrectomy in a hemophiliac performed with an adrenal - saving , transperitoneal lateral approach using four trocars . no significant complications were observed either postoperatively or in the long - term , which can most likely be attributed to the adequate preparation of the hemophilia patient for surgery , as well as the effective cooperation between urologist and hematologist . perioperative and postoperative bleeding episodes are the most frequent complications reported in hemophilia patients . for patients with no coagulation disorders , tlrn intraoperative bleeds are observed at 2.22.8% , and are frequently a reason for conversion to an open procedure . there are no significant differences in the reported percentage of all surgical complications , hemorrhage included , between hemophilia patients with adequate substitution of deficient coagulation factor and patients with no coagulation disorders [ 8 , 9 ] . it is therefore crucial for hemophilia patients to undergo surgery in special reference centers , which provide expert health - care services and are equipped with a modern laboratory for careful daily monitoring of deficient coagulation factor activity [ 9 , 10 ] . in conclusion , laparoscopic radical nephrectomy in hemophilia patients is a safe and effective procedure for renal carcinoma . surgery should be performed by an experienced urologist in cooperation with a multidisciplinary team , providing both perioperative and postoperative care , supported by a specialized laboratory .

surgery in patients with hemophilia is a serious challenge . it requires a comprehensive approach , as well as careful postoperative monitoring . we present here the first case of a transperitoneal laparoscopic radical nephrectomy ( tlrn ) for renal cell carcinoma , of the clear - cell type , performed in a hemophilia b patient . the level of factor ix clotting activity before surgery and on postoperative days 16 was maintained at 65130% and at 3040% on subsequent days until healing of the post - operative wound was achieved . the intraoperative and postoperative courses were uneventful . tlrn can therefore be considered safe and effective for renal cell carcinoma . in hemophilia patients , the tlrn procedure requires proper preparation , as well as adequate substitution therapy for the deficient coagulation factor provided by a multidisciplinary team in a comprehensive center .

colorectal cancer ( crc ) is one of health problems in the world ( 1 ) . it was the third most common cancer with nearly 1.4 million new cases in 2012 . about 54 percent of colorectal cancer cases occurred in more developed countries ( 2 ) . people with a first - degree relative ( fdr ) ( parent , sibling , or offspring ) have 2 to 3-foldrisk of developing disease compared to individuals with no family history ( 3 ) . according to iranian annual of national cancer registration report , crc is the fourth most common cancer after skin , breast and gastric cancer and its incidence rate was estimated 6 to 7.9 in 100,000 people . furthermore , over the last 25 years there has been a growing trend ( 4 - 9 ) . because of family history or certain medical conditions , colorectal cancer screening should begin before age 50 . recent data indicate that fdrs of crc patients significantly under - use colonoscopy screening . the participation rate lying between 30 and 64% ( 10 - 13 ) . several studies showed factors such as sex , age , health status , knowledge and attitude , number of colorectal cancer affected cases in family , age and stage of diagnosis are important to refuse to participate in colonoscopy screening program . a low socioeconomic status ( low income , unemployment , low educational level , no health insurance coverage ) has been associated with lower screening participation in many studies ( 14 - 17 ) . one turkish study indicated fdrs of patients having a higher educational level and income had screening testing twice more than the patients having lower income ( 36% vs 18% , p < 0,001 ) ( 18 ) . the aim of this study was investigation of the association between socioeconomic factors and participation in colonoscopy screening program among first degree relatives of colorectal cancer affected cases . this cross sectional descriptive study was conducted on 200 first degree relatives of colorectal cancer cases . a clustered probability design was used to select representative samples among total 400 high risk fdrs who were consulted and recommended to participate in colonoscopy screening program by physicians between 2007 and 2013 in research institute for gastroenterology and liver disease of shahid beheshti university of medical sciences , tehran , iran . the questionnaire included first degree relatives demographic and socioeconomic status including educational level , employment , income , health insurance coverage and health status in terms of smoking , alcohol consumption , suffering from diabetes and hypertension diseases . finally they answered to these questions have you ever undergone colonoscopy screening test ? and would you like to participate in colonoscopy screening program ? we investigated the association between participation of fdrs in colonoscopy screening program , and socioeconomic and health status variables through using chi - square and fisher exact test by spss 19 . also , multiple logistic regression analysis used to predict for participation in colonoscopy screening program . odds ratios ( ors ) and its 95% confidence intervals ( cis ) were obtained . of total 200 participants , 57.5% were female , 51.5% , 50 years and older , 85% married , 87.1% living in tehran , 55.5% diploma and higher educational level , 83% were employed ( full or part time ) and 53.7% were with 10 million rials and more monthly income . the mean of age , monthly income and body mass index ( bmi ) was 51.4 years , 16,000,000 rials and 26.4 respectively . from interviewees population , 59% had undergone at least one colonoscopy screening test to the time of the interview . tables 1 and 2 shows results of bivariate analysis between participation in colonoscopy screening program to time of interview and decision to participate in future with demographic , socioeconomic and health status variables . as can be seen , in data analysis by chi - square method , there was no statistical significance between demographic , socioeconomic , health status variables and participation in colonoscopy screening program to time of interview . but in the same analysis , there is statistical significance between educational level and monthly income with decision to participate in future . analysis showed first degree relatives with academic educational level were more interested to participate in colonoscopy screening program ( p = 0.006 , ors = 2.7 and 95%ci = 1.3 - 5.8 ) . also , fdrs with monthly income 10 million rials and over participated more than others in this program ( p = 0.005 , ors = 2.4 and 95%ci = 1.2 - 4.5 ) . in the logistic regression analysis , high educational level ( diploma and higher ) was predictors for participating in colonoscopy screening program in first degree relatives ( p = 0.031 , ors = 2.9 and 95% ci = 1.10 - 7.67 ) . this study examined the association between socioeconomic status ( ses ) and participation in colonoscopy screening program in first degree relatives of colorectal cancer patients . we did not find association between demographic variables , socioeconomic status and participation in colonoscopy screening test to time of interview in bivariate chi - square analysis , whereas there was statistical significance in high level education and more income with decision to participate in same analysis . in this survey a recent study indicated fdrs female with age below 50 underwent more than males and age 50 and older ( 19 ) . another study indicated fdrs with higher educational level and income participated in screening program more frequently ( 18 ) . one survey in korea showed income disparities for participating in colorectal cancer screening among both males and females ( 20 ) . one older study in canada confirmed people in the highest - income quintile had higher odds of receiving colonoscopy screening ( adjusted or 1.50 ; 95% ci 1.48 - 1.53 ) ( 21 ) . in the current study we used multiple logistic regression for demographic and socioeconomic variables analysis to predict participation in colonoscopy screening program in fdrs . therefore , high educational level ( diploma and university degree ) was a predictor to participate in colonoscopy screening test . one published study in 2012 showed the frequency of screening in patients with higher educational level ( ninth class ) , below the ninth grade and none were 33% , 21% , and 17% respectively ( p = 0,017 ) . the fdrs of patients with higher income levels ( > 1000 turkish liras , equivalent to about 700 usd at the time of the study ) had screening twice more often than the patients having lower income ( 36% vs. 18% , p < 0,001 ) ( 22 ) . as a matter of fact , socioeconomic status ( ses ) is a powerful factor to participate in colonoscopy screening test . in this study there was not an association between participation in colonoscopy program and health insurance coverage but one study in australia notified fdrs with private insurance were at significantly greater odds of receiving colonoscopy testing ( 23 - 25 ) . it is obvious that socioeconomic status is an important variable for participation in colonoscopy screening test . therefore , when crc screening is planned , elderly with positive family history , low educational level and lower income should get special attention to be convinced for undergoing colonoscopy screening test . additionally , it is necessary that people with low income be covered by appropriate health insurance to participate in colorectal cancer screening tests . these data collected through interviewing via phone and we relied to interviewees answers . it is obvious that socioeconomic status is an important variable for participation in colonoscopy screening test . therefore , when crc screening is planned , elderly with positive family history , low educational level and lower income should get special attention to be convinced for undergoing colonoscopy screening test . additionally , it is necessary that people with low income be covered by appropriate health insurance to participate in colorectal cancer screening tests . these data collected through interviewing via phone and we relied to interviewees answers .

backgroundapproximately 15% to 25% of colorectal cancer ( crc ) cases have positive family history for disease . colonoscopy screening test is the best way for prevention and early diagnosis . studies have found that first degree relatives ( fdrs ) with low socioeconomic status are less likely to participate in colonoscopy screening program . objectivesthe aim of this study is to determine the association between socioeconomic status and participation in colonoscopy screening program in fdrs.patients and methodsthis descriptive cross - sectional , study has been conducted on 200 fdrs who were consulted for undergoing colonoscopy screening program between 2007 and 2013 in research institute for gastroenterology and liver disease of shahid beheshti university of medical sciences , tehran , iran . they were interviewed via phone by a valid questionnaire about socioeconomic status . for data analysis , chi - square , exact fisher and multiple logistic regression were executed by spss 19.resultsthe results indicated 58.5% participants underwent colonoscopy screening test at least once to the time of the interview . there was not an association between participation in colonoscopy screening program and socioeconomic status to the time of the interview in binomial analysis . but statistical significance between intention to participate and educational and income level were found . we found , in logistic regression analysis , that high educational level ( diploma and university degree in this survey ) was a predictor to participate in colonoscopy screening program in fdrs.conclusionsaccording to this survey low socioeconomic status is an important factor to hinder participation of fdrs in colonoscopy screening program . therefore , planned interventions for elevation knowledge and attitude in fdrs with low educational level are necessary . also , reducing colonoscopy test costs should be a major priority for policy makers .

the ingestion of caustic substances induces a wide range of injuries to the gastrointestinal tract , which can be mild or fatal , or leads to chronic disease and is a worldwide problem [ 1 , 2 ] . caustic ingestion in children is usually accidental ingestion , while ingestion in adults is often due to suicidal intent , and injuries tend to be more severe . approximately 17,000 ingestions involving caustic agents were reported to us poison centres in 1988 , which when extrapolated to the us population yields an estimate of approximately 26,000 ingestions of corrosive agents yearly . caustic agents with a ph level < 2 or > 12 rapidly penetrate layers of the esophagus resulting in necrosis - induced eschar formation in the mucosa that limits deep tissue penetration . the extent of tissue destruction depends on the physical form , type , and concentration of corrosive agent , premorbid state of the tissue , contact duration , and amount of substance ingested . esophageal mucosa is thought to be more resistant to acidic than alkaline substances , as alkaline liquids are often highly viscous and thus persist for a longer duration in the esophageal mucosa causing liquefactive necrosis , and serious esophageal injury becomes inevitable once alkaline liquids penetrate deep muscle layers . caustic ingestion by children has persisted in most developing countries including nigeria [ 46 ] . inspite of the fact that accidental caustic ingestion is an entirely easily preventable problem , it has however persisted in rural nigerian communities because the commonly implicated agent which is caustic soda ( sodium hydroxide , naoh ) is sold in open markets without restrictive legislations . this substance when in liquid form shares most of the characteristics of drinking water that is , colourless , odourless , and tasteless . caustic soda is used in many nigerian homes for local soap and detergent production , a practice that is increasingly widespread . this is because the skill of soap and detergent production is regularly taught to the unemployed rural village dwellers as part of the poverty alleviation programmes of the nigerian government . and in most rural homes engaging in this trade , facilities are insufficient to enable delineation of soap production from food processing and cooking section of the household . when solution of caustic soda is stored in such areas that are accessible to children and in familiar containers , the stage is set for accidental ingestion of such dangerous chemical . alarmed by the frequent presentation of rural children to our new cardiothoracic surgery unit with complaints of caustic ingestion , we set out to analyse our experience in the first four years with a view to discover the risk factors to exposure to caustic agents in the rural nigerian communities and clinicopathologic characteristics of caustic ingestion in our paediatric patients and recommend preventive measures against accidental caustic ingestion . it was analyse the paediatric cases of caustic ingestion in our new cardiothoracic surgery unit with a view to identify the perpetuating factors and recommend preventive measures . this is a retrospective study of paediatric patients who presented to our unit following caustic ingestion between november 2006 and november 2010 ( four years ) . sources of data included admission records , patients ' records , cardiothoracic surgery unit records , and theatre registers . data extracted for analysis included patients ' demographic data , parental socioeconomic data , diagnosis , caustic agent ingested including quantity ( where possible ) , and reason for ingestion , complication , and treatment with outcome . all patients were evaluated in regard to the physical examination , routine laboratory investigations , and radiological assessment performed . our unit though new and first in the state with a population of 3,902,051 people ( 2006 national census ) is still creating awareness amongst the doctors on its existence and the range of pathologies that should be referred to it . the total number of children who presented following caustic ingestion during the study period was 16 with age ranging from one year and two months to 18 years ( mean age = 5 years and 4 months ) . there were 13 boys and three girls ( m : f = 4.3 : 1 ) . the reason for caustic ingestion was accidental in all the 16 patients ( 100% ) , while 15 ( 93.7% ) out of the 16 patients ingested caustic soda . the only ingestion of acid was in the 18-year - old daughter of a civil servant who mistakenly ingested concentrated acid stored in wine bottle in her mother 's wardrobe . the highest educational attainment of the mothers of the patients was secondary education in 9 ( 56% ) and primary education in the remaining 44% . also 87.5% ( 14 ) of the mothers of the patients were engaged in local soap making , while one each was a civil servant and farmer , respectively . twelve ( 75% ) out of the 16 patients presented to our unit on referral after having presented to and received initial treatment from other hospitals , while only four ( 25% ) presented to our unit early following caustic ingestion . all patients ( 100% ) had barium oesophagogram and late oesophagoscopy during the assessment of the oesophagus . long - segment oesophageal stricture was present in three ( 18.7% ) of the patients , one of which has had successful oesophageal replacement operation using colonic conduit ( figures 1 and 2 ) , while the parents of the remaining two patients requested for referral to other centres . barium swallow oesophagogram demonstrated normal oesophageal capacity in eight ( 50% ) patients , and dilatable / short - segment oesophageal stricture in four ( 25% ) patients all of whom achieved satisfactory swallowing after 24 sessions of oesophageal dilatation ( table 1 ) . the only patient who ingested acid developed extensive oesophagogastroduodenal strictures and suffered from chronic protein energy malnutrition because of inadequate jejunostomy tube feeding and absence of parenteral nutrition . stamm 's gastrostomy was done for seven patients due to severe dysphagia , while feeding jejunostomy was done for one patient because of extensive oesophago - gastro - duodenal strictures . eight patients were able to swallow well after three to four days of acute - phase treatment . caustic ingestion in children though still encountered globally is certainly most frequently encountered by thoracic surgeons working in the developing countries where poverty level is high , and there are no restrictions to sale and handling of caustic chemicals [ 2 , 47 ] . the present study reveals the great impact of caustic ingestion on the overall toll of paediatric thoracic morbidity and mortality in nigeria . this incidence has shown that caustic ingestion in children in nigeria may actually be increasing or the incidence in the south - south region of nigeria where our unit is situated may be higher than elsewhere considering the incidences in the previous nigerian studies by ogunleye et al . which recorded 23 cases in ten years , onotai and nwogbo . which recorded 30 cases in ten years , and adegboye et al . this increase although marginal does not portend improvement in the socioeconomic status of the common citizens who are rural dwellers . the predominance of male sex in this study ( m : f = 4.3 : 1 ) which has been found in many other similar studies [ 28 ] may mean that boys explore their environment more than girls . this study also reveals that all incidences of caustic ingestion in children were accidental and in rural dwellers . other studies have also documented accidental ingestion as the major reason for caustic ingestion in children [ 6 , 7 ] . this actually means that dangerous chemicals are not stored out of reach of children probably as a result of ignorance on the part of the adults , carelessness , or lack of space and that caustic ingestion in rural children is a completely preventable problem . this study shows that all but one patient ingested caustic soda ( alkali ) unlike in india where sulphuric acid is commonly ingested . in the case of caustic soda which is used for local soapmaking by the low socio - economic households in rural nigerian communities , space facility is commonly inadequate for the soapmaking area to be separated from food - processing section of the household . this has called for serious concern on the safety of this occupation and need for restructuring which may include creation of local community centres for local soap manufacturers to keep their raw materials and carry out soap production in such centres which should be away from homes and without children 's presence . another suggested preventive measure is the incorporation of colour and perfume in caustic soda granules by the manufacturers so that its solution will not be colourless and odourless , the two characteristics of safe drinking water which make solution of caustic soda impossible to be differentiated from water even by adults . the only acid ingestion which occurred in the grownup child was also accidental because the caustic agent was stored in a clean beverage drink bottle and kept in the cupboard , which made the dangerous substance nonsuspicious . low level of parental educational attainment has been discovered to be directly related to the caustic ingestion by children as all the parents of the patients in this study had either primary ( 44% ) or secondary education ( 56% ) . even with this , we are confident that properly taught preventive measures can be understood by all normal adults . family low socio - economic status has also been discovered to be a risk factor for caustic ingestion in children [ 2 , 7 ] . this study has collaborated the fact that alkali damages oesophagus more than stomach , [ 1 , 7 ] as all the patients who developed stricture following ingestion of caustic soda developed only oesophageal stricture ascertained during the late barium swallow and meal study and oesophagoscopy which were uniformly carried out on all our patients . these investigative modalities revealed long - segment oesophageal strictures in three ( 18.7% ) patients , one of which has already had successful oesophageal replacement operation with colonic conduit ( figures 1 and 2 ) . the other two patients with long - segment oesophageal strictures were referred to other cardiothoracic surgery centres within nigeria on parental request . the other 25% of patients who developed short - segment dilatable strictures were successfully treated with oesophageal dilatation , giving a stricture rate of 50% . other studies have noted oesophageal stricture rate of 1952% in children caustic ingestion [ 2 , 5 , 8 ] . the only patient with extensive oesphago - gastro - duodenal strictures ingested acid and could not be salvaged because in the absence of parenteral nutrition , the initial jejunostomy tube feeding carried out could not improve her weight to make her fit for esophagogastrectomy and oesophagojejunostomy . this patient died of protein - energy malnutrition at home 12 months after caustic ingestion . the high stricture rate in this study is partly attributed to the late presentation by 75% of our patients . a common malinformed practice amongst the late presenters was the practice of induction or stimulation of vomiting after caustic ingestion . this has the potentiality of doubling the contact time which directly correlates with severity of oesophagitis and stricture . this subset of patients who were initially treated in private hospitals for various durations arrived at our unit beyond four weeks when oesophageal stricture had already developed . early presentation would have afforded us the opportunity to treat respective patients with steroid and antibiotic to limit the severity of inflammation and infection which would reduce the severity of necrosis and subsequent stricture , [ 8 , 10 ] although the benefit of steroid therapy is not supported by all . various studies have tried to evaluate the merits and demerits of the available conduits for oesophageal replacement in paediatric corrosive oesophageal stricture ; [ 4 , 7 , 9 , 11 ] however , the conduit should be able to grow and lengthen as the child grows . colonic conduit used in this study has that capability in addition to leaving the stomach intact to perform its important function of storage . finally , the recommended preventive measures must be simple , applicable , and straightforward for easy adoption by the rural dwellers . public enlightenment of present and prospective rural dwellers who are engaged in local soap making on the dangers of caustic ingestion , storage of caustic agent in safe places that can not be reached by children , separation of soap making from food processing and cooking area of the household , creation of local / community centres for local soap making , incorporation of colour and perfume to caustic soda granules at the point of production to make its solution to possess colour and odour and therefore distinguishable from drinking water , restriction on sale and handling of caustic substances . public enlightenment of present and prospective rural dwellers who are engaged in local soap making on the dangers of caustic ingestion , storage of caustic agent in safe places that can not be reached by children , separation of soap making from food processing and cooking area of the household , creation of local / community centres for local soap making , incorporation of colour and perfume to caustic soda granules at the point of production to make its solution to possess colour and odour and therefore distinguishable from drinking water , restriction on sale and handling of caustic substances . caustic ingestion among rural children in nigeria appears to be increasing in the present research . the stricture rate of 50% contributes to the workload of cardiothoracic surgeons practicing in nigeria . it is hoped that with widespread adoption of the preventive measures advocated by the present study , the menace can be drastically reduced if not eradicated among rural children .

background . inspite of the fact that accidental caustic ingestion is an entirely easily preventable problem , it has however persisted in rural nigerian communities because the commonly implicated agent which is caustic soda ( sodium hydroxide , naoh ) is sold in open markets without restrictive legislations . this study aims to identify the perpetuating factors of paediatric caustic ingestion and recommend preventive measures . method . retrospective analysis of clinical records of our paediatric patients who presented following caustic ingestion between november 2006 and november 2010 was made for demography , socioeconomic status of parent(s ) , caustic substance ingested with amount ( where known ) , circumstance of ingestion , means of oesophageal evaluation , treatment and outcome . results . there were 16 paediatric cases of caustic ingestion during the study period with age ranging from 1 to 18 years with mode in the 13 years group and male : female ratio 4.3 : 1 . in 100% of the cases , the caustic ingestion was accidental , while caustic soda was the agent in 93.7% , and 87.5% of the parents were into local soap and detergent production . in all patients , the oesophagus was evaluated with late barium swallow / meal and oesophagoscopy before treatment . conclusion . caustic ingestion among rural children in nigeria can be prevented .

chronic obstructive pulmonary disease ( copd ) continues to be a major medical problem . with no curative therapy being available , management of severe exacerbations of copd mortality from copd continues to rise and the world health organisation predicts it will be the third leading cause of death by 2030 . there is current evidence suggesting that quality improvement interventions ought to be focussed at recognition of complications and treatment of the same . we examine a randomized double - blind , cross - over study published by israeli investigators staz and rav looking at the effect of n - acetylcysteine ( nac ) on airflow limitation in copd . twenty - four moderate to severe copd patients were randomized to placebo or nebulised nac ( 1,200 mg per day ) treatment twice daily for 6 weeks . this was followed by a 2-week washout period and patients were crossed over to alternative therapy for a further 6 weeks . evaluation of forced vital capacity , inspiratory capacity and other parameters was made after each 6-week treatment . the results showed that forced vital capacity and inspiratory capacity were higher , especially after exercise , in the nac group compared with placebo . they concluded that use of nac in moderate to severe copd patients produces a beneficial effect on physical performance , probably due to reduction in dynamic hyperinflation with a relatively short course of treatment . it is impossible to extrapolate these data to the icu population , but this paper may ignite renewed interest in nac therapy , possibly reducing the need for invasive ventilation or the number of ventilator days . roflumilast is a new phosphodiesterase-4 inhibitor , and may offer some hope for patients with moderate to severe copd . the lancet published two randomised clinical trials suggesting that this new agent decreases copd exacerbations and the need for adjuvant corticosteroid therapy , improves lung function tests and reported functional capacity when compared with placebo . it seems likely that roflumilast could become an important concomitant therapy in certain copd subsets . acute myocardial infarction is often a diagnostic challenge in the critically ill . a recent muticentre , emergency - room - based study by reichlin and colleagues looked at the difference between sensitive troponin assays and standard troponin assays . cardiac troponin levels were determined in a blinded fashion with the use of four sensitive assays and a standard assay . acute myocardial infarction was diagnosed in 17% of cases and accuracy was ascertained using auc ( area under the receiver operating characteristic curve ) . the authors concluded that this new diagnostic assay should substantially improve the early detection of acute myocardial infarction and , therefore , outcome . atrial fibrillation is the direct cause of one in four strokes in the over 80 year olds . treating individuals with warfarin reduces the rate of stroke for those who have atrial fibrillation by approximately one - half to two - thirds . but the increased risk of haemorrahge and need for monitoring has sparked much research , and a recent study tested a new direct thrombin inhibitor , dabigatran , against warfarin . connolly and colleagues employed a non - inferiority trial , randomly assigning 18,113 patients with atrial fibrillation and a risk of stroke to receive , in a blinded fashion , fixed doses of dabigatran ( 110 mg or 150 mg twice daily ) or , in an un - blinded fashion , adjusted - dose warfarin . the study boasts of a favourable outcome towards dabigatran in terms of both preventing stroke / systemic embolism and lesser rates of major haemorrhage . burtin and colleagues investigated whether a daily exercise session , using a bedside cycle ergometer , is a safe and effective intervention in preventing or attenuating the decrease in functional exercise capacity that is associated with prolonged icu stay . ninety critically ill patients with expected prolonged stay were randomized to bedside ergometer along with standardized therpay ( physiotherapy ) . there was no adverse effect from the outcome among survivors and the intervention group had significant functional improvement at hospital discharge . another investigating party looked at the gender impact on the outcomes of critically ill patients with nosocomial infections . multivariable logistic regression analysis was used to control for confounders in the evaluation of gender impact on icu death post - nosocomial infections . over 5,000 patient admissions were studied and the conclusion was that female icu patients developing nosocomial infections seem to be at increased risk of icu mortality , after carefully controlling for other prognostic factors . further studies are needed to elucidate the pathophysiology underlying this gender - related difference , to devise tailored gender - specific therapies that might improve outcomes . alberda and colleagues published a multicentre observational study examining the relationship between the amount of energy and protein administered during icu stay and clinical outcomes in critically ill patients , and the extent to which pre - morbid nutritional status influenced this relationship . the type and amount of nutrition received were recorded daily for a maximum of 12 days . data were collected on 2,772 mechanically ventilated patients who received an average of 1,034 kcal / day and 47 g protein / day . the effect of increased calories associated with lower mortality was observed in patients with a body mass index < 25 and 35 with no benefit for patients with a body mass index of 25 to < 35 . acute kidney injury ( aki ) has been the subject of ncepod ( national confidential enquiry into patient outcome and death ) interest recently and data into provision of care and outcomes have been published . french investigators floccard and colleagues have looked into 6-month outcomes from aki requiring renal replacement therapy ( rrt ) in the icu . quality of life was assessed using the short form health survey ( sf-36 ) questionnaire . the results indicated that patients who received rrt for aki had a high mortality rate 6 months after rrt finished . survivors ( 38% ) at follow - up had a lower level of quality of life compared to a reference population , and their physical health was more affected than their mental health . acute necrotising pancreatitis is a serious condition with a high mortality rate . a recent prospective study assessed quality of life outcomes in 31 patients . survivors ( 68% ) were assessed at 3 , 6 and 12 months following hospital discharge by an investigator blinded to their previous treatment . health related quality of life was assessed by the short form health survey ( sf-36 ) questionnaire and functional outcome by the six - minute walk test . they concluded that , in the first year after the insult , patients showed improvement in their physical components of quality of life and in their physical function , but their outcome at 12 months was still poor compared to the general population . this patient group in particular may benefit from a structured rehabilitation programme continuing after hospital discharge . aki : acute kidney injury ; copd : chronic obstructive pulmonary disease ; nac : n - acetylcysteine ; rrt : renal replacement therapy .

the burden of chronic obstructive pulmonary disease on intensive care is heavy , but newer modalities of treatment are now available to improve outcomes . cardiac - based research continues to generate new drugs and tests to better outcome and aid in early diagnosis . and how do various intensive care interventions compare in improving clinical and functional outcomes ?

diagnostic cytogenetic testing has undergone a marked evolution since the introduction of chromosome banding techniques in the late 1960s.2 dna - based techniques such as genomic copy number microarrays ( cytogenetic microarrays [ cmas ] ) are the latest tools available for clinical use.1 the initial cgh technology was developed for genome - wide screening for unbalanced rearrangements in a single experiment.1,35 however , the resolution of this conventional cgh was only 310 mb4 comparable with high - resolution karyotyping,1 thus cgh was further adapted for use on microarrays.6 with array cgh , cloned ( e.g. , bacterial artificial chromosomes [ bacs ] ) or synthesized ( e.g. , oligonucleotides [ oligos ] ) dna fragments representing precise chromosomal loci across the genome are immobilized on a glass surface.1,7,8 copy number variants ( cnvs ) are determined by the differences in hybridization pattern intensities between patient dna and control dna.7 hybrid snp / oligo arrays have been developed for the analysis of cnvs and detection of copy number neutral regions of homozygosity . for these analyses , the patient dna is labeled and hybridized to the microarray , and the patient results are compared with a well - studied reference dna.9 it should be noted that not all cnvs are pathologic , in that it has been demonstrated that the mean number of benign cnvs per person could be as high as 800 or more.10 the resolution and yield of an array is limited by the genomic coverage ( the length of and spacing between probes ) on the microarray3,11,12 and by the specific statistical algorithms used to set the criteria for gains and losses . the increased resolution of microarray technology over conventional cytogenetic analysis allows for identification of chromosomal imbalances with greater precision , accuracy , and technical sensitivity . rauch et al.13 investigated the diagnostic yield of various genetic tests used in the evaluation of patients with unexplained cognitive impairment . in their study , molecular karyotyping would only miss 0.6% of cases with disease - causing balanced de novo aberrations . they noted that molecular karyotyping in every patient with cognitive impairment would have the highest diagnostic yield of any single test ( 28.9% ) and was , thus , suggested by the authors to be considered a first - tier test . recently , miller et al.14 reviewed the evidence for utilization of cma as a first - tier test for the investigation of dd / id , multiple congenital anomalies , and/or autism spectrum disorders ( asds ) . these authors recommendation for use of cma as a first - tier test was based on studies of 21,698 patients referred for the above - listed indications , in whom the diagnostic yield was 12.2% higher than that of a g - banded karyotype . after a review of 36,325 patients with dd / id , hochstenbach et al.15 also recommended that cma be a first - tier test in this group of patients . in their study , shen et al.16 specifically investigated the utility of cma in the investigation of children with asd . they also provided evidence that analysis should be the first - tier test for children with autism . they found that although abnormalities were found on karyotyping and fragile x testing 2.23% and 0.46% of the time , respectively , a microarray identified deletions or duplications in 18.2% of patients ( in addition to the linking of submicroscopic de novo deletions and duplications identified on cma to the patients disorders,17,18 de novo cnvs have also been implicated in increasing the risk for asd and point to regions of the genome that may house candidate genes for autism.19,20 additional uses for cma include the investigation of individuals with physical or cognitive impairment but in whom conventional cytogenetic studies demonstrated an apparently balanced translocation . subsequent cma investigation demonstrated that the karyotype was actually unbalanced ; several studies have shown that approximately 20% of individuals with an apparently balanced translocation ( de novo or familial ) have loss or gain of genetic material as identified by cma.21,22 more recently , cma has been shown to be valuable in uncovering chromosomal regions of medical importance apart from the original indication of the study . adam et al.23 reported three patients evaluated for dd or dysmorphic features / multiple anomalies who were found by cma to have microdeletions encompassing known tumor susceptibility genes . in a larger study , adams et al.24 found that 0.18% of patients with an identified gain or loss of genetic material had the inclusion of a gene associated with a cancer - predisposing condition . both sets of authors emphasized that information gained from cma , such as the unexpected finding of tumor susceptibility , can have a direct bearing on the future medical management of patients with dd / multiple congenital anomalies in addition to providing an explanation of the general phenotype . in addition to identifying copy number variants that affect the number of copies of a particular gene or genes , microarray analysis could theoretically identify genes that are disrupted by breakpoints in the genome . disruption could be on the basis of interruption of a coding sequence or of a sequence that affects transcription and translation , e.g. , sequence changes in a promoter region . examples include duplications and deletions involving the nrxn1 and cntn4 genes.25,26 finally , as pointed out by moeschler.27,28 and saam et al.,29 an accurate diagnosis for patients will provide the clinician the opportunity to discuss treatment options , prognosis , and recurrence risks as well as to avoid unnecessary future testing . although microarray analysis is proficient in characterizing chromosomal imbalances ( which ultimately improves patient care),29 clinicians ordering the test need to be aware of the different clinical platforms ( e.g. , bac versus oligo , targeted versus whole genome , and snp ) , the variation in resolution among arrays and the information each provides . for example , many clinicians are unaware that a whole genome oligoarray can detect clinically significant copy number changes missed on a targeted bac array30 or that a snp array can detect long contiguous stretches of homozygosity that can be associated with uniparental disomy or consanguinity , both of which increase the risk for autosomal recessive conditions . array resolution is dependent on the number and types of probes used and how they are distributed across the genome.31 bac probes are larger than oligonucleotide probes used for oligo and snp arrays ( bacs are 75,000 to 150,000 base pairs in length , whereas oligos are usually 50 to 60 base pairs long ) . higher probe density on oligo arrays allows for copy number evaluation to be based on multiple adjacent probes , enhancing the accuracy of the interpretation . oligonucleotide array construction tends to have better reproducibility and less batch - to - batch variation than does bac construction.31 snp microarrays are applications of microarray technology that also provide genome - wide copy number analysis . in addition to copy number changes , snp arrays are able to detect so - called copy number neutral abnormalities such as segmental uniparental disomy and areas of long contiguous stretches of homozygosity that can give rise to disease , congenital anomalies , or cognitive impairment.32,33 snp arrays are increasingly being used in the assessment of cognitive impairment or dd , with or without associated anomalies and are likely to be used in the diagnosis of these conditions.9,11 when ordering a cma , the clinician should be aware of the various platforms currently in use and their limitations . questioning the laboratory performing the test about coverage of the array in specific regions of interest ( e.g. , telomeres , x chromosome , and common microdeletions ) is justified . the clinician also should understand what type of follow - up tests will be performed , and on whom , in the event of abnormal results . further , for deletions and duplications , parental studies ( by fluorescence in situ hybridization [ fish ] or metaphase preparations , if possible ) should be conducted to rule out the presence of a chromosomal rearrangement such as an insertion or inherited duplication . although rare , for a family in which such a rearrangement is found , recurrence risk can be as high as 50% . with increased utilization of a diagnostic test this is certainly the case with array cgh and identification of what we now understand to be benign cnvs . an international consortium of more than 75 laboratories has been formed to address questions surrounding array - based testing . the international standard cytogenomic array consortium ( https://isca.genetics.emory.edu/iscabrowser/ ) is investigating the feasibility of establishing a standardized , universal system of reporting and cataloging cgh results , both pathologic and benign , to provide the clinician with the most accurate and up - to - date information.14 databases currently available for referencing gene location and function , cnv listings , and up - to - date clinical information for specific abnormalities include the uc santa cruz database ( http://www.genome.uscs.edu ) , the toronto database of genomic variants ( http://projects / tcag.ca / variation/ ) , decipher ( http://www.sanger.ac.uk/postgenomics/decip ) , and ecaruca.34 even though cma technology has greatly improved since it was initially developed,4 clinicians ordering these tests must be aware of the limitations that remain . array cgh can not identify balanced chromosomal rearrangements , such as translocations or inversions , or differentiate free trisomies from unbalanced robertsonian translocations.13,35,36 some aneuploidies can be missed , such as xyy if the wrong gender control is used.31 marker chromosomes may also be missed , depending on the size , marker composition , and array coverage of the specific chromosomal region present on the marker.35 detection of mosaicism has been reported , but the accuracy of detecting low levels described by some groups37 has been questioned by others.35,36 recently , scott et al.38 suggested that mosaicism for an extra chromosome could be detected at the 10% level , whereas mosaicism for deletion or duplication of part of a chromosome could be detectable at the 2030% level . interpretation of the significance of a rare copy number change can be incomplete if parental samples are unavailable for comparison and published data on the cnv are lacking . a microarray should not be ordered when a rapid turnaround time is needed ( e.g. , a stat newborn analysis ) , especially if a chromosomal trisomy is suspected . currently , a stat g - banded chromosome analysis can be performed within 48 hours . with some array cgh platforms , although technically some arrays may be run in 35 days in some laboratories , analysis and confirmation of results with fish ( development of a unique probe can take weeks ) and analysis of parental samples and interpretation may take much longer . although microarray is a powerful diagnostic tool for the evaluation of chromosomal copy number changes , its use as a first - tier test may not always be appropriate . for example , conventional karyotyping may be more appropriate when a common aneuploidy ( e.g. , trisomy 21 , trisomy 18 , or a sex chromosome aneuploidy ) is suspected . fish with a single probe to confirm a suspected diagnosis of a well - described syndrome , such as williams syndrome , would be a more cost - effective testing methodology . cma also should not be used in cases of family history of chromosome rearrangement in a phenotypically normal individual or in cases of multiple miscarriages.14 finally , cma can not detect low - level mosaicism or , in some arrays , polyploidy . cma testing for cnv is recommended as a first - line test in the initial postnatal evaluation of individuals with the following : multiple anomalies not specific to a well - delineated genetic syndrome.apparently nonsyndromic dd / id.autism spectrum disorders . further determination of the use of cma testing for the evaluation of the child with growth retardation , speech delay , and other less well - studied indications is recommended , particularly by prospective studies and after - market analysis . appropriate follow - up is recommended in cases of chromosome imbalance identified by cma , to include cytogenetic / fish studies of the patient , parental evaluation , and clinical genetic evaluation and counseling . cma testing for cnv is recommended as a first - line test in the initial postnatal evaluation of individuals with the following : multiple anomalies not specific to a well - delineated genetic syndrome.apparently nonsyndromic dd / id.autism spectrum disorders . further determination of the use of cma testing for the evaluation of the child with growth retardation , speech delay , and other less well - studied indications is recommended , particularly by prospective studies and after - market analysis . appropriate follow - up is recommended in cases of chromosome imbalance identified by cma , to include cytogenetic / fish studies of the patient , parental evaluation , and clinical genetic evaluation and counseling .

laboratory evaluation of patients with developmental delay / intellectual disability , congenital anomalies , and dysmorphic features has changed significantly in the last several years with the introduction of microarray technologies . using these techniques , a patient s genome can be examined for gains or losses of genetic material too small to be detected by standard g - banded chromosome studies . this increased resolution of microarray technology over conventional cytogenetic analysis allows for identification of chromosomal imbalances with greater precision , accuracy , and technical sensitivity . a variety of array - based platforms are now available for use in clinical practice , and utilization strategies are evolving . thus , a review of the utility and limitations of these techniques and recommendations regarding present and future application in the clinical setting are presented in this study .

according to the fifth edition of the diagnostic and statistical manual of mental disorders ( dsm-5 ) , rapid cycling bipolar disorder is defined as the presence of at least four mood episodes within a 12-month period that meet the criteria for hypomania , mania , or a major depressive episode.1 significantly , the prevalence rate of the rapid cycling subtype of bipolar disorder ranges from 25% to 43% in the current literature.2 furthermore , patients with rapid cycling bipolar disorder are at an increased risk for poor treatment response , a longer course of illness , and greater morbidity and mortality.2 nevertheless , the exact pathophysiology of rapid cycling bipolar disorder is still not clearly understood , and the current options for effective treatment remain limited . thyroid pathology has long been a subject of investigation in rapid cycling bipolar disorder . evidence has indicated that levothyroxine therapy might be a potentially useful treatment to reduce mood instability in this group of patients;38 however , most responsive cases in the literature were females and the responses were independent of thyroid status . we present the case of a 32-year - old male who developed a breakthrough rapid cycling course and first - onset clinical hypothyroidism at the age of 31 years while receiving lithium therapy . after levothyroxine augmentation therapy was given , the patient showed significant improvement in the course of rapid cycling and abnormal thyroid function over the following year . mr a was a 32-year - old male patient with the first onset of a depressive episode and suicide attempt at the age of 20 years . when he was 22 years old , he had his first manic episode and consequently received a dsm - iv diagnosis of bipolar 1 disorder . despite a good response to lithium 600 mg , valproic acid 1,200 mg , and risperidone 2 mg per day , mr a did not take medication regularly after each period of acute treatment . in the subsequent 5 years , he was hospitalized an average of two times each year for the acute treatment of manic or depressive episodes . during depressive episodes , therapy of lithium but not antidepressant was provided . lamotrigine was used briefly for a depressive episode at the age of 26 years and discontinued because a subsequent manic episode occurred . thyroid function tests showed subclinical hypothyroidism ( serum free t4 : 1.03 ng / dl , referential range : 0.72.3 ng / dl ; thyroid - stimulating hormone [ tsh ] : 6.36 iu / ml , referential range : 0.45.0 iu / ml ) only once during acute treatment for mania with lithium 600 mg and valproic acid 1,700 mg per day at age 28 years . mr a received the maintenance therapy of bipolar disorder in the daycare unit from the age of 28 years . after 2-year treatment with valproic acid 1,500 mg per day , lithium 600 mg per day , and long - acting injectable risperidone 25 mg every 2 weeks , mr a had more regular medication adherence and remained in remission of bipolar disorder between the ages of 28 and 30 years . by the age of 30 years , lithium and risperidone were discontinued due to intolerable hand tremors . quetiapine 400 mg per day was subsequently combined with valproic acid 1,500 mg per day for maintenance therapy . the follow - up thyroid function test between the ages of 28 and 30 years in addition , mr a did not have evidence of physical diseases or substance abuse during the period of psychiatric treatment . his first - degree family did not report any history of psychiatric or thyroid morbidities . at age 31 years , mr a had a breakthrough manic episode while on maintenance therapy of valproic acid 1,500 mg and quetiapine 400 mg per day . lithium 900 mg per day was added ( serum lithium level : 0.85 meq / l ) ; however , a classic rapid cycling course of illness occurred over the following year ( mania for 3 months , depression for 2 months , mania for 5 months , and depression ) despite the combination therapy of lithium , valproic acid , and various antipsychotics at adequate dosage for sufficient duration . during each of these episodes , the exam during the second depressive episode of the course of rapid cycling illness showed clinical hypothyroidism ( serum free t4 : 0.6 ng / dl ; tsh : 11.5 iu / ml ) for the first time in his life . a thyroid sonogram revealed diffuse goiters . because of the clinical hypothyroidism and thyroid goiters , levothyroxine 50 g per day was administrated in addition to the psychopharmacotherapeutic regimen of lithium 900 mg , lamotrigine 50 mg , and clozapine 100 mg per day . serum levels of free t4 and tsh then returned to normal , at 1.1 ng / dl and 3.8 iu / ml , respectively . mr a maintained the therapeutic regimen and remained in remission from the rapid cycling illness for the subsequent year . no intolerable adverse effect was noted . this 32-year - old male carried a diagnosis of bipolar 1 disorder for 12 years . a breakthrough rapid cycling course and concurrent clinical hypothyroidism first occurred in the eleventh year of his illness despite combination treatment with various mood stabilizers and antipsychotics . this case suggested that the pathophysiology of rapid cycling bipolar illness involves thyroid dysregulation in the subgroup of patients whose bipolar mood symptoms respond well to the administration of levothyroxine . previous reports have suggested that more than half of the patients with refractory rapid cycling disorder were clinically responsive to levothyroxine therapy.38 notably , this treatment response was independent of clinical thyroid status despite evidence from another study showing that hypothyroidism was associated with rapid cycling in bipolar disorder.9 in these reports about levothyroxine therapy for rapid cycling bipolar disorder , responsive patients were most likely to be female . on the other hand , male patients with rapid cycling bipolar disorder were under - investigated , and the efficacy of levothyroxine therapy for these cases was controversial . bauer and whybrow reported successful thyroxine treatment of a male patient whose bipolar rapid cycling course began and resolved after changes in thyroid status.5 positive results of thyroxine therapy were also observed in two other male cases reported by bauer and whybrow and by weeston and constantino.6,7 conversely , stancer and persad reported only a transitory response to levothyroxine treatment in two male patients with rapid cycling bipolar disorder.3 we report a male patient with classic rapid cycling bipolar disorder and coexisting thyroid pathology who responded well to levothyroxine therapy . this finding supported that understanding thyroid pathophysiology is relevant in male patients with rapid cycling bipolar disorder and levothyroxine efficacy . a mechanism for the association between thyroid dysfunction and rapid cycling bipolar disorder has not been fully elucidated . early evidence suggested that hypothyroidism decreases noradrenergic turnover rates and results in hypersensitivity of the -adrenergic receptors . this hypersensitivity , in turn , leads to a rapid switch to mania , particularly when antidepressants that block the effects of norepinephrine reuptake are coadministered.10,11 furthermore , emerging investigations have indicated that thyroid hormones are important regulators of the periodicity of the biological clocks underlying bipolar disorder.12,13 impairment in self - regulation of the hypothalamic pituitary thyroid axis may therefore contribute to the pathological oscillations of the catecholamine systems in rapid cycling bipolar disorder.14 in our case , we could not totally exclude the possibility that the hypothyroidism was associated with lithium therapy . although the hypothyroidism in our rapid cycling bipolar patient was mild , we provided levothyroxine to him since levothyroxine therapy concurrent with lithium treatment is recommended in rapid cycling bipolar cases having thyroid goiters or clinical hypothyroidism.15 the positive result in our patient supported this recommended strategy . in contrast to previous reports about lithium - related hypothyroidism,15 our patient was distinct in being male , aged below 50 years , and with no family history of thyroid diseases or thyroid autoantibodies . moreover , antidepressants were not given to our patient during major depressive episodes since antidepressants might trigger rapid cycling in bipolar disorder.2 levothyroxine augmentation therapy therefore warrants further investigation in depressed patients with rapid cycling bipolar disorder and concurrent hypothyroidism . emerging evidence also suggests that combined treatment with clozapine and lamotrigine might be useful for treatment - resistant rapid cycling bipolar disorder.16,17 in our patient , we provided levothyroxine augmentation therapy 1 week after the initiation of clozapine therapy and 2 weeks before the initiation of lamotrigine . consequently , we should also consider the possibility that this remission was due to this combination . historically , one of our patient s episodes of depression switched to mania during lamotrigine therapy when he was 26 years old . therefore , the present treatment response might also have been due to the addition of levothyroxine rather than to the combination of clozapine and lamotrigine . however , this hypothesis can not be examined at this point because of clinically ethical reasons . levothyroxine augmentation therapy improved mood instability and thyroid dysfunction in our male patient with rapid cycling bipolar disorder and concurrent hypothyroidism . this observation suggested that further investigation of both levothyroxine pharmacology and thyroid pathology in male patients with rapid cycling bipolar disorder is indicated .

the literature suggests that patients with bipolar disorder , particularly females , have greater vulnerability to rapid cycling features . levothyroxine therapy might be potentially useful to attenuate mood instability in this patient group . in contrast , reports on male patients remain limited and controversial . herein , we report a 32-year - old male patient who had bipolar 1 disorder for 12 years who developed a breakthrough rapid cycling course and first - onset clinical hypothyroidism at the age of 31 years during lithium therapy . after levothyroxine augmentation therapy was introduced , the patient had remission from the rapid cycling illness course along with normalization of serum levels of free t4 and thyroid stimulating hormone in the subsequent year . this observation suggested that investigation of both levothyroxine pharmacology and thyroid pathology in male patients with rapid cycling bipolar disorder might be of much value .

isolated dislocations of the trapezio metacarpal joint without associated fracture has been reported very rarely in the literature . there are reports of associated injuries like fracture of the trapezium , dislocation of the metacarpophalangeal joint and fractures of the base of the thumb metacarpal . authors report a case of isolated carpometacarpal dislocation of the right thumb , in an adult , successfully managed conservatively . at 15 months follow up the patient had full function of the hand without any clinical or radiological evidence of instability or posttraumatic arthritis . isolated dislocations can be successfully managed by closed reduction and immobilization in a back slab , with unstable dislocations requiring surgical intervention . isolated dislocations of the trapezio metacarpal joint [ tm ] without associated fracture is a very rare injury[1 - 4 ] , with few reports in the literature . associated injuries reported include , fractures of the trapezium [ 5 - 7 ] , dislocation of the metacarpophalangeal joint ( mp ) [ 4,8 - 10 ] , and associated fracture of the base of the metacarpal . there is debate over optimal management of the dislocation , with reports suggesting conservative management [ 1 , 9 ] , to aggressive surgery , including ligament reconstruction [ 11 - 13 ] . however , if the joint is stable after a closed reduction , immobilization in a thumb spica can result in a stable joint . 36 year old patient presented in the accident and emergency of a regional referral hospital with pain and deformity of the right thumb , following an alleged road traffic accident . the patient was unable to move the right thumb , and had a prominence over the dorsal aspect of the right hand . radiographs of the right hand revealed a dorsal dislocation of the carpo - metacarpal joint of the right thumb without any associated fracture ( fig.1a , b ) . following reduction , the tm joint was found stable , and hence it was decided to treat the dislocation in a thumb spica . he was followed up every week for the first 3 weeks with weekly radiographs which confirmed concentric reduction of the tm joint . at 6 weeks radiograph at 15 months follow up showed well reduced and stable tm joint without any signs of arthritis . however there was a calcified shadow over the radial aspect of the thumb ( white arrow ) , which could be due to calcification in the straight antero lateral ligament ( fig . frontal radiograph of the hand showing the dorsal dislocation of the tm joint frontal radiograph at 15 months follow up showing calcification of the ligament [ white arrow ] , and congruent joint . thumb has a unique role in the function of the hand , and a normal thumb is essential for digital pincing and for a powerful grip . both trapezial and metacarpal surfaces have double inverse curvature in the shape of a saddle . an injury which is occasionally reported is carpo - metacarpal dislocation of the thumb , can lead to long standing hand disability if not properly treated . isolated carpometacarpal dislocation of the thumb is a very rare injury [ 1 - 4 ] , accounting for less than 1% of all hand injuries . isolated tm dislocations almost always displace dorsally , but there are reports of volar dislocations . most thumb dislocations are dorsal , and are classified as simple [ reduced closed ] and complex [ irreducible closed and requiring open reduction ] . many associated injuries has been reported along with tm dislocation of the thumb , which includes fracture of the trapezium[5 - 7,15 ] , dislocation of the metacarpophalangeal joint , also known as floating thumb , injury of the ulnar collateral ligament , fracture of the distal radius and bennett fracture . force causing flexion and axial loading of the metacarpal base result in rupture of the dorsolateral ligament and dorsal subluxation . the dorsal ligament complex is the largest and thickest and most important ligamentous restraint [ 10 , 13 , 16 ] and if this ligament is cut , the major stabilizer is lost and a caropmetacarpal dislocation ensues [ 13 , 16 ] . if the metacarpal is further flexed , the anterior oblique ligament is stripped from the base of the metacarpal resulting in complete dislocation [ 1 , 2 ] . optimal treatment method is still debatable varying from closed reduction and casting , percutaneous fixation , ligamentous repair , capsular placation followed by k wire fixation [ 1 , 2 ] . milankov and miljjkovic has named this injury as the bennett fracture without a fracture implying that the injury is unstable after closed reduction as in a bennett fracture . closed reduction and a plaster cast with the thumb in abduction , and kept for 4- 6 weeks is the preferred treatment if the joint is stable [ 1 , 4 , 8 , 9 , 13 ] . if the joint is unstable , it is preferable to hold the reduction with k wires , with or without capsulorrhaphy . though many ligamentous reconstructive procedures have been described using the tendons around the wrist , conservative management may still gives equally good results [ 1 , 8 ] . however recurrent instability is a concern and ligament reconstruction should be considered in unstable cases . our case was stable after reduction and conservative management with thumb spica gave good functional result . marcotte and trzeciak too reported that the isolated dorsal mcp joint dislocation remains stable after closed reduction . patients with tm dislocation showing no signs of instability after a closed reduction can be managed conservatively [ 1 , 13 ] . post reduction the joint was stable and conservative management in spica cast gave good clinical result . isolated tm joint dislocations , if stable after a closed reduction could be managed in a plaster cast with good functional results .

introduction : isolated dislocations of the trapezio metacarpal joint without associated fracture has been reported very rarely in the literature . there are reports of associated injuries like fracture of the trapezium , dislocation of the metacarpophalangeal joint and fractures of the base of the thumb metacarpal.case report : authors report a case of isolated carpometacarpal dislocation of the right thumb , in an adult , successfully managed conservatively . at 15 months follow up the patient had full function of the hand without any clinical or radiological evidence of instability or posttraumatic arthritis.conclusion:isolated dislocations can be successfully managed by closed reduction and immobilization in a back slab , with unstable dislocations requiring surgical intervention .

in recent years , the field of radiology has advanced from reviewing films on a view box to a digital era with viewing on a computer monitor . the digital environment has opened the doors to new image processing techniques that have capitalized on the three - dimensional ( 3d ) datasets of computed tomography , magnetic resonance imaging ( mri ) , and positron emission tomography . for example , maximum intensity projection and volume rendering provide a two - dimensional representation of the 3d volume and can better define some complex anatomy ; however , these techniques are limited by overlapping structures1,2 ( figure 1 ) . in this paper , we will discuss several features of the depth 3-dimensional ( d3d ) augmented reality imaging system . the d3d user wears a headset , similar to that used in 3d gaming , which provides a separate image to each eye , yielding binocular disparity and depth perception.3 d3d also provides convergence of the eyes to a particular focal point of interest , tracks the individual s natural head movements , and provides corresponding images to each eye s display ; thus , an immerse environment is established . the d3d algorithm provides an enhanced discrimination of separated points in space that might otherwise appear to overlap when viewed by conventional methods . s enhanced visualization is accompanied by a joystick control system , similar to that of a pilot such that the radiologist can fly through the image while selecting objects of interest with a 3d cursor . while d3d technology can be applied to multiple types of radiological imaging , the specific focus in the article will be related to viewing of microcalcifications in mammography . breast cancer is one of the leading causes of death in women.4,5 mammography can detect suspicious microcalcifications associated with preinvasive or invasive cancers.6 while breast calcifications are extremely common , and can be present in up to 86% of mammograms,7 a minority of calcifications biopsied tend to be preinvasive or invasive cancers in asymptomatic patients . a linear and branching distribution of microcalcifications is suspicious for ductal carcinoma in situ ( dcis).8,9 standard mammographic views may not reveal the true linear and branching distribution due to a suboptimal viewpoint . from the wrong viewpoint , a linear distribution of calcifications can appear as an amorphous aggregate , leading to false negatives . on the other hand , depending on the angle of view , a cluster of calcifications can be wrongly interpreted to follow a linear pattern , causing false positives . consequently , full 3d viewing of a group of calcifications has the potential advantage of reducing both false negatives and false positives . to test this hypothesis , in the present study , we generated image sets from a simulated dataset of microcalcifications and evaluated the discrimination of a branched or linear pattern when viewed with d3d . a simulated 3d dataset of microcalcifications in a linear , branching pattern was created using a total of 34 voxels in a 646464 matrix by an in - house script , with each microcalcification being of the same size . using a cartesian coordinate system , the simulated 3d dataset was uploaded such that each microcalcification was assigned to a unique ( x , y , z ) voxel within the volume of interest and a total of 262,144 ( 643 ) voxels were created of which 34 were assigned the value of 1 to represent calcification displayed as a white pixel . all other voxels within the volume of interest were assigned the value of 0 to represent noncalcified tissue . an initial left eye viewing perspective was assigned an ( x , y , z ) position outside the volume of interest . from the left eye viewing perspective , a series of cones , each being defined by the cone angle and the trajectory angles and , were sent into the volume of interest to record the highest voxel in its path , either a 0 or a 1 ( figure 2 ) . finally , the values recorded for each cone were displayed in the head display unit with a unique image sent to each eye such that binocular disparity and depth perception are achieved ( figure 3 ) . the number of cones for each eye viewing perspective is determined by factors including : size of the pixel array in the head display unit , acceptable latency time for the user , and the computer processor speed . after the initial left and right eye images are established ( figure 4a ) , a new image is provided to each eye display each time any of the following occurs : changing the interocular distance to provide greater binocular disparity ( figure 4b ) ; changing the angular field of view ( figure 4c ) ; volume of interest is translated or rotated ( figure 4d ) ; user rotates their head with roll , pitch , or yaw maneuvers , by translation or combination thereof ( figure 4e ) . depth perception is the ability to distinguish the relative distance of an object in one s visual field . depth perception requires binocular disparity , which is the difference in image location seen by the left and right eyes . the simulated data were viewed with the d3d system by the author ( ew ) , who is a board - certified radiologist with 11 years of experience in evaluating the distribution of the microcalcifications . using simulated data allows one to visualize differing orientations and gain an appreciation of the importance of 3d visualization from multiple viewing points in obtaining an accurate diagnosis . a simulated 3d dataset of microcalcifications in a linear , branching pattern was created using a total of 34 voxels in a 646464 matrix by an in - house script , with each microcalcification being of the same size . using a cartesian coordinate system , the simulated 3d dataset was uploaded such that each microcalcification was assigned to a unique ( x , y , z ) voxel within the volume of interest and a total of 262,144 ( 643 ) voxels were created of which 34 were assigned the value of 1 to represent calcification displayed as a white pixel . all other voxels within the volume of interest were assigned the value of 0 to represent noncalcified tissue . an initial left eye viewing perspective was assigned an ( x , y , z ) position outside the volume of interest . from the left eye viewing perspective , a series of cones , each being defined by the cone angle and the trajectory angles and , were sent into the volume of interest to record the highest voxel in its path , either a 0 or a 1 ( figure 2 ) . finally , the values recorded for each cone were displayed in the head display unit with a unique image sent to each eye such that binocular disparity and depth perception are achieved ( figure 3 ) . the number of cones for each eye viewing perspective is determined by factors including : size of the pixel array in the head display unit , acceptable latency time for the user , and the computer processor speed . after the initial left and right eye images are established ( figure 4a ) , a new image is provided to each eye display each time any of the following occurs : changing the interocular distance to provide greater binocular disparity ( figure 4b ) ; changing the angular field of view ( figure 4c ) ; volume of interest is translated or rotated ( figure 4d ) ; user rotates their head with roll , pitch , or yaw maneuvers , by translation or combination thereof ( figure 4e ) . depth perception is the ability to distinguish the relative distance of an object in one s visual field . depth perception requires binocular disparity , which is the difference in image location seen by the left and right eyes . the simulated data were viewed with the d3d system by the author ( ew ) , who is a board - certified radiologist with 11 years of experience in evaluating the distribution of the microcalcifications . using simulated data allows one to visualize differing orientations and gain an appreciation of the importance of 3d visualization from multiple viewing points in obtaining an accurate diagnosis . when the author visualized the microcalcifications with a single viewing perspective , the microcalcifications were classified as a cluster , which is indeterminate for cancer ( figure 5a ) . when the author visualized the microcalcifications with d3d , the system was rotated and the microcalcifications were classified as a linear pattern ( figure 5b ) , which is suspicious for breast cancer . finally , the image was rotated further and the microcalcifications were classified as a branching pattern , which is highly suspicious for dcis breast cancer ( figure 5c ) . the d3d s augmented reality imaging technique is an extremely computationally demanding process that is operated only through the recent advances in computer processing and head display unit technology . using a simulated image , d3d achieves a higher level of convergence and improved human machine interface ( hmi ) to discriminate linear or branching calcifications . while conventional two - view mammography can not assign microcalcifications to a specific 3d coordinate system , digital breast tomosynthesis and dedicated breast computed tomography are able to provide 3d spatial localization ; thus , d3d can only be used for these types of breast imaging.1015 d3d suggests that the preferred method of looking at calcifications is a fly - through such that the radiologist can better appreciate the 3d pattern . dcis can be multifocal , with regional variation in the histologic grade that predicts the risk for progression to invasive cancer . therefore , it is crucial to identify and treat all areas of dcis for the best possible outcome . whether viewing with contiguous slices or volume rendering , characterizing the 3d pattern of microcalcifications can be extremely difficult because there is no depth perception and no convergence of the viewing perspectives to a focal point . d3d provides an immersive fly - through perspective such that a 3d map of the suspicious microcalcifications can be drawn and highlighted . beyond improving the display of microcalcifications , d3d holds promise for enhanced visualization and discrimination of malignant breast masses within a dense breast or behind areas of benign pathology or previous surgery . in addition , d3d can give the viewer the ability to fly - around a breast mass and highlight the change in the shape or volume of the mass before and after therapy , by comparing the current mass to a 3d ghost of the mass recalled from a pretreatment baseline . there is strong rationale to support the value of dynamic 3d view of a tumor mass throughout the course of therapy . while the efficacy of neoadjuvant chemotherapy ( nact ) in advanced breast cancer is known to correlate to tumor shrinkage,16 data from the recent investigation of serial studies to predict your therapeutic response with imaging and molecular analysis ( i - spy ) trial demonstrated the importance in breast tumor morphology . in this study , the particular phenotype of the breast tumor , such as well - defined margins or multilobulated appearance , correlated with the pathologic response to nact and contributed to the clinical recommendation for breast conservation therapy instead of mastectomy.17 in fact , the mri findings were a better predictor of pathological response to nact compared with clinical assessment.18 in addition to enhanced visualization of the changing 3d morphology of the tumor , d3d can also help make an accurate volume and shape comparison of the tumor at two or more time points as a quantitative measure of effectiveness of nact . in the current practice , shifts in patient position from scan to scan can change the position and orientation of a breast tumor , which obscures subtle differences between treatment cycles . d3d can register the image to a 3d grid that is tied to an anatomic reference point . proper position and orientation of the ghost images representing prior states of the mass can permit color - coding of the regions of the tumor that are expanding or shrinking with an automatic calculation of the volume of change . in addition to mammography , the d3d s augmented reality technique can be applied to many of the radiological subspecialties . in neuroradiology , characterization of a cerebral aneurysm s morphology , orientation , neck , and relationship to other vessels is extremely important in both follow - up and in surgical planning . d3d can facilitate understanding the interrelationship of comminuted fracture fragments to guide surgery and to accurately orient the placement of prosthetic joints . in pulmonary imaging , the depth perception by d3d may help to better identify , characterize , and follow - up pulmonary nodules . in virtual colonoscopy , the improved hmi may speed up the examination and offer improved lesion detection . for all of these applications , and others to be conceived , the fact that d3d technology can input conventional digital radiologic images will permit thorough and rapid side - by - side comparison with the current standards . new radiological advances such as additional mri sequences , new contrast agents , and thinner imaging planes are expanding the information presented to the radiologist . it is becoming impractical for the radiologist to scroll through hundreds of slices to evaluate each item on the checklist . there is a growing need to optimize presentation of radiological images in a practical manner , whereby the radiologist can view the whole volume of data at once . not only does d3d of the future offer such an improved visual display , but also it will provide nonvisual sensory information to the user , including auditory and tactile feedback . for example , mr elastography provides information on the stiffness of tissue and d3d s augmented reality presents this as a tactile response to the stiffness by a glove . d3d s augmented reality provides new opportunity for enhanced visualization and improved hmi , creating the potential for improved diagnosis and response to therapy . d3d is an augmented reality medical imaging system that provides stereoscopic 3d imaging with binocular disparity . furthermore , d3d provides hmi in the form of a gaming joystick to fly inside the image and view the 3d lesion from any angle . we have illustrated , using a simulated dataset of breast microcalcifications , how the d3d system can reveal a linear branching morphology that would have otherwise been invisible under conventional imaging . future testing of the d3d should be performed to determine the utility of the system in mammography and other radiological subspecialties .

purposethe purpose of this article is to present images from simulated breast microcalcifications and assess the pattern of the microcalcifications with a technical development called depth 3-dimensional ( d3d ) augmented reality.materials and methodsa computer , head display unit , joystick , d3d augmented reality software , and an in - house script of simulated data of breast microcalcifications in a ductal distribution were used . no patient data was used and no statistical analysis was performed.resultsthe d3d augmented reality system demonstrated stereoscopic depth perception by presenting a unique image to each eye , focal point convergence , head position tracking , 3d cursor , and joystick fly-through.conclusionthe d3d augmented reality imaging system offers image viewing with depth perception and focal point convergence . the d3d augmented reality system should be tested to determine its utility in clinical practice .

virola surinamensis is a myristicaceous tree growing in the amazonian flooded plains and produces seeds during the rainy season [ 2 , 3 ] . seeds are viable shortly after ripening and are adapted to be dispersed by water or by large birds such as toucans and araaris . the seedling formation can be divided in two distinct phases : seed germination and seedling development . the cotyledons are hidden in the seed coat ( cryptocotylar ) and are storage organs of fatty material and polysaccharides that are recruited for the maintenance of seedling during its growth and development . a study carried out on v. venosa revealed that the major lignans cubebin and dihydrokusunokinin accumulated in the seeds were not detected in its seedlings which accumulated a polyketide instead . the major constituent identified in the seedling roots was shown to be the lignan sesamin , a minor constituent in the seeds . a different result were observed with v. sebifera in which a possible translocation of hydroxytetralone lignans and a preferential accumulation of a lignan hydroxy - otobain was observed in the whole seedlings . in view of the lack of systematic investigation regarding this important event in the reproduction of tropical trees , the translocation of secondary metabolites occurring in large seeds to be used as a defensive compounds in the seedlings remains as a hypothesis [ 8 , 9 ] . virola surinamensis seeds contain 15.4% of soluble tannins as a dry mass and the highest concentration of compounds with a probable defensive function yet recorded . phytochemical analysis of v. surinamensis seeds collected at combu island demonstrated the occurrence of lignoids , propiophenone , and -lactones in these organs . analysis of seedling leaves of v. surinamensis growing in the field , in greenhouse conditions and in micropropagated plantlets revealed the absence of lignans and the exclusive occurrence of juruenolide c ( 8a ) ( figure 1 ) . herein , we wish to report the analyses of fatty acids and major secondary compounds in seeds of v. surinamensis in order to evaluate a selective consumption during the germination process . tlc ) was carried out on silica gel gf-254 ( merck ) and column chromatography ( cc ) on silica gel 60h ( 0.0050.045 mm ) ( merck ) . the h nmr ( 200 mhz ) and c nmr ( 50 mhz ) spectra of samples were recorded on a bruker - ac 200 in cdcl3 with tetramethylsilane ( tms ) as an internal standard . warb . were collected in february 1995 at combu island ( 013010s ; 0482742w ) , near belm , par state , brazil . a dry voucher sample ( lopes-037 ) has been deposited in the spf - herbrio do instituto de biocincias da universidade de so paulo . mature seeds were frozen for analysis or germinated as previously reported and maintained at greenhouse facilities of instituto de qumica - usp . one dried seed ( 320 mg ) , after the germination process , was extracted with ch3oh ( 3x 50 ml ) . the concentrated extract ( 70 mg ) was suspended in ch3oh / h2o ( 6 : 4 ) and filtered through a millipore membrane ( 0.45 m ) . the filtered extract was submitted to preparative on hplc ( rp-8 , 10 m , 250 22 mm column ; ch3oh / h2o 60 : 40 ch3oh 100% ( 50 min ) , 8 mlmin , optimized conditions ) , followed by prep . tlc ( silica gel ; hexane / etoac / i - proh or ch2cl2/me2co ) to yield 4-hydroxy-3-methoxypropiophenone ( 1 , 1.6 mg ) , galbulin ( 2 , 5.5 mg ) , guaiacin 3 ( 1.4 mg ) , galbacin ( 4a , 2.0 mg ) , galbelgin ( 4b , 1.0 mg ) , calopeptin ( 5a , 1.6 mg ) , veraguensin ( 5b , 5.0 mg ) , 7,2-dihydroxy-4-methoxy - isoflavone ( 6 , 1.5 mg ) , ,2-dihydroxy-4,4-dimethoxydihydrochalcone ( 7 , 1.8 mg ) , juruenolide c ( 8a , 1.2 mg ) , and juruenolide d ( 8b , 1.3 mg ) . all these compounds were identified by comparison of spectroscopic data with that reported in the literature . individual seeds before and after germination process were extracted ( 3x ) with 200 ml of n - hexane . the transesterification of oils was carried out according to a procedure described by maia and rodrigues - amaya , 1993 . the methyl esters were dissolved with n - hexane ( 2 mgml ) , and 1 l was injected in a hewlett - packard 5890 gas chromatograph coupled to a hewlett - packard 5988 mass spectrometer in the condition previously described [ 12 , 23 ] . individual seeds , before and after the germination process , were extracted ( 3x ) with 20 ml of ch3oh . the extract was concentrated to dryness and the residue dissolved with ch2cl2 to obtain 2 mgml as the final concentration , and 1 l was injected . all the analyses were performed with seven replicates in a hewlett - packard 5890 gas chromatograph coupled to a hewlett - packard 5988 mass spectrometer . the sample was injected ( 250c ) on a db-5 column ( 30 m 0.25 mm i d 0.25 m of film tickness ) . the column temperature was initially 120c ( 2 min ) , then programmed to 230c at 7cmin , kept at 230c for 10 min , and then increased to 290c in 15 min . the identification of individual constituents was carried based on injection of isolated substances and comparison of their mass spectra . all values were reported as means sem , and were analyzed for statistical significance by two way analysis of variance followed by student test . two groups of seeds of v. surinamensis , before germination ( bg ) and 6 - 7 months after germination ( ag ) , were analyzed for fatty acids and major secondary metabolites . the second group ( ag ) showed a decrease of 30% in dry weight , but without significant changes in the extraction yield ( table 1 ) . these results are in agreement with durian 's hypothesis , in which seeds are a nutrient storage organ to supply the seedling during the growth process . the analyses of fatty acids content carried out in seeds of v. surinamensis before and after germination showed similar relative content of lauric acid ( 16% ) , myristic acid ( 70% ) , palmitic acid ( 6% ) , and stearic acid ( 8% ) . this result is similar to that previously reported , and since no preferential uptake of fatty acids could be detected , the major role of fatty material as carbon source is clearly supported ( table 2 ) . the secondary metabolites in both groups of seeds of v. surinamensis were analyzed by gc - ms . the chromatographic profile observed for both groups exhibited the predominance of galbulin ( 2 ) , galbacin ( 4a ) , and veraguensin ( 5b ) as the major compounds ( figure 2 ) . after statistical analyses , no significant variation was observed in the relative content of monitored compounds , except to compound 1 ( p < 0.05 ) ( table 2 ) . from v. surinamensis , new substances were isolated and some neolignans showed allelopathic properties . in addition , the increase of phenolic compounds was observed after elevated co2 submission in v. surinamensis and a strong inhibition of co2 assimilation by sun exposure . however , the analyses of the composition occurring in the seeds of this species during germination and seedling processes had not been studied yet . in summary , the germination of v. surinamensis seeds and the seedling development are processes in which both fatty acids and secondary metabolites ( lignans , isoflavonoids , and juruenolides ) are equally consumed in the seeds indicating their physiological role as energy and carbon source , or by other physiological function . in spite of the large concentration of lignans in the seeds ( 8.5% as dry weight basis ) , no specific translocation to the seedlings and no consumption of a specific compound from the seeds could be detected . the lignans could have biological importance to the seeds , but after the lignans uptake to the seedling , our results , in addition to the previous phytochemical investigations , reinforce the use of these compounds as energy and carbon source by the seedlings .

the major secondary metabolites and fatty acids occurring in the seeds of virola surinamensis were monitored by gc - ms during germination and seedling development . the role as carbon source for seedling development was indicated considering that both classes of compounds were similarly consumed in the seeds and that no selective consumption of compounds could be detected .

compartment syndrome is a known complication of knee arthroscopy , and so is popliteal pseudoaneurysm . in this case , both of these clinical entities occurred simultaneously . however , a fasciotomy did not lead to complete resolution of symptoms , until the patient had definitive treatment of his pseudoaneurysm . this case reminds an important clinical lesson that , in post - surgical swellings , we should always suspect an underlying vascular cause . it also suggests that an early ultrasound should be booked to rule out a pseudoaneurysm hiding underneath an apparent compartment syndrome . a 60-year - old gentleman was referred to the vascular surgery service , from the orthopedics department , with a he hit his left knee while getting out of a lorry , 2 months before this presentation . an mri at that stage confirmed lateral meniscal tear , and there was no other injury to surrounding structures . he had a left knee arthroscopy and repair of meniscal tear after a few weeks . he developed a swollen leg soon after the surgery . with significant swelling of his calf , and pain out of proportion and intracompartmental pressure of 40 mmhg , a clinical diagnosis of compartment syndrome was made and fasciotomy was performed to relieve the pressure in fascial compartments in the leg . however , he had persistent pain in calf and knee , and after a few weeks , when his calf swelling reduced , a pulsating mass was felt behind the same knee . an ultrasound performed , showing a 7 4 cm thick walled cystic mass in the popliteal fossa filled with irregular blood , suggestive of a popliteal aneurysm . on examination , he was hemodynamically stable . his left calf was swollen with a circumference of 3 cm greater than his right . his laboratory reports for full blood count , urea and electrolytes were normal . in view of the ultrasound findings , it confirmed 6 5 4 cm pseudoaneurysm , compressing and displacing his left popliteal artery . however , three - vessel run - off below the knee was satisfactory ( figs 1 and 2 ) . figure 1:ct angiogram of the left leg , coronal section , shows popliteal pseudoaneurysm ( asterisk ) , communicating and displacing the popliteal artery ( arrow ) . figure 2:ct angiogram of the left leg , transverse section , shows popliteal pseudoaneurysm ( asterisk ) adjacent to the popliteal artery ( arrow ) . ct angiogram of the left leg , coronal section , shows popliteal pseudoaneurysm ( asterisk ) , communicating and displacing the popliteal artery ( arrow ) . ct angiogram of the left leg , transverse section , shows popliteal pseudoaneurysm ( asterisk ) adjacent to the popliteal artery ( arrow ) . a diagnosis of iatrogenic popliteal pseudoaneurysm secondary to arthroscopy was made . the absence of this on his mri after before his arthroscopy suggests that it was not related to his initial trauma . compartment syndrome was considered to be secondary to his pseudoaneurysm due to its pressure effect . the initial significant calf swelling may have masked the clinical findings of a pulsating mass , but as the swelling reduced several weeks post - surgery , the pseudoaneurysm became easily palpable . after achieving proximal and distal control , the pseudoaneurysm was opened and clot was evacuated ( fig . the arterial injury was easily identified at the proximal end of the pseudoaneurysm ( fig . 4 ) and was closed with a patch of short saphenous vein ( fig . 5 ) . he was discharged home within a week . at an outpatient visit after 2 weeks , his wound was well healed and he had good peripheral pulses . compartment syndrome in limbs occurs due to increased pressure within fascial compartments and inability of connective tissue to stretch . common causes include long bone fractures , hemorrhage , ischemic reperfusion , burns , crush injuries , prolonged immobilization , substance abuse and carbon monoxide poisoning etc . iatrogenic causes include knee arthroscopy , lithotomy position , improper use of elastic bandage and use of hypertonic saline [ 46 ] . in this case , the cause of compartment syndrome following arthroscopy can be 2-fold . another more relevant factor could be iatrogenic popliteal pseudoaneurysm , causing compartment syndrome due to direct pressure effect . the incidence of popliteal aneurysms is between 0.1 and 1% , while traumatic pseudoaneurysms constitute 03.5% of all popliteal aneurysms [ 7 , 8 ] . the iatrogenic popliteal pseudoaneurysm is caused by penetrating injury during any intervention around the knee joint , e.g. total knee replacement , arthroscopy of knee joint , acupuncture , femoral artery angiographic procedures , etc . they may present with features characteristic of an aneurysm , e.g. pulsating mass , pain , nerve compression and rupture . other presentations include thromboembolism causing limb ischemia , deep venous thrombosis and tumor . in this case , it presented initially as compartment syndrome , and later investigations showed popliteal pseudoaneurysm to be the cause of this . diagnosis of iatrogenic popliteal aneurysm can be made with clinical examination and be confirmed with radiological investigations . clinical examination may sometimes fail to reveal a pulsating mass due to significant swelling . however , if significant swelling appears following any knee intervention , iatrogenic pseudoaneurysm should always be suspected . an ultrasound should be performed as an initial screening tool , but investigation of choice would be a ct angiogram , that has sensitivity of 95.1% and specificity of 98.7% . when compared with conventional angiogram , ct is quick , gives accurate results and is associated with less patient discomfort , and decreased cost . treatment modalities include ultrasound - guided thrombin injection , endovascular stent placement and open repair . placement of endovascular stents is quick and less invasive , but is associated with deformation and failure . in this case , due to compression and displacement of the popliteal artery by pseudoaneurysm , open repair was performed . we suggest that a diagnosis of popliteal pseudoaneurysm should always be suspected , if significant calf / knee swelling appears following any knee intervention . an urgent ultrasound should be performed in such a scenario . a ct angiogram of lower limb not only provides dimensions of popliteal pseudoaneurysm , but also its pressure effects on adjacent popliteal artery . open surgery appears to be successful treatment modality , when popliteal artery is found to be compressed and displaced .

this case describes a 60-year - old gentleman who presented with a pulsating mass behind his knee . before this , he had a fasciotomy for suspected compartment syndrome of leg following knee arthroscopy , but this failed to resolve his leg symptoms . he was hemodynamically stable on presentation . his left calf was swollen with a circumference of 3 cm greater than right . there was a large pulsating mass palpable in his left popliteal fossa . distal neurovascular status of the leg was intact . he had a normal cardiovascular , respiratory , abdominal and neurological examination . ultrasound showed a cystic mass in the popliteal fossa suggestive of aneurysm . ct angiogram demonstrated a 6 5 4 cm pseudoaneurysm compressing and displacing the left popliteal artery with satisfactory three - vessel run - off . an emergency repair was performed . an arteriotomy was identified at the proximal end of pseudoaneurysm and it was closed with a patch of small saphenous vein . it led to a good clinical outcome .

aquagenic syringeal acrokeratoderma ( asa ) is an acquired or hereditary keratoderma of unknown etiology . drug - induced cases of asa of the palms have been reported , associated with rofecoxib , celecoxib , aspirin , and in one case , tobramycin used for cystic fibrosis . several pathogenic mechanisms have been proposed , including structural or functional defects of the horny layer during adolescence , primary disease of the sweat ducts , increased sodium concentration in the skin , thereby increasing the water - retention capacity of the horny layer or a reaction to drugs . we present a case of a woman who used spironolactone for polycystic ovary syndrome ( pcos ) and developed asa 2 weeks later , after withdrawing the drug . a 21-year - old woman presented to our outpatient clinic with complaints of palmar eruption . she noted wrinkling and edema of the skin on the palms after soaking in water for 5 - 10 min , 3 weeks earlier . the wrinkling and edema were accompanied by sensations of tightness , tingling , and pruritus . the condition became better 10 - 15 minutes after exposure to water had ceased , but did not completely resolve . these findings regressed gradually after drying the hands , but were not completely resolved . on dermatological examination , whitish , keratodermic , macerated plaques , and dilated punctae were observed over the volar surface of the hands [ figure 1 ] . after soaking the hands in water for 5 min , the lesions became more translucent , noticeable , and symptomatic [ figure 2 ] . before soaking the hands in water , whitish keratodermic macerated plaques and dilated punctae were observed after soaking the hands in water for 5 min , the lesions became more translucent , noticeable , and symptomatic from her medical history , we learned that she used spironolactone for pcos up to 2 months earlier . she denied any concomitant hyperhidrosis , a personal or family history of cystic fibrosis , abnormal scalp hair , or atopic diathesis . her cousin had similar lesions years ago , but her symptoms were completely resolved with treatment . the disease had been treated at another center with 19% aluminum hydrochloride cream with no improvement . the laboratory findings , including sweat chloride concentrations were within normal limits , except for very small elevation of prolactin levels . we wanted to perform genetic testing to define cystic fibrosis transmembrane conductance regulator ( cftr ) mutations , but she would not accept any further tests . the patient was treated with topical pomade containing 10% urea and salicylic acid twice a day and topical 10% urea lotion ( excipial lipo ; orva ) . asa has been described in the literature under various names for similar conditions , patients with flat - topped , pitted , or translucent papules , with pebbly or white , prominent eccrine pores that are macerated in appearance and that appear on the hands and feet , exacerbated by water immersion . the disease was first reported as a hereditary papulotranslucent acrokeratoderma in 1973 by onwukwe et al . they reported a condition that appeared soon after puberty , demonstrated an autosomal dominant mode of inheritance and associated with fine - textured scalp hair and an atopic diathesis . afterwards , in 1974 , aquagenic wrinkling was reported by elliot in a letter to the editor , describing an anecdotal observation in children with cystic fibrosis . subsequently , several reports presented by several names , including transient reactive papulotranslucent acrokeratoderma , asa , aquagenic keratoderma , transient aquagenic palmar hyperwrinkling , and early aquagenic wrinkling . histopathological changes include orthohyperkeratosis with increased thickness and abnormal staining of the stratum corneum , dilated acrosyringia , and dermal eccrine ducts with hyperplasia of eccrine glands , clear cell changes and vacuolations , and increased capillaries around and adjacent to the eccrine glands . although asa is often related to cystic fibrosis , researchers have reported that it is not only specific for cystic fibrosis ; it is also seen in different conditions , such as marasmus and nephrotic syndrome . drug - induced cases of asa of the palms have been reported in single case reports , associated with rofecoxib , celecoxib , aspirin , and , in one patient , with tobramycin used for cystic fibrosis . the proposed mechanisms for the cases using rofecoxib , celecoxib , and aspirin involve an increase in the sodium retention of epidermal cells . in these cases , the proposed mechanism is cyclooxygenase-2 ( cox-2 ) inhibition in epidermal cells , which may cause increased sodium reabsorption in a mechanism similar to the effect of cox-2 inhibitors on kidney cells . adrenal steroids have recently been shown to play an important role in the regulation of renal cox-2 expression . according to zhang et al . , blockade of mineralocorticoid receptors with spironolactone leads to upregulation of renal cortical cox-2 expression . in our patient , who was using spironolactone for pcos for approximately 2 months withdrawing the drug may have caused increased sodium retention of epidermal cells . during treatment , 20% aluminum chloride solution , botulinum toxin injections , antihistamines , pomade containing 5% salicylic acid , a mixture of mometasone furoate and petroleum jelly , and a cream containing 20% urea were used for treatment . our patient had not improved with 19% aluminum hydrochloride cream , perhaps because she had not suffered from palmar hyperhidrosis . withdrawing spironolactone may have caused increased sodium retention of epidermal cells , thereby inducing asa .

aquagenic syringeal acrokeratoderma is a rare , transient , and usually bilaterally symmetric , palmoplantar keratoderma . patients complain of tingling and pain in the hands starting a few minutes after exposure to water and lasting for 20 - 30 minutes after removal . clinically , there is marked wrinkling with edematous white papules on the palms or , less often , the soles . we present the case of a 21-year - old woman who used spironolactone for polycystic ovary syndrome and had similar clinical features 2 weeks later , after withdrawing the drug .

the molybdenum cofactor ( moco ) is essential for the activity of these enzymes and is associated with amidoxime reductase in mitochondria . moco deficiency ( mocd ) causes a severe progressive metabolic encephalopathy with neonatal convulsions , spasticity , opisthotonus , brain atrophy , altered facial morphology and severe developmental disability , spherophakia and dislocated lenses in survivors , associated with deficiency of both xanthine oxidase and sulfite oxidase . histopathology of the brain shows severe loss of neocortical neurons , gliosis and areas of cystic necrosis in white matter , also seen in sulfite oxidase deficiency , suggesting that deficiency of sulfite oxidase causes much of the cerebral pathology . the mocs1a and mocs1b genes encode an enzyme complex that forms cyclic pyranopterin monophosphate ( cpmp ) from gtp . the mocs2a and mocs2b gene product , in association with a protein encoded by mocs3 , convert cpmp to molybdopterin ( mpt ) . cpmp is deficient or absent when there are mutations in the mocs1 gene , while its oxidation product , compound z , is detectable in urine when there are mocs2 mutations ( fig . 1 ) . the gephyrin gene product adenylates mpt and adds molybdenum to form moco . when urine amino acids are screened on suspicion of a metabolic disease , an elevated s - sulfo - l - cysteine level suggests either sulfite oxidase deficiency or mocd . an elevation of urine xanthine and low blood uric acid indicate an additional deficiency of xanthine oxidase due to mocd . patients with mocs1a or mocs1b deficiency have been treated with a stable injectable form of cpmp ( hitzert et al . , 2012 , veldman et al . , 2010 ) , but with mocs2 mutations supplementation with cpmp is ineffective . pyridoxal-5-phosphate is sequestered by elevated levels of the cyclic form of alpha - amino adipic semialdehyde ( piperideine-6-carboxylate ) in mocd , so seizures in mocd might respond to pyridoxine supplementation ( struys et al . , 2012 ) . a 3.2 kg full term newborn girl with apgar scores 9 at 1 min and 5 min appeared well until day 2 when refractory seizures , opisthotonus , startle reflexes and vomiting developed . the pregnancy and family history were unremarkable ; the parents were of samoan and caucasian origin . despite treatment with intravenous glucose - saline , phenobarbitone and phenytoin , cranial ultrasound mri showed a thin anterior corpus callosum and mri showed severe hypoplasia of its body and splenium ; there was a slight parallel appearance of the lateral ventricles with mild prominence of the trigone and temporal horns . there was subtle loss of gray / white matter differentiation and cerebral edema with attenuation of surface csf spaces . the deep cerebral veins , the vein of galen and the internal cerebral veins were dilated . a dilated serpiginious vein connected the superior sagittal sinus and vein of galen instead of the usual straight sinus and could indicate a persistent embryonic vein . the weights and measurements were in keeping with the gestational age at autopsy , which confirmed normal external morphology and thinning of the corpus callosum , cerebral edema and congested tortuous meningeal vessels . uric acid , s - sulfo - l - cysteine and xanthine in urine were measured by direct - injection electrospray tandem mass spectrography ( veldman et al . , 2010 ) . urine sulfite was measured by a semi - quantitative dipstick test ( merckoquant test sulfite , merck chemicals , darmstadt , germany ) . mutations in mocs2b were identified by pcr amplification of exons and neighboring intronic sequences of leukocyte genomic dna from the patient and her parents and sanger sequencing . mocs2a and mocs2b wild - type ( wt ) proteins and the mocs2b - s140f variant were recombinantly expressed in escherichia coli and purified to homogeneity . the small subunit of mpt synthase , mocs2a , was expressed and purified as intein - fusion protein with a chitin - domain for subsequent affinity purification and eluted with ammonium sulfide , resulting in the release of activated mocs2a protein with a thiocarboxylated c - terminal tail ( gutzke et al . , 2001 ) . mocs2b wildtype and the mocs2b - s140f variant were cloned into pet15b , expressed in e. coli bl21 and purified by ammonium sulfate precipitation and subsequent gelfiltration using superdex 200 size exclusion column . changes in three - dimensional structure of the mutant protein were analyzed by circular dichroism spectroscopy ( rudolph et al . , 2001 ) . complex formation of mpt synthase was analyzed by isothermal titration calorimetry using mocs2a and either wt mocs2b or the mocs2b - s140f variant . in vitro mpt synthesis rates were quantified as a function of the concentration of small mpt synthase subunit mocs2a ( llamas et al . , 2004 ) . uric acid levels in urine were low during life and at autopsy , and urine xanthine was elevated , while the level of compound z which is normally undetectable in urine was found to be elevated ( data not shown ) . urine s - sulfocysteine ( 44 mol / l ) and s - sulfocysteine : creatinine ratio ( 231 mol / mmol creatinine ) were markedly elevated . two novel mutations of the mocs2 gene in dna from blood of the patient were predicted to impair mrna synthesis or enzyme activity . > t ( p.s140f ) encoded a substitution of phenylalanine for serine and the other , c.501 + 2delt is predicted to disrupt a splice site . in silico analysis using the crystal structure of bacterial mpt synthase predicted the location of s140 at the end of -stand 6 , which is part of a highly conserved sequence motif forming the active site within the mocs2b ( e. coli moae ) and being involved in binding the c - terminal end of mocs2a ( e. coli moad ) . the exchange of the polar serine residue to the much larger , hydrophobic phenylalanine presumably influences the stability of the central -sheet of mocs2b and the overall assembly of the heterotetrameric mpt synthase complex . following expression and purification , the total yield of mocs2b - s140f was much lower than that for wt mocs2b ( fig . consistently , circular dichroism spectroscopy revealed an alteration in the protein folding , given that between 210 and 220 nm a more negative signal was recorded , which suggests changes in the content of helical structures in mocs2b - s140f ( fig . these might influence either the oligomerization between two mocs2b protomers or the interaction with the small subunit ( mocs2a ) . therefore , we analyzed the complex formation of mpt synthase by isothermal titration calorimetry using mocs2a and either wt mocs2b or the mocs2b - s140f variant . while in the presence of wt mocs2a an effective complex formation associated with a saturation of heat release was observed ( fig . 2c ) , only minor heat release peaks were seen with mocs2b - s140f ( fig . 2d ) suggesting a severely affected interaction between both subunits , which could not be quantified . note that wt mocs2b binds mocs2a with a kd = 0.36 0.047 m ( fig . this finding identifies a defective association of both mpt synthase subunits as a major disease - causing mechanism . finally , we determined in vitro mpt synthesis rates as a function of the concentration of small mpt synthase subunit mocs2a . while wt mocs2b showed an effective mpt synthesis ( determined by the oxidation product forma , fig . 2e ) , mocs2b - s140f was only able to produce low levels of mpt at high concentrations of mocs2a . the differential diagnosis of mocd includes deficiency of sulfite oxidase and pyridoxine - dependent epilepsy ( struys et al . , 2012 ) . mocd can be associated with a number of morphological abnormalities of the brain and face . it is important to emphasize that some of the reported changes can be similar to those seen in neonates with hypoxic ischemic encephalopathy , so metabolic investigations should not be neglected in cases of presumed intrapartum hypoxia ( topcu et al . , 2001 ) . investigations should include screening of amino acids in urine , which would identify high levels of s - sulfo - l - cysteine in mocd , associated with high urinary xanthine and low levels of plasma uric acid . the detection in urine of compound z confirms the diagnosis of mocs2 deficiency , and facilitates decisions about treatment . exogenous cpmp only works in cases with mocs1 deficiency who can not synthesize cpmp , and could potentially slow or stop the progression of disease ( veldman et al . , 2010 ) , although seizures and cramped synchronized general movements have been observed on day 1 in a baby diagnosed prenatally with a mocs1 mutation ( hitzert et al . , 2012 ) , so it is possible that irreversible brain damage occurs prenatally . in this case , protein expression experiments confirmed that the s140f mutation severely reduces complex formation of mpt synthase . as some residual activity is detectable in vitro , a milder presentation with low levels of enzyme activity might be considered in this case . in vitro analysis of expression of the allele containing the splice site mutation was not possible for this patient , although the wild type human sequence at both c.419 and c.501 + 2 is conserved in several species ( table 1 ) ( anonymous , 2014 ) . biochemical testing for recurrence in a future pregnancy could include measurement of s - sulfo - l - cysteine level or sulfite oxidase activity in chorion villus cells , or of s - sulfo - l - cysteine in amniotic fluid . mutation analysis reassured the parents that treatment with exogenous cpmp was not indicated , as it has only been shown to help babies with mocs1 mutations . the child died before the potential benefit of pyridoxine supplementation was published ( struys et al . , 2012 ) .

backgroundmolybdenum cofactor deficiency ( mocd ) is a severe autosomal recessive neonatal metabolic disease that causes seizures and death or severe brain damage . symptoms , signs and cerebral images can resemble those attributed to intrapartum hypoxia . in humans , molybdenum cofactor ( moco ) has been found to participate in four metabolic reactions : aldehyde dehydrogenase ( or oxidase ) , xanthine oxidoreductase ( or oxidase ) and sulfite oxidase , and some of the components of molybdenum cofactor synthesis participate in amidoxime reductase . a newborn girl developed refractory seizures , opisthotonus , exaggerated startle reflexes and vomiting on the second day of life . treatment included intravenous fluid , glucose supplementation , empiric antibiotic therapy and anticonvulsant medication . her encephalopathy progressed , and she was given palliative care and died aged 1 week . there were no dysmorphic features , including ectopia lentis but ultrasonography revealed a thin corpus callosum.objectivesthe aim of this study is to provide etiology , prognosis and genetic counseling.methodsbiochemical analysis of urine , blood , sanger sequencing of leukocyte dna , and analysis of the effect of the mutation on protein expression.resultsuric acid level was low in blood , and s - sulfo - l - cysteine and xanthine were elevated in urine . compound z was detected in urine . two mocs2 gene mutations were identified : c.501 + 2delt , which disrupts a conserved splice site sequence , and c.419c > t ( ps140f ) . protein expression studies confirmed that the p.s140f substitution was pathogenic . the parents were shown to be heterozygous carriers.conclusionsmutation analysis confirmed that the mocd in this family could not be treated with cpmp infusion , and enabled prenatal diagnosis and termination of a subsequent affected pregnancy .

, we describe the first case of fatal large bowel ischemia in the aftermath of laparoscopic incisional hernia repair . a literature search using pubmed was performed to identify all published cases of intestinal ischemia following laparoscopic procedures . our search revealed 13 cases of intestinal ischemia following various laparoscopic procedures . including this one , 10 of 14 cases reported on so far had impaired cardiovascular , hepatic or renal function or atherosclerosis . patient - related risk factors seem to play the most important role in the development of this rare but devastating complication . preventive measures and methods to identify patients at risk for developing intestinal ischemia during and after laparoscopy patient selection , an optimal hydration status , an optimized technique with lowest insufflation pressure possible , and intermittent decompressions of the abdomen when the procedure is lengthy are the measures that have a potential to prevent this complication . whatever laparoscopic procedure has been performed , intestinal ischemia should be considered in any patient with nonspecific abdominal symptoms . it has been described after laparoscopic cholecystectomy , inguinal hernia repair , gynecologic myolysis , and fundoplication . laparoscopic repair of ventral and incisional hernia ( lrvih ) is gaining popularity due to its low recurrence rate , short hospital stay , and low complication rate . in this report a 47-year - old obese woman ( bmi of 42 ) with a large incisional hernia at midline laparotomy was referred for laparoscopic correction . her medical history was significant for hypertension , transabdominal gynecologic surgery , peripheral vascular disease , and included multiple angioplasties of the iliac arteries . a 15-minute break that included decompression of the abdomen was made halfway through the operation . this is locally a common practice during long operations and was not triggered by any specific adverse event . the hernia defect measured 20 cm 16 cm and correction required application of two 30cm20 cm expanded polytetrafluoroethylene meshes ( dualmesh , wl gore , flagstaff , az , usa ) . the meshes were fixed both with tackers ( protack , tycouss , norwalk , ct , usa ) and transabdominal sutures . c - reactive protein was significantly raised . to evaluate the possibility of a missed bowel lesion , we decided on a relaparoscopy . intraabdominal pressure was maintained at 12 mm hg throughout this short procedure that took not more than 12 minutes . upon exploration , only bowel distension was found with no signs of contamination , perforation , or ischemia . given these findings postoperatively , the patient developed systemic inflammatory response syndrome , respiratory insufficiency , and required transfer to the intensive care unit . within the next few days , the patient slowly stabilized , required less and less support , and experienced no apparent infection . on postoperative day 9 , she produced bloody diarrhea that prompted us to perform a colonoscopy . examination revealed severe ischemic colitis in the transverse colon . mesenteric angiography was performed showing an occluded superior mesenteric artery and a compensatory distended inferior mesenteric artery with a pinpoint stenosis at its origin . balloon angioplasty ( figure 1 ) successfully dilated this stenosis , the patient was placed on anticoagulants and , afterward , the patient steadily improved . another colonoscopy was performed that showed multiple perforations of the ischemic transverse colon . at subsequent laparotomy , a fecal peritonitis due to multiple perforations of the ischemic postoperatively , the patient deteriorated further and died the next day , 16 days after the first operation . acute mesenteric ischemia is the result of a sudden reduction in intestinal blood flow that is insufficient to meet the metabolic demands of the bowel . specific risk factors include advanced age , atherosclerosis , low cardiac output states , cardiac arrhythmias , severe cardiac valvular disease , administration of medications known to reduce intestinal perfusion ( such as diuretics , digoxin , alpha - adren - ergic agonists ) , various forms of shock , septicemia , dehydration , hypotension , and others . although a few cases of fatal bowel ischemia are described after open cholecystectomy , various cardiac and peripheral vascular procedures , cystectomy , esophagectomy , and others , the incidence of postoperative bowel ischemia is extremely low . this indicates that the effects of surgery on bowel perfusion are usually well tolerated and have no clinical consequences . a number of physiologic changes during laparoscopy create an additional risk of compromised mesenteric circulation . the intraabdominal hypertension created by the pneumoperitoneum reduces mesenteric perfusion , cardiac output , and mesenteric outflow . direct absorption of insufflated carbon dioxide into the circulation may also lead to mesenteric vasoconstriction . however , all these adverse physiological effects of pneumoperitoneum are obviously well tolerated in the vast majority of patients , because a clinically manifested bowel ischemia after laparoscopic procedures is an extremely rare complication . a literature search using pubmed revealed only 13 case reports before the present one ( table 1 ) . once it occurs though , intestinal ischemia following a laparoscopic procedure is a devastating complication . eleven of 14 patients including this one died as a consequence , creating an overall mortality of 79% . reported cases of intestinal ischemia after laparoscopic procedures ns = not specified ; iap = intraabdominal pressure . rapid diagnosis is essential to prevent the catastrophic events associated with mesenteric ischemia . because early signs and symptoms are nonspecific however , given the negligible incidence of intestinal ischemia amid the large number of laparoscopic procedures performed , the diagnosis is as a rule missed or delayed . in only one reported case was the diagnosis established clinically and relatively early . this patient was treated with high - dose anticoagulants and recovered . in all other reported cases , the risk seems to be particularly high in patients with impaired hepatic or renal function or atherosclerosis . including this one , 10 of 14 patients ( 71% ) reported on so far had at least one of the previously mentioned risk factors present . it has been previously stated that the risk is higher when the laparoscopic procedure is lengthy . although in this case intestinal ischemia developed after an indeed very lengthy procedure , data from the literature do not provide strong support of that view . of 13 previously published reports , duration of surgery was specified in 10 of them on average equaling 67.5 minutes ( median , 62.5 , range 22 to 120 ) , which is quite usual for procedures that were performed . we used decompression once halfway through this long procedure , but it did not prevent development of fatal intestinal ischemia . it is probably a futile endeavor to precisely determine the specific role of laparoscopy in the cascade of events that led to mortality in the patient we describe . long laparoscopy in the patient at risk with unknown preexisting compromised mesenteric circulation definitely carried a potential to further compromise bowel perfusion . it is also possible that development of postoperative ileus in combination with systemic inflammatory response syndrome played a triggering role in the development of this complication . no signs of intestinal ischemia at relaparoscopy and a relatively long clinical course in our patient might offer certain support to this second possibility . to the best of our knowledge , this is the first reported case of intestinal ischemia following lvihr and the only one we have experienced in a series of 401 lrvih performed so far ( incidence of 0.25% ) . carbajo et al , reporting earlier on their experience with lvihr , mentioned in brief among postoperative complications a case of a small bowel leakage due to ischemia but did not provide any further details on this issue . patient selection , an optimal hydration status , an optimized technique using the lowest insufflation pressure possible , and intermittent decompressions of the abdomen when the procedure is lengthy are the measures that have a potential to prevent this rare complication . whatever a laparoscopic procedure has been performed , intestinal ischemia should be considered in any patient with nonspecific abdominal symptoms .

background and objectives : intestinal ischemia is a very rare complication of laparoscopic procedures . in this report , we describe the first case of fatal large bowel ischemia in the aftermath of laparoscopic incisional hernia repair.methods:a literature search using pubmed was performed to identify all published cases of intestinal ischemia following laparoscopic procedures.results:our search revealed 13 cases of intestinal ischemia following various laparoscopic procedures . including this one , 10 of 14 cases reported on so far had impaired cardiovascular , hepatic or renal function or atherosclerosis . none of these patients - at - risk survived . in this series , no indications of faulty operative technique could be identified.conclusion:patient-related risk factors seem to play the most important role in the development of this rare but devastating complication . preventive measures and methods to identify patients at risk for developing intestinal ischemia during and after laparoscopy are not completely clear . patient selection , an optimal hydration status , an optimized technique with lowest insufflation pressure possible , and intermittent decompressions of the abdomen when the procedure is lengthy are the measures that have a potential to prevent this complication . whatever laparoscopic procedure has been performed , intestinal ischemia should be considered in any patient with nonspecific abdominal symptoms .

the dopaminergic action in the kidney is impaired in essential hypertension due to an overactivity of g - protein - coupled receptor kinase type 4 ( grk4 ) , an enzyme that desensitizes dopamine d1 receptor ( d1r ) [ 1 , 3 ] . over - activity of grk4 is shown to be caused by three activating variants of grk4 , namely , r65l , a142v , and a486v [ 2 , 4 ] , in humans , and we have previously reported that these grk4 gene variants are associated with salt - sensitive and low - renin hypertension . in addition to grk4 , gene polymorphisms related to the renin - angiotensin - aldosterone system ( raas ) , such as angiotensin converting enzyme ( ace ) , angiotensinogen ( agt ) , angiotensin ii type 1 receptor ( agtr1 ) , and aldosterone synthase ( cyp11b2 ) , have been reported to be associated with hypertension . many studies attempt to link a certain genotype with hypertensive phenotype by establishing a difference in genotype frequency between hypertensive and normotensive patients . however , hypertension is a complex trait that develops slowly and latently , being modulated by many overlapping and counteracting systems . hence , it is difficult to convincingly establish the causality of gene polymorphisms in hypertension , unless such gene variant is shown to increase blood pressure in transgenic animal models . given this limitation , it may be beneficial to explore associations between factors postulated to underlie hypertension , such as fluid retention , raas overactivation or oxidative stress , and hypertension - related genotypes in those who have not yet developed hypertension . n - terminal pro - b - type natriuretic peptide ( nt - probnp ) is a peptide made by cardiomyocytes during the formation of brain natriuretic peptide ( bnp ) . nt - probnp is often used as a biomarker of cardiac volume and pressure load [ 68 ] . because nt - probnp as a marker is very sensitive and dynamic , nt - probnp may reflect mild fluid retention caused by hypertension - related gene variants . another prohypertensive condition postulated to be associated with many of the gene variants is the over - activation of the raas . the increased activity of the raas may be due to the increased aldosterone production in some instances [ 9 , 10 ] and an increase in oxidative stress in others . therefore , urinary 8-hydroxy-2-deoxyguanosine ( 8-ohdg ) , a marker of oxidative stress , and plasma aldosterone concentration were also measured in this study . the present study tested the correlations of hypertension - related gene polymorphisms including grk4 with physiological and chemical indices related to hypertension and atherosclerosis in healthy , normotensive adults . all protocols were carried out with the approval of fukushima medical university institutional review board . study participants were recruited japanese volunteers with normal blood pressure ( < 140/90 mmhg at office or < 135/85 mmhg at home ) as defined by the japanese society of hypertension committee for guidelines for the management of hypertension who were working in a hospital in fukushima prefecture . those with cardiovascular disease ( subjects receiving regular followup ) , chronic kidney disease ( estimated glomerular filtration rate < 60 ml / min/1.73 m and/or macroproteinuria ) , or diabetes ( hba1c - jds < 6.5% and/or receiving medical treatment ) were excluded from the study . after providing written consent , cardioankle vascular index ( cavi ) and ankle - brachial index ( abi ) were measured by vs-1500 n ( fukuda denshi co. , ltd . augmentation index ( ai ) and central systolic blood pressure ( csbp ) were measured by hem-9000ai ( omron corp . urinary electrolytes were measured to estimate the amount of daily sodium intake based on the kawasaki 's formula [ 13 , 14 ] . urinary albumin and 8-ohdg was measured by latex nephelometry and enzyme - linked immunosorbent assay , respectively . patient samples for blood analyses were obtained at 8:30 am after the patients had rested in the recumbent position for 30 minutes . routine laboratory analyses were performed in the hospital laboratory with an automated method using hitachi autoanalyzer 7070 ( hitachi high - technologies corporation , tokyo , japan ) . urinary albumin and 8-ohdg , plasma aldosterone concentration , and nt - probnp were measured by srl inc . variants of grk4 ( r65l a142v , and a486v ) , agt m235 t , at1r a1166c , cyp11b2 c-344 t , and pai-1 4/5 g were detected by fluorescence probe melting curves . correlations between physiological indices and number of grk4 single nucleotide polymorphisms ( snps ) are assessed by one - way factorial anova . association between systolic blood pressure and nt - probnp levels were analyzed by pearson product - moment correlation coefficient test . differences in laboratory tests among groups in table 2 were analyzed by cochran - cox test and one - way factorial anova . the mean systolic and diastolic blood pressures at the office were 124.4 16.2 and 79.1 12.4 mmhg , respectively . since subjects with diabetes were excluded from the study , the average levels of fbs and hba1c were normal ( table 1 ) . cavi , ai , sbp , and csbp were measured as physiological indices of atherosclerotic changes . no significant relationships were observed between the number of grk4 polymorphisms and cavi , ai , sbp , or csbp ( figure 1 ) . in the subjects who have two or more grk4 polymorphic alleles , nt - probnp levels were significantly higher than those with one or no grk4 polymorphic allele ( 41.0 5.0 versus 60.2 6.7 pg / ml , p < 0.05 , figure 2(a ) ) . this was not due to higher blood pressure , as there was no association between nt - probnp and office sbp in the healthy normotensives in this study ( figure 2(b ) ) . other hypertension - related genotypes , ace , agt , agtr1 , and cyp11b2 , were not significantly associated with nt - probnp concentration ( table 2 ) . also , none of the hypertension - related polymorphisms examined showed significant association with plasma aldosterone concentration or urinary 8-ohdg , a marker of oxidative stress ( table 2 ) . the present study showed for the first time that a significant increase in serum nt - probnp concentration exists in normotensive , healthy subjects harboring hypertension - related polymorphisms of grk4 , while there was no association between any of the hypertension - related genotypes studied and physiological indices ( cavi , ai , sbp , and csbp ) , plasma aldosterone concentration , or an oxidative stress marker , urinary 8-ohdg . we have previously reported the association between grk4 polymorphisms ( r65l , a142v , and a486v ) and salt sensitivity and/or hypertension . in japanese with untreated , newly diagnosed hypertension , a genetic model based on grk4 r65l , grk4 a142v , and grk4 a486v was 94.4% predictive of salt - sensitive hypertension . also , in normotensive , young american twins , individuals who were homozygous for haplotype 65l-142v - a486 showed a 1.05 mmhg steeper increase in sbp per year increase in age compared with those homozygous for the most common r65-a142-a486 haplotype . the present study did not find a blood pressure difference in normotensive , japanese adults possibly because of lack of power due to a smaller sample size . however , the fact that there was a significant increase in serum nt - probnp concentration among those with grk4 polymorphisms suggests that salt - sensitive phenotype may be apparent before blood pressure elevation . salt sensitivity is associated with an increased morbidity and mortality due to cardiovascular disease even in normotensive population . in patients with stable coronary disease , nt - pro - bnp is a better marker of long - term mortality than conventional cardiovascular risk factors or the degree of left ventricular systolic dysfunction [ 22 , 23 ] . there are also reports that nt - probnp is associated with unfavorable cardiovascular outcome in patients with left ventricular hypertrophy , geriatric population [ 25 , 26 ] or diabetes . to determine if grk4 polymorphisms and nt - probnp can predict future cardiac risks , prospective studies with larger sample size may be useful . physiological indices , cavi and ai , are both known to increase with greater number of cardiovascular risk factors and complications [ 2830 ] . ai may be more sensitive than cavi in detecting small differences in cardiovascular risk factors [ 3133 ] . also , estimated central systolic blood pressure ( csbp ) has shown to be better than brachial blood pressure in assessing atherosclerosis and predicting cardiovascular outcome . however , in this relatively young , normotensive study population , none of the hypertension - related genotypes correlated with csbp , cavi , or ai . the lack of association in this study may suggest that detectable atherosclerotic damage or hemodynamic alteration is not one of the early changes during the development of hypertension . the major finding of this study is that nt - probnp concentration was slightly but significantly elevated in the normotensive subjects with more hypertension - related grk4 polymorphisms . the values of nt - probnp observed in the present study fall within the normal range , but there have been studies that show slight but significant changes with different conditions . heringlake et al . examined the effects of saline infusion on healthy men and found a significant elevation of plasma nt - probnp from approximately 3 pmol / l ( 25 pg / ml ) to 7 pmol / l ( 59 pg / ml ) 8 hours after the infusion . even though the difference in the values of nt - probnp is relatively small , the diagnostic benefit may still be apparent . it is notable that among the various hypertension - related gene polymorphisms studied , only grk4 showed a significant correlation with serum nt - probnp concentration . this finding is in accordance with the proposed mechanism of association between grk4 and hypertension , as polymorphic grk4 has been shown to increase d1r phosphorylation , decrease camp response to dopamine in renal tubular cells , and impair natriuresis [ 2 , 4 ] , which would lead to sodium and fluid retention . another finding from this study is that none of the hypertension - related gene polymorphisms were associated with plasma aldosterone concentration or urinary 8-ohdg . an increase in aldosterone production is postulated to be a mechanistic link between some ras - related polymorphisms and hypertension [ 10 , 36 ] , and oxidative stress is considered as an important factor in hypertension involving over - active raas . however , at least in this study population , no significant difference could be detected in plasma aldosterone concentration or urinary 8-ohdg by different genotypes . an important limitation of this study is that the majority ( 74% ) of study subjects were female , reflecting the high female ratio of hospital workers in japan . as such , some of the findings may not be directly applicable to the general population . in conclusion , grk4 polymorphisms have a close relationship with serum nt - probnp concentration , which may reflect fluid retention and increased cardiac load . grk4 may be a potential target to screen for the risk of future hypertension and cardiovascular disease so that lifestyle modifications such as salt restriction can be chosen by at - risk subjects to prevent future adverse events . 6,660,474 ) on grk mutants in essential hypertension and formed the company hypogen , inc .

g protein - coupled receptor kinase 4 ( grk4 ) with activating polymorphisms desensitize the natriuric renal tubular d1 dopamine receptor , and these grk4 polymorphisms are strongly associated with salt sensitivity and hypertension . meanwhile , n - terminal pro - b - type natriuretic peptide ( nt - probnp ) may be useful in detecting slight volume expansion . however , relations between hypertension - related gene polymorphisms including grk4 and cardiovascular indices such as nt - probnp are not clear , especially in healthy subjects . therefore , various hypertension - related polymorphisms and cardiovascular indices were analyzed in 97 normotensive , healthy japanese adults . nt - probnp levels were significantly higher in subjects with two or more grk4 polymorphic alleles . other hypertension - related gene polymorphisms , such as those of renin - angiotensin - aldosterone system genes , did not correlate with nt - probnp . there was no significant association between any of the hypertension - related gene polymorphisms and central systolic blood pressure , cardioankle vascular index , augmentation index , plasma aldosterone concentration , or an oxidative stress marker , urinary 8-ohdg . normotensive individuals with grk4 polymorphisms show increased serum nt - probnp concentration and may be at a greater risk of developing hypertension and cardiovascular disease .

annually , more than 7 million patients with chest pain present to emergency departments in the usa . however , of these patients , 75% do not have cardiac - related chest pain.1 evaluation and treatment of these patients imposes a cost of more than us$10 billion on the us health system.2 in iran , a frequent number of beds in coronary care units ( ccus ) are occupied by low - risk patients with suspected diagnosis of acute coronary syndromes ( acss ) . in 2003 , azizi et al found that approximately 70% of these patients did not have deterioration of their symptoms during their hospitalization and were discharged after 23 days.3 at the same time that these ccu beds were occupied by low - risk patients , 2%8% of patients with chest pain who actually had acs were discharged.4 in a study of 903 patients with acute chest pain , it was found that patients stayed an average of 3.01 days in ccu and that this hospitalization duration was associated with : the diagnosis of acute myocardial infarction and unstable angina , severity of complications , the use of invasive and noninvasive diagnostic methods , and primary triage for referring patients to ccus.5 factors such as time of admission , insurance coverage , cardiac monitoring , exercise tests , and echocardiography had effects on increasing the length of the patients stay period.5 the results of another study have shown that the probability of occurrence of serious complications in low - risk patients is much less than high - risk patients.6 gatein et al have shown that patients with a normal electrocardiogram without chest pain can be observed without cardiac monitoring and there is no indication for the admission of such patients to ccu.7 the current study was done in 2008 , the data were collected this year , to determine the rate of exploitation of resources and cardiovascular outcomes in low - risk patients with chest pain in ccus of hospitals affiliated to a major medical university in tehran , iran . in this descriptive study , 550 patients with chest pain who were hospitalized in the ccu of six affiliated general hospitals of shahid beheshti university of medical sciences , tehran , iran , were recruited by census method during a 4-month period . the statistics of the surveyed hospitals in 2008 are presented in table 1 . using the thrombolysis in myocardial infarction ( timi ) risk score , 95 patients were identified as low risk ( 17.27% ) , 110 ( 21.5% ) as moderate risk , and 336 ( 61% ) as high risk . the low - risk group was evaluated with respect to demographics , bed - occupancy rate ( bor ) , mean hospitalization period , expenses during admission to ccu , and cardiovascular outcomes in the 30-day period postdischarge . for gathering the required information , inclusion criteria , based on the timi score provided by the american college of cardiology for the categorizing of patients with chest pain , and patient medical records were used simultaneously . the inclusion criteria consisted of disease information , admission to duration of stay in ccu , the expenses of hospitalization , and cardiovascular outcomes . the timi score uses seven independent risk factors : presence of three or more coronary artery disease ( cad ) risk factors established cad on angiography use of aspirin for at least 1 week occurrence of angina at least twice in a recent 24-hour period st segment deviation of 0.5 mm or more increase in cardiac enzymes . patients are categorized according to their scores into low risk ( timi score < 3 ) , moderate risk ( timi score 35 ) , and high risk ( timi score > 5 ) . for determination of the validity of timi scores and information gathered according to the inclusion criteria , the content validity method was applied . for reliable testing of timi , the interobserver reliability method was used ; risk rate was determined in this way and , after ten observations , an acceptable rate of 0.80 was achieved . since this study was based on medical records of the surveyed hospitals and no diagnostic or therapeutic intervention was performed on patients , there was no medical ethics approval and no need to obtain informed consent , either written or verbal , from any patient . since this study was based on medical records of the surveyed hospitals and no diagnostic or therapeutic intervention was performed on patients , there was no medical ethics approval and no need to obtain informed consent , either written or verbal , from any patient . mean ( standard deviation ) hospitalization duration in the low - risk group was 3.04 ( 0.71 ) days ( range , 14 days ) ( table 2 ) . using analysis of variance ( anova ) , no significant difference was seen between the six hospitals regarding hospitalization duration ( p = 0.602 ) . the highest bor by low - risk patients was seen in taleghani and shohada tajrish hospitals and the lowest was in modarres hospital ( table 2 ) . mean total hospitalization expenses was us$205 ( range , 129240 ) ( table 3 ) . in patients who had insurance , 90% of hospitalization expenses using anova , no significant difference was seen between the six surveyed hospitals ( p = 0.699 ) . in terms of cardiovascular outcomes , the majority of patients ( 89.5% ) at 1-month follow - up did not have any cardiac complications and six cases ( 6.3% ) presented to emergency departments due to chest pain and were discharged after receiving outpatient treatment and four cases ( 4.2% ) were readmitted to ccu . at the 1-month follow - up of low - risk patients , in the six surveyed hospitals , of 550 patients who were hospitalized in ccus with the diagnosis of acute coronary syndromes , 95 cases ( 17.5% ) were low risk and their mean hospitalization duration was 3.04 days . in udvarhelyi et al s study , mean hospitalization period was reported as 3.01 days , which is in agreement with the present study.5 one of the reasons that bor was the lowest at modarres hospital is that the hospital is a specialty hospital for patients with cardiac disorders . mean treatment expenses of the patients studied was us$205 , whereas in udvarhelyi et al s study , hospitalization expenses were reported as us$2375.5 in the sirois and pimental study , the mean triage expenses of patients in emergency departments was us$189.6 the high cost of unnecessary hospitalization of low - risk patients and increased cost to insurance systems can be reduced by the prevention of hospitalization of such patients . in the current study , at 1-month follow - up no deaths occurred . similarly , in solinas et al s study , at 1-month follow - up after discharge from emergency unit , acs was seen in 5.2% ( three acute myocardial infarction cases ) but no deaths were reported.8 in the present study , the fact that there was no cardiovascular complications in 89.5% of patients at 1-month follow - up shows that the studied patients were not high risk and were not indicated for admission to ccus . additionally , they did not have any special guidelines for triage of patients with chest pain . as a result of this ineffective approach , a considerable number of low - risk patients were admitted to the limited ccu facilities , which should be reserved for the treatment of high - risk patients . since special care is expensive and requires expert personnel , patients should be categorized according to their treatment needs and those in critical condition should be prioritized for admission to ccus .

backgroundmost patients who present to medical centers due to chest pain do not suffer from acute coronary syndromes and do not need to be hospitalized in coronary care units ( ccus ) . this study was done to determine exploitation of resources and cardiovascular outcomes in low - risk patients with chest pain hospitalized in ccus of educational hospitals affiliated with a major medical university.methodsover a 4-month period , 550 patients with chest pain who were hospitalized in the ccus belonging to six hospitals affiliated to the authors medical university were recruited by census method . using thrombolysis in myocardial infarction risk score , 95 patients ( 17.27% ) were categorized as low - risk patients . this group was evaluated with respect to demographics , bed occupancy rate , mean hospitalization period , expenses during admission , and cardiovascular outcomes in the 30-day period postdischarge.resultsmean ( standard deviation ) hospitalization duration was 3.04 ( 0.71 ) days . no significant difference was seen between the six surveyed hospitals regarding hospitalization duration ( p = 0.602 ) . the highest bed occupancy rate was seen in taleghani and shohada tajrish hospitals and the lowest was in modarres hospital . the mean paid treatment expenses by low - risk patients was irr 2,050,000 ( us$205 ) . mean total hospitalization expenses was us$205 . no significant difference was seen between the six surveyed hospitals ( p = 0.699 ) . of the patients studied , 89.5% did not show any cardiovascular complications in 1 month and no deaths occurred.conclusiongiven the high bed - occupancy rate by low - risk patients , associated high hospitalization costs , and the lack of cardiovascular complications in patients observed at 1-month follow - up after discharge , it is recommended that appropriate evaluations be performed in emergency units to prevent unnecessary admissions .

a 23 year - old female patient , 160 cm tall and 48 kg , was diagnosed with acute appendicitis and admitted for a laparoscopic appendectomy . she had no abnormalities in her pediatric medical history , but from the age 18 , she had slowly begun experiencing headaches in her left temporal lobe , nausea , and vomiting . in june of that year , she experienced generalized convulsions and aphasia . in a brain mri and mra , an infarction in the posterior divisions of the left mesencephalic arteries also , in a blood test , an increase in lactic acid was discovered ( 7.54 mm / l [ normal level : 0.5 - 2.254 mm / l ] ) . she was diagnosed with melas after testing ( adenosine - to - guanine transition at t - rna nucleotide 3243 in pcr sequencing ) . the patient had to orally ingest 200 mg of carbamazepine and 100 mg of aspirin per day and subcutaneously inject 30 units of insulin in the morning and 20 units in the evening . she had no history of total anesthesia . in a physical examination before the anesthesia , the patient was able to read but had auditory aphasia such that she could not understand spoken words . in the physical examination , there were no signs of hypotonia or amyotrophy of the limbs . the laboratory results showed hyponatremia ( 126 meq / l ) , hyperglycemia ( 257 mg / dl ) , and light metabolic acidosis ( ph 7.346 , paco2 36.3 mmhg , hco3 20.1 mm / l , be -5.3 one year prior to her admission to the hospital , she had an ecg that revealed a cardiac index of 67% and no abnormal findings . for sugar control , 4 units of shortacting insulin were injected , and 0.9% normal saline was administered to control hyponatremia . after the patient was taken to the operating room , we attached ecg standard leads ii , noninvasive monitors for blood pressure , heart rate , arterial oxygen saturation , capnogram , and bispectral index ( bis ) , and a nerve stimulator to the patient using the multi channel anesthesia monitor s/5 ( datex - ohmeda , usa ) . preliminary vital signs were as follows : blood pressure 115/65 mmhg , heart rate 100 beats / min , oxygen saturation rate 97% , and the ecg results appeared normal . afterwards , we administered lidocaine ( 40 mg ) with the master tci ( fresenius vial s.a . , france ) ; we then injected 2% propofol ( fresofol , fresenius kabi , austria ) and remifentanil ( ultiva , glaxosmithkline , uk ) at target concentrations of 4 g / ml ( marsh - model ) and 5 ng / ml ( minto - model ) , respectively . after roughly 90 seconds had passed , we checked lid reflexes and found that the patient had lost consciousness . we administered atracurium ( 0.5 mg / kg ) , the bis was 50 , and we saw that there was no response to tof stimulation with the nerve stimulator placed on the ulnar nerve . we started mechanical respiration with air ( 1.5 l / min ) , oxygen ( 1.5 l / min ) , respiratory volume of 450 ml , and respiratory rate of 12 breaths per minute . we started invasive blood pressure monitoring through the radial artery and measured the esophageal temperature with a body temperature monitor . during the operation , we used a forced - air warming blanket ( bair hugger , austine medical , usa ) to stabilize the patient 's body temperature . for fluid maintenance , we administered 0.9% normal saline at 200 ml per hour . during the operation , the patient 's vitals were kept stable with blood pressure at 120 - 140/60 - 80 mmhg , heart rate 80 - 100 beats / min , oxygen saturation 100% , body temperature 37.0 - 37.4 , and bis 40 - 60 . thirty minutes after inducing anesthesia , the arterial blood gas study showed ph 7.44 , paco2 32 mmhg , pao2 299 mmhg , hco3 23.3 mm / l , be -2.1 mm / l ; her electrolytes were na 125 meq / l , k 3.8 meq / l , cl 88 twenty minutes prior to the end of the operation , we administered ondansetron ( 4 mg ) to prevent post - operative nausea and vomiting . after suturing the peritoneum , we stopped injecting remifentanil , kept the level of propofol in the target effect site at 2 g / ml , and restored spontaneous breathing . after the operation was over , we stopped injecting propofol and stabilized spontaneous breathing at 300 ml per breath on the spirometer . on the nerve stimulator , afterwards , the patient responded to voice commands and opened her eyes . with stabilized spontaneous breathing , the operation lasted around 1 hour , and during the operation , 350 ml of 0.9% normal saline were used . we then moved the patient to the recovery room and kept her under observation with blood pressure , electrogram , and oxygen saturation monitors . in the recovery room , we gave her oxygen at 5 l / min through the facial mask . the arterial blood gas study showed ph 7.32 , paco2 43 mmhg , pao2 219 mmhg , hco3 21.2 mm / l , and be -3.6 mm / l ; her electrolyte levels were na 128 meq / l , k 4.1 meq / l , and cl 90 meq / l ; and her blood sugar level was 120 mg / dl . we then moved the patient to the ward where we performed a lactic acid test , which measured 3.6 mm / l . three days after the operation , the patient showed no complications from the operation or anesthesia , so she was released from the hospital . clinical manifestations have been found in tissues with high levels of energy consumption , such as brain and muscles . kearns - sayre syndrome , melas syndrome , mitochondrial myopathy , dad ( diabetes mellitus and deafness ) , lhon ( leber 's hereditary optic neuropathy ) , leigh syndrome , narp ( neuropathy , ataxia , retinitis pigmentosa , and ptosis ) , merrf ( myoclonic epilepsy with ragged red fibers ) syndrome , and mngie ( myoneurogenic gastrointestinal encephalopathy ) are all categorized as mitochondrial diseases . it is characterized by dementia and seizures caused by encephalopathy , lactic acidosis , ragged - red fibers , and strokelike episodes that usually occur before the age of 40 . there is also a build - up of lactic acid in plasma and cerebrospinal fluid . this mitochondrial disease is inherited from the female parent and is caused by an a - to - g transition mutation at position 3243 of the mitochondrial genome . there is currently no curative treatment for the disease , but there have been various attempts of symptomatic treatment . because melas syndrome causes systemic diseases that affect many organs , including the brain , a patient who needs to undergo general anesthesia will require careful anesthetic monitoring , especially of body temperature . reported a patient with mitochondrial myopathy accompanied by myoadenylate deaminase deficiency who was highly sensitive to his malignant hyperthermia . . reported that there was no significant change in the patient 's body temperature when using sevoflurane and isoflurane for general anesthesia . there are controversies about the relationship between melas syndrome and malignant hyperthermia , but because melas syndrome is a mitochondrial disease , we must beware of malignant hyperthermia . also during an operation , we must be careful of hypothermia because it can further inhibit mitochondrial functions . in our case , we performed total intravenous anesthesia using propofol and remifentanil to prevent malignant hyperthermia ; to prevent hypothermia , we continuously monitored body temperature via thermometer placed in the esophagus and used a forced - air warming blanket . when performing total intravenous anesthesia , propofol must be used with care . propofol can cause mitochrondial dysfunction , which is thought to be caused by the propofol infusion syndrome from extended use of propofol . the present case was a short , 1-hour operation , so we did not experience any complications such as propofol - induced changes in heart functions or worsening of acidemia midoperation . . reported on mitochondrial myopathy patients who suffered prolonged effects from rocuronium and vecuronium . tempelhoff et al . also reported patients resistant to non - depolarizing muscle relaxants like the patient in our case ; they stated that patients on anticonvulsants like carbamazepine and phenytoin experienced resistance . because many melas patients also contract kidney disorders , for example , de toni- debre - fanconi syndrome , nephritic range proteinuria , and fsgs , causing a disorder in the excretion of drugs or extending the effects of the medicine , one should refrain from the usage of nephrotoxic drugs and drugs excreted by the kidneys . thus , for our patient , we used atracurium , which is not excreted by the kidneys . we continuously checked the level of muscle relaxation and found neither prolonged effects nor resistance to the muscle relaxant . melas patients need to be carefully monitored for acidemia and electrolyte imbalance and require fluid therapy accordingly . most patients have lactic acidosis and metabolic acidosis . administering a fluid containing lactic acid , such as ringer 's lactate solution , will worsen lactic acidosis , which will also cause metabolic acidosis . because our patient had hyponatremia and lactic acidosis the patient 's hyponatremia was not corrected after the operation , but because she did not appear to have hyponatremia - caused reduced level of consciousness after regaining consciousness , it was not addressed . problems in the cardiovascular system including cardiomyopathy , wpw syndrome , and conduction disturbances are prevalent in melas patients . therefore , having an ecg prior to an operation is absolutely necessary , echocardiography tests should be taken if possible , and continuous ecg monitoring and blood pressure monitoring are necessary during the operation and immediately thereafter . moreover , the usage of drugs that cause changes in the cardiovascular system should be avoided or used carefully in small amounts during the operation . when the patient has to fast for the surgery , the tissue cells can not get enough energy for fast metabolism , and build - up of metabolites such as lactic acid worsens the lactic acidosis . therefore , before and after surgery , the patient 's blood sugar level must be carefully controlled with particular caution so that the patient does not experience hypoglycemia during anesthesia . in the present case , we administered short - acting insulin to the patient for hyperglycemia . also , before , during , and after anesthesia in the recovery room , we regularly monitored her blood sugar level , but the patient did not have significant hypoglycemia or hyperglycemia . in conclusion , because melas syndrome affects all organs , particularly in the excretory system , cardiovascular system , and respiratory system , general anesthesia for melas patients requires special attention to the choices of the anesthetic method , drugs , and fluid . therefore , in pre - anesthetic evaluations , one must take all symptoms of the body into consideration and carefully monitor the patient for various complications , such as malignant hyperthermia , hypothermia , prolongation of muscle relaxant effects , and instability in the cardiovascular system , during the operation .

a 23-year - old woman with melas ( mitochondrial myopathy , encephalopathy , lactic acidosis , and stroke - like episodes ) underwent a laparoscopy - assisted appendectomy . melas syndrome is a multisystemic disease caused by mitochondrial dysfunction . general anesthesia has several potential hazards to patients with melas syndrome , such as malignant hyperthermia , hypothermia , and metabolic acidosis . in this case , anesthesia was performed with propofol , remifentanil tci , and atracurium without any surgical or anesthetic complications . we discuss the anesthetic effects of melas syndrome .

a 60-year - old female with a history of recurrent cystitis and painless gross hematuria for 3 years was referred to our institution complaining of intermittent urinary retention . the patient had undergone a radical hysterectomy with bilateral salpingo - oophorectomy due to squamous cell type cervical cancer 20 years ago . 1 ) . we found no definite mass lesion during urethrography ; however , a urethral narrowing was revealed . magnetic resonance imaging ( mri ) showed a urethral mass invading the base of the bladder and the anterior vaginal wall with no pelvic lymph node enlargement . the mass showed homogeneous , low signal intensity on t1-weighted images and inhomogeneous contrast enhancement after gadolinium administration . on t2-weighted images , the mass showed high signal intensity surrounded by a low signal intense rim ( fig . a fan - shaped four - port laparoscopic transperitoneal approach was performed ( one 10 mm port placed at 10 mm above the umbilicus [ camera ] , one 12 mm right pararectal trocar , one 12 mm trocar placed laterally in the right lower quadrant [ assistant port ] , and one 5 mm trocar placed between the left anterior iliac spine and the umbilicus ) . after ureteral dissection , we clamped the ureter close to the ureterovesical junction by using a hem - o - lok clip and performed a frozen biopsy . the results of the frozen biopsy were negative and right side pelvic lymph node dissection was performed . left side ureteral dissection and pelvic lymph node dissection were also performed as right side maneuvers . the peritoneum was incised at the vesicovaginal culde - sac and the lateral pedicles of the bladder were clamped by using hem - o - lok clips . the bladder and vagina were dissected around carefully with a finger inserted into the vagina because gas leakage was possible via the vaginal opening . we incised the peritoneum along the medial umbilical ligaments and dissected the anterior perivesical space . the urethral mass similar to a large prostate was revealed in front of the bladder and we incised the endopelvic fascia . as my assistant drew the bladder in the cephalic direction and compressed the vestibule to protect against air leakage , i performed a urethrectomy with anterior vaginal resection . a 20 cm ileal segment was chosen and an ileal conduit procedure was performed by using an open - assisted technique . the total operative time was 405 minutes , and the estimated intraoperative blood loss was 580 ml . in the pathologic gross examination , an exophytic friable mass measuring 5.65.3 cm was found at the urethra and bladder neck . clear cell adenocarcinoma was found at the urethra and bladder neck , and the tumor had invaded the periurethral connective tissues ( fig . 3 ) . however , all surgical margins and both pelvic lymph nodes were free of tumors . in the immunohistochemical study , the tumor cells showed positive immunoreactivity to ck7 and were negative to ck20 , cea , and cd10 . drop infusion pyelography performed at postoperative day 14 showed no leakage at the uretero - conduit anastomosis sites , and the patient was discharged without complications . after 3 and 6 months with no adjuvant treatment , computed tomography showed no local recurrence or distant metastasis . urethral carcinomas are uncommon , and make up less than 0.02% of all female carcinomas . although squamous cell carcinomas are usually identified in female urethral carcinomas , more than half of carcinomas in the urethral diverticulum are adenocarcinomas . carcinoma arising in the female urethral diverticulum was first reported by hamilton and leach in 1951 , and about 100 cases of female urethral carcinoma associated with urethral diverticulum have been reported . although the histogenesis of urethral adenocarcinoma is controversial , it occurs in the urethral diverticulum and may arise in the paraurethral ducts and skene glands . patients usually complain of difficulty in voiding and hematuria , and the most common sign is a palpable suburethral mass . the patient in this case had a history of recurrent urinary tract infections and symptoms of difficulty in voiding . in magnetic resonance imaging , the normal urethra has a target - like appearance , reflecting 3 histologically distinct layers : an inner lower - intensity layer consisting of urethral mucosa and glands , a middle high - intensity submucosal layer , and an outer low - intensity muscle layer consisting of inner longitudinal muscles and outer striated muscles . tumors arising from the urethral diverticulum or paraurethral glands may dissect the urethral muscle layer . in this case , the tumor also showed high signal intensity on t2-weighted images and was surrounded by a low - signal - intense ring at the periphery . park et al reported on the expression of cdx-2 in 60.9% of stomach adenocarcinoma patients and suggested the value of determination of tissue - specific immunohistochemical stains in diagnostic differentiation of adenocarcinomas . park et al reported that the positive predictive value of cdx-2 ( + ) , ck7 ( + ) , ttf-1 ( - ) , and ck20 ( - ) in adenocarcinoma was 85.7% . the tumor cells in the present case stained ck7 ( + ) , ck20 ( - ) , and cd10 ( - ) . treatment preference in the past has included a range of local excisions to more aggressive treatment composed of anterior exenteration , chemotherapy , or radiation . local excision more frequently resulted in local recurrence or distant metastasis than did aggressive treatment . in 73% of patients treated with local excision only , treatment failed , with either local recurrence or distant metastasis . when only radiation treatment was administered , disease - free survival was about 33% . anterior exenteration with urinary diversion showed more promising results , with 87% of patients being disease - free at 6 months to 2 years . laparoscopic radical cystectomy has recently become the accepted gold standard treatment modality for patients with muscle - invasive bladder cancer . with the development of laparoscopic equipment , laparoscopic radical cystectomy with urinary diversion has become feasible and provides many intraoperative and postoperative advantages over the traditional open approach . a review of the literature found only one reported case of the laparoscopic approach in patients with a urethral tumor . however , laparoscopic surgery in this setting of adenocarcinoma arising from the urethral diverticulum has not previously been reported in the english literature . although the oncologic outcome of the laparoscopic approach is still being evaluated , many reports have shown that oncologic safety and functional outcome of laparoscopic cystectomy are similar to those of the traditional open approach . castillo et al first reported on laparoscopic radical surgery in male patients with urethral cancer . he performed a laparoscopic radical cystoprostatectomy and en bloc urethrectomy by additional perineal incision , and this maneuver was a feasible method for the treatment of urethral cancer in men . however , in the current case , the female urethral cancer did not require an additional incision . laparoscopic cystourethrectomy with resection of the anterior vagina in women does not require additional incisions and is a feasible treatment modality for urethral cancer in female patients .

adenocarcinomas arising in the female urethra have been rarely reported . here we report a case of laparoscopic radical cystourethrectomy with incontinent urinary diversion in a patient with adenocarcinoma in the urethra and bladder . a 60-year - old female presenting with a history of recurrent cystitis and painless hematuria was referred to our facility with voiding difficulty and a urethral mass . radiologic evaluation showed an enhanced mass in the urethra and bladder neck . cystoscopic biopsy of the mass in the bladder neck revealed an adenocarcinoma . laparoscopic radical cystourethrectomy with anterior vaginal wall excision followed by extracorporeal incontinent urinary diversion was performed .

cholangiocarcinoma is an invasive malignancy with poor prognosis that presents as cholestasis with or without apparent mass in imaging . this malignancy originates from interahepatic or exterahepatic biliary ducts and can present as obstructive gross dilatation of the intra or extrahepatic bile ducts . extrahepatic cholangiocarcinoma is the most common form of this malignancy ( 1 , 2 ) . intrahepatic cholangiocarcinoma represents approximately 10% to 20% of all primary liver cancers and 20% to 25% of cholangiocarcinomas ( 3 ) . the highest prevalence rates are found in parts of asia , most notably certain regions of thailand , hong kong , china , japan , and korea . chronic infestation of the biliary tree with one of the liver flukes is thought to be the cause of these high rates ( 4 ) . early diagnosis of intrahepatic cholangiocarcinoma is unusual , and the annual mortality rate is almost identical to the annual incidence of the tumor ( 5 , 6 ) . caroli 's disease is a rare disorder characterized by congenital non - obstructive gross dilatation of the segmental intrahepatic bile ducts ( 2 , 5 , 6 ) . the disease has been included in the classification of choledochal cysts ( as type v ) ( 2 , 5 , 6 ) . this bile duct ectasia that may be diffuse or limited usually becomes symptomatic in early adulthood ; more than 80% of patients present with symptoms before the age of 30 years . as in our case that is presented below , differentiation between cholangiocarcinoma and limited caroli 's disease that present as cholangitis and cystic dilation of biliary ducts is somewhat difficult . a 56 year - old male patient admitted to hospital due to intermittent epigastric and right upper quadrant ( ruq ) pain associated with fever , chilling , jaundice , and 10 kilogram weight loss for 5 months . on examination he was icteric , blood pressure was 140/80 mm hg , pulse rate was 96 per minute and temperature was 39 centigrade . patient 's laboratory findings trans - abdominal ultrasounogram , computerized tomography ( ct ) scan and magnetic resonance cholangio - pancreaticography ( mrcp ) revealed several various size turtose and tubular shape cystic structures without apparent mass lesion limited to left lobe of the liver ( figure 1 ) . common bile duct ( cbd ) , port vein and intra - hepatic bile ducts of right lobe were normal . thorax and other abdominal organs including the gallbladder , spleen , pancreas , kidneys and pelvic organs were normal . regarding the clinical history ( intermittent periods of fever , abdominal pain and jaundice ) and paraclinic findings , diagnosis of cholangitis non - homogenous mixed hypodensity associated with cystic lesions and bile stasis limited to the left lobe of the liver in mrcp ( left lower image ) and ct scan ercp was performed for further evaluation of this febrile cholestatic disease ; ampulla of vater appeared normal in duodenoscopy . cbd , right hepatic bile duct , left hepatic bile duct and intra - hepatic billiary ducts of the right lobe were normal in cholangiogram . but mentioned cystic lesion of biliary ducts in the left lobe that appeared in mrcp , were n't visible in ercp ; there was n't any communication between mentioned cystic lesion and left hepatic bile duct . however minimal sphinctrotomy was done but there was n't any pus or stone in cbd . fever , jaundice and abdominal pain intensified at the next 3 days after ercp . at this time imipenem was prescribed . after one week , abdominal pain was decreased markedly , serum level of bilirubin was decreased to 7 mg / dl and fever discontinued . at this time a percutaneous ct guided core biopsy was done and revealed hepatic fibrosis with bile duct ectasia consistent with caroli 's disease . a large mass revealed in left lobe of the liver at laparotomy that surgeon had taken a wedge biopsy from it only . histopathologic assessment of this surgical biopsy confirmed cholangiocarcinoma . due to vascular invasion , tumor was unresectable and the patient scheduled for palliative chemotherapy . preoperative diagnosis in our case was caroli disease but because of recent significant weight loss , high level of serumca19 - 9 and particularly no communication between left hepatic bile duct and intra - hepatic cystic structures in ercp ( obstructive bile duct dilation ) , caroli disease was n't an appropriate diagnosis for our patient . clinical manifestation and imaging findings of cholangiocarcinoma and caroli 's disease may be similar somewhat . communication between intra - hepatic cystic lesions and right or left hepatic duct in endoscopic retrograde cholangiopancreaticography ( ercp ) in patient with cholestasis and intrahepatic cystic lesions is a key point for the differentiation of caroli disease that is a non - obstructive biliary disease from cholangiocarcinoma that is an obstructive lesion ; visualization of cystic like dilated intra - hepatic bile ducts in ercp indicates the presence of free communication between ecstatic bile ducts and right or left hepatic duct ; this is consistent with localized caroli disease rather than cholangiocarcinoma . due to special laminar growth of cholangiocarcinoma into adjacent tissues , this tumor may be not visualized in cross sectional imaging such as ct scan . so this malignancy can present as a multi - cystic lesion ( due to bile duct obstruction ) without apparent mass in imaging . surgical resection is the only curative treatment in cholangiocarcinoma but because of delay in diagnosing , most cases are unresectable . patients with caroli 's disease typically present with recurrent episodes of fever and abdominal pain caused by cholangitis . the result of these complications may be cholangiocarcinoma , which develop in less than 10% of patients . endoscopic retrograde cannulation of the biliary system may be used to facilitate removal of sludge or stones from the accessible part of the biliary system , and the cysts may be drained by an endoscopic or percutaneous route . liver resection for unilobar caroli 's disease and liver transplantation for diffuse caroli 's disease are associated with excellent long - term patient survival and a low rate of complications .

early diagnosis and appropriate treatment of cholangiocarcinoma is problematic . cross sectional imaging and tumor marker ca 19 - 9 are not absolutely reliable and tissue sampling is difficult . we present a patient with cholangitis and cystic dilation of intra - hepatic bile ducts that primarily diagnosed as caroli 's disease in imaging and needle biopsy but laparotomy and surgical biopsy revealed cholangiocarcinoma .

since laser - assisted subepithelial keratectomy ( lasek ) was introduced to refractive surgery in recent decade , many clinical controlled trials have been reported [ 112 ] . although laser in situ keratomileusis ( lasik ) is dominantly used in refractive surgery due to little pain and rapid visual rehabilitation , surface ablation including lasek is also a valuable technique for high myopia , thinner cornea , or retinal pathology [ 13 , 14 ] . some studies reported that lasik seemed to have significant benefit over lasek . therefore , it is necessary to review in greater depth the available studies to understand the benefits of lasek versus lasik in myopic patients . due to a scarcity of randomized control trials ( rcts ) addressing this issue we decided to include nonrandomized comparative studies . we performed a meta - analysis of existing rcts and comparative studies of lasek versus lasik for the treatment of myopia in an attempt to detect any differences in safety and efficacy as the primary concern between the two techniques . two reviewers independently searched the following electronic databases : pubmed , embase , and the cochrane controlled trials register up to july 6 , 2012 . to achieve the maximum sensitivity of the search strategy and identify all trials comparing lasek and lasik , we used appropriate free text and thesaurus terms including laser - assisted subepithelial keratectomy or laser subepithelial keratomileusis or after the relevant titles were identified , the abstracts and full text of these studies were reviewed to decide whether they met criteria for our study . a manual cross - reference search of the bibliographies of relevant articles was conducted to identify studies not found through the computerized search . the search included all controlled clinical trials and comparative studies comparing lasek and lasik for myopia . patients were presented with any degree of myopia and astigmatism and were aged greater than 18 years . at least one or more clinical outcome parameters representing visual acuity , spherical equivalent , corneal haze , or flap complications must be assessed and published . in the selected studies , the study quality assessment was based on the methods recommended in the cochrane handbook for systematic reviews of interventions . areas of methodological quality examined were randomization , allocation concealment , masking of outcome assessment , and completeness of follow - up . according to potential bias from included studies , we selected the following : one patient treated with two surgeries ( ? ) , similar preoperative manifest refraction spherical equivalent ( mrse ) ( ? ) , similar best - corrected visual acuity ( bcva ) ( ? ) , similar pachymetry ( ? ) , one surgeon ( ? ) , one machine ( ? ) , and timing of the outcome assessment in two similar groups ( ? ) as quality assessment index . based on the cochrane collaboration guidelines and these added assessments , the selected studies were appraised by two reviewers independently . the primary outcome parameters for inclusion were safety and efficacy on the basis of the previous study . efficacy measures examined were proportions of patients achieving uncorrected visual acuity ( ucva ) 20/20 and mrse within 0.50 diopters ( d ) of the target . safety measures examined were proportions of patients losing 1 line of bcva and final mean mrse . the proportion of flap - related complications and corneal haze ( higher than grade 1 ) were assessed as the secondary outcome parameters . a customized data extraction form , as described in the cochrane handbook for systematic reviews of interventions , was used to record the authors of each study , the year of the trial , duration of the study , the number of subjects , demographics information of each study subject , and the laser machine type used in the procedures . , the included studies were divided into two groups : low to moderate myopia group ( less than 4.50 d ) and moderate to high myopia group ( higher than 4.50 d ) . quantitative data for the minimal outcome criteria were entered into the software cochrane review manager ( revman ) version 5.0 and analyzed . summary estimates , including 95% confidence intervals ( ci ) , were calculated . for continuous outcome data ( e.g. , mean mrse ) means and standard deviations were used to calculate a weighted mean difference ( wmd ) . for dichotomous outcomes ( e.g. , proportions of ucva 20/20 ) , the odds ratio ( or ) was calculated . fixed effects model was used unless significant evidence of statistical heterogeneity or clinical diversity was found . however , for results showing significant heterogeneity ( i > 50% ) , random - effects meta - analysis was performed . outcome measures were assessed on an intent - to - treat ( itt ) basis . twelve studies published between 2002 and 2008 met the inclusion criteria [ 112 ] . in the end , 1 study in rct and 11 nonrandomized comparative studies [ 1 , 312 ] were included in the present meta - analysis involving a total of 1011 patients who underwent lasek or lasik . we identified several potential sources of bias in the included studies ( table 2 ) . six months postoperatively , there were no statistically significant differences in mean mrse , the proportion of the refractive se within 0.50 d , and the proportion of loss of 1 line of bcva between the lasek and lasik groups ( p = 0.35 , p = 0.10 , and p = 0.33 , resp . ) the severity of corneal haze was also not significantly different between the two groups ( table 3 ) . twelve months postoperatively , there were no statistically significant differences in mean mrse , the proportion of the refractive se within 0.50 d , ucva 20/20 , and loss of 1 line of bcva between the lasek and lasik groups ( p = 0.16 , p = 0.69 , p = 0.39 , and p = 1.00 , resp . ) ( figure 1(b ) and table 3 ) . six months postoperatively , there were no statistically significant differences in mean mrse , the proportion of the refractive se within 0.50 d , and the proportion of ucva 20/20 between the lasek and lasik groups ( p = 0.16 , p = 0.85 , and p = 0.19 , resp . ) the proportion of participants with loss of 1 line of bcva in the lasek group was significantly higher than that in the lasik group ( p = 0.0004 ) ( table 3 ) . corneal haze was more severe in the eyes treated with lasek than those treated with lasik ( p < 0.00001 ) ( table 3 ) . twelve months postoperatively , there were no statistically significant differences in the proportion of the refractive se within 0.50 d between the two groups ( p = 0.85 ) ( table 3 ) . there was an increasing trend of statistically significant difference in mean mrse for the lasek - treated eyes ( p = 0.05 ) ( figure 1(d ) ) . the proportion of ucva 20/20 was significantly less ( p = 0.02 ) , and the proportion of loss of 1 line of bcva was significantly more ( p < 0.00001 ) in the lasek - treated eyes than the lasik - treated eyes ( table 3 ) . corneal haze was more severe in the eyes treated with lasek than those eyes treated with lasik ( p < 0.00001 ) ( table 3 ) . two studies indicated that no intraoperative or postoperative flap complications occurred in the lasik - treated eyes [ 1 , 8 ] . the remaining study reported that corneal flap displacements were found on postoperative day 1 in 4 lasik - treated eyes . analysis of these data showed no significant difference in the incidence rate of flap - related complications between two groups ( p = 0.34 ) ( table 2 ) . based on a visual analysis of the funnel plots , no obvious evidence of publication bias was founded ( figure 2 ) . with the evidence available from the selected clinical controlled trials , we found that there were no significant differences in visual and refractive outcomes between the lasek and lasik for low to moderate myopia in the midterm and long - term follow - up . however , the safety profile ( loss of 1 line of bcva ) of the lasek - treated eyes in moderate to high myopia was significantly worse than that of the lasik - treated eyes in the midterm and long - term follow - up . the efficacy ( mrse and ucva ) of lasek for moderate to high myopia appeared to be a significantly worsening trend than those of lasik in the long - term follow - up . there was no significant corneal haze ( higher than grade 1 ) in lasek - treated eyes at 3 and 6 months postoperatively due to low to moderate myopia [ 1 , 2 , 8 , 9 ] . however , corneal haze occurred more frequently ( 25.3% ) at 6 and 12 months postoperatively in kim et al . 's study due to high myopia , conforming to the results of a previous study by lin et al . . the increased usage of surface ablation techniques for high myopia is ascribed to cause the higher incidence of clinically significant haze and regression in lasek . the visual and refractive results ( ucva , bcva , and mrse ) at 6 or 12 months postoperatively indicated no statistically significant differences between the two groups in subjects with low to moderate myopia [ 2 , 5 ] . additionally , the normal visual function , such as reading performance after refractive surgery , was not significantly changed in the two groups . even in de benito - llopis et al . 's study , the snellen bcva levels and safety index ( postoperative bcva / preoperative bcva ) were significantly higher in the lasek group than those in the lasik group . in other more sensitive parameters , such as contrast sensitivity ( cs ) and higher - order aberrations ( hoas ) , kim 's study and tietjen et al . 's study all demonstrated that cs values of the lasek group were higher than those in the lasik group at 6 and 12 months postoperatively [ 7 , 9 ] . in kirwan and o'keefe 's study , a greater increase in hoas these differences in objective parameters may support the belief that better visual quality can be achieved by lasek in low to moderate myopia . some authors thought that flap and microkeratome complications or interface problems ( cutting of the lasik flap and subsequent repositioning onto the stromal bed ) seemed to be the main factors responsible for the postoperative increasing in hoas reported in kirwan and o'keefe 's study . other authors believed that the reduction of cs was caused by stromal wound healing - related factors after creation of the flap , not by the deeper ablation depth [ 2 , 7 ] . spherical - like aberrations were significantly greater after lasek than those after lasik at postoperative 3 months in buzzonetti et al . authors thought that the difference may be due to the central subepithelial fibroblast hyperplasia ( we thought it was corneal haze ) observed after lasek . compared to kirwan and o'keefe 's study , we thought that the duration of follow - ups was short and the degree of myopia was higher in buzzonetti et al . the differences of visual results conformed to the different incidence of corneal haze between the two different degrees of myopia in the present meta - analysis . three studies reported flap - related complications [ 1 , 8 , 12 ] . the incidence rate of flap - related complications of lasik was not significantly higher than that of lasek in the present meta - analysis . however , reduced bcva in lasik - treated eyes is known to be associated with flap - related complications including an inconspicuous shifted flap , striae , and interface debris . refractive surgeons need to be aware of the potential risk of postoperative flap - related complications such as diffuse lamellar keratitis , epithelial ingrowth , flap infection , or flap traumatic avulsion . and we must take caution to identify these complications in the early and late postoperative periods and provide effective management . to summarize , the present meta - analysis study of lasek versus lasik seemed to suggest that both procedures were safe , effective , stable , and predictable for the treatment of low to moderate myopia . advantages of lasek may include the absence of stromal wound healing - related factors or flap - related complications that can occur in lasik , which may decrease in bcva and contrast sensitivity or increase higher - order aberrations . however , the increased incidence of stromal haze and regression in lasek significantly affected the visual and refractive results in high myopia . recently , studies showed that the intraoperative mmc in lasek or prk could reduce corneal haze and regression and result in similar visual and refractive outcomes compared to lasik for moderate to high myopia [ 19 , 20 ] . further evidence - based study will be needed to clarify the advantages of lasek / prk with intraoperative mmc compared to lasik first , in our selected 12 studies , 1 study is rct and the remaining 11 studies are retrospective comparative studies or prospective nonrandomized controlled trials . theoretically , the principle of meta - analysis is to collect data from prospective randomized controlled trials and perform valid comparison [ 21 , 22 ] . the low number of rcts reported in the literature may be ascribed to the different procedural criteria applied in clinical practice for lasek and lasik due to severity of myopia and/or thin cornea . it is impossible to perform randomization , allocation concealed , or double - blinded during comparative study due to the surgical difference . in all of the selected studies , second , there were many potential biases between the groups in each study according to table 3 . there were differences in preoperative patient characteristics such as mrse , bcva , and pachymetry [ 3 , 5 , 9 , 11 ] . it is recognized that surgical nomograms , laser systems , surgical experiences , and intra- and postoperative procedures affect the clinical outcomes . surgeon , machine , and timing of the outcome assessment in the groups ( follow - up intervals ) had obvious differences in the selected studies . access to individual level data could certainly have improved the quality of adjustment as well as the precision of estimates . we roughly calculated 80% confidence intervals of diopters according to mean preoperative mrse and standard deviations . there were overlapping parts between the low to moderate myopia group and the moderate to high myopia group . in addition , we did not attempt to gain access to unpublished results , and only studies written in english were selected .

this systematic review was to compare the clinical outcomes between laser - assisted subepithelial keratectomy ( lasek ) and laser in situ keratomileusis ( lasik ) for myopia . primary parameters included mean manifest refraction spherical equivalent ( mrse ) , mrse within 0.50 diopters , uncorrected visual acuity ( ucva ) 20/20 , and loss of 1 line of best - corrected visual acuity ( bcva ) . secondary parameters included flap complications and corneal haze . twelve clinical controlled trials were identified and used for comparing lasek ( 780 eyes ) to lasik ( 915 eyes ) . there were no significant differences in visual and refractive outcomes between the two surgeries for low to moderate myopia . the incidence of loss of 1 line of bcva was significantly higher in moderate to high myopia treated by lasek than lasik in the mid - term and long - term followup . the efficacy ( mrse and ucva ) of lasek appeared to be a significant worsening trend in the long - term followup . corneal haze was more severe in moderate to high myopia treated by lasek than lasik in the mid - term and long - term followup . the flap - related complications still occurred in lasik , but the incidence was not significantly higher than that in lasek . lasek and lasik were safe and effective for low to moderate myopia . the advantage of lasek was the absence of flap - related complications , and such procedure complication may occur in lasik and affect the visual results . the increased incidence of stromal haze and regression in lasek significantly affected the visual and refractive results for high myopia .

refractory benign esophageal stenosis makes it difficult to consume meals , which markedly reduces a patient s quality of life . however , dilation can cause esophageal perforation in some patients , and sufficient dilation can not be achieved for others with refractory stenosis , despite repeated ebds . moreover , patient management can be very difficult . in this study , to treat a patient with refractory corrosive esophageal stenosis safely and effectively , we used an endoscopic submucosal dissection ( esd ) device , the sb knife jr , combined with oral steroid therapy , which is reportedly useful for preventing restenosis after dilation for esophageal stenosis . esophageal stenosis developed in a 61-year - old female approximately 4 years after she had attempted suicide by taking a sulfate . although the patient had frequently undergone balloon dilation at another hospital , no improvements were observed in her condition . the patient was referred to the department of surgery in our hospital , and underwent further dilation . after the procedure , the esophagus was observed to be perforated , with hematoma formation being noted around the esophagus . when laparotomy was performed to remove the hematoma , the stenosis became exacerbated . after 3 months , she was referred and admitted to our department for further treatment . although she had been on a liquid diet for the previous 3 years , no abnormalities were found in her hematological data . her height , body weight , and body mass index ( bmi ) were 158.4 cm , 58.6 kg , and 23.4 , respectively . malnutrition was not noted . after she had been admitted , upper digestive tract endoscopy using a gif - xq260 endoscope ( olympus optical , tokyo , japan ) with an end diameter of 9.0 mm was performed to confirm the stenotic site . a pinhole - like stenosis was observed in an area 39 cm from the incisor , which made it impossible to pass the endoscope further into the tract ( fig . when dilating the stenosis with the dilation procedure ( cre balloon dilator ; boston scientific , boston , ma , usa ; 68 mm ) under fluoroscopy , the stenotic site was found to be relatively soft , indicative of a short - segment stenosis.fig . a pinhole - like circumferential membranous stenosis was observed in an area 39 cm from the incisor . b incision of the membranous region of the stenotic site by use of the sb knife jr . a gif - xp240 endoscope ( maximum diameter 7.7 mm ) was successfully passed through the opening . a gif - q260 endoscope ( maximum diameter 9.2 mm ) was successfully passed through the opening electrocautery therapy in this case a pinhole - like circumferential membranous stenosis was observed in an area 39 cm from the incisor . b incision of the membranous region of the stenotic site by use of the sb knife jr . a gif - xp240 endoscope ( maximum diameter 7.7 mm ) was successfully passed through the opening . a gif - q260 endoscope ( maximum diameter 9.2 mm ) was successfully passed through the opening subsequently , stenosis - reducing surgery was performed by use of a gif - xq260 endoscope . an esd device , the sb knife jr ( md-47703 ; sumitomo bakelite , tokyo , japan ) , was used to make an incision in the stenotic site . during this procedure , the membranous stenotic site was initially captured by use of the sb knife jr , with an incision being performed while drawing the tissue in endocut mode set at effect 3 ( output 80 w ) ( fig . dilation was performed by use of a cre balloon dilator ( boston scientific ; 810 mm ) , with inflation continuing until the diameter reached 10 mm ( fig . a second dilation was therefore performed , with the balloon being inflated to a diameter of 12 mm , which made it possible to pass a gif - q260 endoscope ( olympus optical ) with an end diameter of 9.2 mm through the tract ( fig . in accordance with the endoscopic findings , severe stenosis was observed in the lower thoracic esophagus . the major axis of the stenosis was less than 10 mm , and it was a short - segment stenosis.fig . as observed endoscopically , a tight stenosis was noted in the lower thoracic esophagus ( arrow ) . the major axis of the stenosis was less than 10 mm , and it was a short - segment stenosis fluoroscopy before electrocautery therapy in this case . as observed endoscopically , a tight stenosis was noted in the lower thoracic esophagus ( arrow ) . the major axis of the stenosis was less than 10 mm , and it was a short - segment stenosis the procedure used for stenosis - reducing surgery is illustrated schematically in fig . 3 ; after approaching the membranous stenosis , the sb knife jr was opened fully ( fig . 3schematic diagram of electrocautery therapy by use of the sb knife jr . on approaching the membranous stenosis , the sb knife jr was opened fully ( a ) , followed by tight capture and drawing in of the target tissue ( b ) . finally , the membranous site was rapidly incised ( c ) schematic diagram of electrocautery therapy by use of the sb knife jr . on approaching the membranous stenosis , the sb knife jr was opened fully ( a ) , followed by tight capture and drawing in of the target tissue ( b ) . finally , the membranous site was rapidly incised ( c ) dietary ingestion was started next day , in conjunction with oral administration of prednisolone at 20 mg / day for 2 weeks . subsequently , the dose was reduced by 5 mg / week over a total administration period of 5 weeks . after initiation of the prednisolone therapy , follow - up endoscopy was performed at one - week intervals . to prevent restenosis , further 12 mm diameter dilations were conducted by use of a cre balloon dilator 1 , 2 ( fig . 4a ) , 3 , and 4 weeks after prednisolone administration was started ( 4 times in total ) . the patient was discharged on the day after the second balloon dilation , and she underwent the 3rd and 4th balloon dilations and steroid dose reduction at the outpatient clinic . on completion of prednisolone therapy , it became possible to pass a gif - q260 endoscope through the tract without restrictions ( fig . dietary restrictions became unnecessary , and the patient s body weight has increased by 5 kg.fig . a endoscopy findings after oral administration of prednisolone ( 20 mg / day ) for 2 weeks . the mucosa at the stenotic site where the treatment was performed was completely covered by regenerated epithelium . a gif - q260 endoscope was successfully passed through the opening and no restenosis was observed clinical course after electrocautery therapy . a endoscopy findings after oral administration of prednisolone ( 20 mg / day ) for 2 weeks . the mucosa at the stenotic site where the treatment was performed was completely covered by regenerated epithelium . a gif - q260 endoscope was successfully passed through the opening and no restenosis was observed endoscopic dilation is usually the initial treatment for benign esophageal stenosis . however , because not all cases respond to this treatment , surgery may be required for some patients . recent studies have described the usefulness of self - expanding removable and biodegradable stents [ 2 , 3 ] . although these treatments have been performed successfully , limitations are associated with their use , for example migration and epithelial hyperplasia - related stenosis [ 4 , 5 ] . esd techniques with needles and it knives have been shown to be useful for relieving esophageal stenosis / anastomotic - site stenosis [ 68 ] . however , use of these devices may be limited , because of perforations . the it knife , also used by muto et al . in their report , is equipped with a ball chip made of an insulating material at the tip and is capable of safer incision of stenotic regions than needle knives . however , experience is needed to successfully attach the knife to the stenotic site to be incised and adjust the strength of outward tension . adjusting the size of the incision because of these problems , the incidence of perforations was 3.5 % in the report by muto et al . this study was therefore designed to investigate stenosis - reducing surgery with a scissor - type esd device , for safer and more accurate relief of a stenosis than with an it knife . use of the esd scissor - type knife , the sb knife jr , makes it possible to safely perform incisions while capturing and drawing the target tissue inward . because it was easy to capture and cut the tissue , we were able to use the device to successfully treat the stenosis of this particular patient . the additional benefits of using this knife include being able to capture the target tissue several times , and being able to precisely control the tissue volume to be incised by regulating the volume of tissue captured . this makes it possible to safely conduct balloon dilation without adding pressure to any single point . a disadvantage is that the indication is only short - segment stenosis . in this case , repeated endoscopic dilation over several years resulted in a perforation during the dilation procedure . however , favorable dilation was ultimately achieved by combined use of an electrocautery incision with the sb knife jr , and oral administration of a steroid , which helped prevent restenosis after the stenosis - reducing surgery . several previous studies have described the effectiveness of topically injected or orally administered steroids for prevention of restenosis after balloon dilation for esophageal stenosis or post - esd stenosis . , we performed a preliminary animal experiment in which a steroid was administered after circumferential esophageal esd . esophageal circumferential mucosal defects were created in four pigs by endoscopic mucosal dissection ( esd ) . one pig was sacrificed five minutes after esd , and another two pigs were followed - up by endoscopy and sacrificed 1 and 3 weeks after esd . the remaining pig was followed - up by endoscopy , received a local steroid injection five times , and was sacrificed 8 weeks after esd . consequently , the number of myofibroblasts appearing in the healing process was lower than that in the steroid - untreated group and their morphology and arrangement was different ( unpublished data ) . because myofibroblasts have been reported to have the ability to contract , we speculate that steroid treatment may prevent stenosis by changing the amount , morphology , and arrangement of myofibroblasts . , we encountered a case of refractory benign esophageal stenosis that required frequent dilation over a long period of time . our case demonstrated that dilation using our newly developed esd technique in conjunction with steroid therapy resulted in a favorable clinical course . the method reported herein may be suitable for treatment of short - segment stenosis , and may potentially be useful as an novel treatment for refractory benign esophageal stenosis , especially membranous stenosis . moreover , it may serve as a beneficial treatment for postoperative anastomotic - site stenosis and congenital membranous stenosis .

a 61-year - old female with refractory corrosive esophageal stenosis repeatedly underwent endoscopic balloon dilation at another hospital ; however , no improvements were observed in the esophageal stenosis . consequently , she had been on a liquid diet for the previous three years . she was admitted to our department for further treatment . a radial incision was made , by use of the sb knife jr , for a pinhole - like stenosis in a short segment 39 cm from the incisor , and dilation was safely performed by use of a cre balloon dilator . subsequently , prednisolone was orally administered to prevent re - stenosis . this was followed by a favorable clinical course .

mycosis fungoides ( mf ) and szary syndrome comprise approximately 53% of primary cutaneous lymphomas . typical histopathologic picture in mf is the presence of a dense infiltrate of atypical lymphocytes in the dermis with epidermotropism ( presence of atypical lymphocytes in epidermis ) . immunophenotyping shows expression of cd4 + antigen , though cd8 + and double negative cd4/cd8 variants have been described . hence , these cutaneous lymphomas mimic other skin conditions both clinically and histologically , posing a diagnostic challenge to the dermatologists and the pathologists . a 43-year - old man presented with large areas of atrophic , wrinkled and dyspigmented skin , mainly distributed over his buttocks and ventral aspect of both thighs extending up to the popliteal fossa . the lesions initially started as superficial pustules which subsequently broke down to form well - defined , extremely painful ulcers . initially , they were small in size , which gradually coalesced with each other to form large , bizarre - shaped ulcers . he was diagnosed as pyoderma gangrenosum clinically and started on a tapering dose of oral prednisolone along with regular local dressing ; which is continuing till date . at present , the patient approached us with the complaint of emergence of new lesions over his trunk , for the last 6 months . 17 cm 13 cm , mainly distributed over his buttocks [ figure 1 ] and ventral aspect of both thighs even extending up to the popliteal fossa . routine serum biochemistry was unremarkable ; except for the presence of reduced hemoglobin and elevated bilirubin levels . histopathological examination revealed stratified squamous epithelium with hyperkeratosis , acanthosis , and basal cell degeneration . the upper dermis was diffusely infiltrated by the monomorphic population of atypical , small to medium - sized lymphoid cells with cerebriform nuclei . immunohistochemistry showed cd8 + , cd3 + , cd2 + , tia1 + , cd20 , cd4 , cd5 , cd30 , cd56 , cd7 , tdt , granzyme b. the mib-1 labeling index was < 5% [ figure 3 ] . the aspirate and biopsy showed focal deposit of atypical lymphoid cells , suggestive of metastatic involvement of the bone marrow . the whole body positron emission tomography ( pet ) scan revealed active space occupying lesions ( sols ) in segment vi and vii of liver and focal involvement of the spleen [ figure 4 ] . at present , the patient is on follow - up and doing satisfactorily . clinical photograph revealing large atrophic scars with thinned and wrinkled skin , distributed over buttocks . speckled areas of hyperpigmentation and depigmentation are observed within the lesions stratified squamous epithelium showing diffuse dermal infiltration of atypical , small to medium - sized cells with obvious epidermotropism ( h and e , 100 ) inset shows lymphoid cells with cerebriform nuclei ( h and e , 400 ) immunohistochemistry showed cd8 + , cd3 + , cd2 + , cd20 , cd4 , cd5 , cd30 , cd7 , granzyme b ve ( dab chromogen , 40 ) whole body positron emission tomography - computed tomography findings suggestive of active metastatic space occupying lesion in liver with multiple simple cysts and focal involvement in spleen mf is the most common primary cutaneous t - cell lymphoma ( ctcl ) , occurring in old adults , with a 2:1 male predominance . the most common site of involvement is photoprotected regions such as the trunk and body folds . they mentioned unusual and newly described variants comprising of hyperpigmented , hypopigmented , urticarial , bullous , solely papular , pustular , and hyperkeratotic variants . , there is only a single report of cd8 + mf mimicking pyoderma gangrenosum in the english literature , to the best of our knowledge . one case was natural killer t - cell lymphoma and other mf in a case of ulcerative colitis . investigators have proposed several histologic criteria to distinguish mf from other inflammatory and neoplastic cutaneous conditions . parameters suggesting a diagnosis of mf included atypical intraepidermal lymphocytes surrounded by halos , pautrier 's microabscess , exocytosis , disproportionate epidermotropism , epidermal lymphocytes larger than dermal lymphocytes , hyperconvoluted intraepidermal lymphocytes , and lymphocytes aligned within the basal layer . characteristically , the lymphocytic infiltrate is helper t - cell phenotype of cd2 + , cd3 + , cd5 + , cd4 + , tcr+ , and cd8. rarely , it is suppressor / cytotoxic cd8 + . a feature which is helpful to differentiate between ctcls and benign reactive lymphoid hyperplasia of the skin is a loss of the t - lineage antigens cd2 , cd3 , cd5 , and cd7 that occurs in neoplastic t - cell lymphomas . studied 17 cases of cd8 + ctcl and found that nine cases showed the clinical and histological features of well - defined types of ctcl , included as separate entities in the eortc classification for primary cutaneous lymphomas . this group included two cases with mf - like lesions , two cases of pagetoid reticulosis , two cases of lymphomatoid papulosis , two cases of cd30 + primary cutaneous large t - cell lymphoma , and one case of panniculitis - like sub - ctcl . the other eight cases formed a homogeneous group showing a distinctive set of features , not consistent with that of other well - defined types of ctcl . the clinical characteristics of these included presentation with generalized patches , plaques , papulonodules , and tumors mimicking disseminated pagetoid reticulosis ; metastatic spread to unusual sites and an aggressive course . in our case , other ctcls were ruled out by a combination of clinical , histological and immunohistochemical findings . on histology , atypical convoluted cerebriform lymphoid cells in the dermis with epidermotropism were observed . the immunohistochemical findings were cd8 + , cd3 + , cd2 + , tia1 + , cd20 , cd4 , cd5 , cd30 , cd56 , cd7 , and tdt , granzyme b ve . the finding of loss of cd4 and cd5 antigens and positivity with cd8 antigen were consistent with the diagnosis of cd8 + mf . extracutaneous dissemination in mf is observed in < 10% of patients with patch or plaque disease and in 3040% of patients with tumors or generalized erythrodermatous involvement . the most commonly involved organs are lung , spleen , liver , and gastrointestinal tract . patients with the extracutaneous disease at presentation involving either lymph nodes or viscera have a median survival of < 1.5 years . in our case , the patient had a remitting course for almost 20 years , with recent extracutaneous spread to bone marrow , along with pet scan showing multiple liver deposits . this case is being reported to highlight one of the most atypical clinical presentations of cd8 + mf on rare occasions ; the first such report from india . thus , skin biopsy and immunohistochemistry are essential tools to arrive at the correct diagnosis in such cases .

mycosis fungoides ( mf ) , a primary cutaneous t - cell lymphoma , accounts for < 1% of non - hodgkin lymphomas . the diagnosis of classic mf is based on a constellation of typical clinical presentation , histopathology , immunohistochemistry , and t - cell monoclonality detected by molecular studies . rarely , atypical clinical presentation may occur . the typical immunohistochemical phenotype is , cd2 + ve , cd3 + ve , cd5 + ve , cd4 + ve , and cd8 ve . here , we report a rare case of cd8 + ve mf in a 43-year - male patient who was clinically diagnosed as pyoderma gangrenosum initially . the atypical presentation and rarity of such case have prompted this report .

laparoscopic surgery is currently one of the most common procedures performed for both diagnostic and therapeutic purposes . as laparoscopic instruments and technical skills have improved , the use of laparoscopy has expanded to different areas including gynecology , general surgery , and urology . it has replaced the open approach in several procedures because of better cosmetic results , a shorter recovery period , and high efficacy . although major complications are uncommon in laparoscopy , involving < 2% of cases , laparoscopy is not without risk . this is the most critical and dangerous phase , in which > 50% of major laparoscopic complications occur , with a mortality rate of 0.05% to 0.2% . access - related complications including retroperitoneal vascular injury , intestinal perforation , wound herniation , wound infection , abdominal wall hematoma , and trocar - site metastasis are of particular importance and are uncommon , but they can result in significant morbidity and even death . major vascular injury is the most life - threatening complication of laparoscopy , occurring most often during laparoscopic entry while one is inserting a veress needle or especially the first trocar . although the reported incidence of major vascular injury in laparoscopic procedures is as low as 0.05% to 0.26% , it can cause serious morbidity and death in 8% to 17% of patients . various technologies and techniques for laparoscopic access have been introduced to decrease the related complications . the closed technique using a veress needle , the open hasson technique , and the visual entry method have been used . although there are multiple reports on major vascular injury during the closed - entry technique , there is no consensus regarding the superiority of one method over the others based on sufficient evidence . veress needle insertion is the most popular method used by gynecologists ; the open technique is more commonly applied by the younger generation of general surgeons . to our knowledge , there is no report on major access - related complications of laparoscopic entry techniques in the urology literature . all patients who underwent laparoscopic surgery over a 15-year period from 1996 to 2011 at our institution were included in the study . laparoscopic entry was carried out by either the closed veress needle technique or the modified open hasson technique . among the 5347 procedures , the closed technique was used in the first 474 operations and the open technique in the remaining 4873 cases . the peritoneum was then incised with scissors under direct vision , and a bladeless 12-mm trocar ( 10-mm trocar in children ) was inserted into the peritoneal cavity . we did not use the hasson trocar in our patients , and we applied a towel clip or suture to stop gas leakage . all surgeries were performed in academic settings by laparoscopy fellows during their training course under the supervision of 4 attending urolaparoscopists . major vascular injury was defined as an injury to the aorta , vena cava , iliac vessels , or mesenteric vessels . on the basis of previous studies , injuries to the epigastric , omentum , and abdominal wall vessels patients ' charts were reviewed retrospectively to investigate for access - related major vascular injuries . a total of 5347 patients ( 3214 men and 2133 women ) were included in the study . the mean age of the patients was 31.6 5.2 years in the closed - access group and 43.2 8.9 years in the open - access group . all of the major vascular injuries occurred in the closed - access group during the setup phase with insertion of the first trocar . the location of the injury was the abdominal aorta in 2 patients and the external iliac vein in 1 patient . the diagnosis was made immediately after the first trocar insertion based on brisk bleeding through the trocar and a sudden decrease in blood pressure . management was performed after conversion to open surgery , control of bleeding , and repair of the injured vessel by an attending urologist with expertise in vascular surgery . the use of laparoscopy has increasingly expanded in gynecology , general surgery , and urology for several diagnostic and therapeutic procedures . in urologic procedures , laparoscopy is currently used in ablative and reconstructive operations such as donor nephrectomy , radical nephrectomy , radical prostatectomy , partial nephrectomy , adrenalectomy , pyeloplasty , and ureterolithotomy . because a substantial number of the major complications of laparoscopy occur during the laparoscopic access phase , evaluating the most serious complications of this phase is particularly important in assessing laparoscopic safety . several studies have focused on the safety of laparoscopic entry techniques , but they have mostly been reported by gynecologists and , to some extent , general surgeons . to our knowledge , there is no report on laparoscopic access techniques in the urology literature . we focused on studying major vascular injury in patients undergoing the two most commonly used laparoscopic entry techniques in urologic surgery . major vascular injury is the most devastating and dangerous complication of laparoscopy , and it was rarely reported before the laparoscopy era . although the reported incidence of major vascular injury in laparoscopy is 0.01% to 0.64% , it is believed to be under - reported . twelve of the respondents reported 19 vascular injuries ; the aorta was injured in 8 cases . in our own observations , we have witnessed several unreported major vascular injuries in gynecology and general surgery operations performed by the closed - access technique . the most common location of the injury was the distal aorta or inferior vena cava and the major branches of these vessels . because of substantial associated morbidity and mortality rates , it is the most feared complication of laparoscopy . chapron et al reported that major vascular injury resulted in death in 11.8% of patients and significant vascular complications in another 11.8% . in a study on bleeding complications in laparoscopic surgery by opitz et al , among different intraoperative and postoperative bleeding complications , major vascular injury had the highest mortality rate ( 2.4% ) , as well as the highest rate of conversion to open surgery ( 45% ) . most authors accept major vascular injury as an absolute indication for immediate conversion to open surgery . although the surgeon 's experience is claimed to be an important risk factor for major vascular injury , opitz et al showed that experience correlates with the incidence of intraoperative bleeding complications but not with major vascular injury . mayol et al assessed several factors that could be correlated with access - related complications and showed that the closed - access technique was the only significant factor in multivariate analysis . several authors have reported that 75% to 87.5% of major vascular injuries occurred during the insertion of the veress needle or the first trocar . the largest series of open laparoscopies , by penfield , reported 10 840 procedures with no major vascular injury . given the lack of sufficient comparative studies , several authors have mentioned the lack of significant evidence on the greater safety of one laparoscopic entry technique over the others . although the difference in the incidence of major vascular injuries between open- and closed - access techniques has not been statistically significant , given the high rates of morbidity and even mortality caused by this complication , even a small difference in its incidence has substantial clinical importance . major vascular injury is a preventable , unacceptable , and potentially lethal complication , and its incidence should be reduced as much as possible . insertion of the veress needle and the first trocar is the most dangerous phase of laparoscopy , accounting for 40% of laparoscopy complications and most of the deaths . in a literature review by bonjer et al , 489 335 cases of closed laparoscopy and 12 444 cases of open laparoscopy were reviewed . they found a vascular injury incidence rate of 0.075% with a mortality rate of 0.8% in closed laparoscopy cases and no incidence of vascular injury in open laparoscopy cases . merlin et al published a meta - analysis of studies comparing the open- and closed - access techniques , and they showed a trend toward a decreased risk of major complications for the open - access technique . the incidence rate of vascular injury was 0% to 0.03% for the open - access technique and 0.003% to 1.33% for the closed - access technique . merlin et al emphasized that , given the low incidence of vascular injury in both groups , the evidence is not clear . ours is the first series of laparoscopic urologic procedures studying the incidence of access - related major vascular injury . because 3 cases of major vascular injury occurred among our first 474 patients with the closed - access technique and because several cases of major vascular injury during the closed - access phase were reported in the gynecologic and general surgery literature , we decided to substitute the closed - access technique with open - access laparoscopy to avoid the life - threatening vascular complications of the closed technique . the safety profile of each technique could not be overemphasized in an academic setting where fellows who have not completed their learning curve carry out the procedure . applying the technique might be difficult in obese patients and require a larger incision , with its inherent associated problems such as a higher incidence of gas leakage . although there seems to be a higher risk of postoperative hernia , there were no patients with incisional hernia because of meticulous fascial closure in our series . considerable differences in the number of patients in the 2 groups and the retrospective nature of the study are its drawbacks . however , the 0% incidence of major vascular injury during the open - access technique in 4873 patients favors the greater safety of the technique , particularly in an academic setting . although the difference in its incidence has not been statistically significant between closed and open techniques , it should be noted that it is a preventable , unacceptable , and potentially lethal complication that should be abolished from the laparoscopy field . regarding its clinically lower incidence in urologic procedures performed by the open - access technique , it seems that using the open technique may be safer , particularly in an academic setting .

background and objectives : major vascular injury is the most devastating complication of laparoscopy , occurring most commonly during the laparoscopic entry phase . our goal is to report our experience with major vascular injury during laparoscopic entry with closed- and open - access techniques in urologic procedures.methods:all 5347 patients who underwent laparoscopic urologic procedures from 1996 to 2011 at our hospital were included in the study . laparoscopic entry was carried out by either the closed veress needle technique or the modified open hasson technique . patients ' charts were reviewed retrospectively to investigate for access - related major vascular injuries.results:the closed technique was used in the first 474 operations and the open technique in the remaining 4873 cases . three cases of major vascular injury were identified among our patients . they were 3 men scheduled for nephrectomy without any history of surgery . all injuries occurred in the closed - access group during the setup phase with insertion of the first trocar . the injury location was the abdominal aorta in 2 patients and the external iliac vein in 1 patient . management was performed after conversion to open surgery , control of bleeding , and repair of the injured vessel.conclusions:given the high morbidity and mortality rates associated with major vascular injury , its clinically higher incidence in laparoscopic urologic procedures with the closed - access technique leads us to suggest using the open technique for the entry phase of laparoscopy . using the open - access technique may decrease laparophobia and encourage a higher number of urologists to enter the laparoscopy field .

the prevalence of end - stage kidney disease ( eskd ) in patients with spina bifida ( sb ) is difficult to ascertain . a report of 283 patients with myelomeningocele treated in a single centre > 25 years found chronic kidney disease in 6.7% ; the rate of progression to eskd is unclear . ninety - seven percent of patients with myelomeningocele had neuropathic bladders and upper tract dilation , and vesicoureteric reflux was more common in patients with renal dysfunction . several reports have suggested that eskd is the most common cause of death in sb , and sb may be underappreciated as a cause of eskd in population registries as it may be ascribed to neurogenic bladder rather than sb directly . transplantation is the treatment of choice for affected individuals , however , haemodialysis ( hd ) is often the initial modality of the renal replacement therapy chosen . peritoneal dialysis ( pd ) may be challenging due to anatomical abnormalities and concerns regarding the risk of spread of infection from the peritoneal cavity to the central nervous system ; however , one study found pd to be safe and effective in a paediatric cohort of pd patients with sb . we report a case of recurrent syncope during hd in a man with sb and the arnold chiari type ii malformation ( cm ii ) , which has been completely prevented by intravenous mannitol given pre - dialysis and intra - dialytically . a 32-year - old man with sb developed eskd due to reflux nephropathy and enrolled in a maintenance hd programme . he returned to normal each time over a variable period from 10 to 30 min after termination of hd . this shunt was assessed by the neurosurgical service and found it to be functioning entirely normally . he had the cerebrospinal fluid ( csf ) removed from the shunt reservoir pre - hd to increase pressure accommodation . video - electroencephalography ( eeg ) during syncope showed a pattern consistent with the sleeping state , but no seizure activity or signs of encephalopathy . reducing the size of the dialysis filter , the blood flow rate and the duration of dialysis treatment in an attempt to reduce osmotic shifts were unsuccessful , however , this did reduce the severity of events and the recovery time , suggesting some benefit . magnetic resonance imaging ( mri ) of the brain revealed cm ii with severe herniation of the cerebellar tonsils through the foramen magnum , as shown in figure 1 . we theorize that the severity of compression of the reticular activating system was such that very minor increases in cerebral volume were enough to cause syncope and could not be compensated for by the functioning ventriculo - atrial shunt . the eeg pattern consistent with the sleeping state adds further to the evidence of compression on the reticular activating system by the herniating cerebellar tonsils . in an attempt to reduce intra - cerebral pressure , we gave a trial of 50 g of mannitol immediately before dialysis and an additional dose at the midpoint in the treatment . this regime was immediately successful at preventing syncopal events , and he then underwent 80 hd sessions without one syncopal event . at that point , a trial of mannitol withdrawal was made , however , he again suffered a syncopal event . cm ii is defined by downward displacement of the medulla oblongata and cerebellar tonsils through the foramen magnum and is associated with a myelomeningocele . spontaneous syncope has been associated with cm i , due to compression of neurological structures by the descending tonsils . in one reported case , these syncopal episodes are most likely a result of compression of the midbrain ascending reticular system or through compression of the vertebrobasilar artery . experimental evidence suggests that cm is associated with abnormalities in control of the autonomic nervous system and may be associated with cardiac arrest due to ventricular fibrillation . the association between the sudden death and cm due to compressive phenomena on the brain stem and the medulla are becoming increasingly recognized . a similar case has been reported in which a woman with sb suffered recurrent syncope during hd , which was ascribed to dialysis disequilibrium syndrome ( dds ) and was prevented by measures used to reduce dialysis intensity . dds is associated with cerebral oedema due to the rate of changes in osmolarity and urea removal and is directly related to dialysis intensity . it is therefore reasonable to assume that changes in cerebral volume and compression of vital structures in individuals with a severe form of cm ii result in syncope . the logical first step in this situation would perhaps be to transition to pd , however , this was not possible in this case due to extensive previous abdominal surgeries . the ability of mannitol to reduce brain water and hence brain volume and intra - cranial pressure ( icp ) has been demonstrated using mri . it is therefore reasonable to assume that the use of mannitol in our patient prevented syncope by reducing cerebral volume and compression of the reticular system by the herniating cerebellar tonsils . these patients are often of small stature , which makes them more vulnerable to large fluctuations in fluid and solute concentration during dialysis , and may have low - lying cerebral venous sinuses causing elevation of intra - cranial venous pressures , which may indirectly increase icp by reducing absorption of csf . this case sheds light on the possible complications , which may arise during hd in patients with sb and the chiari malformation , an area where little published data exists . these difficulties may become increasingly recognized as the long - term survival in sb increases and a proportion of patients require long - term hd , intravenous mannitol may prevent syncopal events .

spina bifida ( sb ) is associated with chronic kidney disease as a result of vesicoureteric reflux . a proportion of patients progress to end - stage kidney disease ( eskd ) . haemodialysis ( hd ) is probably the most common modality in eskd , as intra - abdominal malformations and previous surgery can make peritoneal dialysis more challenging . the chiari malformations also frequently occur in these patients . we report a case of recurrent syncope induced by hd in a patient with sb and the chiari ii malformation . sparse data exist on the complications of hd in this patient population and on the approach to the management of dialysis - induced syncope in these individuals .

this evolution proceeds in fits and starts rapid changes interspersed with plateaus . upon reaching each plateau , there is the temptation to believe that it is now time to address the question , once and for all , of what is the best treatment strategy for patients . such an approach has some disadvantages : the procedure is continually evolving ; yardsticks ( endpoints ) in use also continue to change ; and patients ( and their expectations ) continue to change . these caveats are not meant to denigrate randomized clinical trials because they remain the key to evidence - based medicine . the three components of current treatment strategy medical therapy , surgical revascularization , and percutaneous coronary intervention ( pci ) are all changing . medical therapy intensive risk - factor modification with medical therapy is essential , irrespective of whether it is the sole therapy or whether the patient requires revascularization . this change has arguably ( but probably ) been the result of the competition from the " newer kid on the block " pci . even surgeons have finally embraced the ideal of " less invasiveness " with new approaches such as the minimally invasive " beating heart surgery " . however , the field that has changed the most is pci , with the introduction of stents ( previously only used in few patients up to the mid-1990s , but now in approximately 90% of cases ) [ 6 - 9 ] , threnopyndines [ 10 - 12 ] , and glycoprotein ( gp ) iib / iiia inhibitors [ 13 - 17 ] . it has been documented to reduce enzyme elevation post - procedure , and may improve harder endpoints in other patient groups . the article by bhatt and topol , in this issue of current controlled trials in cardiovascular medicine , reviews the latest trials comparing stenting with bypass surgery , for the treatment of multivessel coronary disease . both the arterial revascularisation therapy study ( arts ) and the stent or surgery ( sos ) trial , are important additions . however , as yet , we have details only for arts , as the sos trial has only recently been presented at the 2001 american college of cardiology scientific sessions and has not yet been published . for the arts trial , we know that one - year mortality rates and the combined endpoint ( death , myocardial infarction , and cerebrovascular accident ) were similar . follow - up target vessel revascularization rates remain higher in the stent group , but the gap between the stenting and surgery has closed dramatically from previously published trials of percutaneous coronary intervention versus surgery . in the bypass angioplasty revascularization investigation ( bari ) , diabetic patients treated with coronary bypass graft surgery ( cabg ) had a better mortality at two years . there were other important differences in the arts trial , namely , creatinine kinase ( ck ) elevation was more than twice as frequent in the surgical group ( 12.6% versus 6.2% , p < 0.001 ) . of interest , elevated level of ck - mb was the main predictor of a poor outcome in the surgical group , but not in the pci group in which the main factor for a poor outcome was the presence of diabetes mellitus . the authors concluded that , " coronary stenting for multivessel disease is less expensive than bypass surgery and offers the same degree of protection against death , stroke , and myocardial infarction ; however , stenting was associated with a greater need for repeat revascularization " . details of the sos trial remain unpublished , but are hopefully in press at this time . this imbalance in mortality was apparently related to malignancy and , as bhatt and topol suggest , " play of chance is the likeliest explanation for this finding " . this is difficult to determine , as it depends on the " scorecard " system used to define " winning . " if the scorecard endpoint were death or myocardial infarction , at least with nondiabetic patients , the answer would be a toss - up ( it could go either way ) . the ten - year follow - up data on nondiabetic patients from the bari trial show almost identical event - free survival in both surgery and percutaneous transluminary coronary angioplasty ( ptca ) , using this endpoint . if , however , the scorecard endpoint is the avoidance of the potentially debilitating effects of central nervous system function disturbance , post revascularization with dramatic decrease in neurocognitive function , then pci is the clear winner . this is , in part , because there is considerable evidence of neurocognitive changes after cabg , but it has not been assessed after pci ; the sos trial may help with this . on the other hand , if the scorecard is avoidance of a repeat procedure , such as repeat pci , then cabg is the winner . there are other issues with these trials ; as bhatt and topol discuss , gp iib / iiia inhibitors were used infrequently . these agents have been studied intensively in the setting of acute coronary syndromes as well as pci , and have been found to dramatically decrease periprocedural cardiac enzyme elevation . whether this would have made a large difference in the follow - up of these patients with multivessel disease , there is longer - term evidence that mortality rates may be improved with gp iib / iiia agents , although this has not been specifically studied in a randomized trial . the lower use of gp iib / iiia agents , mirrors the practice in europe where these agents are not used routinely primarily because of cost . there are other advances which these trials also do not take into consideration because these were not either available or not widely used as the standard of care . there is great interest in the use of distal protection devices , which may improve the outcome of pci and decrease embolization . similarly , drug - coated stents appear to dramatically decrease restenosis rates , and if the forthcoming trials substantiate the early results , they will revolutionize the field . gp iib / iiia agents have been introduced which will be used to prevent lesions and periprocedural infarction in higher risk patients , and drug - coated stents may prevent angiographic and clinical restenosis . surgery , however , will remain an excellent treatment strategy , at least for patients who are not candidates for percutaneous intervention and probably for the diabetic patients ( particularly those with advanced multivessel disease and impaired left ventricular function ) . for the majority of patients who could have either pci or surgery , the less invasive approach with percutaneous intervention , will become the standard . ace = angiotensin - converting enzyme ; cabg = coronary bypass graft surgery ; ck = creatinine kinase ; gp = glycoprotein ; pci = percutaneous coronary intervention ; ptca = percutaneous transluminary coronary angioplasty . arts = arterial revascularisation therapy study ; bari = bypass angioplasty revascularization investigation ; sos = stent or surgery .

the treatment of patients with coronary artery disease continues to evolve ; all three strategies medical therapy , surgical revascularization , and percutaneous coronary intervention have changed . medical therapy with intense risk - factor modification and treatment with a statin , aspirin , and angiotensin - converting enzyme ( ace ) inhibitors , should be used unless contraindicated . surgical therapy has also changed with the introduction of minimally invasive , beating heart surgery . percutaneous coronary intervention has perhaps changed the most radically with adjunctive therapy glycoprotein iib / iiia inhibitors , thienopyridines , and reliance on stent implantation . the future , with new distal protection devices and drug - coated stents , should continue to see increased numbers of patients who can benefit from percutaneous intervention .

renal involvement in monoclonal gammopathy and multiple myeloma is well described and the most common is tubular damage by light chain cast nephropathy ( myeloma kidney ) and glomerular damage through amyloidosis or light chain deposition disease ( lcdd ) . membranoproliferative glomerulonephritis ( mpgn ) associated with monoclonal gammopathy has also been described , and sethi et al . introduced the term monoclonal - associated mpgn ( mg - mpgn ) to characterize a type of mpgn with monoclonal immunoglobulin ( ig ) deposits ( whole molecule or subunits ) , which mimics immune complex mpgn and differs from lcdd by the absence of ig deposition on tubular and vascular basement membranes , and by the non - linear , granular appearance of glomerular deposits . monoclonal gammopathy has also been linked to c3 glomerulonephritis ( c3 gn ) [ 2 , 3 ] . c3 gn is an uncommon , recently described , condition characterized by bright complement c3 staining and the absence of ig on immunofluorescence . it can be with or without mpgn morphology with mesangial and/or subendothelial electron dense deposits on electron microscopy [ 46 ] . it typically results from abnormalities in the alternative pathway of complement ( cap ) , which can be both genetic and acquired . recently , bridoux et al . described six patients with c3 gn secondary to monoclonal gammopathy . in previously reported cases of monoclonal gammopathy and c3 gn , renal outcome has been poor [ 3 , 7 ] . although chemotherapy has been reported to improve renal function [ 7 , 8 ] and to normalize c3 nephritis factor ( c3nef ) activity , no previous reports on renal outcome succeeding stem cell transplant we present a patient with a combination of mg - mpgn and c3 gn secondary to monoclonal gammopathy , which show full recovery after chemotherapy and stem cell transplantation . a 64-year - old woman was referred to the hospital with continuous proteinuria and microscopic haematuria in the past 3 years . she had noted foaming urine several times and slight peripheral oedema during urinary tract infections . apart from this , she has had no prior significant illness and her well - being was unaffected at the time of admission . urine analysis revealed significant proteinuria and kappa light chains were found in the urine together with a urine igg(k ) m - component . urine microscopy showed over 100 erythrocytes per high power field , no leucocytes or erythrocyte casts . 2013serum creatinine4580 mol / l778388851007062egfrml / min per 1.73 m605659497384proteinuriag/24 h3.223.20.4urine m - componentpositivepositivepositivepositivenegativeurine kappa light chain<10514321410serum haemoglobin7.19.3 mmol / l7.27.26.66.16.778serum albumin3748 g / l2827272931erythrocyte sedimentations rate<2010425serum m - componentg / l8112937<2negativep - iga0.73.7 g / l1.30.361.11p - igg6.114.9 g / l14.140.411.78.3p - igm0.42.1 g / l1.20.580.82p - free kappa light chain3.319.4 mg / l98.480.1425.1720.322.810.8p - free lambda light chain5.726.3 mg / l10.210.87.97.2169p - kappa / lambda ratio0.621.709.657.4554.199.71.41.2plasma complement c30.91.8 g / l0.241.021.09plasma complement c40.10.4 g / l<0.040.250.22complement factor b54154%992complement c3nef cleavagepositive > 10%403complement c3nef haemolytic assaynegative 15%3.53complement factor i60152%260117complement factor h69154%155115november 2009 : admission , stage of mgus ; december 2011 : stage of light chain myeloma ; march 2012 : treatment with chemotherapy is started ; september 2012 : 3 months after stem cell transplant ; may 2013 : 1 year after stem cell transplant . november 2009 : admission , stage of mgus ; december 2011 : stage of light chain myeloma ; march 2012 : treatment with chemotherapy is started ; september 2012 : 3 months after stem cell transplant ; may 2013 : 1 year after stem cell transplant . electron microscopy revealed subendothelial deposits in the peripheral glomerular basement membrane , which also showed a sign of splitting . a bone marrow biopsy was performed showing a normal haematopoietic marrow with all cells represented . there was no myeloma infiltrates , but there was a small amount of single multiple myeloma oncogene 1 ( mum1)-positive plasma cells . the findings were interpreted as a state of monoclonal gammopathy of undetermined significance ( mgus ) . ( a ) membranoproliferative glomerulonephritis , periodic acid schiff 200 ; ( b ) immunofluorescence for c3 , 200 ; ( c ) immunofluorescence for kappa light chain , 200 ; ( d ) electron microscopy demonstrating splitting of the glomerular basement membrane and deposits . ( a ) membranoproliferative glomerulonephritis , periodic acid schiff 200 ; ( b ) immunofluorescence for c3 , 200 ; ( c ) immunofluorescence for kappa light chain , 200 ; ( d ) electron microscopy demonstrating splitting of the glomerular basement membrane and deposits . the patient started treatment with an angiotensin - converting enzyme inhibitor to improve renal dynamics , to decrease proteinuria , to control blood pressure and to limit glomerular leucocyte infiltration . in the succeeding 18 months , there was sustained proteinuria and increased kappa light chain in blood samples ( table 1 ) . twenty - five months after admission , the patient had increasing plasma light chains and plasma m - component with an even more distinct kappa lambda ratio . at this time , the patient was discussed , as the significant amount of peripheral c3 deposition in the kidney biopsy arouse the question of a possible c3 gn and serum complement was measured . both plasma c3 , c4 and factor b were reduced . a c3nef was found estimated by a positive fluid phase c3nef cleavage , although negative c3nef haemolytic assay [ 9 , 10 ] . complement factor i ( cfi ) and h ( cfh ) were affected . erythrocyte sedimentation was highly elevated and the patient had become anaemic ( table 1 ) . therefore , a new bone marrow biopsy was performed showing increased amounts of atypical plasma cells , 1015% with a positive reaction to mum1 , and kappa monoclonal chains were also found in the smear and imprint . thus , the patient had progressed to a state of light chain myeloma and treatment was started with three series of bortezomib and dexamethason followed by cyclophosphamide priming and autologous stem cell transplant . the patient 's blood samples , including igs and complement factors , were in the normal range . one year after stem cell transplantation , the proteinuria had disappeared , kidney function was normal and complement factors , haematological parameters and igs were all normal ( table 1 ) . here , we present a patient , who has a light- and electromicroscopic picture of mpgn with subendothelial and intramembranous deposits of c3 and the absence of ig . thus , c3 gn seems straightforward , but there are also substantial amounts of kappa light chains in the tissue , especially surrounding the c3 deposits , suggesting that the deposition of light chains might cause the secondary c3 deposition , as the monoclonal ig in the case of mg - mgpn described by sethi et al . sethi et al . hypothesized that the deposition of monoclonal ig activates the complement system to cause acute injury to the glomerular capillary walls and mesangium causing proliferative and reparative changes . this hypothesis was supported by the frequent co - localization of c3 with the monoclonal ig in the mesangium and along capillary walls . reduced c3 and c4 levels were described together with isolated c3 staining in three biopsies , but it is not clear if co - localization of c3 and light chains was found . abnormalities in both classical ( ccp ) and the alternative complement pathway ( cap ) are also common . ccp is activated by immune complexes as well as monoclonal light chain deposition and is typically manifested by normal / mildly decreased serum c3 and low serum c4 . , a small amount of c3 is constantly autoactivated and can be amplified by the alternative amplification loop . cap activation is usually marked by low c3 and normal c4 and by low factor b and cd50 . this patient shows activity in both ccp and cap , with decreased levels of early components of each pathway namely c4 and factor b. since multiple components are decreased through consumption in both the classic and alternative complement pathways , an acquired disorder rather than genetic seems likely and genetic testing for an inherited disorder was not performed . the monoclonal kappa light chains causes the complement activation , either directly through activity in ccp or indirectly by uncontrolled activity in cap as described . light chains have previously been reported as the cause of mpgn through the complement activity [ 12 , 13 ] , but the presence of c3nef and enhanced activity of complement factor i points to uncontrolled activity in the cap . they suggested that c3 deposition due to cap activation was caused by autoantibody activity of the monoclonal ig . recently , zand et al . also reported a case series of c3 gn and monoclonal gammopathy in 32 patients with cap activation , but they only found circulating c3nef in two patients . the elevated activity of cap could explain the elevated activity of complement factor i as well . otherwise , transcriptional activity of cfi is enhanced in the presence of some cytokines , e.g. il-6 , and il-6 is elevated in multiple myeloma . administration of cfi to cfi knockout mice cause enhanced cleavage of c3b and appearance of c3 along the basal membrane of the glomerulus . following institution of chemotherapy and stem cell transplant , serum paraprotein decreased and the renal function improved . this strongly indicates that the complement activity in both ccp and cap , including the c3nef , is related directly to the monoclonal kappa light chain secreted by clonal plasma cells . it is possible that the kidney involvement had evolved to be the result of other myeloma - associated kidney lesions , e.g. myeloma - kidney at that point . however , the proteinuria and kidney function did not change significantly during the course of the haematological disease . it is possible that the improvement in proteinuria following treatment is attributable to switching off the production of kappa light chains , thus preventing their overflow into the urine , but overall we considered the possibility of another lesion minimal and another biopsy was not performed . one and 2 years later , when proteinuria was continuously high , they were detected and low . monoclonal gammopathy is a continuum and it seems , in this case , that the renal disease precedes the diagnostic set criteria for multiple myeloma . it also seems that the renal damage is reversible , although we have no post - treatment biopsy .

membranoproliferative glomerulonephritis ( mpgn ) and c3 glomerulonephritis ( c3 gn ) can be secondary to monoclonal gammopathy and multiple myeloma . mpgn type 1 is caused by activation of the classical pathway by immune complex formation , and c3 gn results from abnormalities in the alternative pathway of complement . in previously reported cases of mpgn and c3 gn secondary to monoclonal gammopathy / multiple myeloma , renal outcome has been poor . here , we present the first patient , to our knowledge , who showed full renal recovery and normalization of the complement system after chemotherapy and stem cell transplantation .

xanthogranulomatous pyelonephritis ( xgp ) is an uncommon and distinct type of chronic infective pyelonephritis in which yellow , lobulated masses diffusely replace the renal architecture . the disease is characterized by accumulation of foamy histiocytes , macrophages with mature adipocytes , and occasional giant cells . . a higher incidence of about 18% has also been reported in the pediatric age range . first described by schlagehaufer in 1916 , xgp occurs in 1% of all renal infection . the disease often mimics other inflammatory or neoplastic renal disorders ; hence , it has been described as a great imitator owing to its variant clinical presentation . unlike chronic pyelonephritis , it may spread to the perinephric tissue with formation of abscesses and even fistulas . the involved areas of the kidney are eventually destroyed , leading to nonfunctioning of the kidney . we retrospectively reviewed the cases presented at our tertiary care referral center for a better understanding of the clinicopathological profile of xgp with an aim to improve the outcome in future cases . all pathologically proven cases of xgp during the period of october 2007 to march 2010 in our institute were included in this retrospective review . all patients underwent ultrasound , intravenous pyelography ( ivp ) , and renal isotope ( dtpa ) scanning . the study comprised 16 cases , 10 females and 6 males with q mean age of 51.517.04 years . the youngest patient in the series was 15 years and the oldest was 73 years . the highest incidence was found in the fifth decade of life in both males and females . all patients had unilateral disease predominantly affecting the left kidney ( 9 cases out of the 16 ) . all patients had loin pain as the main presenting complaint followed by fever ( 68.7% ) and dysuria ( 62.5% ) . the other complaints were hematuria ( 31.2% ) , anorexia ( 31.2% ) , and weight loss ( 18.7% ) . the duration of symptoms ranged from 6 weeks to 7 years ( mean , 18 months ) . on examination , renal angle tenderness could be elicited in 10 cases and a palpable lump associated with pyonephrosis in 5 cases . the laboratory results showed the presence of anemia in all cases with a mean hemoglobin of 8.7 g / dl and a raised erythrocyte sedimentation rate above 90 mm / hour . urine culture reports were available for 10 patients , of whom 6 patients had growth of gram - negative organisms [ e. coli ( 4 cases ) and proteus ( 2 cases ) ] and 4 cases had no growth . one case was associated with a tumor ( renal cell carcinoma ) , and renal stones ( staghorn or otherwise ) were present in 10 cases . all patients had a nonfunctioning or poorly functioning involved kidney on ivp confirmed by dtpa renal scan . gross pathology showed increased perinephric fat and adherent capsules in 6 cases , whereas in the remaining 10 cases the capsule was stripped off easily ( fig . nine cases were associated with calculi : staghorn in eight cases and ureteric calculi in two cases . in all specimens , the corticomedullary tissue was replaced by yellow nodular areas of fatty tissue with diffuse dilatation of the pelvicaliceal system . microscopically , there was diffuse , granulomatous , inflammatory infiltrate consisting of dense lymphoid aggregates with large sheets of foamy histiocytes and neutrophils with plasma cells ( fig . there was a background of chronic pyelonephritis characterized by focal , variable renal tubular atrophy , fibrosis , and chronic inflammation . xgp is becoming a well - recognized cause of renal morbidity , with more cases being reported in the literature . the disease is prevalent in all age groups and is more common in females . in our series , a slight female preponderance was noted in the age distribution from 15 to 73 years . the lesion is generally unilateral with both the right and the left kidney affected with equal frequency . the exact pathogenesis is still not known , but a number of predisposing factors have been implicated . these include recurrent urinary tract infection , genitourinary obstruction , altered immunological anomalies , and abnormal lipid metabolism . in our series , we found recurrent urinary tract infections , obstruction , and nephrolithiasis as the main factors responsible for the development of xgp [ 10 - 13 ] . all our patients had pain ( abdominal / flank ) as the primary presenting complaint followed by fever , dysuria , and weight loss , as reported in previous studies . radiologically , plain x - ray of the abdomen revealed the presence of calculi , especially staghorn calculi ( fig . a nonfunctioning or poorly functioning kidney is the most common finding on ivp and dtpa renal scan . xgp is generally a disease limited to the affected kidney , but spread to adjacent tissues has also been seen . according to the extent of involvement of the adjacent tissue , malek and elder have classified this disease into three stages : stage i : nephric . one of our patients had both concomitant renal cell carcinoma and xgp in the same kidney . this is a very rare presentation and only a few such cases have been reported . reports of complications such as renocolic fistula and psoas / paranephric abscess have been described . in our series , none of the patients had any sort of complications , and all patients underwent total nephrectomy of the affected kidney [ 17 - 20 ] . the varied clinical presentation and paucity of definite diagnostic tests make the diagnosis difficult to confirm . however , studies have shown that clinical laboratory findings when combined with imaging modalities such as computed tomography scanning and magnetic resonance imaging can help to identify this fulminate kidney infection preoperatively . as in other studies , our results show that xgp is common in middle - aged female patients . most of these patients had a history of recurrent urinary tract infection , urinary tract obstruction , and urolithiasis , all of which are probable predisposing factors for the development of xgp . identifying this subpopulation of patients , aggressively treating the urinary tract infection with appropriate antibiotics , and evaluating and relieving the urinary obstruction is important . early diagnosis may limit the disease process and associated morbidity , thus leading to a good outcome . early diagnosis and prompt treatment play a crucial role in minimizing the morbidity and mortality rates of xgp . the treatment of choice for diffuse xgp is surgery and consists of nephrectomy with resection of all other involved tissue .

purposexanthogranulomatous pyelonephritis is an uncommon disorder of unknown etiology that is characterized by extensive destruction of the involved kidney . it is being increasingly recognized as an important cause of renal morbidity around the world.materials and methodsthis retrospective study was undertaken to review the xanthogranulomatous pyelonephritis cases presented at our tertiary care referral center in bangalore , india.resultsa total of 16 biopsy - proven cases of xanthogranulomatous pyelonephritis from october 2007 to march 2010 treated at our institute were included in the study . there were 10 females and 6 males with a mean age of 51.5 years . flank pain was the most common presenting symptom followed by fever . all patients had unilateral disease and underwent total nephrectomy of the affected nonfunctional kidney.conclusionsxanthogranulomatous pyelonephritis is a chronic and unusual infectious inflammatory condition involving the renal parenchyma . the definite treatment is nephrectomy . early identification and prompt treatment of this relatively benign and uncommon condition is important to minimize morbidity and mortality .

the term mycotic aneurysm was first used by osler in 1885 when he described a patient with multiple aortic aneurysms secondary to what he termed malignant mycoticendocarditis . because the appearance of the lesion resembled a fungal growth , he used the term mycotic aneurysm . although extension of infection to the walls of the small pulmonary and meningeal arteries from neighboring or contiguous inflammatory foci often caused aneurysms in tubercular cavities and the meninges , tubercular aneurysms of larger vessels , particularly the aorta , whether from within or without , are very rare . the first case of tubercular involvement of the aorta ( aortitis ) was reported in 1882 by weigert and the first case of tubercular mycotic aneurysm of the aorta was reported in 1895 . we report the case of a young female patient who was started on anti - tubercular treatment for pleural effusion and sent home . this time , she was found to have aortic aneurysm which later on proved to be tubercular in origin . though the patient was operated upon , despite aggressive management a female patient aged 21 years was admitted with complaints of fever and dyspnea from 20 days . she also had significant weight loss and constitutional symptoms . on examination , vitals were normal ; there were clinical findings suggestive of pleural effusion , splenomegaly , and ascites . investigations revealed pleuralfluid : adenosine deaminase - 73.9 u / l , cytology - 162 white blood cell ( n-10% , l-90% ) , proteins - 3.2 g / dl , culture - sterile , gram stain - negative , and acid fast bacilli ( afb)-negative . hemogram : total leukocyte count ( tlc ) - 6800/cmm , polymorphs 67% , lymphocytes 27% , hemoglobin - 10.2 g% , platelets 209,000/cmm , and erythrocyte sedimentation rate ( esr ) - 30 mm 1 h. biochemistry : random blood sugar - 76 mg% , urea - 32 mg / dl , creatinine - 0.8 mg / dl , sodium - 137 meq , potassium - 4.0 meq , and chloride - 102 meq . no organisms were detected on gram staining of sputum , sputum culture was sterile and it was negative for afb . the patient was started on anti - tubercular treatment and discharged . after 45 days , she presented with a history of yellowish discoloration of eyes from 20 days and palpitations from 15 days . chest radiograph revealed globular mass adjacent to left heart border as shown in figure 1 . on detailed work up with computed tomography ( ct ) thorax followed by angiography , there was a saccular pseudoaneurysm in descending thoracic aorta with impending rupture [ figures 24 ] with left pleural effusion and minimal pericardial effusion . hemogram : tlc - 5800/cmm , polymorphs 89% , lymphocytes 8% , hemoglobin - 11.7g% , platelets - 209,000/cmm , esr - 75 mm 1 h. hiv elisa was nonreactive . biochemistry : random blood sugar - 80 mg% , urea - 17 mg / dl , creatinine - 0.8 mg / dl , sodium - 131 meq , potassium - 4.4 meq , and chloride - 98 meq . liver function tests : bilirubin ( total - 7.2% , conjugated - 5.8 mg% ) , serum glutamic oxaloacetic transaminase - 550 iu , serum glutamic pyruvic transaminase - 251 iu , and alkaline phosphatase - 156 iu . finally , the patient was diagnosed to have disseminated tuberculosis ( tb ) with att - induced hepatitis . , she developed upper gastrointestinal ( gi ) bleed and immediately was taken up for surgical intervention by the department of cardiothoracic surgery . aorto - aorto bypass grafting with excision of aneurysm with polytetrafluoroethylene graft with feeding jejunostomy was performed along with repair of esophagus as she had aortoesophageal fistula . again after 2 days , second surgery was performed in which diversion cervical esophagostomy and gastro - esophageal junction transection with exclusion with tube gastrostomy was done . however , later , patient developed septicemia and finally expired on the 17 day of admission . aortic aneurysm histopathology report , which was received later on , revealed epithelioid granulomas and was positive for afb . chest radiograph posteroanterior view showing a rounded opacity along the left heart border computed tomography chest ( axial sections ) showing aortic aneurysm computed tomography chest showing aortic aneurysm with impending rupture vr image anterior view of the aortic aneurysm reviews by haythorn in 1913 and by silbergleit et al . in 1965 , in both the pre- and post - antibiotic era , suggest that this lesion has been rare . in a recent population - based series of patients with disseminated tb ( a group that is at increased risk of tubercular aortic aneurysm ) , . moreover , most of the tubercular aortic aneurysm case reports are from the industrialized world , where the prevalence of tb has declined over the past half - century . the bacilli may get implanted directly on the internal surface of the vessel wall , the bacilli may be carried to the adventitia or media by the vasa vasorum , or the involvement of the vessel wall may occur by direct extension or indirectly via the lymphatics from a contiguous focus such as a lymph node or paraspinal abscess . in the majority of the reported cases of tubercular aortic aneurysm ( 75% ) , a contiguous focus of tb was described , mainly lymph nodes ( 63% ) ; the other sites included paraspinal abscess , lung , pericardium , vertebrae , and prostate ( 37% ) . in the remaining 10 reported tubercular aortic aneurysm cases ( 25% ) , no contiguous focus of disease was described , thus implicating either of the first two mechanism described above . the patients in whom a primary contiguous focus could not be identified , they may be termed as having primary mycotic aneurysm , a term coined by crane . in our case also , there was an adjacent focus of infection in the form of a lymph node that probably eroded into the aorta . in our patient , the diagnosis of aortic aneurysm was made only after ct thorax was done for a suspected mass adjacent to left cardiac border , which was followed by angiography to confirm the diagnosis . in the series by long et al . as was found in the series by long et al . , one or more of the three clinical scenarios suggested tubercular aortic aneurysm in 39 of 40 patients ( 98% ) . each scenario suggested a complication of tubercular aortic aneurysm that may be an indication for surgical intervention : ( 1 ) persistent chest , abdominal , or back pain , ( 2 ) hypovolemic shock or other evidence of major bleeding , particularly into the lung or gi tract , but also into the pleural space , peritoneal cavity , retro - peritoneum , or pericardial space , or ( 3 ) palpable or radiographically visible para - aortic mass , especially if expanding or pulsatile . our patient had palpitations as the only symptom and radiological para - cardiac opacity on chest radiograph . the patient developed major upper gi bleeding through the aortoesophageal fistula and required urgent surgery . rupture of tubercular aortic aneurysm into the digestive tract is even rarer , with only a few cases being reported in literature . reported a 60-year - old male patient who presented with massive hematemesis and died suddenly . site of involvement included ascending aorta , distal aortic arch , proximal descending thoracic aorta , distal descending thoracic aorta , and infrarenal abdominal aorta . all patients either had received att previously or were receiving it at the time of presentation . rapid deterioration in the clinical status was the most marked clinical feature . in addition to clinical suspicion and suggestive findings on chest radiographs , contrast - enhanced ct scan is the most reliable means of demonstrating the aneurysm , and it often provides useful information on the status of the para - aortic tissue as well . in our case also , it was the saccular appearance on ct chest that was suggestive of an aortic aneurysm . because the patient had disseminated tb , a remote possibility of tubercular aortic aneurysm was kept , which was confirmed later on . in a patient when there is disseminated tb , persistent chest pain , abdominal pain or back pain , evidence of major bleed with hypovolemic shock or a palpable or radiologically visible mass both the patients who underwent surgery but did not receive anti - tubercular drugs died , and no patient survived without surgery in the series by long et al . they also found that despite 1 or more months of anti - tb drugs , progression of the lesion resulting in death or surgery occurred in 17 of the total of 41 cases . it is conceivable that access to the aneurysm by what is otherwise an effective anti - tubercular drug regimen is limited to the aortic blood ( the small vessels within the vicinity of the aneurysm were invariably thrombosed ) which may not easily penetrate the laminated thrombus that forms the wall of the aneurysm . our patient also received anti - tubercular drugs for 45 days , but she had progression of her aneurysm despite the treatment , though the drugs were modified after admission to the hospital . it must be recognized , however , that although the presence of an aneurysm and its mycotic nature might be predicted preoperatively , the likelihood of it being tubercular might not be anticipated . in over one - third of the patients in the above - mentioned series , tb was not diagnosed at presentation . even at surgery , determining the tubercular nature of the lesion is problematic . the gross appearance may not be distinctive , and acid - fast stains are unlikely to be performed .

tubercular aneurysms of larger vessels , particularly the aorta is very rare . the first case of tubercular involvement of the aorta in the form of aortitis was reported in 1882 by weigert and the first case of tubercular mycotic aneurysm of the aorta was reported in 1895 . the preoperative diagnosis of tubercular aortic aneurysm is difficult . even at surgery , determining the tubercular nature of the lesion is problematic . the gross appearance may not be distinctive , and acid - fast stains are unlikely to be performed . we report the case of a young female patient who was started on antitubercular treatment for pleural effusion and was found to have aortic aneurysm , which later on proved to be tubercular in origin .

we initially conducted reference broth microdilution tests ( 6,7 ) for 211 isolates of endemic and epidemic esbl - kp from taiwan ; 53% of isolates had a cefepime mic of < 8 mg / l ( susceptible ) . isoelectric focusing ( ief ) was then performed by the method of matthew et al . approximately 40% of isolates had a pi of 8.2 enzyme ( shv-5 ) ; 40% of isolates produced enzymes with a pi of 7.9 , 8.4 , or 8.8 ( ctx - m - type ) ; an additional 20% of isolates contained both an shv-5 plus a ctx - m enzyme . the ief results of 110 geographically representative isolates of esbl - kp were categorized by cefepime mic level ( table ) . the enzymes with pis of 7.6 and 5.4 were shv-1 and tem-1 , respectively , which have been reported previously in taiwan hospitals ( 2,4 ) . all the enzymes with pis of 5.4 , 7.6 , and 8.2 were evenly distributed among the isolates regardless of cefepime mic values , indicating no association with resistance to this fourth - generation cephalosporin . all 23 isolates with pi 8.2 enzymes and a nonsusceptible cefepime mic ( > 16 mg / l ) contained enzymes with pis of 7.9 , 8.4 , or 8.8 . in the absence of these ctx - m enzymes , isolates with pi 8.2 enzymes remained susceptible to cefepime . thus , the high mic level for cefepime was attributed to enzymes with pis of 7.9 , 8.4 , and 8.8 . this finding is supported by the fact that those isolates with a single ctx - m enzyme ( 10 with pi 7.9 enzymes [ ctx - m-14 ] and 8 with pi 8.4 enzymes [ ctx - m-3 ] ) had very elevated cefepime mic results in the absence of a pi 8.2 enzyme ( 9 ) . two isolates with pi 8.4 enzymes remained susceptible to cefepime ( mic 2 g / ml ) and probably produced low levels of ctx - m-3 . mic test , reference broth microdilution method according to national committee for clinical laboratory standards . ten of 34 isolates having a cefepime mic > 16 mg / l did not have enzymes with pi values of 8.2 or 8.4 . all 23 isolates were simultaneously coexistent with pi 7.9 , 8.4 , or 8.8 ( 12 with pi 7.9 plus 8.4 ; 9 with pi 7.9 ; and 2 with pi 8.8 ) . all the 11 isolates ( pi 7.8 or 6.3 ) were coexistent with pi 8.2 . ceftazidime mic < 8 mg / l ; ceftriaxone mic < 32 mg / l . these data indicate that cefepime resistance in esbl - kp isolates from taiwan may result from either the cumulative effect of pi 7.9 , 8.4 , 8.8 , or 8.2 enzymes or hyperproduction of any of the enzymes with the ctx - m phenotype ( pi 7.9 , 8.4 , or 8.8 ) . the enzyme with a pi of 8.8 is a novel ctx - m -lactamase most similar to ctx - m-3 ( unpub . several ctx - m enzymes have been shown to confer high mic levels for cefepime ( 1012 ) . bauernfeind et al . reported an isolate of salmonella typhimurium that had a ctx - m-2 enzyme ( pi 7.9 ) and a cefepime mic of 64 mg / l ( 10 ) . outbreaks have also been reported of isolates producing ctx - m enzymes ( pi 8.4 ) , including k. pneumoniae ( cefepime mic 4 - 8 mg / l ) , e. coli ( cefepime mic 8 - 32 szabo et al . reported an outbreak of 14 esbl - kp strains ( pi 8.2 , probably shv-5 ) that had high - level resistance to cefepime ( mic90 > 256 also noticed seven isolates of esbl - kp ( shv-5 ) with cefepime mics ranging from 32 these researchers described the elevated cefepime mic as being due to the combined effect of shv-5 hyperproduction and decreased outer membrane permeability ( loss of 36-kda outer membrane protein [ omp ] ) ( 13 ) . the cefepime mic for isolates hyperproducing shv-5 without loss of the 36-kda omp remained < 16 mg / l , a susceptible level ( 13 ) . loss of the 36-kda omp also conferred cefoxitin resistance , and introduction of a plasmid carrying the 36-kda omp gene markedly reduced the mic of cefoxitin , from 128 mg / l to 16 mg / l ( 13 ) . whether the isolates reported by szabo et al . also had concomitant outer membrane defects is unknown , but these authors later recommended that cefepime not be considered the treatment of choice against shv-5-producing esbl - kp ( 14 ) . however , in 44 isolates with cefepime mics > 16 mg / l , only 7 were resistant to cefoxitin . furthermore , for isolates with high cefepime mic values resulting from single ctx - m enzymes ( 10 with pi 7.9 and 8 with pis of 8.4 ) , only two ( one each with pis of 7.9 and 8.4 ) were resistant to cefoxitin . the relatively low rates of cefoxitin coresistance provide indirect evidence that 36-kda omp loss may not play an important role in the expression of cefepime resistance in esbl - kp strains in taiwan . alternative therapy using cefepime against esbl - kp strains in taiwan could be reliable if appropriately guided by cefepime and ceftazidime mic results . the cefepime mic is useful for predicting the presence of ctx - m enzymes , which usually confer resistance to this fourth - generation cephalosporin . cefepime can not be used if the mic exceeds 8 mg / l , which predicts the presence of ctx - m -lactamases . cefepime may reasonably be used clinically if the mic is consistently < 1 mg / l , which indicates the absence of a ctx - m enzyme . for isolates with cefepime mics > 2 to < 8 mg / l , use of cefepime should be further guided by the ceftazidime mic . if the ceftazidime mic remains in the susceptible range ( < 8 mg / l , predicting enzymes of pi 7.9 , 8.4 , or 8.8 ) , cefepime should not be used . if the ceftazidime mic is > 8 mg / l ( predicting enzymes of pi 8.2 ) , cefepime at appropriate doses has a potential therapeutic role because most pi 8.2 enzymes rarely elevate the cefepime mic to > 8 mg / l . in conclusion , outer membrane defects and the inoculum effects ( 13 ) that may adversely elevate mic values must still be considered if cefepime is chosen as an alternative therapy against esbl - kp strains . this strategy of focused utilization of a newer cephalosporin could reduce some selective pressures of carbapenem use among esbl - kp and thus minimize the development of carbapenem - resistant strains . in addition , phenotypic characteristics appear to accurately differentiate two important endemic and epidemic groups of esbl types ( ctx - m series and shv - like ) in k. pneumoniae strains in taiwan .

to guide selection of carbapenems or fourth - generation cephalosporins as therapy , 110 klebsiella pneumoniae isolates with extended - spectrum -lactamases from taiwan were characterized by phenotypic ( mics ) , molecular , and chemical methods . mic patterns of ceftazidime and cefepime clearly differentiate strains treatable by cefepime and those capable of efficiently hydrolyzing available cephalosporins ( ctx - m series and shv - types ) . continued use of cefepime appears to be a treatment option in cases for which mic results are available and interpreted by the criteria presented .

a 37-year - old serving army officer , a diagnosed case of schizophrenia for the last nine years , was on regular review and maintenance medication . since he had two relapses due to poor drug compliance , he was on inj . haloperidol decanoate every three weeks , and had achieved good remission . since the last one year he noticed a gradually increasing difficulty in swallowing liquid food . there was no history of hand tremors , restlessness or abnormal involuntary movements of lips , tongue or neck . he was evaluated by the ent surgeon , and the examination of the oropharynx and larynx was normal . while he was being considered for esophageal imaging studies , he was referred for routine psychiatric review . physical examination and mental status examinations were normal . possibility of td presenting as isolated dysphagia was considered , and abnormal involuntary movements score was 14 . maintenance drug was changed to quetiapine 150 mg / day and was supplemented with tab donepezil 10 mg/ day , and tab vit e 400 iu / day . he responded to treatment quickly , became fully asymptomatic in eight weeks and is presently maintaining improvement . dysphagia in td can be isolated or in combination with other bucco - lingual - masticatory features . tardive dyskinesia not only may be painful and disfiguring , but it can also predict poor outcome in schizophrenia . although many treatments have been tried , none have proven completely efficacious . the best treatment even today is prevention . a meta - analysis of the trials of cholinergic drugs by tammenmaa et al . bergman et al . , in a preliminary study of seven patients found that addition of donepezil while on stable anti - psychotic therapy was associated with a clinically significant improvement in the symptoms . as one can see from the above data , a definite and reproducible therapeutic regimen has not yet been evolved for td . hence in our case of td presenting with isolated dysphagia , a combination treatment was offered , and the patient has responded well . however , more case studies will be required before strongly recommending the above regimen for this disabling drug - induced illness .

tardive dyskinesia ( td ) , neuroleptic - induced delayed onset movement disorder , remains an enigmatic phenomenon and a therapeutic challenge . only a few cases of dysphagia also have been reported in world literature and to the best knowledge of the authors no case of td manifesting as isolated dysphagia has been reported so far from india . we report a case of td consequent to prolonged exposure to typical neuroleptics , manifesting as isolated dysphagia who responded well to a combination of quetiapine , donepezil and vit e.

pancreatic solid pseudopapillary tumor ( spt ) is a rare neoplasm , representing ~2% of pancreatic tumors . the histological origin of the tumor is poorly understood , showing remarkable variability in their presentation , biological behavior and prognosis . our literature search has identified only 16 previously reported cases of spt at an ectopic site [ 25 ] . we report a case of 33-year - old male presenting with spt arising in the root of small bowel mesentery with lymph - node metastasis . the site as well as the presence of lymph - node metastasis makes our case report unusual . a 33-year male presented with a 1-year history of epigastric and right upper abdominal pain associated with episodes of upper abdominal fullness relieved after vomiting . initial laboratory values revealed a white blood cell count of 8400/mm ( 80% neutrophils , 20% lymphocytes ) , hemoglobin 12.5 g / dl , total bilirubin 2.4 mg / dl , conjugated bilirubin 1.8 mg / dl , alanine aminotransferase 33 u / l ( normal 545 u / l ) , aspartate aminotransferase 41 u / l ( normal 545 u / l ) and alkaline phosphatase 27 u / l ( normal 42128 u / l ) , albumin 3.9 mg / dl and total protein 6.7 mg / dl . abdominal ultrasound ( us ) examination revealed well - defined thick and irregular - walled cystic lesion of size 6 5 cm below the body of the pancreas . contrast - enhanced computed tomography ( ct ) scan showed a round cystic lesion of size 5.2 4 cm with irregular enhancing thick wall , below the body of the pancreas ( fig . us - guided fine needle aspiration cytology showed clusters of ductal epithelial cells and occasional acinar cells . with the diagnosis of a cystic neoplasm of the pancreas , patient underwent exploratory laparotomy which revealed a cyst of size 6 5 cm found to be arising from the root of small bowel mesentery , along with a lymph node of size 2 cm 1.5 cm adjacent to it and medial to the duodenojejunal flexure ( fig . the cut surface showed a cystic lesion containing hemorrhagic fluid with areas of solid components and necrosis . figure 1:photomicrograph of the arterial phase ct showing well - circumscribed low attenuated lesion ( arrow).figure 2:a photograph during laparotomy showing the origin of the lesion ( arrow ) at the root of mesentery medial to the duodenojenunal flexure . photomicrograph of the arterial phase ct showing well - circumscribed low attenuated lesion ( arrow ) . a photograph during laparotomy showing the origin of the lesion ( arrow ) at the root of mesentery medial to the duodenojenunal flexure . histopathological examination revealed tumor cells arranged in organized nests , few trabecular and pseudopapillae formation . the slide shows few polygonal and elongated cells with round to oval vesicular nucleus , inconspicuous nucleoli and moderate to abundant faint eosinophilic granular cytoplasm ( fig . cytoplasm was positive for vimentin , cd-10 and nse ( neuron - specific enolase ) ; granularity of cytoplasm was positive for alpha-1 antitrypsin and alpha-1 antichymotrypsin . figure 3:photomicrograph indicating the tumor composed of irregular pseudopapillary structures ; prominent myxoid changes can be seen in the stroma . photomicrograph indicating the tumor composed of irregular pseudopapillary structures ; prominent myxoid changes can be seen in the stroma . he received six cycles of gemcitabine ( 1 g / m ) . till the end of 10 months spts of the pancreas are rare exocrine pancreatic tumor , well known for indolent biologic behavior . frequently , it is named as solid and cystic tumor , solid and papillary epithelial neoplasm , papillary - cystic neoplasm , papillary - cystic epithelial neoplasm , papillary - cystic tumor or franz tumor . in 1996 , the world health organization renamed this tumor as spt for the international histological classification of tumors of the exocrine pancreas . it commonly occurs in the head or tail region of the pancreas , usually in females in second to fourth decade of life . the present case was a 33-year - old male who had presented with an epigastric mass . laparotomy revealed the lesion to be arising from the root of small bowel mesentery medial to the duodenojejunal flexure , with a nearby lymph node ; the lesion being separate from the normal pancreas . histopathological examination showed that the lesion was an spt of pancreatic origin and had also metastasized to the lymph node . spt occurring in an ectopic pancreas is a rare phenomenon , with only 16 previously reported cases , at various sites such as the mesocolon , ovary , retroperitoneum , liver , stomach and duodenum [ 25 ] . the root of small bowel mesentery is till date an unreported site for spt ; this being the first such case described . the presence of tumor in male and the lymph - node metastasis is also a rare occurrence . the clinical presentation of the tumor is usually nonspecific , like vague abdominal pain , gradually enlarging mass or compressive signs . some asymptomatic patients are detected incidentally during routine physical examination or by imaging studies . in some rare instances , acute manifestations such as pancreatitis or hemoperitoneum caused by rupture of the tumor ultrasonographically , the tumor is well encapsulated , homogeneous or heterogeneous , and composed of solid echogenic and hypoechogenic cystic components . ct scan usually demonstrates a well - encapsulated and circumscribed retroperitoneal mass , hypodense , with various solid and cystic components owing to hemorrhagic degeneration . magnetic resonance imaging is better than ct for distinguishing certain tissue characteristics , such as hemorrhage , cystic degeneration or the presence of a capsule . the pathologic diagnosis of spt on light microscopy depends upon the presence of solid areas alternating with pseudopapillary formations ; evidence of cellular degeneration , cholesterol clefts , nuclear grooves , aggregates of foamy histiocytes and hyaline cytoplasmic globules . immunohistochemical staining for specific cell lineage markers is of marginal utility in proving the diagnosis of spt . vimentin is consistently expressed , and tumor cells are focally positive for cytokeratin and synaptophysin , and few positive for s-100 protein , cd-56 and cd-10 [ 7 , 12 ] . the management of spt localized to the pancreas is straightforward and surgical removal with or without pancreatic resection is the treatment of choice . similarly , local invasion and metastasis should not be the contraindication for resection [ 7 , 12 ] . there have been reports of using various chemotherapy regimens based upon cisplatinum and 5-flururacil , gemcitabine alone or combination of ifosfamide , cisplatin and vp-16 . spt remains a distinct entity and has favorable prognosis , though histogenesis is still controversial .

abstractpancreatic solid pseudopapillary tumor is a rare neoplasm . very rarely , it may arise from an ectopic site . solid pseudopapillary tumor occurring in the root of mesentery has not been described in the literature . this report summarizes a case of an adult male having the tumor arising from the mesenteric root . he underwent complete resection of the tumor followed by six cycles of adjuvant chemotherapy and remains asymptomatic till date .

accumulated evidences indicated that abnormal vitamin d status is associated with the etiology of type 2 diabetes . compared with subjects with normal glucose tolerance , patients with type 2 diabetes and impaired glucose tolerance ( igt ) have lower vitamin d levels [ 1 , 2 ] . some prospective studies suggested vitamin d deficiency increases the risk of type 2 diabetes [ 3 , 4 ] . however , the specific mechanisms by which vitamin d influences the risk of type 2 diabetes are not very clear . insulin resistance and deteriorated -cell function are the two major pathophysiologic aspects of type 2 diabetes . but not all studies obtained concordant conclusion . nonetheless , most of these surveys evaluated insulin sensitivity and -cell function using indices just calculated from fasting glucose and insulin , which is not fairly accurate [ 5 , 6 ] . therefore , the aim of this study was to investigate the relationship between serum 25-hydroxy vitamin d ( 25-ohd ) and insulin sensitivity , -cell function in newly diagnosed type 2 diabetes , using more predominant evaluation indicators of insulin resistance and -cell function which were derived from oral glucose tolerance ( ogtt ) . all subjects in this study came from a community survey of urban population over 40 years who lived in gulou district , nanjing city , china , from september to october 2012 . subjects with severe pancreatic disease , liver disease , and renal disease and those with excessive fasting blood glucose were excluded . according to the criteria of world health organization ( who ) 1999 , 395 patients with newly diagnosed diabetes were enrolled in this study , including 157 men and 238 women , with average age of 59.62 8.15 years . the study was approved by the ethics committee of the first affiliated hospital of nanjing medical university . verbal informed consent was obtained from all participants . the height , weight , systolic blood pressure ( sbp ) , and diastolic blood pressure ( dbp ) were measured by trained doctors or nurses . body mass index ( bmi ) was calculated by dividing weight in kilograms ( kg ) by height in squared meter ( m ) . blood pressure and pulse were taken as the mean of 3 consecutive measurements after at least 5 minutes rest . after 1012 hours overnight fasting , venous blood samples were collected to measure fasting plasma glucose ( fpg ) , fasting serum insulin ( ins0 ) , high density lipoprotein cholesterol ( hdl ) , low density lipoprotein cholesterol ( ldl ) , triglyceride ( tg ) , alanine aminotransferase ( alt ) , and -glutamyltransferase ( ggt ) . then the 75 g oral glucose tolerance tests ( ogtt ) were performed , and venous blood samples were obtained at 30 and 120 minutes after glucose load for measuring the plasma glucose ( 30 min plasma glucose , pg30 , and 120 min plasma glucose pg120 ) and serum insulin ( 30 min serum insulin , ins30 , and 120 min serum insulin , ins120 ) . glycated hemoglobin ( hba1c ) was examined with capillary blood ( variant ii , bio - rad ) . hdl , ldl , tg , alt , and ggt were measured using chemiluminescence methods on the autoanalyzer ( modular e170 , roche ) . serum insulin was measured by radioimmunoassay ( iodine [ i ] insulin radioimmunoassay kit , beijing north institute of biological technology ) , and the coefficient variation of intra - assay and interassay was < 10% . serum 25-ohd was measured by enzyme immunoassay ( 25-hydroxy vitamin d kit , immunodiagnostic systems limited , ids ltd . ) , with coefficient variation of intra - assay < 8% and interassay < 10% . insulin resistance of liver was estimated using the homeostasis model assessment ( homa - ir ) , which was calculated as follows : homa - ir = insulin ( miu / l ) glucose ( mmol / l)/22.5 . matsuda insulin sensitivity index ( matsuda isi ) was used to evaluate whole - body insulin sensitivity , which was calculated as 10000/g0i0gi , where g and i are the average levels of plasma glucose in mg / dl and insulin in miu / l of ogtt . to evaluate the insulin secretion , the area under insulin ( aucins ) and glucose curves ( aucglu ) during ogtt were calculated , and the ratio of aucins to aucglu was a surrogate index for insulin release ( which was defined as insr ) . disposition index ( di , calculated as matsuda isi insr ) was used to assess -cell function , which combines both insulin secretion and insulin sensitivity . according to the tertiles of 25-ohd concentration in total population , the subjects were divided into three groups ( low tertile t1 , middle tertile t2 , and high tertile t3 ) . one way - anova and the chi - square test were used to analyze the differences among groups . all statistical analyses were carried out using the statistical package for social science for windows ( spss , version 13.0 ) . the average 25-ohd concentration was 29.15 6.15 , 42.49 3.78 , and 59.83 8.17 tg , tc , and the sex ratio had significant difference among three groups . compared with t1 group , subjects in t3 group had lower tg and tc levels , whereas there was no significant difference of age , bmi , blood pressure , hdl , ldl , alt , ggt , and hba1c among three groups . in total subjects , there was significant difference of homa - ir , matsuda isi , and insr among three groups . on the contrary , homa - ir and insr gradually declined ( shown in table 2 ) . after adjustment for sex , age , bmi , and blood pressure , the difference of homa - ir and insr among groups disappeared , whereas the difference of matsuda isi among three tertiles was still significant . additionally , after further adjustment for tg , tc , hdl , ldl , alt , ggt , and hba1c , there was no significant difference of homa - ir , matsuda isi , and insr among three vitamin d tertiles . di was not different among three groups before or after adjustment for confounding factors . table 3 showed the insulin sensitivity and -cell function of vitamin d tertiles in female and male subjects . in males , no significant difference of homa - ir , matsuda isi , insr , and di was found among three groups before or after adjustment for confounding factors . in females , there was significant difference of homa - ir , matsuda isi , and insr among three vitamin d tertiles , even though adjusting for sex , age , bmi , blood pressure , tg , tc , hdl , ldl , alt , ggt , and hba1c the difference was still significant . with the increasing level of vitamin d of females , matsuda isi trended to increase ; however , homa - ir and insr tended to decrease . in recent years , the influence of vitamin d on diabetes becomes a research hotpot ; many studies paid attention to the relationship between vitamin d and insulin sensitivity and -cell function . in the present study , serum 25-ohd showed positive association with matsuda isi and negative association with homa - ir . after adjustment for metabolic confounding factors including sex , age , bmi , blood pressure , and serum lipid , the association attenuated . the influence of obesity and dyslipidemia on insulin resistance may contribute to this phenomenon . the association between vitamin d and insulin resistance may be diluted by the intense association obesity and insulin resistance . some researches demonstrated that excessive fat accumulation could reduce the concentration and activity of the vitamin d in adipose tissue . vitamin d also affects obesity ; low serum vitamin d levels always accompany increased serum parathyroid hormone levels and calcium influx of fat cells , which stimulates lipogenesis , inhibits fat decomposition , and aggravates obesity . some recent studies of molecular biology had indicated that vitamin d may influence insulin sensitivity in more than one way . in target cells of insulin action , vitamin d could increase insulin receptor , enhance the activity of transcription factors , and regulate the cell calcium concentration ; all these effects can improve insulin sensitivity [ 14 , 15 ] . vitamin d could regulate the immunological reaction of macrophages and monocytes , reduce the concentration of interleukin-1 ( il-1 ) , interleukin-6 ( il-6 ) , and tumor necrosis factor- ( tnf- ) , and so on , and thereby relieve inflammatory reaction . on the contrary , vitamin d deficiency is associated with high level of inflammatory factors such as il-6 , tnf- , and c - reactive protein ( crp ) [ 17 , 18 ] . there are also several researches that studied the interaction between vitamin d and -cell function . -cells express vitamin d receptor , which can bind to 1,25-dihydroxyvitamin d. there is vitamin d acting element in insulin gene promoter region , and vitamin d can activate the transcription of insulin gene [ 14 , 19 ] . meanwhile , -cells express 25-ohd-1 alpha - hydroxylase ( cyp27b1 ) , which could facilitate vitamin d activation . vitamin d can also regulate -cell calcium concentration and influence insulin secretion through calcium - dependent pathway . in our study , insulin secretion index insr was different among three vitamin d tertiles ; however , the difference attenuated after adjustment for sex , age , bmi , blood pressure , and so on . in females , insr was different among three vitamin d tertiles although adjusted for metabolic confounding factors . interestingly , among three vitamin d tertiles , insr was the lowest in higher tertile . this phenomenon may be attributed to the implication of insr , which only represents the secretion function of -cell regardless of the influence of insulin resistance . during pathophysiology of type 2 diabetes , as insulin resistance developed , -cells compensatorily secret more insulin . when -cell fails to compensate , type 2 diabetes occurs . the subjects in our study were all newly diagnosed type 2 diabetes , whose -cell was in early phase of decompensation . subjects with higher vitamin d had better insulin sensitivity , so their -cell needed to secret less insulin ; this may explain the reason why insr was the lowest in higher vitamin d tertile . di is index of -cell function after adjustment for insulin resistance , and there was no significant difference of di among three vitamin d tertiles . this suggested that vitamin d maybe have no influence on compensatory secretion function of -cell . our study also demonstrated that men distinguish from women in the relationship of vitamin d with insulin sensitivity and -cell function . in our study population divided by gender , the vitamin d levels of men were not associated with insulin sensitivity and -cell function . nevertheless , there was significant association between vitamin d and insulin sensitivity and -cell function in women . after adjustment for all kinds of metabolic confounding factors , the association was still significant . until now , rare studies focused on the gender difference in relationship of vitamin d with insulin sensitivity and -cell function . reported that there was gender difference in the relationship between vitamin d and type 2 diabetes risk among koreans , and the association was stronger in young women . gonadal hormone was speculated as an initiating factor ; however , further study is needed for elucidating mechanisms . considering the association between vitamin d and insulin sensitivity and -cell function , vitamin d supplement may be one promising way to improve insulin resistance and reduce risk of diabetes . an intervention study conducted by mitri et al . suggested that 25-hydroxyvitamin d supplements in dosage of 2000 ui / day can significantly improve islet -cell function . a 6-month randomized controlled trial carried out in south asian female population demonstrated that 25-hydroxyvitamin d supplements in dosage of 4000 ui / day can improve insulin sensitivity of patients with vitamin d deficiency , but no effects were observed on dyslipidemia . because of the regional and ethnic differences , until now , no international consensus was reached about the two doses of vitamin d supplement we had regulated . given the existence of gender differences in the relationship between vitamin d and insulin sensitivity , the supplement of vitamin d may also need to consider difference of gender . because the subjects in this study were all citizens in one district and the blood samples were collected in narrow time interval , the geographic and seasonal disturbance on vitamin d was minimized in our study . of course our study was just a cross sectional study , and we could not affirm the causal relationship between vitamin d and insulin sensitivity and -cell function . in conclusion , our study demonstrated that serum 25-ohd is associated with insulin sensitivity and -cell function for female newly diagnosed type 2 diabetes patients ; the association is ambiguous in males . this association may be instructive and meaningful to the supplement of vitamin d and improvement for insulin sensitivity and -cell function .

the aim of this study was to investigate the relationship between serum 25-hydroxy vitamin d ( 25-ohd ) and insulin sensitivity and -cell function in newly diagnosed type 2 diabetes . 395 newly diagnosed type 2 diabetes patients were enrolled in this study . venous blood samples were collected at 0 min , 30 min , and 120 min of ogtt to measure serum glucose and insulin . matsuda isi and homa - ir were used to determine insulin sensitivity . the ratio of 0120 min area under curve of insulin to glucose ( insulin release index , insr ) was calculated as surrogate index of -cell insulin secretion function . the products of insulin secretion indices multiplied by matsuda insulin sensitivity index were used as disposition indices . patients were divided into three groups according to tertiles ( t1 , t2 , and t3 ) of 25-ohd concentration . there was significant difference among three groups for homa - ir , matsuda isi , and insr . homa - ir , matsuda isi , insr , and di were undifferentiated among three groups in male patients . but homa - ir , matsuda isi , and insr were significantly different among three groups in female patients after being adjusted by confounding factors . in conclusion , serum 25-ohd is associated with insulin sensitivity and -cell function for female newly diagnosed type 2 diabetes patients , and the association is ambiguous in males .

the objective of this study was to present the outcome of the internal limiting membrane ( ilm ) peeling flap technique for a treatment - nave , flat edge ( type ii ) , full - thickness macular hole ( mh ) . a 52-year - old man presented with complaints of decreased vision and seeing black spot . he was diagnosed to have a flat edge , full - thickness mh , which was confirmed by optical coherence tomography ( oct ) . he underwent 23 g vitrectomy with brilliant blue g - assisted inverted ilm peeling with an inverted flap over the hole followed by fluid gas exchange . postoperative follow - up until 3 months showed successful closure of the mh , which was confirmed by oct . the best - corrected visual acuity improved from baseline 6/60 to 6/12 at the final follow - up . using the inverted ilm flap technique , a treatment - nave , flat edge ( type ii ) , full thickness mh achieved successful anatomical and functional outcomes . macular hole ( mh ) is a full - thickness defect of the retinal tissue involving the fovea . it is confirmed by optical coherence tomography ( oct ) , and clinically , an mh appears like full - thickness defect with its edges lifted toward the vitreous and cystic changes seen at the edges of the neurosensory retina . this appearance of the mh is amenable to successful surgical outcome of its closure besides other known prognostic factors affecting the outcome.13 a large mh has increased risk of surgical failures , with 44% remains open after surgery.4 similarly , it is also difficult to achieve successful closure in the refractory mh.5,6 in the recent past , such a surgically challenging mh had a promising outcome using the inverted internal limiting membrane ( ilm ) peeling flap technique.46 we report a successful closure of a treatment - nave , flat edge , full - thickness mh ( type ii appearance ) using the inverted ilm peeling flap technique . a 52-year - old man presented with complaints of seeing black spot in his vision in the left eye . he had a history of undergoing phacoemulsification with intraocular lens implantation and retinal laser done ( for peripheral lattice degeneration ) 2 years ago in the right eye . on examination , his best - corrected visual acuity was 6/9 in the right eye and 6/60 in the left eye . anterior segment examination was unremarkable in both eyes except posterior chamber intraocular lens in place in the right eye and grade 2 nuclear sclerosis with early cortical cataract in the left eye . intraocular pressure was 16 mmhg and 18 mmhg in the right and left eyes , respectively . dilated fundus examination showed clear ocular media , attached retina , inferior peripheral lattice degeneration , and vitreous liquefaction in the left eye . the right eye showed clear ocular media , attached retina , and peripheral laser marks . oct showed a full - thickness mh with flat edge in the left eye ( figure 1a ) and a maintained foveal contour in the right eye . based on the above mentioned clinical evaluation , a diagnosis of the full - thickness mh with flat edge , inferior peripheral lattice degeneration and cataract in the left eye , and pseudophakia in the right eye was made . he underwent 23 g vitrectomy , brilliant blue g - assisted ilm peeling ( inverted flap technique ) , fluid gas exchange , and endolaser in the left eye . intraoperatively , after induction of posterior vitreous detachment , vitrectomy was completed and endolaser was barraged around the inferior lattice degeneration ( figure 2 , left top ) . brilliant blue g was then injected over the macular area to stain the ilm ( figure 2 , left middle ) . ilm peeling was initiated from the temporal side all around the mh , at approximately two - disk diameter area , and hinged at the edges of the hole ( figure 2 , left bottom ) . ilm was then trimmed , and adequate residual ilm was inverted over the hole ( figure 2 , right top / middle ) . following this , fluid air exchange was performed and ilm was pushed into the mh ( figure 2 , right bottom ) two months follow - up examination showed the best - corrected visual acuity of 6/24 . anterior segment examination showed grade 2 nuclear sclerosis with early posterior subcapsular cataract and cortical spokes . fundus examination showed attached retina , laser marks around the inferior lattice degeneration , and closed mh . oct showed closed mh with a maintained foveal contour and dimpling in the temporal macula ( figure 1b ) . three months follow - up examination showed the best - corrected visual acuity of 6/12 and n8 . inverted ilm peeling flap technique has improved the confidence of approach to successful surgical outcome in refractory and large mhs.46 michalewska et al4 have shown that using the inverted ilm flap technique in eyes with a large mh ( > 400 m size ) had a 98% success rate of mh closure compared to 88% in eyes that underwent the standard technique . they suggested that the inverted ilm flap technique prevents postoperative flat open appearance of an mh and also improves the functional and anatomical outcomes of an mh > 400 m . they have also shown that the mean visual acuity at month 12 was 0.28 with the ilm flap technique and 0.17 without the flap technique ( p=0.001 ) . pires et al5 have also shown successful closure of the reopened mh that had undergone previous surgery using the ilm peeling translocation technique . the current case presented closure of a treatment - nave , type ii pattern mh appearance with flat edge3 in the eye that has not undergone any previous surgery . this has never been reported ( in the pubmed ) . using the ilm flap technique in this eye , successful anatomical and functional improvements ( figure 1 ) our case and other publications46 imply that whatever is the technique , the concept of leaving the ilm over the hole remains the same and can improve the functional outcome . in stage 2 , usually there will be evidence of some form of vitreomacular adhesion or vitreomacular traction , which was not evident in this case besides the flat appearance of edges like a type ii closure . the size of the hole had a minimum diameter of 319 m and base diameter of 345 m . since this was also associated with symptomatic vision decrease , the case was advised for surgery . ideally , in small stage 2 mh , one may defer surgery as there is a possibility of spontaneous closure and the hole size is usually < 200 m . the inverted ilm flap technique is usually performed for a chronic large mh , a failed mh , or high myopia with mh and foveal schisis . in this case , possibly because of the flat edge , there is less likelihood of vitrectomy alone being successful in the closure of mh . the ilm flap technique in such kind of eyes allows the mller cells and external limiting membrane to grow along the ilm as a scaffold to close the hole . our case demonstrates that a treatment - nave , flat edge mh can achieve successful anatomical and functional outcomes using the ilm flap technique .

objectivethe objective of this study was to present the outcome of the internal limiting membrane ( ilm ) peeling flap technique for a treatment - nave , flat edge ( type ii ) , full - thickness macular hole ( mh).methodsa 52-year - old man presented with complaints of decreased vision and seeing black spot . he was diagnosed to have a flat edge , full - thickness mh , which was confirmed by optical coherence tomography ( oct ) . he underwent 23 g vitrectomy with brilliant blue g - assisted inverted ilm peeling with an inverted flap over the hole followed by fluid gas exchange.resultspostoperative follow - up until 3 months showed successful closure of the mh , which was confirmed by oct . the best - corrected visual acuity improved from baseline 6/60 to 6/12 at the final follow-up.conclusionusing the inverted ilm flap technique , a treatment - nave , flat edge ( type ii ) , full thickness mh achieved successful anatomical and functional outcomes .

though the soft tissue casts have become a popular aid in fabrication of the cervical contours of the implant crowns , their use in a conventional fixed partial denture also play an important role . in many clinical practices , dies are trimmed to expose margins of the preparations . the soft tissue emergence profile that surrounds the prepared teeth the resultant restorations either show triangular spaces above the tissues or become over or under contoured due to the loss of gingival architecture.1 overcontoured restorations result in food and plaque retention in the interproximal , facial , and lingual cervical areas which can lead to caries , gingival inflammation , and/or gingival hyperplasia.2 - 4 undercontoured restorations may create excessive interproximal spaces and problems with phonetics and esthetics.3 often , laboratory technicians are unable to contour the crowns properly in the interproximal regions without a soft tissue cast.5 many procedures for fabrication of the soft tissue casts for conventional fixed partial denture have been reported in the literature.1,5 - 8 this article describes a modification of the technique described by williamson et al . to fabricate the soft tissue cast for the conventional fixed partial denture.5 the modification comprises fabrication of the facial and proximal gingival architecture associated with the prepared teeth in resilient material and remaining portion in hard dental stone the impression was made with a polyvinyl - siloxane material ( exaflex ; gc america , chicago , il , usa ) using the conservative tissue management technique ( fig . 1).5,6 the impression was disinfected in conventional manner and poured with the type iv gypsum material ( ultrarock ; kalabhai karson , mumbai , india ) to make a master cast ( fig . 2 ) . after retrieval of the master cast , impression was washed thoroughly to prepare it for second pour to fabricate a modified soft tissue cast . a polymethylmethacrylate based resilient liner ( permasoft denture liner - pink ; dentsply austenal , york pa , usa ) was carefully mixed and applied onto the facial and proximal aspects of the impression surface around the prepared teeth and edentulous spaces with a small painting brush ( camlin , mumbai , india ) ( fig . care was taken to prevent seepage of the resilient liner over the teeth and lingual gingival impression surfaces during the liner application . the undercuts ( in the form of irregular surfaces ) were prepared in the resilient liner as shown in figure 3 to achieve mechanical interlocking in the gypsum material . the teeth and lingual gingival areas were reproduced in gypsum material to accomplish sufficient bulk for strength . in addition , lingual preparation margins were usually kept supra - gingivally , hence the use of resilient material in lingual surfaces was not necessary . the resilient liner was polymerized by immersing the liner - applied portion of the impression in the hot water ( 60 for 2 - 4 minutes ) as per the manufacturer 's instructions . the water temperature should not be increased more than 70 to prevent any dimensional change in the impression.9 after complete polymerization of the resilient liner , remaining portion of the impression was poured in type iii gypsum material ( kalstone ; kalabhai karson , mumbai , india ) . the cast was retrieved from the impression after setting of the gypsum material ( fig . the polymethylmethacrylate based resilient liner could be easily separated from the silicone - based impression ; hence , the separating medium was not required before pouring . the resultant cast was produced with facial and proximal gingival surfaces in resilient liner material and rest of the cast in gypsum material . this soft tissue cast was used along with master cast to develop and evaluate ideal axial contours of the fixed partial denture ( fig . 5 , 6 ) . merely pouring a second cast from the final impression in a rigid polyvinyl - siloxane impression material and using it as a soft tissue guide has been suggested.5,6 similar procedure of pouring of a second cast in the final impression as a soft tissue cast was performed with changes in the materials . according to some authors , the problem with this approach is that the gingival tissue has been retracted , and the cast does not correspond accurately to the patient 's intraoral situation.1,8 hence these procedures require conservative tissue management for minimal acceptable retraction that helps reproducing the accessible margins without hampering the gingival tissues architecture much . still some authors have critiqued this procedure , mentioning the problem that the gingiva is not reproduced in a passive state.1 but recording the gingiva in passive state for correct reproduction of the cervical contours sometimes does not allow complete seating of the restorations on the soft tissue cast ( especially for subgingival preparations ) due to collapsing of the marginal gingiva onto the preparation margins . hence , the soft tissue cast reproduced from an impression made with conservative tissue management is safer than from the impression recorded with the gingiva in passive state . tan and ruder recorded gingival form with the partially prepared teeth sparing the marginal areas which is an ideal method , but required an additional impression and cumbersome laboratory procedures.8 williamson et al . described the fabrication of a soft - tissue cast by completely pouring the impression with the elastomeric impression material , which can give the false seating of the restorations due to overall flexibility leading to faulty cervical contours.5 tan and ruder described a simplified technique for creating a soft tissue masque to aid in shaping the gingival contours.8 although , this technique does not require additional clinical visit but it definitely requires additional elastomeric impression and many manipulations with the additional impression to form the removable gingival masque , which is technique sensitive and time consuming . described a technique that simultaneously registers maximal intercuspal position and gingival emergence profile.1 this technique requires additional clinical visit and the technique sensitive clinical as well as laboratory procedures to reproduce the gingival emergence profile . bassiouny and yearwood described establishment of gingival emergence profile by creating a soft tissue masque in which the additional manipulation with the final impression is required by making channels for incorporation of resilient material.6 the principal advantage of this technique is that , the consistencies of materials used to fabricate the cast simulate consistencies of the oral tissues as gingival areas ( being soft ) allow better perception for the technician to contour the marginal porcelain and the tooth - structure areas ( being hard ) facilitates accurate fit - checking of the restoration without flexion or distortion . in addition , pink color of the resilient material used in this technique provides gingival colored background ( which is a closer looking platform ) that helps technician in better color perception during evaluation of the final contours . special care must be exercised when selecting materials to be used for soft tissue casts.10 most of the resilient materials used for the soft tissue casts are incompatible with impression materials and often require a separating medium causing blockage of the impression details.11 gerrow and price studied the surface detail reproduction of different flexible die material systems and concluded that the surface detail reproduction was adversely affected when a separator was required between the impression and flexible die material.11 polymethylmethacrylate based resilient material used in this technique is compatible with the silicone based elastomeric impression material and eliminates the use of separating medium . pouring the desired area of the impression with soft material and remaining in hard material requires more time and technique sensitivity than pouring it completely in either of the material . looking at the disadvantage versus advantage ratio the technique is more beneficial at the expense of additional time required . the resilient liner should be carefully poured to prevent the seepage into the tooth - surface areas . an accidental seepage of small amount of material on the tooth surfaces does not significantly affect the desired outcome . the resilient liner poured in the impression was carefully cured at the temperature about 60 to avoid any possible dimensional changes . studied dimensional stability of a polyvinylsiloxane impression material following ethylene oxide and steam autoclave sterilization.9 they concluded that impressions sterilized by ethylene oxide ( 71 ) were acceptable for use in the construction of fixed or removable prostheses compared to that with steam sterilization ( 132 ) which were not acceptable . the dimensional stability of the polyvinylsiloxane impression material is affected with increased steam autoclave temperature cycle . the materials used in this procedure are relatively less expensive , readily available , and easy to use . the technique described in this article is relatively quicker and more cost effective than previously described techniques . this technique does not require additional clinical appointment , second impression procedure , technique sensitive manipulations with impression , and cumbersome laboratory procedures . the simplicity of this technique facilitates and justifies its routine use in fabrication of fixed dental prosthesis .

in process of fabrication of a fixed partial denture , dies are trimmed to expose margins of the preparations . the need for the soft tissue cast is quite evident as the soft tissue emergence profile that surrounds the prepared tooth is destroyed in the process of fabrication . this article describes a modified technique to fabricate the soft tissue cast for the conventional fixed partial denture . the impression made with the polyvinylsiloxane was first poured to prepare the die cast . after retrieval of the cast , the same impression was poured second time with the resin based resilient material to cover the facial and proximal gingival areas . the remaining portion of the impression was poured with the gypsum material . this technique does not require additional clinical appointment , second impression procedure , technique sensitive manipulations with impression , or cumbersome laboratory procedures . the simplicity of this technique facilitates and justifies its routine use in fabrication of the fixed partial denture .

although the first report on circulating tumors was published by ashworth in 1869 , the lack of technology precluded further investigations on their clinical use until recently . developments in immunological and quantitative real - time pcr - based analysis have enabled the detection , enumeration and characterization of circulating tumor cells ( ctcs ) . the monitoring of ctcs has the potential to improve therapeutic management at an early stage and also to identify patients with increased risk of tumor progression or recurrence before the onset of clinically detected metastasis . furthermore , the molecular profiling of ctcs can provide new insights into cancer biology and systemic treatment in neoadjuvant or adjuvant settings . it is assumed that the detection of ctcs is associated with cancer , based on the finding that ctcs can be detected in all major cancers and not in healthy subjects or those with benign disease . most of the assays are based on enrichment and subsequent identification of ctcs using monoclonal antibodies directed against epithelial epitopes , for example , the transmembrane glycoprotein epithelial cell adhesion molecule ( epcam ) or cytokeratins that are expressed on both normal and malignant cells . this widely based approach is based on the fact that blood cells usually lack detectable expression of epithelial markers , being of mesenchymal origin . what remains to be confirmed is whether or not trafficking of normal epithelial cells could occur in certain benign conditions and might contribute to false positive findings in the current assay methods unless unambiguous criteria for the malignant nature of the marker positive cells are used . however , although the number of epithelial cells in the blood of healthy individuals and patients with a variety of nonmalignant disease is low , they may be present in 0.3% of cases . furthermore , using the epcam - based cellsearch ( veridex ) methodology , pantel et al . showed that circulating epithelial cells are found in between 0% and 18.7% of patients with benign colonic disease ; the epispot cytokeratin 19 assay found circulating epithelial cells in between 8.3% and 28.6% of patients with benign colonic disease . therefore , in patients 's pretreatment , with suspicion of cancer , or during followup of cancer patients where normal tissue persists , such as in breast or colon cancer , the detection of these benign cells could be interpreted as a relapse of the primary cancer . this is in addition to the potential problem of ctcs that do not express epcam or cytokeratins . the use of the biomarker p504s , although not prostate specific , has facilitated the differentiation between normal , dysplastic , and malignant tissues in prostate biopsy samples . normal or benign cells do not express p504s , whereas cells arising from prostatic intraepithelial neoplasia ( pin ) or cancer are positive . thus , at least in prostate cancer patients , the use of double immunomarcation could resolve this problem , whereby a malignant circulating prostate cell ( cpc ) would need to express both psa and p504s , a benign cpc only psa . the prostate tumor early cancer test ( protect ) study was started in 2008 ; the first stage evaluated 409 consecutive men attending a prostate cancer screening program in chile . the thirty women acting as controls were all cpc negative ; in the 409 men , the frequency of malignant cpc detection increased significantly with age and psa level and is associated with a biopsy positive for cancer . it was possible to detect malignant cpcs even at serum psa levels of < 2.0 ng / ml . the second stage was to determine the diagnostic yield of men with suspicion of prostate cancer because of an elevated serum psa and/or abnormal dre ; 228 consecutive men undergoing prostate biopsy had a blood sample taken immediately beforehand to determine the presence or absence of malignant cpcs . the detection of malignant cpcs had a sensibility of 86.2% , specificity of 90.8% , a positive predictive value of 78.9% , and a negative predictive value of 94.3% . it was noted that in some men without cancer detected on biopsy p504s negative , cpcs were detected . in the present study , we analyze prospectively a cohort of patients with suspicion of prostate cancer based on an increased serum psa and/or abnormal digital rectal examination and the presence of benign cpcs , defined as psa positive p504s negative cells detected in venous blood and the results of the prostate biopsy . the study was carried out between january 2009 and november 2012 , in the hospital de carabineros de chile ( hoscar ) and the hospital de la direccin de prevision de carabineros de chile ( dipreca ) . the study protocol and written consent forms were approved by the ethical committees of all the three centers . consecutive men , aged between 45 and 80 years presenting to a prostate cancer screening program , without a previous history of prostate cancer or prostate biopsy and fulfilling the criteria a 12-core ultrasound guided transrectal pb were invited to participate . biopsy criteria were serum psa 4.0 ng / ml , serum psa > 0.75 ng / ml / year , and/or digital rectal examination ( dre ) abnormal or suspicious of cancer . this was defined as the presence of a nodule , areas of indurations , or asymmetry in the size of the lateral lobes . immediately before pb , an 8ml venous blood sample was taken in a tube containing edta ( beckinson - vacutainer ) . samples were maintained at 4c and processed within 48 hours . the prostate biopsy and cpc detection were independently analyzed , with the evaluators being blinded to the clinical details and results of the biopsy or cpc test . mononuclear cells were obtained by differential centrifugation using histopaque 1.077 ( sigma - aldrich ) , washed and resuspended in 100 l of autologous plasma . 25 l aliquots was used to make slides ( silianized , dako , ca usa ) , dried in air for 24 hours , and fixed in a solution of 70% ethanol , 5% formaldehyde and 25% phosphate buffered saline ph 7.4 . cpcs were detected using a monoclonal antibody directed against psa , clone 28a4 ( novocastra laboratory , uk ) , and identified using an alkaline phosphatase - anti alkaline phosphatase - based system ( lsab2 , dako , usa ) , with new fuschin as the chromogen . positive samples underwent a second process with anti - p504s clone 13h4 ( dako , usa ) and identified with a peroxidase - based system ( lsab2 , dako , usa ) with dab ( 3,3diaminobenzidine tetrahydrochloride ) as the chromogen , according to the manufacturers ' instructions . a cpc was defined according to the criteria of ( international society of hematotherapy and genetic engineering ) ishage and the expression of p504s according to the consensus of the american association of pathologists . a malignant cpc was defined as a cell that expressed psa and p504s and a benign cpc as a cell that expressed psa but not p504s , and leucocytes could be p504s positive or negative but did not express psa ( figures 1(a)1(c ) ) . the discrimination of the detection of benign cpcs was defined using the normal parameters : true positive ( tp ) , false positive ( fp ) , false negative ( fn ) , and true negative ( tn ) . the predictive values , positive ( ppv ) , and negative ( npv ) were evaluated , as well as the positive and negative likelihood ratios ( + lr and lr , resp . ) . descriptive statistics were used for demographic variables , expressed as mean and standard deviation in case of continuous variables with a normal distribution . in case of an asymmetrical distribution , the median and interquartile range ( iqr ) values were used . student 's t - test was used to compare continuous variables with a normal distribution , the mann - whitney test for ordinate and continuous variables with a nonnormal distribution , and chi - squared for the differences in frequency . the diagnostic yield for the test - detecting benign cpcs for this purpose patients were classified as having or not having prostate cancer . for the purpose of the use of the number of mcpcs detected / ml as a diagnostic tool , and only as a mathematical exercise , the number of mcpcs / ml was considered as a continuous variable . analysis was performed using the stata 11.0 program ( statacorp lp , college station , tx , usa ) . the mean age was 65.6 8.9 years and the median serum psa was 5.20 ng / ml ( interquartile range ( iqr ) 4.317.30 ng / ml ) . a total of 21(5.9% ) men had cpcs p504s negative detected ( table 1 ) . the presence of p504s negative cpcs had a sensitivity of 9.29% ( 95% ci 5.8513.85% ) of detecting benign disease with a specificity of 100% ( 95% ci 96.78100.00 ) . the positive predictive value for benign disease was 100% ( 95% ci 83.75100.00% ) and the negative was predictive value 35.74% ( 95% ci 30.4841.23% ) . the prevalence of benign disease ( no cancer ) was 61.67% ( 95% ci 61.6871.47% ) . of the men with prostate cancer detected on biopsy , none had cpcs psa ( + ) p504s ( ) detected . the pathology report was defined as benign hyperplasia , benign hyperplasia with small foci of chronic prostatitis , or hyperplasia benign with chronic prostatitis . cpcs psa ( + ) p504s ( ) were associated with chronic prostatitis , with the frequency of benign cpcs being detected in 226 biopsies without evidence of prostate cancer , being 1/98 ( 1.0% ) benign hyperplasia , 4/89 ( 4,5% ) benign hyperplasia with small foci of chronic prostatitis , and 16/39 ( 41.0% ) of men with benign hyperplasia with chronic prostatitis . chi - squared for trends , p < 0.0001 , with an overall risk of 1.00 , 4.51 , and 82.00 , respectively . it has been considered that only cancer cells have the ability to disseminate or migrate into the circulation . however , these results and those published by pantel et al . suggest that benign inflammatory disease cells can escape into the circulation . the diagnosis of positively tested patients for psa positive cpcs was based according to the strict criteria defined by ishage with internal positive and negative controls . this finding is consistent with the fact that inflammatory cytokines can stimulate the migration of epithelial cells . with respect to prostate cancer and the role of cpcs in its detection or in patients ' pretreatment , the potential background of nonmalignant prostate cells in blood may be an important confounding factor and lead to false - positive findings in cpc diagnostics . the fact that these benign cpcs do not express p504s is important . in published studies using cpcs as a sequential test to detect prostate cancer , double immunostaining was used , only cpcs psa ( + ) p504s ( + ) were considered to be malignant , whereas cells psa ( + ) p504s ( ) were considered to be benign and patients were classified as negative for cancer . the results suggest that although p504s ( ) cpcs are specific for benign disease , they are not sensitive in its detection ; however , there is no association with the presence of a cancer . this has implications on systems based on epcam , cytokeratin , or psa alone and may explain why no significant differences were found on the frequency of cpcs detected in early prostate cancer and controls [ 1315 ] . similarly using rt - pcr , 8% of patients with benign prostatic disease had cpcs detected . in men after radical prostatectomy , there are no native prostate cells ; thus all cpcs detected in blood have disseminated from metastatic microfoci and thus clinically represent cancer cells . this may explain why after primary surgery the use of epcam- , cytokeratin- or psa - based markers is associated with prognosis and survival . however , after radiotherapy or brachytherapy with residual normal prostate tissue , this may not be the case . the fact that men with benign prostate cells detected did not have prostate cancer in the second or third biopsies decreases the possibility that some of these false - positive events were actually tumor cells arising from undetected cancer . however , in other tumors such as colon or breast where there is normal tissue present , this may cause clinical uncertainty as there is no marker such as p504s to differentiate between benign and malignant . this study stresses the need that cpc detection , and by inference ctc detection used as a screening test or in patients with normal tissue remaining after primary treatment , should be further classified to determine their malignant state . in prostate patients , the use of double immunomarcation with p504s permits this differentiation and allows the test to be used in patients ' pretreatment . in other cancers , the use of epcam- or cytokeratin - based methods does not permit this differentiation , given that most patients with benign inflammatory diseases have an excellent prognosis and will not develop cancer . in summary , patients with chronic prostatitis may have circulating prostate cells detected in blood , which do not express the enzyme p504s and should be thought of as benign in nature . in other cancers , the presence of benign inflammatory tissue may cause migration of benign cells into the blood and thus cause false - positive findings .

introduction . developments in immunological and quantitative real - time pcr - based analysis have enabled the detection , enumeration , and characterization of circulating tumor cells ( ctcs ) . it is assumed that the detection of ctcs is associated with cancer , based on the finding that ctcs can be detected in all major cancer and not in healthy subjects or those with benign disease . methods and patients . consecutive men , with suspicion of prostate cancer , had blood samples taken before prostate biopsy ; mononuclear cells were obtained using differential gel centrifugation and cpcs detecting using anti - psa immunocytochemistry . positive samples underwent further classification with anti - p504s . results . 329 men underwent prostate biopsy ; of these men 83 underwent a second biopsy and 44 a third one . of those with a biopsy negative for cancer , 19/226 ( 8.4% ) had cpcs psa ( + ) p504s ( ) detected at first biopsy , 6/74 ( 8.1% ) at second biopsy , and 5/33 ( 15.2% ) at third biopsy . men with cancer - positive biopsies did not have psa ( + ) p504s ( ) cpcs detected . these benign cells were associated with chronic prostatitis . conclusions . patients with chronic prostatitis may have circulating prostate cells detected in blood , which do not express the enzyme p504s and should be thought of as benign in nature .

kikuchi - fujimoto disease ( kfd ) is a benign , self - limiting disease characterized by histiocytic necrotising lymphadenitis . in 1972 , the exact cause of kfd is unknown and it is suspected that viral agents or autoimmune aetiology may have some role . a wide range of possible associations of the disease with agents like yersinia enterocolitica , toxoplasma gondii , epstein - barr virus , cytomegalovirus and a host of other viruses has been suggested , but not proven to be contributory . some consider kfd to be a sle - like autoimmune condition caused by virus - infected transformed lymphocytes . we report a case of intra - abdominal lymphadenitis that presented as fever of unknown origin(fuo ) and diagnosed by excisional biopsy as a case of kfd . a 32-year - old male , a resident of gwalior in central india , presented with complaints of fever , weight loss , and decreased appetite since one month prior to presentation . fever was high grade ( daily spikes of up to 102f ) , intermittent , and not associated with chills or rash . physical examination revealed an average built and well - nourished male with no evidence of any significant findings on general or systemic examination . the haemogram was conspicuous for the lack of leucocytosis with a low normal total leucocyte count ( tlc ) of 4200 cells / mm . the differential counts showed neutrophils 62% , lymphocytes 29% , eosinophils1% , basophils 0% , and monocytes 8% . erythrocyte sedimentation rate ( esr ) was significantly raised at 95 mm at the end of the first hour . hiv - i and hiv - ii , hbsag , and anti - hcv were negative . ultrasonography ( usg ) of the abdomen revealed mild hepatomegaly with multiple mesenteric lymph nodes and omental mesenteric thickening in the right lower abdomen suggestive of an infective etiology such as koch s abdomen . usg - guided fine - needle aspiration(fna ) taken from the mesenteric lymph nodes showed lymphocyte predominance , few centro blasts , and centrocytes in the background of lympho glandular bodies and red blood cells without granuloma and epitheloid cells ; which is suggestive of reactive lymphadenopathy . the patient was further subjected to a full fuo workup , including blood tests for malarial antigen as well as parasite , widal test , dengue serology , leptospira serology , scrub - typhus serology and rpr for syphilis . blood cultures were taken on three different occasions from three different sites and all were sterile . a further workup was initiated to rule out any connective tissue disorders , and antinuclear antibody ( quantitative ) , cytoplasmic antineutrophil cytoplasmic antibody , perinuclear antineutrophil cytoplasmic antibody , and serum cryoglobulins were found to be normal . furthermore , a bone marrow aspiration and biopsy tests were done , which only revealed a cellular active bone marrow with all normal haematopoietic elements and no abnormal cells . furthermore , a contrast - enhanced computed tomography ( cect ) of the thorax and whole abdomen was done . it revealed subcentimeter nodes in the bilateral axillae which were insignificant , and multiple small mildly enlarged lymph nodes ( 5 - 25 mm ) in the right iliac fossa along mesenteric and right iliac vessels without evidence of obvious internal necrosis or calcification suggestive of infective or inflammatory pathology ( e.g. tubercular ) . as previous usg - guided fna cytology was inconclusive , the patient was subjected to a diagnostic laparoscopy and excisional biopsy of the iliac lymph nodes . intraoperative findings revealed a normal bowel with thickened omentum and multiple enlarged mesenteric lymphnodes along external iliac vessels . the omental and liver biopsies were unremarkable while the lymph node biopsy revealed large geographic areas of necrosis involving 70% of the total nodal area with extensive karyorrhectic debris with the absence of neutrophils , plasma cells , granulomas , afb , or fungal elements ( figures 1 - 3 ) . lymph node showing geographic areas of necrosis with focally preserved follicles ( h&e , 40 ) . lymph node showing large areas of necrosis with focally preserved follicles ( h&e , 100 ) . necrosis with prominent karryorrhectic debris , which is devoid of neutrophils and plasma cells ( h&e , 400 ) . considering the clinical presentation and laboratorial profile of high esr , low normal tlc and necrotising lymphadenitis , a diagnosis of kfd was considered and the patient was started on oral prednisolone at an initial dose of 40 mg / kg and later tapered . consequently , serologies for yersinia , toxoplasma , ebv , cmv , hsv - i and hsv - ii , as well as parvovirus were sent and all were negative . the patient noted a significant improvement in symptoms by day 3 with the absence of fever and resumption of normal appetite by day 5 . he was discharged on day 7 and was later followed up for 1 year through outpatient visits and telephonic interviews . it is diagnosed on the basis of histopathological evaluation , which characteristically shows necrotising lymphadenitis . . typically it is found among young asian women , in a ratio of 4:1 ( female : male ) with most cases being under the age of 30 years . the onset could be acute or subacute , evolving over two to three weeks . bosch et al . reported that the most frequent site of lymphadenopathy is cervical lymph nodes(56%98% ) , more commonly occurs in the posterior cervical triangle(88.5% ) , and is generally unilateral ( 88.5% ) and localised . less frequent symptoms include weight loss , nausea , vomiting , sore throat , and night sweats . skin lesions like maculopapular , morbilliform , urticarial rashes , or a disseminated erythema have been reported . elevated esr and neutropenia were the prominent haematological findings in a review of the literature on kfd . this disorder does not have a characteristic radiological appearance . in a study of 96 retrospective ct scans of patients with confirmed kfd , kwon et al . found that multiple homogeneous lymphadenopathies involving levels ii to v were found in most , with 94% being smaller than 2.5 cm . diagnosis is based on lymph node histology with excision biopsy providing the best diagnostic accuracy . abdominal tuberculosis , non - hodgkin s lymphoma , systemic lupus erythematosus or infections like t. gondiior yersinia enterocolitica are close differential diagnoses and may have similar clinical and/or pathological presentation . our case was a rare presentation of kfd , presenting in a male patient , conspicuous in the absence of cervical lymphadenopathy and presenting with localised intra - abdominal lymphnodes in the right iliac fossa . such a presentation in a tropical country like india usually leads the clinician to suspect tuberculosis . intra - abdominal lymphadenopathy was reported in 2.6 - 4.3% of the cases in theexisting literature . only 28 cases of kfd involving intra - abdominal lymphadenopathy have been reported in the japanese and english literature . a review of kfd cases involving intra - abdominal lymph nodes reported an almost equal occurrence in males , with fever followed by abdominal pain being the most common presenting symptoms . mesenteric lymph nodes , including iliac lymphadenopathy was seen in 16 of the total 28 reported cases . however , kfd should be considered in young adults with intra - abdominal lymphadenopathy with symptoms such as night sweats , weight loss and nausea instead of blindly favouring other common diagnoses like tb or lymphoma . this case serves as a reminder that differential diagnosis of pyrexia of unknown origin should not unduly skewed based on the common disease principle .

kikuchi - fujimoto disease ( kfd ) is a benign , self - limiting disease characterized by histiocytic necrotising lymphadenitis . though several viral agents or an autoimmune etiology has been proposed as causative , the exact cause remains unknown . it has a female predilection and most commonly seen among young asian people . patients usually present with a febrile illness and the presence of lymphadenopathy may provide a clue to diagnosis . the most common site of lymphadenopathy is cervical lymph nodes while intra - abdominal involvement is uncommon . cases of kfd presenting with intra - abdominal lymphadenopathy have been reported to occur with equal frequency in both sexes . abdominal tuberculosis , non - hodgkin s lymphoma , and systemic lupus erythematosus are close differential diagnoses for this type of presentation . treatment is mostly supportive as the disease usually resolves spontaneously ; steroids are only required in severe cases . we report a 32-year - old male patient of intra - abdominal lymphadenitis that presented as fever of unknown origin ( fuo ) and diagnosed by excisional biopsy as a case of kfd .

cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy ( cadasil ) is a hereditary disease of the cerebral small blood vessels caused by mutations in the notch 3 gene.1 the main clinical manifestations are recurrent ischemic strokes , migraine , and progressive cognitive impairment.1 epileptic seizures have only been reported in 511% of patients with cadasil.2,3 moreover , the occurrence of a seizure is very rare as an initial manifestation in patients with cadasil.2,3 here , we describe a patient with cadasil who initially presented with a seizure . a 43-year - old male patient visited the emergency department because of a new - onset seizure . according to the witness , the patient was talking on the phone to his office staff , and then he suddenly screamed and fell on the floor . soon he developed a generalized tonic - clonic seizure for about 3 minutes followed by postictal confusion that lasted several seconds . he denied a history of febrile convulsion and an infection involving the central nervous system . he was a current smoker and had hypercholesterolemia , but he did not experience a transient ischemic attack , recurrent headache , or psychiatric illness . his family history showed that his father died of stroke , and his mother had epilepsy due to neurocysticercosis . the serum glucose level increased up to 164 mg / dl ; otherwise , there were no other abnormal laboratory findings . a 1.5-t brain magnetic resonance imaging ( mri ) scan showed multiple white matter hyperintensity lesions on both periventricular white matter , anterior temporal lobes and external capsules ( fig . a scalp electroencephalogram showed frequent focal spikes over the left frontal area and secondary bilateral synchrony ( fig . results of the genetic test showed that the patient had a heterozygote r544c mutation at exon 11 of the notch 3 gene . initially , oxcarbazepine ( 600 mg daily ) was given to the patient for seizure control . the patient had been seizure - free after antiepileptic drug treatment during the 5-year follow - up . seizures are uncommon manifestations in patients with cadasil.2,3 they usually occur following a stroke , and they are often characterized by generalized tonic - clonic seizures in patients with cadasil . in a report of 102 patients with cadasil , 10% of them had seizures . most of these patients had generalized seizures ( 9 of 10 patients ) , and they had a history of previous stroke ; however , none of them had a seizure as the initial manifestation.3 a pooled data analysis of cadasil demonstrated that 6 of 105 patients experienced seizures , and in only 3 of them , seizures occurred as an initial manifestation.2 recently , two patients with cadasil who initially presented with seizures were reported.4,5 a focal seizure arising from the parie - to - occipital junction was reported in one case.4 in the other case , focal status epilepticus of left hemispheric origin was reported.5 however , in either of these reports , the mechanism of seizures associated with cadasil was not mentioned . although the exact cause of an epileptic seizure in patients with cadasil is currently unknown , high - signal - intensity lesions frequently found on anterior temporal regions may be associated with epileptogenesis in these patients . patients with temporal lobe epilepsy ( tle ) sometimes have white matter abnormalities in the anterior temporal lobe ( waatl ) , which are also frequently observed in patients with cadasil.3,6 waatl are clinically useful because they indicate the side of the seizure foci in patients with tle.6,7 in a post - mortem high - resolution 7-t mri study , a large number of cortical lesions and subcortical lesions were also shown in patients with cadasil.8 recently , gasparini et al . suggested a noteworthy hypothesis on the association between leukoaraiosis and epileptic seizures . they asserted that occult cortical micro - infarcts may be associated with epilepsy in patients with leukoaraiosis.7 leukoaraiosis is commonly observed on mri scans of patients with cadasil;9 hence , epileptogenic cortical lesions can lead to seizures in patients with cadasil . unfortunately , high - resolution 7-t mri could not be performed to identify cortical lesions in the present patient , because it is currently unavailable at our clinic . in some previous reports , cholinergic denervation in the cerebral cortex and white matter tract has been observed in patients with cadasil.10 cholinergic neurons modulate excitability in the central nervous system.11 additionally , several experimental studies have demonstrated that cholinergic denervation may generate seizures through the facilitation of kindling.11 interestingly , keverne et al . reported cholinergic neuronal damage along white matter tracts that mainly reached toward the frontal cortices in nine patients with cadasil.12 consequently , susceptibility to seizures may be increased in patients with cadasil , as white matter lesions in the frontal lobe seem more prone to epileptic seizures than those in the temporal lobe . therefore , our patient s seizure could have originated from the frontal region despite involvement of the temporal white matter . although seizures are uncommon and likely to occur with a stroke in patients with cadasil , patients with this disease can initially present with a seizure . when physicians encounter patients with new - onset seizures with an unexplained white matter lesion on a brain mri scan , they should consider cadasil . in addition , the exact mechanism of seizure development is still unclear , so further research with more patients with cadasil is warranted .

cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy ( cadasil ) is a hereditary disease of the cerebral small blood vessels characterized by recurrent ischemic strokes , migraine , and progressive cognitive impairment . in patients with cadasil , in whom subcortical white matter structures are typically involved , epileptic seizures have been rarely reported as an initial clinical symptom . we describe a patient genetically confirmed as having cadasil who initially presented with a seizure .

in recent years a lot of effort has been undertaken in order to prepare and investigate ordered structures of -conjugated organic molecules on nanoscopic and mesoscopic scales . the interest of both fundamental and applied science was mainly driven by the goal to understand and improve the properties of materials used for organic electronics ( e.g. , light emitting diodes , field effect transistors and solar cells ) and to establish novel systems for optical applications ( e.g. , waveguiding and lasing ) . frequently small rodlike molecules like oligothiophenes , oligoacenes and oligophenylenes have been selected as model systems . in the group of oligothiophenes sexithiophene ( 6 t ) has shown interesting high quality properties like a charge carrier mobility of up to 0.1 cm/(v s ) . consequently there has been an interest in understanding the growth mechanism of such molecules on well - defined model substrates like single crystalline cu , sheet silicates or patterned sio2 . the study in this paper aims at providing a conclusive picture of the formation of 6 t nanostructures by an in - depth analysis of the growth on an alkali - halide single crystal , namely potassium chloride ( kcl ) . kcl exhibits a face centered cubic crystal structure with a lattice constant of 6.36 . the unit cell of the ( 100 ) surface can be described by the 2d - space group p4 mm as shown in figure 1 . importantly , this high symmetry surface exhibits rotation centers of order 2 and 4 as well as mirror and gliding planes . it is expected that the symmetry of the substrate will be reflected in the multiplicity of epitaxial alignments of the deposited molecules . ( a ) the ( 100 ) surface of the kcl crystal , with the white rectangle illustrating the surface unit cell . ( b ) the p4 mm symmetry of the surface unit cell including the respective symmetry elements . the hot wall epitaxy ( hwe ) technique was applied for the deposition of the organic material , which allows the growth process to be performed close to thermodynamic equilibrium , and in further consequence relatively high vapor pressure of the organic deposit in the substrate region can be achieved . therefore the requirements concerning vacuum conditions are reduced as compared to , e.g. , molecular beam epitaxy . the source material 6 t was purified twice by thermal sublimation before filling it into the quartz tube of the hwe reactor . kcl substrates were transferred into the deposition chamber via a load lock and subsequently preheated at the deposition temperature ( 60135 c ) for 30 min to clean the surface from adsorbed species and to ensure a stable temperature during the whole deposition process . the deposition was performed thereafter under a base pressure of 9 10 mbar at a nominal deposition rate of 0.4 nm / min . x - ray diffraction ( xrd ) measurements were carried out on a philips xpert x - ray diffractometer using cr k radiation ( = 2.29 ) and a secondary graphite monochromator . brentano configuration by varying the z - component of the scattering vector q. consequently it is possible to detect lattice planes which are parallel to the sample surface . pole figures are acquired by measuring at a constant length of q and only varying its direction . based on both the observed bragg peaks of the specular scan and the direction of the poles ( net - plane normals ) within the pole figures , the involved crystallographic phases as well as the azimuthal alignment of the crystallites with respect to the substrate can be identified . optical microscope images have been acquired by a nikon labophot 2a microscope in combination with a nikon type 115 digital camera . scanning force microscopy ( sfm ) studies of the deposited organic films were performed using a digital instruments dimension 3100 in the tapping mode . the images have been acquired at scan speeds of 46 m / s using sic tips exhibiting a cone angle of 40. nominal values for resonance frequency and tip radius are 325 khz and 10 nm respectively . in this paper we reported on epitaxial growth of 6 t on kcl ( 100 ) , which was examined by crystallographic and morphological investigations . by means of sfm analysis different morphologies furthermore , it was found that the area covered by islands is declining with increasing substrate temperature , whereas the sample area covered by needles is constant over the investigated temperature range ( 60135 c ) . consequently we can draw the conclusion that needle - like structures are energetically more stable as compared to flat islands formed of standing 6 t molecules on kcl ( 100 ) . additionally , different activation energies for the growth of nanoneedles in height and width have been deduced from sfm analysis , namely , 0.26 0.02 ev and 0.15 0.04 ev , respectively . by means of xrd specular scans it was possible to determine the contact planes of the structures on the surface . needles with { 010 } and { 411 } and islands with the { 100 } facet parallel to the substrate surface have been detected . utilizing xrd pole figures and fft analysis of optical microscope images we observed that there is a well - defined azimuthal alignment of the structures on the surface in addition to the stacking in growth direction . notably structures with { 100 } and { 411 } contact planes are in perfect azimuthal alignment to each other , which is explained by ledge directed epitaxy of the islands on the sidewalls of already existing needles . the orientation of the crystallographic structures which are present on the substrate surface fulfills the growth model for rodlike molecules on sheet silicate substrates developed by simbrunner et al . therein it is explained that the adsorption of a single molecule dominates in a first step and the nucleation of organic crystallites which follows thereafter only leads to a slight reorientation of the lmas . in particular rotational and mirror symmetries have to be reflected by the formed needle orientations . the latter considerations are substantiated by the results presented in this paper . the 4-fold rotational symmetry and the mirror symmetry of the kcl ( 100 ) substrate surface leads to eight distinct growth directions of each crystal type . moreover two different crystal contact planes , namely , { 010 } and { 411 } , are characterized by an analogous lma orientation as similarly observed for p - hexaphenyl on kcl ( 100 ) . this hints that the adsorption geometry of single molecules seems to be decisive for the organic crystal nucleation as expected by the growth model . the fact that one adsorption geometry can lead to different crystal contact planes may be explained by polymorphs of the first monolayer , that are both based on the same azimuthal orientation of the lma on the substrate surface . the argument is supported by the fact that monolayer polymorphs of 6 t have already been reported on ag ( 001 ) and ag ( 110 ) . concluding the latter discussion it can be stated that the azimuthal alignment of the organic crystals and molecules is basically determined by a two step process . the initial phase is dominated by the adsorption of single molecules in their energetically preferred adsorption geometry on the substrate surface . this adsorption process is mainly determined by an interplay between substrate geometry , molecular geometry and importantly symmetry properties . in the second step , where the organic crystal nucleation takes place , only a slight azimuthal realignment of the molecules can be caused in order to optimize the lattice match at the interface .

the morphology and structure of sexithiophene deposited on kcl ( 100 ) substrates was investigated by scanning force microscopy and specular x - ray diffraction measurements . two different needle - like structures with { 010 } and { 411 } contact planes have been observed as well as islands of almost upright standing sexithiophene molecules with a { 100 } contact plane . furthermore an azimuthal alignment of all three crystal orientations was observed by x - ray diffraction pole figure measurements , and the growth directions reflect the 4-fold rotational symmetry of the substrate surface . in addition the analysis of crystals with { 411 } and { 100 } contact planes unveiled that they share a common crystallographic direction which is explained by ledge directed epitaxy .

smooth muscle tumors of uncertain malignant potential ( stump ) are mesenchymal uterine tumors lying between benign leiomyomas and leiomyosarcomas . the term stump the value , in the differential diagnosis , of a number of surface markers , like p16 and p21 , has been studied . they are usually clinically benign but , in some cases , recurrence can occur many years following hysterectomy . little is known about metastasis of these tumors and , until march 2011 , there was no case reporting lung metastasis and especially multiple pulmonary nodules and pleural effusion due to stump . on the other hand , benign metastasizing leiomyomas is a clinicopathologic condition where pathologically benign smooth muscle neoplasms derived from uterine leiomyomas metastasize to extrauterine sites , like lung , pelvic lymph nodes or abdomen surfaces . a case of a 51-year - old woman , gravida 0 - para 0 , who was admitted with progressive dyspnea on exertion is presented . the past medical history revealed that 3 years ago and due to persisting menorrhagia , the patient underwent dilatation and curettage . histopathologically , after thorough gross processing of the specimen , an intramural smooth muscle tumor of the uterus with a diameter measuring 5 cm was identified and six ( 6 ) sections from the tumor were obtained . microscopy showed mild mitotic activity ( 26 mf/10 hpf ) , moderate nuclear atypia and lack of tumor necrosis [ figure 1 ] . a second typical leiomyoma , adenomyosis and sparse areas of thin - walled arteriolar type ( plexiform ) vessels were also identified but with no typical indication of endometrial malignancy present . the absence of necrosis and atypical mitosis made pathologists consider that the tumor belongs to the so - called grey zone or stump . uterine smooth muscle tumor with mild mitotic activity ( smooth muscle tumors of uncertain malignant potential tumor ) chest x - ray and chest computed tomography ( ct ) confirmed the presence of bilateral pulmonary nodules [ figure 2 ] . as multiple metastases due to tumor of unknown origin were suspected , the patient underwent a series of diagnostic tests : brain and abdomen cts , gastroscopy , colonoscopy , bronchoscopy , mammography , thyroid ultrasound and skeletal scintigraphy , none of which indicated primary extrapulmonary tumor . a metastatic malignant smooth muscle cells neoplasm with uterine origin was diagnosed [ figure 3 ] . cell nuclei presented diffuse moderate mitotic activity ( 6 mf/10 hpf ) , but there were also some atypical mitoses . the immunohistochemical examination revealed that the tumor was positive in desmin and smooth muscle actin ( sma ) and negative in cd117 and cd34 . both pathology and cytopathology reports excluded that the condition was associated with benign metastasizing leiomyoma . chest computed tomography was consistent with multiple pulmonary nodules and pleural effusion pathology was consistent with a metastatic pulmonary leiomyosarcoma the patient underwent 14 cycles of chemotherapy , with multiple drug combinations , including ifosfamide , epirubicin , docetaxel , gemcitabine , bevacizumab , cisplatin , cyclophosphamide and vincristine . these tumors are the most common neoplasm of the uterus . on the other hand , leiomyosarcomas are the most common type of uterine sarcomas , accounting for approximately 30% of them . they usually arise de novo and , only in rare cases , a leiomyoma can be transformed into leiomyosarcoma . differential diagnostic criteria distinguishing these tumors from benign myomas include coagulative cell necrosis , moderate to severe cytologic atypia and numerous mitotic figures . some researchers described that this heterogeneous category of neoplasms contains more groups like atypical leiomyomas with limited experience , smooth muscle tumor of low malignant potential , atypical leiomyoma with low risk of reccurence and mitotically active leiomyoma . stump diagnosis should be used sparingly and after a detailed clinical , histopathological and immunohistochemical examination . hematogenous dissemination of uterine leiomyosarcomas is the most common pattern of spread , and lung metastasis occurs in more than half of the patients . however , there is only one case reporting pleural effusion due to sarcoma of the uterine smooth muscle . on the other hand , there is no data about the possible metastatic behavior of uterine stump . in the case presented here , the possibility that the neoplasm was leiomyosarcoma can not be excluded as the zone between the benign and malignant nature of stump is not clear . also , the hypothesis that the metastatic lung focuses derived from malignant transformation of benign uterine metastasizing leiomyomas can not be proved but seems to be extremely unlikely . however , all clinical , histopathological and immunohistochemical indications incline to the stump diagnosis . furthermore , research on new immunohistochemical markers and histopathological characteristics could have some value in the diagnosis of problematic cases . finally , considering the unpredictable clinical behavior of stump and the fact that the malignant potential of some of them is substantial , patients should receive close and long - term follow - up . metastasis can not be excluded and , considering the pattern of metastatic spread of leiomyosarcomas , the lung could be the most common target organ . prognosis can not be determined due to the relative rarity of these tumors and the low experience on chemotherapy effect . however

smooth muscle tumors of uncertain malignant potential ( stump ) are mesenchymal uterine tumors lying between benign leiomyomas and leiomyosarcomas . although lung metastases from uterine leiomyosarcoma are common , stump usually does not metastasize . a case of a 51-year - old woman with progressive dyspnea on exertion and multiple space - occupying lesions in both lungs is presented . she had a history of a total abdominal hysterectomy 3 years ago . lung biopsy through video - assisted thoracic surgery was consistent with metastatic malignant smooth muscle cell tumor . she received multiple cycles of chemotherapy and died 11 months later . cell necrosis , atypia and mitotic count are important criteria determining the malignant potential of a uterine smooth muscle tumor . the diagnosis and clinical course of stump are not totally and clearly known , and metastasis , especially pulmonary with pleural effusion , is not a common phenomenon . when this occurs , prognosis seems to be poor . surveillance of these patients should be close and long term .

mechanical failure of femoral stem after total hip arthroplasty is well reported in the literature . albeit being rare , with the prevalence of 0.2311% , the consequences can be devastating to the patients . three - dimensional analysis dictates highest stress concentrations are around the lateral aspect of the middle third of the femoral stem . femoral stem failure can be broadly categorised to patient - specific factors , technical issues or implant related factors . in revision hip arthroplasty , the safe extraction of retained fractured components remains a challenging prospect as it can be extremely demanding and potentially detrimental to the remaining host bone . therefore , many approaches have been described to address this complex issue before hip reconstruction . among those , the technique of drilling a hole in the exposed proximal part of retained fractured femoral stem and attaching a threaded extraction device , or sophisticated surface undercutting and an extraction device wedged in to facilitate extraction . removal of cemented well fixed broken stem can be also achieved by a femoral trephine technique , femoral cortical window technique , extended femoral osteotomy ( eto ) procedure and retrograde nail impaction via the knee joint . we describe a modified technique for extraction of well - fixed cemented fractured femoral stem . a 52-year - old female had bilateral sequential total hip replacement for idiopathic avascular necrosis of femoral heads . the right hip was cemented charnley elite ( de puy international , leeds , uk ) and the left side was uncemented jri ha coated ( joint replacement institution , sheffield , uk ) total hip arthroplasty . both hip arthroplasties were uneventful . however , 10 years following right total hip replacement , patient started to experience a gradually worsening pain in proximal right thigh with no history of trauma . the fractured stem was approached by creating a small , longitudinal , posterior femoral cortical window measures 1 cm 2 cm just below the level of fracture of femoral stem . through this window , tungsten carbide drill bit ( synthes , west chester , pa , usa ) is employed to create a crater on the proximal end of residual stem posteriorly ( fig . once achieved , a charnley pin is used to disimpact the residual stem through the crater by controlled retrograde orthopaedic mallet blows till the stem is extracted . once stem removed , the cortical window is re - positioned and two - cable ready system ( zimmer , warsaw , in , usa ) applied to secure the cortical window . the cement mantle in this technique is preserved and cement - in - cement technique was performed to achieve femoral stem revision . a small developmental dysplasia of hip ( ddh ) exeter stem was cemented in utilising the cement- in - cement technique ( fig . follow up , the patient was independently mobile with pain free hip and good range of motion . oxford hip score was 47 and harris hip score was 91 . a 74-year - old male patient with bilateral total hip arthroplasties . the last two were for fractured femoral stems . the last revision was in 2004 years and ran a smooth post operative course . in december 2012 , this patient presented acutely with atraumatic crescendo pain in his right hip . this patient sustained preoperative myocardial infarction and the cardiologist advised strongly against discontinuing clopidogrel to maintain the patency of his cardiac stents . the decision was made to revise only the fractured femoral components as full hip revision arthroplasty could have been detrimental to his health . this is because of his multiple co - morbidities and high american society of anaesthesia score ( asa ) of 4 . patient underwent single stage revision surgery where the fractured femoral stem was extracted using this modified extraction technique . the acetabular component was retained and supplemented with a posterior lip augmentation device ( plad ) to secure the hip from any potential future dislocation . at 12 months follow up , patient denies any hip pain and has a stable range of motion . radiographs showed evidence of osseus incorporation of cortical window in both patients ( fig . 5 ) . a 52-year - old female had bilateral sequential total hip replacement for idiopathic avascular necrosis of femoral heads . the right hip was cemented charnley elite ( de puy international , leeds , uk ) and the left side was uncemented jri ha coated ( joint replacement institution , sheffield , uk ) total hip arthroplasty . both hip arthroplasties were uneventful . however , 10 years following right total hip replacement , patient started to experience a gradually worsening pain in proximal right thigh with no history of trauma . the fractured stem was approached by creating a small , longitudinal , posterior femoral cortical window measures 1 cm 2 cm just below the level of fracture of femoral stem . through this window , tungsten carbide drill bit ( synthes , west chester , pa , usa ) is employed to create a crater on the proximal end of residual stem posteriorly ( fig . once achieved , a charnley pin is used to disimpact the residual stem through the crater by controlled retrograde orthopaedic mallet blows till the stem is extracted . once stem removed , the cortical window is re - positioned and two - cable ready system ( zimmer , warsaw , in , usa ) applied to secure the cortical window . the cement mantle in this technique is preserved and cement - in - cement technique was performed to achieve femoral stem revision . a small developmental dysplasia of hip ( ddh ) exeter stem was cemented in utilising the cement- in - cement technique ( fig . follow up , the patient was independently mobile with pain free hip and good range of motion . the last revision was in 2004 years and ran a smooth post operative course . in december 2012 , this patient presented acutely with atraumatic crescendo pain in his right hip . this patient sustained preoperative myocardial infarction and the cardiologist advised strongly against discontinuing clopidogrel to maintain the patency of his cardiac stents . the decision was made to revise only the fractured femoral components as full hip revision arthroplasty could have been detrimental to his health . this is because of his multiple co - morbidities and high american society of anaesthesia score ( asa ) of 4 . patient underwent single stage revision surgery where the fractured femoral stem was extracted using this modified extraction technique . the acetabular component was retained and supplemented with a posterior lip augmentation device ( plad ) to secure the hip from any potential future dislocation . at 12 months follow up , patient denies any hip pain and has a stable range of motion . our proposed method exploits the concept of small cortical window just distal to the proximal part of the broken stem . although utilising the cortical window is not a novel technique , the modification described herein utilising simple instrumentations , using a narrow osteotome , a small rectangular window 1 cm 2 cm is created along the long axis of the proximal femur posteriorly . the other modification includes , after removal of cortical window , a tungsten drill bit is utilised to drill and create a crater the posterior aspect of the well fixed distal broken stem . a charnley pin retractor is used to disimpact the femoral stem by careful and controlled retrograde orthopaedic mallet impaction till the successful extraction is achieved . after stem extraction , the cortical window is keyed - in and secured with cable ready system . in morland 's technique , the cortical window has to be grafted due to cortical destruction using a high speed burr . the cortical window in our method is slightly bigger in dimension ( 1 cm 2 cm in comparison to 0.4 cm 1 cm in morland 's method ) . we believe this is necessary to prevent damage to the rest of femoral bone during drilling and preserving cement mantle during femoral component extraction . this cortical bone window can be readily sealed and secured with cables . in our method , we favour this technique as slot osteotomy in femoral component / synthetic bone construct offer significantly superior stiffness when compared to ( eto ) constructs . in our case series , the first patient had her femoral stem revised to small ddh stem with cement in cement technique . by creating a proximal femoral window , a standard length primary stem can span the window without risking weakening of the femur . femora windowed distal to tip of fractured stem , to aid retrograde tapping , risk stress risers and authors recommend long revision stem to traverse cortical window to prevent periprosthetic fractures . therefore , proximal cortical window was performed because the fracture of femoral stem happened at the proximal one third ; this allowed safe bypassing the cortical window without running the risk of the cortical window acting as a stress riser . therefore , proximal cortical window and the existing cement mantle were sufficient to utilise and offer the patient a primary rather than revision implant . the second patient was a high anaesthetic risk patient who was in significant hip pain and limited mobility due to a fracture of a long revision femoral stem and with evident proximal femoral bone loss ( paprosky iii - b ) . a lengthy single stage revision of both acetabular and femoral components would invariably be associated with high perioperative morbidity and mortality . such symptomatic patient requires short procedure , albeit the revised long stem may re - fracture with time because of poor proximal femoral bony stock . therefore , it was mandatory to implant a long revision femoral stem to address the non supportive femoral metaphysis and the limited diaphysial fixation . in both patients , the preservation of femoral stem cement mantle remains an attractive option as removing bone cement can be detrimental to host bone and can culminate in fractures or perforation . our modified technique offers a simple and controlled method in extracting a well fixed fractured cemented femoral stem . it has the advantage of retaining the cement mantle with subsequent good seal of the femoral cortical window secured with cable ready system . furthermore , tungsten carbide drill bit and charnley pin retractor are relatively readily available to aid the extraction of the broken stem . finally , it yields the option of implanting a standard femoral stem and obviates the need for bypassing the cortical window with long revision femoral component . the removal of well - fixed fractured femoral component can be extremely demanding and potentially detrimental to the remaining host bone . the sliding cortical window technique utilising tungsten carbide drill and charnley pin retractor is technically easy and most importantly ; preserves host bone stock with cement - in - cement revision hip arthroplasty . we believe this technique can be added to the armamentarium of revision hip surgeon when faced with the challenge of extracting a fracture cemented femoral stem . written informed consent was obtained from the patient for publication of this case report and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request the two senior authors supervised , critically revised the article and were the operators in the surgical procedures illustrated .

introductionthe removal of well - fixed broken femoral component and cement mantle can be extremely demanding , time consuming and potentially damaging to the host bone . different methods have been described to extract broken femoral stem yet this remains one of the most challenging prospect to the revision hip surgeon.presentation of casethe authors present two cases underwent a modified sliding cortical window technique utilising a tungsten carbide drill , charnley pin retractor and an orthopaedic mallet to aid extraction of a fractured cemented femoral stem in revision total hip arthroplasty.discussionthe modified technique offers a simple and controlled method in extracting a well fixed fractured cemented femoral stem . it has the advantage of retaining the cement mantle with subsequent good seal of the femoral cortical window secured with cable ready system . furthermore , tungsten carbide drill bit and charnley pin retractor are relatively readily available to aid the extraction of the broken stem . finally , it yields the option of implanting a standard femoral stem and obviates the need for bypassing the cortical window with long revision femoral component.conclusionfractured femoral stem is a rare yet a complex and very demanding prospect to both patients and hip surgeons . the sliding cortical window technique utilising tungsten carbide drill and charnley pin retractor is technically easy and most importantly ; preserves host bone stock with cement - in - cement revision hip arthroplasty . we believe this technique can be added to the armamentarium of revision hip surgeon when faced with the challenge of extracting a fractured cemented femoral stem .

the commonest genetic disorder among africans is sickle cell disease ( scd).12 in nigeria , the prevalence of sickle cell trait is about 25% while the homozygous state is found in about 3% of the population.3 nigeria has the largest population of people with scd , with about 150,000 births annually.45 the aim of this study is to evaluate the prevalent crises and morbidities associated with scd in adolescents in babcock university teaching hospital ( buth ) , to also assess the level of knowledge of these adolescents about scd and to determine their emotional response to the disease . this was a retrospective review of case notes of adolescents with sickle cell anaemia ( aged 1724 years ) that was seen in the emergency room and haematology clinic of buth , ogun state , nigeria from may 2013 to april 2014 . the haematology clinic of buth operates once a week and receives referrals from the babcock university , other units within the clinical department in the hospital and its environs . only adolescents with haemoglobin genotype ss established by the cellulose acetate haemoglobin electrophoresis data extracted from the patients case notes included psychological assessment , age , gender , genotype , history of blood transfusion , complications and crises . data was entered into a microsoft ( ms ) excel spread sheet and analysed using descriptive statistics . a total of 50 adolescents were seen in the hospital during this study period . of these 50 ( aged 1724 years ) , 25 ( 50% ) were males while 25 ( 50% ) were females giving a male / female ratio of 1:1 . forty - nine ( 98% ) were students while one ( 2% ) subject a nurse [ table 1 ] . socio - demographic data vaso - occlusive crises ( voc ) in the form of bone pains ( 93.1% ) were the commonest crises encountered [ table 2 ] . in total , 108 episodes of bone pain were documented giving an average rate of 2.6 episodes per patient . type of cickle cell crises three ( 6% ) adolescents gave a history of previous blood transfusions ( ranging from one to two ) . associated morbidities were malaria 34 ( 85% ) , tonsilitis 1 ( 2.5% ) , pneumonia 1 ( 2.5% ) , leg ulcer 1 ( 2.5% ) , azotaemia 1 ( 2.5% ) and subarachnoid haemorrhage 2 ( 5% ) [ figure 1 ] . morbidities associated with sca majority ( 88% ) had adequate knowledge about general health maintenance while knowledge on nutrition and appropriate analgesia use is still largely inadequate [ table 3 ] . eleven ( 22% ) had symptoms attributable to depression , four ( 8% ) had suicidal ideation while one ( 2% ) had a history of attempted suicide . previous reports have described scd as a condition of childhood with most youths not living past their teens.67 improvement in the diagnosis and treatment of many of scd 's life - threatening conditions over the past decade has led to an extended life expectancy with many living well into their 40s.8 many adolescents with scd have to deal the psychological burden of having a chronic disease , the disadvantage of being categorised as socially dysfunctional.910 as a result , there is clinical consensus that added attention needs to be focused on the period from adolescence to young adulthood . to facilitate adolescents with scd live a longer and healthier life , lepontois and others11121314 are of the opinion that there is need for adolescents with chronic conditions , like scd , to develop both short- and long - term psychological and social skills needed to successfully navigate this developmental period and the medical and social systems in which they function . acute episodes of bone pain signalling marrow ischaemia or necrosis is pathognomonic of scd and is the most common cause of hospital admissions . these recurrent attacks of acute pain are serious complications that often require treatment with parenteral opioids , in the emergency room ( er ) and/or the hospital.151617 this study reveals that bone pain is the commonest crises necessitating hospital admission as documented in previous studies.1819 the episode of pain per patient is higher than that documented by platt et al . ; this could be a consequence of the academic stress the subjects are experiencing . however , the average duration of pain of 7 days is consistent with literature.15 in this study , the commonest indication for blood transfusion was severe anaemia ; this is consistent with the finding of otaigbe in port harcourt , nigeria.20 this is however different from studies in developed countries where the indication for transfusion were variable with several studies showing a decline in complication rates among sickle cell patients.2122 nigeria is a malaria - endemic region ; so , it is not surprising that the prevalent morbidity recorded in these subjects was malaria . this finding is also consistent with results from other studies.1823 the fact that malaria infection precipitates voc could also account for bone pain crises being the commonest presentation of sickle cell crises recorded in this study . it was quite interesting to note that majority of the subjects had adequate knowledge about general health maintenance ; though on further questioning , many of the subjects do not actually stick to their care plan . the reluctance to use routine medications , to avoid conditions that can precipitate voc and attend follow - up appointments is all part of the adjustment difficulties documented in chronic medical conditions like scd.242526 consistent with the literature,4272829 a significant number of the patients in this study had feelings of depression . however , it was noted that subjects who had more knowledge about their condition with strong family support had a more positive outlook about their disease ; improved coping skills and better adherence to their routine medications which could be responsible for reduced hospital visits . the study shows that the majority of adolescents who have better knowledge about their condition with strong family support have a positive perception of their illness which equates not only better control of their illness but also better quality of life with reduced hospital visits . this study emphasizes the importance of psychosocial intervention as part of a comprehensive health management for people with scd . the onus is on health - care providers to work closely with the family to ensure that there is a smooth transition from paediatric to adolescent care by providing as much information as possible to assist the affected adolescent in navigating this turbulent period .

background : many adolescents with sickle cell disease ( scd ) have adjustment difficulties in the transition period from paediatric care to the adult system because they find themselves in unfamiliar waters where they have to learn to manage themselves . the aim of this study is to evaluate the prevalent crises and morbidities associated with scd in adolescents in babcock university teaching hospital ( buth ) , to also assess the level of knowledge of these adolescents about scd and to determine their emotional response to the disease.materials and methods : this was a retrospective review of case notes of adolescents with sickle cell anaemia that were seen in buth , from may 2013 to april 2014 . data extracted from the case notes was entered into a microsoft ( ms ) excel and analysed using descriptive statistics . results were presented in tables.results:a total of 50 subjects were seen in the department during this study period . vaso - occlusive crises in the form of bone pains ( 93.1% ) were the commonest crises encountered . associated morbidities were malaria 34 ( 85% ) , tonsilitis 1 ( 2.5% ) , pneumonia 1 ( 2.5% ) , leg ulcer 1 ( 2.5% ) , azotaemia 1 ( 2.5% ) and subarachnoid haemorrhage 2 ( 5% ) . majority ( 88% ) had adequate knowledge about general health maintenance while knowledge on nutrition and appropriate analgesia use is still inadequate . eleven ( 22% ) had symptoms of depression , four ( 8% ) had suicidal ideation while one ( 2% ) had a history of attempted suicide.conclusion:this study emphasizes the importance of psychosocial intervention as part of a comprehensive health management for people with scd .

flap advancement is an integral part of root coverage procedures . when re - adapting flaps , coronal positioning facilitates healing by primary intention . possible complications documented in mucogingival surgeries include bleeding , pain , necrosis of the graft or the overlying flap , hemorrhage , ecchymosis and swelling . occurrence of such post - operative complications is a major factor determining the patient 's future attitude to the treatment procedures . a recent study has shown comparable results with that of the connective tissue graft technique , which has the most predictable outcome for root coverage . this technique is usually indicated in patients with a thick gingival biotype as in these cases , the periosteum has sufficient thickness and can be easily manipulated on to the root surface . it is also the technique of choice in cases where the patient is not willing to go for a second donor site surgery . this is a case series involving gingival recession in five patients in the maxillary canine - premolar area , which were treated at our facility using this periosteal pedicle graft ( ppg ) technique . although the procedure showed acceptable clinical results in terms of root coverage , excessive post - operative edema involving the canine space , was observed the next day after surgery , without exception in all the five cases . although some amount of swelling is expected after coronal repositioning of a flap , the extent of swelling noted in these cases was unacceptable as it caused considerable patient morbidity and apprehension . this article highlights the clinical appearance of this complication , its severity and discusses ways by which it may be prevented . this was an observation that the author came across while performing a randomized controlled clinical trial in assessing the efficacy of the ppg as a root coverage procedure . the mean age of the patients was 37.5 years ( range 28 - 48 years ) . the recessions were present in relation to the maxillary canine or first premolar tooth [ figure 1 ] , belonging to miller class i recession . there was a vertical recession depth of 4 mm in two of the cases , and 3 mm in the remaining three cases from the cement - enamel junction . scaling and root planing was performed on all the five cases prior to the surgical procedure . gingival recession with respect to the maxillary right canine and premolar the surgical procedure was performed by a single trained calibrated surgeon . a full thickness flap was elevated 3 - 4 mm apical to the osseous crest . an incision was made through the periosteum where the flap was still attached to the bone to create a partial thickness flap [ figure 2 ] , and a periosteal pedicle flap raised and inverted over the planed and conditioned root surface [ figure 3 ] . the periosteum was stabilized using size 4 - 0 resorbable sutures ( vicryl , ethicon ) . the overlying flap was then coronally positioned over the periosteal graft and sutured using size 4 - 0 surgical silk ( ethicon ) [ figure 4 ] . a non - eugenol pack ( coe - pak ) post - operatively , 400 mg of ibuprofen ( brufen ) was prescribed 3 times a day for 5 days . chlorhexidine ( 0.12% ) mouth rinse ( periex ) was also prescribed to be used twice a day for 2 weeks . reflection of a partial thickness flap to expose the periosteum periosteal graft raised and inverted over the recession area partial thickness flap sutured in a coronal position three of the patients reported to the clinic with an extra - oral , painless swelling involving the right canine and buccal spaces on the 2 day after surgery [ figure 5 ] , out of which two cases also exhibited ecchymosis below the lower eyelid . post - operative swelling in relation to the canine / buccal / periorbital spaces the swelling was firm and tender on palpation and also extended to the lower eyelid in two of the cases . a considerable amount of apprehension and some skepticism regarding the treatment procedure was noted in all patients . after initial observation of such an occurrence , in the first two patients ; the patients who followed , were prescribed a serratiopeptidase containing tablet ( lyser - d ) thrice daily for 3 days , post - operatively . the success of any root coverage procedure not only depends upon the amount of root coverage achieved , but also upon the patient comfort and satisfaction following the procedure . the authors suggested this technique , as periosteum can be easily harvested near the surgical site itself and does not require a secondary donor site . hence , the need for a second surgical site as in case of a sub - epithelial connective tissue graft is eliminated . furthermore , periosteum has a rich vascular plexus , and the periosteal cells tend to release vascular endothelial growth factors , which may play a role in new attachment procedure . patient discomfort was reported to be lesser in case of the ppg as compared to the connective tissue graft , but no complications have been reported until date in relation to this technique . however , in our case , all the patients reported of severe post - operative swelling the next day involving the canine and buccal space area , which persisted for up to 5 days . swelling due to edema may require up to 72 h in order to peak and is guided by muscle attachments , fascia and bone . reflection of the periosteum creates a dead space allowing the blood and inflammatory fluid to move in the direction of least resistance . when the surgical site is in the canine premolar area , the blood that gets collected in the infraorbital space tends to coagulate and can give rise to hematoma formation . lengthy surgical procedures may create extensive tissue injury and prolong vasodilation that in turn permits more fluid to accumulate in the interstitial spaces and results in higher levels of biologic and inflammatory mediators . thus , we suggest that post - operative complications such as swelling and hematoma formation may be minimized by : minimizing the duration of the surgerygentle handling of the tissuesavoiding overt reflection of the flap in an attempt to obtain better coverage . not controlling the bleeding from soft - tissue before suturing , can direct the blood and inflammatory fluid into the infra orbital space . it is advisable to control the soft - tissue bleeding by applying firm pressure with moist gauze on the flap prior to suturing . minimizing the duration of the surgery gentle handling of the tissues avoiding overt reflection of the flap in an attempt to obtain better coverage . not controlling the bleeding from soft - tissue before suturing , can direct the blood and inflammatory fluid into the infra orbital space . it is advisable to control the soft - tissue bleeding by applying firm pressure with moist gauze on the flap prior to suturing . edema and related morbidity seem to be a constant and expected complication of ppg when used in the maxillary canine / premolar area . these complications can be minimized by some of the above mentioned precautions and post - operative care methods . the aim of this case series was to highlight one of the possible frequent complications of the ppg technique , which should be kept in mind while selecting this particular procedure for recession coverage .

post - operative complications following flap surgeries or mucogingival procedures are important factors influencing patient 's perception of periodontal procedures . hence , it is important to foresee such complications and take adequate measures pre- and post - operatively . we treated five consecutive cases of gingival recession in the maxillary canine - premolar area using the inverted periosteal graft with a coronally positioned flap technique . following each of these surgeries , the patients complained of post - operative swelling the next day involving the canine space or buccal space area . the swelling persisted for at least 5 days , however , it was painless . this paper highlights the post - operative complications associated with the said procedure and makes a case for detail enquiry in the form of controlled studies .

traumatic neck injuries ( tnis ) represent 5 - 10% of all severe trauma cases . particularly , neck injuries related to motor vehicle crashes ( mvcs ) , suicide , and homicide accounted for 3500 deaths annually . blunt trauma causes around 5% of all neck injuries which are mainly associated with m mvc - related neck injuries usually occur due to the sudden collision of the neck with the steering wheel or dashboard which might cause tracheal crush at the cricoid ring or esophageal compression against the cervical vertebrae . a retrospective study from pakistan reported 15 neck trauma cases of 5 ( 33.3% ) patients were involved in mvcs . the authors observed poor outcome in 20% of the cases who had delayed surgical intervention . furthermore , a prospective study from bangladesh reported 18% of cut throat cases secondary to accidental injuries . moreover , cut throat injuries secondary to mvcs and fall - related injuries can also be caused by a pointed object which leads to penetrating injury to a lesser extent . these injuries occur mainly due to glass or sharp metallic projection inside the vehicle . in blunt trauma patients , injuries of the laryngotracheal ( 0.04% ) and pharyngoesophageal ( 0.3% ) region are relatively infrequent as compared to the aerodigestive injuries caused by penetrating neck trauma ( 5 - 15% ) . though , injuries to the vertebral column ( 0.7% ) and carotid ( 0.9% ) arteries are rare ; they often proves fatal in blunt trauma . for instance , the majority of pni in the united states are caused by firearms ( 44% ) , stabbing ( 40% ) , and gsw ( 4% ) in urban areas . particularly , injuries of the aerodigestive tract ( 23 - 30% ) are frequently observed in pni cases and of note , esophageal injuries are associated with poor outcomes . furthermore , vascular injuries are responsible for complications in around 40% of pni cases . cut throat injuries are usually associated with fatal complications and are potentially life - threatening due to the involvement of vital structures . usually , the pni are directly proportional to the crime rate and military conflict in a particular country . nevertheless , the overall rate of tni is difficult to assess and usually remains under - reported . to the best of our knowledge , therefore , we highlighted the incidence , etiology , injury patterns , and outcome of neck injuries to understand its burden on the healthcare system in qatar ; which is a small country ( 1.8 million people ) with high population diversity ( 80% are expatriates ) . it is a retrospective analysis of all tni patients who were admitted to the hamad general hospital ( hgh ) between january 2008 and december 2012 . hgh is a tertiary hospital with level i trauma center in the state of qatar . patient with minor neck injury who did not require hospital admission were excluded from the study . furthermore , brought in dead cases data were reviewed for demographics , mechanism of injury ( mvcs , fall from height , fall of heavy object , stab , machinery , self - inflicted , and assault ) , injury severity score ( iss ) , neck injuries ( involving skin , vascular , nerve , and thyroid gland ) , zone of injury ( zone i iii ) , associated injuries , and interventions . hospital length of stay , ventilatory days , major complications , and mortality were also recorded . details regarding the hospital course of all patients were recorded from admission until discharge or death . the primary outcome was the all - cause hospital morbidity and mortality . in order to assess the severity of the injury , zone ii is superior to zone i and extends as far as the angle of the mandible . zone iii is the area between the angle of the mandible and the base of the skull . diagnosis of tni was confirmed by computed tomography ( ct ) for stable patients or operative exploration in the presence of one of the following : clinical signs of neck injury involving the platysma ( for penetrating injury ) , hard signs of vascular injury ( bleeding , hematoma , and shock ) , and signs of aerodigestive injury . the management of neck injuries in our hospital is based on the guidelines of the eastern association for surgery of trauma . data were presented as proportions , medians , or mean standard deviation as appropriate and the analysis was carried out using the statistical package for social sciences version 18 ( spss inc . , chicago , il , usa ) . in this study , a total of 51 tni cases were included revealing an overall incidence of 0.61/100,000 population . the mean age was 31 9 years and majority ( 98% ) was males . ninety - two percent of the cases were expatriates ( of them 43% were from india and nepal ) , and 8% were nationals [ table 1 ] . mvc ( n = 15;29.4% ) was the most frequent mechanism of injury followed by stabbing ( n = 9;17.6% ) , machinery injury ( n = 9;17.6% ) , fall from height ( n = 5;9.8% ) , and assault ( n = 4;7.8% ) [ figure 1 ] . number of cases with neck injury based on the mechanism of injury and number of deaths the most frequently injured structures of neck includes larynx ( n = 6,11.8% ) , thyroid ( n = 6;11.8% ) , trachea ( n = 5;9.8% ) , internal ( n = 4;7.8% ) and external ( n = 4;7.8% ) jugular vein , hypopharynx ( n = 3;5.9% ) , and carotid artery ( n = 1;2% ) [ figure 2 ] . the isolated neck injury was observed in 11 ( 21.6% ) cases while the remaining 40 cases had other associated injuries . moreover , head ( n = 35;68.6% ) , chest ( n = 11;21.6% ) , and upper extremities ( tni patients were mainly presented with active bleeding ( 38% ) , hypovolemic shock ( 16% ) , and respiratory distress ( 16% ) . details of neck injuries neck injury and associated injured body regions common surgical interventions mainly included simple repair and closure ( 53% ) , vein ligation ( 12% ) , repair of major arteries ( 4% ) , tracheal repair ( 6% ) , larynx and hypopharynx repair ( 4% ) , and repair of parotid gland ( 2% ) . neck exploration was performed in 88.2% cases , 38% were intubated and emergency tracheostomy was needed in 17.6% of cases . the median length of hospital stay was 4 ( range ; 1 - 59 ) days and intensive care unit stay was 3 ( range ; 1 - 36 ) days . permanent tracheostomy was needed in four patients ( of which one had persistent dysphagia ) , one patient developed wound infection , one had an ugly scar and three required psychiatric consultation and long - term care . ipsilateral brachial plexus injury was found in two patients and one patient developed pharyngocutaneous fistula and died . the overall mortality rate was 11.8% ( six patients ) ; 5 ( 83.3% ) had associated injuries , and only one ( 16.7% ) had isolated neck injury . three patients died due to mvc - related tni , whereas stabbing , fall , and assault accounted for mortality of the other 3 cases . despite the fact that tni can cause potentially life - threatening complications , the exact incidence , management , and outcome of tni remain underreported . moreover , there are limited studies on neck injuries from the rapidly developing countries like qatar with a diverse population . to the best of our knowledge , this is a unique study from our region that describes the injury pattern , management , and outcome of tni . a recent study from london demonstrated the overall incidence of pni to be 4.3/100,000 populations . though , the overall incidence of tni cases was lower in our series , but it is predominantly observed among the physically active young male population . our findings are consistent with earlier reports showing a high incidence of tni among young males [ table 2 ] . in our series , tni were mainly related to mvc ( 29% ) , machinery injury ( 18% ) , stabbing ( 18% ) , and falls ( 10% ) . similarly , akhtar and awan observed 15 cases of tni ; of which 33% sustained mvcs , 20% had gsw , 7% had machinery injury . however , aich et al . reported 67 cases ; 48 ( 71.6% ) had homicidal injury , 12 ( 17.91% ) sustained injuries due to accidents , and 7(10.44% ) cases were involved in the suicidal attempt . whereas , mvc is the primary cause of accidental cut throat injuries caused either by broken glass or by the insertion of sharp projection of the vehicle after distortion . review of neck injury cases in our series , a higher proportion of tni cases ( 78.4% ) had associated injuries while 21.6% cases had isolated neck trauma . moreover , laryngotracheal and hypopharynx injuries were observed in 21.6% and 6% cases in our series which corroborate with an earlier study demonstrated similar incidence of laryngotracheal ( 24.9% ) and pharyngeal ( 8.2% ) injuries . contrarily , a prospective study of 223 pni cases mainly observed vascular , spinal cord , aerodigestive tracts , and nerves injuries . in our study , head is the most commonly associated injured body regions followed by upper extremities and chest . reported chest injuries ( 65% ) to be the most frequently associated injured body region among tni patients . due to the anatomical position , the vast majority of studies identified neck injuries within zone ii ( 50 - 80% ) . consistently , the majority of tni patients in our study sustained injuries in zone ii ( 78% ) . moreover , tni patients were mainly presented with active bleeding , hypovolemic shock , and respiratory distress in our study . though , the incidence of neck injury is infrequent , proper management of tni is crucial to avoid major complications . operative management is indicated in patients with persistent signs of major injury such as active hemorrhage , hoarseness , stridor , respiratory distress . in our study , the majority of the cases underwent neck exploration followed by intubation and emergency tracheostomy . an earlier study reported similar rates of tracheostomy but showed a higher rate of intubation . since , long - time management of tni patients with platysma injury advocates mandate surgery . however , this concept has been changed in many trauma centers to support selective nonoperative management . moreover , systematic clinical examination remains the cornerstone based on a stepwise protocol in which the selected investigations will be confirmatory . hence , selective observation with findings of physical examination and symptoms is getting more attention . consistently , many studies have also proposed selective observation to rule - out major vascular or esophageal injuries . a recent review on the management of pnis also supports selective nonoperative management and advocated the use of ct angiography for the detection of potential vascular injuries . in our study , tni patients had a lower injury severity with median iss of 5 ( range ; 1 - 58 ) which is also reflected by the shorter median hospital stay 4 ( range ; 1 - 59 ) days . consistently , aich et al . reported lower injury severity in the majority ( 81% ) of the tni patients who were discharged from the hospital within 2 weeks of admission . in our series , the overall mortality rate was 11.8% and of the six patients died , five had associated injuries and one sustained isolated neck injury . similar , rates of mortality have been observed by different studies from nigeria ( 10% ) and bangladesh ( 9% ) . reported a lower mortality rate ( 1.5% ) which was mainly associated with other injuries , rather than that of pni . one of the major limitations of this study includes its retrospective design which attributes to some missing information regarding the alcohol abuse and intervention details . furthermore , the smaller sample size is another limitation which is described by the lower incidence of neck injuries in our population . hence , the expected variation of our findings with current literature might be due to small numbers , rather than to real differences . moreover , machinery , self - inflicted injury , and assault can be caused either by a blunt or penetrating trauma , and lack of this information renders us to classify our cases into blunt and penetrating injury mechanisms . furthermore , this study lacks clinical follow - up to look for long - term outcomes . though tni is not frequent in qatar , it represents an alarming entity due to its fatal complications if remains untreated . the majority of tni cases are young males , mainly injured by mvcs , occupational injuries , and stabbing . patients with persistent signs of major injuries as evidence by active hemorrhage and respiratory distress should be preferably managed by operative intervention . moreover , early neck exploration should be done in patients with deeper neck injuries to avoid severe complications and worst outcomes . interestingly , the overall complication rate was low in our patients , and the observed morbidity and mortality are mainly attributed to the associated injuries rather than isolated tni . hence , early interventions and injury prevention based on major risk factors are important for preventing these injuries . moreover , the findings of the present study could be the basis for the motivation of public health authorities to initiate awareness programs focusing on socio - cultural , mental health , and psychiatric consultation .

objectives : we aimed to analyze the pattern and outcome of traumatic neck injury ( tni ) in a small population.materials and methods : it is a retrospective analysis of all tni patients who were admitted to the trauma center between 2008 and 2012 . patients demographics , details of tni , associated injuries , hospital course , and mortality were analyzed.results:a total of 51 tni cases were included revealing an overall incidence of 0.61/100,000 population . the mean age was 31 9 years . the most frequent mechanism of injury was motor vehicle crash ( 29.4% ) followed by stab ( 17.6% ) , machinery injury ( 17.6% ) , fall ( 9.8% ) , and assault ( 7.8% ) . larynx , thyroid gland , trachea , jugular veins , and carotid were the commonly injured structures . the majority of cases had zone ii tni whereas isolated injury was observed in 11 cases . tni were mainly presented with active bleeding ( 38% ) , hypovolemic shock ( 16% ) and respiratory distress ( 16% ) . surgical interventions mainly included simple repair and closure ( 53% ) , vein ligation ( 12% ) , repair of major arteries ( 4% ) , tracheal repair ( 6% ) , larynx and hypopharynx repair ( 4% ) , and repair of parotid gland ( 2% ) . neck exploration was performed in 88% , and emergency tracheostomy was required in 18% of cases . overall mortality rate was 11.8% , of which five patients had associated injuries , and one had isolated tni.conclusion:tni are not frequent but represent an alarming serious entity in qatar . patients with persistent signs of major injuries should undergo early operative interventions . moreover , the effective injury prevention program should be developed to minimize these preventable injuries in the majority of cases .

the unfolded protein response ( upr ) is an interorganella communication system that is activated to maintain the homeostasis of the endoplasmic reticulum ( er ) , where newly synthesized secretory and transmembrane proteins are folded and assembled . when unfolded proteins accumulate in the er , eukaryotic cells from yeast to humans transmit an er stress signal to the nucleus to enhance transcription of er quality control proteins such as er - localized molecular chaperones and folding enzymes ( collectively termed er chaperones hereafter ) and components of er - associated degradation ( erad ) . these in turn enhance the cell 's capacity for productive folding and degradation , respectively ( mori , 2000 ; schroder and kaufman , 2005 ; ron and walter , 2007 ) . the prototype of the upr was originally discovered in the 1970s in studies of the virus - induced transformation of mammalian cells . these identified two cellular proteins induced by the glucose starvation that resulted from the rapid growth of transformed cells ( shiu et al . , 1977 ) . later work showed that these glucose - regulated proteins ( grp78 and grp94 ) were major er chaperones ( munro and pelham , 1986 ; sorger and pelham , 1987 ) and that the trigger for their induction was the accumulation of unfolded proteins in the er ( kozutsumi et al . , 1988 ) . the transcriptional induction of grps thus represented a homeostatic response to ensure the function of the er . nonetheless , analysis of the molecular mechanism of the upr did not advance in mammalian cells in the 1980s and early 1990s ; rather , major progress was made using the budding yeast saccharomyces cerevisiae as a model . peter walter 's group at the university of california , san francisco and my group ( first at the university of texas southwestern medical center in dallas , with mary - jane gething and joe sambrook , and then at the hsp research institute in kyoto , japan , with takashi yura ) identified ire1 , a type i transmembrane protein in the er , as the sensor and transducer of the er stress signal ( cox et al . , 1993 ; mori et al . , 1993 ) and then hac1 , a basic leucine zipper ( bzip ) protein , as the transcription factor responsible for yeast upr ( cox and walter , 1996 ; mori et al . the events in the er and nucleus were connected by ire1-dependent unconventional ( spliceosome - independent ) splicing of hac1 mrna ; hac1 is translated only from spliced hac1 mrna ( chapman and walter , 1997 ; kawahara et al . , 1997 ) . while working with yeast , however , we wanted to go back to mammals , and in 1995 recruited the talented hiderou yoshida to this project at the hsp research institute . we thought that the difficulty in analyzing mammalian upr was because the real cis - acting element responsible for the mammalian upr had not been identified , in marked contrast to the yeast upr , in which we identified the cis - acting upr element necessary and sufficient for transcriptional induction of yeast er chaperones , allowing us to perform a genetic analysis ( mori et al . , 1992 ) . although the literature at that time said that elements a and b were both present in mammalian er chaperone promoter and that both participated in the induction of the er chaperone gene , the involvement of plural elements could not explain the coordinated induction of a dozen er chaperones . hiderou immediately noticed that these were not in an a / b relationship , but rather an a / a ' relationship : that is , the mammalian element was duplicated or triplicated with several changes in nucleotide sequence . he succeeded in extracting a consensus sequence ccaat - n9-ccacg and demonstrated that this single er stress - response element ( erse ) is indeed responsible for the transcriptional induction of a number of er chaperones in response to er stress ( yoshida et al . , 1998 ) . once this cis - acting element was identified , we were able to apply one - hybrid screening , which was used when i cloned yeast hac1 . from 6 million clones , hiderou obtained two positive clones that both encoded bzip protein , namely , activating transcription factor ( atf)6 and xbp1 ( yoshida et al . , 1998 ) . hiderou and kyosuke haze then decided to split the work , with hiderou concentrating on xbp1 and kyosuke on atf6 . hiderou was later to discover that xbp1 is a functional counterpart of yeast hac1 ( yoshida et al . , 2001 ) . atf6 is a protein of 670 amino acids and its basic region shows significant similarity to that of yeast hac1 . regrettably , however , its mrna did not seem to be spliced in response to er stress , and it is therefore not a direct homologue of yeast hac1 . we raised an antibody against atf6 and analyzed the behavior of endogenous atf6 before and after er stress , but the results kyosuke obtained were puzzling . although no atf6 band was detected under unstressed conditions , as is also the case with hac1 , a band was detected after the addition of er stress inducers such as tunicamycin , calcium ionophore a23187 , and thapsigargin , again , similarly to hac1 . importantly , this band was not detected in heat - shocked cells , suggesting the involvement of atf6 in mammalian upr . embarrassingly , however , the band was much smaller ( 50 kda ) than the expected molecular mass ( 80 kda ) . in contrast , transfection of atf6 cdna into cells produced both 90- and 50-kda bands . we suspected that full - length atf6 protein might be translated from overexpressed atf6 mrna , but not from endogenous atf6 mrna ( overexpression might overcome the translational block of atf6 mrna , as in the case of yeast hac1 mrna ) , but we still needed an explanation for the 50-kda band ; it looked like a protein had been spliced . we sought the missing 40-kda portion by making various truncations , but the results were obscure and confounding . it turned out that kyosuke had used different methods to make the protein extract for western blot . when he analyzed endogenous atf6 , he freeze - thawed the sample cells a couple of times , centrifuged them , and used the resulting supernatant , on the basis that as a transcription factor , atf6 must of course be a soluble protein . but when he analyzed transfected atf6 , he lysed transfected cells with sds sample buffer , because the small - scale cell culture used for transfection did not provide enough cells for freeze and thaw . the missing endogenous 90-kda protein was recovered in pellets after freeze - thaw , and indeed found after lysing the pellet with sds sample buffer . kyosuke is a brilliant man , but his preconceived idea on a transcription factor kept us in the dark for half a year ! atf6 was originally cloned as one of eight partial cdnas ( atf18 ) encoding bzip protein ( hai et al . , 1989 ) . full - length atf6 cdna was cloned as a cofactor of serum response factor ( zhu et al . , 1997 ) . atf6 had been thought to be a soluble nuclear protein until we found that it contains a hydrophobic stretch immediately c - terminal to the bzip domain ( figure 1b ) , which anchors atf6 in the er membrane ( figure 1a ) . inspired by brown and goldstein 's elegant work on sterol regulatory element - binding protein , which is responsible for cholesterol homeostasis ( brown and goldstein , 1997 ) , these findings gave us the exciting idea that atf6 is an er membrane - bound transcription factor activated by er stress - induced proteolysis . mammalian transcription factor atf6 is synthesized as a transmembrane protein and activated by proteolysis in response to er stress . unstressed hela cells were fixed and stained with anti - atf6 antibody ( a ) , anti - kdel antibody ( b ) , or 4,6-diamidino-2-phenylindole ( dapi ) ( c ) . the positions of the serine cluster , basic region , and leucine zipper as well as the transmembrane domain are indicated . the hydropathy index was calculated by the method of kyte and doolittle ( 1982 ) . atf6 is constitutively synthesized as a precursor protein designated patf6(p ) that anchors in the er membrane through the single transmembrane domain near the center of the molecule . er stress - induced proteolytic cleavage of patf6(p ) releases the n - terminal fragment designated patf6(n ) containing basic leucine zipper and transcriptional activation domains . patf6(n ) translocates into the nucleus and activates transcription of genes encoding er chaperones by binding to cis - acting erse present in their promoter regions . so , atf6 was constitutively synthesized as a type ii transmembrane protein of 90 kda in the er ( glycosylation in the luminal region increases the apparent molecular mass of atf6 over its estimated molecular mass of 80 kda ) , designated patf6(p ) , which is converted to a soluble nuclear protein of 50 kda in response to er stress . this patf6(n ) , containing all the hallmarks of an active transcription factor , enters the nucleus and activates the transcription of er chaperone genes via binding to erse ( figure 1c ) . we wrote a paper and submitted it to molecular biology of the cell in november 1998 . the reviewers asked us to purify our anti - atf6 antibody to ensure its specificity as well as to demonstrate a direct precursor / product relationship by a pulse chase experiment , because atf6 was the second membrane - bound transcription factor identified at that time ( thanks to the subsequent identification of many other membrane - bound transcription factors , cycloheximide chase experiments are now allowed ) . the paper was accepted after three revisions and finally published in the november 1999 issue of molecular biology of the cell ( haze et al . , 1999 ) . our finding that mammalian er expresses more er stress sensor / transducers than yeast er has given our identification of atf6 a particular impact in the field . although yeast cells cope with er stress by activating the single ire1-hac1 pathway , randy kaufman 's and david ron 's laboratories identified mammalian homologues of yeast ire1 as ire1 ( ubiquitously expressed ) and ire1 ( expressed only in the gut ) , respectively ( tirasophon et al . , 1998 ; wang et al . , 1998 david ron 's laboratory also identified an additional er stress sensor / transducer , designated protein kinase - like er kinase ( perk ) , which is responsible for er stress - induced translational block . by expressing perk , metazoan ( but not yeast ) cells are able to decrease the burden on the er when the protein folding environment is compromised under er stress conditions . by 1999 , these various findings showed that mammalian er expressed three types of er stress sensors / transducers . later , we showed that atf6 is necessary and sufficient for the transcriptional induction of er chaperones and is also required for transcriptional induction of erad components in response to er stress ( okada et al . , 2002 ; atf6 is thus the most important er stress sensor / transducer in regulating the level of er quality control proteins in mammals . we have recently produced mouse anti - atf6 monoclonal antibodies that can detect both endogenous patf6(p ) and patf6(n ) in human and mouse cells and made them available through bioacademia ( http://www.bioacademia.co.jp/ ) .

the unfolded protein response ( upr ) , an evolutionarily conserved transcriptional induction program that is coupled with intracellular signaling from the endoplasmic reticulum ( er ) to the nucleus , is activated to cope with er stress and to maintain the homeostasis of the er . in 1996 , we isolated a basic leucine zipper protein , which had been previously named activating transcription factor ( atf)6 , as a candidate transcription factor responsible for the mammalian upr . subsequent analysis , however , was confounding . the problem was eventually tracked down to an unusual property of atf6 : rather than being a soluble nuclear protein , as expected for an active transcription factor , atf6 was instead synthesized as a transmembrane protein embedded in the er , which was activated by er stress - induced proteolysis . atf6 was thus unique : an er stress sensor / transducer that is involved in all steps of the upr , from the sensing step in the er to the transcriptional activation step in the nucleus .

the 2010 human influenza a ( h1n1 ) virus pandemic seriously affected many countries , including kuwait . in children , respiratory involvement usually occurs with h1n1 ; extra pulmonary problems are not common.1 liver involvement is rare and needs early identification and treatment . a 9-year - old child was admitted with intermittent low - grade fever , cough , vomiting , and abdominal pain lasting for one week . he received oral antibiotics ; the fever subsided initially but reappeared after a few days , along with jaundice . he was previously healthy , with no past history of liver disease . on examination , he was alert and oriented , his temperature was 39c , he was icteric , appeared toxic , was sweating , had a respiratory rate of 30 breaths / minute , and had congested tonsils ; a respiratory system exam showed prolonged expiration with expiratory rhonchi . there were no signs of meningeal irritation , and the rest of his physical examination was unremarkable . investigations revealed a hemoglobin ( hb ) count of 14.5 g / dl , a total leukocyte count of 3.37 10 , neutrophils 19% , lymphocytes 68% , a platelet count of 255 10 . urinalysis showed mild urobilinogen and ketones , but a urine culture was sterile after 48 hours of incubation . mmol / l , alanine amino - transferase was 1763 u / l , aspartate amino - transferase was 1871 units / l , alkaline phosphatase was 246 units / l , and gamma glutamyl transferase was 107 units / l . g / l , serum ammonia count 74 mmol / l , and serum lactate 2.06 mmol / l . the patient had normal serum amylase and lipase levels , a negative cold agglutinin test , a normal ultrasound of the abdomen , and a negative chest x - ray . nasal and throat swabs for h1n1 were positive by a reverse transcription polymerase chain reaction ( pcr ) test . a hepatitis a , b , and c serological screen was negative , and his serum acetaminophen level was normal . furthermore , an additional work - up to rule out other causes of fulminant liver failure was performed , including negative blood tests for herpes simplex virus pcr , adenovirus pcr , epstein his immunoglobulins ( igg , igm , and iga ) were within normal limits ; he also had a negative antinuclear antibody ( ana ) < 1:40 titer and a negative anti - smooth muscle antibody and anti - liver kidney microsomal antibody ( anti - lkm ) , ruling out the possibility of autoimmune hepatitis . finally , his serum amino acid and urine organic acids were unremarkable . he was treated according to centers for disease control and prevention ( cdc ) guidelines2,3 with tamiflu ( oseltamivir ; genentech , san francisco , ca ) for five days and other supportive measures , including fresh frozen plasma , iv - administered vitamin k , lactulose , and prophylactic intravenous antibiotics . severe infection is characterized by pneumonia , sepsis , septic shock , and multi - organ failure . extra - pulmonary involvement is rare in uncomplicated human infections.1 studies of mouse models suggest multiple organ localization , including the lungs , heart , thymus , liver , and spleen.4 snchez - torrent et al reported h1n1 encephalitis in a 3-month - old infant from spain.5 hepatic involvement is not frequent and accounts for less than 3% of all cases.1 carrillo - esper et al , in 2010 , reported two adult h1n1 patients with hepatic involvement.1 el - shabrawi et al , in 2011 , reported a 10-month - old child with acute myocarditis and fulminant hepatic failure associated with h1n1.6 the subject of the current case report had acute hepatic failure that presented as jaundice , elevated liver enzymes , and coagulopathy . most of the other causes of liver failure had been ruled out by relevant investigations . he responded well to antiviral and other supportive treatment , and showed full clinical and laboratory recovery . no viral replication is needed to produce hepatic damage , as there is evidence of hepatic oxidative stress and a decrease in antioxidant defenses even when the virus is isolated only from the lungs . this might be explained by the production of pro - inflammatory cytokines in the respiratory airway that leads to changes in hepatic metabolism and enzymatic activities.7,8 even though hepatic complications are rare in pediatric h1n1 cases , in reporting this case we would like to draw the attention of pediatric health care professionals to the importance of early recognition , focused investigations , diagnosis , and treatment of complicated human h1n1 infection .

liver involvement in pediatric influenza a ( h1n1 ) infection is rare . focused clinical evaluation and laboratory tests can rule out or identify hepatic complications early on . here we report on a 9-year - old boy treated by the gastroenterology , hepatology , and nutrition unit of al - adan hospital s pediatric department . the patient , who was infected with h1n1 during the 2010 pandemic , showed symptoms of associated acute hepatic failure , was managed conservatively , and recovered completely following treatment . the author would like to draw the attention of pediatricians to the hepatic aspect of human h1n1 infection in order for them to recognize it early and treat it in a timely manner .

the incidence of fungal liver abscess is rare compared to pyogenic or amebic liver abscess . routes of exposure of bacteria can occur by biliary tree , portal vein , hepatic artery , direct extension , and cryptogenic abscess . a 65-year - old female patient admitted with a complaint of upper abdominal pain for 15 days , more on the right hypochondrium and epigastric region , associated with a history of nausea and vomiting . she was a known case of diabetes mellitus for 5 years , on oral hypoglycemic drugs . respiratory , cardiovascular , central nervous system , and musculoskeletal system found to be normal . routine blood investigations such as complete blood count and renal and liver function tests were normal . ultrasound abdomen showed 7.15 cm 4.43 cm ill - defined echo texture lesion with internal anechoic area seen in segment vii and v of the liver [ figure 1 ] . we are not sure whether we are dealing with chronic liver abscess or infected hydatid cyst ; hence , we proceeded with contrast computed tomography ( ct ) abdomen and immune assay for igg antibodies against hydatid cyst ( echinococcus ) . contrast ct abdomen showed enlarged liver of 20.8 cm with ill - defined hypoechoic collection with air fluid level of size 13 cm 10 cm 7 cm noted in the right lobe of liver with enhancing walls suggestive of liver abscess [ figures 2 and 3 ] . however , serum enzyme - linked immunosorbent assay ( elisa ) against echinococcus igg - positive ( 0.78 od ) ( reference interval - negative < 0.3 , positive > 0.3 ) . the patient was started on antibiotics and albendazole for hydatid cyst . we are not sure with diagnosis whether synchronous hydatid cyst with pyogenic liver abscess or hydatid cyst becomes infected . gram stain showed many pus cells and fungal filaments branching septate hyphae , suggestive of candida albicans and culture and sensitivity were also suggestive of c. albicans . later , we placed pigtail catheter inside the abscess cavity and the cavity started resolving [ figure 4 ] . ultrasound abdomen showed 7.15 cm 4.43 cm ill - defined echo texture lesion with internal anechoic area seen in segment vii and v of the liver axial computed tomography abdomen showed enlarged liver with hypodense fluid collection contrast computed tomography abdomen showed enlarged liver of 20.8 cm with ill - defined hypo echoic collection with air fluid level of size 13 cm 10 cm 7 cm noted in the right lobe of liver with enhancing walls suggestive of liver abscess ultrasound abdomen with pigtail catheter inside the abscess cavity with resolving abscess hydatid cyst occurs due to infection with echinococcus granulosus . after ingestion of parasite embryo , it releases an oncosphere which penetrate the mucosa of intestine . larvae of echinococcus reach portal venous system through intestine and spread to various organs such as liver , lung , spleen , brain , muscle , and other parts . ultrasound abdomen mostly diagnoses hydatid cyst , but when the diagnosis is uncertain , we need ct abdomen or magnetic resonance imaging ( mri ) abdomen to fetch diagnosis . when imaging fails to identify the lesion or when the lesion is doubtful , we need serological examination , which is confirmatory . following serological test used for the diagnosis of hydatid cyst . they are complement fixation test , indirect hemagglutination test , latex agglutination test , elisa , indirect immunofluorescence antibody test , immunoelectrophoresis , and immunoblotting . sensitivity and specificity of elisa vary from organ to organ , in which hydatid cyst is involved . hydatid cyst liver carries higher sensitivity ( 90% ) compared to hydatid cyst of the lung ( 75% ) . elisa for igg carries higher sensitivity ( 90% ) compared to elisa for igm ( 85% ) or ige ( 80% ) antibodies . ultrasound abdomen shows calcification of the cyst wall with double echogenic shadow due to pericyst . mri abdomen shows mixed low signals on t1-weighted images whereas mixed high signals on t2-weighted images with septations . mostly , hydatid cysts with immunocompromised status are more prone to develop liver abscess following hydatid cyst . the occurrence of abscess in hydatid cyst creates diagnostic difficulty when seropositive for hydatid cyst , but imaging fails to identify hydatid cyst or serology positive for hydatid cyst , but aspirate shows negative for hydatid . in our case , there was a diagnostic difficulty because imaging failed to identify typical hydatid cyst , but seropositive for hydatid cyst . with extensive search on pubmed , this is the first case reported with hydatid cyst with fungal liver abscess created diagnostic difficulty . the previous description of fungal abscess mostly associated with liver malignancies or hematological malignancies . fungal liver abscess following hydatid cyst was treated with pair and medical management such as albendazole with antifungal agents . this case created diagnostic difficulty whether we are dealing with liver abscess or hydatid cyst . sometimes , it may be possible that concurrent occurrence of hydatid cyst with liver abscess or hydatid cyst became infected and mimic like liver abscess . immunocompromised states with hydatid may be more prone for fungal liver abscess compared to pyogenic liver abscess . this kind of cases can be managed with initially pair followed by pigtail for proper resolution .

liver abscess is mostly either pyogenic or amebic . fungal and mycobacterial liver abscesses are rare and mostly associated with immunosuppression . the occurrence of fungal liver abscess with hydatid cyst was never reported previously . this case created diagnostic difficulty , whether we are dealing with liver abscess or hydatid cyst . sometimes , it may be possible that concurrent occurrence of hydatid cyst with liver abscess or hydatid cyst become infected and mimic like liver abscess .

a 19-year - old female patient presented with a chief complaint of pain in left lower back tooth region since 10 days . on intraoral examination , mandibular left first premolar showed a large class i caries involving pulp . the tooth was tender on percussion and showed no response to electrical and thermal pulp testing . radiographic evaluation with intraoral periapical ( iopa ) radiograph showed periapical radiolucency in relation to lower left first premolar [ figure 1 ] . more than one root canal was suspected in that tooth and extra medially and distally angulated periapical radiograph was taken to help in a better interpretation of the canal system . based on the clinical and radiographic evidences , it was diagnosed as chronic apical periodontitis in relation to the mandibular left first premolar . preoperative intraoral periapical of mandibular first premolar anesthesia was achieved by means of inferior alveolar nerve block with 1.8 ml of 2% lignocaine with 1:80,000 adrenaline . teeth were isolated using rubber dam and all caries were removed prior to access opening . after access opening , the trunk of the canal seemed to trifurcate at mid - root level giving rise to three separate canals . the orifices to the three root canals were found and enlarged with gates glidden drill . the pulpal tissue was removed using barbed broach ; the working length was determined using periapical radiograph . working length radiograph revealed three canal orifices leading to three separate canals but exited as two apical foramina 's [ figure 2 ] . the three root canals were thoroughly instrumented and shaped by step back technique to a size 30 ( apical preparation ) , and the root canals were irrigated using 3% sodium hypochlorite and 3% hydrogen peroxide solutions during root canal cleaning . intracanal medication with calcium hydroxide powder mixed with saline , carried through lentulo spirals , was placed . at the second appointment , the root canals were obturated with zinc oxide sealer and laterally condensed gutta - percha [ figure 3 ] . a final radiograph was then taken to confirm the quality of the obturation [ figure 4 ] . the access cavity was sealed with irm and the patient was then given appointment for permanent restoration . working length intraoral periapical showing three canals with two apical foramina 's master cone intraoral periapical intraoral periapical immediately after obturation failure to recognize anatomical complexities will result in treatment failure . the clinician should view mandibular premolar tooth group as complex and use all available armamentarium to achieve a successful outcome . good quality radiographs and thorough radiographic examination are essential for detection of additional canals . in the present case , the iopa radiographic features suggested the possibility of three canals . however , because of the superimposition of roots , radiographic diagnosis of three canals is not always possible in all cases . several other indications may be useful such as use of magnification and fiber optic illumination , dyes , advanced imaging techniques like computed tomography ( ct ) , spiral ct , micro - ct . an optimum access cavity is equally important criterion to negotiate buccally or lingually deviated canals . a good tactile sense and precurved files will help the clinician to negotiate the canals better for a predictable outcome . careful interpretation of the radiograph , close clinical inspection of the pulpal floor and proper modification of access opening are essential for a successful treatment outcome along with accurate knowledge of anatomical variations .

the aim of this article was to report an unusual anatomic variation of mandibular first premolar , with one root and three distinct canals , which leave pulp chamber and merge short of apex to exit as two separate apical foramina . the incidence of three canals existing as two apical foramina has only been documented in the literature by a few case reports . to achieve successful endodontic treatment , the clinician has to identify the different canal configurations and treat them properly .

congenital dyserythropoietic anemias ( cdas ) are inherited disorders that result from anomalies during the final stages of erythropoiesis and consequently present defective production of red blood cells 1 . cdas are characterized by chronic hyporegenerative anemia with inadequate reticulocyte count for the degree of anemia , except for cda type iv , and mild hemolysis . the most common complications associated with cdas are iron overload , cholelithiasis , and splenomegaly 2 , 3 . dyserythropoiesis and morphological features of erythroblasts are commonly identified in other related anemias ( hereditary hemolytic anemia , hereditary stomatocytosis , diamondblackfan anemia , fanconi anemia , and other inherited bone marrow failure syndromes ) that should be excluded in clinical practice . moreover , the overlapping phenotypes shown in cdas , even in patients with the same genetic variation , can make differential diagnosis difficult 1 . the identification of the causative genes of cdas allowed the classification of these diseases , as well as increasing understanding of pathogenesis and clinical management of cdas 4 , 5 , 6 , 7 , 8 . three classic types of cdas are distinguished by morphological abnormalities in erythroblasts ; the most recent classification recognizes six different types of cdas : ia , ib , ii , iii , iv , and thrombocytopenia xlinked with or without dyserythropoietic anemia , resulting from variants of cdan1 , c15orf41 , sec23b , kif23 , klf1 , and gata1 genes , respectively 1 . congenital dyserythropoietic anemias are a rare group of anemias , and their estimated frequency in europe is variable , the lowest 0.08 cases / million in scandinavia to the highest 2.60 cases / million in italy 9 . to date , more than 100 cases of cda type ia have been reported 3 , several members of a family with cda type ib 6 , more than 400 cases of cda type ii 10 , members of two families with cda type iii 7 , and only four patients with cda type iv 8 , 11 . the different genetic variants causing disease are compiled in the human gene mutation database ( http://www.hgmd.cf.ac.uk/ac/ ) : thirtyfour in the cdan1 gene , eightyeight in the sec23b gene , and sixtythree in klf1 gene but only one variant responsible for dyserythropoietic anemia . we report the case of a patient diagnosed with unclassified cda ; genetic study allowed the identification of the pathogenic variant c.973g > a , p.glu325lys , in the heterozygous state in the klf1 gene , this being the fifth case reported with cda type iv . a female patient aged 13 exhibited systolic murmur , hepatosplenomegaly , polyarthralgia , weight loss as result of high temperature , and signs of anemia onset , dyserythropoiesis , and mild hemolysis . in the neonatal period her twin brother and other siblings have no signs of anemia , her mother has iron deficiency anemia , and her father and grandparents have no known diseases . the blood count data of this patient at 14 years of age were indicative of normocytic hyperegenerative anemia : decreased red blood cells , hemoglobin and hematocrit , increased red distribution width , and reticulocytes ; other parameters were within the normal range ( table 1 ) . serological data were distinctive from hemolysis : increased lactate dehydrogenase , hyperbilirubinemia due to indirect fraction , and haptoglobin was undetectable ( table 1 ) . there were no signs of iron overload , transferrin saturation , and iron and ferritin values were within the normal range ( table 1 ) . the hemoglobin electrophoresis test was normal except for increased fetal hemoglobin , 12% ( normal range of hbf 0.82 ) . normal ranges in brackets : red blood cells ( rbc 3.55 ) , hemoglobin ( hb 1215.5 ) , hematocrit ( ht 3646 ) , red distribution width ( rdw 10.514.5 ) , reticulocytes ( retic . 01.5 ) , median corpuscular volume ( mcv 8098 ) , median corpuscular hemoglobin ( mch 2733 ) , median corpuscular hemoglobin concentration ( mchc 3235 ) , platelet ( ptl 120450 ) , total bilirubin ( 01.2 ) , lactate dehydrogenase ( ldh 10250 ) , transferrin saturation ( tf sat . 2045 ) , iron ( 37130 ) , ferritin ( 10160 , females ) , hepcidin ( 226 ) . data morphology of peripheral blood cells of the patient aged 13 was as follows : presence of poikilocytosis , anisocytosis , basophilic stippling , polychromia , and mild macrocytosis with 10% erythroblasts . bone marrow morphology aspirated from the patient aged 18 showed intense hyperplasia of red cell series mostly at the last maturation stages , myeloid cells / nucleated erythroid cells ratio of 0.1 ( m / e normal range in adults from 1.2 to 5 ) . binuclearity appears in 15% of orthochromatic erythroblasts , multinuclearity , and abundant iron in mononuclear phagocyte cells with a small number of sideroblasts ( < 5% ) ( fig . analysis by electron microscopy revealed ultrastructural abnormalities of erythroblasts , nuclear and chromatin alterations : pyknosis , karyorrhexis , sponge nuclei , euchromatin areas connecting nuclear membrane , pores in the nuclear membrane through which cytoplasm seems to penetrate into nuclei and intercellular bridges . ( a ) may grnwald stain of bone marrow aspirate ( 40x ) : erithroid hyperplasia , dyserythropoiesis , erythroblastic multinuclearity . ( b ) ultrastructural abnormalities of erythroblasts , nuclear and chromatin alterations : pyknosis , karyorrhexis , sponge nuclei , euchromatin areas connecting nuclear membrane , pores in the nuclear membrane through which cytoplasm seems to penetrate into nuclei , intercellular bridges were also observed but no double nuclear membrane . at 24 , the patient had a premature twin birth , one twin died at 72 h and the other at 40 days because of hydrops fetalis , respiratory failure and sepsis . , this 44yearold patient needs occasional blood transfusions , whenever infectious processes ( urinary infection , at the initial treatment for virus c hepatitis ) but is not transfusion dependent . she presents hyperferritinemia ( 797 ng / ml ) although iron ( 77 g / dl ) and transferrin saturation ( 30% ) are within the normal ranges . the patient has been diagnosed with cda type iv after a genetic study by ion torrent next generation sequencing ion ampliseq ( life technologies ) with a customized panel for cdas ( cdan1 , c15orf41 , sec23b , kif23 , and klf1 genes ) . a pathogenic allelic variant in the heterozygous state was identified in the klf1 gene ( c.973g > a , p.glu325lys ) . congenital dyserythropoietic anemias are rare inherited disorders characterized by a reduced reticulocyte production and hyperplasia in bone marrow . the anemia and hyperbilirubinemia are usually observed in childhood and young adults . the clinical presentation in these patients could lead to misdiagnosis such as hemolytic anemia , thalassemia , hereditary spherocytosis , or iron deficiency anemia , and as consequence , to inappropriate therapies . therapies for cda patients are red cell transfusions , iron chelation to prevent organ damage , splenectomy to abrogate transfusion requirements , or special therapies such as interferon in cda i patients 12 or stem cells transplantation in severe cases of cda 13 , 14 , 15 . the morphological abnormalities of bone marrow erythroblasts support the differential diagnosis of cdas , mainly represented by cda types i and ii . cda type i presents megaloblastic binucleated erythroblasts ( 25% ) , chromatin bridges between nuclei , spongy , or swisscheese appearance of heterochromatin and invagination of cytoplasm into the nucleus . cda type ii presents normoblastic binucleated and multinucleated erythroblasts ( 1035% ) and peripheral double plasma membranes . cda type iii presents giant multinucleated erythroblasts , intranuclear clefts into heterochromatin , autophagic vacuoles , and karyorrhexis . cda type iv presents dyserythropoietic morphology similar to cda types i and ii : binucleated erythroblasts , rare immature erythroid cells with marked heterochromatin 2 , 3 . the analysis of erythrocyte membrane proteins facilitates the diagnosis given that the hypoglycosylation of band 3 is the diagnostic hallmark of cda type ii 16 . the cda type iv ( omim 613673 ) is an autosomaldominant disorder caused by variants in the klf1 gene ( chr 19p13.2 ) which encodes for the krppellike factor 1 ( klf1 ) , an essential erythroidspecific transcriptional factor member of the krppellike family . klf1 can act as a transcriptional activator and repressor of erythroid gene expression , an activator of genes for heme and globin synthesis , blood group antigens , and other erythroid factors 17 , 18 . sixtythree variants on klf1 gene have been described so far and result in different phenotypes such as : hereditary persistence of fetal hemoglobin , borderline elevated levels of hemoglobin a2 , microcytosis and/or hypochromia , lutheran blood type , congenital hemolytic anemia , congenital dyserythropoietic anemia type iv 19 , 20 . recently , homozygosity for null variants has been associated with embryonic lethality 21 . to date , four patients with cda iv have been reported , all of them exhibiting the same autosomaldominant variant c.973g > a , p.glu325lys , in the heterozygous state in the klf1 gene , 4 , 10 , the same genetic variant as the case reported in the present work . this pathogenic variant is found in the second zinc finger of klf1 , an essential region for binding to dna motif in the regulatory regions of many erythroid genes . all of the patients reported as cda type iv , and the patient in this work , showed normocytic anemia , normal or slightly increased reticulocyte count , elevated values of hbf , elevated ldh , hyperbilirubinemia , and reduced haptoglobin . in two cases , anemia had been found at birth and required repeated blood transfusions . in another case , anemia was associated with hydrops fetalis and treated with intrauterine transfusions ; thalassemic facies and female genitalia with a male karyotype were also presented 8 . almost all patients exhibit hepatomegaly and splenomegaly , one was splenectomized aged 4 8 , and the present patient was splenectomized aged 36 . in one case , the liver showed a moderate iron overload , not caused by blood transfusion therapy 11 . these patients showed similar features in peripheral blood smear and in bone marrow aspirate : anisopoikilocytosis , polychromasia , erythroid hyperplasia , dyserythropoiesis signs , basophilic stippling of erythroblasts and erythrocyte , bi and multinucleated erythroblasts with internuclear bridges and enlarged nuclear pores . moreover , erythrocytes of patients reported had low protein expression of cd44 and aqp1 water channel , both expression genes regulated by klf1 8 , 11 . as klf1 is a transcriptional regulator of the switch from fetal to adult hemoglobin , and of many red blood cell membrane proteins , the clinical characteristics of cda type iv are a combination of hemoglobinopathy , red blood cell defect , and hereditary persistence of fetal hemoglobin features . these conditions together distinguish cda type iv from other diseases such as thalassemia , hereditary spherocytosis , and hereditary persistence of hbf 11 . the wide variety of phenotypes observed in cda patients makes differential diagnosis difficult ; the identification of the genetic variants plays a crucial role in the clinical management of patients . genetic diagnosis would contribute to classify cda patients , and even to identify genetic factors that modify phenotype severity . the detection of a genetic variant in misdiagnosed or unclassified cda patients would mean these inherited disorders were more frequent than at present . sdlii : acquired , analyzed , and interpreted the clinical data and morphological images , and revised the manuscript . mjmj : designed the genetic study , analyzed and interpreted genetic variants , and wrote the article .

key clinical messagecongenital dyserythropoietic anemias ( cdas ) are displayed by ineffective erythropoiesis . the wide variety of phenotypes observed in cda patients makes differential diagnosis difficult ; identification of the genetic variants is crucial in clinical management . we report the fifth case of a patient with unclassified cdas , after genetic study , with cda type iv .

vestibular evoked myogenic potential ( vemp ) is one of such tests which checks function of otolith organ . vemp can be elicited by placing the electrodes on different contracted muscles and hence the names cervical vemp and ocular vemp . it is a proposed reliable test of saccular or inferior vestibular nerve function . in human , a vestibulo - ocular reflex stabilizes the visible world upon the retina during head and body movements . the cervical vestibular evoked myogenic potential ( cvemp ) assesses the descending vestibular pathway as ipsilateral sacculocollic reflex ; reported the ocular vestibular evoked myogenic potential ( ovemp ) to evaluate the ascending vestibular pathway as crossed vestibulo - ocular reflex . they also premised that binaural acoustic stimulation can elicit ovemps as effectively as monaural acoustic stimulation does . the former method requires more muscular effort than the later since continuous upward gazing is necessary during ovemp testing . peaks in cvemp are denoted with the small letter to discriminate the waveform from the neurally evoked responses . the amplitude of the waveforms is mostly large and keeps varying from few microvolts to 100 microvolts , depending on the contraction of the muscle tension ( with upward gazing ) and stimulus intensity . most commonly in clinics , vestibular evoked myogenic potential testing is used to assess sacculocollic function in cases of vestibular neuritis , endolymphatic hydrops , superior canal dehiscence syndrome , acoustic neuroma , auditory neuropathy , and some neurodegenerative diseases [ 46 ] . a study on 30 noise induced hearing loss ( nihl ) subjects indicated prolonged vemp latencies and reduced peak to peak amplitude , which concluded the high possibility of vestibular dysfunction , specially the saccular pathway , in individuals with nihl . click and tone burst stimuli have often been used in research on cvemp and so are the amplitude modulated tones . five hundred hz short duration tone burst stimuli are most commonly used , as the animal studies revealed vestibular afferent nerve fibres to be more sensitive to the low frequencies [ 8 , 9 ] . larger vemp amplitudes with 500 hz tone bursts than with 1000 hz and 2000 hz tone bursts were observed . short latency was observed for click evoked cvemp as compared to short duration tone burst stimuli [ 9 , 11 ] . these authors reported a higher response rate for the click stimuli than the short duration tone burst stimuli . however , higher response rates were seen for the click stimulus . at the same time , no difference between the two stimuli with regards to response latency or amplitude was obtained . in addition , higher amplitude responses were seen over a range of modulation frequencies ( 5 , 39 , 59 , 78 , 98 , and 122 hz ) , and specifically the 39 hz modulation frequency yielded the largest amplitude response . but there is a dearth of knowledge on the effect of different stimuli on ovemp response and hence the present study was carried out . the aim of this study was to obtain ovemp responses in normal hearing subjects using different test stimuli like click , 500 hz short duration tone bursts , and amplitude modulated tones . to accomplish the objective of the study , a group of 60 healthy subjects aged 18 to 40 ( mean age of 28.05 years ) years were recruited . the group consisted of subjects with normal hearing sensitivity within 15 dbhl across 250 hz to 8000 hz for air conduction ( ac ) threshold and 250 hz to 4000 hz for bone conduction ( bc ) . all the subjects had a type tympanogram with bilateral ipsilateral and contralateral acoustic reflexes present . volunteers with uncomfortable level for speech greater < 95 dbhl were included in the study . any history or presence of any conductive hearing component or neurological symptoms , vertigo , or giddiness a calibrated diagnostic gsi 61clinical audiometer was used to track the air and bone conduction pure tone thresholds . calibrated middle ear analyzer gsi - tympstar was used for tympanometry and reflexometry , and ovemp recordings were done using intelligent hearing system smart ep version 3.94 ( florida , usa ) . the air conduction and bone conduction thresholds were obtained at frequencies 250 hz8 khz and 250 hz4 khz , respectively , by placing the headphones and bone vibrator on both the ears and mastoid , using a mixture of both ascending and descending methods . ovemp was recorded using click , 500 hz short duration tone burst , and 500 hz mixed amplitude modulated stimuli . best cvemp response using a frequency modulation of 39 hz with 100% amplitude modulation and 10% of frequency modulation depth at 500 hz short duration tone burst was obtained ( see table 1 ) . in order to achieve low impedance , the avoidance of the electrodes capturing activity from sources of interference , for example , electromagnetic radiation , was cautioned . electrode sites were cleaned using skin preparation nu - prep gel , and then the electrodes were placed , respectively . noninverting electrode was placed beneath the eye over the inferior oblique muscle of the eye , inverting electrode at 1 - 2 cm below the active electrode over the cheek and ground electrode on forehead . electrode impedance was kept below 5 kohm , and interelectrode impedance was kept at 2 kohms for all the electrodes . subjects were made to sit comfortably in a straight upright chair and were asked to relax and maintain an upward gaze at 30 degrees during the ovemp recording . the presence of the biphasic complex was taken as the presence of vemp . in order to achieve a high degree of reliability and validity during the measurements , the n1 and p1 latencies as well as peak to peak amplitude of n1-p1 were determined for all waveform . anova and post hoc bonferronni test were carried out to see the significant difference between the recordings using different test stimuli . ovemp was investigated using click stimulus , 500 hz mixed modulated stimulus , and 500 hz short duration tone burst stimulus . from figure 1 , it is evident that click ovemp latency is better than 500 hz short duration tone burst and 500 hz mixed modulated stimuli in latency . however , peak - peak amplitude is better for 500 hz mixed modulated stimulus compared to click stimulus . to note down the statistically significant difference , one way anova and bonferroni post hoc test were carried out . for the click stimulus , the latency of the n1 and p1 was significantly shorter in comparison to the 500 hz short duration tone burst and 500 hz mixed modulated stimuli . from figure 2 , it is evident that mean n1 latencies of click , 500 hz short duration tone burst , and 500 hz mixed modulated stimuli are 9.99 2.25 ( sd ) msec , 11.66 1.37 ( sd ) msec , and 11.22 2.37 ( sd ) msec , respectively . similarly mean p1 latencies were 13.20 2.69 ( sd ) msec , 15.77 1.93 ( sd ) msec and 15.28 2.35 ( sd ) msec for click , 500 hz short duration tone burst , and 500 hz mixed modulated signal , respectively . one way anova test showed main significant effect { f = ( 2,357 ) = 39.23 ; p = 0.00 } on n1 latency across different test stimuli . for p1 latency one way anova test showed significant difference { f = ( 2,357 ) = 40.31 ; p = 0.00 } across the test stimuli . bonferroni analysis showed , there was better n1 and p1 latencies for click as compared to 500 hz short duration tone burst and 500 hz mixed modulated stimulus . when the comparison was made at 500 hz short duration tone burst to 500 hz mixed modulated stimulus , there was no significant difference in n1 and p1 latencies . peak to peak amplitude of ovemp was recorded using different test stimuli . in figure 3 , mean peak - peak amplitude and standard deviation are shown across different test stimuli . using click stimulus mean peak - peak amplitude was 3.74 2.96 ( sd ) v ; however , 500 hz short duration tone burst and 500 hz mixed modulated stimuli had 5.58 2.93 ( sd ) v and 6.03 4.64 ( sd ) v amplitudes , respectively . one way anova test showed main significant effect { f = ( 2,357 ) = 13.67 ; p = 0.00 } on peak - peak amplitude across the different test stimuli . bonferroni analysis showed no significant difference ( p > 0.05 ) in peak - peak amplitude between 500 hz short duration tone burst and 500 hz mixed modulated stimuli . test results revealed statically significant difference in peak to peak amplitude between click and 500 hz stimuli ( tone burst and mixed modulated signal ) . results of the present study exhibited click to have significantly better n1 and p1 latencies as compared to 500 hz short duration tone burst and 500 hz mixed modulated stimuli . there was no difference in peak to peak amplitude between 500 hz short duration tone burst stimulus and 500 hz mixed modulated stimulus . however , peak - peak amplitude showed significant reduction in click stimulation as compared to 500 hz short duration tone burst and 500 hz mixed modulated stimuli . similar to the present findings , [ 16 , 17 ] reported significantly better n1 and p1 latencies for click compared to 500 hz short duration tone burst stimuli . peak - peak amplitude was significantly high for 500 hz short duration tone burst when compared with click stimuli . similar findings have been reported by [ 9 , 11 ] using cvemp response . these longer latencies may be attributed to different excitation patterns of vestibular neurons when exposed to short duration tone burst stimulus or 500 hz mixed modulated stimulus . it has been reported that primary vestibular neurons respond to one short duration tone burst or 500 hz mixed modulated stimulus by double or triple firing . hence , the longer latency associated with 500 hz short duration tone burst stimulus and the 500 hz mixed modulated stimulus may be due to the influence of second or third electrical impulse spikes . peak - peak amplitude was observed higher for 500 hz stimuli as compared to click and may be attributed to the difference in the energy of the stimulus spectrum ; it is the primary reason why the 500 hz short duration tone burst stimuli produced ovemps more effectively than the clicks . the difference of stimuli in sound frequency of 500 hz short duration tone burst stimuli from that of click stimulus , dominantly containing higher frequencies . reduced peak to peak amplitude may be also due to its lower mechanical energy of click , especially the energy from 500 hz to 1000 hz . in addition , the amplitude differences between vemp elicited by click versus short duration tone burst and 500 hz mixed modulated stimuli may be due to differences in the stimulus spectrum level . when comparisons were made at an equal peak to equal intensity levels , the click stimulus had a lower stimulus spectrum level than the short duration tone burst stimulus and the 500 hz mixed modulated stimulus , due to its wider bandwidth . hence , present study suggests 500 hz short duration tone burst to elicit best ovemp responses as it was present in 100% of healthy subjects at higher intensity , and also it had higher peak - peak amplitude as compared to any other frequencies . however , the use of click stimulus is not recommended as it evoked less amplitude and poor wave morphology . with the results of this study , it is concluded that 500 hz stimuli may be preferable when assessing the presence or absence of vemp responses , as larger amplitude response facilitates peaks with good morphology .

aim . ocular evoked myogenic potential ( ovemp ) are short latency potentials evoked by higher acoustic stimulation . in this study , we aimed at comparing the click , 500 hz mixed modulated , and 500 hz short duration tone burst stimuli using ovemp . material . click , 500 hz mixed modulated and 500 hz short duration tone burst stimuli were used for the study . method . conventional sampling and conveneint study design were used . sixty healthy subjects underwent contralateral ovemp testing maintaining 30 degrees upward gaze . single channel electrode montage was applied to record ovemp response . results . on statistical analysis the three stimuli evoked equal response rates ( 100% ) , and when latency of n1 and p1 and peak - peak amplitude were compared , the click evoked showed significantly early latency and lower peak - peak amplitude than the 500 hz stimuli . five hundred hz stimuli did not show significant difference in latency and peak - peak amplitude of n1-p1 . discussion . thus , 500 hz stimuli can evoke better latency and peak - peak amplitude . ovemp has good clinical significance in diagnosing subjects with vestibular dysfunction . to add to the sensitivity of the ovemp test , 500 hz stimuli may also be used as it can evoke better ovemp responses in clinical population with good morphology .

abdominal compartment syndrome ( acs ) is a life - threatening syndrome with an increase in incidence among critically ill patients . primary acs results from a direct injury within the abdomen and pelvic region ( e.g. , a blunt or penetrating trauma , ruptured abdominal aortic aneurysm or laparotomy ) . a direct injury to the abdomen creates an opportunity for hemorrhage and tissue injury . the initial bleeding causes hypoperfusion to the tissues and the accumulating of blood clots within the abdomen initiates intra - abdominal hypertension ( iah ) . acs is most commonly diagnosed in patients with sustaining abdominal or pelvic traumas or in those suffering from some other intra - abdominal hemorrhagic catastrophes . less common etiologic factors are space - occupying lesions ( e.g. , tumors , obstructed bowel ) and bowel / retroperitoneal edema or ascites as well as accompanying mesenteric ischemia or severe pancreatitis . the incidence of acs is reported to be up to 35% in the intensive care population , with reduced survival when compared with other intensive care patients . mortality and morbidity rates are extremely high when patients develop acs , and recognition and treatment are time critical . although the cause of iah can vary , and the degree of organ dysfunction can differ from patient to patient , the reason for this is the effect of decreasing blood flow and increasing pressure on abdominal organs and surrounding organs that creates the end organ dysfunction that defines acs . acs is characterized by a silent physiological derangement and can easily be overlooked or misinterpreted . normal values of intra - abdominal pressure ( iap ) are considered to be close to atmospheric pressure , represented as 0 - 5 mmhg . pooling of blood in the peripheral circulation occurs as congestion is made in the large veins due to the impeded pathway through the abdomen . as the diaphragm is pushed up by the expanding volume of the abdomen , the heart and the pulmonary veins are compressed , causing increased pulmonary vascular resistance and impaired right ventricular systolic function . the congested heart often produces an elevated central venous pressure and pulmonary capillary wedge pressure . this is not a reflection of the patient 's fluid status but rather an indicator of the rising intra - thoracic pressure and systemic vascular resistance . the increase of thoracic pressures is also manifested by increasing peak airway and plateau pressures that can be measured in a mechanically ventilated patient . these pressures are seen to rise early in the process of acs ( iap 15 mmhg ) , and continue to rise as the iap increases . a decline in cardiac output is an early characteristic of acs as well as an escalating heart rate , which occur in an attempt to compensate for the reduced stroke volume . eventually , cardiac contractility decreases and hypotension becomes apparent after the compensatory mechanisms begin to fail . alveoli continue to collapse as the pressure increases , resulting in decreased oxygen uptake within the blood . indications for iap monitoring include abdominal surgery , traumatic injuries , distended abdomen with acs signs and symptoms such as oliguria , hypoxia , hypotension , unexplained acidosis , mesenteric ischemia and/or elevated intra - cranial pressure . monitoring of iap should be considered for the patients having temporary closure with abdominal packs and receiving large volumes of resuscitation fluids for septic or hypovolemic shock . there needs to be vigilance in assessment of the patient 's iap and organ function to optimize early recognition . every clinician , especially nurses , should remember the risk factors for intra - abdomen hypertension and be vigilant to avoid the progression to acs . by measuring the iap through the bladder , a quick and accurate assessment of abdominal pressure is achieved , and this can be performed by emergency or critical care nurses without a specific medical order or sophisticated invasive monitoring equipments . with regard to the fact that acs is a very lethal condition , the researcher intended to recognize patients affected by acs via iap measurement in patients with severe abdominal and pelvic trauma and then investigate the relationship between pelvic fracture and this hazardous syndrome [ figure 1 ] . the clinical presentation of compartment syndrome is also related to heart system , respiratory system and kidney . death rate is high for compartment syndrome . and , the diagnosis of patients in danger , and monitoring them for the symptoms of the syndrome and precocious treatment could help decrease death rate for this syndrome this research was a descriptive analytical study that was performed to characterize patients who develop primary acs and to investigate the relationship between pelvic fracture and acs in abdominal trauma patients ( n = 100 ) referring to the nemazee hospital in 2010 . iap was firstly monitored at the time of patient 's entrance to the emergency room and then every 4 h in patients suspected to be at high risk for acs , e.g. , those undergoing severe abdominal trauma and pelvic fracture . the bladder pressure method is described as the gold standard and is the most reliable measurement of iap via indirect means . the bladder is considered an excellent vehicle for reflecting the iap as it acts as a passive reservoir when its volume is less than 100 ml . with the patient in supine position , the drainage tube , connected to the foley catheter , is clamped ; 60 ml sterile saline is instilled into the bladder via the aspiration port using an 18-gauge needle and the needle is then attached to a three - way stopcock and water manometer . the manometer is filled with sterile saline and then opened to the patient . the zero mark of the manometer is placed at the level of the pubic symphysis and the pressure is read at the meniscus . the iap is measured in cm h2o and converted to mmhg by the formula : mmhg = cm h2o divided by 1.36 . a supine and horizontal position during measurement is most likely to provide reproducible and comparable readings . acs is diagnosed when there is a sustained iah of > 20 mmhg with single or multiple organ dysfunctions such as hypoxia , oliguria or anuria and hypotension , which were not previously present . if the critical care nurse is aware of the high - risk patient groups , suspicion and vigilance may be pivotal in the recognition of the clinical manifestations and early intervention . this highlights the importance of establishing and tracking the iap at an early stage in patients considered to be at risk of acs . during a 12-month period ( since november 2010 ) , we measured the iap in 100 patients afflicted with severe abdominal and pelvic trauma , and diagnosed primary acs in 28 of them . about 82.14% ( n = 23 ) of the patients with acs were male and 17.86% ( n = 5 ) were female , and their mean age was 27 years ( 5 - 50 years ) . demographics of patient groups by age , sex , mechanism of trauma , associated injury and refer or not refer to operation room about 75% ( n = 21 ) of the patients with acs were referred to the operating room , and underwent laparatomy . among the patients being referred to the operating room , 76.2% ( n = 16 ) expired and 23.8% ( n = 5 ) survived the operation . among the patients not being referred to the operating room , 100% ( n = 7 ) expired . about 46.42% ( n = 13 ) of the patients with acs had pelvic fracture , and the chi - square test showed a significant relationship between pelvic fracture and the percent of acs . acs has been indicated as a complication in serious abdominal trauma for more than 50 years . it develops as a consequence of increased iap not only in abdominal trauma but also in intestinal obstructions , with serous edema of the bowels or a chronically growing ascites , in acute hemorrhagic necrotic pancreatitis and septic peritonitis . in recent years one clinical picture of acs is characterized by abdominal distension , hypoxia and hypercapnia with oliguria up to anuria , when organ dysfunction improves after abdominal decompression . in this research , of these 100 patients , 28 patients with primary acs were identified . among the patients with acs , 82.15% ( n = 23 ) expired and 17.85% ( n = 5 ) survived . malbrain ( 2005 ) showed that the incidences of iah and detected patients with acs were 32.1% ( n = 85 ) and 12.9% ( n = 11 ) , respectively . patients with iah ( iap > 12 mmhg ) on admission had a 30-day decrease in survival time compared with those with no iah ( 62% vs. 79% ) , but the difference was not statistically significant . regarding age and gender , 82.14% ( n = 23 ) of the patients with acs were male , and their mean age was 27 years ( 5 - 50 years ) in the present study , which is in accordance with walter et al . they reported that 13 males , aged 45 5 years , developed acs 11.6 2.2 h following resuscitation from a shock . regarding the type of trauma in the present study , 57.14% ( n = 16 ) of the patients with acs had car accidents , 35.71% ( n = 10 ) had motorcycle accidents and 7.14% ( n = 2 ) had suffered from a fall . about 46.42% ( n = 13 ) of the patients with acs had pelvic fracture ; chi - square showed a significant relationship between pelvic fracture and the percent of acs . about 75% ( n = 21 ) of the patients with acs were referred to the operating room and underwent laparatomy , of whom 76.1% expired , but 100% of the patients who were not referred to the operating room expired . among all the patients with acs , 82.15% ( n = 23 ) expired . in a research by pleva et al . , traffic accident trauma together with sporting and leisure time injuries prevailed in 73% of the subjects , and there were 87 abdominal cavity traumas : 31 injuries of the liver , 35 injuries of the spleen , four injuries of the pancreas , 12 injuries of the bowels and five injuries of the retroperitoneum . in the present study , acs occurred in eight patients , of whom six had liver injury . from those six patients , four cases were treated by suture and drainage and two cases and by tamponade in the area of traumatized liver segments seven and eight . in another patient , acs developed as a result of a blunt abdominal trauma associated with pelvic fracture , where decompression laparotomy found no surgical source of bleeding and there was only 500 ml of blood in the douglas space , but extensive distension of thin loops was found together with edema , which was consistent with the findings of our study . immediately after decompression of the abdominal cavity , diuresis was restored and ventilation parameters of the injured improved significantly . in the last patient , acs developed due to extensive retroperitoneal hematoma with injury of soft retroperitoneal tissues and pelvic fracture , where progressive bleeding into the abdominal cavity occurred with developed coagulopathy . every clinician , especially the nurses , should remember the risk factors for iah and be vigilant to prevent its progression to acs . technology and diagnostic capabilities have been developed and refined to optimize the care and treatment of critically ill patients . this has bought a new set of challenges as critically ill patients survive longer and new complications unfold . , acs can develop due to extensive retroperitoneal hematoma with injury of soft retroperitoneal tissues . early intervention and diagnosis is essential among these patients as delayed intervention enhances the risk of death extremely . a critical care nurse is well situated to detect subtle signs or changes in the patients clinical condition that may prompt early investigation into the iap . acs is a clinical syndrome that can easily be misinterpreted and a high index of suspicion to iah may be attributed to improved survival from acs .

introduction : an increase in abdominal pressure can lead to so - called intra abdominal compartment syndrome ( acs ) . multiple factors such as an increase in retroperitoneal volume due to pancreatitis , bleeding and edema as a result of pelvic fracture can lead to compartment syndrome . prevention is better than cure in compartment syndrome . by measuring the intra - abdominal pressure ( iap ) through the bladder , a quick and accurate assessment of abdominal pressure is achieved . therefore , this study aimed to evaluate the relationship between pelvic fracture and acs in traumatic patients.materials and methods : this research was a descriptive analytical study conducted on 100 patients referring to the shiraz nemazee hospital in 2010 . iap was monitored every 4 h in patients suspected to be at high risk for acs , e.g. , those undergoing severe abdominal trauma and pelvic fracture . the iap was measured via the urinary bladder using the procedure described by kron et al . data collected were analyzed using spss software.results:the findings showed that acs occurred in 28 of 100 patients . with regard to the associated injuries with abdominal trauma , 19% of all patients and 46/42% of the patients with acs had pelvic fracture . chi - square test revealed a significant relationship between pelvic fracture and incidence rate of acs ( p < 0.001).conclusions : according to the collected data , pelvic fracture due to a trauma can be one of the important causes of an increase in iap and acs . in this lethal condition , prevention is better than cure . therefore , serial measurement of iap through the bladder in high - risk patients ( those with pelvic fracture by trauma ) is recommended to the nurses to diagnose this condition and to decrease the incidence of mortality .

a 65-year - old female visited korea university anam hospital complaining of chest pain , palpitation , and dyspnea . on the basis of computed tomography , she was diagnosed with takayasu s arteritis including a large aneurysm ( 58 mm ) on the aortic distal arch ( fig . because the patient strongly refused surgery , we performed thoracic endovascular aortic repair ( tevar ) with left subclavian artery ( lsca ) to left common carotid arterial transposition ( fig . after tevar , the patient s symptoms improved , and she was discharged on postoperative day 10 with a normal chest x - ray ( fig . the patient returned to the hospital complaining of moderate dyspnea on postoperative day 19 , and the follow - up chest x - ray showed a severe left pleural effusion ( fig . after the insertion of a chest tube , postoperative chylothorax was confirmed by a pleural fluid analysis . conservative management with a fat - free diet and nil per os was attempted for 2 weeks , but there was no remarkable improvement . therefore , we administered a subcutaneous injection of octreotide ( 0.1 mg ) every 8 hours for 2 weeks ; however , even these injections had no effect . surgical treatment was also considered , but given the possibility of unsuccessful repair due to the uncertainty of the exact site of the thoracic duct leakage and the patient s strong refusal , it could not be our next option . therefore , we performed an intranodal lymphangiogram using lipiodol ( poppy seed oil used as a radio - opaque contrast agent to outline structures in radiological investigations ) on postoperative day 46 . a total volume of 3 to 6 ml of lipiodol was injected into each lymph node at the inguinal area under the guidance of ultrasonography . during the fluoroscopy , the lipiodol had migrated to the retroperitoneal lymphatics but did not advance beyond the l3 level . however , the chest x - ray taken 3 days after the thoracic duct embolization ( tde ) revealed that the lipiodol had migrated up to the subclavian lymphatics ( fig . the chest tube drainage suddenly decreased on the 3rd day after tde , and we were finally able to remove the chest tube on the 13th day after tde ( fig . postoperative chylothorax is a rare but serious complication of the thoracic and esophageal surgical procedure . further , a significant loss of immunoglobulins , t lymphocytes , and proteins into the pleural cavity results in immunosuppression . conservative treatments include drainage of the pleural effusion , a diet including medium - chain triglycerides ( mcts ) , total parenteral nutrition ( tpn ) , and injection of somatostatin analogs like octreotide . an mct diet and tpn reduce the chyle s flow , and somatostatin analogs reduce the intestinal chyle production . in case the high - output chylothorax responds poorly to conservative management , surgical treatment such as thoracic duct ligation , pleuroperitoneal shunt , pleurodesis , or pleurectomy is required . lymphangiography has also been considered a treatment of chylothorax , being less invasive than surgery and having a success rate of about 80% ( table 1 ) [ 36 ] . the mechanism is thought to be caused by lipiodol , which produces an inflammatory process and occludes the chyle leak . complications of lymphangiography are pulmonary oil embolism , hypersensitivity , and lymphatic obstruction , but these are rare and usually minor . in our case , postoperative chyle leakage was not reduced or improved despite the trial of conservative management and octreotide injection . therefore , we performed an intranodal lymphangiogram and tde with lipiodol . through this case , we verified that tde with lipiodol could be considered an alternative for the treatment of postoperative chylothorax , if conservative medical treatment is unsuccessful and surgical treatment is not possible .

chylothorax is a rare postoperative complication of a thoracic surgical procedure . here , we report a case of chylothorax after thoracic endovascular aortic repair with debranching for the distal arch aneurysm of the aorta . first , the patient was treated by a medical method ( nil per os , fat - free diet , and octreotide ) , but this method failed . the patient strongly refused surgical treatment . therefore , we tried to occlude the thoracic duct by lymphangiography lipiodol , and this line of treatment was successful .

enterocolic lymphocytic phlebitis ( elp ) is a disease entity characterized by lymphocytic inflammation of the bowel wall and mesenteric veins and venules , without arterial involvement and without evidence of systemic vasculitis . the term has been first described by saraga et al . in 1989 , although earlier reports seem to have described the same entity . female was referred to the surgical outpatient clinic because of an abdominal ( mesenteric ) mass . she had been evaluated by the gastroenterologist because of abdominal pain that had been present for some weeks , forcing her to take analgetics . there was no history of previous abdominal complaints and the pain could not be induced by movement or eating . the patient had lost some weight with a diet , but otherwise intake was normal . a couple of days before presentation she complained of nausea , without vomiting . an ultrasound of the abdomen revealed a tumourous mass in the left lower quadrant of the abdomen . on computed tomography ( ct ) scan and mri this appeared to be a tumour in the radix mesenterii ( fig . the differential diagnosis included neoplastic processes , such as malignant lymphoma , desmoid tumour , a carcinoid or a gastro - intestinal stromal cell tumour . figure 1:(a ) transverse ct image with the ill - defined tumour in the left side of the patient . ( a ) transverse ct image with the ill - defined tumour in the left side of the patient . explorative laparoscopy was converted to an open procedure because of the macroscopic malignant aspect of the tumour . the mesentery of the sigmoid was involved and had to be resected en bloc with the sigmoid and part of the jejunum . a pathology report surprisingly showed no malignancy ; the resection specimen consisted of a 40 cm long part of small bowel and the sigmoid connected to one another by thickened , tumorous - appearing mesentery . on cross section an ill - defined mass was seen , extending in the bowel walls , with near ulceration of the overlying small bowel mucosa ( fig . 2 ) . vasculitic lesions were seen in venous structures , resembling veno - occlusive disease with signs of recanalization and with the presence of inflammatory cells , mainly lymphocytes ( fig . a diagnosis of elp is predominantly made after histological resection , since the diagnosis relies on the presence of submucosal venules in biopsy specimens . most biopsies present mucosa but not submucosa and therefor no classifying diagnosis can be made on biopsy alone . presentation of elp with a tumour - like mass is rare but has been described . elp has a wide range of clinical and histological presentation [ 6 , 8 , 9 ] . clinical presentation can range from long - standing abdominal complaints with a sudden ( sub)acute worsening of complaints to presentation with an acute abdomen . histological features can range from a granulomatous phlebitis , a necrotizing phlebitis to myointimal and endothelial hyperplasia often accompanied by venous thrombi . aetiology and pathophysiology are unknown but a possible relation with a delayed type hypersensitivity reaction has been postulated [ 3 , 4 ] . in concordance with this some medication have been related to elp , e.g. flutamide and rutoside [ 5 , 7 ] . in our patient none of these possible associations this benign condition can mimic malignancy , necessitating a wide excision , also because obtaining a pre - operative histopathological diagnosis is hardly possible .

a patient with complaints of an abdominal ( mesenteric ) mass is presented . differential diagnosis included neoplastic processes , such as malignant lymphoma , desmoid tumour , a carcinoid or a gastro - intestinal stromal cell tumour . an oncological resection was performed . despite the malignant appearance of the tumour no malignancy was found with histopathological examination . vasculitic lesions were seen in venous structures , resembling veno - occlusive disease with signs of recanalization and with the presence of inflammatory cells , mainly lymphocytes . a diagnosis of enterocolic lymphocytic phlebitis was made . this benign condition can mimic malignancy , necessitating a wide excision , also because obtaining a pre - operative histopathological diagnosis is hardly possible .

after getting informed consents , peripheral blood and serum samples were obtained from 32 ebv - positive npc and 5 ebv - positive i m patients who were under observation and treatment at dr . this study was approved by the ethical committee of the faculty of medicine , gadjah mada university . serum anti - vca and ebna igg assessed by a commercially available kit ( panbio , sinnamon park , queensland , australia ) and were used to determine the positive or negative status of ebv in serum samples . the serum levels of il-4 were determined by an eli - sa kit ( r&d system , minneapolis , mn , usa ) . the serum levels of ifn- were detected by an immunodot blot assay using diluted antihuman ifn- antibodies ( boehringer mannheim , gaithersburg , maryland , usa).6 the result of each sample subtracted from the optical density reading of the relevant internal control , was divided by 100 and expressed as densitometric units ( du ) . peripheral blood mononuclear cells ( pbmc ) were isolated and the expression of il-4 and ifn- mrna was semiquantitatively assessed by a polymerase chain reaction ( pcr)-colorimetric dot blot assay . briefly , total rna from pbmc was extracted and the resulting cdna was amplified by pcr . the sequences of the primers used in the amplification of human il-4 were as follow : 5-ctgcaaatcgacacctatta-3 and 5-gatcgtctttagcctttc - 3 ( product size : 0.44 kb ) . the sequences of the primers used in the amplification of human ifn- were as follow : 5-ccatgggcccgcaggcggcagc-3 and 5-gaggacggagagctgttcttcc-3 ( product size : 0.49 kb ) . the pcr products were then immobilized on nitrocellulose membrane using a modified dot blot apparatus , hybridized , visualized and read at an absorbance of 546 nm . the result of each sample was subtracted from the optical density reading of the relevant internal control , divided by 100 and expressed as densitometric units ( du ) . data were statistically calculated by oneway analysis of variance followed by fisher 's least square difference using a statistical package ( spss inc . , the serum levels of il-4 in patients with i m and npc were significantly lower than those of the control ( p < 0.05 ) ( figure 1a ) . no significant difference between the serum levels of this cytokine in patients with i m and those with npc was observed ( p > 0.05 ) ( figure 1a ) . however , the serum levels of ifn- in patients with npc were significantly higher than those in the control and patients with i m ( p < 0.05 ) ( figure 1b ) . slightly increased serum levels of ifn- in patients with i m as compared to those of the control could be detected ( p < 0.05 ) ( figure 1b ) . interestingly , the levels of il-4 and ifn- mrna expression in patients with i m and npc were not significantly different from those of the control ( p > 0.05 ) ( figure 2 ) . serum levels of il-4 ( a ) and ifn- ( b ) in patients with infectious mononucleosis ( i m ) and nasopharyngeal carcinoma ( npc ) . the levels of il-4 ( a ) and ifn- ( b ) mrna in the unstimulated peripheral blood mononuclear cells of patients with infectious mononucleosis ( i m ) and nasopharyngeal carcinoma ( npc ) . the present study showed that the serum levels of il-4 in i m and npc patients were lower , but the serum levels of ifn- in these patients were higher than those of the healthy subjects , suggesting predominant ifn--driven immunity in i m and npc patients which is in agreement with previous reports.35 it has been believed that increased levels of ifn- may be associated with decreased levels of il-4 during viral infections and vice versa.7 one may assume , therefore , that i m and npc seen in the present study might be predominantly associated with ifn--associated immunity which might , in turn , down - regulate the activation of il-4-associated immunity . interestingly , the present study also found that the serum levels of ifn- in npc were much higher than those in i m . moreover , the previous studies have reported much lower levels of ifn- gene expression in infected lymphoid tissues of i m patients compared to those in the tissues of npc.89 since increased levels of ifn- are indicators of a more active cellular immunity in npc,10 a possibility that ifn--driven cellular immune response in npc may be more intense than that in i m can not be ruled out . surprisingly , il-4 and ifn- mrna levels in pbmc of i m and npc patients were comparable with those of the control . one of the possibilities to explain this result is that the present study has used unstimulated pbmc from these patients , making detection of altered cytokine gene expression difficult . support for this notion is the fact that elevated cytokine production by peripheral blood cells from i m patients has been observed only after activation of the cells by mitogens11 or t cell receptor ligation.12 it seems plausible , therefore , that unstimulated pbmc from i m and npc patients may not be the preferable source of cells to detect ebv - altered cytokine gene expression . if so , one may speculate further that detectable serum level of il-4 and ifn- in both i m and npc patients seen in the present study might be driven from the ebv - infected tissues . the extrapolation of the present study in the management of i m and npc remains speculative . if increased serum levels of cytokines seen in the present study originate from the infected or tumor tissues , it would seem that the host immune response in both i m and npc is predominated by ifn--driven cellular immunity which is much more intense in the latter than the former disorder . subsequently , it remains to be further investigated whether the serum levels of ifn- may be used as one of the markers to assess the management of i m and npc . the fact that the serum level of this cytokine has been used in i m patients to monitor the progression of disease and follow the treatment35 suggests that monitoring of ifn- serum levels may be worthy to detect the progression of npc as well . the present study shows that the serum levels of ifn- , but not il-4 , elevate in i m and particularly npc patients . however , the gene expression of both cytokines in unstimulated pbmc of i m and npc patients is similar to those of the controls . these results suggest that the levels of ifn- may be predominant over those of il-4 during the course of i m and npc .

background : cytokines have been suggested to participate in the pathogenesis of infectious mononucleosis ( i m ) and nasopharyngeal carcinoma ( npc).methods : serum levels and gene expression of interleukin-4 ( il-4 ) and interferon- ( ifn- ) were assessed by immunologic and pcr assays , respectively in patients with epstein - barr virus ( ebv)-associated i m and npc and ebv nega - tive controls.results:the serum levels of ifn- were elevated , but those of il-4 were decreased in i m and npc patients as compared with those of the control group ( p < 0.05).conclusions : these results suggest that serum levels of ifn- may be predominant over those of il-4 during the course of i m and npc .

christoph bock ( cemm research center for molecular medicine of the austrian academy of sciences , austria ) was one of two invited speakers and gave an overview of dna methylation data in general terms as well as the number of different assays available . dr bock highlighted the 450k array s accuracy and similarity to genotyping applications in addition to having a quick and easy analysis workflow compared with sequencing based methods and to this end briefly presented a 450k analysis tool developed in his group , rnbeads ( http://rnbeads.bioinf.mpi-inf.mpg.de ) . other tools mentioned , in which dr bock is a contributor , included epiexplorer , epigraph , biq analyzer , and methmarker . finally , dr bock presented godmc ( genetics of dna methylation consortium ) that facilitates genome - wide association studies of dna methylation . this consortium has been organized to bring together researchers studying the genetic basis of dna methylation and provide a centralized hub for coordinating analysis , summary statistics , replication , and meta - analysis . in addition to rnbeads , a number of other software packages have been developed for 450k data analysis . chloe wong ( kings college london , uk ) presented their recently published package , watermelon , available from bioconductor . watermelon provides a number of qc steps including the use of snp probes for sample relatedness and identification of possible sample mix - ups . the package provides a wide variety of normalization options and they have compared 15 types of preprocessing methods in which they found their own dasen method as the most effective . however , they encourage users to experiment and determine the method best suited to their data . tiffany morris ( cancer institute , university college london , uk ) presented the recently released champ package , an r - package available for download at http://www2.cancer.ucl.ac.uk / medicalgenomics / champ/. this package offers novel methods for downstream analysis . these include a function for batch effect estimation using singular - value decomposition ( svd ) that highlights technical variation ; a new way to call differentially methylated regions ( dmrs ) using a feature - oriented dynamic window that aims to capture neighboring significant probes ; and also a function for estimating copy number aberrations ( cnas ) in 450k data . kasper hansen ( john hopkins bloomberg school of public health , usa ) presented the minfi package available from bioconductor . dr hansen gave an overview of the currently available functions for qc , normalization , and also mentioned functions that would be released in the near future for predicting the sex of samples to highlight mislabeled samples , a function to estimate cell composition and a dmr caller . dr hansen particularly emphasized the importance of considering sample mix - ups , especially in large ewas studies as up to 10% of samples can be mislabeled . kim siegmund ( university of southern california , usa ) was the 2nd invited speaker and she discussed her implementation of the methylumi package available from bioconductor . dr siegmund focused on the importance of background correction ( of both type i and type ii probes ) and dye bias adjustment ( of type ii probes ) and emphasized the impact of background noise on values , principally for studies where small changes are expected . in these studies dr siegmund has found that the removal of background noise and adjustment for dye bias removes the commonly observed trend of increasing signals across an array . as such , dr siegmund is confident that there is now a strong understanding of normalization methods , however , it is important to next focus on differentiating cell types . she ended by giving an overview of publically available data sets from the cancer genome atlas ( tcga ) . francesco marabita ( karolinska institute , sweden ) presented recently published work of his evaluation of six different analysis pipelines that differ in normalization method . he used two unpublished and two published data sets to make the comparison and found quantile normalization and beta mixture quantile dilation ( bmiq ) to be the most effective methods . robert lowe ( queen mary university of london , uk ) presented his recent work on a new public database for illumina 450k data known as marmal - aid ( http://marmal-aid.org/ ) . this allows easy access to all publically available 450k data ( currently 8000 + samples ) . the data are extracted from public repositories and a number of pre - processing steps are applied such as data imputation and normalization . he showed that samples cluster by tissue rather than batch that suggests methylation differences of > 10% were detectable above the influence of batch . roderick slieker ( leiden university medical center , the netherlands ) presented a method for characterizing tissue specific differentially methylated regions ( tdmrs ) in two independent data sets of four peripheral tissues ( blood , saliva , buccal swab , and hair follicles ) and six internal tissues ( liver , muscle , pancreas , subcutaneous fat , omentum , and spleen with paired blood ) . of the tdmrs , 13% mapped to gene body cpg islands and 25% to cpg islands shores . implementation of annotations that recently became available through encode showed enrichment of tdmrs in dnase hypersensitive sites and transcription factor binding sites . amy webster ( manchester university , uk ) presented results in relation to her study on differential methylation related to response of etanercept in patients with rheumatoid arthritis . a huge advance in the treatment of rheumatoid arthritis ( ra ) has been the introduction of biologic drug therapies ; however , 40% of patients fail to respond . they chose 24 patients to identify a methylation signature indicative of response and found nine probes that showed significant differences . while the sample size was small this preliminary data indicate a possible methylation biomarker of response . the program was brought to a satisfying close following two talks given by representatives from illumina : bret barnes ( illumina , usa ) explained clearly the rationale behind the design of the 450k array and the requirement for a mixture of probe types , while fraz syed ( illumina , usa ) discussed a whole genome bisulfite sequencing library preparation kit . it is clear that analysis pipelines for the 450k have evolved over the past year . while last year s talks focused heavily on type 1 and type 2 differences , these appear less of a concern now . details of the preprocessing methods are very important , particularly in ewas studies and a number of effective methods are now available . one issue that was mentioned in a number of talks was the importance of knowing the cell type composition in an experiment . dr hansen highlighted this particularly effectively during his talk , illustrating the point by showing aging data where newborns have a significantly different blood composition to that of the elderly and hence correcting for this is essential before looking for changes in methylation between the two groups . readers wishing to keep informed of issues related to the illumina 450k platform are encouraged to visit the actively - used web forum set up last year , http://groups.google.com/group/epigenomicsforum

the illumina infinium humanmethylation450 beadchip the successor to their hugely popular humanmethylation27 beadchip is arguably the most prevalent platform for large - scale studies of dna methylome analysis . after the success of last year s meeting1 that discussed initial analysis strategies for this then - new platform , this year s meeting ( held at queen mary , university of london ) included the presentation of now established pipelines and normalization methods for data analysis , as well as some exciting tools for down - stream analysis . the importance of defining cell composition was a new topic mentioned by most speakers . the epigenome varies between cell types and insuring that methylation differences are related to sample treatment and not a differing cell population is essential . the meeting was attended by 215 computational and bench scientists from 18 countries . there were 11 speakers , a small poster session , and a discussion session . talks were recorded and are now freely available at http://www.illumina.com/applications/epigenetics/array-based_methylation_analysis/methylation-array-analysis-education.ilmn

choroid plexus papillomas ( cpp ) and choroid plexus carcinoma ( cpc ) ) comprise 2 - 4% of all pediatric brain tumors . of these , these tumors produce symptoms even when small because of their strategic location as well as cerebrospinal fluid ( csf ) over production . diagnosis rests on imaging studies that show the mass in the location of third ventricle with typical imaging features on sonography , computed tomography ( ct ) , and magnetic resonance imaging ( mri ) . radiosurgery can achieve reduction in size as well as vascularity of lesion to allow less complicated procedure . a 7-week - old full term male presented with downward gaze since birth and progressive increase in head size . on examination , the child was normal weight but was lethargic . cranial sonography revealed dilatation of bilateral lateral ventricles with an echogenic lobulated mass in the third ventricle with internal vascularity [ figure 1 ] . no evidence of hemorrhage was noted in the ventricular system or brain parenchyma . a diagnosis of choroid plexus papilloma was suspected and a contrast - enhanced ct ( cect ) confirmed the enhancing mass in the third ventricle with hydrocephalus [ figure 2 ] . to know the exact extent of the tumor as a part of preoperative evaluation , a contrast - enhanced mri was performed . a lobulated mass was noted in the third ventricle , hypointense on t1 weighted and mildly hyperintense on t2 with intense enhancement on administration of intravenous gadolinium . contrast - enhanced images depict the extension into the fourth ventricle [ figure 3 ] . child underwent a shunt procedure followed by right frontal craniotomy with transcortical transforaminal total excision of the tumor . the main feeding vessel was posterior choroidal artery that was identified after debulking of the tumor . the histopathology of the resected tumor showed tumor cells arranged in multiple papillae with fine fibrovascular core , confirming the diagnosis of cpp [ figure 4 ] . postoperative course of the child was uneventful and follow - up ct revealed no residual tumor . sagittal ( a ) , coronal ( b ) , and axial ( c ) cranial sonographic images reveal an echogenic lobulated mass obstructing the third ventricle . doppler evaluation ( d ) reveals vascularity within the lesion axial computed tomography ( ct ) images reveal an enhancing lobulated mass in the third ventricle ( a ) with dilatation of the lateral ventricles ( b ) axial magnetic resonance ( mr ) images ( a and b ) reveal the tumor with hypointensity on t1-weighted images and mild hyperintensity relative to gray matter on t2-weighted images . contrast - enhanced axial ( c ) and sagittal ( d ) images reveal avid enhancement within the tumor and extension into fourth ventricle low power ( a ) and high power ( b ) photomicrograph reveal tumor cells arranged in multiple papillae with fine fibrovascular core cpp is a rare tumor of neuroectodermal origin , accounting for less than 1% of all intracranial neoplasms . it has predilection for lateral ventricle in infants and children and fourth ventricle in adults . however , description of third ventricular cpp is limited to a few case reports or case series . these tumors typically present in neonatal or early childhood period , pointing to their congenital origin . these lesions typically manifest with increasing head size , lethargy , decreased activity , and poor psychomotor milestones in infants . as the child grows older , visual impairment and gait disturbances are noted , related to raised intracranial pressure ( icp ) and direct pressure caused by the tumor . hydrocephalus and raised icp in these cases is caused by two mechanisms : direct obstruction of csf pathway and overproduction of csf by tumor cells that tend to maintain function of choroid plexus . because of their strategic location , very small lesions can be symptomatic and likely to be missed . most of the lesions that have been described measure between 2 and 5 cm . razzaq and chishti , reported a giant cpp of third ventricle measuring 8 5 5 cm . certain interesting symptoms and signs associated with third ventricle cpps have been described in literature . bobble - head doll syndrome and drop attacks were noted in a 2-year - old child by pollack et al . this was hypothesized to be due to intermittent obstruction of foramen of monro and proximal aqueduct . behavioral disturbances have also been described , probably related to proximity and pressure by the tumor on hypothalamus . imaging plays a vital role in differentiating between obstructive ( noncommunicating ) and nonobstructive ( communicating ) hydrocephalus . ultrasonography ( usg ) is the modality of choice in utero , neonatal , and early infancy . one of the greatest strengths of usg is the monitoring of hydrocephalus in the most noninvasive way , with no need for sedation and without the use of radiation . besides , usg can detect small intraventricular lesions that can sometimes be missed on noncontrast ct , as was the case in our patient . ct plays an important role in older children where the acoustic window for usg is lost . the degree of heterogeneity is variable depending on the size of tumor , and if marked , should lead to a suspicion of cpc , particularly if there is adjacent invasion . mri is the modality of choice in older children for central nervous system imaging in general and intracranial tumors in particular . this is related to the ability of mri to provide multiparametric imaging affording a preoperative typing and grading of tumor , planning of biopsy , and surgery . complete removal of tumor is advocated and various approaches to third ventricular tumors include transcallosal , transfrontal , transforaminal routes , and supracerebellar infratentorial . in individual cases , the surgical approach would depend on location , size , vascularity , and extension of tumor through the foramen of monro . another innovative therapy is radiosurgery that aims at avascular necrosis and shrinkage of tumor and is best as an adjunct to surgery .

choroid plexus papilloma ( cpp ) represents an uncommon pediatric brain tumor with an overall incidence less than 1% of all intracranial tumors . most of these tumors occur in the lateral ventricles in neonates . third ventricular location is uncommon , limited to a few case reports . these highly vascular tumors retain the physiological function of choroid plexus and thus lead to overproduction of cerebrospinal fluid ( csf ) , besides obstructing the csf pathway . imaging is fairly sensitive and specific in affording the diagnosis of this tumor . surgical approaches differ according to the site of tumor and aim is complete removal of tumor . we present an interesting report of an infant who presented to our department for cranial sonography that lead to suspicion of this tumor , later confirmed by other imaging modalities and histopathology .

the alterations in plasma lipids related to obesity that contribute to the higher incidence of cardiovascular disease in obese subjects mainly involve hypertriglyceridemia1,2 and low serum high - density lipoprotein ( hdl ) cholesterol . increases in low - density lipoprotein ( ldl ) cholesterol levels are less frequent3,4 and have been less well investigated . lipidic emulsions of defined composition that are made without protein can mimic the intravascular behavior of plasma lipoproteins . injected into the bloodstream , chylomicron - like or ldl - like emulsions acquire circulating apolipoproteins that modulate the emulsion s metabolism and thus serve as a probe of the metabolic status of lipoproteins . accumulation of ldl in the plasma leading to hypercholesterolemia is mostly due to reduced ldl plasma clearance by the ldl receptors rather than increased lipoprotein production . in a recent study that used ldl - like nanoemulsions to probe ldl metabolism , we observed that , in sedentary subjects , ldl removal from the plasma compartment was slower than in athletes , although there was no difference in ldl cholesterol between sedentary subjects and athletes.5 this suggests that the increased removal of ldl in athletes is compensated for by an increased input of lipoprotein into plasma , either by increased conversion of ldl from vldl or by increased direct ldl synthesis by the liver . to verify whether there are defects in ldl intravascular catabolism in obese subjects , we tested the plasma clearance of an ldl - like nanoemulsion in subjects with morbid grade iii obesity ( body mass index ( bmi ) > 40 kg / m ) in comparison with control subjects ( 25 kg / m ) of normal weight . ten obese ( three male and seven female ) and ten non - obese ( four male and six female ) subjects participated in the study . all participants were volunteers selected from the outpatient clinics of the institution . none of them were addicted to alcohol or had diabetes mellitus , liver , renal , thyroid , inflammatory , or neoplastic disease , and none were pregnant . the design and objectives of the study were explained to the participants , and written informed consent was obtained . blood samples for the determination of plasma lipids and apolipoproteins were collected after a 12-h fast . commercial enzymatic methods were used for the determination of total cholesterol ( boehinger - mannheim , penzberg , germany ) , triglycerides ( abbott laboratories ) and hdl cholesterol after chemical precipitation of apo - b - containing lipoproteins with magnesium phosphotungstate . ldl cholesterol was calculated by the formula of friedewald.6 plasma apo ai and apo b were assayed by radial immunodiffusion ( lipo - partigen r - apoa - i and nor - partigen r - apob plates , behing , marburg , germany ) . the ldl - like nanoemulsion was prepared from a lipid mixture composed of 40 mg / mmol egg phosphatidylcholine , 20 mg /mmol cholesteryl oleate , 1 mg /mmol triolein , and 0.5 mg /mmol cholesterol purchased from sigma chemical co. ( st louis , mo ) , in addition to a mixture of [ c]cholesteryl oleate and [ h]-triglycerides purchased from amersham international ( amersham , uk ) . emulsification of the lipids by prolonged ultrasonic irradiation in aqueous media and two - step ultracentrifugation of the crude emulsion with density adjustment by the addition of kbr in order to obtain the lde microemulsion was carried out by the method of ginsburg et al.7 as modified by maranho et al.8 the participants fasted for 12 h prior to the test at 9 am , but they were allowed two standard meals during the study at 12:30 pm and 6 pm . the ldl - like nanoemulsion containing 70 kbq of [ c ] cholesteryl oleate and 121 kbq of [ h ] triacylglycerol at a total of 56 mg /mmol in a 100-l volume was intravenously injected in a bolus . plasma samples were collected over 24 h ; the first sample was collected 5 minutes after the injection of the nanoemulsion , and , after that , at 1 , 2 , 4 , 6 , 8 , 12 , and 24 h after the injection . the safety of the radioactive dose injected into the subjects was assured according to radioprotection regulations9 described elsewhere.10 the procedures for lipid extraction and the addition of scintillation solution to each blood sample for radioactive counting and determination of the plasma decay curves of the radiosotopic labels of the nanoemulsion were performed as described previously using the anacomp software.11 all recorded variables were tabulated as means sd or sem . differences in the plasma lipids were evaluated using the mann whitney test , and differences with p < 0.05 were considered statistically significant for all comparisons . the safety of the radioactive dose intravenously injected into the patients was assured according to the regulations of the international commission on radiological protection.9 the equivalent dose derived from the injected dose for each experiment was 0.1233 msv , well below the 20-msv annual limit for the intake of radionuclides . table 1 shows the individual physical characteristics and the plasma lipid and apolipoprotein profiles of the obese subjects and the controls . obese subjects had ldl cholesterol levels similar to those of the controls , but the hdl cholesterol values were lower . on the other hand , fasting triglyceride levels were greater in the obese subjects ( p= 0.019 ) than in the controls . it is apparent that the curves obtained from the obese subjects did not differ from those of the non - obese controls . in fact , the calculated cholesteryl ester fcr of the morbid obese subjects was equal to that of the controls . the triglyceride fcr was lower in the morbid obese subjects than in the non - obese controls . in the non - obese controls , , there was a trend ( although not statistically significant ) of a greater triglyceride fcr in comparison to the cholesteryl ester fcr . in this study , in a group of morbid obese subjects , the removal of cholesteryl esters of an ldl - like nanoemulsion from plasma was similar to that observed in control subjects , but triglyceride removal was slower . injected into the blood stream , the ldl - like nanoemulsion acquires several circulating apolipoproteins such as apo cii and apo e. apo cii is the co - factor for lipoprotein lipase and can eventually stimulate the enzyme to break down the residual triglycerides present in this nanoemulsion . on the other hand , apo e is recognized by the receptors that remove ldl from circulation.12 in several studies from our group , a triglyceride - rich emulsion labeled with radioactive triglycerides and cholesteryl esters has been used to test the chylomicron metabolic pathway in several disorders that affect plasma lipid metabolism.1319 this pathway is also common to very - low - density lipoproteins ( vldl ) that ( similarly to chylomicrons ) undergo degradation of their triglyceride content by lipoprotein lipase using apo cii as a co - factor . in obese subjects , the removal of the triglycerides of the chylomicron - like emulsion from plasma was similar to that in the non - obese controls , but the cholesteryl ester removal was slower.20 this finding suggests that , although the lipolysis process occurs normally in the obese , there is difficulty in removing the remnants from circulation , a defect that is associated with atherosclerosis development . in the correlation study on obese subjects that was subsequently performed , a negative correlation between cholesteryl ester removal ( i.e. , remnant removal ) and bmi was found ; in contrast , lipolysis correlated positively with bmi.21 one can hypothesize that the excess insulin in the plasma of obese subjects stimulates lipolysis , whereas their obesity inhibits the mechanisms of remnant removal , in which ldl receptors are also involved . however , when the morbidly obese were compared with obese subjects , the former showed diminished lipolysis , indicating that additional defects appear in individuals with extremely high bmis . another aspect is alterations in glucagon - like peptide 1 , which modifies the postprandial rise in triglyceride concentration , whose effects are not completely understood in morbid obesity , despite the functions already described.22,23 yet another aspect which may be mentioned is the fact that treatment of obese patients with the cholesterol removing agent sibutramine does not appear to correct the hypertension normally associated to obesity.24 whereas the chylomicron - like emulsion probes the lipolysis and remnant removal of triglyceride - rich lipoproteins , the ldl - like nanoemulsion probes the function of the mechanisms that remove ldl from circulation . the fact that the removal of the ldl - like nanoemulsion was normal in the morbidly obese indicates that those mechanisms are not altered in these subjects . this was confirmed by the fact that ldl cholesterol and apolipoprotein b concentrations were both normal , although different removal rates associated with different synthesis rates might have resulted in equal ldl concentrations , a possibility that we explored in this study regarding the removal rates . the fact that , in both control and obese subjects , the triglycerides of the ldl - like emulsion were removed faster than the cholesteryl ester indicates that lipolysis also occurs in those particles as it does in chylomicron - like emulsions . the finding that the triglycerides of the ldl - like nanoemulsion were removed more slowly in the morbidly obese than in the controls is noteworthy . there are significant structural differences between ldl - like particles and chylomicron - like emulsion particles . while in the chylomicron - like emulsion , the triglyceride component is prevalent , constituting up to 70% of the particle composition , in ldl - like particles , the triglyceride content is rather residual . on the other hand , the particle diameter of the chylomicron - like emulsion is two to four times greater than that of the ldl - like preparation . nonetheless , both preparations showed slower triglyceride removal in the morbidly obese subjects ( but not in the obese subjects ) , as compared with the controls .

introduction : obesity increases triglyceride levels and decreases high - density lipoprotein concentrations in plasma . artificial emulsions resembling lipidic plasma lipoprotein structures have been used to evaluate low - density lipoprotein metabolism . in grade iii obesity , low density lipoprotein metabolism is poorly understood.objective:to evaluate the kinetics with which a cholesterol - rich emulsion ( called a low - density emulsion ) binds to low - density lipoprotein receptors in a group of patients with grade iii obesity by the fractional clearance rate.methods:a low - density emulsion was labeled with [ 14c]-cholesterol ester and [ 3h]-triglycerides and injected intravenously into ten normolipidemic non - diabetic patients with grade iii obesity [ body mass index higher than 40 kg / m2 ] and into ten non - obese healthy controls . blood samples were collected over 24 hours to determine the plasma decay curve and to calculate the fractional clearance rate.results:there was no difference regarding plasma levels of total cholesterol or low - density lipoprotein cholesterol between the two groups . the fractional clearance rate of triglycerides was 0.086 0.044 in the obese group and 0.122 0.026 in the controls ( p = 0.040 ) , and the fractional clearance rate of cholesterol ester ( h1 ) was 0.052 0.021 in the obese subjects and 0.058 0.015 ( p = 0.971 ) in the controls.conclusion:grade iii obese subjects exhibited normal low - density lipoprotein removal from plasma as tested by the nanoemulsion method , but triglyceride removal was slower .

normally , the body forms a blood clot in reaction to an injury . with dic massive bleeding can occur due to the body 's lack of clotting factor and platelets . its prognosis , regardless of cause , is often poor and needs to be treated promptly [ 1 , 2 ] . dic is not itself a specific illness ; rather , it is a complication or an effect of the progression of other illnesses . it is always secondary to an underlying disorder and is associated with a number of clinical conditions , generally involving activation of systemic inflammation . such conditions include the following : recent episode of sepsis , anesthesia , surgery or trauma , reaction to blood transfusion , severe liver disease , delivery complications , leukemia , and solid cancers . acute dic develops quickly ( over hours or days ) and must be treated immediately . the condition begins with excessive clot formation in the small blood vessels and quickly leads to serious bleeding . chronic dic causes excessive blood clotting , but it usually does not lead to bleeding . cancer is the most common cause of chronic dic ; gastric , pancreatic , and prostatic cancers are notorious . prostate cancer is one of the solid tumors that is the most common malignancy in men and is the second cause of death in men among neoplastic diseases . dic secondary to prostate cancer is not that rare , but only several cases of the initial presentation have been reported [ 715 ] . in this paper we discuss an 85year old man who fulfilled the criteria for diagnosis of dic . the consequent investigation as to the underlying disease resulted in the discovery of metastatic prostate cancer . an 85year old man was admitted to the accident and emergency ward with vast ecchymoses that first emerged in his left popliteal area 15 days prior and gradually progressed to the inguinal area . he had a history of hematuria and bleeding from his lower lip , which could not be easily controlled . his past medical history was remarkable for a two year history of hypertension , which was under medical therapy with losartan , nitroglycerin , metolazone , metoral , and amlodipine . he also had a history of unstable angina and transurethral resection of the prostate seven years ago . at the time of admission his vital signs were stable . the laboratory workup revealed low levels of hemoglobin , low platelet count in cbc , and low fibrinogen along with prolonged prothrombin time ( pt ) and partial thromboplastin time ( ptt ) . international normalized ratio ( inr ) was significantly higher than its normal ranges ( table 1 ) . to prove the presence of dic , hematologic factors v , vii , and viii were checked , which were found to be below their normal ranges . results of laboratory tests of the patient in emergency ward as signs and results of test were suggesting dic he was subjected to supportive therapy . the patient received vitamin k , one unit of packed red cells , and two units of fresh frozen plasma . his profession as the patient consequently was hospitalized in isolation , blood samples were sent for serology and pcr , and he underwent treatment with ribavirin , but he was unresponsive to therapy . during the days of hospitalization , the level of hb went from 11.2 to 8.1 gr / dl while pt and ptt became immeasurable , so he was treated with one unit of fresh frozen plasma twice a day . as the results of pcr and serology were negative , further investigations included direct and indirect coombs tests for anti cardiolipin and anti phospholipid iggs and igms , but were all found to be negative . in order to rule out the possibility of malignancies such as gastric , pancreatic and prostatic cancers that could have led to dic , abdominopelvic sonography and chest x the chest x ray ( figure 1 ) revealed some opacities so chest and abdominopelvic computed tomography scan with oral and intravenous contrast was performed ( figs . 2 , 3 and 4 ) . neither para aortic adenopathy nor abnormal collection nor mass were reported , but several nodules with speculated and irregular margins was seen in the lungs , the largest of which was located in the apex of left lung and was approx . 2 cm in largest dimension . endoscopy was performed to find a gastric origin , but only a small hiatal hernia was observed . to rule out the pancreatic and prostatic origin , the report indicated kidneys , bladder , spleen , and liver to be normal , but an ill defined area with an estimated volume of 10 ml was seen in the prostate . consequently , the results of the ultrasonography directed all our attention to the prostate gland . chest ct scan with oral and intravenous contrast ( several nodules with speculated and irregular margin in lungs are seen ) . according to the findings from imaging , prostate specific antigen ( psa ) a whole body bone scan revealed a number of metastatic areas in bone that were the foci that lead to the dic . upon confirming the diagnosis the patient underwent treatment . as orchiectomy was not possible , hormonal ablation followed by chemotherapy with taxotere 100 mg every 21 days was prescribed to him . he was then discharged with normal pt and ptt and no source of bleeding after the first course of chemotherapy . in this paper we reported an 85year old man with vast ecchymoses and bleeding . his laboratory workup consisted of decreased platelet count , prolonged pt and ptt , decreased level of fibrinogen , increased level of ldh , and d dimer , which confirmed the presence of dic . the diagnostic procedures to find the underlying cause of dic ended up in the discovery of metastatic prostate cancer . bone is the most common site of metastasis in prostate cancer and it is responsible for inducing dic even more than gastric and pancreatic cancer . the incidence rate of dic is 1330% in metastatic prostate cancer , but it is infrequent as the first manifestation [ 1 , 2 , 7 ] . the first symptom in our patient was vast ecchymoses on different parts of his body and hematuria . most other cases reported previously also presented initially with ecchymoses , hematuria , and gastrointestinal hemorrhage [ 715 ] . the known risk factors making patients more susceptible to dic include : older age , advanced tumor stage , and primary tumor necrosis . considering these risk factors our patient was at great risk of dic . the mechanism leading to dic is still vague , very likely it is related to tumor cells that express procoagulant factors on their surface or possess rich thromboplastin . the other theory is the production of some cytokines such as il6 and tumor necrosis factor [ 19 , 20 ] . dic is a fatal coagulopathy that needs a rapid supportive treatment to replace the hematologic factors in its life threatening episodes , but the main treatment is to diagnose the underlying disease and rectify it . investigations of the cause of dic in our patient were highly suggestive for prostate cancer due to the high serum level of psa and lesions seen in imaging of prostate . biopsy and pathology can confirm the diagnosis but , in case of bleeding , can exacerbate the process of dic or even initiate it by the introduction of thromboplastic substances into the blood stream [ 22 , 23 ] . the treatment of this cancer is hormonal manipulation because testosterone is a stimulator of cancerous cells . so the source of hormones , especially testosterone , should be dispelled by orchiectomy or drugs such as flutamide , which competes with androgen receptors at the cellular level , and ketoconazole , which suppresses the adrenal production of testosterone [ 25 , 26 , 27 ] . in our patient , because of active bleeding , it was not possible to perform orchiectomy and only an lhrh agonist was prescribed together with chemotherapy with taxotere every 21 days . in other similar cases , patients underwent hormone therapy , androgen blockade , and low oral anticoagulants along with chemotherapy especially during the hormone resistance phase [ 8 , 9 , 10 , 29 ] . in kato et al case report docetaxel ( taxotere ) was used to treat the afflicted tissues . in another report ketoconazol with the dose of 400 mg every eight hours was used in emergency management of dic in metastatic prostate cancer . disseminated carcinomatosis of the bone marrow derived from solid cancer with dic has a very poor prognosis and despite all treatments these patients will die soon . the patient till writing this report is still alive and treated by hormonal manipulation and chemotherapy . in conclusion , malignancies should be considered in cases of dic , especially in elderly men in whom no underlying cause can be found to explain it .

disseminated intravascular coagulopathy ( dic ) is an acquired disease that occurs secondary to a variety of underlying conditions including solid tumors . prostate cancer ( pca ) is one of these tumors and dic is the most prevalent coagulopathy related to pca , but it is rarely reported as the first manifestation of it . this paper is a report of an 85year old man who presented with hematuria and vast ecchymoses . thorough work up resulted in finding metastatic pca with dic as presenting condition . although dic is a rare manifestation of metastatic prostate cancer , it should be consider when no other reason can be found to explain it .

brain computed tomography was consistent with ischemic cerebral vascular accident , showing two small ischemic lesions on the left hemisphere , one in the head of the caudate nucleus and the other in the white matter of the semi - ovale center . there was no record of previous infarcts in the cerebral territory or in other organs or peripheral regions . besides arterial hypertension , controlled with an agiontensin converting enzyme inhibitor , there were no other known risk factors such as smoking , diabetes or dyslipidemia . other than the patient s father who had died of stroke at a late age , no other family risk factors could be identified . the mass was described as spherical , heterogeneous , with a size of 29x23x32 mm , mobile , attached by a short stalk to the posterior wall . intraoperative tee confirmed the presence of the previously reported lesions ( left atrial mass and pfo ) but also revealed an abnormal aortic valve . a nodular , oval mass ( 9x7 mm ) was present in the non - coronary leaflet and valvular excrescences ( around 10 mm length ) arose from both the non- coronary and the right coronary leaflets and projected into the aorta . left atriotomy a grey gelatinous tumor was found attached to the superior aspect of the posterior wall of the left atrium , near the ostium of the left superior pulmonary vein . in order to assure better visualization and by surgical option , pfo was sutured via right atriotomy . inspection of the aortic valve revealed the presence of two nodular formations , with multiple villous projections , attached to either the right or the non - coronary cusps . aortic valve papillary fibroelastomas in situ ( a ) and after resection ( b ) . weaning from bypass was easy without the need of inotropic support . pathological findings of the resected masses were consistent with left atrial myxoma and aortic valve papillary fibroelastomas ( pfe ) ( figure 2 ) . a - myxoma ( hematoxylin - eosin x100 ) : neoformation consisting of mucous pools and eosinophilic loose connective tissue stroma with low celularity , mainly fibroblasts and inflammatory cells . b - aortic valve papillary fibroelastoma ( hematoxylin - eosin x40 ) : exophytic neoformation consisting of several digitiform processes with loose connective tissue axis covered by a thin endotelial layer . cerebrovascular ischemia is generally the result of atheroemboli from a central vessel or in situ thrombosis of a cerebral vessel or emboli from a cardiac source ( usually left chamber thrombi ) . a minority of ischemic strokes is associated with other sources of cardioembolism : pfo is the most prevalent among these , while primary cardiac tumors are rare . it has been identified as a potential risk factor for stroke , by means of paradoxical embolism , and it is present in more than 50% of young patients with cryptogenic stroke . myxoma is the most frequent primary cardiac tumor and its clinical presentation may vary from an asymptomatic finding to sudden death . common presentations include fatigue , chest pain , pulmonary edema and infarcts : cerebral , myocardial and peripheral . cardiac myxoma is predominantly a left atrial tumor that is usually attached to the atrial septum by a stalk . pfe is the third most common primary cardiac tumor ( after myxoma and lipoma ) accounting for approximately 7% of cases . it may be found anywhere in the heart , however approximately 80% are found on the valvular endocardium ( predominantly on the aortic valve ) . manifestations include transient ischemic attacks , stroke , myocardial infarct , peripheral infarct , syncope and even sudden death . both these tumors are benign in nature , but , regardless of their size , they are potential embolic sources to the brain and the coronary circulation . the sources of cardioembolic stroke usually occur isolated . however , in the present case , multiple causes coexisted in the same patient , any of which might have been the cause of the described cerebral ischemic event . some interesting points of this case report need to be emphasized : 1 ) combined presence of histologically different primary cardiac tumors . the probability of a patient developing either a cardiac myxoma or a pfe during a lifetime is very low . describe a case of myxoma on the atrial surface of the mitral anterior leaflet coexisting with a papillary fibroelastoma on the leaflets ventricular aspect . reported the case of a myxoma in the fossa ovalis and a pfe on the posterior wall of the left atrium . described the presence of a myxoma on the lateral wall of the right atrium and a pfe on the left atrium surface of the inter - atrial septum . matsushita et al . also reported a case of concomitant left atrial myxoma and aortic valve pfe . described the case of a myxoma ( implanted on the left atrium aspect of the inter - atrial septum ) with several areas of pfe - like tissue . pfe are usually single tumors , multiple tumors are extremely rare ( only 5% of pfe present as multiple tumors ) . usually they appear at different locations in the heart ( multiple intraventricular sites or involving separate cardiac valves ) . very few cases of multiple tumors on the aortic valve have been published in the literature . before echocardiography was available , pfe were usually only found by chance during cardiac surgery or autopsy . the advent of echocardiography and the routine use of intraoperative tee in cardiac surgery are responsible for an increasing number of reported cases of pfe . intraoperative tee can be more detailed and comprehensive than pre - operative tee because it is performed under general anesthesia . often the pre - operative tee is a focused examination as a complete examination is not always possible ( for example in the case of an awake , non cooperative patient ) . it is a well - known fact that intraoperative tee can reveal new information , which is why its routine use is strongly recommended by many authors . in our center though pfe are asymptomatic in the majority of patients , their identification is important because ( due to their embolic risk ) these tumors may result in life - threatening complications . the fact that in our case report the aortic valve presented a multiple pfe obviously increased the risk of embolic events . identification of these tumors allowed for surgical excision that was curative since recurrence of pfe has not been reported . in summary , our case highlights a rare combination of pfo and histologically different primary cardiac tumors ( left atrial myxoma and two aortic pfe ) , any of which could have been the cause of the cerebral ischemic event that the patient was admitted for . the probability of a patient developing a myxoma and multiple pfe simultaneously is extremely low . the coexistence of a pfo ( even though it is relatively common ) adds to the rarity of our case . the pfe were incidentally found by intraoperative echocardiography , a fact that reinforces the importance of its use . tee is now used routinely during cardiac surgery in many centers ; intraoperative tee allowed for the correction of all surgically treatable causes of cardiac embolism present in this patient during the same surgery .

we report a case in which multiple uncommon causes of an ischemic vascular accident coexisted in the same patient . the patient was admitted with signs of acute stroke . investigation workup revealed a left atrial tumor ( myxoma ) and a patent foramen ovale . intraoperatively , transesophageal echocardiography added new information : papillary fibroelastomas were found in the aortic valve . this finding dictated a change in the surgical plan , adding resection of aortic valve masses to the planned excision of the left atrial tumor and patent foramen ovale closure . the uniqueness of this case derives from the coexistence of rare primary cardiac tumors . there are only five cases in literature of myxoma concomitant with fibroelastoma and the occurrence of multiple fibroelastoma is also extremely rare . moreover this case emphasizes the benefit of the intraoperative use of transesophageal echocardiography to improve the diagnosis and management of cardiac surgical patients .

although various series of such cases have been published over the years in foreign journals , our indigenous case is unique for the following reasons : it describes a lady who went upto late 2 trimester before undergoing transnasal transsphenoidal resection of pituitary adenoma to restore her vision . moreover , as she took cabergoline for the entire duration of the gestation with no untoward side effects , we believe this is the first reported case from our country . a 30-year - old lady ( gravida 2 parity 1 live birth 1 ) whose last child birth was 9 years ago presented to us in the 2 trimester of pregnancy ( august 2007 ) , with progressive decrease in vision in the right eye for 6 weeks . she also complained of coarsening of facial features and enlargement of hands and feet for 3 years . her blood pressure was normal . the fundal height corresponded with the period of gestation ( 18 weeks ) . central nervous system examination revealed right temporal field defect with temporal pallor of the right optic disc . hormonal profile revealed elevated human growth hormone ( hgh ) 37.9 ng / dl and insulin - like growth factor 1 ( igf-1 ) 424 ng / ml ( normal 117 - 329 ng / ml ) , her serum prolactin was also mildly elevated , i.e. 107 ng / ml . magnetic resonance imaging of the brain revealed a 34 23 20 mm sellar , suprasellar mass abutting the third ventricle [ figure 1 ] . ultrasound of the abdomen revealed a single live fetus , corresponding to the period of gestation . mri pictures of pituitary tumor - sagittal view - left - before surgery , right - after surgery we discussed the treatment options and the risks involved with the patient and her family . she underwent endoscopic transnasal transsphenoidal radical excision of the tumor in the 22 week of pregnancy.the postoperative period was uneventful . ( mib-1 stands for mindbobmb homolog-1 : a commonly used monoclonal antibody that detects the ki-67 antigen which is a cellular marker for proliferation [ name derived from city of origin - kiel , germany and the number of the original clone in the 96-well plate ] . ki-67 is an excellent marker to determine the growth fraction of a given cell population . the fraction of ki-67-positive tumor cells ( the ki-67 labeling index ) is often correlated with the clinical course of cancer . mib-1 one of its primary advantages over the original ki-67 antibody ( and the reason why it has essentially supplanted the original antibody for clinical use ) is that it can be used on formalin - fixed paraffin - embedded sections , after heat - mediated antigen retrieval ) . following surgery , her hgh however , continued to be elevated , 4.37 ng / dl on the 1 post - op day and 5.58 ng / dl on the 7 post - day . as she could not afford inj . she then went on to deliver a full - term baby boy by caesarian section in january 2008 ( birth weight- 3.14 kg).following delivery , she was unable to breast feed the child , however , she resumed having her normal periods . she came for her 1 follow - up visit in february 2009 . at this stage , she was found to have elevated hgh levels [ table 1 ] . her acromegalic features had regressed , igf-1 levels had normalized [ table 1 ] and there was no tumor detected in the mri scan [ figure 1 ] . pregnancy in a patient with acromegaly is very unusual , as the enlarging pituitary adenoma suppresses gonadotropin secretion rendering the patient amenorrheic and infertile . up to 30% of hgh - secreting pituitary adenomas also secrete prolactin and this adds to the problem . twenty - four patients with acromegaly and pregnancy were reported by cozzi , et al . , in the same year , caron , et al . also reported 59 pregnancies in 43 women with acromegaly . more recently , cheng , et al . have reported a much larger series of patients . this effect is more marked in a patient with a pituitary macro adenoma and this leads to headache , visual symptoms , and field defects . normal pregnancy and pregnancy in a patient with acromegaly have markedly different effects on growth hormone ( gh ) physiology . in normal women , during the 1 trimester , pituitary growth hormone ( hgh ) is the only measurable gh in maternal serum . after the 1 trimester , placental growth hormone ( gh - v ) contributes the major portion of circulating gh . gh - v in turn stimulates 1gf-1 production , and this will inhibit maternal hgh production . beckers , et al . showed that patients with acromegaly demonstrate a paradoxical rise of hgh with thyrotropin releasing hormone . gh - v is resistant to stimulation by gh secretagogues . the immulite 2000 assay ( manufactured by the siemens health care diagnostics based at tanyton , new york state , usa used with international standard is 98/574 ) used in our laboratory was unable to distinguish between hgh and gh - v in our patient . hgh does not cross the placenta , and acromegaly in the mother has no direct bearing on the fetus and its development . since pregnancy itself is an insulin resistant state , elevated gh can cause impaired glucose tolerance and frank diabetes . there is also an increased incidence of hypertension and coronary artery disease in patients with acromegaly . our patient 's glycemic control and blood pressure recordings were normal and she did not require any additional treatment . in earlier studies , the median time for surgery was in the 19 week of pregnancy , our patient underwent surgery in 22 week of pregnancy . earlier series used bromocriptine during pregnancy , our patient received cabergoline without any untoward side effects during pregnancy . we report this case because of : the rarity of spontaneous conception in a patient with untreated active acromegaly.successful transnasal transsphenoidal surgery during the 2 trimester of pregnancy with no danger to the fetus or the mother.the use of cabergoline in the treatment of acromegaly during pregnancy . successful transnasal transsphenoidal surgery during the 2 trimester of pregnancy with no danger to the fetus or the mother .

pregnancy in a patient with acromegaly is a rare occurrence . here in , we report a patient with acromegaly who presented to us in the 2nd trimester of pregnancy with visual loss in the right eye . her vision improved after surgery . she went on to have an uneventful pregnancy and delivered a term baby , by caesarian section . one year following her delivery , she received stereotactic radiotherapy . subsequent follow - up revealed that her tumor had regressed and her igf-1 levels had normalized .

for 35 reportable communicable diseases for which cluster detection could inform programmatic activities ( 1 ) , we analyzed disease counts for patients of all ages combined . for amebiasis , cryptosporidiosis , and giardiasis , for which outbreaks among young children are of particular interest , additional analyses were restricted to disease counts among patients < 5 years of age , for 38 total daily analyses . in bcd time cylinders centered on every census tract centroid ; the circular base represents space ( maximum geographic cluster size of 50% of all reported cases ) , and the height represents time ( maximum temporal window length of 30 days , for most diseases ) . for each cylinder , a likelihood ratio based test statistic is calculated . the test statistic is considered elevated if the observed disease count during the time window in census tracts with centroids inside the cylinder s circular base exceeds the expected number of cases , which is a function of 1 ) the case count in the circle during a baseline period ( which accounts for any purely geographic variations in disease occurrence , diagnosis , and reporting ) and 2 ) the total case count citywide during the time window ( which accounts for citywide purely temporal patterns , such as seasonality or secular trends ) ( 3 ) . the cylinder with the maximum test statistic is the cluster least likely to be due to chance under the null hypothesis that the same process generated disease counts inside and outside the cylinder . to create a simulated dataset , cases dates are randomly shuffled and assigned to the original census tracts . the maximum statistic for each simulated dataset is calculated in the same way as for the observed dataset . for each disease , this process is repeated daily 999 times . the maximum value for the observed dataset is ranked among the 999 trial maxima . a p value ( range 0.0011 ) is derived from this ranking ; p = 0.001 represents the highest significance relative to the permutation trials . the monte carlo approach to deriving significance by using repeated trials , each permuting observed data attributes , is designed to control for multiple testing . a recurrence interval ( ri ) is calculated as the reciprocal of the p value and represents the number of days of daily surveillance required for the expected number of clusters at least as unusual as the observed cluster to be equal to 1 by chance ( 11 ) . we defined a signal as any cluster with an ri > 100 days ; that is , during any 100-day daily analysis period , the expected number of clusters at least as unlikely as the current cluster is 1 . cary , nc , usa ) to generate case and parameter files ( table 1 ) , read in a coordinate file of census tract centroids , invoke satscan in batch mode , read analysis results back into sas for further processing , and output files to secured folders . for any signals , the program also generated emails notifying bcd leadership and staff responsible for follow - up ( technical appendix ) . * exception to residential address at time of report : if the residential address is not geocodable ( e.g. , because the case - patient is not a resident of the city or because a post office box is reported instead of a street address ) , then the geocoded work address , if available , is substituted . this automated analysis detected the second largest us outbreak of community - acquired legionellosis ( 12 ) , identifying a cluster of 8 cases centered in the south bronx on friday , july 17 , 2015 ( ri = 500 days ) ( figure ) , before any human public health monitor noticed it . on monday , july 20 , an increase in cases was independently noticed by bcd staff members routinely investigating individual cases , and on july 21 , an infection - control nurse working in the outbreak area called bcd to report an increase . the dohmh and state and federal partners conducted an extensive epidemiologic , environmental , and laboratory investigation to identify and remediate the outbreak source , a cooling tower . automated output from spatiotemporal analysis on july 17 , 2015 , indicating a cluster ( dark gray ) of 8 legionellosis cases over 8 days centered in the south bronx , new york city , new york , usa . in subsequent days , this cluster expanded in space and time into the second largest us outbreak of community - acquired legionellosis . a shigellosis outbreak among the observant jewish community in brooklyn ( 13 ) began in late october 2014 and was detected with 9 cases on november 14 , 2014 ( ri = 333 days ) . bcd does not routinely investigate individual shigellosis reports , so automated analysis alone prompted early outbreak identification . shigellosis outbreaks within this community occur cyclically and have been linked to daycare and preschool attendance ( 14 ) . starting in mid - november , bcd staff visited community schools , daycare centers , and health fairs to promote appropriate handwashing . the outbreak subsided by mid - march 2015 . other clusters prompting investigations included legionellosis ( queens , april may 2015 ) and campylobacteriosis ( brooklyn , october 2014 ) . during a 1-year period , 28 unique signals were observed across 15 diseases ( table 2 ) , which staff perceived as a reasonable number for investigation . a signal for a particular disease was defined as unique if the first most likely cluster on a particular day did not encompass any of the same census tracts as the first most likely cluster on the prior day . the signaling rate for most diseases was based on 598 d of surveillance ( february 10 , 2014september 30 , 2015 ) . for 5 diseases , the signaling rate was based on a shorter surveillance period to reflect analytic adjustments : hepatitis a , paratyphoid fever , and typhoid fever ( 190 d under surveillance after extending to a 60-d maximum temporal cluster size ) ; legionellosis ( 160 d under surveillance after excluding unresolved cases ) ; and shiga toxin producing e. coli ( 21 d under surveillance after excluding cases with only a positive multiplex pcr gastrointestinal panel test ) . confirmed , probable , and suspected cases among residents with event dates october 1 , 2014september 30 , 2015 . the signal was detected at the lower 100-d threshold on the same day for 50% of the signals , 1 d earlier for 19% of signals , 2 d earlier for 19% of signals , 3 d earlier for 6% of signals , and 7 d earlier for 6% of signals . no public health response was conducted for an amebiasis cluster ( manhattan , april 2015 ; ri = 143 days ) consisting of 6 men ( 3449 years of age ) diagnosed within a 12-day period and residing within a 0.35-mile radius because no case - patients were identified as food handlers or daycare workers . a public health response also was not conducted for a giardiasis cluster ( bronx , april 2015 ; ri = 1,000 days ) that consisted of 6 household members who acquired the infection during international travel . investigators were interested in being notified of and following such clusters over time , even if they ultimately were not actionable or verified as true outbreaks . several outbreaks in new york city , new york , were detected by daily automated spatiotemporal analyses . early cluster detection facilitated prioritization of individual case investigations , outbreak recognition and investigation , provider and community outreach , and timely intervention to limit sickness and death . this method has proven particularly useful for identifying and monitoring outbreaks of shigellosis ( 6,8,9 ) and legionellosis and might be useful for monitoring additional diseases with outbreak potential , including pertussis , syphilis , and tuberculosis . key to the system s success is a strong informatics infrastructure , especially electronic laboratory reporting and near real - time geocoding of surveillance data . other facilitators include a powerful statistical disease surveillance methodology , knowledgeable epidemiologists to interpret signals , and adequate outbreak investigation resources . these methods could be useful to other health departments receiving more reports than can be rapidly reviewed manually . supplemental information , sas code , and sample output for daily reportable disease spatiotemporal cluster detection , new york city , new york , usa .

each day , the new york city department of health and mental hygiene uses the free satscan software to apply prospective space time permutation scan statistics to strengthen early outbreak detection for 35 reportable diseases . this method prompted early detection of outbreaks of community - acquired legionellosis and shigellosis .

since self - expandable metallic stent ( sems ) placement started being covered by insurance in japan in january 2012 , sems placement has been practiced in several hospitals in japan , including ours . the insertion of sems was performed under endoscopic and fluoroscopic guidance by endoscopists and surgeons . wallflex colonic stents ( boston scientific , natick , ma , usa ) were used in the majority of the patients in our hospital . in 2014 , the european society of gastrointestinal endoscopy ( esge ) expressed some concern regarding the efficacy of sems in cases of colorectal cancer ileus . while colostomy is the definitive treatment for malignant colonic obstruction , sems placement is strongly recommended as the preferred palliative treatment for malignant colonic obstruction . the use of sems placement as a palliative treatment for malignant colonic obstruction is becoming popular as an alternative to colonic stoma . accordingly , we investigated the efficacy of sems placement as a palliative treatment among patients treated in our hospital . an 82-year - old japanese man was suffering from right hypochondrial pain for 1 week and visited our hospital . the laboratory findings on admission indicated severe anemia ( red blood cell count , 426 10/l ; hemoglobin , 7.9 g / dl ) . an abdominal computed tomography ( ct ) scan demonstrated wall thickening in the ascending colon with some swollen regional lymph nodes , indicating a diagnosis of colon cancer . he agreed to undergo colonoscopy , which showed a type 2 tumor in the ascending colon ( fig 1 ) . using an endoscope , a guide wire was introduced across the stenosis and beyond the obstruction . the sems was inserted through the endoscope over the guide wire and deployed in place . we used a 22 60-mm stent ( wallflex colonic stent ; boston scientific ) . fig 2 shows a radiography image taken after the stent had been placed in the ascending colon . he did not attend any of the scheduled follow - up visits after sems placement . a year and a half after the sems placement , the patient attended the hospital because of difficulty in passing stool and reocclusion . a plain abdominal ct scan showed bowel reobstruction due to the ascending colon cancer after sems placement . fig 3 shows significant dilatation of the ascending colon with the sems in the abdominal ct scan . a coronal section of the abdominal ct scan revealed the presence of a mass in the ascending colon and cecum ( fig 4 ) . the patient demonstrated a good postoperative course and was discharged from our hospital in remission 16 days after the surgery . he has been followed up every few months for over 3 years and has not required any adjuvant chemotherapy . there have been reports of colonic stents to relieve colonic obstruction , with the stents used as a bridge to surgery [ 4 , 5 ] . however , since the first report in 1991 , sems have been used for palliative treatment of obstructed colorectal cancer to avoid surgery . colorectal cancer is among the most common malignant diseases , and colorectal obstruction has been reported in 729% of patients with colorectal cancer . patients presenting with acute colorectal obstruction due to cancer have both a higher operative mortality rate and a poor overall survival than nonobstructive cases [ 7 , 8 ] . surgeons have been performing initial decompressive operation with a stoma to relieve the symptoms of the stenosis caused by cancer . colorectal obstruction has been considered to require emergency surgery to relieve the obstruction as soon as possible . however , surgical procedures such as resection and primary anastomosis , hartmann 's procedure , subtotal or total colectomy , diverting stoma formation , and even only stoma formation without colectomy are invasive techniques . stoma formation may help improve the patient 's quality of life , especially when used as palliative treatment . evidently , in patients with unresectable colorectal cancer , the aim is to improve their quality of life . for this reason , a minimally invasive decompressive procedure such as sems placement is a good option for palliative treatment instead of surgery . , potential complications after insertion of a colonic stent include perforation , bleeding , stent migration , reobstruction , and pain . in the esge clinical guideline , sems placement is strongly recommend as the preferred treatment for palliation of malignant colonic obstruction based on the evidence . patients who underwent sems placement had a shorter hospitalization ( 10 vs. 19 days ) and a lower intensive care unit admission rate ( 0.8 vs. 18.0% ) than those who underwent surgery [ 11 , 12 ] . however , while short - term complications occurred more often in the surgery group , late complications were more frequent in the sems group . stentrelated complications mainly included reobstruction ( 18% ) , colonic perforation ( 10% ) , and stent migration ( 9% ) . regarding reobstruction , the median stent patency in the palliative setting ranges widely between 55 and 343 days [ 13 , 14 ] . a previous study reported a median stent patency of 106 days ( range , 68288 days ) in the sems group . tumor ingrowth and overgrowth causes stent reobstruction and usually occurs during the long - term course of stent therapy . stent replacement and stent reopening by a stent - in - stent have been reported as the preferred methods to manage reobstruction , with satisfactory results ( clinical success , 7586% ) [ 1 , 16 , 17 ] . . we should recommend patients to undergo radical operation if they are shown to be good candidates to overcome colon cancer . in the present case , although the patient was a good candidate for surgery , he did not provide informed consent , and thus we were unable to perform the surgery . we should have insisted that the patient visit our hospital for follow - up every few months after the procedure . the patient presented reobstruction after sems placement , and the surgery was eventually performed after the patient had provided informed consent . in conclusion , colorectal stent placement may be a good treatment option for patients who refuse to receive conventional therapeutic strategies or in those with unresectable colorectal cancer . however , patients should be carefully followed up every few months after sems placement because of the risk of reocclusion . it is necessary for endoscopists and surgeons to work together and develop management strategies that support reintervention and surgery .

self - expandable metallic stent ( sems ) placement has been practiced in several hospitals in japan , including ours , since january 2012 . here , we report the case of an 82-year - old japanese man who presented to the hospital with a 1-week history of right hypochondrial pain . computed tomography ( ct ) findings indicated colorectal cancer . the laboratory findings on admission indicated severe anemia ( red blood cell count , 426 104/l ; hemoglobin , 7.9 g / dl ) . we performed sems placement because the patient refused to undergo surgery . he did not attend any of the scheduled follow - up visits after sems placement . however , a year and a half after the sems placement , the patient attended the hospital because of difficulty in passing stool . a plain abdominal ct scan showed bowel reobstruction due to the ascending colon cancer after sems placement . we performed an emergency operation , ascending colostomy , on the same day . colorectal stent placement may be a good treatment option for patients who refuse to undergo conventional therapeutic treatments or in those with unresectable colorectal cancer . patients should be carefully followed up every few months after sems placement because of the risk of reocclusion .

cardiofacio - cutaneous ( cfc ) syndrome ( omim : 115150 ) is a rare , sporadic , heterogeneous disorder first described by reynolds et al . in 1986 . cfc syndrome is characterized by multiple congenital anomalies consisting of peculiar craniofacial dysmorphism , congenital heart defects , ectodermal anomalies , and psychomotor retardation . various mutations have been described mainly , braf , mek1 , mek2 , and kras . till now , approximately 100 cases are reported in the literature , with only a few reports from india . a 4-year - old child born out of a nonconsanguineous marriage was brought by his parents for generalized dryness of skin since birth . the child was born through normal vaginal delivery but suffered from delayed developmental milestones and retarded growth . dermatological examination revealed the presence of follicular keratotic lesions over trunk and bilateral extremities with dry scaly erythematous plaques over face and extremities . multiple hyperkeratotic erythematous plaques of size varying from 1 to 3 cm with partially adherent thick yellowish whitish scaling over extensor surfaces of both legs were also present [ figure 1 ] . the child was found to have coarse scalp hair with sparseness of eyebrows and eyelashes , frontal bossing , bitemporal narrowing , broad base nose , and prominent philtrum [ figure 2 ] . left arm ( right ) showing multiple follicular keratotic lesions and left leg ( left ) showing hyperkeratotic lesions typical cranio - facial features including frontal bossing , bitemporal narrowing , prominent philtrum , broad base nose , and dry scaly erythematous plaques other systemic examination revealed hypertelorism , strabismus , and hypotonia of the abdomen . the child was found to have atrial septal defect on 2-d echocardiography [ figure 3 ] . these constellations of findings were consistent with the diagnosis of cfc syndrome . two - dimensional echocardiography showing atrial septal defects molecular genetic analysis for mutation could not be done in our patient because of financial constraints and unavailability of analysis in our institute . germline mutations in a number of genes coding transducers and modulatory proteins participating in the ras - map kinase - signaling pathway have been causally linked to noonan syndrome ( ns ) and a group of clinically related disorders , the so - called neuro - cfc syndromes or rasopathies . cfc syndrome is a rare rasopathy characterized by distinctive craniofacial features , cardiac anomalies , neurocognitive impairment , ectodermal abnormalities , and failure to thrive . cfc syndrome is caused by heterogeneous , heterozygous activating germline mutations in braf , mek1 , mek2 , and kras genes . the first three cases of cfc syndrome were reported by blumberg in 1979 but the term itself was coined by reynolds in the year 1986 . the typical craniofacial features include relative macrocephaly ; bitemporal narrowing ; hypoplastic supraorbital ridges ; hypertelorism ; telecanthus ; down slanting palpebral fissures ; epicanthal folds ; short nose with depressed bridge and anteverted nares ; high arched palate ; low set , posteriorly rotated ears ; short , webbed neck ; prominent philtrum ; and submucous cleft palate . dermatological features consist of severe atopic dermatitis , ichthyosis , multiple palmar and plantar creases , hyperkeratosis of hands and feet , keratosis pilaris , caf - au - lait macules , melanocytic naevi , and hemangiomas . failure to thrive can occur in infancy due to gastroesophageal reflux and the tendency to vomit and constipation . most common cardiac anomalies include pulmonic stenosis ( 45% ) , septal defects ( 23% ) , patent ductus arteriosus , tetralogy of fallot , and cardiomyopathy . other rare manifestations include hearing loss , nystagmus , short stature , hepato - splenomegaly , seizures , hydrocephalus , cortical atrophy , frontal lobe hypoplasia , brainstem atrophy , and acute lymphoblastic leukemia . the clinical diagnosis is based on the cfc index and grebe and clericuzio criteria ( 2000 ) , which include : macrocephalyophthalmological abnormalitiesneurological abnormalities / developmental delayhistory of polyhydramnioshyperkeratotic skin lesionsgastrointestinal dysfunctioncardiac defectsparse / curly haircharacteristic facial featuresgrowth retardation ophthalmological abnormalities neurological abnormalities / developmental delay history of polyhydramnios hyperkeratotic skin lesions gastrointestinal dysfunction characteristic facial features out of the 10 clinical features , seven have to be present for the diagnosis of cfc syndrome . in our case seven features were present , that is , growth retardation , macrocephaly , ophthalmological abnormalities , developmental delay , hyperkeratotic skin lesions , cardiac defect ( asd ) , and characteristic facial features as shown in figures 1 and 2 . in ns , bleeding diasthesis ; skeletal deformity , joint laxity ; and lymphedema , whereas in costello syndrome unusually flexible joints ; and loose folds of extra skin , especially on the hands and feet are differenting features from cfc syndrome . a multidisciplinary approach is usually required with emphasis on cardiac and neurological manifestations in cases of cfc syndrome . our purpose was to highlight the various cutaneous and extracutaneous manifestations of this syndrome because of the rarity of this condition in indian settings . we suggest that a complete workup of patients with cfc syndrome should be done for better counseling and management . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed .

cardiofacio - cutaneous syndrome is a rare genodermatoses with multiple congenital anomalies ( mca ) and mental retardation . although various mutations have been described , the diagnosis can be made clinically based on constellation of symptoms . herein , we report a classical case with typical craniofacial features and atrial septal defect .

multiple studies have reported that obese men have a larger prostate volume ( pv ) than do nonobese men [ 2 - 6 ] , and recently some studies have revealed that a relationship exists between obesity and luts . the suggested pathophysiology was hyperinsulinemia [ 9 - 11 ] , caused by tissue insulin resistance , which stimulates the autonomic nervous system , particularly the sympathetic nervous system . the korean national health and nutrition surveys reported an increase in the prevalence of obesity from 1995 to 2001 . the prevalence of clinical bph was reported to be from 10.6% to 31% in men over 50 years of age , with an age - related increase seen in south korea . however , there are insufficient data on the effect of obesity on luts in korean men . therefore , in this cross - sectional study , we investigated the effects of obesity on pv and luts in korean men . from december 2007 to 2009 , a total of 10,383 ostensibly healthy korean men aged 50 years visited our health promotion center for a routine check - up . among them all men underwent detailed clinical evaluations with the international prostate symptom score ( ipss ) questionnaire . anthropometric measurements , including height , weight , and waist and hip circumferences , were determined . a blood sample was obtained for serum prostatespecific antigen ( psa ) measurement ( axsym , abbott laboratories , abbott park , il , usa ) . body mass index ( bmi ) was calculated as the weight divided by square of the height , and waist - to - hip ratio ( whr ) was determined as the waist circumference divided by the hip circumference . the exclusion criteria of this study were mild luts ( ipss<8 ) ; the use of medications affecting prostate growth , such as antiandrogens and 5--reductase inhibitors ; a high serum psa level of > 4.0 ng / ml ; abnormal findings on the dre ; pyuria ( white blood cells > 5 on urinalysis ) , the presence of neurogenic bladder dysfunction ; confirmed prostate cancer ; acute or chronic urinary retention status ; acute or chronic prostatitis within the previous 3 months ; a history of recurrent urinary tract infection or bladder stones ; and previous surgical intervention related to bph . univariate analysis by pearson 's correlation coefficient was used to test the linearity of the relationships among the variables . multiple linear regression analysis was used to test the linear effect of variables in predicting pv . all statistical analysis was performed by using commercially available software ( spss , version 14.0 ko , chicago , il , usa ) . a p - value of < 0.05 was considered statistically significant . in total , 465 men with luts ( ipss8 points ) and aged 50 years were included in this prospective study . the univariate analysis showed that the pv was positively correlated with all obesity - related parameters : bmi , waist circumference , and whr ( table 2 ) . however , multiple linear regression analysis demonstrated that , among the obesity - related parameters , only waist circumference was a significant factor in predicting pv ( table 3 ) . the univariate analysis showed that there were no statistically significant relationships between obesity - related parameters and luts ( table 2 ) . luts comprise a spectrum of voiding and storage symptoms , which in men are generally considered a sign of clinically significant bph . a review of the available data appears to support a strong independent relationship between obesity and bph or luts . over the past two decades , many different groups have investigated the influence of obesity on the development of bph and luts with conflicting results [ 1,17 - 22 ] . most of these groups have concluded that overall obesity , abdominal obesity , and/or whr can increase the risk of bph and luts , at least to some degree . the veterans administration normative aging study reported that increased bmi was a significant predictor of a clinical diagnosis of bph . rohrmann et al examined the association between obesity and luts in the national health and nutrition examination survey ( nhanes ) iii cohort . they found that an increase in bmi after age 25 was positively associated with luts . they also noted that men with a larger waist circumference ( > 102 cm ) were more likely to have luts than were men with a smaller waist circumference . kristal et al examined several modifiable lifestyle factors related to the development of symptomatic bph in 5,600 men enrolled in the placebo arm of the prostate cancer prevention trial who were followed for 7 years . they reported significant increases in symptomatic bph ( ipss>14 ) , with abdominal obesity as measured by whr . laven et al examined a cohort of 27,858 swedish men and found that low birth weight and abdominal obesity , but not bmi , were associated with an increased risk of luts . together , these results suggested that weight gain and central adiposity in adulthood were associated with a higher prevalence of luts . joseph et al looked at modifiable risk factors for luts specifically in black men and found no greater risk with increasing bmi . gupta et al followed 1206 vietnam veterans from the air force health study for an average period of 15 years and showed no increased risk of bph or luts in men with metabolic syndrome compared with that in men without it . to our knowledge , only three studies have assessed the relationship between obesity and luts in korean men [ 20 - 22 ] , and all were done in a cross - sectional manner . one was a community - based study performed in 348 elderly men whose age was over 65 years , in which no relationship between obesity and luts was shown . the second study also showed that there was no association between metabolic syndrome and voiding dysfunction in men older than in their 60 s . the third study by lee et al involving 602 patients ( aged 40 years ) with bph or luts who were attending a urology clinic , provided evidence that central obesity is the predictor of luts correlated with bph . that study reported that korean men with a waist circumference of > 90 cm experienced a 1.36-fold increased risk of severe luts compared with those with a waist circumference of 90 cm . they also observed that storage symptoms , such as nocturia and urgency , increased with increasing pv in men with a waist circumference of > 90 cm . our study of 465 men recruited through the health promotion center showed that pv was positively correlated with central obesity , as represented by waist circumference , but not with bmi , which represented overall obesity . our study might have been affected by selection bias due to the heterogeneous eligibility of the study population . this may be why our study population showed a relatively small pv ( mean : 26.6 ml ) compared with the pv values reported in the three studies mentioned above [ 20 - 22 ] . recent studies concerning the pathophysiology of bph have suggested that in addition to the conventional risk factors , such as age , family history , and androgen activity , newly identified risk factors , such as diet and obesity , may have a major role in the development of bph . we think it may be difficult to directly adopt the results of those studies to korean persons , because differences in the incidence of bph , luts , and obesity exist among different ethnic groups . moreover , obesity defined by the adult treatment panel iii is much more rigid for western men ( > 102 cm of waist circumference ) than for orientals ( > 90 cm of waist circumference ) . we need another large , longitudinal , prospective , community - based study to fully reveal the relationship between obesity and bph or luts in korean men . our data showed that pv was positively correlated with central obesity , as represented by waist circumference , but not with bmi , which represented overall obesity .

purposewe investigated the effects of obesity on prostate volume ( pv ) and lower urinary tract symptoms ( luts ) in korean men.materials and methodsfrom december 2007 to 2009 , a total of 10,383 ostensibly healthy korean men aged 50 years visited our health promotion center for a routine check - up . among them , 872 men who wanted a prostate evaluation were enrolled in this study . all men underwent detailed clinical evaluations with the international prostate symptom score ( ipss ) questionnaire . anthropometric measurements , including height , weight , and waist and hip circumferences , were determined . a blood sample was obtained for serum prostate - specific antigen ( psa ) measurement . thereafter , a digital rectal examination and transrectal ultrasound were performed.resultsin total , 465 men with moderate to severe luts ( ipss8 points ) were included in this prospective study . the participants ' mean age was 57.2 years . multivariate analysis demonstrated that only waist circumference was a significant factor in predicting pv besides age and serum psa . the univariate analysis showed no statistically significant relations between any of the obesity - related parameters and luts . the pv was also not correlated with luts.conclusionscentral obesity is the more important predictor of pv than overall obesity . there are no significant relations between obesity - related parameters and luts .

geolocation and remote sensing technologies are increasingly being applied to the mapping and spatial analysis of infectious diseases , including lymphatic filariasis and malaria . for such maps to reflect the real pattern of infection or disease , lymphatic filariasis and malaria are both currently subject to renewed control programmes , and share anopheline vectors in some parts of the world . filariasis is being targeted for elimination , but reduction in its infection intensity could conceivably , via the removal of infection - induced vector mortality , lead to more efficient transmission of malaria . accurate mapping of the two infections can help monitor their control , including the detection of any unwanted interactions . here , we present spatial analysis of both parasites in the same area of papua new guinea , using a recently developed technique which estimates the scale of variation , taking into account the typically highly skewed distribution of parasite counts . in a rural area of the east sepik province , cross - sectional parasitological surveys were done of the population aged over five years , as part of a trial of diethylcarbamazine ( dec ) plus ivermectin versus dec alone against lymphatic filariasis . although , with regard to malaria , the lower age threshold is a limitation , in the nearby wosera area , peak prevalence was not reached till after five years . wuchereria bancrofti microfilariae were counted microscopically on nuclepore filters , through which 1 ml of night - collected blood had been passed . anopheles mosquitoes , predominantly anopheles punctulatus s.s . , are the vectors of filariasis in the area . villages are divided into subunits , which we call hamlets , distinguished by names in the local languages . these were mapped with a hand - held trimble ensign global positioning system ( gps ) machine . in the 1994 survey , immediately before the first round of treatment , blood samples were obtained from 2,219 people in 149 hamlets . hamlets whose distance to their nearest neighbour was , due to gps inaccuracy , measured as less than 10 m were combined with their nearest neighbour . there were two such instances , so reducing the total number of hamlets to 147 . as described elsewhere , spatial structure in the infection densities was fitted by a negative binomial model . the mean density is fitted as a log - linear function of age , sex , and the hamlet mean . in turn , the hamlet means are given a spatial structure , with closer hamlets being more highly correlated . specifically , hamlet i adds a ' hamlet effect ' ui to the logarithm of the mean density . when exponentiated , these are similar to standardized mortality ratios ( smrs ) although relate to parasite densities rather than death rates , so can be called standardized parasite density ratios . these age- and sex - adjusted hamlet effect uil have a covariance matrix ( 1/)exp(-dil/ ) , where dil is the distance between hamlet i and l. the parameter measures the scale of spatial correlation . more specifically , loge2 is the distance over which the correlation reduces by half , which we call the ' half - distance ' . the process can also be thought of a smoothing process of the raw hamlet means , adjusting for age and sex , and with a large spatial scale ( ) corresponding to a greater degree of smoothing . the model was fitted by programs written in the c and fortran languages , and checked in terms of ability to represent the spatial variability , and robustness to distributional assumptions . at the individual level , the mean pre - treatment microfilaraemia density ( including zeros ) increased with age , till reaching 1591 mf / ml in the 4049 year age group , then flattening out . the mean p. falciparum density was 18 asexuals per 200 white cells in those aged 510 years , decreasing to below 2 for ages over 30 years . at the hamlet level , the median of the crude hamlet - specific pre - treatment mean microfilarial densities was 552 mf / ml , range 04625 . for p. falciparum , the median was 2.2 asexual parasites per 200 white cells , range 0113 . the figure shows the spatial variation in the pre - treatment density of both parasites in this area , estimated from the model , taking into account age and sex effects , and spatial correlation . w. bancrofti had an estimated half - distance of 1.7 km ( = 2.41 , = 1.79 ) . p. falciparum showed virtually no spatial correlation , the half - distance being just 14 m ( = 0.0208 , = 1.13 ) , around the resolution limit of the gps . spatial variation of a ) w. bancrofti and b ) p. falciparum in parts of urim and urat census districts , east sepik province . the scale is in kilometres with an arbitrary origin near the centre of the study area ( 142.7e , 3.6s ) . each hexagon represents one hamlet , with the shading showing the quartile of the standardized parasite density ratio . for w. bancrofti , the 0 , 25 , 50 , 75 and 100th percentiles are 0.27 , 0.56 , 1.02 , 1.71 and 4.3 respectively . for p. falciparum the curve plotted against the vertical axis shows the rate at which correlation in mean parasite density decays with distance . the solid lines in the body of the map show unpaved roads , and the dashed line indicates the division of villages between the two census districts . one year after the first round of mass treatment with anti - filarial drugs ( coverage 88% ) , all 14 randomized clusters showed a reduction in williams mean w. bancrofti density , ranging from 47 to 96% , mean 80% . all 14 clusters showed an increase in williams mean p. falciparum , the increases ranging from 2 to 255% , mean 91% . however , although dec+ivermectin was more effective against w. bancrofti , no tendency was seen for those clusters to have larger increases in p. falciparum : in 3 of the 7 pairs the dec+ivermectin cluster had the larger increase , with 4 having the opposite tendency . to further investigate the possibility that this increase was due to the treatment , the results of the spatial models were put into a hamlet - level analysis : an ' ecological ' analysis in epidemiological terms . the difference in the post- and pre - treatment hamlet effects was calculated for both filariasis and malaria , and a linear relation tested using the pearson correlation coefficient . there was negligible correlation between the changes in the densities of the two infections ( r = 0.026 , p = 0.75 ) . the world health organization methodology of ragfil ( rapid assessment of the geographical distribution of bancroftian filariasis ) is based on a 50 50 km grid . gyapong et al . have compared this to a finer 25 km grid in ghana , with both leading to operationally similar conclusions . when extended to three other countries of west africa , the method showed filariasis to have an unexpectedly wide geographical distribution . the current results suggest that , at the opposite end of the spatial scale , it may be possible for foci to persist within the interstices of a 50 50 km grid , or even a 25 25 km one ; a conclusion similar to that reached by srividya et al . in india . however , the overall importance of any such effects will also depend on the relative magnitudes of variation at different scales , which we are unable to measure beyond the extent of our current study area . the need for accurate geographical monitoring may increase if the current elimination campaign reduces filariasis over a wide scale and proceeds from an ' attack ' to a ' consolidation ' phase ( to borrow malaria eradication terminology ) . for example , thompson et al . , found the risk of malaria varying by a factor of 6 over 500 m . however , the scale of variation found in the current study was still smaller than expected , with even the closest hamlets showing little correlation . the much smaller scale of variation of malaria is probably related to its rapid variation over time . by comparison , the risk of acquiring w. bancrofti infection per mosquito bite seems to be much smaller , but infections can last much longer . a single cross - sectional survey therefore reflects a longer - term aggregate of filariasis exposure history . our estimation of the hamlet effects can be seen as a smoothing method , in which the degree of smoothing is determined by the data . in this example , the west - east trend in filariasis density was not easily discernible in the raw data , while the low spatial correlation of malaria meant that the smoothed map is similar to the crude one . any pattern presumably reflects spatial variation in factors which affect the parasite , vector or host , but which are not included in the model . in the current study , such factors are likely to include those related to vector density , such as distance to breeding sites , but this information is not available for the whole study area , and the lack of pattern in malaria infection suggests that other factors must also be involved . we view the technique as potentially useful in identifying such factors , as well as identifying ' hot spots ' of infection . our method takes account of the extreme skewness shown by most parasite distributions , which can cause problems even at the exploratory stage of analysis . for example , we found that using the common log(x+1 ) transformation to plot the hamlet ' geometric means ' induced a spurious spatial correlation in malaria infection . excess mosquito mortality caused by w. bancrofti would make it feasible for filariasis control to enhance malaria transmission . an ' ecological ' analysis did not show such an effect in this study , but monitoring should continue in those areas where anopheles are vectors of both infections . for the elimination of filariasis , mapping at small as well as large scales will be necessary , including urban areas , especially as efforts proceed beyond the ' attack ' phase . dec diethylcarbamazine gps global positioning system ragfil rapid assessment of the geographical distribution of bancroftian filariasis smr standardized mortality ratio the work originated in a drug trial of which james kazura and michael alpers were the co - principal investigators , and which was led in the field by phil hyun and zachary dimber . neal alexander worked on the drug trial and , for this paper , made the gps readings and wrote the first draft . moses bockarie also contributed to the trial , including ensuring that the blood slides were read . the spatial model was initially developed by neal alexander under the supervision of bryan grenfell . the model was finalized by neal alexander , rana moyeed and julian stander , and fitted by programs written by rana moyeed and julian stander . the drug trial was supported financially by the world health organization ( grant number tdr 910466 ) and the government of papua new guinea . julian stander was partially supported by the european union tmr network erb - fmrx - ct96 - 0095 . bryan grenfell was supported by the wellcome trust and the biotechnology and biological sciences research council .

the spatial variation of wuchereria bancrofti and plasmodium falciparum infection densities was measured in a rural area of papua new guinea where they share anopheline vectors . the spatial correlation of w. bancrofti was found to reduce by half over an estimated distance of 1.7 km , much smaller than the 50 km grid used by the world health organization rapid mapping method . for p. falciparum , negligible spatial correlation was found . after mass treatment with anti - filarial drugs , there was negligible correlation between the changes in the densities of the two parasites .

a 36-year - old , otherwise healthy male , presented with recurrent pain of the left second toe . this started with walking several years earlier . physical examination revealed point tenderness at the nail of the left second toe , with no evidence of deformity or discoloration of the nail . radiographs of the left foot demonstrated a focal osteolytic lesion with a subtle sclerotic margin in the distal phalanx of second toe ( fig . a diagnostic inspection through magnetic resonance imaging ( mri ) focused on the presence of a 0.7 0.6 0.5 cm well - marginated osteolytic lesion , with a low signal rim on all pulse sequences ( fig . surgery was performed in the supine position under spinal anesthesia with a thigh tourniquet , removing the nail from its bed to access the tumor , and a subsequent longitudinal incision was performed directly to the nail bed . a non - encapsulated , grey - white , rubbery mass was isolated with 2.5 loupe magnification ( fig . the postoperative wound was closed and the removed nail was reattached to protect the nail bed ( fig . four weeks postoperatively , the patient was able to ambulate without symptoms . at the 1-year follow - up appointment , hematoxylin and eosin - stained sections showed poorly circumscribed mass with infiltration of the surrounding adipose tissue , which consisted of cellular proliferation arranged into long fascicles ( fig . the tumor cells were elongated , slender , spindled cells of uniform appearance ( fig . glomus tumors are uncommon , and thought to represent less than 1.5% of all benign soft tissue tumors of the extremities.2 ) due to the fact that they appearance in the extremities is rare , their diagnosis is commonly delayed or missed . radiographically , these tumors appear as well - circumscribed radiolucent lesions , with endosteal erosion of the adjacent cortex or sclerosis of adjacent bone . the radiographic appearance resembles that of an enchondroma , epithelial inclusion cyst , or simple bone cyst.3 ) mri can be particularly helpful in the detection of early lesions , which are often smaller and more difficult to diagnose definitively by physical examination.4 ) mri features that are considered diagnostic for glomus tumors include intermediate or low - signal intensity on t1-weighted images , marked hyperintensity on t2-weighted images , and strong enhancement after the injection of gadolinium - based contrast material.5 ) the pathological appearance of the tumor is nests of glomus cells , which are small , uniform , rounded cells surrounding capillary sized vessels . the glomus cells show smooth muscle actin in immunohistochemical stains ; however , desmin , cd34 , and s-100 proteins are usually negative . although glomus tumors are benign lesions , excision of the lesion with a sufficient margin of surrounding normal tissue not only confirms the differential diagnosis , but also results in adequate treatment.2 ) fibromatoses are rare lesions , accounting for 0.03% of all tumors.6 ) fibromatoses are characterized by proliferation of well - differentiated fibroblasts , infiltrative growth ( ill - defined outlines ) , presence of a variable amount of collagen in between the proliferating cells , lack of cytological features of malignancy and scanty or absent mitotic activity and aggressive clinical behavior ( repeated local recurrences but lack of capacity to metastasize distantly).7 ) fibromatoses are divided into two large subgroups based on their location , superficial and deep . superficial fibromatoses are typically small , slow growing tumors , whereas deep fibromatosis are commonly large , faster growing and more aggressive tumors . superficial fibromatosis includes palmar fibromatosis ( dupuytren disease ) , plantar fibromatosis ( ledderhose disease ) , juvenile aponeurotic fibroma , and infantile digital fibromatosis.8 ) one of the superficial fibromatoses , palmar fibromatosis is the most common , followed by plantar fibromatosis . fibromatoses of the extremities are generally rare.9 ) to our knowledge , no reports of superficial fibromatosis at the toe phalanx exist in the literature . radiographs are frequently normal in patients with palmar and plantar fibromatosis ; nevertheless , occasional scalloping of the adjacent bone is seen in patients with juvenile aponeurotic fibroma.10 ) in the present case , a focal osteolytic lesion with a subtle sclerotic margin was found in the distal phalanx of second toe . these lesions may be difficult to detect and manage , as they have a tendency to infiltrate adjacent structures and reoccur locally . mri is considered the primary imaging modality in fibromatosis , for the purposes of planning surgery , detecting postoperative local recurrence and evaluating disease progression in patients not treated with surgery.6 ) signal characteristics have been shown to correlate with the cellularity of the lesion.8 ) fibromatosis does not metastasize , although recurrence rates vary . treatment is based on either excision of the mass or radiotherapy and chemotherapy if the condition is inoperable ; however , wide excision is the most effective method.9 ) using microscopy , the lesions contain spindle - shaped myofibroblastic cells , dense deposits of intracellular collagen fibers , variable amounts of extracellular myxoid matrix , and compressed and elongated vessels.7 ) the present case is distinguished from a glomus tumor by the tumor cytomorphology ( h&e ) and immunoreactivity , and smooth muscle actin is negative . the presentation of this condition shows the possibility of encountering uncommon superficial fibromatosis in the distal phalanx of the toe , and suggests that superficial fibromatosis should be included in the differential diagnosis of a glomus tumor in the toe .

various types of tumor can occur in the subungual space , including glomus tumors , subungual exostosis , hemangioma , epidermal cysts , and malignant tumors . while fibromatosis can occur at various sites throughout the body , it is very rarely seen in the toe . here , we are the first to report a case of superficial fibromatosis mimicking a glomus tumor in the subungual space of the second toe . the presentation of this condition shows the possibility of encountering uncommon superficial fibromatosis in the distal phalanx of the toe , and suggests that superficial fibromatosis should be included in the differential diagnosis of a glomus tumor in the toe .

classic neuroimaging findings described in gm2 gangliosidosis is hyperdense signal in bilateral thalami in non - contrast computed tomography ( ncct ) scan and hypointensity in t2 weighted mri images . hyperdens thalamus in ncct head in a child with neuroregrssion , facial dysmorphism and organomegaly , should lead us to think about gm1 gangliosidosis . a 16-month - old girl presented with history of regression of mile stones for last 6 months . psychomotor development was normal until 12 months of age ; subsequently , she gradually lost ability to sit , neck control , and social smile . she had attained vocabulary of single syllable by 1 year , but subsequently lost it . there was no significant family history . on examination , she had coarse facies , horizontal nystagmus , hepatosplenomegaly , and multiple mongolian spots [ figure 1 ] . on fundus examination , she had bilateral macular cherry red spots [ figure 2 ] . skeletal survey revealed dysostosis multiplex at dorsolumbar junction , as superiorly notched ( inferiorly beaked ) vertebral bodies in the lateral view at the thoracolumbar junction [ figure 3 ] . clinical diagnosis of gm1gangliosidosis was supported with mri brain findings and confirmed with absence of -galactosidase enzyme activity in leukocytes [ figure 4 ] . clinical pictures of a 16-month - oldgirl showing massive hepatosplenomegaly , excessive mongolian spots , and severe failure to thrive photograph of retina in patient with gm1gangliosidosis showing cherry red spot and optic disc edema x - ray of same patient showing dysostosis multiplex at lumbar spine and ncct scan of brain ( axial sections ) at level of thalamus showing bilateral hyperdense thalamus axialt1-weighted image and t2-weighted image at the level of thalamus show diffuse dysmyelination of white matter with bilaterally symmetric thalamic signal change , which appear hyperintense on t1-weighted and hypointense on t2-weighted images gm1gangliosidosis is a rare autosomal recessive lysosomal storage disorder caused by deficiency of lysosomal enzyme -galactosidase , resulting in progressive neural and visceral accumulation of gm1gangliosides , its asialo derivative ga1 , and other minor glycolipids and glycopeptides . three clinical phenotypes can be distinguished and classified by age of onset : infantile , late infantile / juvenile , and adult . the age of onset and rate of progression of the disease depend on the residual activity of enzyme -galactosidase . infantile gm1gangliosidosis , the most common and severe form , is characterized by facial and skeletal abnormalities and neurological deterioration before the age of 6 months . this disorder can be diagnosed by several ways , including lysosomal enzyme assay of low -galactosidase activity in peripheral blood leukocytes or cultured skin fibroblasts , detection of abnormal urinary oligosaccharide excretion , and rectal biopsy . prenatal diagnosis by measurement of enzyme activity in amniotic fluid and cultivated amniotic fluid cells has also been established . the classic neuroimaging findings in patients with infantile gm1gangliosidosis include thalamic hyper density on non contrast computed tomography ( ncct ) scan and hypointense signal of the thalami with persistent high signal intensity of the white matter on t2-weighted images , indicating severely defective myelination[13 ] [ figure 4 ] . significant white matter abnormalities are present only in the infantile form of gm1gangliosidosis , but they are also described in other infantile - onset neuronal storage disorders , such as gm2gangliosidosis and infantile neuronal ceroid lipofuscinosis . a paucity of myelin in gm1gangliosidosis has been demonstrated by several classical neuropathologic and neuroimaging studies of patients and animal models .

gm1gangliosidosis is a rare autosomal recessive lysosomal storage disorder caused by deficiency of enzyme -galactosidase , resulting in progressive neural and visceral accumulation of gm1gangliosides . coarse facial features , bilateral cherry red spots , and dysostosis multiplex are important clue to diagnose this condition . we describe a case of gm1gangliosidosis with dysostosis multiplex and characteristic magnetic resonance imaging findings .

congenital mesenchymal hamartoma of the chest wall ( mh ) , synonymous and partly incorrectly named as congenital mesenchymoma , is a rare benign lesion which usually presents antenatally or during early infancy . however large thoracic wall resections in the growing child subsequently result in deformations of the thoracic cage and spine . to avoid these long term sequels conservative management of patients has been suggested . however this option may be of limited value in infants with extended cystic and enlarging mh . after an uncomplicated pregnancy antenatal routine obstetrical ultrasonography of the fetus at 39 weeks of age had revealed an extensive chest mass . intrauterine magnetic resonance imaging ( mri ) depicted the presence of a large heterogeneous mass of 7 x 5.3 cm occupying the fetus right thorax . the baby was delivered by caesarean section with a weight of 3170 g. apgar scores were 5/7/8 and postnatal oxygen supplementation was applied . the baby was in a stable condition , however , a protrusion of the right chest wall was obvious ( figure 1 ( fig . 1 ) ) . chest x - ray showed a large cloudy calcificated mass extending within the right hemithorax shifting the mediastinum to the left . the lesion destructed parts of the 6 to 9 rib and displaced the right lung , vessels and the mediastinum to the contralateral side . histopathology revealed cartilage with expression of protein s100 and a low proliferation rate ( mib-1 ) . furthermore , proliferating spindle cells , osteoclast - like giant cells , newly generated fibrous ossifications as well as ectatic vascular spaces were found ( figure 2 ( fig . 2 ) ) . postnatal mri showed a multicystic mass of 6.7 x 5.8 x 5.6 cm arising from the thoracic wall and consisting of large fluid contained cavities . histopathology results and imaging both were consistent with the diagnosis of a congenital mesenchymal chest wall hamartoma . as the baby was in a fair condition a conservative treatment was favored . at three weeks of age in the course of the follow up examination at 5 weeks of age we noticed an anemia with the necessity of a transfusion ( hemoglobin 6.8 g / dl ) . the mri disclosed an increase in size to 9.3 x 8.1 x 7 cm due to hemorrhage . this enlargement was accompanied by shifting the large vessels to the left side and compressing the inferior vena cava . sedimentation levels within the large cystic spaces of the hamartoma indicated intralesional bleeding ( figure 3 ( fig . an extended resection of the thoracic wall encompassing the ribs 7 through 9 were nearly completely as well as parts of the 6 and 10 rib . chest wall reconstruction was facilitated by preservation of the outer musculature and the use of a bovine pericardium patch . she showed a slight deformity of the right thoracic wall due to a bony defects of the ribs without concomitant deformation of the spine . the mass arises from the central part of the ribs . in the recent literature nearly 80 cases usually the mass presents in early infancy although some cases with presentation in adults were observed . diagnosis is based on imaging ( chest x - ray , mri ) and histopathological findings . typically the lesion is large and well delineated but compresses the surrounding organs and results in a deformity of the thoracic wall . following an initial period of rapid growth between the 28 and 36 week of gestation discontinuity of enlargement or spontaneous regression different therapeutic approaches have been reported in the literature : the majority of the hamartomas has been excised by primary intuition or secondary due to respiratory distress , cardiovascular compression or neurological symptoms . however a few authors described conservative management and a spontaneous regression supporting the concept to be appropriate for children with minor symptoms , . the mh was left in place and follow up at the age of 6 years revealed some reduction in size after conservative management . shimotake et al . described a newborn with a large mh occupying the left hemithorax resulting in severe respiratory insufficiency . as conclusion the authors advocate conservative management after confirmation of the diagnosis . only cameron et al . reported a case comparable to our experience . initially this infant was managed conservatively but in the age of 5 month the tumor increased in size . intralesional bleeding lead to increasing compression of the lung and excisison of the mh . based on the suggestions of these case reports we initially favored a conservative management in the presented case with avoiding the risks of a destructive en - bloc resection and the risk of long term complications as impaired thoracic growth and postsurgical scoliosis . different signal intensities of the cyst content with fluid - fluid levels are a well known feature of mh in mri and ct . this bleeding can lead to an enlargement of the tumor size and compression of the lung as reported above . one patient underwent partial tumor resection because of profuse bleeding in the course of open biopsy . in the presented infant the intralesional bleeding resulted in repeated severe anemia with worsening of the patient s condition . after stabilization we performed the resection of this lesion . in conclusion conservative management of mh requires close follow - up examinations of the patient to recognize potential life threatening complications .

we report a case with prenatally diagnosed large cystic - solid mesenchymal chest wall hamartoma . an attempt of conservative management was made however repeated intralesional hemorrhage led to enlargement and severe anemia which required urgent resection at the age of 8 weeks . the infant had an unimpaired development over a follow - up of 4 years .

chronic obstructive pulmonary disease ( copd ) predominantly affects elderly people with history of smoking or exposure to noxious gaseous substances for a prolonged period . this progressive and poorly reversible problem of air flow limitation has been found to be associated with a variety of systemic manifestations , and amongst these , reduced bone mineral density ( bmd ) has been recognized as one of the systemic effects of copd irrespective of the stage of the disease , being compounded by restricted mobilization , poor intake of food and use of corticosteroids concomitantly . osteoporosis and osteopenia are common observations in copd , and the degree of the loss of bmd has been found to be proportionate to the severity of the disease . this association is important from a clinical point of view as appropriate interventions may lessen the morbidity of the copd patients . in the present study , we have looked at the degree and frequency of osteoporosis and osteopenia in our opd patients with copd . copd patients , diagnosed on spirometry as per the gold guidelines , were selected randomly from the opd of the institute of pulmocare and research , kolkata ( india ) , and were included upon the availability of written informed consent for measurement of bmd . patients with any significant comorbidity such as concomitant active respiratory tract infection , neoplastic disease , significant cardiac ailment or any systemic disease that can likely affect the bmd from immobilization or treatment were excluded . similarly , patients with history of taking systemic steroid in the preceding 6 weeks were also excluded . information about smoking and treatment with corticosteroids , calcium supplementation , day - to - day activities , respiratory exercises done regularly or not along with history of hospitalization and exacerbation frequently ( more than twice ) , cumulative dose of systemic steroid ( prednisolone equivalent use in last 1 year ) was obtained with the help of a questionnaire . the bmds of the left heel bone ( calcaneus ) of the patients of the copd education camps were measured with the help of a broadband ultrasound bone densitometer ( hologic sahara , hologic inc . the system incorporates two ultrasound transducers positioned opposite to each other , touching the lateral aspects of the heel that is being placed in between the transducers . the densitometer measures the speed of sound ( sos ) and broadband ultrasonic attenuation ( bua ) in db / mhz of an ultrasound beam that passes through the calcaneus . it makes an estimation of bmd and the t - score from this data by the system software . the t - score quantifies the difference between the patient 's bmd and the mean value for healthy young adults from the reference group . according to who , the normal value for t - score is within 1 sd of the mean value for young adults ( 1 to + 1 ) . osteoporosis is considered to be present when the value for bmd is less than 2.5 sd below the mean for young adults . the bmds of the left heel bone ( calcaneus ) of the patients of the copd education camps were measured with the help of a broadband ultrasound bone densitometer ( hologic sahara , hologic inc . the system incorporates two ultrasound transducers positioned opposite to each other , touching the lateral aspects of the heel that is being placed in between the transducers . the densitometer measures the speed of sound ( sos ) and broadband ultrasonic attenuation ( bua ) in db / mhz of an ultrasound beam that passes through the calcaneus . it makes an estimation of bmd and the t - score from this data by the system software . the t - score quantifies the difference between the patient 's bmd and the mean value for healthy young adults from the reference group . according to who , the normal value for t - score is within 1 sd of the mean value for young adults ( 1 to + 1 ) . osteoporosis is considered to be present when the value for bmd is less than 2.5 sd below the mean for young adults . thirty - seven patients with mean age 65.32 9.58 years and a male female ratio of 35:2 were included . the bmd findings were ( a ) normal in 10 patients ( 27% ) ( the mean t - score being 0.51 0.27 ) , ( b ) osteopenia in 19 patients ( 51.35% ) ( the mean t - score being 1.78 0.31 ) , and ( c ) osteoporosis in 8 patients ( 21.62% ) ( the mean t - score being 2.84 0.23 ) . when the mean bmd scores of osteoporosis ( 0.26 0.03 ) and osteopenia ( 0.38 0.04 ) were compared , the difference was found to be highly significant ( p < 0.001 ) statistically . the mean t - scores were 0.51 0.27 for normal group , 1.78 0.31 for osteopenia , 2.84 0.23 for osteoporosis , and 2.10 0.57 for osteopenia and osteoporosis combined . the frequency and the results of the unpaired difference between the copd patients with normal and lower bone density as regards different historical , clinical , fev1 and bmd score the statistical analysis shows that there is significant difference in mean dose of glucocorticosteroid ( duration in months ) and mean bmd score of copd patients between normal and low bmd patients with osteopenia + osteoporosis . if the mean bmd scores of osteoporosis ( 0.26 0.03 ) and osteopenia ( 0.38 0.04 ) are compared , the difference is found to be highly significant ( p < 0.001 ) statistically . osteoporosis is a systemic skeletal disease characterized by micro - architectural reduction of bone tissue , leading to a low bone mass , increased bone fragility and thereby increased fracture risk . osteopenia refers to bmd that is lower than normal peak bmd , but not low enough to be classified as osteoporosis . both these phenomena can develop from different etiologies such as prolonged immobilization , restricted movement , calcium and phosphate deficiency , use of systemic steroid , etc . it has been found that osteoporosis and osteopenia are common observations in copd which is a disease of chronic airflow limitation with poor reversibility to bronchodilators . reduction of bmd in copd has been found in about 50% of patients in several studies . while steroid ( inhaled or systemic ) therapy is being considered the most common risk factor , investigators , however , have argued that use of steroids alone can not explain the high prevalence of osteoporosis / osteopenia in copd patients . the degree of lung function reduction and severity of copd is also found to correlate with these phenomena . in a cross - sectional study , the prevalence of osteoporosis was 75% in patients with gold stage iv disease and was strongly correlated with reduced ffv1 . in the large torch ( towards a revolution in copd health ) trial again , over half of the copd patients recruited ( out of the 6000 patients ) had osteoporosis or osteopenia as determined by dual energy radiograph absorptiometry ( dexa ) . our finding of the prevalence of osteoporosis and osteopenia to be as high as 73% tallies the observations elsewhere . the data from our observation reveal that copd patients having osteopenia and osteoporosis ( n = 27 ) and copd patients with a normal bmd ( n = 10 ) have no difference as regards age , lung function ( fev1 ) , hospitalization rate , and frequency of respiratory exercise done regularly . however , they differ in duration of symptoms ( p = 0.03 ) , the duration of diagnosis of copd ( p = 0.04 ) , and dose of systemic steroid ( p = 0.011 ) . although the patients with reduced bmd had higher frequency of repeated exacerbations in last 1 year , it was not statistically significant ( p = 0.44 ) . it is an interesting observation that the patients with a normal bmd had reduced duration of symptoms and the time elapsed after the diagnosis , while the disease severity was equal in magnitude as per the fev1 value . this is possible if the copd patients with normal bmd had faster decline of fev1 or the low bmd copd patients had some coexistent problem affecting their bmd differentially . this can be explained clearly by higher intake ( p = 0.011 ) of systemic steroid in the later group . it is likely that the group having low bmd was also affected by prolonged immobilization for a higher rate of exacerbation as noted . unfortunately , we have not taken into account the duration of immobilization in the low bmd group . interestingly , although the exacerbation rate was higher in the osteoporosis osteopenia ( combined ) group , the hospitalization rate in the same group was lower than the other . it is not possible to explain this paradox with such a small number of recruits . all the patients were in gold iii / iv stage ( mean fev1 = 0.80 0.40 l ) and we have not noted the bmd of the early copd patients . hence , the actual prevalence of osteoporosis / osteopenia in overall copd population can not be conferred from our observation . incidentally , again , the history of calcium intake in the preceding 1 year was more with the patients of osteoporosis or osteopenia though none had history of taking bisphosphonate . it is not possible to comment on the reasons of such higher level calcium supplementation in this group . besides intake mere calcium supplementation may not be enough to measure actual calcium utilization for restoring the bmd . factors like vitamin d deficiency need to be taken into account and this area needs attention in future studies . although the method has comparable accuracy , it is not considered the gold standard as dexa scan . moreover , a single heel ultrasound measurement may not correctly indicate the bmd in general since this can be affected by local pathological conditions . although there was no such obvious factor encountered during the study , observing a strict protocol in this regard would have been better . since most of our volunteers were males , we could not gather any information about the bmd of female copd patients in our community . with a small number of subjects , we have not looked for the presence and the effects of the systemic inflammation by measuring any of its markers , though we could have some idea about the level of sarcopenia from reduced bmi . historical assessment of frequency of exacerbation in last one year , though imperfect , is important since it reflects the status of the patient as per the severity and the level of care . since there is no difference between the two groups as far as severity of copd ( fev1 as 0.79 0.49 vs. 0.81 0.37 l in normal and reduced bmd group , respectively ) is concerned , the higher prevalence of hospitalization in normal bmd group needs further investigation . association of osteoporosis and osteopenia in copd is important from a clinical point of view as appropriate intervention may lessen the morbidity of the copd patients and such high prevalence of the conditions can not be ignored in our population .

background : reduction of bone mineral density ( bmd ) is a known and established phenomenon in chronic obstructive pulmonary disease ( copd ) . however , there have been no data regarding osteoporosis / osteopenia in copd patients in india.aim:to look for the degree and frequency of osteoporosis / osteopenia in our opd patients being diagnosed as copd.materials and methods : thirty - seven randomly selected patients with copd were assessed for bmd with commercially available ultrasound bone densitometer ( hologic sahara ) in a pulmonary opd . some cofactors for reduced bmd were also noted.results:out of the 37 copd ( all belonging to the gold iii / iv category ) patients studied , the bmd was found to be normal in 10 ( 27% ) patients , while 27 ( 73% ) patients were found to have osteopenia / osteoporosis [ 19 ( 51.35% ) and 8 ( 21.62% ) patients having osteopenia and osteoporosis , respectively].conclusion : frequency of osteoporosis and osteopenia was found to be very high ( 73% ) in our population of advanced copd . the data suggest a need for further in - depth study regarding the issue .

sickle cell disease ( scd ) is a genetic disorder caused by the substitution of valine for glutamic acid at the sixth position of the amino acid -chain of the haem molecule [ 1 , 2 ] and is characterized by the possession of sickle haemoglobin . it is a significant cause of morbidity and mortality among black individuals and descendants of negroid race . life expectancy is shortened with studies reporting average life expectancy of 42 and 48 years for males and females , respectively . scd is characterized by defect in plasma and erythrocyte lipids associated with chronic oxidative stress . these two morbid processes disturb lipid homeostasis which in turn may lead to atherosclerosis in these patients [ 7 , 8 ] . abnormal lipid homeostasis , as well as other haematological disorders , has been reported in sca and this has been suggested to have the potential to alter membrane fluidity and functions of red blood cells ( rbc ) in individuals with scd [ 911 ] . mostly , a standard lipid profile ( triglyceride , total cholesterol , high - density lipoprotein cholesterol , and low - density lipoprotein cholesterol ) is used to assess the risk of coronary artery disease ( cad ) . earlier studies in patients with scd recorded a significant increase in triglyceride ( tg ) levels and decreased levels of total cholesterol ( tc ) , high - density lipoprotein cholesterol ( hdl - c ) , and low - density lipoprotein cholesterol ( ldc - c ) . atherosclerosis , often associated with cad , is characterized by elevated levels of cholesterol and ldl - c . pulmonary hypertension , the main form of cardiovascular dysfunction in scd , is often characterized by low levels of tc and ldl - c . relying on ldl - c levels to assess cardiovascular disease may be misleading as reported in a recent meta - analysis . that study recorded low levels of ldl - c but high levels of non - hdl - c ( tc - hdl - c ) in people with cardiovascular disease [ 11 , 13 ] . it is imperative that these reported dyslipidemia cases in scd should be interrogated in light of the new findings . in addition , there is a paucity of data on lipid profile in scd patients in ghana . in light of the above , we sought to determine the lipid profile and non - hdl - c levels in scd patients in the steady state . this hospital - based cross - sectional study was carried out at the sickle cell unit of tema general hospital in the greater accra region of ghana . a total of 50 scd patients ( 12 with hbs and 38 with hbsc haemoglobin variants ) were recruited for the study . a total number of 50 healthy , age- and sex - matched controls also participated in the study . patients who have been diagnosed with the sickle cell disease , those with the genotype hbss and hbsc who are in the steady state , and those who allowed parental consent were included in the study . exclusion criteria included patients with inflammatory episodes , patients with sickle cell trait , patients on medications that affect lipid metabolism , and those who have had blood transfusion four ( 4 ) months prior to the study . all protocols for the study were approved by the institutional review board ( irb ) of the university of cape coast as well as the sickle cell clinic of the tema general hospital . all data was deidentified before analysis . in all subjects , 5 ml of overnight fasting venous samples was collected from all eligible subjects : 3 ml was put in plain tube , allowed to clot , and centrifuged at 2500 rpm for 5 minutes and the serum was used for estimation of lipid profile ; 2 ml was put in edta tube and used for confirmation of their haemoglobin phenotype by cellulose acetate electrophoresis . tc and tg concentrations were analyzed by enzymatic assay , whereas hdl - c was estimated calorimetrically . the calculation of vldl - c was done by vldl - c = triglyceride/2.2 and ldl - c calculation was done by the following friedewald equation : ldl - c = tc - hdl - c ( tg/2.2 ) . data was entered into microsoft excel ( microsoft , redmond , wa , usa ) and analyzed with spss version 16.0 ( spss inc . , the results were expressed as mean standard deviation and t - test was used to calculate the level of significance . the mean ages of the sickle cell disease ( scd ) patients and those without scd were 18.14 4.63 years and 21.42 7.76 years , respectively . scd was found to be more prevalent in females ( 78.0% ) than in males ( 22.0% ) , with majority of the scd patients , 33 ( 66.0% ) , aged between 10 and 19 years . assessments of obesity using bmi was significantly (= 0.002 ) lower in the scd patients than in those with no scd ( table 1 ) . both systolic and diastolic blood pressure parameters of the scd patients were significantly lower ( < 0.0001 ) compared to healthy subjects . serum lipid profile showed no statistically significant difference between the two groups as tg , ldl , vldl , and non - hdl were compared ( p > 0.05 ) except for tc and hdl ( p = 0.001 , < 0.0001 , resp . ) ( table 1 ) . the plasma lipid concentrations , bmi , and blood pressure of the three groups are shown in table 2 . mean bmi , sbp , and dbp were significantly lower in sc and ss patients ( p < 0.05 ) compared to the healthy controls ( aa ) . tc and hdl cholesterol were significantly lower in sc and ss patients compared to the control groups ( p < 0.05 ) , despite being higher in the sickle cell patients with ss genotype than in those with sc . in addition , tg / hdl ratio was significantly higher in sc patients than in the healthy controls and ss patients . both sbp and dbp were each significantly associated with vldl [ sbp , p = 0.01 , or : 0.74 ( ci : 0.60.93 ) ; dbp , p = 0.023 , or : 1.45 ( ci 1.052.0 ) ] . our study also investigated the relationship of bmi and blood pressure variables with serum lipid profile in scd patients and healthy individuals . body mass index showed a nonsignificant inverse correlation with tc , tg , and vldl in both scd and healthy patients ( see supplementary data s1 in supplementary material available online at http://dx.doi.org/10.1155/2016/7650530 ) . however , bmi correlation with ldl was negative for scd patients and positive for healthy controls and vice versa for hdl despite being significant for scd patients ( supplementary data s1 ) . sbp was directly related to all lipid profile parameters in the controls with the exception of ldl whereas tg and vldl showed inverse correlation with sbp in the cases . on the other hand , with the exception of hdl , dbp was positive but not significantly related to tc , tg , ldl , and vldl in cases whereas in the controls all the lipid profile parameters with the exception of vldl and non - hdl - c showed a nonsignificant positive correlation with dbp . this study sought to assess the lipid profile and non - hdl - c levels of sickle cell disease patients in the steady state compared to healthy controls . our findings showed that cholesterol ( total cholesterol , hdl ) levels decreased in scd patients and were dependent on whether the patient has haemoglobin ss or sc ; non - hdl remained unchanged between the two groups . non - hdl - c is a significant predictor of cardiovascular disease among diabetes patients . we observed no significant difference in non - hdl - c levels among our participants . this to our knowledge is the first report on non - hdl - c levels in scd and thus gives credence to the established evidence that cardiovascular disease in sickle cell disease is mostly due to pulmonary hypertension and not atherosclerosis associated with elevated levels of tc , hdl , and ldl [ 9 , 18 , 19 ] . the decreased tc and hdl in scd are well documented in almost all the studies that have examined lipids in patients with scd [ 2022 ] . hypocholesterolemia in scd has been attributed to increased erythropoiesis in response to the anaemia associated with scd as stated in earlier studies [ 10 , 23 ] . consistent with some but not all studies , we recorded low hdl in scd patients compared to controls . several reasons including small sample sizes , differences in gender , age , and weight , and variations in disease severity have been ascribed for these inconsistencies . in the general population , low hdl is a recognized risk factor of cardiovascular disease but low hdl also remains a common feature of pulmonary hypertension which is the main cardiovascular disorder associated with scd . scd patients with low hdl are more likely to have received more blood transfusions , an indication of the severity of the patient 's condition . the observed tg level is consistent with the findings of reaven in scd patients in nigeria . however , we can not proffer any reasons for the observed levels of ldl which seems to be at variance with what is recorded in most studies [ 24 , 29 ] except to say that the use of steady state patients could account for this observation . the tg / hdl - c ratio also known as the atherogenic index has been implicated in endothelial dysfunction associated with insulin resistance . the increase in this index as observed in this study suggests an increased risk of pulmonary hypertension among our participants . also , we noted that the tg / hdl - c ratio was higher in sc - scd patients than in ss - scd patients , further providing evidence of the high level of tg in the scd participants . multivariate analysis showed an association between elevated vldl levels and blood pressure ( bp ) with scd patients being more liable to developing diastolic dysfunction ( depicted here by elevated dbp ) which ultimately increases mortality . the observed vldl level is strengthened by the earlier observation of the positive correlation between tg and vldl . the role of tg in the development of pulmonary hypertension in scd is well elucidated with high vldl levels similar to the one recorded further buttressing the tg levels recorded in this study . it was evident from this study that dyslipidemia characterized by low hdl and tc was present among the scd patients who participated this study .

background . abnormal lipid homeostasis in sickle cell disease ( scd ) is characterized by defects in plasma and erythrocyte lipids and may increase the risk of cardiovascular disease . this study assessed the lipid profile and non - hdl cholesterol level of scd patients . methods . a hospital - based cross - sectional study was conducted in 50 scd patients , in the steady state , aged 828 years , attending the scd clinic , and 50 healthy volunteers between the ages of 838 years . serum lipids were determined by enzymatic methods and non - hdl cholesterol calculated by this formula : non - hdl - c = tc - hdl - c . results . total cholesterol ( tc ) ( p = 0.001 ) and high - density lipoprotein cholesterol ( hdl - c ) ( p < 0.0001 ) were significantly decreased in cases compared to controls . the levels of non - hdl - c , low - density lipoprotein cholesterol ( ldl - c ) , and triglyceride ( tg ) were similar among the participants . the levels of decrease in tc and hdl were associated with whether a patient was scd - ss or scd - sc . systolic blood pressure and diastolic blood pressure were each significantly associated with increased vldl [ sbp , p = 0.01 , or : 0.74 ( ci : 0.60.93 ) ; dbp , p = 0.023 , or : 1.45 ( ci : 1.052.0 ) ] . conclusion . dyslipidemia is common among participants in this study . it was more pronounced in the scd - ss than in scd - sc . this dyslipidemia was associated with high vldl as well as increased sbp and dbp .

oral myiasis was however , first described by laurence ( 1909 ) and is reported mainly in the tropics and is associated with , inadequate public and personal hygiene . the term myiasis refers to infestation of living tissues of animals or humans by diptera larvae . the species of flies that cause myiasis are cochiliomyia hominivorax , known as the screw worm fly , dermatobia hominis or human botfly , sacrophagidae species , alouttamyia baeri and anastrepha species family . myiasis can be classified clinically as primary ( larvae feed on the living tissue ) and secondary ( larvae feed on dead tissue ) . depending on the condition of the involved tissue it is classified into accidental myiasis ( larvae ingested along with food ) , semi - specific myiasis ( larvae laid on necrotic tissue in wounds ) and obligatory myiasis ( larvae affecting undamaged skin ) . further classification can be based on the site as cutaneous , external orifice , internal organs and generalized . the most common anatomic sites for myiasis are the nose , eye , lung , ear , anus , vagina and more rarely , the mouth . incidence of oral myiasis as compared to that of cutaneous myiasis is less as the oral tissues are not permanently exposed to the external environment . reported cases of oral myiasis are most commonly seen in patients with special health care needs like mental and physical challenging conditions , neurodegenerative disorders , cerebral palsy , learning difficulties , and in bedridden and medically compromised patients . the reason for the high occurrence in such patients relates to the many common predisposing factors of myiasis in these patients like poor oral hygiene , incompetent lips , halitosis , seizure disorders and trauma to oral tissues with wounds exposed to environment and hyper - salivation . the species is widely distributed throughout south - east asia , china , the indian subcontinent , tropical africa , and papua new guinea . human myiasis due to c. bezziana is very rare and first was reported in hong kong in july 2003 . the unusualness of c. bezziana infestation is that it can cause extensive tissue invasion of intact skin or mucosal surfaces and leads to burrowing and extensive damage to soft tissues and bone . the affected locations in oral myiasis reported are upper lip , anterior palate , gingiva , buccal mucosa , extraction sites and the lower jaw . traditionally , treatment consists of manual removal of maggots after local application of asphyxiating agents like oil of turpentine , ether , ethyl or mercuric chloride , chloroform , calomel , iodoform , olive oil , phenol , gentian violet and hydrogen peroxide . systemic therapy of ivermectin , a macrolide semi - synthetic antibiotic isolated from streptomyces avermitilis has improved the management by decreasing the course of infection , faster recovery and complete resolution of lesions . it acts by blocking the nerve impulses on nerve endings through the release of gamma amino butyric acid ( gaba ) leading to palsy and death . most recently , nitrofurazone topical application with flushing of the wounds in gingiva has shown promising results without any surgical intervention . this is due to the prion rods found in flies ( hypoderma bovis and oestrus ovis ) and being implicated in at least five human diseases , including sporadic creutzfeldt - jakob disease ( cjd ) which is responsible for 85% of all cases of chronic wasting diseases . thus myiasis is considered as a risk factor for prion diseases in humans . as oral myiasis is not a common occurrence , many clinicians and diagnosticians are unaware of its clinical presentation and progression leading to delay in treatment and morbidity in some cases . prevention of oral myiasis includes good community sanitation and maintenance of good individual and environmental hygiene . wounds should not be left open and oral hygiene care of medically compromised patients and those with special health care needs should be monitored by an attendant / guardian or parent . to conclude , oral myiasis is an uncommon infestation in the general urban population but is seen more often among rural and urban patients with special health care needs and requires immediate attention to prevent debilitation and disfigurement of oral tissues .

myiasis is a rare disease caused by invasion of tissue by larvae of certain dipteran flies . it is more common in countries with tropical climate . oral myiasis is not a very common condition and many clinicians are unaware of its diagnosis . common predisposing factors are poor oral hygiene , halitosis , trauma , senility , learning disabilities , physically and mentally challenged conditions . oral myiasis can lead to rapid tissue destruction and disfigurement and requires immediate treatment . treatment consists of manual removal of maggots from oral cavity after application of chemical agents . use of antibiotics reduces the duration of infection and hastens the recovery period . good sanitation , personal and environmental hygiene and cleanliness and special care for debilitated persons are the best methods to prevent oral myiasis .