Datasets:

anumafzal94

/

10k-pubmed-4096

like 0

nosocomial infections , also called healthcare - associated infections are those infections acquired by a patients as a result of treatment in a hospital , clinic or healthcare service centre . these infections generally appear 48 hours or more after hospital admission or within 30 days after discharge . they occur because of instrumentation , increased use of antimicrobial agents , breaks in aseptic techniques and lack of hand hygiene . at any time , microorganisms often implicated in these infections include escherichia coli , pseudomonas aeruginosa , klebsiella species , staphylococcus aureus and mycobacterium tuberculosis . according to the american national nosocomial infections surveillance , more than 40% of nosocomial infections occurred in parts of asia , latin america , and sub - saharan africa . it usually ferments lactose on macconkey agar to produce pink colonies with surrounding areas of precipitated bile salts . e. coli strain will produce indole from tryptophan ; it does not produce hydrogen sulfide , urease , and can not use citrate as sole carbon source . in some hospitals , e. coli strains were found to be the highest and most frequent among the pathogenic microorganisms isolated from ten teaching hospitals in china . pathogenic strains of e. coli are responsible for three types of infections in humans ; urinary tracts infections , neonatal meningitis , and intestinal diseases . in many west african countries , nosocomial infections are abound but not much study has been done to determine the proportion of infections acquired by patients or health workers from hospital and or healthcare - providing facilities . hospitals serve a reservoir of various types of microorganisms ; some may be multiple resistant to antibiotics and the selective pressure of antimicrobial use in hospitals , therefore makes the environment a repository for these resistant strains . newman and his colleagues reported on the occurrence of nosocomial infections in korle - bu teaching hospital in accra , ghana . these studies are therefore necessary and need to be conducted in many other parts of the country in order to generate national data on these pathogenic organisms , more especially on their antibiotic resistant patterns in ghana . this study sought to determine the antibiotic resistance patterns of e. coli isolates from the premises of three hospitals in kumasi , ghana . the samples were collected from kumasi south , tafo and suntreso hospitals in kumasi , ghana . a total of 600 swabs samples of floors , benches , beds , door handles , and waste water from drainages were collected between january and june , 2010 . the swabs were put into sterile test tubes , closed tightly , and labeled appropriately . all the materials including culture media , reference antibiotics , and reagents were purchased from oxoid , basingstoke , united kingdom unless otherwise stated . the various samples collected were separately inoculated into 10 ml of nutrient broths and incubated at 37c for 24 hours . using a sterile platinum loop , each culture was separately streaked onto the surface of macconkey agar plates , labeled and incubated at 37c for 48 hours , and observed for signs of growth and colony appearance . colonies that appeared pink on the macconkey agar plates were removed with sterile inoculating wire and separately streaked onto the surface of eosin methylene blue agar plates . isolated black - colored colonies with metallic sheen were again fished out into nutrient broths and incubated at 37c for 24 hours . the various subcultures were streaked onto nutrient agar slants , incubated at 37c for 48 hours , and then kept in the refrigerator at 20c for further identification and antibiotic sensitivity studies . the e. coli isolates were screened through the various microscopic examination and biochemical reactions to confirm their identities . these included indole , oxidase , and arginine dehydrolase production , citrate utilization , nitrite reduction , fermentation of carbohydrates ( such as xylose , maltose , arabinose , glycerol , and starch ) , methyl red - voges proskauer test , and reaction triple sugar iron agar [ 11 , 12 ] . all the tests were performed on reference - typed culture of e. coli ( atcc 25922 ) . kirby - bauer disc diffusion method as recommended by the clinical and laboratory standards institute was used to determine the in vitro susceptibility of the identified e. coli isolates to gentamicin ( gm ) 10 g , ciprofloxacin ( cip ) 5 g , ceftriaxone ( cro ) 30 g , ampicillin ( amp ) 10 g , and cotrimoxazole ( sxt ) ( trimethoprim - sulphamethoxazole ) 25 g . a standardized suspension of the isolated e. coli was prepared by inoculating a colony into 10 ml peptone water and incubated at 37c for 24 hours . a sterile swab was dipped into the standardized inoculum and used to inoculate evenly the surface of already prepared mueller - hinton agar ( oxoid basingstoke , uk ) . the agar was left for 15 minutes for the surface moisture to dry . a multichannel disc dispenser ( oxoid , basingstoke , uk ) the method was replicated three times and the mean zones of inhibition compared with figures ( table 1 ) provided by the clinical and laboratories standards institute . a total of 150 ( lactose fermenter ) isolates recovered on macconkey agar ( oxoid , basingstoke , uk ) were suspected to be e. coli . e. coli isolates were identified from the various locations ( benches , floor , door handles and drainages , male , female , and pediatrics wards ) in the three hospitals ( figure 1 ) . a total of 97 isolates from the three hospitals were confirmed as e. coli . jarvis and martone reported that e. coli as the most common nosocomial pathogen in some hospitals in the united states . also , e. coli has been reported to be among the most frequent isolates in hospitals in ethiopia . among the three hospitals from which the samples or swabs were taken , e. coli isolates were widely distributed in various locations throughout the three hospitals for which samples were analyzed ( table 2 ) . about 90% of the e. coli isolates exhibited resistance to ampicillin while 6.2 and 3.1% , respectively , showed intermediate and sensitive . for cotrimoxazole ( trimethoprim - sulphamethoxazole ) , 78.4% of the isolates were resistant while 9.3 and 12.3% intermediate and sensitive responses . between 26.8 to 46.4% of the e. coli isolates also showed resistance to gentamicin , ciprofloxacin , and ceftriaxone , while 14.4 to 47.4% gave intermediate responses . ceftriaxone , ciprofloxacin , and gentamicin sensitive isolates were also in the range of 23.7 to 39.2% ( figure 2 ) . the majority of the gentamicin sensitive e. coli isolates ( 28.9% ) was isolated from the male wards followed by floor samples ( 21.1% ) as shown in table 3 . none of the drainage samples were resistant to gentamicin , while 20% each from the floor and female wards proved resistant . , 46 e. coli isolates exhibited intermediate response to ceftriaxone , 30% were from the male wards , 21.4% from floor and 2.2% from drainage samples . most of the e. coli resistant isolates ( 26.9% ) were from the benches and 19.2% from male wards while no resistant strains were recovered from door handles ( table 3 ) . ciprofloxacin - resistant e. coli isolates were recovered from floor samples ( 29% ) followed by the samples from pediatric wards ( 19.4% ) . e. coli isolates which exhibited intermediate response to ciprofloxacin ( 30% ) were in the samples / swabs from the male ward and none from door handles . majority of the e. coli sensitive isolates were from female wards ( 30.4% ) followed by male and pediatric wards samples ( 17.4% ) . the distributions of ampicillin resistant e. coli isolates were 22.7 , 20.5 , and 19.3% for male wards , floors , and benches , respectively ( table 3 ) . many of the isolates obtained were found to be resistant to more than two different classes of the reference antibiotics ( table 4 ) . majority of the e. coli isolates ( 53.6% ) were isolated from the hospital beddings while about 21% were from floor samples ( table 2 ) . most of the e. coli isolates ( 90 to 78% ) were resistant to ampicillin and cotrimoxazole , respectively ( figure 1 ) . the high occurrence of e. coli isolates in these samples could be attributed to poor hygienic conditions in these hospitals and the overcrowding in these hospitals due to inadequate number of health care facilities in the region . a total of 46.4 , 32.0 , and 26.8% of the e. coli isolates exhibited resistance to gentamicin , ciprofloxacin , and ceftriaxone , respectively , and these were similar to what was reported by yismaw and his colleagues . yismaw et al . also reported a similar resistance pattern of e. coli to gentamicin ( 47% ) , ciprofloxacin ( 33% ) , and ceftriaxone ( 26% ) . and these high levels of antibiotic resistance have been attributed to widespread abuse of these antibiotics . out of 97 e. coli isolates , 78 isolates or 80.4% exhibited multiple drug resistance to at least three different classes of the reference antibiotics used . these high numbers of resistant e. coli isolates in the hospitals are potential reservoirs of resistant genes which can easily be transferred to other pathogens . hence , there is a need to observe proper hygiene , use of effective disinfectants , and monitor the administration and prescription of antibiotics in hospitals . most of the e. coli isolates ( 80.4% ) exhibited multiple drug resistance and measures such as observation of proper personal hygiene by health staff and patients , use of effective disinfectants in reducing the possible pathogenic organisms in these hospitals , and so forth . these findings have therefore showed the need for the hospital management to be concerned about the potential of hospitalized patients becoming infected with some nosocomial infections , especially resistant strains of e. coli .

nosocomial infections are infections acquired by a patient as a result of treatment in a hospital or healthcare service providing center and symptoms occurs within a short period of hospitalization . the study was to determine the antibiotic resistance patterns of escherichia coli isolated from kumasi - south , tafo and suntreso hospitals , kumasi , ghana . total of 600 swabs samples from the hospitals were collected between january and june , 2010 . the isolates were identified using morphological and biochemical means . a total of 97 e. coli isolates were obtained from the hospitals . beds in hospital wards had the highest number of e. coli strains ( 53.6% ) , followed by floors ( 20.6% ) while drainages had the least isolates ( 3.1% ) . majority of the e. coli isolates ( 90.7% ) exhibited resistance to ampicillin while 6.2 and 3.1% showed intermediate and sensitive respectively . co - trimoxazole , 78.4% of the isolates were resistant while 9.3 and 12.4% exhibited intermediate and sensitive responses respectively . e. coli isolates ( 28.6 to 46.4% ) were resistant to gentamicin , ciprofloxacin and ceftriaxone while 14.4 to 47.4% gave intermediate responses . most isolates ( 80.4% ) exhibited multi - drug resistance . there is a need to observe proper personal hygiene , use of effective disinfectants and proper disposal of contaminated / pathogenic materials in these hospitals to control nosocomial infections .

decrease in lean mass can occur in patients with chronic advanced diseases and has been described in chronic inflammatory diseases such as rheumatoid arthritis ( ra ) , where it may result in profound weight loss . these changes are linked to the effects of cytokines such as tnf- and interleukins and also the level of disease activity . in recent years , a growing number of biological agents have been introduced for the treatment of various diseases one of them is anti - tnf therapy which is approved for the treatment of many patients with inflammatory arthritis who fail to gain satisfactory disease control with conventional disease - modifying antirheumatic drugs ( dmards ) . in randomized clinical trials ( rcts ) all of these agents have been shown to be effective in reducing clinical signs of inflammation in ra , spondyloarthropathy . adverse effects of anti - tnf therapy include activation of infections and reactivation of latent tb . less critical adverse effects are weight gain which is rarely reported in small observational studies in ra and spondyloarthropathy [ 25 ] and hair loss ( alopecia areata or generalized alopecia ) which has been reported as case report mainly in psoriatic patients on anti - tnf therapy [ 6 , 7 ] . these effects may be of great concern to some patients , especially females , and despite the benefits of these therapies , the adverse effects may lead to discontinuation of anti - tnf therapy . we conducted this retrospective study in hamad medical corporation to find out the incidence of these adverse effects in our patients on anti - tnf , and how often a decision is taken to discontinue treatment because of these adverse effects . all patients on anti - tnf treatment for rheumatic diseases that are being followed in our rheumatology clinic in hamad medical corporation were interviewed by the authors . data collected included age , gender , name of the present , and previous anti - tnfs ; patients were asked whether they had gained weight ordeveloped hair loss while on anti - tnf and if a decision had been made to discontinue the anti - tnf therapy because of these adverse effects . hair loss as a side effect of biologics was considered if the patient developed it after starting the anti - tnf , the dose of methotrexate had not been increased during that period and there was no other reason to explain it . the patient 's file was reviewed to verify the documentation of the hair loss and if discontinuation of the anti - tnf was due to hair loss in the opinion of the physician . weight gain was considered as an adverse effect if it was reported by the patient and it was noticed by the patient after starting anti - tnf therapy and there was no other obvious reason for it . the files of patients with weight gain were reviewed to determine the timing and the degree of weight gain after starting anti - tnf therapy and if the weight gain had resulted in discontinuation of the anti - tnf . of 150 of patients on anti - tnf ( 82 ra , 34 ankylosing spondylitis , 32 psoriatic arthritis , and 4 for other indications ) , 20 ( 13.3% ) cases were reported weight gain in first year while on anti - tnf ( 18 females and two males ) . the range of weight gain was from 2.2 kg to 12 kg with an average weight gain of 5.5 kg . anti - tnf was discontinued in 5/20 ( 25% ) due to this adverse effects . two of the twenty patients developed weight gain on two consecutive anti - tnf infliximab and adalimumab . glucocorticoids were used in 6/20 of our patients in dose ( 510 mg of prednisolone ) and was started before anti - tnf . hair loss after using anti - tnf was reported in five female ( 4 spa , 1 ra ) patients ( 3.3% ) ; anti - tnf was stopped in all of them . a significant number of our patients on anti - tnf ( 13.3% ) developed weight gain with an average of 5.5 kg ( average bmi changes 4.7 ) and it led to discontinuation of anti - tnf in 25% of them , representing 3.3% of all the patients on anti - tnf therapy . though the incidence of hair loss was less than weight gain ( 3.3% ) all of the affected patients were females and the anti - tnf was discontinued in them due to this adverse effect . these drugs have been shown to be effective in reducing clinical signs of inflammation in ra , spa , and effective in reducing radiographic progression [ 810 ] and seem to be safe and well - tolerated drugs but with their increasing use and longer follow - up periods of treatment , a spectrum of adverse events including increased risk of infections , tb reactivation , and new immune - mediated diseases have been observed such as lupus - like syndrome , systemic lupus erythematosus ( sle ) , and interstitial lung disease . weight gain and hair loss have been reported as side effects of anti - tnf in several publications . investigated body composition in 20 patients with ra after 12 weeks of treatment with anti - tnf therapy but did not observe any change in weight or fat - free mass . however after 12 months it was shown that of 53 ra patients receiving anti - tnf therapy , 73% gained weight during the first 12 months of treatment ( mean , 4.17 ; range , 0.513 kg ) . a very recent study investigated the effects of infliximab on body composition in a randomized study with 25 patients , an increase in fat mass was observed in those patients randomized to infliximab after 21 months of treatment but not in those patients randomized to dmards alone . weight gain has also been observed in a number of chronic inflammatory conditions other than ra , which have been treated with anti - tnf therapy . in a study of 106 patients with ankylosing spondylitis ( as ) , a significant increase in weight was observed after 12 months of treatment with anti - tnf therapy ( 2.2 3.9 kg ) , which remained elevated at 24 months . hair loss ( alopecia areata ) has been reported in many cases [ 6 , 7 ] . ferran et al . from spain reported five cases of alopecia areata ( aa ) and reviewing the literature they found 11 cases of aa induced by anti - tnf- therapies . this data showed that weight gain and hair loss associated with anti - tnf therapy are not rare side effects and may result in discontinuation of anti - tnf .

objectives . to investigate the incidence of weight gain and hair loss as adverse effects of anti - tnf therapy in rheumatic diseases . methods . patients using anti - tnf therapy , who are followed in rheumatology clinic , were interviewed using a questionnaire to investigate the side effects of anti - tnf therapy . patients who complained of hair loss and weight gain were asked additional questions concerning the relationship of these adverse effects to anti - tnf use , whether therapy was stopped because of these adverse effects and if the adverse effects reversed after stopping therapy . the files were reviewed to follow the weight change before , during , and after discontinuation of anti - tnf . results . one hundred fifty consecutive patients ( 82 ra , 34 ankylosing spondylitis , 32 psoriatic arthritis , and 4 for other indications ) were interviewed .weight gain was observed in 20 patients ( 13.3% ) with average gain of 5.5 kg . anti - tnf was stopped in five patients because of this adverse effect . hair loss during anti - tnf therapy was reported in five females ( 3.3% ) and anti - tnf therapy was stopped in all of them . conclusion . weight gain and hair loss appear to be associated with anti - tnf therapy and may be one reason for discontinuing the therapy .

proteins with a macrocyclic backbone consisting of a continuous cycle of peptide bonds have been discovered over recent years in bacteria , plants and animals ( 1 ) . these macrocyclic proteins are different from small cyclic peptides , such as cyclosporin , in that they are gene - encoded products , with backbone cyclization occurring as a post - translational modification rather than being non - ribosomally synthesized ( 2 ) . currently , there are five major classes of naturally occurring cyclic proteins : the cyclic sex - pilin ( 3 ) and bacteriocins ( 46 ) from bacterial sources , the -defensins from primates ( 7 ) , trypsin inhibitors from asteraceae and cucurbitaceae family plants ( 810 ) and the cyclotides from plants of the violaceae and rubiaceae ( 1113 ) . the cyclotides are by far the largest family of circular proteins , with recent screening programs suggesting that the total number of sequences may be in the thousands ( 14,15 ) . interest in cyclic proteins has been inspired by the promising therapeutic advantages of cyclic proteins over their conventional linear counterparts ( 1619 ) . one of the major benefits of a circular backbone is improved stability ( 16,17 ) and at least one family of cyclic proteins , the cyclotides , has been shown to be highly resistant to enzymatic , thermal and chemical treatment ( 20,21 ) . this increased stability means that circular proteins are promising scaffolds for drug design applications ( 22,23 ) . the concept of backbone cyclization can be adopted to improve the bioavailability of linear proteins , thus increasing the therapeutic potential ( 2427 ) . furthermore , rigidification of the often - flexible termini through cyclization can lead to favourable entropy changes and improved receptor binding affinities ( 8,9 ) . cybase is a database of cyclic proteins that was initially developed to provide a uniform repository to handle the sequence / structure / function data for circular proteins ( 28 ) . cybase has now been completely redesigned to manage the continuing growth of circular protein data and to provide improved user - interactivity . a major feature of the new release is a new module to manage data on synthetic circular proteins , which was designed to assist in circular protein engineering . additionally , a range of analytical and predictive tools has been designed to handle the unique challenges of circular protein characterization and engineering . although cybase has been completely redesigned , several core features of the original cybase release , including the underlying database architecture and the general search and display capabilities , have been retained in the new version . information on sequence , structure and function is stored in a mysql database , where the central protein table , which contains information on each characterized cyclic protein , is linked to additional tables that described nucleic acid sequences , structures , activities and literature references . the data is accessed using a web - based interface , which provides a variety of text- or alignment - based searching methods . data entries are displayed using dynamically generated data cards , which describe the relevant information , including sequence , classification and cross - links to other entries in cybase or to external biological databases such as genbank , uniprot and pdb . in the original cybase release , the interface was adapted from a popular content management system for community websites written using the php language . in the new release , the interface has been substantially redesigned to increase user - interactivity and improve integration of data with tools . these improvements have been achieved using an additional data abstraction layer implemented in xml that also improves the extensibility and maintainability of the database . as of august 2007 , cybase includes 251 protein sequences , 49 nucleic acid sequences , 39 structures and 91 activity - related entries from five classes of circular proteins . the data content of cybase is now almost double the initial release , and the growth is expected to continue , with a recent study suggesting that in at least one family of circular proteins , the cyclotides , > 9000 sequences have yet to be characterized ( 14 ) . in addition , an increasing number of engineering studies are being applied to circular proteins . the new cybase release provides a new range of tools to aid in cyclic protein visualization , discovery and engineering . in terms of visualization , the tool accepts a multiple sequence alignment and generates a wheel - like diagram that is composed of an inner circle , which describes the consensus sequence from the given multiple sequence alignment , and the radial spikes from each position represent the different amino acids observed at that position , as shown in figure 1 . this representation is useful for evolutionary or mutational studies of circular proteins . for cyclotides and squash trypsin inhibitors , a collier de perles graphical representation ( 29 ) of the sequence / structure has been adapted from the knottin database ( 30 ) to handle the cyclic nature of cyclotides . this representation provides a link between protein sequences and their structures and is particularly useful for protein engineering , sequence structure analysis , visualization and comparisons of positions for mutations , polymorphisms and contact analysis ( 29 ) . for the visualization of structures , a tool based on jmol ( http://www.jmol.net ) has been added to the structure cards to allow a quick overview of each structure and to highlight crucial structural features such as the surface hydrophobicity . in combination with the activity entries in cybase , visualization of the structures panel ( a ) shows a diversity wheel representation of sequence diversity from a multiple sequence alignment , where the consensus sequence is positioned in the inner circle and the spike protruding from each position represents the amino acid variation observed at that position . panel ( b ) is a collier de perles representation of the prototypical cyclotide , kalata b1 , showing the sequence and disulphide connectivity . collier de perles representations can be generated for proteins belonging to the cyclotide or trypsin squash inhibitor classes . panel ( c ) shows a cyclic seqplot , which is a representation for noe data measured from an nmr experiment . backbone noes are drawn as dark bars , where the height of the bar is relative to the strength of the noe . 134 47 mm ( 600 600 dpi ) sequence graphical representations incorporated into cybase . panel ( a ) shows a diversity wheel representation of sequence diversity from a multiple sequence alignment , where the consensus sequence is positioned in the inner circle and the spike protruding from each position represents the amino acid variation observed at that position . panel ( b ) is a collier de perles representation of the prototypical cyclotide , kalata b1 , showing the sequence and disulphide connectivity . collier de perles representations can be generated for proteins belonging to the cyclotide or trypsin squash inhibitor classes . panel ( c ) shows a cyclic seqplot , which is a representation for noe data measured from an nmr experiment . backbone noes are drawn as dark bars , where the height of the bar is relative to the strength of the noe . 134 47 mm ( 600 600 dpi ) several tools have been added to cybase to facilitate cyclic protein discovery . characterization of cyclic proteins has benefited from approaches in molecular biology and mass spectrometry ( to determine sequence information ) and nmr ( to determine 3d structures ) . to assist in molecular screening for cyclic protein genes , the cybase primer match tool , which was developed from suggestions from users , can rapidly predict primer - binding sites given a list of primer sequences and a template sequence . seamless process , which means that the location of the n- and c - termini can not be determined from the mature peptide alone . mass spectrometry methods , which measure the mass of the mature peptide or enzyme - digested fragments , are commonly used for rapid protein sequence determination . existing computational tools , which form the core of protein sequence proteomics , do not consider the effect of cyclization on a protein of interest , which changes the mass of the mature protein , the pi of the protein and introduces additional fragments when the protein is digested . accordingly , the cybase digest peptide tool allows for the in silico enzyme digestion of cyclic peptides as well as the prediction of properties such as the absorption coefficient and the pi . fingerprint search tool gives the capability to search the entire database using masses of peptide fragments obtained from an enzymatic digestion of the reduced original peptide for rapid protein sequence identification . analysis of nmr data , such as chemical shift and noe patterns , can provide an early indication of the structure of a protein . chemical shifts and noe restraints are stored in cybase and can be presented visually for analysis and comparison . the alphaplot tool can easily generate chemical shift index plots , which are commonly used to identify secondary structure ( 31 ) . cyclic seqplot tool offers a new representation for short- and long - range noe patterns , which uses a circular template as shown in figure 1 , and can be used to quickly identify structural elements ( e.g. secondary structure ) . cybase provides tools to facilitate the engineering of cyclic proteins . to help identify potential targets for backbone cyclization , the cybase termini distance distributions page provides current statistics on n- to c - termini distances of proteins from the pdb . the distribution of distances from the pdb as of june 2007 is shown in figure 2 and indicates that a significant number of proteins have n- to c - termini distances below 20 , a distance that may only require linkers made of a few residues ( 32 ) . one based on an ellipsoid and the other on a random - walk algorithm have been described previously ( 33 ) . the current study is further useful because the proximity of the n- and c - termini of proteins has been implicated as an important factor in protein stability and folding ( 34 ) . predict linker tool predicts the size of a poly - alanine linker needed to connect the termini of a given protein . the algorithm models the cyclized structure using an increasingly longer closing linker while avoiding steric clashes by using the modeller program ( 35 ) . an example model of an artificially cyclized protein is shown in figure 2 . cyclization energy tool , which predicts the change in the unfolding free energy , gcycl , by backbone cyclization . the algorithm used for the energy prediction is based on the probability of a given linker length stretching a particular distance over the folded and unfolded states of the protein , and has been described in detail previously ( 36 ) . as circular proteins have been shown to be relatively stable , circular proteins present themselves as promising scaffolds for grafting applications . by following the cybase synthetic analogues tool , users can view summaries of grafted or modified peptides and identify which variants had been successfully folded and which variants had interesting activity . the collation of this information is potentially very useful for developing rules for future studies involving synthetic cyclic peptides . figure 2.cyclization tools incorporated into cybase . by scanning the distribution of n- to c - termini distances from the pdb as shown in panel ( a ) its relatively short n- to c - termini distance of 9.8 means that it is potentially more amenable to backbone cyclization compared to a protein with a longer termini distance . panel ( b ) shows a model of a cyclic mii using its native linear structure as a template ( pdb i d : 1mii ) ( 37 ) , which has been cyclized in silico using a seven - residue poly - alanine linker ( coloured in white ) . 83 136 mm ( 600 600 dpi ) cyclization tools incorporated into cybase . by scanning the distribution of n- to c - termini distances from the pdb as shown in panel ( a ) , the conotoxin mii was identified as a potential target for backbone cyclization . its relatively short n- to c - termini distance of 9.8 means that it is potentially more amenable to backbone cyclization compared to a protein with a longer termini distance . panel ( b ) shows a model of a cyclic mii using its native linear structure as a template ( pdb i d : 1mii ) ( 37 ) , which has been cyclized in silico using a seven - residue poly - alanine linker ( coloured in white ) cyclic proteins are interesting because they offer increased stability compared to conventional proteins and are promising drug scaffolds . cybase is a database dedicated to cyclic proteins that provides a standardized method for accessing information on proteic sequences , nucleic sequences , 3d structures and assay results . cybase also manages data on synthetic analogues of cyclic proteins to assist in drug development projects . since its initial release , cybase has grown in size and now provides a suite of tools that are useful for the visualization , analysis and characterization and engineering of cyclic proteins . these include a new diversity wheel representation , which is useful for analysing circular protein sequence variation , and a predict linker tool to help in the engineering of cyclic proteins from linear targets .

cybase was originally developed as a database for backbone - cyclized proteins , providing search and display capabilities for sequence , structure and function data . cyclic proteins are interesting because , compared to conventional proteins , they have increased stability and enhanced binding affinity and therefore can potentially be developed as protein drugs . the new cybase release features a redesigned interface and internal architecture to improve user - interactivity , collates double the amount of data compared to the initial release , and hosts a novel suite of tools that are useful for the visualization , characterization and engineering of cyclic proteins . these tools comprise sequence / structure 2d representations , a summary of grafting and mutation studies of synthetic analogues , a study of n- to c - terminal distances in known protein structures and a structural modelling tool to predict the best linker length to cyclize a protein . these updates are useful because they have the potential to help accelerate the discovery of naturally occurring cyclic proteins and the engineering of cyclic protein drugs . the new release of cybase is available at http://research1t.imb.uq.edu.au/cybase

the cumulative incidence of uti in children by 6 years of age is 3%7% in girls and 1%-2% in boys . this amounts to between 70 000 and 180 000 children in the united states developing uti annually . frequent urinary tract infections can result in chronic kidney disease and hypertension [ 2 , 3 ] . urinary malformation , urine stasis , and adherence of bacteria to the uroepithelial mucosa are the main predisposing factors for the development of uti . the pathogenesis of uti in detrusor sphincter dyssynergia syndrome is due to infrequent bladder emptying and stasis . most of the studies evaluating uti in children are observational , hence conclusions from such studies are limited . in males , it is more common during neonatal period and early infancy and it declines afterwards . usually associated with anatomical abnormalities and outlet obstruction . about 8% of girls ( 3% prepubertal ) , and 2% of boys ( 1% prepubertal ) experience at least one episode of uti up to the age of 7 . it occurs in 0.10.4% of infant girls and increase up to 1.4% during 15 years and 0.72.3% in school age . the incidence is greater in girls in this age group and is likely due to short urethra and translocation of fecal bacteria . close to 0.2% of circumcised and 0.7% of uncircumcised infant boys are at risk , which reaches to 0.1 - 0.2 during 15 years and 0.040.2 in school age . uti may lead to transient renal damage in 40% and permanent renal scarring in 5% of patients . a multicenter study in 2007 revealed that the cumulative risk of uti in children under age 6 years is 6.2% . in older children with urinary symptoms with or without fever , the prevalence of uti was 7.8% . asymptomatic bacteriuria occurs in 1% and 3% of infants and preschool age children , in about 1% of older children . other common gram negative organisms include kleibsiella , proteus , enterobacter , and occasionally pseudomonas . gram - positive pathogens include group b streptococcus and enterococcus in neonates and infants , and staphlococcus saprophyticus in adolescent girls . fungal infections are much less common and are usually to those who are immune - compromised or diabetic , are on long - term antibiotics , or have long - term indwelling catheter [ 5 , 15 ] signs and symptoms vary greatly by age of the patient becoming more specific as the child grows older . even in the absence of specific signs , a uti should be included in the differential diagnosis of high - grade fever . asymptomatic bacteriuria is present in about 3% of preschool age children , as mentioned in the previous section . in young infants , symptoms are usually nonspecific and may include lethargy , decreased feeding , increased sleep , vomiting , and decreased urinary output [ 16 , 17 ] . occult uti in neonates can be presented with late - onset jaundice especially if conjugated fraction is elevated too . in younger children , presence of upper respiratory infections , otitis media , or gastroenteritis does not eliminate the possibility of a uti [ 19 , 20 ] . in one study of febrile infants , those testing negative for rsv also had a positive urine culture 10.1% of the time , whereas those that tested positive for rsv had a positive urine culture 5.4% of the time . even the presence of varicella , herpangina , croup has been found to decrease the risk of uti by 2.6% [ 5 , 21 ] . in this age group , recurrent abdominal pain could be a symptom of recurrent uti and should be evaluated promptly . in older children , fever is usually the presenting symptom of uti . a fever of greater than 38c without a source has a positive likelihood ratio of 3.6 and with temperatures greater than 39c have a positive likelihood ratio of 4 . besides fever these may include dysuria , frequency , new onset incontinence flank pain , and fever . sometimes , however , younger children may have short periods of urgency not associated with uti . urine in the bladder is usually sterile ; thus any bacteria growing in should be considered an infection . he stated that urine cultures with fewer than 10 colony - forming units per ml were almost always contamination , those with between 10 and 10 colony - forming units per ml were suspicious and should be repeated , and those with more than 10 colony - forming units per ml were indicative of infection . unfortunately , oftentimes the culture will grow a bacterium that is obviously a contaminant , either from the skin or from other parts of the genital tract . thus , most investigators define a uti as the presence of single organism in the urine combined with signs or symptoms of uti in the patient [ 3 , 23 , 24 ] . the traditional cutoff for urine obtained by noninvasive collection methods ( bag or clean catch ) has been 10 cfu / ml . for suprapubic aspiration , 10 cfu / ml is regarded as the cut off [ 5 , 25 ] . some people have used 50,000 cfu / ml from catheterized sample [ 2628 ] . when there are multiple organisms , or low colony count , there is a higher chance of contamination . culture of the urine remains the gold standard for diagnosing utis [ 3 , 15 ] . the significance of bacterial growth from a urine sample depends largely on the method by which urine is obtained and the number of colonies harvested . the culture results from a bagged urine specimen have are only helpful if negative [ 30 , 31 ] . catheterization of the urethra is occasionally difficult in patients with phimosis or labial adhesions . also , the contamination chances although small are still higher than suprapubic aspiration . as children get older and become toilet trained , mid - stream clean catch sample of urine is commonly used [ 32 , 33 ] . the contamination rates are within limits if obtained the urethral area is cleansed with soap and water . with improper cleaning , the incidence of contamination increases by three folds . again , the value of this method is in ruling out rather than diagnosing uti . nitrites are generated from the breakdown of dietary nitrate by bacteria and leukocyte esterase is the breakdown product of white cells . le alone has a positive predictive value of about 35.8% meaning that it has a false - positive rate of about 64.7% . their absence does not rule out an infection as not all organisms produce nitrites ( e.g. , gram - positive and acinatobacter spp . ) . nitrites may not be of significance in infants and small children as the conversion requires 3 - 4 hours and these children urinate much more frequently [ 36 , 37 ] . multiple studies and a few meta - analyses [ 3638 ] found the cutoff of 5 wbc per hpf being used , the sensitivity being 74% and specificity being 86% . when the child appears sick , a cbc , crp , blood culture , and procalcitonin should be obtained to evaluate for sepsis . the first two do not have reliability in differentiating upper from lower urinary tract infection . bacteremia usually clears within 24 hours with appropriate antibiotics , regardless , or route [ 5 , 13 ] . procalcitonin , a proinflammatory marker , is newer and promising but further studies are needed [ 5 , 7 , 41 ] . in infants younger than 8 weeks , lumbar puncture is still recommended as there is lack of evidence to omit this step . all males and females with well - documented utis should be imaged for the presence of urological anomalies associated with uti . the extent of evaluation varies depending on the age of presentation with the first uti and severity of the episode . the younger the child , the higher the likelihood of anatomical abnormality , hence all children younger than 2 years . of age with well - documented uti should be evaluated with a renal ultrasound . beyond 8 yrs of age , it can also be helpful in detecting renal abscesses and stones . for infants younger than 6 months with first - time uti that responds to treatment , ultrasound should be carried out within 6 weeks of the uti . a normal ultrasound does rule out hydronephrosis which when present can suggest either vesicoureteral reflux or obstruction of the urinary tract . a dmsa is a nuclear scan that is often used either to diagnose pyelonephritis or permanent renal scars [ 9 , 45 ] . during an acute uti dmsa these lesions are either permanent ( scars ) or represent focal area of infection that eventually resolve . it should , however , be performed if renal ultrasound shows hydronephrosis or any other sign of vur . the radiation exposure can be reduced by performing a radionucleotide cytourethrogram but this study does not help detect anatomical abnormalities and only grades the reflux into mild moderate and severe . nuclear vcug is used in all females with uti and for followup of positive contrast vcug in females . the goal of the acute treatment is to decrease morbidity , and to prevent long - term renal damage . depending on patient 's clinical symptoms and tolerance , therapy can be oral or parenteral as they have both been found equally efficacious . if intravenous antibiotics are used , they can usually be changed to oral in 24 to 48 hours . parenteral administration of an antimicrobial agent also should be considered when adherence to oral regimen is uncertain . the usual antibiotic choices are cephalosporins , amoxicillin plus clavulanic acid , or trimethoprim sulfamethoxazole . dysfunctional voiding syndromes and constipation should be considered in young children and adolescents with uti . this later syndrome is associated with renal scars , hypertension , and chronic kidney disease . children should have ready access to clean toilets when required and should not be expected to delay voiding . we often start prophylactic antibiotics for at least 6 months or until proper voiding habits are regained . , the rule of vesicoureteric reflux in utis and the role of prophylactic antibiotics in preventing utis have been controversial . there have been a few trials in younger children that found no benefit of antibiotic prophylaxis [ 49 , 50 ] . if needed , the common antimicrobials used are trimethoprim sulfamethoxazole , trimethoprim , nitrofurantoin , and first generation cephalosporins in a one nightly dose . in children the time from first uti to resolution of vur is 6 - 7 yrs . comparison of medical and surgical treatment of vur is hard as different studies use various outcomes . hodson et al . reported decreased febrile utis as the only benefit of surgical management . surgical treatment for vesicoureteric reflux is reserved for patients with high grade and unilateral reflux , recurrent utis despite antibiotic prophylaxis , and noncompliance with antibiotics persistence beyond 9 yrs of age . endoscopic management involves subureteral or intraureteral injection of bulking agent with dextranomer / hyaluronic acid is suggested as first line treatment . infants and children with uncomplicated utis who do not undergo imaging investigations do not require follow up by a subspecialist . infants and children who have recurrent uti or abnormal imaging results should be assessed by a pediatric specialist . assessment of infants and children with renal parenchymal defects should include height , weight , blood pressure , and routine testing for proteinuria . infants and children with a minor , unilateral renal parenchymal defect do not need long - term followup unless they have recurrent uti or family history or lifestyle risk factors for hypertension . infants and children who have bilateral renal abnormalities , impaired kidney function , raised blood pressure , and/or proteinuria should receive monitoring and appropriate management by a pediatric nephrologist to slow the progression of chronic kidney disease . infants and children who are asymptomatic following an episode of uti should not routinely have their urine re - tested for infection . healthcare professionals should ensure that when a child or young person has been identified as having a suspected uti , they and their parents are given information about the need for treatment , the importance of completing any course of treatment and advice about prevention and possible long - term management . parents should be made aware of the possibility of a uti recurring and understand the need to be vigilant and to seek prompt treatment from a healthcare professional for any suspected reinfection . parents should be educated about healthy voiding and stooling habits as means of preventing utis . urinary tract infections are common in children . if recurrent or severe , they do have the potential to cause renal scarring . all younger infants with fever of unexplained origin should have their urine tested and older children with symptoms should also be evaluated for utis . the gold standard for testing for uti is suprapubic aspiration but a urinalysis and a urine culture ( catheterized / clean catch depending on age ) is acceptable . once diagnosed , prompt and appropriate antibiotic treatment can prevent long - term complications and scarring . all younger infants with uti and older children with complicated uti should get a renal ultrasound . this should be followed by vcug only if there is evidence of reflux on ultrasound . prophylactic antibiotics are reserved for recurrent utis and do not seem to benefit patients with low - grade vur .

urinary tract infections remain the most common bacterial infection in childhood . escherichia coli is responsible for over 80% of pediatric utis . other common gram negative organisms include kleibsiella , proteus , enterobacter and occasionally pseudomonas . signs and symptoms vary greatly by age of the patient becoming more specific as the child grows older . even in the absence of specific signs a uti should be included in the differential diagnosis of high grade fever . in younger children , presence of upper respiratory infections , otitis media or gastroenteritis does not eliminate the possibility of a uti . culture of the urine remains the gold standard for diagnosing utis . all males and females with well documented utis should be imaged for the presence of urological anomalies associated with uti . depending on patient 's clinical symptoms and tolerance , therapy can be oral or parenteral as they have both been found equally efficacious . healthcare professionals should ensure that when a child or young person has been identified as having a suspected uti , they and their parents are given information about the need for treatment , the importance of completing any course of treatment and advice about prevention and possible long - term management .

the pig was most likely one of the first animals to be domesticated over 9,000 years ago . pork is an important food source now representing forty - three percent of red meat consumed in the world 1 and is a valuable resource economically in many parts of the world . there are over 250 ' non - extinct ' breeds of swine 2 world wide , many which are pictured at http://www.ansi.okstate.edu/breeds/swine/ ) . for most of the commercial pork industry less than 10 of these breeds are actively used for pork production as either purebreds or in synthetic crosses . coordinated efforts to better understand the pig genome were initiated in the early 1990s with the development of the international pigmap gene mapping project as well as projects by the usda and us agricultural universities . there were two significant linkage maps published by the mid-1990s 3 , 4 of which the largest contained over 1,200 microsatellite markers . since that time , growth of the linkage map has slowed though new gene markers such as microsatellites , amplified fragment length polymorphism ( aflps ) , and single nucleotide polymorphisms ( snps ) have been continuously identified and mapped with limited integration of large linkage maps taking place . substantial pig bioinformatics efforts have been undertaken by the roslin institute , scotland ( www.thearkdb.org ) and in the us ( http://www.animalgenome.org ) supporting pig genome efforts as well as displaying the gene maps and other features of interest to pig genomics researchers . a review of factors affecting pork 's efficient production have been recently summarized 5 and include traits important for efficient production and traits that affect consumer preferences and pork consumption . briefly , the most important traits for pork production in the growing phase are lean growth , feed intake , and pig survival . arguably however , the two most economically important traits overall to pork production are reproductive traits and disease resistance . though consumers are most concerned about the degree of fatness or carcass merit as well as pork quality , pork producers must also pay attention to the ever - growing demand by consumers that the pigs be grown without the use of antibiotics as growth promoters and in facilities that are more welfare conscious . additionally , pork producers must do all of this while becoming more environmentally friendly by having pigs reduce feed wastage , improve feed efficiency , and produce waste that contains less contaminants . initially many qtl experiments were undertaken by using initial linkage maps to help determine regions underlying traits of importance to the pig industry . these early qtl scans used families developed by generally crossing european wild boar with a commercial breed or crossing the exotic chinese meishan breed with a commercial breed . the first such qtl that was discovered was a major locus for fat deposition on chromosome 4 6 . such scans generally used 300 to 700 pigs and usually produced in a f2 design . more recently researchers have used two commercial breeds for f2 families or large commercial synthetic lines or breeds for candidate gene studies and large scale snp association analyses . previous papers 7 , 8 have reviewed qtl results with an emphasis on each trait . however , given the level of database development such efforts seem redundant here . an extensive summary can be found at a new database called pigqtldb ( http://www.animalgenome.org/qtldb/pig.html ; figure 1 ) that combines all the published qtl information into one searchable database and allows the user to search by either , chromosome , trait , or key words from the publications 9 . for completeness as can be seen some traits have extensive numbers of qtl ( i.e. fatness ) while others ( i.e. health , disease resistance ) have had few being discovered . perhaps more interesting is the fact that only a limited number of these qtl have been further investigated to the point that a known causative mutation has been implicated or proven 5 . these include igf2 for muscling and cast for tenderness on chromosome 2 , and prkag3 for meat quality on chromosome 15 . for some qualitative traits like coat color or some single gene abnormalities scans have proved quite useful . interestingly , the first qtl found on chromosome 4 for fatness has yet to be identified . four genes ( esr , prlr , rbp4 , fshb ) identified to date have shown significant associations with litter size with effects ranging from 0.25 to over 1 pig per allele per gene copy with variations depending on breed background 8 . over 20 genes have been examined in multiple laboratories for growth and backfat traits with a causative mutation in mc4r being clearly identified affecting feed intake , growth and backfat 5 . extensively examined meat quality genes ( hal , rn ) have been reported and genetic markers identified within these genes now permit genetic testing and therefore have allowed producers to remove the alleles deleterious to meat quality . several candidate genes or gene regions ( k88 , fut1 , sla , nramp ) have been identified to be associated with differences in immune response or disease resistance with fut1 being currently used to reduce post weaning diarrhea in commercial pork production . recently , a polymorphism has been identified as showing an association with resistance to k88 e. coli 10 . a swine genome community effort produced a ' white paper ' that outlined the role pigs play in agriculture and as biological models for humans . efforts to sequence the pig genome have come from many fronts using multiple approaches 11 . sequences for the pig genome have been generated from ests of cdna clones from various tissues , the sequencing of candidate genes , and more recently large scale genomic sequencing efforts from the swine genome community . most recently , the efforts of the sino - danish generated ~3.84 million shotgun sequences of the pig genome resulting in a 0.66x coverage of the porcine genome translating to 48% of the pig genome being sequenced by this project 12 . for the past 3 years , collaboration has taken the form of an international swine genome sequencing committee , which is active in pushing the pig genome sequencing agenda . sequencing efforts are taking place at the sanger institute in the uk , through this international collaboration composed of many different laboratories . these efforts are also being directed at snp identification for future large scale association trials . private efforts by at least two commercial companies have also produced large snp maps for association studies within commercial company breeding lines and these snps are being actively used for genetic improvement . traditional qtl analyses in the pig have been generally limited to the usual traits affecting growth , carcass composition , reproduction and meat quality . a very limited number of qtl analyses have been devoted to health , disease susceptibility or immune response traits . given the importance of disease susceptibility to the overall pork production economic enterprise furthermore , while the approach to directly associate genomic regions with traits of interests has been effective in looking for useful markers for marker assisted selection to make genetic improvement , it should be realized that the composition of a trait is a complex process that involves physiological , biochemical , genetic , and often environmental factors . traditional qtl analyses , because of their usual requirements to easily and inexpensively measure traits might have limited our view of understanding the nature of how a trait has developed . systematic studies of factors that may contribute to the ultimate trait outcome may help to illustrate the underlying cause of a specific phenotype with better accuracy . for example , including ovulation rate , follicle stimulation hormone levels , uterine length and feed intake and environmental factors may likely add value to qtl analyses and functional evaluation of candidate mutations affecting litter size . a second advance for qtl analyses was the development of imprinting models to look for imprinted qtl in pigs . many of these imprinted qtl make good sense when compared to imprinted gene information from other species such as the mouse . further opportunity to understand the underlying genes to date such analyses have however been rare in most species and no large epistatic model in the pig has been considered . the development of expression arrays and the measurement of expression under different environmental conditions 14 have led to the opportunity of eqtl which measure and treat each observation for gene expression from an array or chip as a new trait . this creates the opportunity for tens of thousands of new traits and the possibility to discover underlying genes and mutations affecting certain traits . several eqtl experiments are underway but at this time none in the pig are fully published . one opportunity , apart from in silico approaches to combine qtl have been to do joint qtl analyses . these are complicated by a lack of similar markers and often by slightly different trait definitions and measurements . on the other hand , there are many repeated discoveries of some qtl , each with limited population size , slightly different testing methods and experimental designs . combining of the existing results will help to better utilize the resources and correct for possible experimental bias , and add power for detecting the emergence of new approaches will definitely improve multi - factorial and complex trait analysis for qtl 17 . the active development of the qtldb 18 has provided a powerful tool for qtl comparisons and alignment of related structural genomic information for positional qtl mining . however , in order to fully utilize the power of meta - analysis , it is necessary to emphasize that individual qtl experiments should be standardized in order for the ease of future such analysis . these may include but not limited to , standardized terminology and measurement methods for traits , well described experimental design , clear criteria to define a qtl , minimum required statistical parameters to find a qtl , and common reference maps to name a few . furthermore , the qtl identified in the porcine genome contributes to construction of concordant qtl maps in mammals . although the organization of mammalian genomes by chromosomal rearrangements has been ongoing since their divergence from a common ancestor approximately 60 110 million years ago , evidence has shown that most orthologous genes were retained within each genome 19 . therefore , the same orthologous gene may have conserved functions in biological or biochemical pathways , and thus explain the same or similar variations of the concordant qtl among different species . for example , wang and colleagues 20 - 21 reported that 93% of high density lipoprotein cholesterol qtl , 100% of low density lipoprotein cholesterol qtl , 80% of triglyceride qtl and 63% of atherosclerosis qtl were found to be concordant between human and mouse . as indicated in table 3 , more than 400 fat qtl have been identified in the pig genome . initial research examined some of these genes 22 in pigs and humans and now a more advanced pilot study by jiang et al . 23 has assigned pig , human , mouse and cattle fat qtl to the human ortholgous regions and has indicated that there are at least six putative concordant qtl regions for lipogenesis on human chromosomes 1 and 2 ( hsa1 and hsa2 ) , corresponding to pig chromosomes 4 , 6 , 9 , 10 , 14 and 3 , 15 , respectively ( figure 2 ) . on one hand , these data provide evidence that the pig is a unique model organism to study and validate obesity qtl and candidate genes in humans 22 , on the other hand , qtl information from other species may be used to accelerate the qtl discoveries in pigs . traditional traits with moderate heritabilities ( > 25% ) can be measured in qtl experiments with relative ease and with family or population sizes of 500 to 700 f2 individuals qtl effects of 3% or larger are usually detected . however , it is clear from the review of many experiments that for traits like reproduction and disease susceptibility with heritabilities of approximately 10% , such sample sizes are inadequate to find the effects desired . furthermore , researchers often dismiss discoveries from candidate gene analyses because they are not found in qtl studies . such conclusions are the result of faulty reasoning since qtl experiments are often much smaller and have less power than association or candidate gene studies . the bottom line however is that much larger experiments must be formulated to find small qtl effects . additionally , specialized families segregating for genetic abnormalities or special disease problems must be developed if the underlying mutations are to be found . collection of health and disease susceptibility phenotypes has been previously discussed . however , additional phenotypes of underlying traits might also yield interesting and useful information . for instance , for reproduction more attention could be paid to ovulation rate , hormone levels and other underlying factors . for growth and muscle composition levels of certain hormones and metabolites . such collection of more useful and descriptive traits would aid in qtl discovery and ultimately in discovering the underlying genes of real interest . qtl discovery in the pig has advanced rapidly but the ultimate goal of discovery of the underlying mutations affecting certain traits has been limited . funding remains a limiting factor as does the development and maintenance of specialized pig families and populations for certain traits and disorders . new methods and experiments , combined with the pig genome sequence , which is expected in the next year should aid in these efforts . ultimately qtl discovery will improve efficiency of pig production , cut costs , make it possible to have healthier products for consumers and make the pig a more useful biomedical model . front page of the pig qtldb ( http://www.animalgenome.org/qtldb/pig.html ) , showing database summaries and ways the database may be accessed . example of mammalian concordant lipogenesis qtl maps for human chromosomes 1 and 2 ( hsa1 and hsa2 ) as references according to number of obesity / fat qtl reported in pig ( purple ) , human ( green ) , mouse ( yellow ) , and cow ( orange ) . number of publications and qtl by years reported source : pigqtldb ( http://www.animalgenome.org/qtldb/ , 9 ) number of qtl by general trait classification source : pigqtldb ( http://www.animalgenome.org/qtldb/ , 9 ) number of qtl by pig trait types source : pigqtldb ( http://www.animalgenome.org/qtldb/ , 9 ) top 20 traits in terms of number of qtl reported . source : pigqtldb ( http://www.animalgenome.org/qtldb/ , 9 ) number of qtl by chromosomes source : pigqtldb ( http://www.animalgenome.org/qtldb/ , 9 )

over the past 15 years advances in the porcine genetic linkage map and discovery of useful candidate genes have led to valuable gene and trait information being discovered . early use of exotic breed crosses and now commercial breed crosses for quantitative trait loci ( qtl ) scans and candidate gene analyses have led to 110 publications which have identified 1,675 qtl . additionally , these studies continue to identify genes associated with economically important traits such as growth rate , leanness , feed intake , meat quality , litter size , and disease resistance . a well developed qtl database called pigqtldb is now as a valuable tool for summarizing and pinpointing in silico regions of interest to researchers . the commercial pig industry is actively incorporating these markers in marker - assisted selection along with traditional performance information to improve traits of economic performance . the long awaited sequencing efforts are also now beginning to provide sequence available for both comparative genomics and large scale single nucleotide polymorphism ( snp ) association studies . while these advances are all positive , development of useful new trait families and measurement of new or underlying traits still limits future discoveries . a review of these developments is presented .

repetitive effortless vomiting is termed as rumination syndrome and is common in infants and mentally retarded individuals . it is associated with considerable morbidity in children who frequently miss the school , have history of multiple hospitalizations , and also suffer significant psychiatric morbidity . unfortunately , before reaching a correct diagnosis , a number of patients undergo unnecessary invasive testing and surgical treatments . symptoms are often confused with that of gastric motility disorders and diagnosis is often delayed due to poor awareness regarding adult rumination syndrome among physicians . here we are presenting a case that posed diagnostic confusion as already mentioned and showed improvement soon after the correct diagnosis was made . the main factors that helped in remission of symptoms were supportive psychotherapy and the firm attitude of the physician . a 26-year - old lady presented with her husband and mother with the complaints of recurrent and intractable vomiting since past 2 years . the vomiting was regular , occurring throughout the day , and it used to increase after meals . for the past 6 months , she was not able to hold even the liquid diet to the extent that few sips of water were sufficient to induce vomiting . along with vomiting , she also complained of episodic loss of consciousness , which she used to regain after 1 - 2 h. these episodes of unconsciousness specifically occurred when she was under some stress . besides this , she was not having any other complaint , e.g. , abdomen pain , fullness in the stomach after having meals , diarrhea or constipation , or swallowing difficulties . her history did not suggest any cardiac problem , focal neurological deficits , or convulsions . at the time of presentation , she was pregnant ( second trimester ) with normal fetal growth . her family history was unremarkable except that she had strained relations with her parents - in - law . though her husband was very supportive but for almost 1 year she was staying at her mother 's house due to this illness . since the onset of illness she underwent extensive laboratory investigations including upper gastro - intestinal endoscopy , barium meal , and mri brain but any of the tests did not reveal any finding that could explain the symptoms . results of her liver and kidney function tests were within normal limits since the onset of illness . in the past , she was treated with a number of drugs including antidepressants , antipsychotics , promethazine , proton - pump inhibitors , and prokinetics for optimal periods without any relief . her husband also took her for a vacation when suggested by a physician , but it also did not improve the situation . looking at such a long history , multiple consultations , and extensive laboratory work - up , she was interviewed in the presence of her husband . then it became clear that her vomiting was effortless ; in other words , she used to stand in front of a wash basin and without putting any finger or anything else in the mouth , used to expel all the food ( liquid or solid ) that she had . the vomiting act was not associated with lacrimation , salivation , cramping of the abdomen , cessation of respiration followed by hyperventilation , and the gag sound that is otherwise common during true vomiting . it always took her about half an hour to expel the food . to make the information clearer , she was made to drink a glassful of water and her vomiting was observed which confirmed the information provided by her husband . her general physical examination showed pale conjunctiva but we did not find any signs of induced vomiting . however , she was not meeting all criteria for the major depressive disorder according to dsm - iv tr . looking at the concern of her family members and her pregnancy , she was hospitalized and reassured . when she did not improve even after 2 days , in view of her pregnancy , oral feeding from a naso - gastric tube was started . to our surprise , she improved within few hours and started taking liquids orally without vomiting them . she also insisted on the removal of the naso - gastric tube , but due to our concerns for the maintenance of feeding , it was kept for 2 days . she kept on taking liquid diet orally as well as through the tube and the symptoms did not recur . now her tube was removed and she was insisted to have solid food . for the next 2 days , she even had solid food without vomiting anything ; at this juncture , supportive psychotherapy was started . she was discharged after 3 days with the advice to attend regular supportive psychotherapy sessions . the diagnosis often poses a challenge to the physicians , especially when encountered in adults with normal intelligence and is often confused with gastroparesis and gastroesophageal reflux . in these adults , it is commonly associated with psychiatric morbidity in themselves or in their family members . one common psychiatric problem is personality disturbances with high scores on hypochondriasis and depression sub - scales . previous literature suggests that these patients often show multiple physician consultations and diagnosis is often delayed by years , and the food is usually expelled within few minutes of having it . could find manometric abnormality only in one - third of patients while levine et al . the present case , gastroscopy , barium meal and mr scan of head were done before presenting to us . however , none of them showed any abnormality . in view of the available literature and her pregnancy the treatment of adult rumination syndrome consists of reassurance , behavior therapy , psychotherapy , and relaxation therapies . these may improve a number of patients while others suffer persistence of symptoms.[36 ] nissen fundoplication has been reported to provide complete relief in the symptoms in one report . this patient was also shown to a number of physicians and was given all kinds of medical treatment including gastrokinetics , antacids , antidepressants , and benzodiazepines without any improvement . the relief was obtained with reassurance , supportive psychotherapy , and our firm attitude to take care of the patient 's health . in conclusion , adult rumination syndrome may be more prevalent than it appears and adequate knowledge of this syndrome among the physicians is necessary to reach to a diagnosis and early intervention . in addition , further studies are required to assess therapeutic benefits of various modalities in this entity .

rumination syndrome is known to exist in infants and mentally retarded adults since long time . in past few years , some reports appeared that showed its existence in adult patients also . it is frequently confused with the intractable vomiting in adults and misdiagnosis leads to delay in appropriate management . we are here describing the case of a female patient with rumination syndrome where specific points in the history delineated the presence of this illness and helped in appropriate management . the patient became symptom free soon after the diagnosis was reached .

percutaneous vertebroplasty ( pvp ) is now widely used for the treatment of many painful vertebral compression fractures , which are secondary to osteoporosis , multiple myeloma , metastatic tumors , and hemangioma ( 1 ) . severe complications are rare and most are related to the leakage of the bone cement into the spinal canal or the perivertebral venous system ( 1 ) . here we present an interesting case of cement leakage into the venous system during pvp , extending into the inferior vena cava ( ivc ) and then being trapped within a previously placed ivc filter . a 58-year - old female patient with a 1 year history of lung cancer was referred to our department for low back pain , left lower - limb swelling , cough and expectoration . her low back pain was getting aggravated and the pain could not be controlled by analgesics . computed tomography ( ct ) scan of spine revealed osteolytic metastatic lesion in the body of l4 without paravertebral space involvement . ultrasound examination revealed free thrombus in the left iliac - femoral vein . to prevent pulmonary embolism ( pe ) , a permanent ivc filter ( optease , cordis , roden , the netherlands ) was inserted in the ivc , before pvp was scheduled . the pvp procedure was performed under local anesthesia , by using a unilateral approach with a 13-gauge needle ( osteo - site , cook , bloomington , in , usa ) , and it was guided by a digital subtraction angiography ( dsa ) fluoroscopy . when the needle tip reached the one third of the anterior l4 vertebral body , intraosseous venography was performed , which showed a rapid venous filling ( fig . 1a ) : contrast material exited though the anterior external vertebral venous plexuses and emptied into the ivc . we repositioned the needle tip to avoid extravasation . the cement ( coriplast 3 , corin medical , gloucestershire , uk ) was prepared by mixing a 2 g of sterile barium sulfate powder ( made by our hospital ) for opacification , and was injected with a simple syringe during a paste - like viscosity . when the l4 vertebral body was nearly filled , fluoroscopy showed cement leaking into the ivc , and migrating to the filter ( fig . the injection of the cement was interrupted immediately ; a total of 5 ml bone cement had been injected . the low - molecular - weight heparin was given subcutaneously for 3 days after the pvp procedure , and was replaced by warfarin later . after the procedure of pvp , the low back pain of the patient was obviously released . she was discharged 10 days after pvp , and was followed - up at our outpatient department . there were no complications that occurred , which related to the filter , within the 8 months of follow - up . cement leakage is the most frequently reported complication of pvp . the rate of cement leakage , outside the vertebral body , is reported to be 73% , and the rate of venous leakage cases is up to 24% ( 2 ) . although most patients with minor leaks are without symptoms , some disastrous consequences have still been reported ( table 1 ) . inferior vena cava filter is a useful device to prevent pe in patients with deep - vein thrombosis . however , cases with foreign materials being trapped in the filter have not been reported frequently . to the best of our knowledge , there are only two cases of cement getting trapped in filters after pvp or kyphoplasty , reported in the previous literature ( 11 , 12 ) . in herbstreit 's report ( 11 ) , the follow - up ct scan on several days after pvp showed cement reaching the ivc and rendering the filter unremovable in the usual fashion . in agko 's report ( 12 ) , abdominal x - rays at eight weeks follow - up showed that the cement fragment embolized the caval filter . in our report , dsa fluoroscopy observed the whole process that cement migrating into the ivc and being captured in the filter . it is the direct evidence that filter can capture bone cement and prevent it from migrating to the pulmonary circulation . in herbstreit 's report ( 11 ) , removal of the cemented filter via endovascular technology was impossible and the patient underwent cavotomy and surgical extraction of the filter . in our report , due to the history of malignancy , there was no evidence of ivc syndrome , ivc perforation , or pe presented in the procedure and follow - up . surgical attempt at the retrieval of the fiter may pose a prohibitive risk in our case . as such , we decided to administer an anticoagulant treatment , and ask the patient to follow up at the outpatient department . the patient 's left lower - limb swelling subsided 1 week later and there were no complications related to the filter at the 8 months follow - up . some authors emphasized that venography does not preclude the cement leakage exactly because of the difference of viscosity between the contrast material and bone cement . some reports demonstrated no significant differences in the frequency or amount of cement leakage and no differences in the clinical outcome between venography and no venography ( 13 , 14 ) . however , some authors advocated using an antecedent venography to confirm the needle position in the trabecular space , to outline the venous outflow pattern , and to show where to look for the cement migration . we conformed to the latter perspective ( 15 ) . in this case , the direction of cement migration was coincident with the venous blood flow , detected by a venography , which indicated that intraosseous venography predicted the direction of venous cement leakage effectively . according to our experience , cement leakage happened more often in patients with draining veins , which appeared ahead of time on a venography ( 15 ) . in this case , the antecedent venography showed rapid venous filling , which reminded us to prevent cement leakage . bhatia recommended a routine pre - injection of the gelatin clotting agent to reduce the cement leakage during pvp ( 16 ) . in our opinion , this method is more suitable to the vertebrae with rapid venous flow , such as the status of this patient . if this method was used in this patient , venous leakage would have been avoided . in summary , this interesting case illustrates that ivc filter could capture bone cement and prevent it from migrating to the pulmonary circulation . vertebral body venography could predict the direction of the bone cement leakage to the veins , effectively .

a 58-year - old female patient , diagnosed with adenocarcinoma of the lung , underwent percutaneous vertebroplasty at the l4 vertebral body due to painful spinal metastases . because of deep venous thrombosis of the left femoral and iliac veins , an inferior vena cava filter had been placed before vertebroplasty . bone cement migrated into the venous bloodstream and then was being trapped within the previously placed filter . this case illustrates that caval filter could capture the bone cement and prevent it from migrating to the pulmonary circulation .

the absence of heart sounds on auscultation at the pre - cordial area , confusion during the diagnosis of acute cholecystitis , acute appendicitis and splenetic lesion on the basis of clinical examination raises the suspicion of one rare condition , the situs inversus totalis . this rare condition is characterized by total transposition of thoracic and abdominal viscera , and the predicted incidence is one in 10,000 among the general population.[14 ] during the embryological development , a 270 degree clockwise rotation instead of normal 270 degree anti - clockwise of the developing thoraco - abdominal organs results in mirror image positioning of the abdominal and thoracic viscera . the association of situs inversus totalis with syndromes such as kartagener 's syndrome , cardiac anomalies , spleen malformations and other such clinical entities makes the clinical scenario extremely challenging for the concerned anaesthesiologist . this rare condition is well described by a few surgical and medical journals , but the anaesthetic implications and considerations have not been thoroughly explained by any anaesthesia speciality journal . we are reporting a case of situs inversus totalis who was operated for symptomatic cholelithiasis , with an aim of thorough discussion of the anaesthetic considerations and implications associated with such anatomical abnormalities . a 55-year - old female patient presented to surgical out - patient department ( opd ) with chief complaints of pain and left hypochondrium for the last 3 days accompanied by nausea and vomiting . she presented a big dilemma to the attending surgeon as all the clinical signs and symptoms pointed towards symptomatic cholelithiasis , but the pain in the left hypochondrium totally contradicted the diagnosis . it was only with the help of radiological investigation reports that we were able to confirm it as a case of situs inversus totalis . her chest x - ray typically depicted dextrocardia and spiral computed tomography ( ct ) scan showed transposition of all major abdominal organs . echocardiography was carried out and revealed normal cardiac parameters with an ejection fraction of 60% . pre - anaesthetic evaluation revealed mallampatti class ii patient with a slight retrognathia , a pulse rate of 74/min , blood pressure of 130/78 mmhg and normal profile of laboratory investigations . she had a history of intermittent respiratory tract infections , especially during the winter season . at present , the patient had no systemic complaint pertaining to any organ system except for the gall bladder disease . a decision to operate the patient tablet ranitidine 150 mg and tablet alprazolam 0.25 mg were administered as premedication a night before and 1 h prior to the surgical procedure with a sip of water . in the operation theatre , a good intravenous induction of anaesthesia was achieved with o2 , isoflurane , propofol 120 mg , butorphanol 1 mg and succinylcholine 100 mg . during induction , we encountered masseter spasm immediately after the administration of succinylcholine , which lasted for approximately 45 s , and disappeared spontaneously , but we were able to ventilate the patient with bag and mask during this episode . intubation was extremely difficult as the larynx was placed quite anteriorly and the laryngoscopic view could be best labelled as cormack lehane grade - iii . maintenance of anaesthesia was carried out with injection vecuronium and low concentration of isoflurane in oxygen and nitrous oxide mixture . the peri - operative period was characterized by frequent copious secretions from the respiratory tract that had to be cleared regularly for smooth ventilation . the surgical procedure was smooth and uneventful , and lasted for about 1 h. at the end of surgery , inj . neostigmine and glycopyrrolate were administered but extubation was delayed as the patient developed prolonged post - operative apnoea . therefore , extubation was performed only after establishing the return of all protective airway reflexes and establishment of regular breathing pattern . the recovery period and hospital stay were uneventful and the patient was discharged in a satisfactory condition on the eighth post - operative day and was called for follow - up after 2 weeks . situs inversus totalis is a rare condition , the etiologic factors for which are still not completely understood . there is no established gender or racial difference in its incidence , but genetic predisposition and familial occurrence point towards multiple inheritance patterns . the symptomatic pain of cholelithiasis in these anomalies presents in the left hypochondrium and may mimic other acute abdomen presentations such as hiatus hernia , pancreatitis , duodenal perforation , etc . the scenario of clinical diagnostic dilemma was similar in our patient also , for which we had to take assistance of the radiology department . the most preferred diagnostic technique involves chest and abdominal skiagrams as well as ct scans . the diagnostic parameters of simple skiagrams include the presence of dextrocardia , stomach bubble under the right dome of diaphragm , liver shadow on the left side and the findings of barium meal.[79 ] there was prolonged post - operative apnoea period in our patient . it was only after 30 min of administration of reversal agents that the patient developed a regular breathing pattern with the return of protective airway reflexes that we were able to successfully extubate the patient . our institute does not have the facilities of diagnosing the atypical cholinesterase levels , and this was a limiting factor in this presentation . hence , we recommended the patient to get these investigations done from the top - most research centre and to bring the requisite reports during the follow - up visits . a case of prolonged paralysis after administration of succinylcholine has been reported earlier also in a patient with situs inversus totalis . the challenging aspects for anaesthesiologists in successful management of patients with situs inversus totalis should be thoroughly evaluated , such as : the association of situs inversus with other syndromes and diseases such as kartagener 's syndrome , mucociliary dysfunction , airway anomalies , etc . , which may predispose the patient to numerous varieties of airway difficulties and pulmonary infections that can have considerable implications during induction of anaesthesia and intubation . we encountered masseter spasm immediately after administration of succinylcholine , which was relieved spontaneously in less than 1 min , and there is no evidence in the literature where masseter spasm developed after injection of depolarizing neuromuscular blockers in patients with situs inversus totalis.the syndrome is associated with numerous cardiac anomalies such as atrial septal defects , ventricular septal defects , transposition of great vessels , absent coronary sinus , double - outlet right ventricle , total pulmonary anomalous venous defect and pulmonary valve stenosis either singly or in combination.the spinal deformities like split cord , spina bifida , meningomyelocele , scoliosis , etc . have been described in the literature , and one has to evaluate the patient carefully if any surgery is planned under neuraxial anaesthesia.the ecg electrodes have to be applied in the opposite direction as the changed surface electric polarity may give a false picture of peri - operative ischaemia.in case of cardiothoracic surgery , lung separation throws a challenging task due to transposition of thoracic viscera . insertion of a double - lumen tube will pose a multitude of challenges , and the successful intubation and separation of lungs can not be accomplished without the aid of fibreoptic bronchoscope . the transposition of the thoracic viscera also alters the various anatomical landmarks , and one has to be well acquainted with ultrasound - guided procedures if in case a need arises for invasive central venous cannulation and brachial plexus blockade.situs inversus in kartagener 's syndrome is invariably associated with mucociliary dysfunction . primary ciliary dyskinesia is present in 25% of the patients with situs inversus totalis with an increased probability of developing respiratory complications . there were plenty of mucoserous secretions during the peri - operative period , even though our patient had no active respiratory tract infection . we administered injection hydrocortisone 100 mg , anticipating bronchospasm due to any subclinical infective pathology . the role of bronchodilators , chest physiotherapy , postural drainage , antibiotics and incentive spirometry can not be underestimated and is mandatory in optimizing the pulmonary status before any surgical procedure.in case of cardiac arrhythmias and cardiac arrest , great care has to be taken while applying direct current with defibrillator pads on the right side . a successful resuscitation of such patients requires a thorough knowledge and skills on the part of the attending anaesthesiologist and intensivists . the association of situs inversus with other syndromes and diseases such as kartagener 's syndrome , mucociliary dysfunction , airway anomalies , etc . , which may predispose the patient to numerous varieties of airway difficulties and pulmonary infections that can have considerable implications during induction of anaesthesia and intubation . we encountered masseter spasm immediately after administration of succinylcholine , which was relieved spontaneously in less than 1 min , and there is no evidence in the literature where masseter spasm developed after injection of depolarizing neuromuscular blockers in patients with situs inversus totalis . the syndrome is associated with numerous cardiac anomalies such as atrial septal defects , ventricular septal defects , transposition of great vessels , absent coronary sinus , double - outlet right ventricle , total pulmonary anomalous venous defect and pulmonary valve stenosis either singly or in combination . the spinal deformities like split cord , spina bifida , meningomyelocele , scoliosis , etc . have been described in the literature , and one has to evaluate the patient carefully if any surgery is planned under neuraxial anaesthesia . the ecg electrodes have to be applied in the opposite direction as the changed surface electric polarity may give a false picture of peri - operative ischaemia . in case of cardiothoracic surgery insertion of a double - lumen tube will pose a multitude of challenges , and the successful intubation and separation of lungs can not be accomplished without the aid of fibreoptic bronchoscope . the transposition of the thoracic viscera also alters the various anatomical landmarks , and one has to be well acquainted with ultrasound - guided procedures if in case a need arises for invasive central venous cannulation and brachial plexus blockade . primary ciliary dyskinesia is present in 25% of the patients with situs inversus totalis with an increased probability of developing respiratory complications . there were plenty of mucoserous secretions during the peri - operative period , even though our patient had no active respiratory tract infection . we administered injection hydrocortisone 100 mg , anticipating bronchospasm due to any subclinical infective pathology . the role of bronchodilators , chest physiotherapy , postural drainage , antibiotics and incentive spirometry can not be underestimated and is mandatory in optimizing the pulmonary status before any surgical procedure . in case of cardiac arrhythmias and cardiac arrest , great care has to be taken while applying direct current with defibrillator pads on the right side . a successful resuscitation of such patients requires a thorough knowledge and skills on the part of the attending anaesthesiologist and intensivists . from the mentioned implications and considerations in a case of situs inversus totalis , it can be safely established that regional anaesthesia is the preferred choice for any infra - umbilical surgery as compared with administration of general anaesthesia , provided that there is no spinal anomaly or dysraphism . the precise diagnosis of situs inversus and a thorough pre - operative evaluation can minimize , to a large extent , the difficulties and the various potential challenges associated with its anaesthetic management . keeping in mind all these considerations and implications , it becomes easier and safer to successfully manage the patients of situs inversus totalis in the operation theatre and intensive care units .

situs inversus totalis is a rare condition with a predicted incidence of one in 10,000 among the general population , the aetiologic factors for which are still not completely understood . in a patient with situs inversus totalis , not just the diagnosis of any acute abdomen pathology is difficult due to distorted anatomy and transposition of thoraco abdominal viscera but equally challenging is the anaesthetic management during the respective surgical procedure . we are reporting a patient who had situs inversus totalis and was operated for open cholecystectomy . the present case report lays an emphasis on the potential difficulties during anaesthetic management and its various implications .

risperidone , quetiapine , and aripiprazole have been associated with tardive dystonia among other side effects . similarly , olanzapine has also been associated with this troublesome effect . however , these reports are from cases of nonaffective psychosis , especially schizophrenia . moreover , the usual age of onset of this neurological side effect has been reported to be in the midthirties or later . we present here a case of tardive dystonia associated with the use of olanzapine in an adolescent girl suffering from bipolar affective disorder . a a sixteen year - old girl , presented to our outpatient department with the complaints of discomfort in the neck and lower back as well as restriction of body movements . she was not able to maintain an erect posture and would tend to fall on either side while standing up from a sitting position . she would keep her head turned to the right and upwards due to the sustained contraction of the neck muscles . there was a sideways bending of the back in the lumbar region . to counter the abnormal positioning of the back and neck , she would keep her limbs in a specific position to allow her body weight to be supported . due to the restrictions with the body movements at the neck and in the lumbar region she would require her parents to help her with daily chores , including all activities of self - care . she had been experiencing these difficulties for the past four months since when she was introduced to olanzapine tablets for the control of her exacerbated mental illness . this was not her first experience with this drug over the past seven years since she had been diagnosed with bipolar affective disorder . her first episode of the affective disorder was that of mania at the age of eleven which was managed with the use of olanzapine tablets in 2.510 mg doses per day at different times . the patient developed pain and discomfort in her neck within the second week of being put on tablet olanzapine at a dose of 5 mg per day . this was associated with a sustained and abnormal contraction of the neck muscles that would pull her head to the right in an upward direction . these features had persisted for the first three years of her illness with a varying intensity , distress , and dysfunction which would tend to correlate with the dose of olanzapine . apart from a brief period of around three weeks when she was given tablet trihexyphenidyl 4 mg per day for rigidity in her upper limbs , she was not prescribed any other psychotropic medication . the introduction and subsequent withdrawal of this medication did not bring about any change in the sustained abnormal contraction of her neck muscles . improvement and subsequent remission of the mood symptoms of the patient provided the treatment team with an opportunity to stop olanzapine . the discomfort in the neck and the abnormal movement of the neck muscles persisted over the next three months period when she was off olanzapine without any significant change , even with a trial of propranolol , trihexyphenidyl , and phenargan injection . reintroduction of olanzapine ( at a dose of 2.5 mg per day ) after a gap of three months for the reemergence of some behavioral features led to a slight aggravation of the already existing abnormal movement and posturing of the neck . with improvement in the clinical picture , olanzapine was reduced and stopped . she was put on tablet sodium valproate , 1000 mg per day during this period for the stabilization of her mood when she was also given escitalopram for a period of three months for her depressive features . the patient responded well to this change in medication , but she developed amenorrhea for which no cause was established after a detailed gynecological evaluation . keeping in mind the possibility of valproate - induced menstrual disturbance , she was shifted to tablet lithium 450 mg per day . the patient was well maintained on this medication for a period of around two years . however , she developed hypothyroidism for which eltroxin was introduced at a dose of 50 micrograms per day . during this period of two years and seven months , the abnormal contraction of the neck muscles and the abnormal positioning of the head improved slightly , and with the improvement , it would cause less discomfort and interference in her activities . however , these movements failed to disappear completely . another exacerbation of the mood symptoms in the form of mania warranted a need for the introduction of olanzapine ( by a different treatment team ) and the patient was reintroduced to 10 mg olanzapine on a daily basis , which led to the current presentation as described earlier . after the case was seen at our institute , the psychotropic medications were stopped as her mood symptoms had remitted and she was put on tablet tetrabenazine ( built up to 75 mg per day in divided doses ) with which the patient had started showing some response with an improvement in abnormal movements of the muscles of the neck as well as the back . she is now able to stand with support and can do some daily chores on her own . the pain and discomfort in the back and neck have also reduced . during the course of the illness , the patient has been investigated for the presence of any neurological illness as the cause of her abnormal movements . her mri scan of the brain , serum and urine copper levels , slit lamp microscopy for the kf ring , complete blood count , tlc , dlc , and usg of the abdomen did not reveal any abnormalities . her thyroid function tests were deranged subsequent to the introduction of tablet lithium carbonate which was restored to normal after the introduction of tablet eltroxin . dystonia is a syndrome of sustained muscle contractions that produce twisting and repetitive movements or abnormal postures . the descriptions of the extent and severity of muscle involvement are variable , ranging from intermittent contraction limited to a single body region , to generalized dystonia involving the limbs and axial muscles . ever since the introduction of the term , dystonia by oppenhiem in the early part of the twentieth century , it has been an area of focused attention of the neurologists . in 1973 , keegan and rajput introduced the term , dystonia tarda to describe drug - induced , sustained muscle spasm causing repetitive movements or abnormal postures . tardive dystonia was a term introduced by burke in 1982 , the description of which required the presence of chronic dystonia , a history of antipsychotic drug treatment preceding or concurrent with the onset of dystonia , the exclusion of known causes of secondary dystonia by appropriate clinical and laboratory evaluation , and a negative family history of dystonia for definitive diagnosis . involvement of isolated regions like the face , neck , and arms would be labeled as focal dystonia , whereas simultaneous involvement of two or more contiguous areas would be called segmental dystonia . when the clinical picture is that of involvement of two or more noncontiguous regions , the label used is , multifocal and the involvement of one leg and one other body region makes it the generalized type . the symptoms of tardive dystonia could begin even after a few days or weeks of exposure to the offending agent . tardive dystonia is prevalent in 0.521.6% of the patients who are treated with neuroleptics . the syndrome of tardive dystonia has been reported with most of the typical antipsychotics . it has been associated with the atypical antipsychotics , namely risperidone , olanzapine , quetiapine , and aripiprazole . reports of tardive dystonia developing with the use of atypical antipsychotics have been predominantly in the cases of nonaffective psychosis and in the adult population in the age ranges of the midthirties and forties . our case is the first case of an affective illness in an adolescent girl developing tardive dystonia on olanzapine . the aggravation of the clinical features with the inadvertent reintroduction of the medication suggests olanzapine is the offending agent . with the growing acceptance of olanzapine as the first - line therapy for the manic phase of bipolar illness and as a mood stabilizer for the maintenance therapy , one needs to be cautious about the emergence of this troublesome adverse effect of this therapy .

atypical antipsychotics are increasingly being associated with neurological side effects . risperidone , quetiapine , and aripiprazole have been associated with tardive dystonia among other side effects . similarly , olanzapine has also been associated with this troublesome effect . however , these reports are from cases of nonaffective psychosis , specially schizophrenia . moreover , the usual age of onset of this neurological side effect has been reported to be in the midthirties or later . we present here a case of tardive dystonia associated with the use of olanzapine in an adolescent girl suffering from bipolar affective disorder . the slight reduction in the severity of the symptoms with the stopping of olanzapine and the reemergence of the full - blown symptoms with the reintroduction of olanzapine , suggest the contributory role of olanzapine .

hyaluronic acid ( ha ) is a polysaccharide containing alternating units of glucuronic acid and glucosamine . apart from the cellular and molecular functions , ha protects local tissues and cells against compression . ha , because of its high swelling property and viscous nature , restricts the movement of molecules including pharmacological agents across the tissues . approved label use of hyaluronidase includes treatment of extravasation injury , for hypodermoclysis and urography . of late , hyaluronidase is tested for management of secondary complications associated with plastic surgery and as an adjunct in improving the efficacy of pharmacological agents . use of hyaluronidase as an adjuvant therapy for improving the pharmacokinetic properties of coadministered drug is of particular interest as many of the regulatory bodies including us fda have approved its use in humans . the potential use of hyaluronidase as an adjunct could be exploited if a suitable carrier based delivery system for hyaluronidase is developed . this would allow coadministration of a second drug by directly incorporating them in the same delivery system and administering both drugs as a single dosage form . few studies demonstrated that the efficacy of anticancer drug and local anesthetics [ 4 , 7 ] could be improved by pretreating the target site with hyaluronidase . understanding the effect of variables on the outcome is important for developing a product with all the predetermined requirements . this will also ensure that such products do not show any batch to batch variation . the effect of process variables can be studied either by checking the effect of one independent variable on the dependent variable at a given time or by using statistical tools , namely , experimental design . in experimental design , all the independent variables are varied together such that the effect of their interaction on the dependent variable is also analyzed . the recent regulatory requirement suggests that quality by design approach should be adopted to build this can be achieved by defining and analyzing the effect of variables on the outcome using experimental design . the product developed using these statistical tools shows more consistency in terms of quality and reproducibility . experimental design using statistical tools such as factorial design and response surface methodology allows the researchers to rapidly study and optimize the conditions to achieve products with the best possible quality and attributes using the limited available resources and without losing any essential information that may affect the outcome [ 10 , 14 ] . liposomal delivery of proteins is one of the widely explored methods for delivery of proteins . in the present study , the effect of process variables on size , percentage drug encapsulation , and zeta potential was studied using factorial design and ccd . cholesterol ( extra pure ) and chloroform ( hplc grade ) were purchased from srl pvt . lipids ( table 1 gives the amount of phosphatidylcholine ( pc ) added during the experiment ) were dissolved in 20 ml of chloroform taken in a 250 ml capacity round bottom flask . the flask was rotated continuously ( rpm as per the table 1 ) as the solvent was removed by evaporation under vacuum at temperature ( t1 ) indicated in table 1 ( buchi rotavapor r-215 ) and the lipids were allowed to deposit as a thin film within the flask . the lipid layer was hydrated with phosphate buffer saline ( 10 ml ) ( ph 7.4 ) containing hyaluronidase ( protein content equivalent to 0.5 mg ) in an orbital shaker ( remi laboratory instruments , india , model - cis-24 bl ) at 150 rpm , 28c for overnight . liposomes formed after overnight hydration were sonicated at 60% amplitude control ( probe sonicator , sonics and materials inc . the liposomes were then transferred into polypropylene tubes and centrifuged at 450 g for 3 min to remove the coarse particles . the supernatant was then centrifuged at 34,600 g for 60 min ( sigma laborzentrifugen 3k30 , germany ) to collect the nanoparticles . the pellet obtained was used for calculating the particle size and percentage drug encapsulation . for size measurement pellet was dispersed in ultrapure water ( milli - q , millipore ) and analyzed using photon correlation spectroscopy ( malvern zetasizer ) . nanoliposomes were made to release entrapped protein by treating them with 1% triton x-100 and the amount of protein was estimated using lowry method . the amount of protein was calculated by comparing the absorbance ( biospec-1601 , shimadzu , japan ) with the standard curve plotted using bovine serum albumin . the effect of variables involved in preparation of hyaluronidase loaded nanoliposomes was studied in two stages . first the effect of pc , cholesterol , temperature during film formation ( solvent evaporation ) ( t1 ) , and speed of rotation of the flask ( rpm ) during film formation ( spr ) on percentage drug ( hyaluronidase ) encapsulation was analyzed using fractional factorial design . the design had eight runs with zero centre points and single base for the selected four factors . the effect of interaction of two variables showing the maximum effect on protein encapsulation was further studied for the effect on protein encapsulation , size , and zeta potential using ccd . the level of other variables was fixed based on the results of fractional factorial deign . factorial studies showed that the outcome , that is , percentage of protein encapsulated , was significantly affected by the amount of pc present in the system . one - way anova showed that the effect of pc on percentage of drug encapsulation was highly significant with a p value less than 0.003 . more than three - fourth of the outcome was contingent on the level of pc . the amount of the protein that could be entrapped in a liposome depends on the size of the protein and the amount of free aqueous phase within the vesicle . the portion of the aqueous phase interacting with lipid layer will be unavailable for the protein to occupy . in the present study , the other independent variables did not have any significant effect on the outcome ( p value > 0.05 ) . although cholesterol as an independent variable did not have significant effect on the outcome , two - way anova showed that the interaction of pc with cholesterol has significant influence on the outcome . this is due to the steric stability that cholesterol provides by controlling the lipid layer fluidity . inclusion of cholesterol is mandatory particularly in case of hydrophilic drugs as cholesterol reduces the leakage of the entrapped drug besides improving the stability of liposomes [ 19 , 20 ] . interaction among the other independent variables did not have significant effect on the outcome ( table 1 ) . the outcome had very high dependence on the level of pc to an extent that the outcome was not affected by the level of other independent variables , namely , t1 and spr . however , when the level of pc and cholesterol was maintained at their lowest levels , a higher amount of protein could be encapsulated if the spr and t1 are maintained at a lower level ( figures 1(a ) and 1(b ) ) . when the level of lipids was high , the outcome , despite showing small dependence on t1 , was unaffected by the spr however , the true effect of t1 was dependent on their interaction with spr ( figures 1(c ) and 1(d ) ) . while p value of temperature and rpm were 0.933 and 0.886 , their interaction had p value 0.536 . this shows that , although individual effect of t1 and spr and their interaction on outcome is insignificant , the effect of each other on the outcome depends on the level of interaction between them . the effect of two - way interaction of the independent variables on percentage drug encapsulation is given in figures 2(a ) and 2(b ) . ccd study showed that pc had significant effect ( p value < 0.05 ) on all the dependent variables , namely , percentage of protein encapsulation , particle size , and zeta potential ( table 2 ) . however , the spr had significant influence only on size and the other two dependent variables were not affected much by the spr . the interaction between pc and spr also had significant effect on size ( table 2 ) . although both the independent variables ( pc and spr ) could affect the outcome , spr is a physical parameter whose effect is always going to depend on the level of pc . as the solvent is allowed to evaporate under vacuum , the lipids will be deposited as a film within the flask . however , the distribution of the film will be affected by the spr . as a result , the size of liposomes will be affected when the lipid layer is hydrated since a uniform and thin film will help in producing uniform small sized particles . however , entrapment was mainly dependent on the amount of pc . in w / o liposomes the amount of protein affected will depend on the amount of aqueous layer . although aqueous phase will be sterically affected by the amount of lipid present in the lipid layer , an optimum level of pc ( with cholesterol ) is required to obtain stable liposomes without drug leakage . the percentage of protein encapsulated in all the trials during ccd was between 8 and 10% ( table 2 ) . the levels of the independent variables were decided based on the outcome of factorial design ( table 1 and figure 1 ) . surface plot ( figure 3(a ) ) showed that percentage of protein encapsulated could be improved by maintaining the level of pc at its lowest level and spr either at lowest or highest level . however , particle size of less than 500 nm would be obtained only when the amount of pc is between 120 and 140 with spr less than 150 rpm ( figure 3(b ) ) . at these conditions , the effect of both the independent variables ( pc and speed spr ) on all three dependent variables could be clearly observed from overlaid contour ( figure 4 ) . overlaid contour plot shows that a percentage protein encapsulation of above 8% could be obtained if the level pc is maintained above 100 mg and spr below 150 rpm . the study on the effect of independent variables on zeta potential showed that pc had significant influence on the outcome ( table 2 ) . spr had more influence on the outcome ( zeta potential when the level of pc was maintained low ( < 45 mg ) ) . when the level of pc was maintained high , spr had less influence on the outcome . the study showed that good stable liposomes would be obtained when the level of pc is either between 40 and 80 mg or 110 and 140 mg with spr as predicted in figure 4 and excellent stability between 90 and 110 mg with spr as per figure 4 . experimental design was used to identify the main variables with significant effect and effect of interaction among the individual variables on the outcome in terms of drug encapsulation efficiency , mean particle size , and zeta potential of nanoliposomes containing hyaluronidase . fractional factorial study showed that phosphatidylcholine was the critical component whose level determines the percentage of protein encapsulation . the ideal conditions for production of particles with least possible and maximum encapsulation efficiency and good zeta potential were studied and identified using ccd . under the optimized conditions ( phosphatidylcholine 140 mg , cholesterol 1/5th of phosphatidylcholine , temperature during film formation 50c , and speed of rotation of flask during film formation 150 rpm ) the mean particle size was found to be 245 9 nm with percentage protein encapsulation of 10 2% and zeta potential 53.7 3.5 mv .

hyaluronidase is an enzyme that catalyzes breakdown of hyaluronic acid . this property is utilized for hypodermoclysis and for treating extravasation injury . hyaluronidase is further studied for possible application as an adjuvant for increasing the efficacy of other drugs . development of suitable carrier system for hyaluronidase would help in coadministration of other drugs . in the present study , the hyaluronidase was encapsulated in liposomes . the effect of variables , namely , phosphatidylcholine ( pc ) , cholesterol , temperature during film formation ( t1 ) , and speed of rotation of the flask during film formation ( spr ) on percentage of protein encapsulation , was first analyzed using factorial design . the study showed that level of phosphatidylcholine had the maximum effect on the outcome . the effect of interaction of pc and spr required for preparation of nanoliposomes was identified by central composite design ( ccd ) . the dependent variables were percentage protein encapsulation , particle size , and zeta potential . the study showed that ideal conditions for production of hyaluronidase loaded nanoliposomes are pc140 mg and cholesterol 1/5th of pc when the spr is 150 rpm and t1 is 50c .

ceftriaxone is a widely used third - generation semi synthetic cephalosporin commonly administrated for treatment of different bacterial infections in children . due to its broad spectrum against bacteria , long half - life and single daily dosing , physicians prefer to use it more frequently . ceftriaxone is mostly eliminated through kidney and the remainder is eliminated via the biliary system . it binds with calcium ions producing reversible precipitations that form biliary sludge and/or lithiasis , called psudolithiasis both in children and adults . there are contradictory reports about the incidence of biliary pseudolithiasis and nephrolithiasis as well as the predisposing factors like age , gender , body weight , dose of drug and the duration of treatment . the aim of this study was to investigate the incidence and predisposing factors that contribute to this kind of complications in children . this quasi - experimental and before- and -after study was conducted in 96 children aged from one month to 13 years ( mean age 1.881.98 years ) hospitalized with different types of infection in vali - e - aser hospital in birjand city from september 2011 until march 2012 . the infections included gastroentritis ( 48% ) , pneumonia ( 26% ) , septicemia ( 14% ) , sinusitis ( 6% ) , pyelonephritis ( 5% ) and febrile convulsion with acute otitis media ( 1% ) . patients suffering from renal disease , hepatobiliary disease , hemolytic anemia , malabsorption or any chronic disease were excluded . all patients received the same ceftriaxone preparation ( rocephin ) intravenously with different daily doses ( 50 - 100mg / kg / day divided into two equal doses ) during 15 minutes under adequate hydration . the children were monitored every day for signs of dehydration and if they were dehydrated , received enough oral or intravenous fluids in adequate doses . for each case , demographic parameters : age , gender , body weight , diagnosis , season of hospitalization , dosage of ceftriaxone and the duration of treatment were assessed . all patients underwent sonography of the gallbladder and urinary tract before the first injection of ceftriaxone and after the end of treatment period . sonography was performed by a medison model v-10 , with convex probe 3 - 5 mhz and linear probe 5 - 10 mhz . patients demonstrating any pre - existing or underlying urinary tract abnormalities such as obstructive malformation and/or stone in urinary tract and/or gallbladder in first sonography were excluded from the study . diagnosis of nephrolithiasis and biliary stone was based on standard criteria including the presence of echogenic foci with posterior shadow in the renal pelvicalicial system or in the gall bladder which were indicative of renal or gall stones . moreover , low - level echo materials which lined in the dependent portion of the gall bladder without posterior acoustic shadowing were diagnosed as biliary sludge . emergency sonography was carried out if patients showed any renal symptoms and complications ( colicky abdominal pain , anuria , acute renal failure ) and/or biliary symptoms ( right upper quadrant pain , cholestasis ) . children with positive sonographic findings after treatment were followed with weekly sonography in the first two weeks and thereafter every two weeks until disappearance of these findings . statistical analysis was performed using spps version 13 , mann - whitney , fisher s exact test and independent t - test . a total of 96 children participated in the study , 55 ( 57.3% ) of the patients were boys . while 22% of them were admitted in summer , numbers of participants in three other seasons were equal ( 26% in each season ) . serum levels of urea , creatinine and calcium were in normal range before and after treatment . post - treatment sonography demonstrated nephrolithiasis in six ( 6.3% ) and gallbladder stone in one ( 1% ) of the 96 subjects without any related symptoms . comparison of the groups with and without nephrolithiasis demonstrated no significant differences with respect to age , body weight , dosage of drug and the duration of treatment . nephrolithiasis showed a significant relation with male gender ( p=0.02 ) ( table 1 ) . characteristics of patients with and without nephrolithiasis there was no significant differences between the two groups in terms of diagnosis and season of hospitalization ( p>0.05 ) ( table 2 ) . clinical features and details of the six nephrolithiasis cases tx : treatment ; rk : right kidney ; lk : left kidney in patient number 1 , stone was disappeared in the third sonography . in patients number 2 and 6 ( fig . 1 ) , stones were present till the third sonography , the patients did not reappear for further examinations . patient number 2 , 4 and 5 did also not come back for follow up . only in one patient , a 22-month old boy , who was admitted for gastroenteritis and received 50mg / kg / day ceftriaxone for 3 days , a 10 mm stone was detected in gallbladder after completion of treatment . white arrow shows renal stone in upper pole of right kidney ( patient number 6 ) circle shows stone in the gallbladder biliary sludge or psudolithiasis is a known side effect of ceftriaxone therapy which has been reported since 1986 . chutipongtanate and thonqboonkerd showed that ceftriaxone at therapeutic levels could be crystallized with free calcium in the urine under physiologic condition . they hypothesize that tubular occlusion and crystal - cell adhesion may play an important role in pathogenic mechanisms of ceftriaxon - induced nephrolithiasis . present study showed that 6.3% of the children developed small sized renal stone and one ( 1% ) patient had gallbladder stone while on ceftriaxone and all were silent . in mohkam et al study in 284 children with pyelonephritis , the incidence of nephrolithiasis was 1.4% . avci et al detected nephrolithiasis in 4 ( 7.8% ) of 51 children with various infections , and all were silent . acun et al reported that 5 of 35 children developed gallbladder and urinary tract precipitations ; three of them had gallbladder pseudolithiasis , one gallbladder sludge and one gallbladder pseudolithiasis and urinary bladder sludge . biner et al in 156 children demonstrated abnormal gallbladder sonograms in 27 ( 17% ) children and urolithiasis in 1 ( 0.6% ) . in schaad study biliary concernments developed in 16 of 37 ( 43% ) patients causing symptoms in 3 , one of whom also had urolithiasis with renal colic and obstructive ureteropyelectasia . araz et al found that all 8 ( 100% ) children who received ceftriaxone 100mg / kg / day for meningitis had positive sonographic findings : 4 patients had biliary sludge with gallstone , 3 had gallstone and one biliary sludge . the incidence of pseudolithiasis and sludge in the gallbladder was 57.6% in ozturk study , 3.3% in kong study , 17% in palanduz study and 18.5% in esmaeili study ; all of them were asymptomatic . in present study , as that mohkam and avci studies , there was no significant difference in terms of age between patients with and without nephrolithiasis , but in avci study , the mean of patients age in the nephrolithiasis group was significantly lower than that of the group without nephrolithiasis . the authors suggested that young age may be a risk factor for the formation of urinary stones during ceftriaxone therapy . in the present study , there was a significant relation between nephrolithiasis and male gender . while there was no significant difference according to gender in mohkam and avci studies . in avci study , renal stones developed during a 7-day course of normal or high doses of ceftriaxone therapy . in the present study , small size renal stones developed during a 2 - 6 day course of normal or moderate doses of ceftriaxone therapy and there was no significant difference according to dose of ceftriaxone and duration of treatment between two groups with and without nephrolithiasis . some authors have reported high doses of ceftriaxone and longer treatment time are risk factors for the development of nephrolithiasis . in present study , most of the patients did not come back for follow up sonography . in mohkam study , follow up sonography after 3 months of treatment was normal . in avci study , the renal stones disappeared spontaneously 3 - 4 weeks later in three out of four cases ; however , it was still present in one patient 7 months after ceftriaxone therapy . the time for disappearance of ceftriaxone associated nephrolithiasis was varied from 5 days to three weeks in other reports . most of our positive sonographic patients did not come back for complete follow up sonography and we did not investigate the metabolic disturbances such as hypercalciuria , hyperuricuria , cystinuria and hyperoxaluria . our study showed that pediatric patients may develop small sized , asymptomatic renal stones during a 2 - 6 day course of normal or moderate dose of ceftriaxone therapy . close monitoring for nephrolithiasis and gallbladder stone or sludge in ceftriaxone treated patients is recommended especially on high dose and long term therapy .

objectiveceftriaxone is a third - generation cephalosporin which is widely used for treatment of infection in children accompanied by complications like urinary tract lithiasis and gallbladder psudolithiasis or sludge . the aim of this study was to investigate the incidence and predisposing factors that contribute to these complications in children.methodsthis quasi - experimental and before- and after - study was conducted in 96 children who were hospitalized for treatment of different bacterial infections and received 50 - 100 mg / kg / day ceftriaxone divided into two equal doses intravenously under conditions of adequate hydration . sonographic examinations of urinary tract and gallbladder were carried out before and after treatment for that purpose . patients with positive sonographic findings after treatment were followed with serial sonographic examinations.findingspost-treatment sonography demonstrated nephrolithiasis in 6 ( 6.3% ) and gallbladder stone in one ( 1% ) , all were asymptomatic . comparison of the groups with and without nephrolithiasis demonstrated no significant differences with respect to age , body weight , diagnosis , season of hospitalization , dosage of drug and the duration of treatment . nephrolithiasis had a significant relation with male gender ( p=0.02).conclusionour results showed that pediatric patients may develop small sized , asymptomatic renal stones during a 2 - 6 day course of normal or moderate dose of ceftriaxone therapy . close monitoring of ceftriaxone treated patients especially on high dose long term therapy for nephrolithiasis and gallbladder psudolithiasis or sludge is recommended .

one of the most frequently asked questions to those of us at june is what kinds of manuscripts are appropriate for inclusion in the journal . any manuscript with the aim of enabling others to enhance their teaching of neuroscience to undergraduates is appropriate ; those with empirically - tested protocols of innovative pedagogy are particularly welcomed and prioritized for publication in june . beyond manuscripts devoted to new classroom approaches and laboratory exercises , a variety of manuscripts in other aspects that are relevant to undergraduate neuroscience education are welcomed , such as : editorials . june welcomes book reviews ranging from popular press volumes relevant to neuroscience to textbooks.media reviews . june welcomes reviews of media such as films , television shows , websites , and software that may have particular value to neuroscience education.commentaries . june welcomes reviews of media such as films , television shows , websites , and software that may have particular value to neuroscience education . manuscripts must be properly formatted according to the instructions to authors available at the june website ( http://funjournal.org ) . manuscripts should be carefully proofread , and attention should be given to both the flow and appearance of information and positioning of tables , figures , and captions . to facilitate indexing , authors are welcome to provide a list of suggested reviewers , which may or may not be used in the review of their article . the first step in the process is an initial screen by the editors to ensure that the manuscript is appropriate for the journal . if not , a notification indicating why the manuscript does not fit the criteria for inclusion in june is sent to the author(s ) . sometimes , an editor may provide suggestions of how the manuscript may be modified to better fit the criteria . once the initial reviews are received , the editors make a decision to accept , request revisions and resubmissions , or reject . often times the difference between acceptance and rejection hinges on a few key issues . in the case of manuscripts detailing innovative approaches to teaching , contentions of effectiveness need to be supported with discussion of appropriate methods of assessment and supporting evidence provided by the results obtained . in some cases , an author may inadvertently fail to obtain permission to use and discuss copyrighted material . in all cases if an author has been asked to revise portions of their manuscript , a cover letter indicating how each of the reviewer s comments and concerns have been addressed should be included in the resubmission . one of the most frequently asked questions to those of us at june is what kinds of manuscripts are appropriate for inclusion in the journal . any manuscript with the aim of enabling others to enhance their teaching of neuroscience to undergraduates is appropriate ; those with empirically - tested protocols of innovative pedagogy are particularly welcomed and prioritized for publication in june . beyond manuscripts devoted to new classroom approaches and laboratory exercises , a variety of manuscripts in other aspects that are relevant to undergraduate neuroscience education are welcomed , such as : editorials . june welcomes book reviews ranging from popular press volumes relevant to neuroscience to textbooks.media reviews . june welcomes reviews of media such as films , television shows , websites , and software that may have particular value to neuroscience education.commentaries . june welcomes reviews of media such as films , television shows , websites , and software that may have particular value to neuroscience education . manuscripts must be properly formatted according to the instructions to authors available at the june website ( http://funjournal.org ) . manuscripts should be carefully proofread , and attention should be given to both the flow and appearance of information and positioning of tables , figures , and captions . to facilitate indexing , authors are welcome to provide a list of suggested reviewers , which may or may not be used in the review of their article . the first step in the process is an initial screen by the editors to ensure that the manuscript is appropriate for the journal . if not , a notification indicating why the manuscript does not fit the criteria for inclusion in june is sent to the author(s ) . sometimes , an editor may provide suggestions of how the manuscript may be modified to better fit the criteria . all manuscripts that are deemed appropriate for the journal are sent to reviewers . once the initial reviews are received , the editors make a decision to accept , request revisions and resubmissions , or reject . often times the difference between acceptance and rejection hinges on a few key issues . in the case of manuscripts detailing innovative approaches to teaching , contentions of effectiveness need to be supported with discussion of appropriate methods of assessment and supporting evidence provided by the results obtained . in some cases , an author may inadvertently fail to obtain permission to use and discuss copyrighted material . in all cases if an author has been asked to revise portions of their manuscript , a cover letter indicating how each of the reviewer s comments and concerns have been addressed should be included in the resubmission . there is a range of ways readers of june can contribute to the journal beyond the submission of manuscripts . one very important way is to use the journal as a resource in your own teaching and to encourage your colleagues to do this as well . in addition , you can promote june to other neuroscience educators , encouraging them to read the journal and to submit manuscripts discussing their own approaches and innovative techniques for teaching neuroscience . it s important to support june in another way as well by joining and holding membership in fun . while june is an open - access journal and free to all , june does cost money to publish . fun members , through a portion of their very reasonable annual dues , provide critical support for june . consider also being a reviewer for june . one is to become an ad hoc reviewer ; to do so , simply send the editor in - chief a short email message expressing your willingness to review articles , indicating your particular areas of expertise . while review board members are regularly called on to complete reviews , such service is typically limited to two or three reviews per year . review board members are also considered to fill vacancies that happen periodically on the editorial board . to be considered for service on the june review board , please contact the june editor - in - chief regarding a possible appointment . june has come a long way since being founded in 2002 . through the efforts of our contributing authors , reviewers , and the entire editorial board , june has contributed to the success of undergraduate programs and neuroscience education around the globe . an important milestone for the second decade of june will be the successful completion of our efforts to become indexed across major databases and services , including psych info , scopus , the national science digital library , the directory of open access journals , medline and pubmed ( grisham , 2012 ) . at this writing , only indexing in medline and pubmed remain to be accomplished , and the application process is partially completed . as technology changes and new avenues for electronic communication become available , expect june to change as well , adding new features or altering existing ones to reflect latest developments . with support from fun members , the undergraduate neuroscience educational community will continue to have a readily available venue for learning about the latest innovations in laboratory exercises and improved teaching approaches . be sure to visit june online at ( http://funjournal.org ) , in person at the fun and at the society for neuroscience annual meetings , or both . publish in , and review articles for june and join in the fun of promoting undergraduate neuroscience education and research .

in the fall of 2002 , the faculty for undergraduate neuroscience ( fun ) began publication of its flagship journal , the journal of undergraduate neuroscience education ( june ) . for the past ten years , june has been a major forum for the free exchange of information among undergraduate neuroscience educators . numerous articles on laboratory exercises , media , pedagogy , curriculum , and issues pertinent to neuroscience educators have been published in june during the past decade . given the vast expertise in pedagogy amongst the fun membership and within the undergraduate neuroscience education community at large , we strongly encourage all fun members and june readers to become actively involved in june by contributing manuscripts and/or by offering your services as a reviewer .

surgery for clinically localized prostate cancer is most effective when the cancer is organ- or specimen - confined ( 1 ) . much effort has therefore been expended on the accurate preoperative prediction of the final pathologic stage of the tumor , the single most important prognostic indicator . using serum prostate - specific antigen ( psa ) , biopsy gleason score and clinical stage , as well as a variety of other clinical variables and their combinations , pretreatment nomograms have been constructed for the prognosis of these tumors ( 1 - 9 ) . although these nomograms have aided clinicians in counseling patients and selecting optimal treatment methods , the validity and general applicability of these tables have been questioned , especially in regard to their extrapolation to populations and groups other than those in which the nomograms were originally constructed ( 4 , 10 , 11 ) . the incidence of prostate cancer in korean men has been increasing , necessitating the construction of nomograms based on korean data . when compared with age - matched men in western countries , korean men have lower normal ranges of serum psa ( 12 ) and smaller average prostate gland volumes . to generate prediction nomograms for korean men , we have analyzed prostate cancer data from a single institute and compared nomograms constructed from these data with preexisting nomograms ( 1 ) . furthermore , we have assessed the applicability of these nomograms to the korean population and determined the necessity of nomograms based solely on korean data . a total of 317 korean men ( mean age 64.3 yr , range 40 to 83 ) with clinically localized prostate cancer who underwent radical retropubic prostatectomy and bilateral pelvic lymphadenectomy at asan medical center between june 1990 and november 2003 were the subjects of this study . inclusion criteria included a pre - biopsy serum psa level ( hybritech tandem - cis assay ) and transrectal ultrasonography or digital guided sextant or ten - site prostate needle biopsy and/or transurethral resection of the prostate , with preoperative histological grade according to the gleason histological scoring system . patients who had received any form of neoadjuvant hormonal therapy were excluded . using the preoperative variables , all patients were assigned a clinical stage in accordance with the tnm system ( 1997 ) . radical prostatectomy specimens were examined microscopically in histological sections at multiple levels after routine fixation . briefly , each surgical specimen was weighed and its external surface was covered in india ink before fixing in 10% formalin . the prostate gland and seminal vesicles were step - sectioned perpendicular to the apical - basal axis for examination . all lymph nodes were analyzed by routine paraffin sections in addition to previous frozen sections . critical pathological parameters considered as diagnostic of organ confinement status were extracapsular extension ( ece ) , seminal vesicle invasion ( svi ) and lymph node metastasis ( lnm ) . patients with negative surgical margins , no ece , no svi and no lnm were considered to have organconfined disease ( ocd ) . using the three preoperative variables , serum psa , biopsy gleason scores and clinical stage , a multinomial log - linear regression was performed to predict the percent probability of ocd , ece , svi and lnm . the nomograms were constructed from the predicted percent probabilities at 95% confidence intervals for the final model . internal validation was analyzed from 1000 additional bootstrap samples to determine sensitivity , specificity , positive predictive value and negative predictive value . for comparison with preexisting nomograms , receiver - operating - characteristics ( roc ) curves were drawn , and the areas under the curves ( auc 's ) were calculated , using the nomograms presented by partin et al . the distribution of the patients and their final pathological findings with respect to each clinical parameter are shown in table 1 . at the time of surgery , the median serum psa was 10.8 ng / ml , and the median biopsy gleason score was 7 . overall ocd , ece , svi and lnm rates were 59.6% , 20.5% , 11.7% and 8.2% , respectively . of the 317 patients , 17 ( 5.4% ) had clinical stage t1a or t1b , 113 ( 35.6% ) had t1c , 183 ( 57.7% ) had t2 and only 4 ( 1.3% ) had t3 . noticeably , all cases of clinical stages t1a and t1b had ocd . clinical stage t2a and t2b tumors showed similar findings on all the pathological parameters examined . ocd in clinical stage t2a and t2b tumors was markedly reduced , to 49.6% and 52.4% respectively , when compared with the 100.0% and 70.0% observed in stage t1a , b and t1c tumors ( p<0.05 ) . of the 317 men , 17 ( 5.4% ) had preoperative serum psa levels of 4.0 ng / ml or less , a value generally considered the normal cutoff ; 16 of these 17 patients ( 94.1% ) had ocd . in addition , 125 patients ( 39.4% ) had preoperative serum psa levels between 4.1 and 10.0 ng / ml , 102 ( 32.3% ) between 10.1 and 20.0 ng / ml and 73 ( 23.0% ) higher than 20.0 ng / ml . gleason scores below 7 were observed in 126 ( 39.8% ) of the 317 patients , whereas 98 ( 30.9% ) had gleason scores of 7 and 93 ( 29.3% ) had gleason scores higher than 7 . the results of the multinomial log - linear regression analysis to predict the final pathologic stage from the patients ' clinical parameters are shown in table 2 . numbers represent probability ( % ) and the dash ( - ) represents lack of sufficient data to calculate probability . from the internal validation analysis , our model predicted the probability of ocd to 69.6 % , ece to 75.8% , svi to 86.2% and lnm to 93.2% . table 3 shows the sensitivity , specificity , positive predictive value and negative predictive value achieved for various predicted probability cutoff values for ocd when assessed in the 1000 validation bootstrap samples . when the aucs were calculated using the partin table , they were found to be 0.724 , 0.626 , 0.662 and 0.794 for ocd , ece , svi and lnm , respectively ( fig . 1 - 4 ) . with increasing incidence of prostate cancer , continuing controversy surrounds the choice of treatment for men with clinically localized prostate cancer . although patients with ocd demonstrate markedly improved disease - free survival when compared with men with extraprostatic disease ( 1 , 13 , 14 ) , the actual rate of ocd , as determined in pathologic specimens at surgery , is reported to be 60% to 70% at best ( 10 ) . that is , as many as 30% to 40% of patients with clinically ' localized ' prostate cancer receive radical operation unnecessarily . this situation has prompted efforts to develop methods for more accurate preoperative prediction of the final pathologic stage . in the past decade , many prediction tables and plots have been generated based on combinations of preoperative parameters ( 1 - 5 , 8 , 15 , 16 ) . however , while aiding physicians in selecting treatment methods , the general applicability of these nomograms has been questioned , especially in regard to their extrapolation to population groups other than those in which they were generated ( 4 , 10 , 11 ) . the increasing incidence of prostate cancer in korean men has raised the same questions to korean physicians , especially since korean patients have clinically distinct characteristics ( 12 ) . when compared with caucasian or japanese men , age - matched korean men have lower normal serum psa ranges , and their average total prostate volumes are intermediate between those of caucasian and japanese men . in addition , korean men have a lower cancer probability and detection rate on needle biopsy within the same psa ranges compared to caucasians . conceivably , these distinctive features may limit the usefulness of preexisting nomograms , necessitating verification of their applicability to this population or construction of prediction tables based on data from korean men only . we found that 17 of 317 patients ( 5.4% ) had serum psa levels below 4.0 ng / ml , and that 8 of these patients ( 47.1% ) harbored cancer cells with poor differentiation , as shown by a gleason score of 7 or higher . similarly , 69 of 125 patients ( 55.2% ) with serum psa levels between 4.1 and 10.0 ng / ml had tumors with a gleason score of 7 or higher , a surprisingly high proportion considering the low serum psa levels . likewise , of the 191 patients with a gleason score of 7 or higher , 77 ( 40.3% ) had serum psa levels lower than 10.0 ng / ml . when compared with age - matched caucasians ( 1 ) , korean men showed a higher ocd rate at all psa concentrations . when matched by gleason score and clinical stage , korean men also showed a higher ocd rate , except for those with a gleason score between 2 and 4 . in addition , when compared with caucasian men , korean men showed a lower ece rate at all psa concentrations , gleason scores and clinical stages . in contrast , korean men showed a higher rate of svi at all psa ranges and clinical stages , as well as an overall lower rate of lnm . these results indicate that korean men have a higher rate of ocd , a lower rate of ece and lnm , and a higher probability of svi than caucasian men ( 1 ) . although korean men tend to show a higher probability of ocd , once the disease extends out it tends to invade into the seminal vesicles first . this may be due to the biological aggressiveness of the cancer cells , the relatively smaller volumes of the prostate gland , or the anatomical relationship between the seminal vesicles and the gland , which may facilitate cancer progression at an earlier stage when the tumor mass is smaller . roc analyses were performed to assess the discriminative ability of the partin tables . a test is generally considered to have an acceptable discriminative power when the aucs are higher than 0.7 on an roc curve . thus , despite the apparent differences in preoperative parameters and pathological stage , the partin tables were able to accurately predict ocd and lnm in korean men . however , the auc 's for ece and svi were lower ( 0.626 and 0.662 , respectively ) , indicating that the partin tables are less accurate for predicting ece and svi in korean men . as previously mentioned , korean men have a higher rate of ocd and svi , but a lower rate of ece and lnm , compared to the results of partin et al . ( 1 ) , but the differences in ece and svi were more pronounced than those in ocd and lnm . this may indicate that the prostate cancer characteristics of korean men are similar to those of caucasian men or that the larger number of cases integrated in the partin table contributed to a statistical difference . the descriptive cancer statistics presented in this study provide representative data that illustrate the characteristics of prostate cancer in korean men . the prediction nomograms we have generated will assist physicians in counseling korean men with prostate cancer regarding the probability of their tumor being at a specific pathological stage . furthermore , these nomograms will assist doctors and their patients to make more informed treatment decisions based on pathological stage , risk tolerance and the values they place on various potential outcomes . in addition , these nomograms may aid in rational selection of patients to undergo radical curative surgery , specifically in korean men with clinically localized prostate cancer . however , it should be remembered that the data in this study and the nomograms generated come from a single institute , which may limit the applicability of our results . at the present time , a larger multi - institutional study is underway to generate more accurate and representative results . in conclusion , nomograms predicting the pathologic stage of clinically localized prostate cancer in korean men have been constructed and validated with accuracy using data from a single institute . with increasing incidence , these nomograms may serve a useful tool in making therapeutic decisions for korean men with newly diagnosed prostate cancer . a larger scale , multi - center study with validation test is warranted for a more representative data .

we analyzed the prostate cancer data of 317 korean men with clinically localized prostate cancer who underwent radical prostatectomy at asan medical center between june 1990 and november 2003 to construct nomograms predicting the pathologic stage of these tumors , and compared the outcome with preexisting nomograms . multinomial log - linear regression was performed for the simultaneous prediction of organ - confined disease ( ocd ) , extracapsular extension ( ece ) , seminal vesicle invasion ( svi ) and lymph node metastasis ( lnm ) using serum prostate - specific antigen ( psa ) , gleason score and clinical stage . nomograms representing percent probabilities were constructed and compared with those presented by partin et al . by calculating areas under the receiver operating characteristics ( roc ) curves . median serum psa at surgery was 10.8 ng / ml , and median biopsy gleason score was 7 . overall ocd , ece , svi and lnm rates were 59.6% , 20.5% , 11.7% and 8.2% , respectively , and areas under the curves were 0.724 , 0.626 , 0.662 , and 0.794 , respectively . pathologic stage of localized prostate cancer in korean men may be predicted using the partin table , with acceptable accuracy for ocd and lnm , but less so for ece and svi .

women who have a history of tubal ligation and desire a return to fertility have the options of tubal anastomosis ( ta ) or in vitro fertilization ( ivf ) . ta has been found to be cost - effective for all women of reproductive age including those over 40 years of age . for appropriate candidates who have proceeded with ta , the surgical approach to this procedure has evolved from an open laparotomy to laparoscopic ta and , most recently , robotically - assisted ta ( rata ) . the potential advantages of rata over open laparotomy include the avoidance of a larger incision , shorter hospitalization time , and speedier postoperative recovery for patients , with comparable patency and pregnancy rates . moreover , the potential advantages of rata over laparoscopic ta include shorter operative time , less technical difficulty due to enhanced ergonomics , and the minimization or elimination of surgeon fatigue when performing reversal on the second fallopian tube . these studies have described the anastomosis step as using multiple ( usually four ) interrupted sutures to reapproximate the mucosal and muscular layers of the proximal and distal fallopian tube segments . a one - stitch technique for the anastomosis step has been used effectively in laparoscopic ta [ 8 , 9 ] . unlike the aforementioned reports , this study goes further by combining the robotic approach along with the one - stitch technique for tubal anastomosis . tubal patency , as evidenced by hysterosalpingogram ( hsg ) and/or subsequent pregnancy , was the primary outcome measure of interest , with operative time a secondary measure . eighteen parous women with a history of tubal ligation who had opted for tubal anastomosis over ivf underwent da vinci robotically - assisted ta between february 2009 and may 2012 . the study outcome measure was tubal patency as demonstrated by hysterosalpingogram ( hsg ) and/or subsequent pregnancy . the positioning of the patient and the robot were similar to methods described by dharia patel et al . . briefly , after general anesthesia was induced , the patient was placed in modified dorsal lithotomy position in steep trendelenberg , with a humi harris kronner uterine manipulator injector ( coopersurgical , trumbull , ct , usa ) for uterine mobilization and chromotubation . two lateral 8-mm da vinci ports ( intuitive surgical , sunnyvale , ca , usa ) were placed in the midaxillary line at the level of the umbilical port , separted by at least 8 cm between port sites . after diagnostic laparoscopy assessed the feasibility of anastomosis , a 10-mm ( 8-mm for more recent cases ) accessory port was placed between the umbilical port and left - sided da vinci port for irrigation and aspiration as well as for the introduction and removal of suture material . the one - stitch technique of dubuisson and swolin , with the modifications described by bissonnette , was used [ 8 , 9 ] . dilute vasopressin ( 1:60 , pitressin ; fujisawa , ontario , canada ) was injected into the mesosalpinges in order to facilitate hydrodissection and to maximize hemostasis . the stumps of the occluded proximal fallopian segments were sectioned sharply with endowrist monopolar curved scissors until the lumen was visualized and indigo carmine injection revealed proximal patency . the occluded ends of the distal fallopian tubes were sectioned sharply with endowrist monopolar curved scissors and exposure of the distal segments to indigo carmine that had been injected through the proximal segments facilitated the identification of the distal lumen by visualizing the uptake of indigo carmine into the distal lumen . suture materials were then advanced into the surgical field through the accessory port . in order to align the proximal and distal fallopian tube segments prior to the reanastomotic step , 50 polyglactin 910 suture ( vicryl ; ethicon , san angelo , tx , usa ) was used in an anterior - to - posterior fashion at the distal aspect of the mesosalpinx and then in a posterior - to - anterior fashion at the proximal aspect of the mesosalpinx . the robotic instruments used as needle drivers for the mesosalpingeal stitch were two endowrist black diamond micro forceps . on both the proximal and distal segments lumina , the one - stitch anastomotic step was performed by using a double - needle , 30 cm , 50 polyglactin 910 suture into the lumen at the 12 oclock position from the mucosa , into the muscularis , and out through the serosa ( figs . 1 , 2 ) . the robotic instruments used as needle drivers for the anastomotic step were two endowrist black diamond micro forceps . chromotubation was performed after anastomosis and oxidized regenerated cellulose ( interceed , ethicon women s health and urology ) was placed over and wrapped around each fallopian tube s anastomosis ( figs . 3 , 4 , 5 , 6 ) . all patients were discharged to home on the same day.fig . 1 placement of 12 oclock suture into the right fallopian tube s proximal lumenfig . 2pulling the needle through the serosal surface of the right fallopian tube after 12 oclock suture placementfig . 5approximation of left fallopian tube s proximal and distal segments after 12 oclock suture placement into each of the aforementioned segmentsfig . 6left fallopian tube after anastomosis placement of 12 oclock suture into the right fallopian tube s proximal lumen pulling the needle through the serosal surface of the right fallopian tube after 12 oclock suture placement right fallopian tube after anastomosis chromotubation of indigo carmine through the left fallopian tube s proximal segment prior to anastomosis approximation of left fallopian tube s proximal and distal segments after 12 oclock suture placement into each of the aforementioned segments left fallopian tube after anastomosis if a patient had not achieved pregnancy within 46 months after rata , postoperative hsg was performed in order to assess tubal patency . for patients who had hsg performed , eighteen patients underwent rata ( surgery performed by s.k.k . ) ; one patient was lost to follow - up . the mean age of the 18 women was 33.7 years with a range of 2739 . blood loss was , on average , less than 25 ml per surgical case . the mean operative time for the 16 bilateral ratas and one unilateral rata with the one - stitch technique in this series was 146 min ( range 89203 ) as compared to 201 min ( range 140263 ) for 16 bilateral tas and two unilateral tas as reported by dharia patel . in 16 of 17 patients ( 94.1 % ) , tubal patency was confirmed in at least one fallopian tube by postoperative hsg and/or subsequent pregnancy . eight of these had bilateral tas , of which five had bilateral tubal patency , two had unilateral patency , and one had bilateral blockage shown at hsg . the pregnancy rate , defined as a positive quantitative beta human chorionic gonadotropin level , was 10/17 ( 58.8 % ) . seven patients had intrauterine pregnancies with fetal cardiac motion ( 41.2 % ) , one patient had an ectopic pregnancy ( 5.9 % ) , and two patients had spontaneous pregnancy losses ( 11.8 % ) , one of which was a blighted ovum and the other a chemical pregnancy . of the ten women who achieved pregnancy , 8/10 ( 80.0 % ) had sonographic evidence of intrauterine pregnancy ( one of which was a blighted ovum ) , 1/10 ( 10 % ) had an ectopic pregnancy , and 1/10 ( 10 % ) had a chemical pregnancy . the average time from surgery to documented conception was 6 months ( range 222 ) . rata has been shown to be a feasible and cost - effective surgical enhancement ; however , it has been shown to entail increased operative times when compared to the open approach [ 2 , 6 ] . rata with the one - stitch technique for the reanastomotic step appears to have similar patency rates as ratas that are performed with multiple sutures placed for the reanastomotic step . since the tubal anastomotic step in rata typically is performed with multiple interrupted sutures ( usually four ) , the one - stitch anastomotic step may decrease operative times while achieving comparable patency and pregnancy rates ; in addition , the lower number of sutures placed may theoretically decrease the chances of restenosis of the fallopian tube . further studies with head - to - head comparison would be needed to compare the operative times between the multi - stitch and single - stitch methods .

abstract the da vinci robotic surgical system has been used more often in recent years for tubal anastomosis ( ta ) and has been reported to have an increased operative time . a one - stitch technique has been used for the reanastomosis step in laparoscopic ta . to date , publications on robotically - assisted ta ( rata ) describe an anastomotic step with multiple ( usually four ) sutures placed . this retrospective case series reports tubal patency data on patients who underwent rata with the one - stitch technique ; tubal patency was the outcome measure . eighteen women ( ages 2739 ) underwent rata with the one - stitch anastomotic technique in tertiary care medical centers between february 2009 and may 2012 . tubal patency was demonstrated in 16/17 patients ( 94.1 % ) , as evidenced by postoperative hysterosalpingogram ( hsg ) and/or subsequent pregnancies . we report the first case series which shows that rata with a single stitch for the reanastomotic step is effective in achieving tubal patency as evidenced by postoperative hsg and/or pregnancies .

although there is conclusive scientific evidence on health risks associated with exposure to shs , the health of a large proportion of children across the world is being adversely affected as a result of exposure to shs at home . an estimated 700 million children worldwide are exposed to second - hand tobacco smoke at home . the global average of children with at least one parent who smokes is estimated as 43% . to protect the nonsmokers right for a smoke - free environment , article 8 of the who framework convention on tobacco control ( fctc ) mandates the implementation of appropriate smoke - free measures by all countries that have ratified the global health treaty . being party to the who fctc , india has enacted and enforced legislation that prohibits smoking in public and work places . 21.9% of children aged 13 - 15 years are exposed to shs in their own homes where their options to avoid the health risks resulting from it are limited . measures to restrict smoking at home need to be introduced in order to protect children from the adverse health consequences of shs . information on how prevalent these practices are among women or the factors that influence such practices in rural india is very limited . this study was conducted to elicit the level of awareness of rural indian women of the effects of shs on health of children and to look into the strategies they use to make their homes smoke free . a community - based cross - sectional study was carried out among rural women attending a primary healthcare clinic organized by a district level nongovernment organization ( ngo ) in nadia district of west bengal , india . the clinics held thrice a week on specified days addressed the health needs of women and children of three neighboring villages . women aged from 25 to 40 years , nonsmokers , having at least one child less than 10 years of age and is exposed to tobacco smoke at home , were eligible to participate in the study . the participants were interviewed at the clinic site by a trained social worker in the period from december 2007 to may 2008 . a pretested , semi - structured questionnaire was used to collect information on socio - demographic characteristics , smokeless tobacco habits , knowledge on specific health impacts of shs on children , and initiatives taken by the participants to make their homes smoke free . the women who reported that they had taken some initiatives to restrict smoking at home were further asked about realistic measures introduced to have a smoke - free indoor environment . a five - point evaluation scale was used to assess their level of agreement or disagreement ( 1 : strongly agree , 2 : agree , 3 : neither agree nor disagree , 4 : disagree , 5 : strongly disagree ) to the following statement i have made my home smoke free . the perceived reasons that made it difficult to have a smoke - free home environment were also explored . data were entered in microsoft excel database and analyzed using was epi - info version 6 statcalc . frequency tables for each independent variable were generated and expressed as percentage of the total number of women that responded in a particular group . the chi - square test ( ) was applied to compare the significant differences of observed frequencies among the groups . a total number of 438 women participated in the study . the mean age of the respondents was 31.2 years . the literacy status was low with only 19.9% of the participants possessing a secondary level of education . the majority ( 85.6% ) belonged to the low socio - economic group with a monthly income of < 3000 indian rupees ( inr ) . smoking by husbands ( 89.7% ) was the major source of exposure to shs at home . a total of 75.8% of women agreed that exposure to shs was harmful to children . knowledge of the impact of shs on the health of children indicated that asthma was the most widespread problem followed by other types of respiratory illnesses like bronchitis . no response was available in the cot death and middle ear infection categories . a total of 67.6% of the women reported having taken initiatives to restrict smoking at home . a significant difference was observed in educational levels ( = 5.53 ; p = 0.018 ) and family income ( = 5.99 ; p = 0.014 ) between the group who had tried to introduce restrictive measures on smoking at home and the group that had not ( 32.4% ) . lower the education ( illiterate and primary level ) and family income ( < 3000 inr ) , less were the initiatives to introduce restrictions on smoking at home . characteristics such as women 's age , number of children , employment status , religion , habit of chewing tobacco , and number of rooms in each household did not differ significantly between the two groups . characteristics of the respondents ( n = 438 ) the women ( n = 296 ) who took the initiative to introduce restrictions on smoking at home were asked what actions they had taken . the other commonly reported initiatives were that they made the spouse / smoker aware of the health effects of shs on children and warned them of the possibility of children taking up the habit . when the women were asked to specify the practical steps taken to create a smoke - free indoor environment , 58.4% said that they did not allow anyone to smoke near children at home , and 27.7% responded that they limited smoking to a well - ventilated room . only 38 ( 12.8% ) these women had a significantly higher level of education compared to the women who had tried to initiate other forms of restrictive measures on smoking at home ( 2 = 4.37 ; p = 0.036 ) . of the 292 available responses to the statement i have made my home smoke free , nearly half of them ( 49.3% , n = 144 ) strongly disagreed and 23.9% ( n = 70 ) disagreed , indicating failure in their initiatives to have a smoke - free home . a total of 19.1% ( n = 56 ) women neither agreed nor disagreed , as they were not able to decide on their level of achievement . only 5.8% ( n=17 ) women agreed and 1.7% ( n = 5 ) strongly agreed to the statement that indicated achieving smoke - free homes . the most frequently reported reason for not being able to institute measures that limit shs at home was the lack of co - operation from the spouse / smoker . other important reasons stated were that women 's opinion was not valued in the family , failure of a sustained initiative , and diminished practical support from spouse / smoker over time [ table 2 ] . responses of surveyed women who took initiatives to make their homes smoke free ( n = 296 ) since the home is the key source of exposure of children to shs , restrictive policies on smoking at home are essential for the protection of children from its harmful health consequences . the introduction of similar legislative measures inside homes is difficult because of diverse complex social and cultural issues . adoption of voluntary restrictive behavior on smoking at home is the ideal way to protect children from exposure to shs , but this may not always be feasible . since women are the primary care givers and play a major role in promoting and protecting the health of children , it is important to look into their strategies of protecting children from the ill - effects of shs in their own homes . there is little documentation on the implications of shs initiatives and policies for subpopulations of women , such as those of lower socio - economic status , young women or those of particular ethno - cultural or marginalized groups . to our knowledge , the present study is the first from india to explore the initiatives of rural indian women to control exposure of shs at home and the effectiveness of the adopted strategies in reducing exposure . the low level of education of women and literacy on health matters is a key problem in rural india . since women are responsible to a large extent for taking care of the health of family members , particularly children , it is essential to educate them on basic issues of healthcare . in our study area , the mentioned district ngo held regular promotion campaigns on health literacy among women as part of their awareness generation support services . the present study revealed that in spite of the low level of literacy of the participating women , the majority ( 75.8% ) were aware of harmful effects of shs on children , demonstrating the effectiveness of the campaign . earlier studies have shown that heightened awareness of the harmful health effects of shs was associated with bans on smoking in the house for both smokers and nonsmokers . in our study , women 's awareness of health risks of shs did not necessarily translate into action for a smoking ban in their homes . a total of 67.6% mothers had tried to introduce some restrictive behavior on smoking at home , but only 12.8% of them had actually attempted to introduce a complete ban on home smoking . mothers were aware of only some of the health hazards caused by exposure to shs on children like asthma and other respiratory illnesses . none were aware of other serious health consequences like sudden infant death syndrome ( sids ) and middle ear infections . the quality of knowledge about shs effects is important , as attitude toward shs depends on the depth of information available , as well as the emotional value of the information to the recipient , among other things . family income emerged to be a determinant of motivation for adopting restrictions on smoking behavior at home . the lower the family income ( < 3000 inr ) the less were the initiatives to introduce restrictions on smoking at home . similar results were found in one of the studies that indicated that families on low income were less likely to have smoke - free homes . relationship issues within the family are important when considering implementation of smoke - free rules at home . rural indian women have little empowerment , and their role in the family is generally restricted to child care , looking after other family members and carrying out routine household chores . even if they are able to comprehend the health risks of exposure to shs , their capacity to implement smoke - free rules in the family may be limited . in the present study , women reported rather guarded efforts , with the majority saying that they had tried to convince their spouses / smoker with friendly counseling to restrict smoking in the presence of children . household dynamics and elements of power and control in relationships need to be considered when designing sensitive tobacco reduction initiatives such as smoke - free homes . the educational level was an important factor in influencing action - taking behavior of women . of the 67.6% of women who wanted to have smoke - free homes , only 12.8% of them had tried to enforce a these women had a significantly higher level of education compared to women who took partial restrictive measures on smoking at home . action taking behavior is a complex matter and may be affected by knowledge about shs , interest in the effects of shs , ability to make plans for action , and ability to carry out the plans . a majority of the women in our study belonged to the low socio - economic and low literacy group , and their efforts to have a smoke - free home were mostly limited to enforcing partial restrictions on smoking at home . considering the rural indian scenario , initiatives taken by women to make their homes smoke - free were encouraging . however , evaluation of the level of achievement in actual practice showed a failure in the majority ( 73.3% ) to enforce smoke - free rules . in the home , smoke - free policies may be ineffective or pose difficulties , because of economic and child care responsibilities , interpersonal dynamic and conflicts . it appeared that the lack of co - operation of the spouse / smoker was the major impediment to achieving the goal . although some of them experienced temporary reduction in exposure to shs at home , the lack of a sustained initiative to pursue the issue was an important reason for their failure . many also felt that their opinion or suggestions on health issues were not valued in the family . poor empowerment of rural india women coupled with low level of education was possibly responsible for such family interactions . the results may not be representative of the vast majority of rural population in india . moreover , the study was a cross - sectional one that addressed the issue only once . following up the same cohort could have revealed more important gender sensitive issues on enforcing smoke - free policies at home . although only a complete smoke - free home would provide the best protection to children , women 's initiatives to introduce restrictive measures on smoking at home had limited success and did not lead to an appreciable change in behavior on smoking at home . poor empowerment of women in rural india probably rendered the interventional measures ineffective . since the home is the major source of exposure of shs to children , women 's initiatives toward a smoke - free home need to be evaluated , and targeted interventions with a focus on cultural attitudes designed . comprehensive strategies along with appropriate educational campaigns and counseling aimed at modifying smoking behavior at home are suggested to protect children from harmful effects of shs .

context : since the home is the primary source of exposure of children to second - hand smoke ( shs ) , measures to restrict smoking at home should be introduced to protect children from its adverse health consequences.aims:objectives of the study were to assess the level of awareness of rural indian women on the health impacts of shs on children and to look into the strategies they used to reduce children 's exposure to shs at home.materials and methods : a community - based cross - sectional study was conducted among 438 rural women using a survey questionnaire . information on socio - demographic characteristics , knowledge on specific health effects of shs on children , and attitude toward having a smoke - free home were collected . the perceived reasons that made it difficult to have smoke - free homes were also explored.results:a total of 75.8% of women agreed that shs was a serious health risk for children . knowledge on health impacts of shs on children identified asthma as the most common problem . smoking by husbands ( 89.7% ) was the major source of exposure to shs at home . while 67.6% of women reported having taken measures to limit shs exposure in their homes , only 12.8% of them had tried to introduce a complete ban on smoking at home . on a five - point evaluation scale , 73.3% of the women indicated a failure of their initiatives to have smoke - free homes.conclusions:women's initiatives to introduce restrictions on smoking at home had very limited success and did not produce an appreciable change in smoking behavior at home . lack of empowerment of women in rural india probably rendered the interventional measures ineffective .

hepatoblastoma ( hb ) is an uncommon primary malignant hepatic tumor in children , primarily affecting infants . usual presentation is an abdominal mass and rarely as virilization due to ectopic sex hormone production . different histological types like pure epithelial , mixed , macrotrabecular , and small cell anaplastic are described . foci of extramedullary hematopoiesis ( emh ) characterized by erythroblasts and megakaryocytes are seen on conventional histology and by immunohistochemistry . clue on fine needle aspiration cytology ( fnac ) for the diagnosis of hb and its differentiation from other small round cell tumors of childhood and also from hepatocellular carcinoma ( hcc ) , its importance has not been adequately stressed . routine investigations showed hemoglobin of 5.6 g% and platelet count of 3.2 lakhs / cu.mm . computed tomography ( ct ) scan showed a mixed nonhomogenous mass in the abdomen extending to the abdominal wall , compressing the liver , and reaching up to the bladder [ figure 1a ] . with a possibility of neuroblastoma the cells exhibited moderate cytoplasm and round nuclei with condensed chromatin ; a few cells displayed intracytoplasmic yellowish - green pigment indicating bile . also seen were a few scattered megakaryocytes and erythroblasts suggesting the evidence of emh [ figure 1b ] . in view of these cytologic findings a diagnosis of small round cell neoplasm suggestive of hb was offered , with an advice to correlate with the serum alpha - fetoprotein ( afp ) levels . serum afp level was elevated to 2000 ng / ml ( normal < 10 ng ) . ( a ) ct scan of case 1 showing non - homogenous mass in the liver . ( b ) photomicrograph showing malignant cells in sheets and trabeculae ( pap , 100 ) ; inset shows a megakaryocyte ( giemsa , 400 ) . ( c ) ct scan of case 2 showing massive hepatomegaly with a large hypodense lesion in right lobe and multiple small lesions . ( d ) photomicrograph of malignant cells arranged in sheets and trabecular pattern ( h and e , 100 ) ; inset shows megakaryocyte ( pap , 400 ) a 19-year - old male presented with a hypochondrial mass . investigations showed a hemoglobin of 7.9g% ; platelet count of 8.9 lakhs / cu mm ; liver function test was within normal limits , and serum afp level was 1888 ng / ml . ct scan showed massive hepatomegaly with large hypodense lesion along with multiple small lesions in the right lobe [ figure 1c ] . fnac smears were markedly cellular with sheets and clusters of cells having moderate to abundant granular / clear cytoplasm and central round nuclei with dense chromatin . a few singly scattered megakaryocytes and erythroblasts were seen [ figure 1d ] . a diagnosis of hb was offered . routine investigations showed hemoglobin of 5.6 g% and platelet count of 3.2 lakhs / cu.mm . computed tomography ( ct ) scan showed a mixed nonhomogenous mass in the abdomen extending to the abdominal wall , compressing the liver , and reaching up to the bladder [ figure 1a ] . with a possibility of neuroblastoma the cells exhibited moderate cytoplasm and round nuclei with condensed chromatin ; a few cells displayed intracytoplasmic yellowish - green pigment indicating bile . also seen were a few scattered megakaryocytes and erythroblasts suggesting the evidence of emh [ figure 1b ] . in view of these cytologic findings a diagnosis of small round cell neoplasm suggestive of hb was offered , with an advice to correlate with the serum alpha - fetoprotein ( afp ) levels . serum afp level was elevated to 2000 ng / ml ( normal < 10 ng ) . ( a ) ct scan of case 1 showing non - homogenous mass in the liver . ( b ) photomicrograph showing malignant cells in sheets and trabeculae ( pap , 100 ) ; inset shows a megakaryocyte ( giemsa , 400 ) . ( c ) ct scan of case 2 showing massive hepatomegaly with a large hypodense lesion in right lobe and multiple small lesions . ( d ) photomicrograph of malignant cells arranged in sheets and trabecular pattern ( h and e , 100 ) ; inset shows megakaryocyte ( pap , 400 ) investigations showed a hemoglobin of 7.9g% ; platelet count of 8.9 lakhs / cu mm ; liver function test was within normal limits , and serum afp level was 1888 ng / ml . ct scan showed massive hepatomegaly with large hypodense lesion along with multiple small lesions in the right lobe [ figure 1c ] . fnac smears were markedly cellular with sheets and clusters of cells having moderate to abundant granular / clear cytoplasm and central round nuclei with dense chromatin . a few singly scattered megakaryocytes and erythroblasts were seen [ figure 1d ] . a diagnosis of hb was offered . hb is a malignant hepatic tumor predominantly of infants with isolated cases described in older children and adults . four percent of tumors are present at birth , 68% in the first 2 years , and 3% over 15 years of age . it is an embryonal neoplasm arising from multipotential blastomatous cells , capable of differentiating into epithelial ( resembling fetal hepatocytes to embryonal cells ) and mesenchymal cell lines . beckwith - wiedemann syndrome , trisomy-18 , trisomy-21 , prader willi syndrome , familial adenomatous polyposis , and extremely low birth weight are some of the conditions reported in association with hb . clinically , 80% cases occur as single liver mass ( involving the right lobe in 57% , left lobe in 15% ) and 20% cases are present as multiple masses . hepatic angiography and ct scan are useful in the preoperative assessment of the location and extent of the tumor . both our cases were anemic ; one of them presented with thrombocytosis and multiple nodules in the liver . cytology of hb depends on the histologic subtype and shows cells arranged in three dimensional clusters , loose sheets , cords , rosette - like structures , and occasionally pseudopapillae . the epithelial type of hb is the most common subtype ; it shows uniform cells with abundant cytoplasm , well - defined cell membranes , and large hyperchromatic nuclei . mesenchymal type is characterized by spindle cells exhibiting hyperchromatic nuclei and poorly defined cell membranes . the small - cell subtype ( anaplastic ) shows discohesive cells with scarce cytoplasm and hyperchromatic nuclei . they are consistently associated with epithelial histology ; more in the fetal epithelial and less differentiated embryonal subtypes . hematopoiesis in hb is located in tumor sinusoids , or in intimate association with the tumor cells suggesting that the microenvironment is an important contributory factor for hematopoiesis in hb . it is suggested that hb tissue retains circulating cd 34 positive multipotential progenitors of bone marrow origin , which proliferate and differentiate to more mature erythroid precursors and megakaryocytes . hb cells as such are clearly differentiated , so it is unlikely that they themselves undergo a transition to hematopoietic stem cells . various cytokines such as erythropoietin , stem cell factor , and il-1 are expressed by the epithelial hb cells . by paracrine stimulation , these cytokines can initiate stromal cell production of other hematopoietic cytokines including il-6 , g - csf , gm - csf , m - csf and leukemia inhibitory factor . the differential diagnosis for hb in children include small round cell tumors , metastatic wilms tumor , neuroblastoma , rhabdomyosarcoma and well differentiated hcc . in our first case the clinical diagnosis was neuroblastoma . but the cells exhibiting moderate cytoplasm with bile pigment and emh on smears prompted us advising serum afp , and an elevated afp levels assisted in the diagnosis of hb . the finding of emh in liver of infants is not unusual ; however , emh seen along with neoplastic round cells on radiologically - guided liver fnac helps to diagnose hb and differentiates it from neuroblastoma . in the second case , the presence of emh and the absence of typical features of hcc allowed the correct diagnosis of hb . overall , 5-year survival has improved from 30% to over 70% , and is now approximately 90% for the majority of children who present with standard risk disease . after the cytologic diagnosis , our first case was lost to follow up while the second case underwent surgical resection in another hospital . the diagnosis of hb was confirmed in the latter patient who is currently being followed up . to conclude , hbs are rare lesions and their preoperative identification helps in an early management of patients .

extramedullary hematopoiesis ( emh ) evidenced by erythropoietic cells and megakaryocytes is a characteristic feature of hepatoblastoma ( hb ) . the typical cytomorphology , the presence of emh and associated clinical and radiological findings offer a reliable diagnosis of hepatoblastoma by fine - needle aspiration cytology ( fnac ) . we describe the cytologic features of hepatoblastomas and discuss the differential diagnosis in two children , aged 53 days and 19 years . the usefulness of emh in differentiating hb from other small round cell tumors and well differentiated hepatocellular carcinoma ( hcc ) on cytology is highlighted .

lc and lcbde , which are usually performed together , is the golden standard surgical procedure for patients with cholecystolithiasis and choledocholithiasis simultaneously , which leads to good cosmetic effect and rapid recovery1 . skeletonization of calot 's triangle and controlling of gallbladder vessels and cystic duct successfully are the key points of the lc . as we all know , currently hem - o - lok clip is generally used to ligate gallbladder vessels and cystic duct during lc . besides , it is reported that hem - o - lok clip is safe to be used in other operations2 . actually , the patients with t - tube who ever underwent lcbde need to do the cbd radiography at postoperative 3 months in order to confirm whether there are residual or recurrent stone in the cbd before removing t tube . however , in recent two years from 2009 november to 2011 october , during which time totally 1600 patients underwent lcs , we found that in 8 patients who ever underwent lc and lcbde clips were found in cbd during fiberoptic choledochoscope , which is a surprising and dangerous finding for both surgeons and patients . hence , we report our findings as an alert here to share some experience with laparoscopic surgeons . eight patients , 6 males and 2 females ( mean age of 56.3 years ; range of 35 to 76 years ) , who underwent lc and lcbde , were included in this retrospective , non - randomized trial . postoperative 2 - 3 months later they went back to out - patient clinic for radiography via t - tube with contrast agent . consequently , filling defects were found in radiographies in all patients . as a result , all patients were admitted into hospital in order to do fiberoptic choledochoscope . the patient took supine position , with pethedine intramuscularly injected , then t - tube was removed from sinus . fiberoptic choledochoscope ( olympus , tokyo , japan ) was inserted into sinus and cbd , and rough cbd inner wall attached with inflammation floc was found . clips and stones were seen in cbd , which is shown in fig . 1 , and removed with stone - retrieving basket ( olympus , tokyo , japan ) successfully . of all patients , in 6 cases there was a single clip in cbd , and 2 clips in other 2 cases . after the procedure was completed , a drainage tube , which was usually removed next day , was dwelled into cbd sinus to drain the fluid in the cbd out of body after no residual stone in cbd was confirmed . finding clips in cbd indicates that clip is not so safe to be used to control vessels and cystic duct during lc and lcbde , which contradicts with some research outcome that indicates that clip is safe to be used to control vessels and ducts2,3 . as a matter of fact meantime , the anatomic basis of cystic duct ligation site close to cbd can possibly lead to clip to drop into cbd by rejection response mechanism , then clip was excluded to outside via t - tube . similarly , delibegovic et al4 . described that the mildest postoperative inflammatory changes were seen in the stapler group , followed by the hem - o - lok group during laparoscopic appendectomy , and inflammation is more frequent after the use of resorbable endoloops . nevertheless , actually clip could not be excluded out of body from sinus because of friction between clips and cbd . in 1995 kitamura et al5 . in addition , in china hu sy6 also reported that titanium clip was ever found in t - tube after lc and lcbde . we think that this is caused by less friction of smooth metal clip . however , we hypothesize if clip drops within few days at early postoperative period , the outcome will be second operation , even deadly because of bleeding and bile peritonitis in addition , we found in all cases there are stones in cbd , but by reviewing all cases retrospectively only 5 cases have residual stones in intrahepatic bile duct , the cbd stones in other 3 patients have ever been removed completely . hence , we hypothesize that clip may be a factor which induces the recurrent stone formation although there is no statistical significance because of less cases . however , we will continue to summarize our experience in the ensuing similar cases to acquire the conclusion which has statistical significance . what 's more , it is reported that dropped clip can cause bile duct obstruction , which only could be cured by second operation7 . in addition , the price of a clip is about us$30 in china , and each patient needs 3 - 4 clips , which gives rise to an economic burden to patients , which could be avoided by using other methods . therefore , based on these factors , we begin to consider the disadvantages of clips . we should investigate other effective and safe methods instead of clip during lc and lcbde . we consider thread ligation is still a kind of cost - effective and safe method , which can ligate vessels and cystic duct safely , economically and minimally invasively . currently , besides lcbde and t - tube drainage , ercp ( endoscopic retrograde cholangiopancreatography ) is also a common and effective method to treat cbd stones worldwide . if the stone is very big and numerous , and the diameter of cbd is more than 1.2 cm , lcbde is superior to ercp because stones could be completely extracted . however , if the diameter of cbd is less than 1.2 cm , ercp is often used to extract stones , otherwise the cbd stricture would happen if we perform cbd exploration in this condition . nowadays laparoscopic surgery is increasingly replacing conventional open operation due to its less invasive effect and rapid recovery8 . especially in recent years the single port access laparoscopic procedure is accepted by more and more patients owning to its better cosmetic effect compared with three or four ports lc . as a result , on behalf of patients we must search a kind of safe and effective ligation method to control vessels and bile duct . hem - o - lok is not a so safe ligation method during lc that we should search a more effective and safe way to control cystic duct and vessels .

currently laparoscopic cholecystectomy ( lc ) and common bile duct exploration ( lcbde ) has become the standard surgical procedure for cholecystolithiasis and choledocholithiasis . during the operation cystic duct and vessels are usually controlled by hem - o - lok clips . however , recently we found clips dropping into cbd in 8 patients during fiberoptic choledochoscope 2 - 3 months after operation . therefore , there is risk that clip can migrate during postoperative period , which probably lead to hemorrhage and bile leakage after lc if this occurs within postoperative few days , or even cause recurrent stone in cbd . so , using of hem - o - lok clips may be not a safe method to control vessels and cystic duct during lc . to our knowledge , this condition has not previously been reported . in our view , other more effective and safe method ligating cystic duct and gallbladder vessels , such as effective and convenient thread knotting method , should be investigated .

the plan will contain three components : ( 1 ) the nei framework for vision research , a draft of which is available containing six goals , ( 2 ) vision research in 2011, which is expected to be released in early 2012 , and ( 3 ) ongoing planning workshops to supplement emerging needs and opportunities being identified by planning panels . recent planning workshops have included ocular pain and sensitivity , ophthalmic genetics , advances in optical imaging and biomedical science , and ocular epidemiology . nei solicited opinions from members of the scientific , medical , and patient communities to help shape its research agenda through a respondents were asked to provide suggestions on the most significant scientific discoveries in vision research since 2004 and the most significant scientific research needs , gaps , and opportunities that can be addressed by nei . similarly , the european commission is currently undertaking an open consultation process for unmet research / clinical needs in vision science and ophthalmology in europe . the consultation process was open from november 15 , 2011 to december 31 , 2011 and will culminate in a white book entitled a vision for horizon 2020 a european strategic roadmap for vision research and ophthalmology, stakeholders in the vision community , including scientists , clinicians , patient organizations , academic and private institutions , and companies were asked to suggest innovative research goals that they would like to get funded . the strategic plan for 20092013 of the international agency for the prevention of blindness ( iapb ) includes six strategic objectives , with approaches and measures of success provided for each of the objectives . the plan includes advocacy to develop sustainable income resources and promote vision 2020 to eliminate the main causes of avoidable blindness by the year 2020 . the international council of ophthalmology 's research committee met in 2002 to develop a research agenda for the prevention of global blindness . they divided research priorities into three domains research : operations research , epidemiologic risk profile , and basic biologic research . they considered research opportunities for cataract , trachoma , onchocerciasis , xerophthalmia , glaucomas , diabetic retinopathy and age - related macular degeneration , and refractive error . action items to move this agenda forward included developing regional consortia to pool resources to estimate burden of disease ; monitoring outcomes of interventions and sharing lessons learned ; getting a consortium of scientists from wealthy and poor countries to systematically monitor new drugs and discoveries testing them for application in the developing world . a novel opportunity for collaboration the approach taken by these organizations to develop research agendas that allow for input from all relevant parties in the vision community has proven to be successful . inherent in the development of research agendas is the need to document what is known about the biology of a given condition as well as the prevalence and incidence of disease and success of interventions . figs 1a d demonstrate the state of funding for vision research by the nei in the us . the actual dollars spent on vision research from fy2007 to fy2012 remained relatively constant , along with the relatively constant inflation rate reflected by the consumer price index . over that same time frame , the percentage of the national institutes of health ( nih ) budget allocated to eye diseases and disorders of vision fell [ fig . 1b ] as did the success rate for new competitive awards from nei [ fig . the number of applications for new competitive awards rose between fy2002 and fy2012 [ fig . 1d ] . in the uk , the success rate for research grants fell from 17% in 20092010 to 15% in 20102011 . success rates for project grants from the national health and medical research council ( nhmrc ) in australia from 2005 to 2010 , showed an increase for 2 years and then fell again recently ( 21.1% , 21.3% , 27.6% , 26.5% , 22.8% , 23.3% ) . these data highlight the need for researchers to consider all potential sources of funding for their research . ( a ) national institutes of health funding for eye diseases and disorders of vision relative to 228 other research / disease areas , fy 2007 to fy 2011 . ( b ) percent of nih funding allocated to eye disease and disorders of vision , fy 2007 to fy 2012 . ( c ) success rates for all new awards by the national eye institute , 2002 to 2011 . ( d ) number of applications for new awards to the national eye institute , 2002 to 2011 the universal consideration for funding is that the reason for funding should align with the mission of the funding organization . a statement on the preliminary grant application web site for the macular degeneration foundation sums it up wellthe foundation carefully considers all eligible applications to determine whether a project fits its current program interests and funding principles. three current areas of focused funding are then outlined , followed by funding principles that include scientific merit , achievability and real world applicability . researchers need to ensure that a potential funding agency would be interested in funding their area of research . the first considerations when looking for research funding are likely to be the amount of funding available and whether institutional indirect charges or administrative overheads are allowable grant expenses . this is because some institutions do not allow scientists to apply for grants where these costs are not allowed.turn-around time from application to funding availability may also be an important consideration when considering possible funding sources . these issues are summarized for various funding sources in table 1 and are discussed in more detail below . the majority of research and development is funded by private industry but federal grants and contracts remain the primary source of research funding for many academic researchers . as shown earlier , the success rates for research funding from the nei in the us , the medical research council in the uk , and the nhrmc in australia have fallen in recent years.researchers should check the web sites of these funding organizations for grant submission deadlines , funding priorities and any restrictions , such as country of residence . the nei will fund research that takes places outside the us professional associations , such as the association for research in vision and ophthalmology , often offer grant writing sessions at their annual meetings . nongovernmental organizations ( ngos ) are very heterogeneous groups , but share a vision and passion for improving their communities or the world in relation to a specific concern , such as glaucoma or blindness . they tend to rely heavily on volunteers and fund - raising to support their missions . depending on the type of ngo , some of these funds are disbursed as grants to researchers . a summary of some of the ngos that fund vision research is contained in table 2 . the list includes the research on disorders that they fund , and ngos that fund projects outside the us . as highlighted in table 1 , ngos generally do not cover institutional indirect costs but can have a much shorter turn - around time from grant application to receipt of funding . for - profit organizations such as device manufacturers and pharmaceutical companies have research and development budgets . they seek research collaborators to evaluate their products and they occasionally fund external investigator - initiated projects . for instance , pfizer inc . has a global investigator - initiated research program . types of research that are eligible for support include clinical studies involving pfizer drugs , observational studies such as epidemiology or outcomes studies.other types of research on diseases states that include novel diagnostic tools where pfizer has no direct commercial interest and in - vitro or animal studies are also eligible . information is available on the pfizer web site and interested researchers are advised to contact pfizer representatives . pfizer also has a competitive grant programs with specific research criteria and timelines ; again , information is available on their website . the alcon research institute ( ari ) , established in 1981 , is a virtual institute that honors outstanding ophthalmic researchers through a symposium and unrestricted research grants . most nonprofit research institutions receive some funding from donors for their nonprofit mission . larger organizations may have development departments . researchers can work with their development officers to help prepare the case to receive the support of specific research programs or projects . again , it is important to align the interest of the donors with the needs of the researchers . service organizations , such as lions clubs international and rotary international , are committed to improving their communities . they provide volunteer time and small grants to research projects with a generally very fast turn - around time . the lions eye health program , in conjunction with the nei , is a community - based education program to promote healthy vision . while websites contain some information about the priorities of service organizations , a call or visit to a local chapter is the best way to determine if a specific research project is a good match to the service organization . local chapters regularly look for speakers for their meetings ; this is a good opportunity to raise the level of interest in vision research in the community . well established processes exist to develop and update national and international priorities for vision research . with the number of grant applications increasing and the pay lines generally decreasing , applicants need to be sure that their funding requests are well matched to the vision and mission of the funding organization . collaboration is encouraged between senior and junior investigators and between researchers in developed and developing countries . as can be inferred from reading the reference list in this manuscript , there is a lot of information available on web sites about potential funding sources , grant deadlines , and other necessary information for grant seekers . researchers are advised to check web sites regularly for updated information and to sign up for email updates and newsletters from funding organizations , where available .

a number of organizations have employed a consultative process with the vision community to engage relevant parties in identifying needs and opportunities for vision research . the national eye institute in the us and the european commission are currently undergoing consultation to develop priorities for vision research . once these priorities have been established , the challenge will be to identify the resources to advance these research agendas . success rates for federal funding for research have decreased recently in the usa , uk , and australia . researchers should consider various potential funding sources for their research . the universal consideration for funding is that the reason for funding should align with the mission of the funding organization . in addition to federal research organizations that fund investigator - initiated research , other potential funding sources include nongovernmental organizations , for - profit companies , individual philanthropy , and service organizations . in addition to aligning with organizational funding priorities , researchers need to consider turn - around time and total funds available including whether an organization will cover institutional indirect costs . websites are useful tools to find information about organizations that fund research , including grant deadlines . collaboration is encouraged .

acupuncture has been used widely in many asian countries for thousands of years to control various diseases and symptoms , and it has recently become globalized . although it has documented safety and efficacy , several serious complications have been reported ( 1 , 2 ) . in this report , we describe a rare case of infectious aortitis leading to aortic dissection resulting from acupuncture , and a literature review . an 83-yr - old woman with history of hypertension was admitted emergently with fever , chill , and chest pain for 2 weeks on 8 july 2012 . she had been treated with acupuncture on her back and buttock because of chronic back pain before the onset of symptoms . blood pressure was 80/50 mmhg , heart rate was 94 beats per minute , and body temperature was 38.2. other vital signs were unremarkable . white blood cell count was 27,420/l with 90% neutrophils and c - reactive protein was 14.78 mg / dl on laboratory examination . because she complaint of chest pain and mediastinal widening on an initial chest x - ray was documented , chest computed tomogram ( ct ) was performed to rule out acute aortic syndromes . and it revealed a dissection of the ascending aorta with hemopericardium and an incidentally noted abscess in the right buttock ( fig . transthoracic echocardiography revealed severely dilated ascending aorta with intimal flap suggestive of aortic dissection , a moderate amount of pericardial effusion without tamponade sign , and no visible vegetations . the left and right ventricular functions were preserved and the cardiac valves had no abnormal findings except mild aortic valve regurgitation . under the impression of acute aortic dissection with an impending rupture , after pericardiotomy , blood with fresh clots was observed and removed securely . on the superior wall of the proximal aortic arch just distal to the innominate artery and beneath the innominate vein , inflamed friable tissue with a hematoma was started and systemic cooling was instituted with arterial cannulation in the right axillary artery and venous cannulation in the right atrium . during removal of the infected adventitial tissue and sharp dissection of the arch and the ascending aorta , the ruptured aorta was firmly compressed and she was cooled continuously . left ventricular vent was placed through the right superior pulmonary vein . upon cardiac fibrillation , a cross - clamp was placed and the aorta was opened by a transverse incision , which revealed circular dissection that reached just above the sinotubular junction leaving the coronary ostia unaffected . then cardioplegia was antegrade infused into the coronary opening . upon reaching the core temperature to 20 , cpb was discontinued and a cross - clamp was off . the ascending aorta was opened by vertical incision , which was extended from the previous transverse aortic incision upward to the proximal aortic arch . antegrade cerebral perfusion of about 10 ml / kg / min was initiated through the arch vessels and adjusted to maintain cerebral perfusion pressures of 60 mmhg . during selective cerebral perfusion , after false lumen obliteration , distal aortic reconstruction of hemi - arch replacement was performed with an open anastomosis technique using a one - branched graft ( intergard , maquet , france ) . distal aortic anastomosis was then complete and an additional arterial cannula was inserted into a side - branch of the graft . after vigorous de - airing maneuvers , flow to the head vessels and lower body was resumed and simultaneously rewarming was initiated . proximal aortic anastomosis was performed at the level of the sinotubular junction during the rewarming period . the patient was easily weaned off bypass , and transesophageal echocardiography showed no abnormal findings . histopathological examination from the ascending aorta , obtained during the operation , showed aortitis without giants cells and caseous necrosis . cultures from the aortic necrotic materials and blood returned positive for methicillin - sensitive staphylococcus aureus , for which she received intravenous cefazolin for 6 weeks . and oral rifampin 600 mg a day was prescribed for 2 weeks after the end of intravenous antibiotic treatment . after surgery , follow - up blood cultures were performed two times a week . in next week , blood cultures were converted to negative . during the antibiotic treatment , biochemical parameters of inflammation were slowly improved and normalized . additionally the right buttock abscess was progressively improved and subsided without a surgical drainage on physical examination . after 11 days of icu treatment because of acute renal failure and 46 days of hospitalization , she was discharged . she remains asymptomatic 2 months later without signs of recurrence , and postoperative follow - up chest ct that was performed after 4 weeks revealed the patent bypass grafts ( fig . infectious aortitis is a rare but life - threatening condition , and most commonly affects the abdominal aorta ( 3 , 4 ) . similar to endocardium , aortic intima is generally highly resistant to infection , but disrupted intima becomes vulnerable to infection . thus , bacteremic seeding of an existing intimal injury or atherosclerotic plaque may lead to aortitis . additionally , normal or atherosclerotic vessels can become involved , resulting from septic emboli of the aortic vasa vasorum , contiguous infective focus extending to the aorta wall , and direct bacterial inoculation at the time of trauma , such as a penetrating injury ( 5 ) . various microorganisms have been associated with infectious aortitis , most commonly staphylococcus , enterococcus , streptococcus , and salmonella species ( 6 ) . clinical manifestations are often nonspecific and have a broad spectrum , depending upon the site of infection and its localized impact and characteristics , frequently causing delays in diagnosis . however , rapid diagnosis is extremely important , because this condition has high mortality and morbidity ( 7 , 8) . computed tomography ( ct ) is widely available and allows a rapid exclusion of other aortic pathologies that may mimic acute aortitis . furthermore , ct findings of periaortic density and adjacent gas collection suggest an impending rupture , even if no aneurysm is present ( 5 , 9 ) . echocardiogram , magnetic resonance angiography , and positron emission tomography are also useful ( 5 , 6 ) . however , neither of these methods led to the correct finding in a case of a patient with aortitis of the ascending aorta . when image studies show signs of potential aortic rupture , prompt management is mandatory since the mortality of ruptured infectious aortitis has been reported to be as high as 90% ( 10 ) . optimal management for infectious aortitis requires complete surgical excision and reconstruction of the infected aorta combined with prolonged antibiotic administration . antibiotics with broad antimicrobial coverage should be initiated as soon as the diagnosis of infectious aortitis is suspected , and while awaiting microbiologic data . the antibiotic regimen can then be tailored , based upon the results of culture and sensitivity data . while no clinical studies have established the optimal duration of antibiotic therapy for aortitis , a treatment course of at least 6 to 12 weeks after surgical debridement and clearance of blood cultures is generally recommended ( 5 , 6 ) . some authors even recommend life - long oral antibiotics following the intravenous course , especially for microorganisms difficult to treat or after in situ prosthetic bypass ( 7 ) . the goal of surgery is to control probable rupture , confirm the diagnosis , remove septic foci , and reconstruct the arterial vasculature ( 8) . for revascularization , prosthetic grafts may be placed in situ or in an extra - anatomic fashion . there is special concern over whether the type of reconstruction might contribute to an increased risk of graft - related complications . theoretically , in situ reconstruction may lead to a higher rate of early graft infection , and extra - anatomic bypass may be impractical , especially when aortic branches are involved , and a lower long - term patency rate may necessitate further aortic reconstruction . however , there have been many reports on the efficacy , safety , and durability of in situ prosthetic graft , with very low rates of early graft infection and mortality ( 4 , 7 ) . therefore , in situ prosthetic graft reconstruction is currently the preferred method of revascularization ( 5 , 7 ) . we believe that the pre - existing atherosclerotic aorta was contaminated by systemic bacteremia caused by acupuncture , leading to infectious aortitis . however , it is uncertain whether the abscess in the right buttock was a consequence of systemic seeding from aortitis or a focus of continuous bacteremia leading to aortitis . in our opinion , the latter is more reasonable because of previous acupuncture history before the onset of symptoms and no other seeding site from aortitis . the second interesting points are the anatomic location and the type of acute aortic syndromes induced by aortitis . the thoracic aorta is a less - frequent site ( about 30% ) than the abdominal aorta for the formation of spontaneous mycotic aneurysm ( 3 , 4 ) . some reports have been dealt with aortitis involving the descending thoracic aorta , but infectious aneurysm on the ascending aorta seems to be extremely rare ( 11 - 13 ) . with regards to a type of acute aortic syndromes , many reports have noted that infectious aortitis causes aneurysmal formation or rupture usually . our case involved the ascending aorta and presented not an aneurysmal formation but acute aortic dissection caused by aortitis , which is extremely rare according to a medline search and literature review . additionally , acute stanford type a dissection combined with aortitis caused by acupuncture has not been reported previously . in conclusion thus clinicians must be aware of this rare , but serious pathology , and that it may present in patients with an existing intimal injury or atherosclerotic plaque . once the diagnosis is established or suspected , early and complete surgical excision of the infected aorta in combination with prolonged antibiotics ( extended for at least 6 - 12 weeks )

nowadays , infectious aortitis has become a rare disease thanks to antibiotics , but remains life - threatening . we present a case of a patient with acupuncture - induced infectious aortitis leading to aortic dissection . chest computed - tomogram scan revealed stanford type a dissection with pericardial effusion . under the impression of an impending rupture , emergent surgery was performed . during surgery , infectious aortitis was identified incidentally , so she underwent resection of the infected aorta including surrounding tissues . then the ascending aorta and hemi - arch were replaced with a prosthetic graft as an in situ fashion . the resected tissue and blood cultures revealed staphylococcus aureus , so prolonged antibiotherapy was prescribed .

methods for detecting non - coding rnas ( ncrnas ) in genomic sequence data have been a topic of intense research . while techniques for detecting protein - coding genes can rely on universal characteristics such as start and stop codons , triplet amino acid codes , or ribosome binding sites , there are no corresponding characteristics known in ncrnas . early approaches to ncrna detection were designed for specific types of rnas , in particular trnas ( 1 ) . other approaches to ncrna searching were designed for detecting arbitrary ncrna classes , typically based on the conserved sequences or secondary structure elements . the rnamotif ( 2 ) tool allows to describe a search pattern consisting of conserved stems and helices , while the erpin tool ( 3 ) allows to annotate an alignment with secondary structure information , which is then used as a search pattern . the infernal tool ( 4 ) also derives its query from a multiple alignment . in contrast to erpin , however , the alignment is translated into a stochastic context - free grammar , which is then used for the ( quite time - demanding ) task of scanning genomic sequences . in general , the computational complexity of searching rnas increases with the complexity of the search pattern , limiting the use of such methods for genome - wide surveys . in this paper , we present fragrep , an efficient tool that is optimized for this kind of sequence - based searches . the approach implemented in the fragrep tool is based on an elementary way of describing search patterns , allowing a highly efficient and hence genome - wide application . this approach is particularly fruitful for the classes of ncrnas that contain stem or loop regions with well - conserved sequence patterns , such as y rnas and vault rnas 5 . , 7 . , which , however , are interrupted by non - conserved sequences of highly variable lengths . compared to rnamotif , we provide a statistically well - motivated ranking scheme , which relieves the user from defining an individual scoring scheme as in rnamotif . the problem of efficiently searching a large sequence database for interrupted sequence patterns is also relevant in the context of other ncdna motifs , for example cis - regulatory modules ( 8) . in this context , the approach investigated in fragrep is complementary to the motif discovery procedures such as biooptimizer ( 9 ) or bipad ( 10 ) : once a suitable motif has been discovered , fragrep can be applied to scan genome databases for such patterns ( or constellations of patterns ) . in some cases , the fragmented patterns are informative enough to be clearly distinguished between true and false positives . in many other cases , however , fragrep can at least act as an efficient filtering technique . the fragrep tool can be downloaded from the url http://www.bioinf.uni - leipzig.de / software / fragrep/. suppose that the ncrna of interest contains k conserved sequence fragments , denoted by c1 , , ck , which occur in a given order in a set of known examples . in practice , the fragment ci is obtained as the consensus sequence of conserved blocks in a multiple alignment . scanning a genome t for these blocks , we expect to find a non - conserved sequence segment xi between any two fragments ci and ci+1 . , xk1 so that the string c1x1c2x2 xk1ck is contained as a substring in t. additionally , fragrep can take into account two further aspects : gap length bounds : for each xi , the user can specify the upper and lower bounds of the length , denoted by ui and i , respectively ; only the matches satisfying i |xi| ui will be taken into account by fragrep . mismatches : the fragment ci does not need to match the corresponding sequence part of t exactly ; the user can specify the number of mismatches ( mi ) . denoting ci as the modified fragment of ci by at most mi arbitrary mismatches we also refer to the string c1x1c2x2 xk1ck satisfying all these constraints as a matching subsequence of t. similar features are incorporated in other tools such as rnabob ( ftp://ftp.genetics.wustl.edu/pub/eddy/software/rnabob-2.1.tar.z ) , which is based on a nondeterministic finite state machine with node rewriting rules instead of the dynamic programming approach used by fragrep . the algorithm underlying fragrep essentially works in two steps:1.for each i [ 1 : k ] , compute a list of all occurrences of ci in t.2.apply a dynamic programming algorithm to the lists computed in the first step in order to find all matching subsequences in t. for each i [ 1 : k ] , compute a list of all occurrences of ci in t. apply a dynamic programming algorithm to the lists computed in the first step in order to find all matching subsequences in t. performing step 1 is straight - forward . as a result , we obtain an ordered list of indices yi=yi,1,yi,2, ,yi , li , with yi , j denoting the position of the j occurrence of ci in t , and li denoting the number of occurrences of ci in t. using y1 , , yk , we now set up a graph g = ( v , e ) with the vertex v = { ( i , j ) | i [ 1 : k ] , j [ 1 : li ] } and an edge between ( i , j ) and ( i+1 , j ) , whenever the corresponding occurrences of ci and ci+1 satisfy the upper and lower bounds for the gap in between . obviously , any path of length k 1 in g corresponds to a valid occurrence of c1 , , ck in t. for each ( i , j ) , i [ 1 : k ] and j [ 1 : li ] , we now computemi , j:={1iftcontains the modelc1,1,u1, ,ci,i , uiwithcioccurring at positionyi , j0otherwise . apparently , we have a valid occurrence of c1 , , ck in t whenever we have mk , j = 1 for some k [ 1 : lk ] . furthermore , we have m1,j = 1 for all j [ 1 : l1 ] ( since every occurrence of c1 is a valid occurrence up to the first fragment ) . now , using the graph g , we can compute all mi , j for i > 1 asmi , j={0ifmi1,j=0for all((i1,j),(i , j))e1otherwise . starting with i = 1 , the mi , now , each non - zero entry in the k row of m indicates at least one valid match . defining l : = maxi li , altogether k l matrix entries are computed , so that the overall time complexity for computing m is o(kl ) ; enumerating all matching subsequences of t can be done in o(kl + ) time . the match number is proportional to the tolerance allowed by the gap length bounds , that is , uii . while in principle is bounded by o(l ) ( since each occurrence of c1 might yield one matching subsequence for each occurrence of ck ) , one is naturally interested in queries that produce few significant rather than an abundance of insignificant matches . hence , for all practical purposes , o(kl ) should be seen as the dominating term in the running time . note that the above procedure can be easily adapted to start dynamic programming with the most informative sequence ca rather than c1 by starting in the a row of m. this increases the search efficiency and in practice leads to a significant speedup , in particular when short or ambiguous fragments are part of the pattern . the c++ implementation of fragrep has been optimized in this and several other algorithmic details to improve the runtime . this limitation could be relaxed by employing a different pattern matching algorithm that allows gaps at a prescribed gap function . the use of the exact smith - waterman local sequence alignment algorithm for this purpose is possible but computationally quite expensive . in our applications , gaps were restricted to specific positions . in this case , it is more efficient to break the search pattern into smaller units linked by short intervals of variable lengths . since the identification of these breaks is self - evident in the applications under our consideration , one obtains significantly more specific query patterns than for gapped alignment matches . a major issue in evaluating the quality of the matches produced by the above procedure is to assess how surprising a given match is , that is , how likely it is to be observed in a random sequence . to this end , fragrep provides p- and e - value - like ranking schemes that are computed from a dinucleotide - based markov model . in order to adapt the markov models to the occurrences of a fragmented rather than a contiguous sequence pattern , we let ej denote the event of c1 , , cj being observed at least once in a sequence of length n in the given order and satisfying the distance constraints given by the respective upper and lower bounds ui and i for each ci ( formally dealing with a probability space over all sequences of length n ) . furthermore , let q(j , l ) denote the event of observing cj at least once in a sequence of length l. our main interest obviously is to determine the probability p(ek ) . denote mt as the first order markov model resulting from the dinucleotide frequency distribution in t , we may compute pt(c1 ) : = p(c1|mt ) as the probability of the fragment c1 being produced by mt . in order to obtain p(e1 ) , we assume that the probability of c1 being produced at a position x in a sequence of length n is independent of the probability of c1 being produced at any other position y in t note that this assumption holds for the fragments that do not contain any substring of length 2 more than twice , and , for all practical purposes , is a sufficiently good approximation for the fragments that are short and contain only few repetitive substrings . now , under this assumption of independence , we obtain(1)p(e1)=q(1,n)=pt(c1)0v < n|c1|(1pt(c1))v the probabilities q(j , l ) can be computed analogously for arbitrary j and l. it is now easy to see that for j { 2 , , k } , we have(2)p(ej)=p(ej1)q(j , ujj)(since , in a sense , cj needs to be generated by mt in a sequence of length uj j + |cj| ) so that we finally obtain(3)p(ek)=p(e1)2jkq(j , ujj ) as described above , p(ek ) is the probability of observing at least one exact match of the given fragmented pattern in a sequence of length n. this value can be easily adapted to the scenario involving occurrences with a certain number of mismatches by modifying the probabilities pt(cj ) accordingly . since different matches obtained by fragrep generally have different mismatches in different positions , we can also compute the analogous probabilities for the individual matches detected by fragrep . finally , w(ek ) : = log ( p(ek ) ) provides a convenient and statistically well - motivated ranking scheme for the matches . we used fragrep to studying the evolution of a class of ncrnas in the slime mold dictyostelium discoideum that was discovered in an experimental survey by aspegren et al . ( 11 ) . we searched the genomic sequence ( 12 ) for the type - i ncrnas using the following simple pattern : table00gttgrccttacagcaa20120gtcaactg2 the first two columns contain the minimal and maximal distance between the pattern fragment ( always 0 for the first fragment , of course ) , the last column is the maximal number of mismatches that is tolerated in each fragment . ( 11 ) ranges between 58 and 88 nucleotides , so that 120 is a reasonable choice for the gap length s upper bound . we recovered 45 candidates , of which 34 were sufficiently similar to the experimentally determined sequences to be alignable . a neighborjoining tree summarizing both known sequences and the novel candidates detected by fragrep is displayed in figure 1 . we find that the class - i ncrnas are located in small clusters in all six chromosomes . interestingly , there are two subclasses , denoted by a and b , that alternate in the larger clusters , even though their directions on the chromosomes do not seem to follow a simple rule . in order to evaluate the performance of the algorithm underlying fragrep , we used the query derived from the vault rna a- , b1- , and b2-box consensus structures in kickhoefer et al . scanning all chromosomes of the human genome took less than 10 minutes on a standard desktop computer with a 2 ghz processor and 1 gb main memory . further results from scanning the human as well as the mouse , rat , and dog genomes are listed in table 1.table00trgcnnagygg10100ggttcgantcc10100ggttcgantcc1 in order to obtain an estimation of the influence of high gap - length tolerance on the running time , we modified the above query to allow for gap lengths up to 20,000 , resulting in an increase of the running time by less than five folds . note that this increase in fault tolerance also increased the number of matching subsequences to the order of hundreds of thousands , so that the significance of such highly fault tolerant queries is already limited from a practical point of view . in spite of this undue fault tolerance , the application of standard multiple alignment tools such as clustalw or dialign to a relatively small set of representatives of an ncrna class can be used to determine conserved sequence patterns , which can be turned into fragrep queries in a straight - forward manner . the fragrep tool can then be employed to find additional members of the ncrna family in related genomes . this approach yields significant matches where other sequence search tools such as blast fail to report useful results , while the structure based approaches such as infernal ( 4 ) are too costly . naturally , fragrep is not limited to ncrna detection ; the search for specific constellations of transcription factor binding sites is another potential application . furthermore , the approach could be easily adapted to searching peptide motifs in protein databases .

many classes of non - coding rnas ( ncrnas ; including y rnas , vault rnas , rnase p rnas , and mrp rnas , as well as a novel class recently discovered in dictyostelium discoideum ) can be characterized by a pattern of short but well - conserved sequence elements that are separated by poorly conserved regions of sometimes highly variable lengths . local alignment algorithms such as blast are therefore ill - suited for the discovery of new homologs of such ncrnas in genomic sequences . the fragrep tool instead implements an efficient algorithm for detecting the pattern fragments that occur in a given order . for each pattern fragment , the mismatch tolerance and bounds on the length of the intervening sequences can be specified separately . furthermore , matches can be ranked by a statistically well - motivated scoring scheme .

polarized cells have an uneven distribution of active atpases and they position their mitochondria so that atp is produced close to where it is needed . transportation of mitochondria to meet local energy needs is especially critical in neurons , where the site of mitochondrial production in the cell body ( davis and clayton , 1996 ) can be centimeters away from a growth cone or synapse with high local atp demand . mitochondria move along both microtubules and actin , using microtubule - based molecular motors for long distance movements ( morris and hollenbeck , 1995 ) . they are among the most abundant and most mobile membrane - bound organelles and , thus , are a major cargo for microtubule motors . conventional kinesin moves mitochondria to the plus ends of microtubules , while dynein moves them toward the minus ends ( tanaka et al . mutations in kinesin motors disrupt organelle transport causing mitochondria to bunch up in the axon or cell body , leading to neuronal dysfunction ( hurd and saxton , 1996 ) . mitochondria are distributed in cells with exquisite fine - tuning of both their location and number , and their transport is likely to be a very well - regulated process . their distribution varies in response to multiple regulatory cues such as energy requirements , growth factors , or the membrane potential of the mitochondria ( morris and hollenbeck , 1993 ; chada and hollenbeck , 2004 ; miller and sheetz , 2004 ) . for example , morris and hollenbeck ( 1993 ) observed increased anterograde transport of mitochondria to active versus inactive growth cones , while chada and hollenbeck ( 2004 ) showed that mitochondria accumulate at local sites of nerve growth factor application . a key finding for addressing these two questions came from recent genetic screens in drosophila . defects in axonal transport were lethal at the embryonic or larval stages in previous screens , hampering the identification of proteins involved in axonal transport of mitochondria in drosophila . however , stowers and colleagues created mosaic flies whose eyes were homozygous for a mutant allele while the rest of the body was heterozygous ( stowers and schwarz , 1999 ) . here , mutant flies were viable , but blind due to a loss of nerve excitation in the eye . two independent screens performed by stowers et al . and guo et al . used this system to identify two distinct components important for transport ; milton ( stowers et al . , 2002 ) , which coimmunoprecipitated with kinesin heavy chains , and miro ( guo et al . , 2005 ) , an integral mitochondrial membrane protein . ( 2006 ) links these two results by showing both that kinesin , milton , and miro work together in anterograde transport and that milton attaches kinesin to mitochondria through miro . glater et al . ( 2006 ) follow up on the original immunoprecipitation results showing interactions of milton with kinesin ( stowers et al . , 2002 ) . they demonstrate that milton forms a complex with the kinesin heavy chain and that no light chains could be found in the complex . this is different from most other known cargoes that bind to kinesin through the tetratricopeptide repeat ( tpr ) domains of the kinesin light chains ( for review see verhey et al . , 2001 ) . the only other example of cargo binding to the kinesin heavy chain is mrnp particles ( kanai et al . , 2004 ; ling et al . , 2004 ) ; however , unlike mitochondria , the adaptor for rna cargoes is yet unknown . these data are consistent with genetic experiments demonstrating that light chains are not required for transport of either mrna or mitochondria by conventional kinesin ( palacios and st johnston , 2002 ; glater et al . , consistent with some cargoes binding the heavy chains directly , there is a small cellular pool of kinesin heavy chain dimers , which are not attached to kinesin light chains ( gyoeva et al . , 2004 ) . milton not only interacts with kinesin heavy chains , but it competes directly with light chains to do so . thus , the kinesin light chains may simply be the most common of several cargo adaptor proteins , including milton , that bind to the same region of the kinesin heavy chain . . however , genome - wide two - hybrid screening identified miro as potentially interacting with milton ( giot et al . , 2003 ) . first , miro is an integral mitochondrial membrane protein found in all eukaryotes ( fransson et al . , 2003 ; aspenstrom et al . , 2004 ; frederick et al . , second , miro had previously been implicated in defects in axonal transport of mitochondria in drosophila ( guo et al . , normally miro has a transmembrane domain that integrates it into mitochondria , but overexpression of miro protein lacking this domain resulted in mislocalization of both miro and milton to the cytoplasm . it is very likely that miro is not only an adaptor for milton , but is also a critical regulator of kinesin - dependent mitochondrial transport . miro is a gtpase with both two gtp - binding domains and two ef hand domains that can potentially bind calcium . this means that either gtpase activity or calcium binding can regulate miro 's conformation and , therefore , its ability to recruit milton or arrange the milton kinesin complex at the surface of mitochondria . the existence of several splice variants of milton with different kinesin and miro binding properties implies that there might be several populations of mitochondria with different transport properties . none of these potential regulatory mechanisms has yet been tested , but some are very likely to occur . does miro regulate movement of mitochondria ? left to right : milton connects kinesin ( red ) to miro on mitochondria . miro has a gtpase domain , followed by two calcium - binding ef hand motifs , a second gtpase domain , and the transmembrane domain . gtp hydrolysis or changes in calcium binding by the ef hands may cause milton to dissociate from miro . milton splice variants differ in their kinesin - binding properties ( glater et al . , 2006 ) . in addition to recruiting kinesin via milton , miro may have other important mitochondrial functions . miro is present in yeast , whereas milton is not , and it is known to play a role in maintaining normal mitochondrial morphology . furthermore , yeast use actin rather than microtubules for mitochondrial transport , so the function of miro in yeast is clearly different . could miro be a more general mitochondrial adaptor that binds to other motile complexes ( such as arp2/3 , myosin v , or dynein ) besides milton ? recent observations of mitochondria transport in fly neurons in vivo demonstrated that there are two populations of mitochondria ; one moves predominantly anterogradely while the other moves retrogradely ( pilling et al . , 2006 ) . could it be that the gtpase or calcium switch on miro toggles between these two states or between microtubule- and actin - based transport ? it will take time to determine the exact role of miro in motor - based mitochondrial transport , but in the short term it is reasonable to ask whether kinesin is bound to retrogradely transported neuronal mitochondria . if not , could it be dissociated by gtp hydrolysis of miro ? this is an exciting and important area for further study because miro is likely to be the key universal adaptor and regulator for mitochondrial transport . ( 2006 ) emphasizes one general principle of motor protein design : although the motor domains seem to be universal for a particular class of motor proteins , the cargo - binding parts are not . motors of the same family are very divergent outside of the motor domain , and even a single motor can bind different classes of cargo using different parts of the molecule . this has been nicely demonstrated recently for cargoes of yeast class v myosin ( myo2p ) ( pashkova et al . , 2006 ) and is further emphasized by the observation of glater et al . ( 2006 ) that milton directly interacts with the kinesin heavy chain while most other known cargoes bind to the light chains . after all , they bind to one of two filament types and all of them move by hydrolyzing atp . however , motors such as conventional kinesin and cytoplasmic dynein probably move dozens of different cargoes along microtubules , and each of them must be transported and regulated differently . cargo interactions , as is nicely demonstrated by the present work of glater et al .

the kinesin motor typically binds to cargo through its light chains . in this issue glater et al . ( p. 545 ) demonstrate a new type of linkage through the adapter protein , milton , and the mitochondrial membrane gtpase , miro . this is an important result because it represents a new mechanism of cargo binding and because miro 's ability to bind gtp and calcium suggests that it is involved in the regulation of mitochondrial transport .

beta blockers ( bb ) and calcium channel blockers ( ccb ) are the main group of cardiac drugs in use for several years . unfortunately , they also remain common causes of cardiovascular collapse following accidental or intentional overdose . we encountered a rare event of toxicity with bb and ccb in a patient who was electively posted for interbody fusion between 4 and 5 lumbar vertebrae ( l4-l5 ) . a 72-year - old gentleman weighing 68 kg and 160 cm tall and hypertensive on treatment for past 10 years with metoprolol - xl-50 mg and amlodipine 5 mg was operated for anterolisthesis of disc at l4-l5 level with canal stenosis . he had previously undergone an uneventful surgery for right rotator cuff repair under general anesthesia 6 years ago . present preanesthetic check - up was normal with heart rate ( hr ) of 62/min , blood pressure ( bp ) of 110/74 mmhg , normal electrocardiogram ( ecg ) , and heart sounds on auscultation . his effort tolerance was only limited by pain in lower limbs . on the day of surgery anesthesia was induced with propofol 2 mg / kg intravenous ( iv ) and after confirming ventilation , vecuronium 0.1 mg / kg was given iv . anesthesia was maintained with oxygen in nitrous oxide , supplemented with isoflurane , vecuronium and propofol infusion , and morphine . intraoperative period of 4 h in the prone position was uneventful except for a drop in bp at induction to 80/54 mmhg , which was managed with a bolus of 250 ml crystalloid . he was extubated and vitals in the recovery room before shifting to intensive care unit ( icu ) were stable for hr of 64/min and bp of 108/54 mmhg . an hour after receiving the patient in icu , his bp dropped to 82/48 mmhg with no change in hr or consciousness . ecg was normal with a sinus rhythm and nonspecific t wave inversion in lead iii . arterial blood gas ( abg ) on room air showed normal oxygenation with metabolic acidosis with elevated strong ion difference ( ph - 7.268 , pao2 -112 , paco2 -40 , bicarbonate - 19.3 with be - 5.6 , and lactate - 1.9 ) . ultrasonography ( usg ) revealed completely collapsed inferior vena cava ( ivc ) which was treated with 2 l of crystalloid administered cautiously over 1 h without any significant improvement . the patient remained conscious and could move his lower limbs well ruling out any spinal shock . vasoactive drugs ( adrenaline , dopamine , and noradrenaline ) were serially added and escalated to maximum ( 20 mcg / min ) without any remarkable change in bp . cardiac evaluation by a senior cardiologist with bedside echo and enzymes ruled out any cardiac pathology . after administration of 6 l of crystalloids , bedside usg revealed an adequately filled ivc without any signs of fluid overload in the lungs . having ruled out cardiac pathology and hypovolemia as the cause of hypotension with worsening organ perfusion the possibility of bb and ccb toxicity was considered . as glucagon was not available in the institution , we started an infusion of insulin in dextrose at 0.15 u / kg / h ( 25% dextrose with 15 units of insulin at 60 ml / h ) ( glucose - insulin - potassium therapy ) along with calcium infusion at 0.5 g / h and potassium at 30 meq over 3 h. glucose and potassium values were monitored every hour , and the infusion was adjusted accordingly . within an hour of treatment with this regime the inotropes could be tapered and stopped within 2 h , urine output improved and euthermia was attained . anesthesia can cause myocardial depression in patients on bb and silent myocardial ischemia in those on ccb . however , the effect of anesthesia on patients receiving combination of ccb and bb is unique and was studied by samad et al . , who found that hypotension ( systolic bp < 90 mmhg ) and bradycardia ( hr < 50/min ) were more common in ccb and bb group ( 55% ) than in bb group ( 15% ) alone . negative inotropic effect of the combination in the presence of impaired left ventricular function has been suggested the cause for profound hypotension . the pathophysiology of toxicity arising from the two groups of drugs revolves around calcium signaling and cardiac myocytes switching from carbohydrates to fatty acids as preferred substrate for energy causing hyperglycemia and acidemia . the shock resulting from bb and ccb toxicity can be very resistant despite the use of all available catecholamines for resuscitation . predictably our patient too did not show any improvement in bp despite the maximum doses of adrenaline , noradrenaline , and dopamine . calcium salts have been recommended as initial therapy as positive inotropy may be beneficial , but they have varied results in improving hemodynamics . engebretsen et al . in the review on role of high dose insulin ( hdi ) in treatment of bb and ccb toxicity concluded that it was a promising treatment and with minimal adverse effect profile and ease of availability supported its use . the benefits are attributed to the promotion of carbohydrate metabolism rather than direct effects on the calcium channel . the insulin doses used have varied widely ranging from 0.015 to 22 u / kg / h . most of the patients receive between 0.5 and 2 u / kg / h . the recovery of shock should be monitored with improvement in organ perfusion rather than chasing traditional hemodynamic parameters . this case highlights the possibility of bb and ccb combination and anaesthetic interaction that can lead to prolonged hypotension that has not been reported earlier . timely consideration of this possibility and early initiation of hdi helped us avert severe organ damage . inability to measure the serum drug level remains a drawback though the administered doses were in the therapeutic range . profound and refractory hypotension can be encountered in hypertensive patients on chronic bb and ccb therapy in the absence of toxic levels . anesthesia in patients receiving these combinations can lead to not only transient intraoperative changes but prolonged hypotension and hypoperfusion that can lead to organ dysfunction .

the increasing use of beta and calcium channel blockers for management of cardiac comorbidities has led to more frequent complications in the postoperative period . anesthetic interaction with these drugs can lead to delayed manifestations of features of toxicity , even when administered in therapeutic doses . we report a case with an uneventful intraoperative period but profound bradycardia and hypotension postoperatively , only relieved with high - dose insulin therapy .

it is well known that cloned animals with identical genomes can be produced by somatic cell nuclear transfer ( scnt ) . scnt can be performed to preserve endangered species , produce transgenic models and propagate dogs with elite abilities . for propagation of dogs with elite abilities , seven cloned drug - sniffing dogs were produced using donor cells from a dog possessing a distinct ability to concentrate and identify specific smells among countless other scents . these cloned dogs displayed similar behavioral patterns , achieved a 100% rate in the selection test for becoming a drug detection dog , and obtained higher scores for the selection test than other naturally bred dogs . however , there is little information available regarding behavioral similarities such as learning , memory and exploratory patterns in cloned dogs . investigations using identical twins and families were performed in humans to examine the relationships between genes and cognitive abilities . the intelligence quotient scores of identical twins raised apart were highly similar ( nearly the same as those of identical twins raised together ) , while those of fraternal twins were less similar . several studies have investigated the heritability of traits in dogs . when the heritability of various behaviors of german shepherd puppies bred to be working dogs was investigated , a strong linkage between genetic factors and activity was shown , with the highest heritability score being 0.53 . in addition , there was a high genetic heritability score of 0.90 for aggression expressed towards strangers . however , other studies have reported conflicting results , showing low heritability of activity and cognitive abilities including memory and learning in dogs . therefore , there is currently no direct evidence of linkage relationships between exploratory patterns , cognitive abilities and genotype in dogs . cloned dogs with identical genomes have already been produced by scnt . since they are derived from the same cell donor , we hypothesized that the cloned dogs would show similar behavioral traits such as learning , memory and exploration . to investigate this hypothesis , two behavioral phenotypes were explored using untrained adult cloned dogs whose genome was derived from the same somatic cell donor . in this study , two female beagles ( cl1 , cl2 ) 6 years of age were generated by scnt as previously described . four more cloned dogs ( cl3 , cl4 , cl5 and cl6 ) 5 years of age were also produced by scnt . the results revealed no clinical symptoms of disease during continuous monitoring throughout the experimental period . since all six dogs were derived from the same fetal fibroblast donor cell line , they have identical nuclear genotypes . four healthy , age matched female beagles produced by natural breeding were used as controls . all animals used in this study were reared in the same environments and maintained in accordance with recommendations in the guide for the care and use of laboratory animals published by the institutional animal care and use committee ( iacuc ) of seoul national university ( approval no . all dogs were fed a constant amount of commercial adult dry food ( natural balance ; natural balance pet foods , usa ) and water daily . several tasks are commonly used to evaluate cognitive ability of dogs resulting from genetic and environmental factors . among them , a reversal learning task using the y - maze test was selected for this study to evaluate learning and memory ability , with some modifications . the testing apparatus was a plastic t - maze ( 4 foot wide 8 foot length 3 foot height ) fence . all dogs could receive the food rewards from only one side of the maze ; therefore , they were trained to search only one side as the obligatory preferred site . the time to reach to the obligatory preferred site was recorded and the values were compared between control and cloned dogs . following the obligatory preference enforcement periods , the dogs were immediately subjected to a reversal learning task of the y - maze test . for the reversal learning , the food reward was placed in the obligatory non - preferred site . once the choice was determined , whether the result was correct or incorrect was recorded . moreover , the times to reach the non - preferred site were also measured . the total number of incorrect choices ( tic ) was calculated for each dog during the reversal learning periods . in addition , the total number of incorrect choices made before ( ibfc ) and after the first correct choice ( iafc ) was evaluated to determine the cognitive performance of dogs . after consuming the reward , after each dog was removed from the testing area , the floor of the maze was mopped with alcohol to erase any scents left behind by the previous dog . each dog was placed in the testing room ( 3 3 m ) for three minutes . using the harvard panlab software , the testing area was divided into three sections ( border , periphery and center ) and the following three categories of movement pattern were subsequently evaluated : time into zone , distance in zone and mean speed in zone . specifically , we computed the ratio of the standard deviation of cloned dogs to that of control dogs . similarly , we calculated the ratios of the standard deviations of each group of six dogs to that of groups with four dogs in all combinations of the group divisions of 10 dogs . the p value was then obtained as a low percentile of the baseline ratio among ratios . because cloned dogs have much more similarity than control dogs , this method results in the p value becoming small . therefore , a p value less than 0.05 was taken to indicate that the variance of the cloned dogs is significantly lower than that of control dogs . the variation of time to reach the obligatory preferred site in cloned dogs was significantly lower than that in control dogs ( p = 0.04 , panel a in fig . although cloned dogs showed no significant similarities when the time to reach the non - obligatory site was analyzed ( p = 0.16 , panel b in fig . 1 ) , cloned dogs showed a significantly lower variance of tic ( p = 0.01 ) than control dogs ( panel c in fig.1 ) . however , cloned dogs did not show a significantly lower variance in the ibfc and iafc ( p = 0.06 , 0.09 ; panels d and e in fig . the permutation test ( table 1 ) revealed that the cloned dogs showed significantly less variation in the following categories of open field test : time in the center and periphery and mean speed in the center ( p < 0.05 ) . however , no significant variations were found in the remaining categories of movement patterns : time in the border , distance and mean speed in the border and periphery region . the variation of time to reach the obligatory preferred site in cloned dogs was significantly lower than that in control dogs ( p = 0.04 , panel a in fig . although cloned dogs showed no significant similarities when the time to reach the non - obligatory site was analyzed ( p = 0.16 , panel b in fig . 1 ) , cloned dogs showed a significantly lower variance of tic ( p = 0.01 ) than control dogs ( panel c in fig.1 ) . however , cloned dogs did not show a significantly lower variance in the ibfc and iafc ( p = 0.06 , 0.09 ; panels d and e in fig . the permutation test ( table 1 ) revealed that the cloned dogs showed significantly less variation in the following categories of open field test : time in the center and periphery and mean speed in the center ( p < 0.05 ) . however , no significant variations were found in the remaining categories of movement patterns : time in the border , distance and mean speed in the border and periphery region . in the present study , we investigated whether dogs cloned from one cell donor behave similarly as age - matched control dogs . as expected , cloned dogs showed similar learning and memory behaviors , as well as exploratory activity , while the control dogs showed more variability amongst themselves than the cloned dogs in their learning and memory behaviors , as well as their exploratory activity . these results indicate that cloned dogs have similar learning and memory behaviors and exploratory activity , which supports the hypothesis that these six cloned dogs with identical genetics behave more similarly to each other than age - matched control dogs . these findings are concordant with those of studies of cloned mice that also showed similar learning , memory and exploratory activity compared to controls . these results also demonstrate a strong linkage between learning , memory , exploratory behaviors and genetics because control dogs and cloned dogs were reared under the same conditions . exploratory behavior is also considered a high level aspect of sensory processing involved in investigating novel stimuli rather than an instinctive behavior . exploratory behavior partially depends on motor and spatial capabilities and on the motivation to explore . in this study , each test was 3 min in duration , whereas previous open field tests in dogs used sessions lasting 10 min . recently , one paper reported that 3 min short durations in open fields yield valid behavioral measures and would reduce biased results related to individual variations in temporal activity patterns . in the present study , the distance , speed displayed in certain areas of the testing room and time spent in these areas were studied as measures of locomotor or exploratory behavior . in agreement with the measurement approach of previous studies , these factors were used as markers of locomotion and exploration in the open field . furthermore , spontaneous activity including locomotion , exploratory behavior and social responsiveness is related to the aging in dogs . because they are at similar age , none of the parameters measured in dogs showed significant differences . however , the mean speed in the center as well as the time in the center and periphery region showed less variation among cloned dogs than control dogs . it can be assumed that the lower variation of mean speed and time in certain regions in cloned dogs was due to the genetic similarities among them ; therefore , genetic factors , which may control the neural circuitry of the brain , also appear to influence exploratory patterns in cloned dogs . it is already known that cloned dogs derived from one genetic source have completely identical genetic information . however , the mitochondrial dna of cloned dogs originated from the source of recipient cytoplasts . to determine the effects of the mitochondrial dna ( mtdna ) genotype on behavior , it is essential to produce cloned dogs with the same mtdna genotype . in the present study , because only two cloned dogs shared the same mtdna , an exact relationship between learning , memory behavior and mtdna genotype could not be demonstrated . although only six cloned dogs were used in the present study , this number is relatively large considering that they have completely identical nuclear genomes . however , since this study was performed with cloned dogs derived from a single genetic source , further and more conclusive studies using various breeds and greater numbers of cloned dogs are necessary the results presented herein will help address national security concerns by expanding and accelerating the available pool of trained detection dogs . furthermore , this study may lead to interest among dog owners who wish to clone their pets through scnt .

somatic cell nuclear transfer allows generation of genetically identical animals using donor cells derived from animals with particular traits . to date , few studies have investigated whether or not these cloned dogs will show identical behavior patterns . to address this question , learning , memory and exploratory patterns were examined using six cloned dogs with identical nuclear genomes . the variance of total incorrect choice number in the y - maze test among cloned dogs was significantly lower than that of the control dogs . there was also a significant decrease in variance in the level of exploratory activity in the open fields test compared to age - matched control dogs . these results indicate that cloned dogs show similar cognitive and exploratory patterns , suggesting that these behavioral phenotypes are related to the genotypes of the individuals .

in a patient underwent aortic valve replacement ( avr ) due to bicuspid aortic valve ( bav ) insufficiency without marked dilation of ascending aorta , the development of delayed - typed aneurysmal complication of ascending aorta has been often reported because the dilated aorta tends to grow insidiously with age . a 58-year - old man who underwent avr with mechanical valve due to severe aortic regurgitation secondary to bav 7 years previously presented with exertional chest discomfort for 1 year . an echocardiography showed a well - functioning mechanical aortic valve without any significant abnormal findings . cardiac multidetector computed tomography ( mdct ) revealed a huge saccular aortic root aneurysm ( 79.7 mm 72.8 mm in size ) compressing the proximal right coronary artery resulting in 90% eccentric diffuse luminal narrowing . the patient subsequently underwent open - heart surgery with resection of the ascending aortic aneurysmal sac and consecutive ascending aorta and hemi - arch replacement using a graft . after successful avr in the patient with bav insufficiency and mildly dilated ascending aorta , a regular aortic imaging such as cardiac mdct with aortography would be helpful to monitor the morphology and size of ascending aorta and related complications to guide future management . bicuspid aortic valve ( bav ) is the most common congenital cardiac anomaly , occurring in 0.46% to 1.37% of the general population . . abnormalities of the aorta such as dilatation , bicuspid aortopathy , coarctation , cystic medial necrosis , and dissection are also often present in affected persons and can be potentially life threatening . the prevalence of dilatation of the ascending aorta among persons with a bicuspid aortic valve is reported in anywhere from 20% to 84% of patients . after successful aortic valve replacement ( avr ) due to bav insufficiency , the dilated aorta tends to grow insidiously with age compared to a normal tricuspid aortic valve . development of large , delayed - typed aneurysmal change following avr has been previously reported . hereby , we report a rare complicated case with an unusual type of aortic dilatation 7 years post - avr that was performed in the setting of bav insufficiency . a 58-year - old man came to our outpatient department complaining of exertional dyspnea ( nyha class i or ii / iv ) and intermittent chest discomfort . his chest pain and dyspnea had been getting progressively worse during the last 6 months . on physical examination , seven years ago , the patient had initially presented to our clinic complaining of exertional dyspnea ( nyha class ii / iv ) . an initial transthoracic echocardiography demonstrated a bav with severe aortic regurgitation but without significant calcification . the echocardiogram also demonstrated normal left ventricular systolic function ( ejection fraction : 60% ) with eccentric hypertrophy and loss of a wave due to atrial fibrillation . the diameter of the aortic root was measured to be 4.56 cm at that time . invasive coronary angiography with aortography before surgery revealed no significant coronary luminal narrowing and a mildly dilated ascending aorta ( fig . 1 a and b ) . he underwent successful avr using a mechanical prosthetic valve ( saint jude # 25 ) without additional aortic surgery . ( a and b ) preoperative ( november 2008 ) coronary artery and aorta angiography demonstrating a normal right coronary artery with a mildly dilated ascending aorta without significant aneurysmal change . his antihypertensive regimen included fimasartan 30 mg daily , nebivolol 2.5 mg daily , and indapamide 1.5 mg daily . a follow - up echocardiography demonstrated a well - functioning prosthetic aortic valve and normal left ventricular systolic and diastolic function . in order to evaluate the cause of dyspnea with chest pain two - dimensional coronary cross - section images revealed a large saccular - typed ascending aortic aneurysm ( 79.7 mm 72.8 mm in size ) just distal to the prosthetic aortic valve annulus ( fig . 2 a and b ) . curved multiplanar reformatted images also demonstrate diffuse , eccentric 90% luminal narrowing of the proximal right coronary artery ( rca ) resulting from external compression by the aneuysmal sac . also noted within the aneurysm was a low - density signal suggestive of mural hematoma or thrombi ( fig . three - dimensional volume rendering images with coronary endoluminal and thrombotic settings confirmed compression of the proximal right coronary artery lumen by the aortic root aneurysm ( fig . 3a the patient subsequently underwent open - heart surgery with resection of the ascending aortic aneurysmal sac and consecutive ascending aorta and hemi - arch replacement using a graft ( hemashield # 28 ) . the pathology of the resected aneurysmal sac demonstrated a vascular wall with myxoid degeneration and dystrophic calcification with organized thrombi . the patient 's post - operative course was uncomplicated , and he has been doing well in outpatient follow - up . ( a and b ) 2-dimensional coronal cross - section images demonstrate a large saccular aneurysm of the ascending aorta just distal to the previously replaced prosthetic valve ( 79.7 72.8 mm in size ) . it appears to contain mural thrombi or hematoma and is seen here compressing the proximal rca . ( c ) curved mpr image demonstrates the compressed proximal rca by the large aneuysmal sac with mural low - density opacities suggesting thrombi or hematoma . aortic aneurysm with mural thrombi or intramural hematoma ( red arrows ) ; eccentrically compressed proximal rca ( yellow arrows ) ; normal mid - rca ( green arrow ) ; prosthetic aortic valve ( blue arrow head ) . mdct = multidetector computed tomography , mpr = muliplanar reformatting , rca = right coronary artery . cardiac mdct 7 years after aortic valve replacement , ( a d ) 3-dimensional volume rendering images demonstrate the saccular type of aneurysm with a narrow neck . the proximal rca is externally compressed by theaneurysmal sac with mural thrombi or hematoma on endoluminal or thrombotic setting . aortic aneurysm with mural thrombi or intramural hematoma ( red arrows ) ; eccentrically compressed proximal rca ( yellow arrows ) ; normal mid - rca ( green arrow ) ; prosthetic aortic valve ( blue arrow head ) . in a patient with bav insufficiency including severe stenosis or regurgitation , avr is usually recommended instead of valve repair according to the current valvular heart disease guidelines . three different types of ascending aorta dilatation in the patient with bav are known as follows ; type 1 is most common type and characterized by dilatation of tubular ascending aorta ( primarily along convexity of aorta ) with mild - to - moderate root enlargement . the patients with type 1 have an older age at diagnosis , higher incidence of aortic stenosis , and the right - left cusps fusion pattern . type 2 is associated with arch dilatation and involvement of tubular ascending aorta , with relative sparing of root . type 3 involves aortic enlargement confined to aortic root with normal tubular ascending aorta and arch sizes . this case demonstrates a saccular aneurysm which does not fall within the classic classification system based on the current literature . furthermore , a large aneurysmal sac compressing the rca appears to be a very rare and complicated presentation . in patients with bav and dilation of the aortic root or ascending aorta , surgical intervention to replace the aortic root and/or ascending aorta if the diameter of the aortic root or ascending aorta is > 5.5 cm , prophylactic replacement of the ascending aorta is strongly recommended regardless of symptoms to avoid life - threatening aortic dissection . if the diameter of the aortic root or ascending aorta is > 5.0 cm and the patient has risk factors for aortic dissection including rapid aortic growth rate ( 0.5 cm / y ) and familial history of aortic dissection or if a skillful surgical team performs the procedures to the patient at low operative risk , surgical correction of the ascending aorta is also reasonable even in asymptomatic patients . furthermore , for patients with bav undergoing avr because of severe aortic insufficiency , replacement of the ascending aorta is recommended if the diameter of the ascending aorta is > 4.5 cm based on expert opinion of current guidelines . in these cases , close evaluation of the morphology and size of ascending aorta should be performed before operation . after successful avr without replacement of the ascending aorta due to any cause in patients with bav , aortic magnetic resonance angiography or computed tomography such as chest or cardiac mdct with aortography is recommended to monitor the size and morphology of the ascending aorta . these evaluation should be performed annually especially in patients with an aortic diameter > 4.5 cm after successful avr according to expert recommendations , . this case suggests that the use of aortic and coronary imaging using cardiac mdct may be helpful in elucidating less common causes of vague or unexplained chest discomfort and dyspnea in the absence of significant abnormalities on echocardiography after aortic valve surgery . we present a rare case of huge saccular aneurysm compressing the rca 7 years after avr in a patient with bav insufficiency . in a case of avr without surgical repair or replacement of the ascending aorta due to any cause , cardiac mdct with aorta and coronary angiography would be helpful to monitor the morphology and size of ascending aorta and to guide future management .

abstractbackground : in a patient underwent aortic valve replacement ( avr ) due to bicuspid aortic valve ( bav ) insufficiency without marked dilation of ascending aorta , the development of delayed - typed aneurysmal complication of ascending aorta has been often reported because the dilated aorta tends to grow insidiously with age.case summary : a 58-year - old man who underwent avr with mechanical valve due to severe aortic regurgitation secondary to bav 7 years previously presented with exertional chest discomfort for 1 year . an echocardiography showed a well - functioning mechanical aortic valve without any significant abnormal findings . cardiac multidetector computed tomography ( mdct ) revealed a huge saccular aortic root aneurysm ( 79.7 mm 72.8 mm in size ) compressing the proximal right coronary artery resulting in 90% eccentric diffuse luminal narrowing . the patient subsequently underwent open - heart surgery with resection of the ascending aortic aneurysmal sac and consecutive ascending aorta and hemi - arch replacement using a graft.conclusion:after successful avr in the patient with bav insufficiency and mildly dilated ascending aorta , a regular aortic imaging such as cardiac mdct with aortography would be helpful to monitor the morphology and size of ascending aorta and related complications to guide future management .

paratuberculosis ( map ) , is a disease affecting mainly domestic but also wild ruminants , including mouflons ( ovis musimon ; wild sheep ) [ 13 ] . in wild ruminants , paratuberculosis often manifests subclinically without overt symptoms which makes the disease more concerning from an epidemiological point of view [ 3 , 4 ] . during the subclinical as well as clinical phase of the infection , the animals spread the agent into the environment by faecal shedding , where it can act as a source of infection for other animals . , animals intended for transport across different regions or countries must undergo quarantine lasting at least 30 days with respect to major epizootic and notifiable diseases , such as bluetongue , bovine tuberculosis , brucellosis , and foot and mouth disease . paratuberculosis does not belong to the above mentioned group and the examination of imported ruminants therefore depends on the preference of the owner of the receiving farm . in addition , due to economic constraints , the belief that paratuberculosis does not represent a problem , or because of its low priority compared to other animal diseases , paratuberculosis control programmes in europe are mostly based on voluntary participation . in some countries , paratuberculosis numbers among the notifiable diseases , but there is no obligation to test animals with clinical signs . thus , animals are not examined due to concerns regarding their obligatory elimination or problems with selling animal remains ( herds with paratuberculosis status ) . animals can be negatively influenced either by physical ( hunger , thirst , injury , etc . ) or psychological / ethological stress ( handling , restraint , new environment , etc . ) . compared to domesticated , calm animals , wild species with excitable temperaments react to stressors more sensitively . while physical stress is connected with pain , psychological stress is characterised by fear which is one of the most important stressors . various stressors can detrimentally affect the immune system of animals , causing disruption of commensal microflora [ 10 , 11 ] , enhancing susceptibility to diseases , or activating latent infections . in the best case scenario , animals are examined for the presence of map before their import into a new farm . healthy animals diagnosed as map - negative are then released into the area of a new farm with other animals . the goal of this work was to assess the influence of stress connected with transport to a new farm in animals that were negative for map but which had originated from a herd in which map was previously detected . although pcr is not able to distinguish between live and dead organisms , a key main advantage lies in its higher sensitivity compared to cultivation . in the case of mouflons ( sheep ) in which cultivation is complicated and the presence of nongrowing isolates was described , real time quantitative pcr ( qpcr ) represents a sensitive tool for detection of map , based on copy number of is900 in map chromosome . the imported group of mouflons consisted of six individuals of different ages ; two mouflon ewes with their offspring were included ( table 1 ) . all animals came from a mouflon farm free of clinical paratuberculosis , although map dna was found in the faeces of a few individuals ( 18.2% positivity ; low concentrations between 10 and 10 map cells ; data not shown ) based on copy number of is900 in map chromosome . in the six animals selected , map dna was repeatedly ( twice ) not detected in their faeces ( is900 qpcr ) four and two weeks before the transportation . all animals were transported from the farm of origin to the receiving farm in boxes used for animal transport ( one hour journey ) . the experiment was conducted on an eleven hectare farm which consisted of about 70 heads of mouflons and 25 heads of fallow deer . the farm has for many years been subjected to monitoring for the presence of paratuberculosis . in the mouflons , the presence of map however , at the time of the experiment , neither culture nor qpcr revealed map in the mouflons inhabiting the receiving farm . after arrival , the mouflons were placed into a quarantine enclosure ( circle ground plan , 50 m ) which consisted of an open space connected with a sheltered sleeve used for capturing animals and the collection of samples ( tunnel connected with the enclosure and with reclosable partitions on both ends ) . the ground in the quarantine was covered with sand ( not originating from the farm ; 10 cm layer ) and the mouflons were fed with map - free hay . the experiment lasted 17 days which included 12 days in the quarantine enclosure and subsequent five days when the mouflons were released into the area of the farm with other mouflons . during the quarantine enclosure period seven times during quarantine , samples of blood were collected from each animal into a vial with edta ( amresco , solon , oh , usa ) , and samples of milk were collected ( on the same days as blood samples ) from mother ewes ( animals number 2 and 3 ; table 1 ) . dna isolation from faeces was performed using a modified qiaamp dna stool kit ( qiagen , hilden , germany ) protocol . according to the procedure described by slana et al . blood was processed according to the instructions of a commercial blood and tissue kit ( qiagen ) . the absence of map in hay used for feeding was confirmed using is900 qpcr on dna extracted using the powerfood microbial dna isolation kit ( mobio , carlsbad , ca , usa ) . each qpcr run included a calibration curve to allow calculation of the absolute number of map cells per gram or ml of the sample . all is900 qpcr analyses were performed on a lightcycler 480 instrument ( roche diagnostics ) . statistical analysis was performed using the graphpad prism 5.04 ( graphpad inc . ) statistical software . the frequencies of occurrence of positive results in the quarantine and postquarantine periods were compared using fisher 's exact test . none of the animals showed overt clinical signs of disease or the presence of map in faeces before the transport . in spite of this , map dna was found in the faeces of all animals either on the first or second day after their transport . during quarantine , map dna was continuously found in the faeces , although the shedding for individual animals was irregular . the highest number of positive results ( in days ) was found for lamb number 5 and the second highest rate in its mother ( number 3 ) . after the release of animals , map was detected for a further two days , after which it was not detected for the subsequent three days , except for one positive case ( lamb number 5 ; table 1 ) . statistically significant differences were found between frequencies of map - positive animals ( young and adult ) in quarantine and after it and between adult animals in the quarantine and postquarantine periods ( table 2 ; p > 0.05 ) . odds ratios ( odds of is900-positive result in animals in quarantine compared to animals out of quarantine ) were 3.3 and 3.1 for the group of adults and all animals ( young and adults together ) , respectively . examination of blood was negative in all cases ( table 1 ) . on two occasions , a very low map positivity was found in the milk of both ewes ( table 3 ) . the hay used for feeding was demonstrated to be map - negative ( data not shown ) . various stress factors can significantly influence the microbial diversity of gut microflora [ 10 , 11 ] . in addition , disturbing the balance and diversity of gut microflora can affect levels of pathogens in the gastrointestinal tract and lead to their shedding from subclinically infected animals . in our case , handling , transport , a novel environment , and dietary changes could have induced the shedding of map in the mouflons ( tables 1 and 2 ) , which were previously demonstrated to be clinically healthy and negative by pcr examination . these mouflons , which originated from a herd in which map was previously detected in a few animals using qpcr , must have been therefore challenged by map infection before the transport . these animals then harboured the latent form of paratuberculosis , which is characterised by an absence of map shedding in faeces and clinical symptoms . a similar effect was observed in clinically healthy cattle and wild deer in which stress probably activated latent malignant catarrhal fever [ 19 , 20 ] . described the reactivation of herpes simplex virus infection in mice after their exposure to restraint stress . generally , paratuberculosis characterised by a long incubation period is mostly induced by stress factors occurring during the life of animals , such as late pregnancy or early lactation . lamb number 5 was the highest map shedder in this study . in lamb number 6 , the frequency of map shedding was comparable with other animals ( table 1 ) . however , due to the low age of the lambs ( both 1/4 of year ) and slow character of the disease , the detection of map in these lambs was probably caused by thus , the demonstration of map in the lambs would most likely reflect the presence of map in other animals , particularly in their mothers . the shedding in faeces was not regular in individual animals but was intermittent , which is characteristic for paratuberculosis . map shedding in milk is also known to be irregular and its likelihood is higher in symptomatic compared to asymptomatic animals [ 23 , 24 ] . the proportion of map shed in faeces is generally higher compared to milk , which could explain why map was observed only twice in the milk of the two ewes over the examined period ( table 3 ) . blood samples were always negative which could be explained by the short - term influence of stress . this stress manifested as map shedding through faeces but not as systemic map bacteraemia , which occurs especially in animals in late stages of infection with accompanying clinical symptoms . previously , map was detected in the blood of one bull which shed a high concentration of map in its faeces and showed clinical signs of the disease . map was also detected in the blood of subclinical cows ; however , the number of positive cases was significantly lower compared to animals in the clinical phase . after the release of the animals from quarantine , map was still detected in faeces for two days , but then the excretion was undetectable . except for one case ( lamb number 5 ) , no positive finding was made on the subsequent three days ( tables 1 and 2 ) . releasing the animals from quarantine together with their grazing on pasture instead of hay feeding could be probably the most important factors which decreased map shedding in the imported animals . therefore , novelty , transport , novel environment , or change of feeding , together with the enclosure of animals in a confined and cramped space could be considered as the factors which induced the map shedding in this study . in this regard , the placement of imported animals into quarantine can help to distinguish truly healthy animals from those with latent map infection . the capture of animals for sample collection did not seem to impose a significant stress as almost all samples collected from animals released out of quarantine were negative ( tables 1 and 3 ) . in conclusion , as paratuberculosis does not belong to the group of major epizootic and notifiable diseases according to european legislation , animals transported to a new farm do not need to be examined for the presence of map or to undergo quarantine . however , in this study we observed map shedding from healthy mouflons with no clinical symptoms and previously determined as map - negative after their transport to a new farm . the results of this study call into question a sole reliance on examination of animals in their environment before transport and also underline the risk of admitting such animals onto new farms without previous placement in quarantine and further examination . obviously , therefore , clinically healthy and diagnostically negative animals coming from exporting farms can potentially represent a risk of paratuberculosis for other animals in a receiving farm and its environment . for this reason , we recommend that animals be examined not only before the transport to a new farm but also after the transport . we suggest keeping animals in a quarantine enclosure until the results of the examination are known . due to the intermittent shedding of map ,

there is no european legislation concerning paratuberculosis that requires that imported animals be kept in quarantine and commonly they are directly released into areas with other animals . in this study , detection of latent infection of paratuberculosis in healthy mouflons previously diagnosed as paratuberculosis - free , but originating from a real time quantitative pcr- ( qpcr- ) positive herd , occurred after their transport to a new farm . during a twelve - day quarantine period , all mouflons irregularly shed mycobacterium avium subsp . paratuberculosis ( map ) in faeces , and in a small number of cases also in milk . after the animals were released from quarantine , map was detected for a further two days , after which , testing was negative , except in one case . therefore , the stress connected with transport , novel environment , dietary change , or limited area with high density of animals might have contributed to the induction of paratuberculosis and the shedding of map from the animals , previously diagnosed as map - negative . according to these results , the keeping of imported animals in quarantine and their examination for map presence not only before the transport but also afterwards should be recommended . the designation of a particular area of a farm as a quarantine enclosure could help to mitigate the impact of stress caused by a confined space with a high density of animals .

large format sections ( synonym macrosections ) ( ls ) comprise an entire histological section of the organ under study . ls allow the histological study of a large part of the organ of interest , that include not only the lesions but also the surrounding tissues possibly inclusive of the entire margins at least along a plane of sectioning . the purpose of the present paper is to review the history and the present practical diagnostic applications of ls . ls have been introduced in surgical pathology more than a century ago . the first study based on ls was published in 1906 by cheatle who realized that most patients were diagnosed to be affected by breast cancer only when the disease was too advanced to be cured . therefore , as breast was the first organ to be studied , which has generated a large number of papers , this paper will first deal with breast tumours , followed by the application of ls in other organs . dr . cheatle used ls in cases of breasts affected by cancer to better understand the relation between the neoplastic mass and the surrounding normal tissue and the possible existence of premalignant changes [ 13 ] . the relation between breast cancer and the surrounding tissue was the object of a further study in 1939 by ingleby and holly . subsequently , marcum and wellings improved and simplified the method which then was applied to study the early phases of breast cancer development [ 6 , 7 ] . in 1973 , wellings and jensen analysed cases of in situ and invasive ductal and lobular in situ and invasive carcinoma leading to the proposal that most breast carcinomas arise in the terminal ductular - lobular unit ( tdlu ) , in spite of the different morphological features . these papers were paralleled with useful studies on mouse and human breasts to better understand the breast microanatomy [ 911 ] which was also accurately described by going and moffat together with the distribution of the mammary lobes . although ls , especially at the beginning , were used in a few laboratories only , their impact on the evaluation of multifocality and multicentricity of breast cancer appeared relevant . egan , in a seminal paper , demonstrated that the incidence of cases showing multifocal breast cancer was more frequent than that obtained from studies based on conventional small block slides . this led to the discovery that multifocal breast carcinomas have a worse prognosis in comparison with unifocal lesions . similar results were subsequently obtained in 1986 by sarnelli and squartini and , more recently , by tot et al . employed ls for a three - dimensional reconstruction of the breast glandular tree , in order to evaluate the extention and type of growth of different types of in situ duct carcinomas ( dcis ) [ 19 , 20 ] . these studies greatly increased the knowledge on the extent and distribution of dcis , as they demonstrated that dcis is frequently a multifocal process and that multifocality is a typical feature of low grade rather than high grade dcis . along this line were the results obtained on multifocality and multicentricity by tot et al . in the last decade , ls were demonstrated to be useful to correlate radiological findings and pathology as it is simple to compare radiological images to the large histological sections . specifically the widespread use of mammographic screening for early detection of breast cancer identifies numerous benign lesions that can be difficult to interpret on the mammogram . this was mostly done by tot et al . who gave a better definition of several benign breast lesions , among which radial scar , which does not need any further diagnostic investigation . more recently tot and tabr correlated the nuclear magnetic resonance ( nmr ) findings with ls demonstrating that ls can help to better diagnose the different histological lesions and features that characterize all the breast malignant tumours . in spite of their utility in diagnostic pathology , ls are still used in a relatively few laboratories , mainly as a consequence of the fact that their preparation is perceived as more timeconsuming and expensive than conventional blocks . this difference is only apparent as in ls a large portion of tissue is examined that is far superior to the conventional small blocks . tot calculated the costs of ls in daily practice and compared them with those obtained from conventional blocks , demonstrating that ls costs do not substantially differ from those of accurate conventional blocking . tucker calculated the cost of ls in a breast care centre and concluded that the ls costs increase from 6.02 usd in cases of lumpectomies to 18.58 usd in cases of mastectomies which was regarded relatively inexpensive and balanced by a better staging and more accurate evaluation of resection margins . as a consequence additional surgical procedures were lowered in number , which led to a decrease of the overall cost of each single patient 's treatment . the method to obtain ls has been previously described in several papers , as well as it is described by tucker in the present issue . at our institution , the breast specimens ( as well as specimens from other organs ) are sliced with a large blade , into sections 5 to 10 mm thick , possibly under radiological guidance or following indications given by the surgeon . one to three ls are obtained from each case and in addition the of rest of the surgical specimen is embedded using traditional small blocks . when the ls major axis is less than 5 cm , the entire specimen is embedded using the same procedure employed for prostatectomies as illustrated by the specific paper of this issue . this last procedure is less time consuming with a shorter turn - around time to obtain the ls . in addition these smaller ls are easy to manage at the microscope and can be easily digitalized into virtual slides with the proper hardware ( personal comunication ) . paraffin blocks from paraffin embedded ls [ 26 , 27 , 29 ] are then cut with a dedicated macrotome . orientation is maintained during the whole embedding process and reported in the final slide . when immunohistochemistry or molecular studies are needed , areas of interest are selected from the ls and cut to obtain small conventional blocks . ls can be used also for 3-dimensional reconstructions as previously shown [ 19 , 29 ] and summarized as follows . ls blocks are deparaffinided by melting paraffin at 60c from 3 to 4 hours , subsequently tissue is immersed in xylene ( four times ) for at least 24 h to remove residual paraffin . tissues are then rehydrated as follows : 50% absolute alcohol and 50% xylene ( 1 hour ) , absolute alcohol ( 2 hours ) , and 70% alcohol ( 2 hours ) . blocks are washed overnight in distilled water , stained in harris ' hematoxylin for 4 - 5 min , rinsed in tape water for 10 min , and immersed in four baths of acid alcohol for 8 min each . finally tissues are dehydrated , through a graded series of alcohol to xylene , and finally immersed in methyl salicylate for one night . the h&e - stained ls slide is used to retrace the lesions to examine on the corresponding cleared tissues . ls are useful during the everyday breast routine practice to better evaluate the tumour dimension , the in situ carcinoma extension , and the resection margins . in the series studied by foster et al . , ls gave more information than conventional blocks in 172 cases out of 656 , as they evidenced additional findings of potential clinical use , as involved margins , minute multiple foci of invasive or in situ carcinoma , or change in size and extent of the tumour under study . correct evaluation of resection margins has become an increasingly important issue especially in cases treated with quadrantectomy . ls are cut and oriented according to the radiological images and the indications given by the surgeon , and orientation is maintained during the paraffin embedding procedures . this allows the exact evaluation of the relationship between invasive or in situ carcinoma and the adjacent surgical margin . by contrast conventional blocking is based on gross inspection at naked eye of the lesions and on palpation of the tissues ; therefore , minute cancer foci , immersed within the fatty breast stroma can escape from examination ( figure 1 ) . in addition having the possibility to visualize the whole section of the breast specimen , it is easier to distinguish the real inked margin from ink migration through tissue fissures frequently present in breast tissues as also stated by tucker ( figure 2 ) . compared two series of breast carcinomas , one studied with conventional histological method and the second studied with ls . accordingly the correct size of the tumour was assessed in all the cases studied with ls , while it was assessed in 63% only of the cases studied by conventional histology . we compared the tumour size on a series of 102 consecutive quadrantectomies evaluated with both ls and conventional blocks . accordingly , in 9/102 ( 8,8% ) ls helped to correctly assess the dimension of the tumour better than the small blocks , especially in invasive lobular carcinoma , where the macroscopic borders of the tumours were ill defined and difficult to be measured at macroscopical level only . in addition the widely spread breast cancer screening programs lead to the detection of a high rate of in situ carcinomas and of microscopic foci of invasive carcinomas . due to the use of ls , it is becoming evident that breast cancer often presents with multiple foci and unifocal , multifocal and multicentric in situ , or invasive carcinomas [ 16 , 17 , 21 ] appear better demonstrated . on a study performed on 574 consecutive cases studied with ls , found that invasive carcinomas was multifocal in 24% and diffuse in 5% of the cases , percentages that are largely superior to those published in paper based on conventional blocking . the prognostic value of multifocality in breast cancer has been widely debated in the literature . nevertheless , studies performed on ls [ 14 , 17 ] have shown that multifocality has a great impact on survival , as the risk of death for breast cancer is higher in patients with multifocal and/or diffuse carcinomas when compared with those with unifocal carcinomas . similar results were obtained at our institution , when ls were compared to conventional small blocks in a series of 102 consecutive cases diagnosed during the year 2010 . the most consistent additional information that ls have provided , over conventional small blocks , was tumour multifocality ( 27/102 cases , 26,4% ) . patients with multifocal tumours exhibited axillary lymph - node metastases in 71,42% while those with unifocal tumours showed axillary nodal involvement in 40,54% . these data confirm that multifocality can be useful in the evaluation of the risk of axillary involvement by breast cancer metastases and confirm that the detection of multiple breast cancer foci has a great prognostic impact and therefore should be carefully searched in all cases of breast cancer . in cases of breast cancer diagnosed in advanced stages , surgery is preceded by neoadjuvant chemotherapy with the aim of reducing the tumour mass . in order to correctly stage breast cancers treated by neoadjuvant chemotherapy , it is of vital importance to evaluate the presence of residual tumour and the degree of tumour regression . in cases showing good response to neoadjuvant chemotherapy therefore , when histology is performed on conventional blocks , small residual tumour foci frequently escape detection . to this purpose the use of ls improves the correct evaluation of the resection specimen ( figure 3 ) . embedding the whole area previously occupied by the tumour finally ls are of use also in the evaluation of other prognostic parameters , such as vascular invasion , which is used to plan chemotherapy . comparing conventional blocks and ls on 102 consecutive cases treated at this institution , in 14 cases ( 13,72% ) vascular invasion similarly to breast pathology , during the last century , ls have been used to shed light on different pathological processes of various organs . since 1960 ls have been proven to be useful to study the extension and distribution of lung diseases as emphysema and , more recently the size of the tumours , to plan radiotherapy in cases of nonsmall lung cancer . in current practice , ls are useful in staging cases of lung cancer ( figure 4 ) as the relationship between the tumour mass and the adjacent obstructive pneumonia is difficult to establish at macroscopic level ( figure 5 ) . in addition the assessment of pleural invasion or resection margins that may be problematic on macroscopic examination , are readily evaluated on ls . ls have been widely used in bone pathology to compare the radiological images to the different pathological aspects of benign and malignant bone tumours [ 3840 ] . specifically , type of growth and extension of osteosarcoma and chondrosarcoma were elucidated comparing radiological imaging and ls from surgical resection specimens . bertoni et al . , using ls , have demonstrated that paraosteal osteosarcomas with areas of dedifferentiation usually show intralesional radiolucencies on radiological images . ls have also occasionally been used to study the inner ear anatomy , but have been largely used to study normal brain anatomy and degenerative brain diseases . ls of brain tissue are stained using several histochemical methods that help to evidence grey and white matter ( figure 6 ) and the related lesions and , as recently demonstrated by howell et al . , are useful to perform a detailed mapping of degenerative brain lesions . in practice , in the daily practice , ls are potentially useful to understand , diagnose , and manage the pathological lesions from all organs . accordingly , slootweg and grot applied ls to stage the neoplastic lesions of the head and neck district , comprising the different areas of the oral cavity and the larynx . tumours arising in the head and neck region often involve mandibular and maxillary bones and the surrounding soft tissues . evaluation of the extent of the tumoural growth and tissue involvement , especially in this district , is of crucial importance to perform a correct staging . as tissues from head and neck region have different consistency . slootweg and grot proposed to cut the surgical specimens using an engine driven water - cooled diamond saw and to obtain ls inclusive of bone and surrounding tissues . these ls are optimal for all types of neoplastic lesions affecting the head and neck region and can easily and unequivocally demonstrate the type and extension of tumoral growth . ls have been proven to be useful in visualizing gastrointestinal tumours ( figure 7 ) . during the last two decades , the wider use of colorectal endoscopies and the application of screening programs for colorectal cancer have led to the recognition of early neoplastic lesions that can be of difficult interpretation using conventional blocks histology . ls allow to visualize the whole lesions and to correlate the histological features with the endoscopic findings . ls were useful to demonstrate the pathway of placental diffusion of cytomegalovirus infection in twins and more recently to study the amyloid involvement in the heart . for diagnostic purposes ls can be applied to almost organs ( figures 8 , 9 , and 10 ) . as shown in figure 11 in a case of transitional cell carcinoma of the urinary pelvis , ls clearly demonstrated that the tumour under study was composed of two distinct neoplastic foci , separated by uninvolved urinary epithelium . currently in prostate pathology , ls constitute a standard of care in the staging of prostate cancer , as carefully explained by montironi et al . in this issue . in addition as prostate cancer must be excluded in donor candidates during organ explanation , a method for cyrosectioning the whole prostate has been proposed [ 49 , 50 ] . ls have been applied in pathology for research and diagnostic purposes since the beginning of the 20th century . in spite of this long history that downgrades the ls to the level of an technique its value is still consistently useful in the every day practice , especially in tumour pathology both for breast and most organs . the criticism that the ls increase the cost and turnaround time of the surgical pathology routine work is not anymore tenable , as it has been demonstrated their cost - effectiveness and the turnaround time not longer than 24 hours .

large format sections ( ls ) first have been introduced in breast pathology more than a century ago . since then , they constituted for longtime a research tool to better understand breast microanatomy and the relationship between radiological images and pathological features . similarly ls have been used to study neoplastic , inflammatory , and degenerative diseases affecting various organs , as brain , lung , gastrointentinal tract , bone , urinary tract , prostate , and placenta . currently ls are mostly applied to diagnostic routine to better stage tumours such as prostate and breast carcinomas or to correlate radiologic imaging to gross specimens . the purpose of the present paper is to review the historical background and the basis of the applications of ls in surgical pathology , with special emphasis on breast tumours .

chronic renal failure ( crf ) is a destructive and progressive disease that causes disequilibrium in the body s metabolism and water and electrolyte balance ( 1 ) , and finally leads to a gradual decline in kidney function over a period of three or more months . in children , the condition usually necessitates long - term clinical care in hospitals and the community ( 2 ) . according to a report by the third international society for health and nutrition research ( 3 ) , 26.3 million individuals worldwide are suffering from crf . the latest epidemiological study of crf in iran has projected that over 40,000 individuals will acquire crf if the current trend of crf acquisition persists ( 4 ) . furthermore , the available data indicate that the number of children with crf is increasing , such that crf prevalence has been reported in 18 per 1,000,000 of the global population ( 1 ) . this disease directly affects the quality of life ( qol ) of children and their families ( 2 ) . qol refers to a sense of well - being and satisfaction with the domains of an individual s life that are considered significant from his / her perspective ( 5 , 6 ) . previously , effective treatments and the management of disease symptoms were thought to provide desirable conditions for patients , but research has indicated that qol is not related only to managing disease symptoms ( 7 ) . in fact , neglecting qol can lead to hopelessness , a lack of motivation to make any effort , and a decline in social , cultural , and health - related functions . furthermore , disease and qol are reciprocally related , and physical disorders and symptoms can directly affect all domains of qol ( 9 ) . since crf is a chronic disease that directly affects the qol of children and their families , treatment teams should conduct focused interventions to empower families to enhance the qol and abilities of the family members so that they can overcome the health - related obstacles they are facing . empowerment refers to the opportunities provided by professionals to family members to improve their existing abilities and competencies and to acquire the new skills required to meet their needs ( 10 ) . family empowerment is a process through which the family acquires knowledge and skills so that it can manage family life optimally and consequently enhance the family members lifestyles and qol ( 11 ) . this type of empowerment , which is realized by the interaction between healthcare professionals and families , brings about a sense of control over family life and leads to positive changes that improve the strengths , abilities , and skills of the family ( 12 ) . taken together , the aim of the empowerment of an ill child and his / her parents can be to help them deal with and more efficiently manage the disease complications to achieve a higher level of qol ( 13 ) . by emphasizing the fact that crf causes fundamental changes in families and leads to serious complications , empowerment programs can reduce the cost of hospitalization and the number of absences from school , and improve the physical and psychological functions and achievements of children with crf . furthermore , since family - centered empowerment programs are based on educational needs assessments , they may help nurses and physicians offer higher quality healthcare services to children with crf , leading to peace and the promotion of healthcare - related competencies among these children and their families . this study was conducted to examine the effects of the family - centered empowerment model on the qol of children with crf from both the children s and parents perspectives . this quasi - experimental study was conducted from january 2012 to february 2013 ( over 13 months ) . the sample size was 34 children with crf and their parents in each of two groups ( intervention and control ) based on similar studies : d = . ethical approval for this study was obtained from the research and technology deputy of the isfahan university of medical sciences and the relevant authorities ( 391138 ) . children were selected from the office of the pediatric nephrologist by simple random sampling so that the first referring individual with the inclusion criteria was assigned to the intervention group and the second to the control group . this process continued until the desired number of participants was obtained for the two groups . the inclusion criteria were : age 8 - 12 years , no previous kidney transplantation , the absence of other chronic diseases , the ability to comprehend the persian dialect , no mental and psychological problems ( by medical file and medical examination ) , the children s and parents consent to participate in the study , and the parents ability to read and write . the exclusion criteria consisted of patient withdrawal from the study , movement , and events such as parents divorce and the death of the parents and/or siblings . in this study , the family empowerment model was considered the independent variable , qol the dependent variable , and the children s age , gender , and education level , and parents place of residence the underlying variables . after the research purposes were explained to , and written consent was obtained from , the participants in both groups , the researcher administered the questionnaires for the pretest . the training sessions were then planned in coordination with the children and parents in the intervention group , and the pediatric nephrologist s office was judged a suitable location for training and thus used to hold the sessions . after the questionnaires had been filled out by the two groups , needs assessment sessions were held by the researcher for the intervention group , and the content of the empowerment program was developed after identifying the sources , limitations , and needs of the children and their parents . the content of the empowerment program was validated and confirmed by a number of experienced university teachers . the codified program was then conducted in accordance with the steps of the empowerment model . seven 45-minute sessions were carried out with the children based on their needs and tolerance , and three sessions in the form of group discussions were held with the parents . the training content was developed based on the results of the children s and parents needs assessments , but the steps of the intervention were taken from a study by alhani et al . training was implemented by the researcher in a group and face - to - face using speech , brainstorming , and educational aids , which included powerpoint presentations , movies , and educational replicas . first step ( knowledge enhancement ) : to enhance knowledge levels , several teaching aids and techniques were used . these included powerpoint presentations , models , posters , team teaching , question - and - answer sessions , lecturing , and role - playing . for this , the participants were divided into 4 - 5 individual subgroups based on the type of disease , and were given teaching materials on kidney physiology and anatomy , etiology , symptoms , disease complications and prognosis , diet , laboratory tests and normal test values , methods of measuring weight , height , and blood pressure , and pharmacotherapy . second step ( self - efficacy enhancement ) : to enhance self - efficacy , two sessions comprising demonstrations were held . in this method , explanations regarding the skills required for weight and blood pressure measurement were given , and these skills were taught to the children via demonstrations . third step ( self - esteem enhancement through participatory training ) : in this step , the children were asked to encourage their parents to help them and to participate in training their parents to identify crf - related issues . in this method , the children transferred the knowledge gained via the materials used in each group discussion as well as observation in the self - efficacy sessions to their parents . the children were given teaching cards of the materials for each session and were asked to give them to their parents to study . the parents then wrote down on paper the material from the cards , what they had learned from their children s statements , and the relevant questions they had , and had their children give their written notes to the researcher in the next session . since the parents were likely to fail to study the cards , to appropriately understand the teaching materials through their children s training , and hence to acquire adequate competency , the researcher invited them to three 45-minute training sessions on the disease course , diet , physical activity , pharmacotherapy , and disease complications . two weeks after the last session , the researcher called all the participants to follow up on the implementation of the skills learned and to ensure that the taught materials were being implemented . furthermore , the participants were given the researcher s telephone number to ask any questions , if necessary . fourth step ( process evaluation ) : to evaluate their knowledge , at the beginning of each session , the children were verbally asked some questions about the materials from the previous session . self - efficacy was evaluated by asking the children to demonstrate or conduct two learned skills appropriately , while self - esteem was assessed by the level of the children s cooperation in the participatory training when giving back the training cards comprising their parents notes . one month after the last intervention in the intervention group , the questionnaires were again administered to both groups . for ethical reasons , the handbook offered to the intervention group was also offered to the control group after the questionnaires had been filled out . the data gathering instrument consisted of two sections : demographic characteristics and the questionnaire of core pediatric qol inventory ( version 4 ) . this questionnaire consists of 23 items , eight items for physical function and 15 items for psychosocial function ( emotional , social , and school functions , each comprising five items ) . the validity and reliability of the persian version of this questionnaire have already been examined in iran , and its content validity and cronbach s alpha were found to be 91.36% and 0.77 , respectively ( 16 ) . the data were analyzed by descriptive and analytical ( chi - square , paired t - test , and independent t - test ) statistics in spss 20.a p value less than 0.05 was considered statistically significant . in this study , the mean age of the children was 10.2 and 10.5 years in the intervention and control groups , respectively . the duration of the disease was 5.5 and 5.1 years , and the age at diagnosis 5.5 and 5.1 years in the intervention and control groups , respectively ( table 1 ) . furthermore , a significant difference in the mean score of the children s qol was seen from their own perspectives in the physical and psychosocial domains and the total qol score in the intervention group before and after the training , but the corresponding difference in the control group was not significant between the two groups before and after the training ( table 2 ) . for the parents viewpoints about their children s qol , the mean qol scores in the physical and psychosocial domains and the total qol score in the intervention group were significantly different before and after the training ( p < 0.05 ) , but in the control group , no significant difference was seen before and after the training ( p > 0.05 ) ( table 3 ) . this study was conducted to explore the effect of the family empowerment model on the qol of children with crf from both the children s and parents perspectives . the findings indicated that , in the intervention group , the children s qol from their own perspectives was significantly different in the physical and psychosocial domains and the total qol score was significantly different before and after the training , but the corresponding difference was not statistically significant in the control group . similarly , mangione - smith et al . ( 17 ) demonstrated that the family - centered empowerment model resulted in an enhancement of knowledge and awareness of disease , a reduction in the number of absences from school and non - emergency referrals , and an overall increase in children s activities in school and their communities . chen and li ( 18 ) considered empowerment interventions to be effective for the promotion of qol in patients with chronic diseases . in light of the findings of several studies and the special status of training in the empowerment model , our findings are not surprising . in their study , graves and shelton ( 19 ) indicated that empowerment caused positive changes in the children s function and considerable improvements in their behavioral problems . gerson et al . ( 20 ) conducted a study on the qol of children with crf and showed that the qol of these children was significantly lower than that of healthy children . ( 21 ) showed that the family empowerment model was effective in improving the qol of children with chronic kidney disease . taimori et al.s ( 13 ) study of the effect of the family - centered empowerment model on the qol of children with asthma demonstrated a significant difference in the qol between the case and control groups before and after the intervention . in the same way , borhani et al . ( 22 ) indicated in their study that qol improved across all domains in the case group of school - aged children with thalassemia compared to the control group after implementing the family - centered empowerment model . the aforementioned findings could be explained by the fact that the specific steps in the empowerment model cause children to engage with and participate actively in the process . furthermore , promoting the children s self - efficacy and improving their self - confidence by increasing their participatory training helped to enhance the qol of the children in the intervention group in this study . additionally , given the use of different training methods and a wide range of materials based on the children s levels of understanding , their qol was likely to improve across all domains . this study also indicated that the qol of the children in the intervention and control groups was significantly different across all domains from their parents perspectives . similarly , a study of qol in children with crf from the children s and their parents perspectives indicated a significant difference in qol scores across all domains between the children and their parents ( 23 ) . ( 24 ) likewise compared the qol between children and adolescents with diabetes and healthy children from their own and their parents perspectives , and demonstrated a significant difference in the total qol scores in the physical , emotional , and social domains between the parents with healthy children and those with diabetic children . in a study of the child parent difference in reporting qol in adolescents with chronic disease , the adolescents reported a significantly lower qol for themselves than the qol their parents indicated for their children ( 25 ) . since the children in this training program were responsible for teaching their parents , they were motivated to participate actively , leading to enhanced self esteem , which could be explained by their significant contribution to their own and their parents learning . moreover , having the parents attend the training sessions simultaneously with their children , which was a strength of this study , could have contributed greatly to improving the qol of the children in the intervention group . a limitation of the present study was the individual characteristics that could have influenced the children s perceptions of qol . each child s interest in adopting the method , their particularities , and their emotional and psychological traits as well as their own and their parents cultural roots could have affected their qol perceptions . given the findings of this study , implementation of the family empowerment model could help children with crf and their parents identify their deficiencies and feel capable enough to change their existing conditions . this model is therefore also recommended for use as a healthcare intervention for children with other chronic diseases to empower such children and their parents and promote their healthcare - related function . given the findings of this study , implementation of the family empowerment model could help children with crf and their parents identify their deficiencies and feel capable enough to change their existing conditions . this model is therefore also recommended for use as a healthcare intervention for children with other chronic diseases to empower such children and their parents and promote their healthcare - related function .

backgroundchronic renal failure ( crf ) causes a gradual decline in kidney function to the extent that crf patients need long - term clinical care , which affects the patients family function and quality of life ( qol).objectivesthe present study was conducted to study the effects of the family - centered empowerment model on qol in children with crf during 2012-2013.patients and methodsin this quasi - experimental study , 68 children with crf and their parents were randomly assigned to two groups , intervention and control , via a random numbers table . an empowerment program was then conducted over the course of seven 45-minute sessions , and a questionnaire to ascertain demographic characteristics and the core pediatric qol inventory ( version 4 ) were administered to both groups before the sessions and one month after the last training session . the data were analyzed using spss 20.resultsthe mean age of the children was 10.2 and 10.5 years in the intervention and control groups , respectively . the duration of the disease was five years in both groups . furthermore , a significant difference was seen in the mean score of the children s qol from their own perspectives in the physical and psychosocial domains and the total qol score in the intervention group before and after the training ( p < 0.05).conclusionssince family - centered empowerment interventions can determine the training- and treatment - related needs of patients and are low cost and effective , they may help parents promote their children s self - efficacy and qol .

monkeys were housed at new england regional primate research center ( nerprc ) , southborough , ma . the animals were maintained in accordance with standards set forth by american association for accreditation of laboratory animal care . thirty mamu - a*01 , mamu - b*01 , and mamu - b*17-negative rhesus monkeys were distributed into three groups , two experimental groups each consisting of 12 monkeys and a control group consisting of 6 monkeys . one of the experimental groups received immunogens containing single consensus gene inserts and the other received immunogens containing a cocktail of 4 complementary mosaic gene inserts . on weeks 0 , 4 and 8 the experimental groups of monkeys received priming immunizations by the intramuscular route with either a total of 5 mg of m consensus gag or mosaic gag and a total of either 5 mg of m consensus nef or mosaic nef plasmid dna for each immunization . at week 33 , monkeys were boosted by simultaneous intramuscular and intradermal inoculations with a total of 10 pfu of a recombinant vaccinia virus expressing the same antigens . we coated multiscreen ninety - six well plates overnight with 100 l per well of 5 g anti - human interferon- ( ifn- ) ( b27 ; bd pharmingen ) in endotoxin - free dulbeccos - phosphate buffered saline ( d - pbs ) . the plates were then washed three times with d - pbs containing 0.1% tween-20 , blocked for 2 h with rpmi-1640 containing 10% fbs . then we added peptide pools and 210 pbls to each well in 100 l reaction volumes in triplicate for pooled peptides assays and in duplicate for peptide matrix assays . each peptide pool was comprised of 15 amino acid peptides overlapping by 11 amino acids . each peptide in a pool was present at a 1 g concentration . following an 18 h incubation at 37c , the plates were washed nine times with d - pbs containing 0.1% tween-20 and once with distilled water . we then incubated the plates with 2 g biotinylated rabbit anti - human ifn- ( u - cytech ) for 2 h at room temperature , washed six times with d - pbs containing 0.1% tween-20 , and incubated for 2.5 h with a 1:500 dilution of streptavidin - ap ( southern biotechnology associates ) . after five washes with d - pbs containing 0.1% tween-20 and three washes with d - pbs , we developed the plates with nbt / bcip chromogen ( pierce ) , stopped by washing with tap water , air dried , and read with an elispot reader ( cellular technology ltd . ) . the responses to the indicator peptides in the control group of 6 animals were in the range of 5108 sfc pbls . we incubated pbl from the monkeys with phycoerythrin - labeled anti - cd8 antibody and then with antiphycoerythrin - labeled magnetic beads ( miltenyi biotech ) following manufacturer s protocol . we then sorted the labeled pbl using a miltenyi automacs cell sorter to deplete cd8 + t lymphocytes . the efficiency of cd8 + t cell depletion in this study using the automacs cell sorter was 94.399.7% . we measured ifn- elispot responses in unfractionated and cd8 + t - lymphocyte - depleted pbl from these monkeys . in the evaluation of the cellular immune response , if greater than one half of a sfc response by unfractionated pbls was eliminated by cd8 + t lymphocyte depletion , we designated that response as cd8 + t lymphocyte - mediated . the responses of cd8 + t lymphocyte - depleted pbl were designated as cd4 + t lymphocyte responses . these highly stringent criteria may underestimate the magnitude of the vaccine - elicited cd4 + t lymphocyte responses . methods for construction of plasmid dna vaccines , recombinant vaccinia virus production and statistical analyses and associated references are available as supplemental on - line material . monkeys were housed at new england regional primate research center ( nerprc ) , southborough , ma . the animals were maintained in accordance with standards set forth by american association for accreditation of laboratory animal care . thirty mamu - a*01 , mamu - b*01 , and mamu - b*17-negative rhesus monkeys were distributed into three groups , two experimental groups each consisting of 12 monkeys and a control group consisting of 6 monkeys . one of the experimental groups received immunogens containing single consensus gene inserts and the other received immunogens containing a cocktail of 4 complementary mosaic gene inserts . on weeks 0 , 4 and 8 the experimental groups of monkeys received priming immunizations by the intramuscular route with either a total of 5 mg of m consensus gag or mosaic gag and a total of either 5 mg of m consensus nef or mosaic nef plasmid dna for each immunization . at week 33 , monkeys were boosted by simultaneous intramuscular and intradermal inoculations with a total of 10 pfu of a recombinant vaccinia virus expressing the same antigens . we coated multiscreen ninety - six well plates overnight with 100 l per well of 5 g anti - human interferon- ( ifn- ) ( b27 ; bd pharmingen ) in endotoxin - free dulbeccos - phosphate buffered saline ( d - pbs ) . the plates were then washed three times with d - pbs containing 0.1% tween-20 , blocked for 2 h with rpmi-1640 containing 10% fbs . then we added peptide pools and 210 pbls to each well in 100 l reaction volumes in triplicate for pooled peptides assays and in duplicate for peptide matrix assays . each peptide pool was comprised of 15 amino acid peptides overlapping by 11 amino acids . each peptide in a pool was present at a 1 g concentration . following an 18 h incubation at 37c , the plates were washed nine times with d - pbs containing 0.1% tween-20 and once with distilled water . we then incubated the plates with 2 g biotinylated rabbit anti - human ifn- ( u - cytech ) for 2 h at room temperature , washed six times with d - pbs containing 0.1% tween-20 , and incubated for 2.5 h with a 1:500 dilution of streptavidin - ap ( southern biotechnology associates ) . after five washes with d - pbs containing 0.1% tween-20 and three washes with d - pbs , we developed the plates with nbt / bcip chromogen ( pierce ) , stopped by washing with tap water , air dried , and read with an elispot reader ( cellular technology ltd . ) . the responses to the indicator peptides in the control group of 6 animals were in the range of 5108 sfc pbls . we incubated pbl from the monkeys with phycoerythrin - labeled anti - cd8 antibody and then with antiphycoerythrin - labeled magnetic beads ( miltenyi biotech ) following manufacturer s protocol . we then sorted the labeled pbl using a miltenyi automacs cell sorter to deplete cd8 + t lymphocytes . the efficiency of cd8 + t cell depletion in this study using the automacs cell sorter was 94.399.7% . we measured ifn- elispot responses in unfractionated and cd8 + t - lymphocyte - depleted pbl from these monkeys . in the evaluation of the cellular immune response , if greater than one half of a sfc response by unfractionated pbls was eliminated by cd8 + t lymphocyte depletion , we designated that response as cd8 + t lymphocyte - mediated . the responses of cd8 + t lymphocyte - depleted pbl were designated as cd4 + t lymphocyte responses . these highly stringent criteria may underestimate the magnitude of the vaccine - elicited cd4 + t lymphocyte responses . methods for construction of plasmid dna vaccines , recombinant vaccinia virus production and statistical analyses and associated references are available as supplemental on - line material .

an effective hiv vaccine must elicit immune responses that recognize genetically diverse viruses1 , 2 . it must generate cd8 + t lymphocytes that control hiv replication and cd4 + t lymphocytes that provide help for the generation and maintenance of both cellular and humoral immune responses against the virus35 . creating immunogens that can elicit cellular immune responses against the genetically varied circulating isolates of hiv presents an important challenge for creating an aids vaccine6 , 7 . polyvalent mosaic immunogens derived by in silico recombination of natural strains of hiv are designed to induce cellular immune responses that recognize genetically diverse circulating virus isolates8 . in the present study we immunized rhesus monkeys by plasmid dna prime/ recombinant vaccinia virus boost using vaccine constructs expressing either consensus or polyvalent mosaic proteins . the mosaic immunogens elicited cd8 + t lymphocyte responses to more epitopes of each viral protein than the consensus immunogens , and to more variant sequences of cd8 + t lymphocyte epitopes . this increased breadth and depth of epitope recognition may contribute both to protection against infection by genetically diverse viruses and to the control of variant viruses that emerge as they mutate away from recognition by cytotoxic t lymphocytes .

statins are used to lower serum cholesterol concentrations in the primary and secondary prevention of cardiovascular disease ( 1 ) . in randomized trials , the use of statins has demonstrated 30% reductions in atherosclerotic end points without serious morbidity . the pleiotropic effects of statins , indirectly related to cholesterol - lowering activities ( 2 ) , have also been assessed , making these drugs more widely accepted in various clinical settings . fluvastatin , available as both fluvastatin sodium and fluvastatin extended - release , is the first synthetic 3-hydroxy-3-methylglutaryl coenzyme a reductase inhibitor . because fluvastatin is well tolerated and lacks clinically significant drug - drug interactions , it is regarded as one of the safest statins , especially in patients receiving multiple medications ( 3 ) . even patients with renal disease , renal transplantation recipients and patients who have undergone pci can be safely treated with fluvastatin ( 4 ) . this includes a broad clinical spectrum of disorders , from mild and non - specific muscle aches or weakness , through asymptomatic and symptomatic elevation of serum creatine kinase levels , to life - threatening rhabdomyolysis . to date , few cases of fatal rhabdomyolysis associated with the use of statins have been reported ; these include 19 patients taking lovastatin , 3 taking pravastatin , 14 taking simvastatin , 6 taking atorvastatin , and 31 taking cerivastatin , the latter which was withdrawn worldwide ( 5 ) . there have been no reports to date of fatal rhabdomyolysis associated with the use of fluvastatin . we report a case of fluvastatin - induced fatal rhabdomyolysis in a patient with liver cirrhosis ; this patient had been switched from simvastatin to fluvastatin 10 days earlier and died due to severe rhabdomyolysis complicated by hepatic failure . a 56-yr - old man with liver cirrhosis caused by the hepatitis b virus visited our hospital on december 30 , 2008 for evaluation of weakness in his lower legs of 1-week duration . he first experienced discomfort and myalgia in his lower legs , which worsened over time and made him unable to walk . he had undergone a percutaneous coronary intervention 10 yr previously at the local hospital and had taken simvastatin ( 20 mg / day ) regularly since then . he was diagnosed with child - pugh c cirrhosis due to hepatitis b virus a year ago and followed - up at the same hospital with stable liver function in a compensated state . ten days before visiting our hospital , he was switched from simvastatin to fluvastatin ( 20 mg / day ) by his doctor , as the patient was concerned about his liver disease . in addition to fluvastatin ( 20 mg / day ) , his medications included aspirin ( 100 mg / day ) , betaxolol ( 10 mg / day ) , candesartan ( 16 mg / day ) , lactulose ( 30 ml / day ) , and entecavir ( 0.5 mg / day ) without diuretics or fibrates . his medical history was significant for no alcohol use and 10 pack - years of smoking , but he had quit smoking 10 yr previously . the patient 's blood pressure was 122/76 mmhg , his temperature was 36.8 , his pulse was 63 beats / min , weight was 98 kg , and his body mass index was 29.8 kg / m . laboratory findings included sodium 125 mm / l , potassium 5.1 mm / l , chloride 97 mm / l , phosphorus 3.1 mg / dl , co2 24.4 mm / l , serum creatinine 1.0 mg / dl , blood urea nitrogen 21 mg / dl , glucose 176 mg / dl , calcium 8.3 mg / dl , phosphorus 3.1 mg / dl , aspartate transaminase 1,303 iu / l ( normal < 40 ) , alanine transaminase 354 iu / l ( normal < 40 ) , alkaline phosphatase 145 iu / l ( normal 40 to 120 ) , total bilirubin 4.6 mg / dl , direct bilirubin 1.4 mg / dl , protein 8.0 g / dl , albumin 2.7 g / dl , and uric acid 3.5 mg / dl . his hematocrit was 38.5% , platelet count was 80,000/l , and white blood cell count was 11,100/l , with 18.5% lymphocytes , 69.7% polymorphonuclear leukocytes , 10.% monocytes , 1.4% eosinophils , and 0.2% basophils . his prothrombin time ( pt ) was 1.78 inr ( 40.7% ) and activated partial thromboplastin time ( aptt ) was 36.5 seconds . his total serum creatine kinase ( ck ) was 36,804 iu / l ( normal 50 to 250 iu / l ) and his ck - mb was 157.0 ng / ml ( normal < 5 ng / ml ) . urinalysis revealed no red or white blood cells , positive dipsticks for protein , occult blood , bilirubin and urobilinogen , but negative for glucose . a tc - diphosphonate scintigram bone scan showed increased uptake over all extremities and muscles of the thorax and abdomen ( fig . treatment with fluvastatin , betaxolol and candesartan was discontinued , and he received massive hydration and urine alkalization . he was treated with intravenous sodium bicarbonate ( 100 meq in 1,000 ml of half - normal saline at a rate of up to 500 ml / h or 50 meq / h ) titrated to a urine ph > 6.5 . he was administered a 20 - 80 mg dose of intravenous furosemide to maintain diuresis . his ck concentration was increased to 166,160 iu / l , and renal failure occurred . he underwent continuous renal replacement therapy on day 7 , but his renal function did not recover and hepatic function worsened , with pt prolonged to 3.8 inr ( 18% ) and total bilirubin increased to 24.5 mg / dl ( fig . fluvastatin is one of the statins shown to reduce the incidence of vascular events and slow the angiographically demonstrated progression of atherosclerotic disease ( 4 ) . since its approval in 1993 , fluvastatin has been administered for more than 21 million patient - years worldwide . among the statins , although there was a report of fatal rhabdomyolysis induced by fluvastatin - gemfibrozil combination therapy ( 6 ) , to our knowledge , fluvastatin alone has not been reported to induce fatal rhabdomyolysis . our patient had both chronic liver disease and established coronary artery disease , making it difficult to choose the most appropriate type and dose of statin , or even whether to treat with statin . the benefits of statins in lowering cholesterol and preventing heart disease outweigh the potential risks of hepatotoxicity , even in patients with chronic liver disease ( 7 ) . the national lipid association ( nla ) expert liver panel has stated that patients with chronic liver disease , nonalcoholic fatty liver disease and nonalcoholic steatohepatitis may safely receive statin therapy , supporting no scientific evidence to contraindicate statin use in patients with compensated cirrhosis ( 8) . literature has also indicated that use of statins in patients with hepatitis c infection and primary biliary cirrhosis is safe . statins have not been shown to worsen the outcome in persons with chronically increased transaminase levels due to hepatitis b or c viruses ( 9 ) . however , the incidence of discontinuations from statins due to hepatotoxicity was significantly higher in hbsag - positive than in hbsab - negative patients with coronary heart disease ( 10 ) . statins are contraindicated in patients with active liver disease or unexplained , persistent increases in liver function tests . except for cerivastatin , all statins have a very low systemic bioavailability owing to their extensive first - pass extraction by the liver . all statins , except for pravastatin , undergo microsomal metabolism by the cytochrome p450 ( cyp ) isoenzyme systems . inhibition of cyp450 isoenzymes by concomitantly interacting drugs can lead to increased plasma concentrations of statins , resulting in myositis and rhabdomyolysis . fibrates , warfarin , digoxin and mibefradil have been reported in patients with statin - associated rhabdomyolysis ( 11 ) . advanced age , diabetes , chronic renal insufficiency , and multiple medications are also associated with increased risks of statin - associated myopathy ( 9 ) . our patient , however , was not taking any drugs that interact with statins , nor was he ingesting alcohol . he did not have any other factors including hypokalemia , hypophosphatemia , hypo- or hyperthyroidism , and diuretics that could predispose him to the development of myopathy . no clinically important interactions have been observed between statins and other drugs used in cardiovascular diseases , such as propranolol , angiotensin - converting enzyme inhibitors , and thiazide diuretics ( 12 ) . about half of all statins currently available in clinical practice fluvastatin , unlike other statins , is metabolized primarily by the cyp2c9 enzyme in the liver , with cyp3a4 and cyp2c8 contributing to a lesser extent , and is therefore less subject to interactions than other statins ( 13 ) . as fluvastatin has the shortest elimination half - life of inactive metabolites among the statins and higher liver extraction , however , it results in high liver and peripheral tissue concentration , minimizing the systemic burden , instead potentiating hepatocellular injury in serious liver disease ( 6 ) . in a population based cohort study ( 14 ) , the highest risk of serious liver dysfunction among statins was associated with fluvastatin ( hazard ratio 2.53 , 95% confidence interval 1.84 - 3.47 ) , which was significantly higher than that with simvastatin ( hazard ratio 1.52 , 95% confidence interval 1.38 to 1.66 ) . with regard to this , candesartan is primarily excreted as unchanged drug ( 75% ) in the urine and feces with a smaller proportion ( 20%-25% ) inactivated by cyp2c9 . entecavir and lactulose are not substrates for and do not inhibit or induce cyp isoenzymes . however , the major enzymes involved in glucuronidation and hydroxylation of nsaids are cyp2c9 ( 16 ) . therefore , we could not exclude the possibility that cyp2c9 enzyme in our patient was partially saturated with candesartan and aspirin or he had genetic variants in cyp2c9 , which we could not identify unfortunately . / d , simvastatin and fluvastatin can reduce low - density lipoprotein by 30%-40% and 10%-20% , respectively . lipophilic statins , including lovastatin , simvastatin , and cerivastatin , also have a greater potential for muscle toxicity than do hydrophilic statins including fluvastatin , atorvastatin , and pravastatin owing to their enhanced ability to penetrate myocytes . in our patient it could be preliminarily explained in addition from a report that hepatic reactions associated with fluvastatin might be more common and more serious than those caused by other statins ( 17 ) , especially in patients with hepatic dysfunction . in one third of severe hepatotoxicity associated with fluvastatin fluvastatin is an established treatment for hypercholesterolemia ; its efficacy and safety have been documented in several clinical trials . rhabdomyolysis associated with fluvastatin is very rare , with the adverse event reporting system of the u.s . food and drug administration showing that only 1.7% of the incidents of statin - associated rhabdomyolysis were related to fluvastatin administration . however , our findings indicate that fluvastatin should be used with caution in patients with liver cirrhosis , especially with other medications metabolized with cyp2c9 .

hmg - coa reductase inhibitors ( statins ) are widely used to treat hypercholesterolemia . among the adverse effects associated with these drugs are statin - associated myopathies , ranging from asymptomatic elevation of serum creatine kinase to fatal rhabdomyolysis . fluvastatin - induced fatal rhabdomyolysis has not been previously reported . we describe here a patient with liver cirrhosis who experienced fluvastatin - induced fatal rhabdomyolysis . this patient had been treated with simvastatin ( 20 mg / day ) for coronary artery disease and was switched to fluvastatin ( 20 mg / day ) 10 days before admission . he was also taking aspirin , betaxolol , candesartan , lactulose , and entecavir . rhabdomyolysis was complicated and continued to progress . he was treated with massive hydration , urine alkalization , intravenous furosemide , and continuous renal replacement therapy for acute renal failure , but eventually died due to rhabdomyolysis complicated by hepatic failure . in conclusion , fluvastatin should be used with caution in patients with liver cirrhosis , especially with other medications metabolized with cyp2c9 .

severe left main coronary artery ( lmca ) disease is a critical condition and it requires prompt management when it manifests in the setting of acute coronary syndrome ( acs ) . interventional management with percutaneous coronary intervention ( pci ) or coronary artery bypass graft ( cabg ) is mandatory in this setting . both approaches ( pci and cabg ) are feasible and many factors intervene in the decisional algorithm , mainly the immediate risks and the long - term major adverse cardiac events , these risks and events are considerable both in the elderly and when the procedure of revascularization is performed urgently . we present a case of acs in an octogenarian male patient related to lmca disease along with severe ostial left anterior descending ( lad ) artery stenosis , emergent cabg consisted of a single graft of left internal mammary artery on lad , the procedure was complicated by graft closure with subsequent acute anterior myocardial infarction and cardiogenic shock . pci was delayed 18 hours because of an unstable hemodynamic condition ; nevertheless it was successful and allowed to rescue the patient . his physical examination was unremarkable , surface electrocardiogram showed sinus rhythm , left bundle branch block , and non specific st / t changes difficult to analyze due to the branch block . the patient had an aortic valve bioprosthesis implanted 5 years ago , he also had pci realized 3 years ago and consisting of 2 long contiguous stents ( drug eluted stents ) in proximal and mid lad artery , and another stent in proximal circumflex artery . the patient had a relatively preserved systolic function with an ejection fraction estimated at 65% and a creatinine clearance of 51 ml / min , as well as a preserved functional capacity . coronary angiogram showed a significant lmca disease with a diffuse narrowing estimated at 70% , a severe subocclusive ostial ( > 95% ) lad stenosis proximal to the stent ( timi-1 flow ) , mild lad intrastent narrowing and moderate ( 65%75% ) proximal circumflex artery disease with intrastent narrowing but patent stent . in addition , there was a moderate lesion on mid right coronary and severe stenosis on distal right coronary artery ( fig . 1 ) . the coronary distribution showed a left dominance , there was minimal tortuosity , mild diffuse calcification , and no intraluminal thrombus visible . a decision to perform emergent cabg was performed consisting of left internal mammary graft to mid left anterior descending artery with an over - stent anastomosis . it was also decided that a pci be performed on the left circumflex afterward . performing an extracorporeal circulation for a complete revascularization additionally the operator estimated that anastomosis on the distal lad beyond the distal stent would be of little benefit and of high risk of restenosis given the small distal caliber of lad . however , on post - operative day 8 the patient presented a syncope with abrupt and persistent poor hemodynamic status , history taking was difficult ( subconscious ) , electrocardiogram was roughly unchanged compared to the last tracing , and cardiac biomarkers showed borderline values . cardiac echogram showed severe left ventricular anterior hypokinesis , ejection fraction at 30% , and emergent coronary angiogram revealed a subocclusive stenosis of the left internal mammary at the anastomotic site ( fig . the procedure was complicated by cardiorespiratory arrest requiring on - table resuscitation , with placement of a temporary pacer and artificial ventilation . at this stage , systolic blood pressure was at 50 mm hg , serum creatinine at 1.9 mg / dl , and it was decided that a pci be performed after stabilization of the hemodynamic condition . along with supportive measure and positive inotropic drugs , an intra aortic balloon was placed and it allowed a restoration of a satisfactory hemodynamic condition with blood pressure at 90/60 mm hg , and an acceptable diuresis of 3540 cc / hour . pci was delayed due to the critical hemodynamic status , nevertheless it was successfully performed 18 hours later . it consisted of lmca , proximal lad , and proximal circumflex angioplasty / stenting ( fig . 3 ) using t - stenting technique ( everolimus drug eluting stents ) with end kissing balloon angioplasty . over the next 48 hours , the patient s hemodynamic condition progressively improved and stabilized , positive inotropic drugs were progressively withdrawn , intra aortic balloon was removed , and the patient restored a normal consciousness with normal sinus rhythm and spontaneous respiration . cpk ( creatine phosphokinase ) peaked at 2200 iu / l on day 2 , cardiac echogram showed severe mid - septal and septoapical hypokinesis with ejection fraction estimated at 40% ( teicholtz ) , bnp ( brain natriuretic peptide ) at day 7 was at 1810 pg / ml . the patient condition continued to improve and he was discharged for a cardiac rehabilitation program with dual antiplatelet therapy ( ticagrelor and aspirin ) . the first issue to discuss in this case is whether the decision of cabg compared to pci was justified , next we will discuss the surgical technique . the patient risks can be evaluated taking into account the clinical and the angiographical data . in this patient , timi score1 ( acs ) was estimated at 4 , yielding a 19.9% events rate with medical therapy within 14 days ( all - cause mortality , new or recurrent myocardial infarction , or severe recurrent ischemia requiring urgent revascularization ) . syntax score and clinical syntax score evaluate the risk of pci , including major adverse cardiac events rates at 1- and 5-year follow - up ( all - cause mortality , cardiac death , myocardial infarction and target vessel revascularization).2 in addition , syntax and clinical syntax scores are used to evaluate risks of pci of unprotected lmca in patients receiving drug - eluting stents.3,4 in this patient , the syntax - score was estimated at 30 , yielding a 23%32% rate of major cardiac events . the syntax score is purely anatomical and is notably significant in this patient with left main disease and with a bifurcation lesion type medina ( 1,1,1 ) . other risk score for pci is the mayo clinic risk score,5 it yields the risk of procedural death and major adverse cardiac events , and it is based on 7 variables ( age , myocardial infarction < 24 hours , preprocedural hemodynamic shock , serum creatinine level , left ventricular ejection fraction , congestive heart failure , and peripheral artery disease ) . surgical risk assessment with euroscore ii6 in this patient yields a 10.03% perioperative mortality risk . at day 8 and after the occurrence of the complication , the patient s condition changed and euroscore ii yielded a 73.89% perioperative mortality risk due mainly to the low ejection fraction , lower creatinine clearance , recent or ongoing myocardial infarction , critical pre - operative state , and recent cardiac surgery . recent literature showed a comparable outcome between pci and cabg in patients with lmca disease , though target vessel revascularization is lower in the cabg group ; chieffo et al7 reported that treatment of unprotected lmca disease with pci showed similar long - term mortality as compared to cabg , however , pci ( even with drug - eluting stents ) was associated with higher rates of repeated revascularization . park et al8 found , after 5 years of follow up , an advantage of elective pci in the composite end point ( death , myocardial infarction , stroke ) and concluded that pci of unprotected lmca with drug - eluting stents is an acceptable alternative to cabg especially in non- diabetic patients and this conclusion was also supported by other studies.9,10 similarly , dahdouh et al11 showed that pci is a possible alternative in octogenarian population with a mean euroscore of 21.1 16.7 and mean syntax score of 28.6 8.7 . in this patient , the lad artery was previously stented with two long contiguous stents starting almost 3 mm after the ostium till to the distal 1/3 . we hypothesize that ostial stenosis of lad was probably enhanced by inappropriate positioning of the proximal stent that did not cover the ostium . surgical anastomosis was theoretically feasible but with little benefit in the distal segment of the lad in a moreover , we estimate that performing a graft on the very proximal segment of lad , also in the stent - free zone is ideal in this case and would have resulted in a better outcome . performing an over - stent coronary anastomosis is not a recognized technique , and , to the best of our knowledge , it is not reported in the literature . accordingly , we estimate that the early complication of cabg should be regarded as a usual consequence of an unusual procedural technique rather than a simple unfortunate complication . in the future , and with the potential success and common use of the totally biodegradable stents , performing anastomosis over the stent - trace could be a promising and feasible technique . revascularization performed in two different sessions and after failure of the graft . in the light of these risk scores along with data from recent literature , knowing the patient anatomy and from a retrospective point of view , we estimate that cabg is a good choice provided that an adequate technique is implemented . also we hypothesize that pci in this non diabetic patient could have been a good choice initially especially with the surgical technical difficulties . in fact , the clinical history of this patient represents a spontaneous cross - over - like between cabg and pci . in order to decide the best approach between medical , pci , or cabg , the attending team should take into consideration the guideline recommendations , the individualized patient settings , and available operative technique for a better outcome and less risk . pci of lmca disease should be regarded as a possible alternative to cabg even in an octogenarian when the surgical risk is estimated significant , and/or when the technique is expected difficult . performing an over - stent anastomosis is hazardous and is not a recognized technique . with the recent advent of the totally biodegradable stents , anastomosis over - stent - trace

we report on an octogenarian patient presenting with an acute coronary syndrome due to significant left main coronary artery disease and severe ostial stenosis of the left anterior descending artery disease . emergent bypass graft performed with beating heart consisted of left internal mammary graft to the mid left anterior descending artery with an over - stent anastomosis . the immediate post - operative phase was simple , however the patient presented on post - operative day 8 with extensive anterior myocardial infarction and cardiogenic shock . emergent coronary angiogram showed subocclusive anastomotic stenosis . percutaneous coronary intervention was performed on left main , proximal left anterior descending , and proximal circumflex arteries . subsequently , the patient restored a satisfactory hemodynamic condition . a focus on the importance of decision for management of left main disease especially in octogenarian is presented , along with a review of the pertinent literature .

according to the world health organization , an adverse drug reaction ( adr ) may be defined as a response to a drug which is noxious and unintended , and which occurs at doses normally used or tested in man for the prophylaxis , diagnosis , or therapy of disease , or for the modification of physiological function . the latter is characterized by features of an allergic reaction without detectable reactions of the adaptive immune system . it has been estimated that medical in - patients receive a total of 90 million courses of drug therapy per year and that the frequency of adrs is about 5% . by limiting the use of the term allergic to those reactions that are immunologically mediated or can reasonably be presumed to be , estimates are that drug allergy may account for 610% of these adverse reactions . recognizing the magnitude of this problem , the national institute of allergy and infectious diseases noted that if knowledge gained from research findings in drug allergy could be widely used , it should be possible not only to improve diagnosis and treatment but also to prevent allergic drug reactions . drug allergy is one type of unpredictable adr that encompasses a spectrum of immunologically mediated hypersensitivity reactions with varying mechanisms and clinical presentations . . a wide spectrum of drugs can sometimes give rise to numerous adverse oral manifestations , particularly dry mouth , taste disturbances , oral mucosal ulceration and/or swelling . fde is characterized by onset of round / oval , erythematous well - defined macules on the skin and/or mucosa associated with itching and burning sensation . the exact mechanism causing fde is unknown , although studies strongly suggest involvement of the immune system . the oral cavity may be the target organ for a number of diverse abnormalities that develop from the side - effects of medications . 5-nitroimidazole derivatives have been used in the treatment of various intestinal protozoal infections for many years . among these agents , metronidazole is a common anti - protozoal agent that is used worldwide , while ornidazole is a relatively new derivative that is used in some countries in treating particular protozoal infections and that has higher patient compliance because of its longer half - life . ornidazole is typically employed in the treatment of infections throughout the organism , especially in the case of intestinal infections or vaginal / urinary tract infections , as it has been proven to have a strong effect against invasive amoeba and anaerobic bacteria . in many cases , ornidazole is also indicated as a prophylactic agent in order to prevent infections from occurring as a result of surgical procedures . a 58-year - old male patient reported to the outpatient department ( opd ) of the ranchi institute of neuro - psychiatry and allied sciences , kanke , ranchi , jharkhand , india with the chief complaint of dirty teeth . the patient gave a history of dirty teeth since 10 years and he got his teeth extracted ( 31 , 32 , 33 , 34 , 35 , 36 , 41 , 44 , 46 , 47 ) 15 years back because of mobility . the patient had history of chewing pan masala with tobacco ( three to four pouches per day ) since 23 years . the patient used to clean his teeth with commercially available dried tooth powder . on examination , the patient was moderately built and nourished and his vital signs were within normal limits . intraoral examination revealed a generalized edema of gingiva with bleeding on probing and deposits of stains and calculus . cervical abrasion was present in 11 , 13 , 14 , 15 , 16 , 24 , 25 , 27 and 43 and root stumps of 12 , 21 , 22 , 23 and 43 were also present . the patient was advised complete oral prophylaxis , extraction of root stumps ( 12 , 21 , 22 , 23 and 43 ) , restoration of cervically abraded teeth and fabrication of prosthesis for replacement of missing teeth . oral prophylaxis was performed under aseptic conditions and ornidazole 500 mg was prescribed to the patient in the form of tablet with a dose of one tablet twice daily and the patient was recalled after 3 days . the next day , the patient again came to the outpatient department with a complaint of ulcers in the mouth with burning sensation . the patient gave a history of intake of tablet ornidazole and , 64 h after ingestion of the tablet , he noticed a burning sensation in the oral cavity along with painful ulcers . intraoral examination revealed a well - defined erythematous macule in the hard palate approximately 4 cm 4 cm in size that was located on the mid portion of the hard palate having ill - defined margins associated with some grayish white lesions over the erythmatous base . he recalled that 10 years back he had similar lesions on the same locations on taking some anti - diarrheal ; on the initial history taking , he had missed on divulging this information . on palpation , all findings were confirmed and the lesion was 4 cm 3.5 cm in size , shallow , tender on palpation [ figure 1 ] . the lesion was approximately 6 cm 3 cm in size extending from the right upper buccal vestibule to attached gingiva of 16 , 15 , 14 , 13 , 12 and 11 , extending mesially across the mid line and extending over the upper left buccal vestibule to attached gingiva of 21 , 22 , 23 , 24 , 25 and 26 . the lesion was tender on palpation and revealed an erythmatous area on gentle rubbing [ figure 2 ] . based on history and clinical examination , a provisional diagnosis of mucosal fde due to ornidazole was given . lesion on the labial mucosa the patient was advised to stop intake of ornidazole and he was prescribed prednisolone 10 mg po thrice daily for 3 days followed by one tablet twice daily for 3 days , followed by one tablet once daily for 3 days along with levocetrizine 5 mg once daily for 7 days . the patient was recalled after 7 days and satisfactory healing was seen [ figure 3 ] . drug hypersensitivity reactions can manifest in a great variety of clinical symptoms and diseases , some of which are quite severe and even fatal . in the clinical setting , adrs are a common and important public health problem , and they always need to be included in the differential diagnosis of patients under treatment with drugs . the most commonly used classification , proposed by rawlins and thompson , differentiates these reactions into two major subtypes : type a reactions that are due to a pharmacological propriety of the causative drug and are thus predictabletype b reactions that occur only in predisposed individuals and are thus hard to predict . type a reactions that are due to a pharmacological propriety of the causative drug and are thus predictable type b reactions that occur only in predisposed individuals and are thus hard to predict . gell and coombs classified immune - mediated allergic reactions to drugs , which describes the predominant immune mechanisms involved in these reactions . this classification system includes : type i - immediate - type reactions mediated by immunoglobulin e ( ige ) antibodies type ii - cytotoxic reactions mediated by immunoglobulin g ( igg ) or immunoglobulin m ( igm ) antibodies type iii - immune - complex reactions type iv - delayed - type hypersensitivity reactions mediated by cellular immune mechanisms , such as the recruitment and activation of t cells . fde has been reported in male patients after history of sexual contact with their spouses , who were found to be receiving the same medication to which the male partners were hypersensitive . genetic polymorphisms in the human leukocyte antigen as well as viral infections such as human immunodeficiency virus ( hiv ) and the epstein - barr virus ( ebv ) have also been linked to an increased risk of developing immunologic reactions to drugs . in addition , topical , intramuscular and intravenous routes of administration are more likely to cause allergic drug reactions than oral administration , while intravenous administration is associated with more severe reactions . prolonged high doses or frequent doses are more likely to lead to hypersensitivity reactions than a large single dose . fde is usually solitary in the initial attack , but with each subsequent exposure , the number of involved sites may increase and preexisting sites may increase in size . the eruption may initially be morbilliform , scarlatiniform or erythema multiforme like . however , urticarial , nodular or eczematous lesions are uncommon . the exact pathogenesis of fde is unknown , although antibodies , antibody - dependent cell - mediated cytotoxicity and serum factors have been implicated . cd8 + t cells seem to play a major role in initiating epidermal injury by producing interferon g and interacting with other inflammatory cells . even if a drug is responsible for activation of cd8 + t cells , it does not seem to be the antigen recognized by cd8 + t cells . the reason for recurrence of lesions at the same site may be explained by the persistence in situ of cd8 + memory t cells . the involvement of cd8 + t cells may suggest a role for cell - mediated hypersensitivity in the pathogenesis of fde . fde represents a unique cdr pattern characterized by skin lesion ( s ) that recur at the same anatomic site ( s ) upon repeated exposures to an offending agent . most commonly , the skin lesion is a dusky erythematous macule and is usually found on the extremities , lips , genitalia and perianal areas , although any skin or mucosal surface may be involved . the skin lesions may be associated with a burning sensation and may be present in multiple numbers or progress to the development of central vesicles and bullae , particularly after the repeated use of an agent . the most characteristic feature of fde is reactivation of the inflammatory process in the previously involved site ( s ) with each subsequent exposure . the classic morphology of fde lesion is dusky red painful patch ( es ) that leave long - lasting or permanent deep postinflammatory hyperpigmentation . other , nonclassic lesions of fde are occasionally seen , including erythema multiforme , steven johnson syndrome , cheilitis , psoriasis , lichen planus - like , hand eczema , melasma , discoid lupus erythematosus , pemphigus vulgaris or hypermelanosis of the vulva and peri - anal area . , we could find only seven cases of intraoral involvement of fde in the english literature [ table 1 ] . cases of intraoral involvement of fde fde due to ornidazole in previously documented three cases had involved the lips , chest and antero - lateral aspect of the thigh . the case described here is unique as it involved the intra - oral site of the hard palate , labial mucosa ( a site rarely associated with fde ) , resulting due to the use of ornidazole . the management of fde depends on the severity of the reaction . for mild cases , withdrawal of the offending drug , with application of mild to moderate topical corticosteroids , and systemic antihistamines are usually sufficient . in severe reactions , the management is similar to other cases of severe allergic reactions , including intensive supportive , maintaining fluid and electrolyte balance , infection control , systemic corticosteroids and systemic antihistamines . although allergic reactions to antibiotics account for only a small proportion of reported adrs , they are associated with substantial morbidity and mortality and increased health care costs . awareness among dental and medical practitioners about fde can lead to correct diagnosis and treatment in order to prevent unnecessary morbidity and the potential risk of death from these severe reactions , and to provide proper medical advice on future drug use .

fixed - drug eruption ( fde ) is an unusual and rare adverse drug reaction . this type of reaction is actually a delayed type of hypersensitivity reaction that occurs as lesions recurring at the same skin site due to repeated intake of an offending drug . here is a case report of a 58-year - old male patient who developed intraoral fdes after ingestion of the first dose of ornidazole .

patients had bilateral symmetrical peripheral neuropathy along with severe emotional disturbances , anorexia , and impotence . they had mild diabetes , simultaneous onset of neuropathy , and without presence of other specific diabetic complications . the patients were all males and in the 6 decade of life in the original report . but , it was a female patient and she was relatively young . only , few female cases have been reported in literature . because of clinical presentation , this syndrome is often confused with neuropathic carcinomatosis or an occult cancer . a 42-year - old house wife ( p2 + 0 , last child birth 24 years ago ) was admitted with complaints of generalized body ache of 1 year duration . the patient had numbness and severe burning sensation over her feet , ascending rapidly to involve her legs and thighs . it was associated with loss of weight ( approximately 8 kg ) , loss of appetite , nausea , frequent vomiting , and altered bowel habits without history of fever or pain abdomen . she was detected to have diabetic 1 year ago and put on oral hypoglycemic agents ( ohas ) . she had undergone cholecystectomy 2 months back ( histopathological examination ( hpe ) suggestive of chronic cholecystitis without malignant change ) . she was amenorrhoic for last 2 months . on admission , she was biochemically euthyroid with normal creatinine phosphokinase ( cpk ) level , negative antinatriuretic factor ( anf ) , rheumatoid factor , anti - double stranded deoxyriobonucleic acid ( dsdna ) , and poor glycemic status ( hba1c 16.9% ) . weight : 36.5 kg , body mass index ( bmi ) : 15.7 kg / m , blood pressure ( bp ) : 100/70 mmhg , pulse : 70/min , regular , all peripheral pulses palpable , pallor : + , icterus : nil , edema : nil , goiter : gr i , acanthosis : absent , muscle function test ( mft ) : 6/6 b / l , ankle brachial pressure index ( abpi ) : left 0.9 , right 1.0 . profound symmetrical wasting was noted in all extremities with associated bilateral weakness more in proximal muscle groups of the lower extremities . hemoglobin ( hb ) : 9.4 ; total leukocyte count ( tlc ) : 12,400 ; differential leukocyte count ( dlc ) : neutrophils ( n)-78 , lymphocytes ( l)-18 , monocytes ( m)-2 , eosinophils ( e)-2 ; erythrocyte sedimentation rate ( esr ) : 86 ; adequate platelet . renal and hepatic profile was normal except hypoproteinemia ( albumin / globulin ( alb / glb):2.6/2.2 ) and hypokalemia . nerve conduction velocity ( ncv ) revealed symmetrical distal axonal and demyelinating type of sensorimotor polyneuropathy involving lower limbs more than upper limbs . computed tomography ( ct ) scan abdomen suggested hepatomegaly with mildly dilated common bile duct ( cbd ) ( post cholecystectomy ) along with suspected stricture ileum along with proximal narrowing . chest x - ray , ct scan brain , ultrasonography ( usg ) abdomen , upper gastrointestinal ( gi ) endoscopy , colonoscopy , ba meal follow through , ct enteroclysis were normal . weight : 36.5 kg , body mass index ( bmi ) : 15.7 kg / m , blood pressure ( bp ) : 100/70 mmhg , pulse : 70/min , regular , all peripheral pulses palpable , pallor : + , icterus : nil , edema : nil , goiter : gr i , acanthosis : absent , muscle function test ( mft ) : 6/6 b / l , ankle brachial pressure index ( abpi ) : left 0.9 , right 1.0 . profound symmetrical wasting was noted in all extremities with associated bilateral weakness more in proximal muscle groups of the lower extremities . hemoglobin ( hb ) : 9.4 ; total leukocyte count ( tlc ) : 12,400 ; differential leukocyte count ( dlc ) : neutrophils ( n)-78 , lymphocytes ( l)-18 , monocytes ( m)-2 , eosinophils ( e)-2 ; erythrocyte sedimentation rate ( esr ) : 86 ; adequate platelet . renal and hepatic profile was normal except hypoproteinemia ( albumin / globulin ( alb / glb):2.6/2.2 ) and hypokalemia . nerve conduction velocity ( ncv ) revealed symmetrical distal axonal and demyelinating type of sensorimotor polyneuropathy involving lower limbs more than upper limbs . computed tomography ( ct ) scan abdomen suggested hepatomegaly with mildly dilated common bile duct ( cbd ) ( post cholecystectomy ) along with suspected stricture ileum along with proximal narrowing . chest x - ray , ct scan brain , ultrasonography ( usg ) abdomen , upper gastrointestinal ( gi ) endoscopy , colonoscopy , ba meal follow through , ct enteroclysis were normal . this 42-year - old known diabetic female was admitted in our department with complaints of generalized body ache with disturbed sleep , anxiety , and irritability for 1 year , which was progressively increasing in severity along with history of significant loss of weight ( total 14 kg ) , nausea , frequent vomiting , and altered bowel habits with intermittent diarrhea and constipation . she was investigated initially to exclude hematological malignancy in the background of generalized bone pain and raised esr . gi malignancy was also excluded considering significant loss of weight , anorexia , nausea , frequent vomiting , and altered bowel habits . ct scan abdomen suggested suspected stricture ileum along with proximal narrowing which was not supported by colonoscopy , ba meal follow through , and ct enteroclysis . she was in very much depressed state and lost weight ( approximately 6 kg ) during institutional management . ncv revealed symmetrical distal axonal and demyelinating type of sensorimotor polyneuropathy involving lower limbs more than upper limbs . patient was discharged in relatively stable condition with a diagnosis of diabetic neuropathic cachexia . at follow - up ( 1 month ) our patient was found to be relatively symptom free with weight gain of 1 kg . our experience highlights that diabetic neuropathic cachexia may occur in young female and responds to psychopharmachological support . though it is a diagnosis of exclusion , low threshold of suspicion will help to reach the diagnosis and reassure patient and near relatives to get rid of the problem because of overall good prognosis .

a 42-year - old lady , a known diabetic presented with generalized body ache , severe burning sensation over her lower limbs , loss of weight ( approximately 8 kg ) , loss of appetite , nausea , frequent vomiting , and altered bowel habits without history of fever or pain abdomen . symmetrical wasting was noted in all limbs with bilateral proximal muscle weakness , particularly of lower limbs . ankle jerks were absent with symmetrically decreased reflexes . nerve conduction velocity ( ncv ) revealed symmetrical distal axonal and demyelinating type of sensorimotor polyneuropathy . hematological and gastrointestinal ( gi ) malignancy were excluded . patient responded to antidepressants .

gluteal muscle contracture ( gmc ) is a clinical syndrome characterized by gait abnormality and limb dysfunction , as well as secondary deformities of pelvis and femur . at present , arthroscopic release , a minimally invasive surgery that was reported by zhang et al for the first time , femoroacetabular impingement ( fai ) typically could be diagnosed on the basis of computed tomography ( ct ) such as the equatorial - edge angle ( ee angle ) . although ee angle may be sufficiently sensitive to identify and differentiate impingement morphologies in all cases and the diagnostic challenges have been previously reported , the judgment method did not work well in gmc patients . in this study , we retrospected all image data and found small ee angles in gmcs , which meant retroverted acetabulum ; however , none of them showed symptoms and signs of fai . therefore , we had reasons to think that , some normal hips with unbalanced hip myodynamia as same as gmcs , may be incorrectly diagnosed as fai through measuring ee angle only . in consequence , the paper was designed to assess the use of the ee angle in the assessment of fai in the diagnosis , as described by werner . twenty - three people of those gmc patients coming for arthroscopic treatment agreed to join in the study . pelvic ct scans of patients admitted to the peking university shenzhen hospital , shenzhen , china , were retrieved from the electronic radiological archive . there were 23 patients ( 46 hips ) who met the premise of having images available ( fig . 1 ) , and all data were further analyzed . before the ct scans were included , it was required to validate correct patient position and radiographic technique to eliminate any measurement error as possible . ( a c ) the 3d reconstruction ct shows a gmc patient with severe gluteus maximus and gluteus medius atrophy for ( a ) posterior view , and ( b ) left side , and ( c ) right side , which have the contracture bands ( white arrow ) in left and right side , respectively . msct scans were performed on ct scanners ( discovery 750hd ; ge healthcare , waukesha , america ) with slice thickness varying between 0.625 and 2.5 mm and a gantry tilt of 0. all scans ranged from the pelvic bone to the proximal femur . the indicator of acetabular retroversion on the ct scans was measured using an adapted version of the method originally described by werner et al and reynolds et al : the ee angle was the angle of the acetabular opening at the maximum diameter of the femoral head ( fig . 2 ) , which was represented by the sagittal plane and a line drawn between the anterior and posterior acetabular rim on the appropriate ct slice . in light of reynolds et al , ee angle was defined as negative if opening posteriorly ( fig . ( a , b ) the ct slice at the level of the maximum diameter of the femoral head . a line was drawn from the anterior to the posterior border of the acetabulum , as well as a line representing the sagittal plane . the graph shows 2 positive angles of ( a ) , one positive and another negative of ( b ) as well . distributions of angles were examined using histogram , and reported as mean standard deviation if distributions were symmetrical . we used independent groups t tests for comparisons between groups ( sex and side ) if assumptions of approximate normality and equal variances were met . review of the hips showed a mean ee angle was 12.93 , with a minimum of -3.42 and a maximum of 24.08 ( table 1 ) . the mean value for males and females were 13.52 and 12.40 , respectively , without statistical significance ( table 1 ) , although the mean value of left hips and right sides reached 13.32 and 12.54 individually , not having statistical differences neither ( table 1 ) . thus , the reduced ee angle could suggest the local excessive coverage of the femoral head by the anterior acetabular edge , but might not be a reasonably good predictor of fai . gmc mainly affects the patient 's tensor fasciae latae , gluteus maximus , gluteus medius , and gluteus minimus , what 's more , sometimes even involves the lateral rotator group and the joint capsule of hip . these involved muscles may be found with muscle fibers degeneration and necrosis , fibrous connective tissue proliferation , and myofascial and fascia hypertrophy , leading to a sequence of secondary pathological changes , such as the hip muscles out - of - balance , which may cause abduction and external rotation deformities of the hip joint , pelvic tilt , and acetabular dysplasia . fai is an abnormal condition where chronic pains occur in the hip joint resulted from degenerative changes in the acetabular labrum and articular cartilage , due to the impingement between the femoral head and acetabulum caused by anatomical abnormalities in the hip joint . in these cases , the hip joint 's range of motions , especially flexion and internal rotation , are limited , eventually resulting in the hip osteoarthritis . as the good compatibility between the acetabulum and the femoral head is the functional basis for normal movement of the hip joint , morphological changes in any one of them will affect the hip functions . the normal border of the femoral head neck junction is a concave arc , which can smoothly move into the acetabulum when the hip joint is flexing or internally rotating . when the femoral offset is reduced or vanished , or the acetabular edge excessively covers the femoral head , the acetabular edge and the head neck junction can be more likely to squeeze and impinge on each other at the end stage of the motion , resulting in fai . it is traditionally held that fai is divided into the cam - type and the pincer - type . the cam - type fai is distinguished by a noncircular femoral head but an anatomically normal acetabulum . the noncircular femoral head may collide with the acetabular edge , leading to cartilage damage and labrum tear and even causing bone cystic degeneration and labrum ossification of the acetabulum . on the contrary , in the pincer - type fai , the femoral head is anatomically normal , but the abnormal acetabulum is characterized by the acetabular retroversion or the excessive coverage on the femoral head , causing linear contact between the acetabular labrum and the femoral head neck junction during the joint motions , thereby leading to the degeneration , hardening , or ossification of the acetabular labrum . such changes aggravate the wrapping of the femoral head by the acetabulum and further exacerbate the range and severity of the lesion . actually , some fai patients can be observed to show the anatomical abnormalities in both the femoral head and the acetabulum , and some researchers have defined this condition as the mixed - type fai . msct has been widely applied in the examination of bone and joint diseases , and its diagnostic value has been recognized as an effective imaging method . as the isotropic advantage of msct allows the 3-dimensional reconstruction in any orientation after the scanning , it is more conducive to observe and measure the structural abnormalities in order to evaluate the severity of the disease . it is reported that msct is more sensitive than x - ray in displaying many aspects , including the hardening of the impacted area on the acetabular edge , early changes in subchondral bone density , tiny synovial hernia , and acetabular rim ossicles on the acetabular edge . there were still some shortcomings in this study , such as the relatively small sample size , the absence of a healthy control group , and the lack of a the previously reported x - ray findings , such as the pistol grip deformity and the cross - over sign are nonquantitative description . in this study , the ee angle was selected to quantify the abnormal bone structure of the hip joint in fai . the ee angle reflects the degree of the acetabular retroversion in the pincer - type fai , which is one of the features of pincer - type fai , typically manifesting as decreased ee angle . the study of a large sample by werner et al showed that the ee angle of the acetabular edge crossing negative group was 21.0 , while that of the crossing positive group was 17.3 . similarly , in chinese populations , chen et al discovered it was 20.4 in 59 fai patients . although in this study , the ee angle was measured as 13.1 3.1 on the left side and 12.5 3.9 on the right side , significantly smaller than previous studies . the reduced ee angle suggested the local excessive coverage of the femoral head by the anterior acetabular edge . according to werner 's study , the participants in our study should be diagnosed as fai ; actually , there was not any meaningful discovery of fai in all patients . in a word , we discovered that gmcs have a higher degree of retroversion ( excessive acetabular retroversion ) than fai hips , seemingly suggesting that they should be attributed to fais . however , in this study , all patients showed no symptoms and positive signs of fai . possible reasons might be that most symptoms of the fai patients occur during flexion , adduction , and internal rotation , but the gmc is a disease manifested as the abduction and external rotation deformities of the hip joint , and thus the impingement is impossible to happen . the first , ee angle can be used for diagnosing the people with balanced hip muscle forces whether have fai or not , while those populations with imbalanced myodynamia , such as gmcs , were not suitable . another probability is that , perhaps ee angle is worthy for everyone , but it has its own limitation . in other words , at least , it can not be a single imaging diagnostic basis ; the muscular factor also plays a significant role in fai pathogenesis . apart from these 2 points , this study also reminded us that , even with the presence of abnormal bone structure , as long as the muscle strength of the hip joint 's abduction and external rotation is greater than that of the adduction and internal rotation , the acetabular impingement would not happen . therefore , some studies indicated that , in the conservative treatment of fai , the excessive hip flexion , adduction , and internal rotation should be prevented , and most patients symptoms could be alleviated by doing so . emara et al reported that 33 of 37 patients showed alleviative symptoms in follow - up , and 6 of them showed recurrence of symptoms , but the pain could be tolerated and no surgery was required . gmc patient 's acetabular deformity mainly manifests as increased retroversion , which may be the anatomical basis for fai and lead to high risks of the acetabular impingement . however , all patients in this study showed no symptoms and signs of fai , suggesting that the measurement of ee angle can only be applied to assessing those people with normal hip myodynamia , and the bone deformity and the muscular disorder should be both considered in the diagnosis of fai .

abstractgluteal muscle contracture ( gmc ) is a clinical syndrome characterized by gait abnormality and limb dysfunction , as well as secondary deformities of pelvis and femur . femoroacetabular impingement ( fai ) typically could be diagnosed on the basis of computed tomography ( ct ) such as the equatorial - edge angle ( ee angle ) , but it did not work well in gmc patients . in this study , we retrospected all image data and found small ee angles in gmcs , which meant retroverted acetabulum ; however , none of them showed no symptoms and signs of fai . therefore , we had reasons to think that , some normal hips with unbalanced hip myodynamia as same as gmcs , may be incorrectly diagnosed as fai through measuring ee angle only.in consequence , the paper was designed to assess the use of the ee angle in the assessment of fai in the diagnosis , as described by werner.twenty-three patients ( 46 hips ) were collected and calculated with the equatorial - edge angle ( ee angle ) by ct scans . all of them were excluded from fai.review of the hips showed a mean ee angle was 12.93 , with a minimum of -3.42 and a maximum of 24.08. the mean value for males and females were 13.52 and 12.40 , respectively , without statistical significance , although the mean value of left hips and right sides reached 13.32 and 12.54 individually , not having statistical differences neither . there were not any symptoms or signs of fai in all patients . thus , the reduced ee angle could suggest the local excessive coverage of the femoral head by the anterior acetabular edge , but might not be a reasonably good predictor of fai.gmc patient 's acetabular deformity mainly manifests as increased retroversion , which may be the anatomical basis for fai and lead to high risks of the acetabular impingement . however , all patients in this study showed no symptoms and signs of fai , suggesting that the measurement of ee angle can only be applied to assessing those people with normal hip myodynamia , and the bone deformity and the muscular disorder should be both considered in the diagnosis of fai .

drug hypersensitivity syndrome ( dhs ) , also known as drug rash with eosinophilia and systemic symptoms ( dress ) , is a severe drug reaction . the syndrome can also be caused by other drugs , such as allopurinol , sulfonamides , beta - lactam antimicrobials , antidepressants , and nonsteroidal anti - inflammatory drugs . allopurinol hypersensitivity syndrome ( ahs ) is characterized by rash , fever , and internal organ involvement . we report a case of an exceptional presentation of agep as a manifestation of ahs . a 67-year - old male was admitted to the dermatology department with history of widespread skin eruption since 10 days . he was started on allopurinol ( 200 mg / day ) for hyperuricemia 8 weeks earlier . clinical examination showed maculopapular eruptions involving trunk , arms and legs , as well as pinhead - sized follicular and nonfollicular pustules on patient 's face and trunk . laboratory investigations revealed a white blood cell count of 13.2 10/l with atypical lymphocytes and hypereosinophilia ( eosinophil count 1.9 10/l ) . iu / l ( reference range 340 ) and alanine aminotransferase 409 iu / l ( 345 ) . barr virus , hepatitis b , c , hiv , parvovirus b19 and human herpesvirus 6 . skin biopsy showed subcorneal spongiform pustules and some single scattered necrolytic keratinocyte [ figure 1 ] . the superficial dermis was edematous , with mixed inflammatory infiltration , including numerous neutrophils and rare eosinophils consistent with the diagnosis of agep . subcorneal spongiform pustules and some single scattered necrolytic keratinocytes the patient improved markedly within 72 h on prednisone 30 mg daily ( dose of 0.5 mg / kg body weight ) . full dose corticosteroid therapy was continued for two weeks , and tapered by 2.5 mg every 57 days , with a total duration of 3 months . causality assessment by the naranjo probability scale showed that ahs had probable causal association with the adverse effect . allopurinol hypersensitivity syndrome is a rare adverse reaction characterized by a spectrum of cutaneous reactions and systemic manifestations . ahs is more frequently associated with chronic renal insufficiency and concurrent use of thiazide diuretics . the exact pathogenesis of this syndrome is yet unclear , but different hypothesis are proposed . it seems to be related to the accumulation of allopurinol or oxipurinol a ( major metabolite of allopurinol ) in patients with renal insufficiency . immunological factors , genetic factors , and human herpes virus - type 6 are also implicated . cutaneous manifestations of hypersensitivity syndrome are heterogeneous , ranging from mild morbilliform exanthema to severe toxic epidermal necrolysis and stevens johnson syndrome . pustules in dhs differ from the typical pattern of agep , in which pustules are more numerous and predominant in main body folds . we scored both the european registry of severe cutaneous adverse reaction ( regiscar ) criteria for dress and euroscar agep score . the score was 7 for dress indicating a definite case and 5 for agep indicating a probable case . the clinical features which most differentiated dress from agep in our patient were the delayed onset ( 8 weeks ) , protracted course and multi - organ involvement . the first case of ahs with generalized nonfollicular pustulosis was described in a 47-year - old man . the second is a 65-year - old man who developed ahs manifested as generalized follicular pustulosis mimicking agep . allopurinol directly inhibits the lymphocytes enzyme purine nucleoside phosphorylase and may affect certain components of the immune system with an alteration of cd4/cd8 rate . the concomitant release of several mediators from eosinophils and/or activation of neutrophils might be important for the clinical evolution of lesions , with appearance of pustules , or aggravation of skin detachment , as well as internal organ involvement in dress . a drug reaction leading to folliculitis and then pustule formation has also been proposed . clinicians should be observant of cutaneous manifestations of hypersensitivity syndrome that may be a nonfollicular and/or follicular pustular eruption as well as the more commonly associated maculopapular rash or erythroderma .

allopurinol hypersensitivity syndrome ( ahs ) is a severe drug reaction . it is characterized by rash , fever , and internal organ involvement . it may present in different clinical forms . we present a case of acute generalized exanthematous pustulosis occurring as a manifestation of ahs .

management of neglected perilunate dislocations is controversial . the various procedures such as open reduction and internal fixation ( orif ) , proximal row carpectomy , lunate excision , and wrist arthrodesis have been advocated . the aim of our study was to evaluate the functional outcome of neglected perilunate dislocations managed by orif . over a period of 10 years ( 1996 to 2006 ) , 14 patients with neglected perilunate dislocations ( undiagnosed or untreated for 6 weeks or more ) were managed by orif . six patients had dorsal trans - scaphoid perilunate dislocation , 6 patients had volar lunate dislocation while the remaining two had a dorsal perilunate dislocation the results were evaluated by clinical scoring system of cooney et al . of the four patients operated after 5 months , two had a fair result while two had a poor outcome . chondral damage to the capitate was noted intraoperatively in both the cases with poor outcomes . the two patients were found to have avascular necrosis ( avn ) of the lunate ; however , functional outcome was fair in both , and both were able to return to their profession . we observed favorable functional results of orif in neglected perilunate dislocations up to 5 months after injury . the development of avn or midcarpal arthritis was not a major disabling factor as long as stability of wrist has been restored . beyond 5 months , an alternative surgical procedure such as proximal row carpectomy should be contemplated as results of orif have not been good uniformly . perilunate injuries are high energy injuries and encountered in young adults.1 up to 25% are diagnosed late , either due to delay in presentation , poor interpretation of radiographs or due to associated injuries that require more urgent attention.13 patients who present within 6 weeks of injury are managed in a manner similar to acute injuries.34 the treatment in such cases is accurate reduction , ligament reconstruction , and stable fixation till the construct is healed.56 however , in neglected cases there is no consensus on the most appropriate treatment method.5 the alternative procedures such as proximal row carpectomy,78 lunate excision,910 and wrist arthrodesis are described.11 some have even reported long - term good results with an unreduced dislocation.12 we present a retrospective analysis of functional outcome of perilunate dislocation managed with orif . the cases were classified as neglected if these were undiagnosed or untreated for 6 weeks or more . out of 14 patients , the diagnosis was made subsequently when an attempt was made to mobilize the patient with crutches and he complained of pain in both wrists . the average age of these patients was 34.6 years ( range 21 - 48 years).the age with a predominance of males ( 12 males , 2 females ) . the dominant hand was involved in 11 patients , non - dominant side in 2 patients , and 1 patient had bilateral involvement . the treatment delay is ranged from 6 weeks to 1.5 years [ figure 1 ] . anteroposterior and lateral views of wrist showing dorsal transscaphoid perilunate dislocation out of 14 cases , 6 patients had a dorsal trans - scaphoid perilunate dislocation , 2 patients had a dorsal perilunate dislocation , and 6 patients had a seven volar lunate dislocation with one patient having bilateral volar lunate dislocation . four patients with volar lunate dislocation had symptoms of chronic median nerve compression ; one patient with bilateral volar lunate dislocation had symptoms of median nerve dysfunction in one hand and ulnar nerve dysfunction in the other . open reduction was performed through the dorsal approach in eight patients ( six with dorsal trans - scaphoid perilunate dislocation and two with dorsal perilunate dislocation ) . the dense fibrous tissue from the carpal joint spaces using a fine bone nibbler was removed . a blunt small curved periosteum elevator was used to carefully shoe - horn or lever the capitate into the lunate fossa and reduce the luno - capitate joint . in two patients with dorsal perilunate dislocations , two 1.5 mm k - wires were used as joysticks in the scaphoid and lunate . the lunate was flexed and the scaphoid extended , while an assistant drove k - wires across scapho - lunate , luno - triquetrum , and capito - lunate articulations . the scaphoid fractures in the six patients with dorsal trans - scaphoid perilunate dislocations were fixed using herbert screws . bone grafting was done in all six cases with graft taken from the distal radius . combined volar and dorsal approach was used in the six patients with seven volar lunate dislocations . the volar approach enabled decompression of the median nerve and facilitated clearing of the lunate fossa and subsequent lunate reduction . k - wires were used to stabilize the scapho - lunate , luno - triquetrum , and capito - lunate articulations . postoperatively , the wrist was immobilized in the neutral position , using a below elbow plaster of paris ( pop ) cast . the pop was changed at 4 weeks , and discontinued after 8 weeks post - surgery , when k - wires were removed . a wrist brace was continued for another 4 weeks along with wrist mobilization exercises . in patients ( n=6 ) with scaphoid fracture , serial wrist radiographs were done routinely at 6 weeks , 12 weeks , 6 months and at last followup . the patients were evaluated according to the clinical scoring system described by cooney et al.13 [ table 1 ] . clinical scoring chart ( cooney , 1987)13 the patients were followed - up for an average period of 4.1 years ( 2 - 12 years ) . among the six patients with dorsal trans - scaphoid perilunate dislocation , four patients had a good outcome score [ table 2 ] . there was one fair and one poor outcome . among the six patients with volar lunate dislocation among the two cases with dorsal perilunate dislocation , one patient had a good result and the second patient presenting 68 weeks after the injury had a poor result . the patient with dorsal perilunate dislocation presenting at 68 weeks developed mid - carpal arthritis clearly seen at 2 year followup visit [ figure 2 ] . two patients ( including the patient with bilateral involvement ) with volar lunate dislocation presenting more than 5 months after injury eventually developed avascular necrosis ( avn ) of the lunate and mid - carpal arthritis of all the involved wrist joints [ figures 3 and 4 ] . over all 5 wrist ( 3 volar dislocation , 1 trans - scaphoid and one dorsal dislocation were operated after 5 monhs had poor ( n=2 ) , fair ( n=3 ) result . summary of the patients ( a ) preoperative x - ray picture , lateral view , of a 1.5-year - old showing unreduced perilunate dislocation . ( b and c ) anteroposterior and lateral view of same case after open reduction and internal fixation with k - wires . ( d ) follow - up x - ray at 2 years x - ray photographs . ap and lateral views of both wrists showing bilateral volar lunate dislocation clinical outcome of same case ( as in figure 3 ) at one year post surgery showing fair result x - ray results of both sides , showing evidence of avn , collapse , and mid - carpal arthritis all patients except two returned to pre - injury work at an average time period of 25 weeks ( 2036 weeks ) . the four patients ( 3 median n + one ulnar n ) with pre - operative neurological deficit improved gradually over a period of 10 to 18 weeks postoperatively ( average 13.5 weeks ) . perilunate dislocations represent approximately 10% of all wrist injuries and are diagnosed late in 25% of cases.5 this percentage may be even higher in developing countries where lack of awareness and inadequate penetration of medical facilities in rural areas compounds the problem . late diagnosed perilunate dislocation ( pld ) presents with many issues ; principal among these are the anticipated complications at surgery due to extensive fibrosis and scarring , uncertainty of return of full function after reduction , and possibility of developing avn of reduced lunate postoperatively . furthermore , numerous treatment options have been advocated . these range from orif,1415 proximal row carpectomy,78 lunate excision,910 and wrist arthrodesis.11 there is no consensus about the upper time limit till when open reduction of perilunate dislocations could be attempted without significant complications . komurcu et al.16 performed orif in six cases with trans - scaphoid perilunate dislocation up to 40 days post - injury ( average 26 days ) and reported favorable results . seigert et al.18 reported good results of chronic perilunate dislocations reduced as late as 35 weeks after injury ; nevertheless , the incidence of good results reduces significantly with delays more than 8 - 12 weeks post - injury . in our series , of the four patients ( 5 wrist ) operated after 5 months , two had a fair result while three wrist had a poor outcome . our findings are similar to those of kailu et al.5 who have reported a favorable outcome in cases delayed up to 25 weeks . kailu et al.5 have also noted that poor results correlate with not only duration of injury but with also the presence of chondral damage . this is also borne out by our study as significant chondral damage to the capitate was noted intra - operatively in both the cases with poor results . dimitriou et al.19 have noted that avascular collapse of lunate does not always leads to significant functional disability . both our patients with avn of the lunate had a fair outcome and were able to return to their professions . kailu et al.5 have emphasized repair of scapho - lunate and lunotriquetral ligaments in neglected perilunate dislocations . seigert18 performed ligament repair in one out of six patients with chronic perilunate dislocation . in our experience with 14 cases , stabilization of the reduced carpus with k - wires across the scapho - lunate , luno - capitate , and luno - triquetral joints we believe that with extensive fibrosis and scarring in chronic cases and the extensive dissection required to reduce the dislocation ; attempting to repair the retracted ligament ends is not worthwhile . both kailu et al.5 and siegert et al.18 furthermore , it may be suggested to use a wrist distracter intra - operatively or if possible , a few days preoperatively to help overcome the extensive fibrosis and scarring and to facilitate the clearing of the lunate fossa . arthrodesis of wrist is reported to give painless and stable joint , it may not be acceptable to most patients . macausland9 and russell10 reported satisfactory results after excision of the lunate in cases with lunate dislocations . later on , seiegert et al.18 and inoue et al.20 reported that excision of lunate alone may lead to irreversible changes due to the development of radioscaphoid arthritis . seigert et al.18 and rettig8 have reported favorable results with proximal row carpectomy in 2 and 12 cases , respectively . this study indicates that the functional results of orif in neglected perilunate dislocations up to 5 months after injury are favorable and even the development of avn or midcarpal arthritis may not be a major disabling factor , as the benefits of a stable wrist could outweigh the disadvantages . however , beyond 5 months , an alternative surgical procedure such as proximal row carpectomy may be kept in mind .

introduction : management of neglected perilunate dislocations is controversial . the various procedures such as open reduction and internal fixation ( orif ) , proximal row carpectomy , lunate excision , and wrist arthrodesis have been advocated . the aim of our study was to evaluate the functional outcome of neglected perilunate dislocations managed by orif.materials and methods : over a period of 10 years ( 1996 to 2006 ) , 14 patients with neglected perilunate dislocations ( undiagnosed or untreated for 6 weeks or more ) were managed by orif . six patients had dorsal trans - scaphoid perilunate dislocation , 6 patients had volar lunate dislocation while the remaining two had a dorsal perilunate dislocation the results were evaluated by clinical scoring system of cooney et al.results:the average followup was 4.1 years ( range 2 - 12 years ) . all except one of the patients operated earlier than 5 months had good results . of the four patients operated after 5 months , two had a fair result while two had a poor outcome . chondral damage to the capitate was noted intraoperatively in both the cases with poor outcomes . the two patients were found to have avascular necrosis ( avn ) of the lunate ; however , functional outcome was fair in both , and both were able to return to their profession.conclusion:we observed favorable functional results of orif in neglected perilunate dislocations up to 5 months after injury . the development of avn or midcarpal arthritis was not a major disabling factor as long as stability of wrist has been restored . beyond 5 months , an alternative surgical procedure such as proximal row carpectomy should be contemplated as results of orif have not been good uniformly .

epithelial - myoepithelial carcinoma ( emc ) is a rare glandular epithelial neoplasm of the salivary gland , with an incidence of less than 1 percent of all salivary gland tumors . emc generally occurs in the parotid gland , but some cases in the maxillary sinus , nasal cavity , trachea , larynx and lacrimal gland have been reported . emc originating from the external auditory canal is very rare and only one case has been reported so far worldwide.1 ) we have recently experienced a case of emc of the external auditory canal in a 45-year - old female patient . the difference between our case and the one previously published was that the tumor was previously proven as a benign mass 5 years ago . however , it seems that pleomorphic adenoma of the external auditory canal can also evolve into emc , similar to the location in the salivary gland . this is the first case in the literature showing the evolvement of pleomorphic adenoma of the external auditory canal to emc . a 45-year - old women visited the hospital for right ear fullness , which started a month before the visit . she had a history of tumor resection for pleomorphic adenoma in the right external auditory canal 5 years ago . she did not have any particular past medical history , except the above - mentioned surgery , nor any particular findings in family history or social history . on the visit , her general condition was relatively fine , and an 8 mm large pink soft tissue lump was observed on physical examination above the right external auditory canal ( fig . an 86 mm large mass of soft tissue density lesion confined to the external auditory canal was observed as well . under the diagnosis of recurrent pleomorphic adenoma , resection was performed with 2 mm margin around the mass . however , the results of postoperative permanent biopsy were consistent with emc ( fig . the tumor showed relatively low - grade differentiation , and there was no invasion of the resection margin . the estimated prognosis based on salivary gland tumor few weeks after the operation , granulation tissue appeared at the surgical site , and external auditory canal mri showed a 56 mm non - enhancing soft tissue lesion in the right external auditory canal . however , invasion into surrounding tissue or erosion of the external auditory canal bone was not detected . positron emission tomography computed tomography showed a hypermetabolic local lesion in the external auditory canal due to inflammation , but no invasion into the surrounding tissue or distant metastasis was observed ( fig . the pathological slides from the first operation 5 years ago were reviewed again to rule out the possibility of misdiagnosis , but there was no evidence of malignancy at that time . although the mass had been completely removed , we were concerned about potential microscopic seeding of the emc . the posterosuperior bone canal and adjacent soft tissue were completely removed , but the anteroinferior bone canal and tympanic membrane were preserved . the classical lateral temporal bone resection involves removal of the bony ear canal , tympanic membrane , and the middle ear , which leads to a high degree of conductive hearing loss . however , we expected good prognosis in this case , such as low grade salivary glands tumor . therefore a modified form of lateral temporal bone resection was chosen in order to preserve the hearing . according to the pathologic findings , there was no remaining malignant tumor , and only chronic inflammation was observed . two months after the operation , the temporal bone ct showed no abnormal contrast enhancement suggestive for a new mass or the recurrence of carcinoma in the external auditory canal . the surgical site was maintained satisfactorily with - out any sign of recurrence , and the patient 's hearing was well preserved for 6 months after the operation ( fig . emc is a rare tumor first described in 1972 by donath , et al.,2 ) and around 320 cases have been so far reported worldwide . the primary site was the parotid gland in 62% of the cases , and emc is also distributed in the nasal cavity , sinuses , palate , submandibular gland , lesser salivary gland , larynx and trachea.3 - 5 ) the average age of tumor onset is 61 years and the incidence is higher in women.3,6 ) emc originating from the external auditory canal has been reported so far in only one case worldwide.1 ) our report is presumably the second case in the literature . the diagnosis of emc is based on optical microscopy , and definite diagnosis is made through immunohistochemical study.7 ) histologically , emc is characterized by tubules consisting of two types of cells , i.e. eosinophilic cuboidal epithelial cells in the inner layer and myoepithelial cells surrounding the membrane with plasma in the outer layer . in immunohistochemical test , epithelial cells in the inner layer can be detected through cytokeratin staining , and myoepithelial cells in the outer layer through antibody staining with s-100 protein and -smooth muscle actin.8 ) as presented in fig . 2 , we were also able to observe the typical cytokeratin staining inner layer and s-100 protein staining outer layer . emc needs to be differentiated from clear cell predominant tumors , such as clear cell myoepithelioma , acinic cell carcinoma and adenoid cystic carcinoma . however , it is easily confused , particularly because adenoid cystic carcinoma has a double - layer structure . s-100 protein is usually staining the outer layer of emc , but the inner layer of the adenoid cystic carcinoma . one interesting finding is that the emc of this patient was previously proven to be a benign tumor ( i.e. pleomorphic adenoma ) 5 years ago . as pleomorphic adenoma can evolve into carcinoma ex pleomorphic adenoma in the salivary gland,9 ) we presumed that the emc of this patient has evolved from the former pleomorphic adenoma . malignant transformation of pleomorphic adenoma is logically possible , but it has never been identified in the external auditory canal . therefore , this is the first report in the literature presenting the evolvement of pleomorphic adenoma into emc in the external auditory canal . another issue is identifying from which cell the emc has originated . in the report of kong , et al.,1 ) the authors have presumed that the cancer has originated from an ectopic minor salivary gland located in the external auditory canal skin . this hypothesis is feasible , but another possibility may be that the emc has originated from the eccrine cells of the external auditory canal . ectopic minor salivary gland may arise anywhere in the head and neck region , but the chances of minor salivary gland arising from the external auditory canal may be low . considering that the normal eccrine gland is also composed of epithelial and myoepithelial cells , eccrine gland can also be an origin of emc . although not certain , we thought that it was more likely that the emc arised from the eccrine gland than the ectopic minor salivary gland of the external auditory canal . pleomorphic adenoma frequently arises from the salivary gland , but it may also rarely arise from ectopic salivary gland tissue or from sebaceous glands of the skin . if it arises from the sebaceous glands , it is known as " chondroid syringoma or mixed tumor " . however , histologically pleomorphic adenoma arising from the sebaceous gland and from the salivary gland are the same.10 ) while pleomorphic adenoma in the skin is a rare tumor , it can be located in various sites in the head and neck , such as the scalp , eyelids , nose , cheek and upper lip . in the external ear , the external auditory canal is a common site of occurrence.11 ) there are those who support the view that their histologic origins are in the ceruminal glands of the cartilaginous segment of the eac.12 ) because emc is a rare disease , the standard treatment method has not been established yet . nevertheless , surgical resection is the best method known . vascular or lymphatic invasion , tumor necrosis , anaplasia of myoepithelium and clear debridement are crucial factors for prognosis.13 ) local recurrence is relatively common , reported in around 31.3% of cases.3 ) emc is classified as a low - grade tumor and it requires long - term follow - up.14 ) in our case , pathologic findings showed no sign of poor prognosis , such as vascular or lymphatic invasion , tumor necrosis , anaplasia of myoepithelium and tumor invasion of the resection margin . based on the experience in salivary gland tumors , the prognosis was expected to be favorable . thus , a typical lateral temporal bone resection was not performed . in order to conserve the hearing , we performed a modified form of lateral temporal bone resection , preserving the tympanic membrane . this surgical method is generally identical with the typical lateral temporal bone resection , except that it maintains the eardrum and the anteroinferior part of the bone canal . in this patient , the mass had already been completely removed in the first operation and histological findings were very favorable . consequently , after in - depth consultation on the pro and cons of the operation , a limited form of operation was performed . thus , we report a patient with histologically rare emc of the external auditory canal . it is presumed that pleomorphic adenoma of the external auditory canal has evolved into emc , as in salivary gland tumors .

a 45-year - old female patient visited the clinic due to ear fullness . a 8 mm sized mass was found in the external auditory canal . it was surgically removed and the pathology exam confirmed epithelial - myoepithelial carcinoma ( emc ) . emc is glandular epithelial neoplasm of the salivary gland . emc originating from the external auditory canal is very rare , and only 1 case has been reported so far in the literature . the difference between our case and the one previously published was that the tumor was previously proven as a benign tumor ( i.e. pleomorphic adenoma ) 5 years ago . therefore , this is the first case in the literature showing the evolvement of pleomorphic adenoma of the external auditory canal into emc .

gastric h / k - atpase is a key proton pump that exchanges hydrogen ( h ) and potassium ( k ) ions across the canalicular membrane in acid - secreting parietal cells . proton pump inhibitors ( ppis ) ( omeprazole , lansoprazole , rabeprazole and pantoprazole ) are initially absorbed via the small intestine and distributed to the gastric parietal cells , where they are activated in the acidic environment of their acidic vesicles and secretory canaliculi . profound acidity ( ph < 1 ) is reportedly necessary for the activation of ppis , thus it has been believed that parietal cells are the only sites in the human body in which ppis are activated . however , cells such as leukocytes and osteoclasts are also known to have acidic vesicles in their cytoplasm . the pump in these cells is known as vacuolar - type h - atpase , different from gastric h / k - atpase ( table 1 ) . if ppis indeed exerted effects on the functions of these cells , additional interesting therapeutic possibilities may be revealed for ppis . however , we would also need to pay attention to the adverse effects of long - term and high - dose ppi therapy . more than half of the japanese population is reported to be infected with helicobacter pylori ( h. pylori ) . unfortunately , japanese national health insurance does not cover treatment of asymptomatic h. pylori infection , even though gastric cancer has clearly been demonstrated to be associated with h. pylori infection . corpus - predominant gastritis is known as a high - risk gastritis pattern in relation to the development of gastric cancer , and is sometimes promoted by treatment with antisecretory drugs . the actions of ppis on the functions of cells other than parietal cells have not been well studied . wandall et al . reported that omeprazole exerts effects on neutrophil chemotaxis , degranulation and superoxide production . it has also been demonstrated that oxygen - derived free radical production from activated neutrophils is inhibited by lansoprazole in vitro , and by an autoradiographic study , that h - lansoprazole - binding sites are present in the cytoplasmic granules of neutrophils infiltrating the gastric mucosa ; also , omeprazole was reported to attenuate the adherence of neutrophils to the venular endothelium of the rat mesentery [ 2 , 3 ] . yoshida et al . reported that expression of integrins ( cd11b and cd18 ) in activated neutrophils was attenuated by omeprazole and lansoprazole . the molecular mechanisms by which ppis affect the neutrophil functions have not yet been fully elucidated . nadph - oxidase ( oxidant - producing enzyme ) and integrins ( adherence molecule ) are membrane - bound enzymes that are activated by fusion of the lysosomal membrane . thus , the effects of ppis on the functions of neutrophils may be associated with lysosomal dysfunction . to explore the underlying mechanisms , we examined the effects of ppis on the lysosomal ph of purified neutrophils activated by f - methionyl - leucyl - phenylalanine ( fmlp ) and opsonized zymosan by assessing the fluerescence intensity ratio of phagocytosed fitc - dextran using digital - fluorescence video microscopy . the results revealed that the lysosomal ph increased in a dose - dependent manner by pretreatment with omeprazole ( 1100 m ) ( table 2 ) ; the intralysosomal ph in the absence of omeprazole was 5.81 , which was not sufficient for activation of omeprazole , because the pka of omeprazole is about 4.0 , while the ph in the cytoplasmic vesicles that subsequently translocated to secondary lysosomes was estimated to be more acidic ( ph < 3 ) . if leukocyte dysfunction is evoked by ppis , the bactericidal functions of the cells may be affected . this possibility is supported by a recent clinical report indicating that the prevalence of pneumonia was significantly increased in a subject population administered ppi therapy . an acid - secreting proton pump is also expressed on the plasma membrane of bone - resorbing osteoclasts , and also of macrophages and kidney epithelial intercalated cells [ 79 ] . this pump mediates the acidification of the extracellular environment and belongs to the family of vacuolar - type h - atpases . reported that a novel selective inhibitor of the osteoclastic v - type atpase prevented bone loss in rats . although the osteoclast v - type atpase is different from the parietal h / k - atpase , tuukkanen et al . reported that omeprazole also inhibits bone resorption in vitro . in a trial conducted by mizunashi et al . , omeprazole changed bone resorption parameters , such as the urinary hydroxyproline and calcium levels , suggesting that it can suppress bone resorption . these data indicate the possible efficacy of ppis in the treatment of osteoporosis to prevent bone fractures . however , a recent case - control study demonstrated that the risk of hip fracture was increased in patients on long - term ppi therapy . these results suggest that the potentially protective effect of osteoclatic proton pump inhibition may attenuate some of the negative effects of gastric acid suppression of ppis , including on calcium absorption . the effects of ppi treatment on mucosal inflammation in the stomach are quite complex . the severity of gastritis is simply influenced by the acidity of the environment and leukocyte activity , and it is generally accepted that h. pylori is the most commonly encountered pathogen in cases of gastritis . ppis reportedly inhibit not only the bioactivity of h. pylori , but also its urease activity which is important for bacterial survival in the acidic environment [ 15 , 16 ] . these in vitro observations are supported by clinical evidence : it was demonstrated that the whole intragastric urease activity as assessed by the urea breath test ( ubt ) , was attenuated by treatment with ppis . however , logan et al . found that treatment of h. pylori - infected gastritis with ppis ( omeprazole , 4 weeks ) improved the histological severity of gastritis in the antrum , but not in the corpus . this observation is compatible with the author s data that the myeloperoxidase content , a quantitative measure of neutrophil infiltration , decreased in the antral mucosa , but significantly increased in the corpus mucosa in patients with h. pylori - infected antrum - predominant gastritis . interestingly , the bacterial density of h. pylori decreased in the antrum , but remained unchanged in the corpus after ppi therapy . this observation implies that the aggravated corpus gastritis was not due to increased bacterial intensity . monochloramine is synthesized by the reaction of ammonia with hypochlorite derived from activated neutrophils , and its synthesis is promoted as the ph rises . the second possibility is closer contact between the bacteria and the gastric mucosa sensitive to immune inflammatory responses ; deep invasion of h. pylori into the gastric pits may evoke strong inflammatory reaction . reported the important finding that atrophic gastritis was promoted in h. pylori - infected patients treated with omeprazole for a long time . since atrophic change of the gastric mucosa has been believed to be a precancerous lesion , it is acknowledged that atrophy is the final stage of mucosal inflammation , thus progression to atrophy is associated with the enhanced inflammation evoked by ppi treatment . authors found that 8-week treatment with ppis elicited a 2-fold increase in oxidative stress in the corpus mucosa , although only a 1020% increase was observed in the mucosal contents of myeloperoxidase and il-8 ( fig . 1 ) . oxidative stress was further increased after long - term ( 24 weeks ) treatment with lansoprazole . corpus - predominant gastritis is known as a high - risk factor for the development of gastric cancer . thus , we must pay attention to the risk of carcinogenic mutations in h. pylori - infected patients receiving ppi therapy . no systematic clinical trials have been performed to elucidate the relative cancer risk of ppi therapy in h. pylori - infected subjects . hypergastrinemia , which is frequently induced by ppis , is thought to be another potent risk factor for carcinogenesis . thus , we need to carefully follow the changes in the gastric mucosa after ppi administration unless anti - h . it has been demonstrated that treatment with lansoprazole reduces the mucosal inflammation in esophagus with gastro - esophageal reflux disease ( gerd ) [ 25 , 26 ] . the authors found that the oxidative stress in the ulcer scar portion in h. pylori - negative patients was significantly decreased in patients treated with ppis as compared with that in patients not treated with ppis ( fig . ulcer relapse is associated with focal inflammation , therefore ppi therapy may be useful to promote ulcer healing in h. pylori - negative subjects . ppis may modulate not only gastric h / k - atpase activity , but also v - type h - atpase activity , which is widely distributed in a variety of cells in the human body . among these , the acid - producing systems in osteoclasts and leukocytes are well developed for maintaining bone turnover and exhibit bactericidal roles and promote tissue - destructive inflammation . therefore , there is still much potential for research on the pharmacological and clinical aspects of ppi treatment .

proton pump inhibitors ( ppis ) are novel compounds that strongly inhibit the h+/k+-atpase in the gastric parietal cells to cause profound suppression of acid secretion . acid - generating atpase , also known as vacuolar - type atpase , is located in the lysozomes of leukocytes and osteoclasts and its activity is also reportedly influenced by treatment with ppis . this concept is supported by the results of studies using autoradiography in which 3h - lansoprazole uptake sites were clearly detected in the cytoplasmic granules of neutrophils infiltrating the gastric mucosa . in vitro studies indicate that ppis increase the intra - vacuolar ph in the lysosomes of purified neutrophils and attenuate the adherence of neutrophils to the vascular endothelium . in clinical practice , the acidic environment in the stomach plays a critical role in the development of gastritis induced by helicobacter pylori ( h. pylori ) . this is worthy of note , because persistent gastritis often results in atrophic and metaplastic changes in the gastric mucosa , which are believed to be preneoplastic abnormalities . in patients with h. pylori - infection , ppi therapy causes corpus - predominant gastritis , which is frequently found in the background mucosa in patients with gastric cancer . the efficacy and safety of long - term ppi - treatment have not been conclusive , thus we need to pay more attention to the additional pharmacological actions of ppis .

pseudotumor cerebri ( ptc ) is an uncommon cause of headache , presenting especially in active jsle . in this paper , we report a case of missed intractable headache that was eventually diagnosed as ptc and presented as the first manifestation of jsle . a 9-year - old girl with a history of progressive headache for four months , fever , fatigue , myalgia , arthralgia , small - joint arthritis of the hands , and recent diplopia was referred to our clinic . the diagnosis of ptc in the background of jsle was made based on her history , physical examination , positive laboratory findings , and increased intracranial pressure , with normal neuroimaging . it seems that a complete neurologic examination in newly diagnosed sle patients is mandatory , especially in the presence of any neuropsychiatric manifestations , such as headache . headache is a common neuropsychiatric manifestation in juvenile systemic lupus erythematosus ( jsle ) , occurring in approximately 38.3% of jsle patients and 72.5% of neuropsychiatric sle ( npsle ) patients ( 1 ) . pseudotumor cerebri ( ptc ) is an uncommon cause of headache , presenting especially in active jsle ( 2 ) . moreover , there are rare published reports of ptc as the first manifestation of jsle . in this paper , we report a case of missed intractable headache that was eventually diagnosed as ptc and that presented as the first manifestation of jsle . a nine - year - old girl , the third child of non - consanguineous parents , was referred to our clinic with severe headache and diplopia . the headache was localized in the right fronto - occipital region with spread to the neck and shoulders . previous records , symptoms of low - grade fever , fatigue , myalgia , arthralgia , mild headache , and small - joint arthritis of the hands had been present for four months . she had no photosensitivity , malar rash , skin lesions , oral ulcers , hair loss , or weight loss . laboratory tests at that time showed mild cytopenia , with platelet count ( plt ) of 249,000/l . her one - hour erythrocyte sedimentation rate ( esr ) was 20 mm / h and c - reactive protein ( crp ) was negative . there were elevated transaminases , with alanine transaminase ( alt ) of 108 u / ml and aspartate transaminase ( ast ) of 70 u / ml , and normal thyroid function tests , with t4 of 8 g / dl , thyroid stimulating hormone ( tsh ) of 4 miu / l . the results also showed negative antiphospholipid antibodies and venereal disease research laboratory ( vdrl ) testing , positive anti - nuclear antibody ( ana ) , negative anti - double stranded dna ( anti - dsdna ) of 69 u / ml ( positive > 100 ) , decreased complement levels ( c3 , c4 ) , and normal urinalysis . the results were compatible with juvenile - onset sle , but optimal follow - up and treatment had not been performed . after two months , her headache gradually progressed , but showed a good response to aspirin 325 mg 3 - 4 times per day , given by her parents . the neurologic findings included bilateral papilledema , bilateral 6th cranial nerve palsy , normal magnetic resonance imaging ( mri ) and magnetic resonance angiogram ( mra ) , and high cerebrospinal fluid ( csf ) opening pressure ( 55 cm h2o at the first visit , 32 cm h2o at the 7th day , and normal at the 10th day ) . csf analysis was within normal limits , with sugar of 46 mg / dl , protein of 33 mg / dl , lactate dehydrogenase ( ldh ) of 64 u / ml , and zero wbcs or red blood cells ( rbcs ) . her parents and other siblings had no history of disease ; however , her 50-year - old aunt ( mother s sister ) suffered from lupus nephritis and her five - year - old cousin ( daughter of mother s brother ) had been treated for myasthenia gravis three years earlier . in the patient s past medical history , levothyroxine had been prescribed for hypothyroidism since the age of four , with good control . the patient was admitted to our hospital with symptoms of severe headache , diplopia , fatigue , malaise , and new - onset hair loss . physical examination showed that she was alert , with an axillary temperature of 38.3c , weight of 30 kg , height of 137 cm , blood pressure of 95/60 mmhg , and heart rate of 100 beats / min . she had bilateral papilledema , bilateral 6th nerve palsy , mild organomegaly , and small - joint arthritis of the hands . the laboratory data at the time of admission showed mild leukopenia and lymphopenia , without thrombocytopenia ( wbc 4300/l , 42% lymphocytes , hgb 12.7 g / dl , and plt 307,000/l ) . she had positive ana ( 103 u / ml , positive > 42 ) and increased anti - dsdna ( 497 u / ml , positive > 100 ) . biochemical markers of renal function ( blood urea nitrogen and creatinine ) and the urinalysis were within normal limits , without any proteins or rbcs . autoantibodies to ribosomal p proteins ( anti - rib - p ) had borderline values according to the laboratory references . although a high titer of antithyroid peroxidase antibody ( anti - tpoab ) was detected ( 270 iu / ml , positive > 40 ) , thyroid function tests showed good control . according to the patient s history , physical examination findings of arthritis , and positive laboratory findings ( positive ana test , increased anti - dsdna ab , and decreased complement [ c3 , c4 ] levels ) , the patient fulfilled four sle criteria ( three laboratory criteria and one clinical criterion ) ( 3 ) . she was therefore treated for sle with acetazolamide , prednisolone ( 1.5 mg / kg / day ) , and hydroxychloroquine . after six months , the patient was in good condition , without any complaints of headache or diplopia . the causes of headache in sle patients are rarely detectable , but ptc as an infrequent cause should be considered ( 4 ) . ptc was characterized by increased intracranial pressure ( icp ) of > 20 cm h2o , with normal neurologic findings except for 6th nerve palsy and papilledema . the most serious complication of ptc is blindness due to severe papilledema ( 5 ) . there are sporadic reports of concomitant sle and ptc in adults , and more rarely in children ( 6 - 10 ) . moreover , in a few cases , ptc was reported as a first manifestation of sle in children ( 6 - 10 ) . most of these patients had prolonged headache , with the interval between the onset of headache and the diagnosis of sle being approximately two months . the headache usually subsides immediately after treatment with high - dose corticosteroids . on the other hand , delayed diagnosis or treatment ( such as in our patient ) could increase the icp , fulfilling the ptc criteria ( 5 ) . in general it has been reported in approximately 17% of sle patients with intractable headaches ( 2 ) . however , nausea , vomiting , and blurred vision are common in these cases ( 2 , 6 - 10 ) . in a report of sle patients , kim and coworkers ( 2 ) focused on the characteristics of ptc during the course of sle . thrombosis occurs in a hypercoagulable state of antiphospholipid antibody syndrome . in approximately 58% of sle patients with ptc , thromboembolic events and high titers of anti - cardiolipin antibody , these antibodies were negative , and mri and mrv were normal , so a thrombotic event could not be the cause of ptc in this patient . on the other hand , in the active phase of sle , immune complex , direct antibodies , or vasculitis may affect the function of arachnoid villi , disturbing the absorption of csf and causing ptc ( 12 ) . fragoso - loyo et al . reported high levels of some cytokines , chemokines , and inflammatory molecules in the csf of sle patients with intracranial hypertension and intractable nonspecific headache ; however , after approximately six months , when the headaches were resolved , these returned to normal limits ( 13 ) . in addition , anti - rib - p antibodies and lupus nephritis may accompany ptc ( 2 ) . our case had no renal complications , but low titers of serum anti - rib - p antibodies were detected . there are some discrepancies in the literature about the presence of autoantibodies in such cases . reported that anti - rib - p was found in 28.2% of sle patients with neuropsychiatric involvement ( npsle ) , whereas 20% of sle patients without neuropsychiatric involvement also had the same antibody . therefore , anti - rib - p is not a specific test for the diagnosis of npsle ( 14 ) . our patient had no significant amount of anti - rib - p antibody at the time of presentation . however , after a reasonable time , any changes in auto - antibody titers should be followed . corticosteroids are the main treatment for ptc in sle patients , either as intravenous methyl prednisolone pulse therapy or as high - dose oral prednisolone ( 2 , 6 - 10 ) . treatment with prednisolone dramatically improved our patient s ptc after approximately 24 hours . in conclusion , it seems that a complete neurologic examination in newly diagnosed sle patients is mandatory , especially in the presence of any neuropsychiatric manifestations , such as headache .

introductionheadache is a common neuropsychiatric manifestation of juvenile systemic lupus erythematous ( jsle ) . pseudotumor cerebri ( ptc ) is an uncommon cause of headache , presenting especially in active jsle . in this paper , we report a case of missed intractable headache that was eventually diagnosed as ptc and presented as the first manifestation of jsle.case presentationa 9-year - old girl with a history of progressive headache for four months , fever , fatigue , myalgia , arthralgia , small - joint arthritis of the hands , and recent diplopia was referred to our clinic . the diagnosis of ptc in the background of jsle was made based on her history , physical examination , positive laboratory findings , and increased intracranial pressure , with normal neuroimaging . treatment with high - dose prednisolone led to dramatic resolution of the headache.conclusionsit seems that a complete neurologic examination in newly diagnosed sle patients is mandatory , especially in the presence of any neuropsychiatric manifestations , such as headache .

relapsing fever is an infection spread by the vectors of lice and ticks ( jump et al . the most important agent is b. persica , which causes the large majority of human cases and has the widest distribution ( dschunkowsky 1913 , baltazard et al . 1950 , colin de verdire et al . 2011 ) . in eurasia , dschunkowsky ( 1913 ) was the first person who described the tick - borne relapsing fever ( tbrf in the ardebil region of iran , and because of this reason it was called borrelia persica ( euzeby 1997 ) . however , in the same area , at early time in1882 , tholozan also published the first clinical description of a case of tbrf , which he called fie ` vre recurrente asiatique , and which was transmitted to humans by an ornithodoros tick ( theodorides 1998 ) . in the following decades , cases of relapsing fever were reported and described all over the middle east region and were attributed mainly to b. persica , but other bacteria were also reported ( nicholson 1919 , adler et al . 1937 , kalra and rao 1951 , davis and hoogstraal 1954 , babudieri 1955 ) . tick - borne relapsing fever is an endemic disease in canada ( southern portion of british columbia ) , mexico , central and south america , central asia , africa , the mediterranean region , and russia ( vial et al . finally , tbrf has a mortality rate of less than 2% ( in treated patients ) to 4 10% ( in untreated individuals ) ( dworkin et al . borrelia duttoni ( causes tbrf ) , is found in east africa and transmitted by the soft tick o. moubata ( carlisle 1906 ) . for the first time , b. persica was isolated and separated from the ardabil , northwestern iran , from the blood smear of a patient by dschunkowsky and luhs in 1913 . the vector of b. persica was first found in iran in 1879 and after that , it was named as o. tholozani ( rodhain 1998 , arshi et al . tick - borne relapsing fever is acquired by at least 15 different borrelia species ( blevins et al . tbrf transmission to humans are mainly attributed to three species of argasidae including , o. tholozani , o. erraticus and o. tartokovyskyi . furthermore , b. persica , b. microti , b. latyschevi , and b. baltazardi are the major transmitting agents of tbrf in iran ( vatandoost et al . 2003 ) . in iran , principal foci of tbrf are almost mountainous provinces of north - west and west parts , and is reported from various parts situated in south and center of the country ( baltazard et al . people in endemic regions should aware of tick infected areas and rodents and use repellents and protective costume to impede tick bites ( dworkin et al . this disease is almost not diagnosed in our area due to a low index of suspicion among clinicians as well as its difficult diagnosis . the aim of this study was to present the epidemiological aspects of the disease in hamadan province , western iran , during 19992013 . in this analytical - descriptive cross sectional study , the epidemiological and clinical aspects of relapsing fever were investigated in hamadan province , western iran ( fig . the countys populations at the 2011 were 525794 , 169352 , 13711 , 75445 , 27645 and 20349 in hamadan , malayer , razan , nahavand , bahar and kabudara - hang , respectively . map of study area in hamadan province , western iran demographical , clinical , and geographical information included in the disease reporting forms and records of relapsing fever cases were requested from the health department of the hamadan university of medical sciences . a confirmed patient was defined as a person who had both febrile illness and detection of spirochetes by wright - giemsa or dark - field microscopy in a peripheral blood smear . results were presented as meanstandard deviation ( sd ) for quantitative variables and were summarized by frequency ( percentage ) for categorical variables . continuous variables were compared using non - parametric kruskal - wallis h test whenever the data did not appear to have normal distribution or when the assumption of equal variances was violated across the study groups . categorical variables were , on the other hand , compared using chi - square test . for the statistical analysis , the statistical software spss version 16.0 for windows ( spss inc . , chicago , il ) was used . during the study period , 276 cases of relapsing fever were recorded that 146 ( 52.9% ) were male and 130 ( 47.1% ) were female with overall mean age of 15.8913.69 yr . regarding age group distributions , most of patients aged less than 20 yr and the prevalence of the disease in patients aged less than 10 yr was 41.3% , in those aged 10 to 20 yr was 31.9% . the prevalence of disease was considerably lowered in older than 40 yr ( 4.7% ) . there has been a downward trend in the prevalence of relapsing fever by increasing age . according to the occupational status , there was no difference between the genders in terms of mean age , age distribution , and clinical manifestations , however occupational status was different between them ( p < 0.01 ) ( table 1 ) . baseline characteristics of tick - borne relapsing fever of hamadan province , western iran ( 19992013 ) regarding clinical manifestations , most patients suffered from classic symptoms of the mentioned disease including sweating , abdominal pain , cough , fever , chilling , headache , nausea , and vomiting . jaundice was only revealed in 8.7% and photophobia and eosinophilia were found only in 8.7% of them ( table 1 ) . the death due to tbrf in none of the patients in this study was reported . interestingly , more than half of the infected cases were found out in a city named razan ( 58.3% ) , followed by kabudrahang ( 37.3% ) , while the prevalence of disease in hamadan city as the center of province was only 2.2% ( table 2 ) . distribution of participants of tick - borne relapsing fever according to different regions of hamadan province , western iran ( 19992013 ) most cases were reported in september ( 53 cases , 19.2% ) ( fig . considering time trend of the mentioned disease between 1999 and 2013 showed an increasing trend of disease from 1999 to 2003 ( from 2.5% to 21.0% ) , while the prevalence of the disease had a decreasing trend after than from 21.0% in 2003 to 1.1% in 2010 ( fig . the trend of the changes in the prevalence of relapsing fever by gender was shown with the peak of occurrence in 2003 as 29 ( 19.9% ) in men and in 2002 as 34 ( 26.2% ) in women ( fig . , assessing the age proved that the occurrence of disease within this time showed no significant changes in the trend of the age of disease occurrence ( fig . number of tick - borne relapsing fever cases by months in hamadan province , western iran ( 19992013 ) number of tick - borne relapsing fever cases of different years in hamadan province , western iran ( 1999 2013 ) the trend of the changes in the prevalence of tick - borne relapsing fever by gender in hamadan province , western iran ( 19992013 ) the trend of the mean age of patients of tick - borne relapsing fever within study period in hamadan province , western iran ( 19992013 ) a total number of 276 cases were investigated . in the study in kurdistan province , 2014 ) and in ardebil province , iran , a total of 391 ( 49% females , 51% male ) patients were studied from 19982001 ( arshi et al . 2002 ) , which is similar to our findings . in the study of masoumi - asl et al . ( 2009 ) , the tbrf cases included 55% women and 45% men , that results of our study is opposed . in a study in the united states from 1997 to 2000 , the patients included 235 men ( 52% ) and 178 women ( 40% ) , data regarding gender was missing for 37 ( 8% ) ( dworkin et al . 2002 ) , that is similar with our study . in this study , most prevalence of the disease was 41.3% , among the age groups of 1 10 years . in a study by croche santander et al . although the distribution of the disease was similar in both male and female genders ( p > 0.05 ) , its prevalence was reduced by increase of age . ( 2009 ) reported that there were 33% of the cases younger than 5 years old , 18% of 610 years old and 27% of 1120 years old . in the study of rafinejad et al . ( 2012 ) , in kurdistan province , iran , 20002004 , most frequencies of tbrf based on age groups were observed as 43.3% , 17.5% and 17.5% in 1019 , 2029 and 04 years old , respectively . in a new highland endemic focus of western iran , most ( 91% ) of the patients were reported to be young people ( moemenbellah - fard et al . 2009 ) . in this study , the rate of infection in rancher , farmer , housekeeper , students and age under the occupation was similar to the finding of rafinejad et al . this information represented that all job groups are at risk of obtaining infection but the majority of cases in our study was rancher . the most frequent clinical presentations showed fever , chills , headache , vomiting , myalgia and abdominal pain ( croche et al . the most common clinical manifestations of tbrf in the recent study were classic symptoms ( 82.6% ) , followed by classic symptoms plus jaundice and classic symptoms plus photophobia and eosinophilia ( 8.7% , 8.7% ) , which is similar to other researches performed in this field . in the study of moemenbellah - fard et al . ( 2009 ) in western iran , cases of tbrf was almost characterized by recurring episodes of fever , chills and headache . in the investigation of arshi et al . ( 2002 ) in ardabil , northwestern province of iran , the most prevalent clinical manifestations were fever ( 93.3% ) , chills ( 86.2% ) and headache ( 85.9% ) . in a study in montana , all patients had fever and other clinical manifestations co - related with tbrf ( such as headache , rash , vomiting and myalgia ) ( schwan et al . however , the disease also occurs during the winter ( cutler 2010 ) . in our study , nearly 53.3% were occurred in the summer , and the frequencies were from april to march . cases of rf are reporting from warm provinces in south of the country as well . in masoumi - asl investigation , the peak of the tbrf prevalence was in summer and the disease occurred during all months of the year with the maximum reported from june through november ( 2009 ) . in the united states , patients were reported during all months of the year : 71% cases were occurred from june to september ; the majority of cases diagnosed in july ( 24% ) and august ( 23% ) ( dworkin et al . 2002 ) . the majority cases of tbrf were reported in the year 2002 and 2003 ( n=115 , 41.7% ) . the trend of the disease was downward in recent years probably due to improving health strategies especially among children and adolescents and particularly in rural areas . this significant trend was also shown in both genders , but the changes of this trend were independent to patients ' age . this disease still has resistant foci of infection , where control can be a major healthcare difficulty . relapsing fever can be acquired by travelers and transmitted to regions where the disease is not epidemic ( colebunders et al . after eco - challenges or in association with military training or activities such as camping or caving , provided potential hosts and natural disease ecologic cycles coincide ( sidi et al . although many would complain this limited disease , impact is not a threat to public health , the lack of consideration of relapsing fever as a potential cause of clinical findings is a cause for concern . according to epidemiological distribution , tbrf is endemic in canada ( southern portion of british columbia ) , mexico , central and south america , central asia , africa , the mediterranean region , and russia ( colebunders et al . these mentioned diseases are mostly reported from areas of war , famine , mass migrations , or overcrowding ( dworkin et al . the distribution of relapsing fever was similar in both male and female genders , but its prevalence showed a reduction in the number of victims by the increase of age . the trend of the changes in prevalence of disease has shown a downward prognosis in recent years probably due to improving health strategies especially among children and adolescents and particularly in rural areas . our study proved that the epidemiological sections of the disease is consistent with previous reports from other regions , but further studies are required to assess its epidemiological parts correctly in different areas of our country .

background : endemic relapsing fever remains under diagnosed in our area according to a low index of suspicion among clinicians , as well as its difficult diagnosis . the goal of this study was to present the epidemiological aspects of the disease in western iran.methods:in this analytical - descriptive cross - sectional study , the epidemiological and clinical aspects of relapsing fever were investigated in hamadan province , western iran from 1999 to 2013 . a confirmed patient was defined as a person who had both febrile illness and detected spirochetes by wright - giemsa or dark - field microscopy in a peripheral blood smear . for the statistical analysis , the statistical software spss was used.results:during the study period , 276 cases of relapsing fever were recorded that 146 were male . due to the age group distributions , most of the patients aged less than 20 yr . patients noticed from april through march , most cases were reported in september ( 53 cases , 19.2% ) . considering time trend of the mentioned disease between 1999 and 2013 showed an increasing trend of disease from 1999 to 2003 ( from 2.5% to 21.0% ) , while the prevalence of disease had a decreasing trend after than from 21.0% in 2003.conclusion:the rate of endemic relapsing fever is similar in both male and female genders , but its prevalence reduced by increase of age . the trend of the changes in prevalence of the mentioned disease has shown to be downward in recent years probably due to improving health policies especially among children and adolescents and particularly in rural areas .

hypothyroidism and subclinical hypothyroidism with / without concomitant goiter are commonly observed among patients on lithium therapy , although the frequencies vary widely from 0 - 52% amongst studies . it has been reported that lithium - associated thyrotoxicosis occurred with an incidence rate of approximately 2 - 7 cases per 1000 person - years , which is higher than the reported incidence rates of thyrotoxicosis ( 0.8 - 1.2 cases per 1000 person - years ) in the general population . in a retrospective study among 209 patients with affective disorders on long term lithium therapy , post - treatment thyrotoxicosis was noted among 2 patients ( 1 male and 1 female ) . in a cross - sectional study , 1.8% of men and 3.9% of women on lithium therapy developed thyrotoxicosis which had an incidence rates of 2.7 and 6.4 per 1000 survivor years respectively . in a prospective study only 1 among 33 women developed hyperthyroidism over the 146 person - years of follow up ; while in another report only 1 case of hyperthyroidism among 150 patients on long - term lithium therapy was observed during a 15-year follow up equivalent to 976 patient - years . we report here a patient who presented with an episode of thyrotoxicosis followed by prolonged hypothyroidism while on lithium therapy . the nature of the presentation and the follow up information on the maintenance treatment are discussed . a 61-year - old female patient was suffering bipolar affective disorder for 23 years and was maintained on lithium along with various psychotropic medications over the years . in the past she had comorbid diagnoses of alcohol dependence syndrome , obsessive compulsive disorder , benzodiazepine ( temazepam ) and nicotine dependence . there was history of self - harm attempts by overdose of prescribed medications a few times . there was no history of thyroid abnormality in the past and she was maintaining euthyroid state during the course of lithium therapy until she developed thyrotoxicosis . she was compliant to lithium . during thyrotoxicosis , she had many instances of confusion suggestive of delirium . the free t4 levels remained high for about three months at 57 , 72 , 40 pmol / l ( normal range : 12.0 - 22.0 pmol / l ) ; and the tsh values were 0.01 after around 5 months of treatment for thyrotoxicosis , the thyroid - stimulating hormone ( tsh ) level increased beyond the normal range . . however tsh level remained high and it was considered that she had developed acquired hypothyroidism possibly due to carbimazole and lithium . mu / l ) for around 7 months before becoming normal ; although there were a few fluctuations . the lithium levels of the patient had fluctuated and she had one recording of lithium level higher than 1.2 mmol / l around 5 months before the onset of thyrotoxicosis ; and a few similar recordings around one year following the thyrotoxicosis episode . tsh and lithium levels remained within usual range during the follow - up period over 5 years after the described phase of thyroid dysfunction . besides lithium , she also had olanzapine as another psychotropic medication which was continued during thyrotoxicosis and at follow up . there were no specific episodes of bipolar affective disorder during or following the active phase of thyroid abnormality . her psychiatric treatment continued as usual ; and she did not require any additional psychiatric input like crisis intervention , support from home treatment team or admission . her thyroid function tests remained mostly within normal range with an occasional brief phase of dysregulation , needing adjustment in thyroxine dose . the thyroid abnormality in this patient occurred after 18 years of being on lithium at an age of 56 . thyroid abnormality associated with lithium has been reported to be more common in women and increased with age , which fits in to the description of the case described here . it may be highlighted that lithium could be continued while the thyroid dysfunction was treated . opposite presentation i.e. thyrotoxicosis following hypothyroidism has also been reported in a lithium - treated patient . the relationship of lithium and hyperthyroidism which occurs rarely seems not to be casual , since hyperthyroidism in these patients occurs three times that of the normal population . there is clearly an increased risk of thyrotoxicosis associated with long - term lithium therapy . various reasons have been considered for this association e.g. diffuse toxic goiter , multinodular toxic goiter , silent / painless thyroiditis have been reported in these subjects . the toxic and immunomodulatory roles of lithium and perhaps genetic and dietary factors too have been implicated . according to these reports , it appears that lithium associated thyrotoxicosis is a heterogeneous condition with different kinds of underlying thyroid pathologies and the mechanisms remain uncertain . the initial thyrotoxicosis in this case for few months could possibly due to thyroiditis ; while the later acquired hypothyroidism could be due to either carbimazole or lithium , or both . it has been postulated that lithium might directly damage thyroid follicular cells and that subsequent release of thyroglobulin into the circulation might be a cause of transient thyrotoxicosis . there is a report where thyroiditis improved after withdrawal of lithium , which is consistent with the theory of lithium s direct toxic effect on thyrocytes . as the patient was euthyroid before the onset of thyrotoxicosis and was compliant to lithium when the thyrotoxicosis symptoms appeared , probability of latent hyperthyroid was unlikely . there are reports of unmasking of latent hyperthyroidism when lithium is being completely or partially discontinued . as lithium suppresses thyroid function , so the early stages of thyrotoxicosis may be clinically undetectable . the symptoms and signs of thyrotoxicosis may be confused with the side effects of lithium and if lithium is withdrawn severe rebound thyrotoxicity may occur . in conclusion , the findings suggest that although rare , thyrotoxicosis appears to be associated with long - term lithium therapy and reemphasize periodic clinical evaluation for thyroid dysfunction and thyroid function tests in lithium - treated patients , irrespective of the record of euthyroid state while on lithium . in the presented case , lithium remained effective in its maintenance role for bipolar affective disorder , following the onset of thyroid dysfunction , its course and treatment . there appears no need to discontinue lithium in the presence of thyroid abnormality in well maintained bipolar patients , especially if the thyroid abnormality is controlled .

while hypothyroidism is common in lithium - treated patients , thyrotoxicosis is rarely reported . we present a female patient on lithium for maintenance therapy of bipolar affective disorder , who developed thyrotoxicosis for few months which was followed by hypothyroidism which continued . there was no further thyrotoxicosis episode during a five year follow up period . while she was treated for thyroid dysfunction , lithium was continued . there was no clinical impact on the maintenance of the bipolar affective disorder during the follow up period ; she was maintained well in the community .

the prevalence of p. skrjabini in iran has been reported 4.2% in goat , 5.43% in sheep ( 1 , 2 ) , and 0.8% in wild sheep ( 1 , 3 ) . researchers could analyze the divergences and genetic distances among taxa in the rdna nucleotide sequences to perform phylogenetic relationships analysis and species identification researches . the rdna secondary structures are predicted from the corresponding primary sequences according to base pairing , containing all the sequence information . although , there are significant variations in rdna sequences across different taxa ( 4 ) , the corresponding secondary structures of the transcribed rrna are highly conserved during evolution ( 5 ) , perhaps due to the important role of the rrna folding in holding the structural rna functions ( 6 ) . in addition , the secondary structures are more conserved than the primary sequences for the semi - compensatory or compensatory mutations , and therefore when the multiple sequence alignments look less reliable due to deletion or insertion , the structures can help to make more reliable assignment of nucleotide homology with important role in the phylogeny ( 7 ) . in addition , some changes , like expansions and deletions , of a certain helix could be specific to a taxon to help in species identification . so , the secondary structures have drawn a lot of attention from phylogenetic scientists however , the study on secondary structures takes a slower step than that primary sequences because of the limited sequence data in genbank suitable for structure prediction . in this study , the secondary structures of 5.8srrna of p. skrjabini were comprehensively investigated and compared with secondary structure of a p. skrjabini ( eu375510.1 ) and two species of h. muscae ( ay251024.1 ) and h. microstoma ( ay251023.1 ) sequences , which are located in the same family retrieved from ncbi . such case studies are suitable to provision of basic data , both for reconstructing molecular evolution in expansive phylogenetic contexts and for analyzing function in ribosome biogenesis . however , only one study could be derived on parabronema at a molecular level ( 9 ) . the aim of this study was to analyze the 5.8s rrnagene sequence and to study the possible effect of nucleotide substitutions on the topology of the secondary structure of the 5.8s rrna molecule in p. skrjabini and related habronematidae species . consequently , we studied the 5.8s rrna gene sequence of the members of the family habronematidae and determined the probable secondary structure of the5.8s rrna molecule for the first time . dna extraction from worms was performed using an extraction kit ( mbst , iran ) according to the manufacturer s instructions . the rrna gene was amplified using the primer pairs based on the r dna genome sequence ( 9 ) . the forward primer was ps - f : 5-gta ggt gaa cct gcg gaa gg -3 and reverse primer was ps - r : 5-ttagtttcttttcct ccgct -3. the pcr reaction was carried out in a total volume of 100l containing 1pcr buffer , 100 mmol mgcl 2 , 100 m dntp mix ( cinaclone , iran ) , 20 mol of each primer ( cinaclone co. ) , 5 unit/l taq dna polymerase ( cinaclone ) and 1l of template dna ( 100 ng dna ) in an automated thermocycler . the pcr was performed using the following protocol : 5 min incubation at 94 c , 33 cycles of 45 s at 94 c , 45s at 59 c , and 45 s at 72 c , with an additional extension step for 5 min at 72 c . the pcr products were analyzed on 1% agarose gels in 0.5 tbe buffer and visualized using sybersafe staining ( cinaclon , iran ) and a uv illuminator . the pcr product was purified using a quick pcr product purification kit ( mbst , iran ) according to the manufacturer s instructions . genomic dna sequencing using the sanger method was performed in both directions on the pcr product by the kawsar biotech co. iran . the sequences were analyzed using the geneious 5.1.6 software and compared against genbank ( www.ncbi.nlm.nih.gov/ ) using the basic local alignment search tool ( blast ) . the probable secondary structure of the 5.8s rrna molecule was constructed using mfold software ( http://mfold.rit.albany.edu/ ) . common structural elements were initially recognized with the help of mfold(10 , 11 ) by screening for thermodynamically optimal and suboptimal secondary structures ( default settings , with t = 37 c ) . energy levels of the presumptive secondary structures were then calculated with mfold ( 10 , 11 ) . alignment , analysis of the derived nucleotide sequences , and cluster analysis were performed using mega 6.0 software ( 12 ) . dna extraction from worms was performed using an extraction kit ( mbst , iran ) according to the manufacturer s instructions . the rrna gene was amplified using the primer pairs based on the r dna genome sequence ( 9 ) . the forward primer was ps - f : 5-gta ggt gaa cct gcg gaa gg -3 and reverse primer was ps - r : 5-ttagtttcttttcct ccgct -3. the pcr reaction was carried out in a total volume of 100l containing 1pcr buffer , 100 mmol mgcl 2 , 100 m dntp mix ( cinaclone , iran ) , 20 mol of each primer ( cinaclone co. ) , 5 unit/l taq dna polymerase ( cinaclone ) and 1l of template dna ( 100 ng dna ) in an automated thermocycler . the pcr was performed using the following protocol : 5 min incubation at 94 c , 33 cycles of 45 s at 94 c , 45s at 59 c , and 45 s at 72 c , with an additional extension step for 5 min at 72 c . the pcr products were analyzed on 1% agarose gels in 0.5 tbe buffer and visualized using sybersafe staining ( cinaclon , iran ) and a uv illuminator . the pcr product was purified using a quick pcr product purification kit ( mbst , iran ) according to the manufacturer s instructions . genomic dna sequencing using the sanger method was performed in both directions on the pcr product by the kawsar biotech co. iran . the sequences were analyzed using the geneious 5.1.6 software and compared against genbank ( www.ncbi.nlm.nih.gov/ ) using the basic local alignment search tool ( blast ) . the probable secondary structure of the 5.8s rrna molecule was constructed using mfold software ( http://mfold.rit.albany.edu/ ) . common structural elements were initially recognized with the help of mfold(10 , 11 ) by screening for thermodynamically optimal and suboptimal secondary structures ( default settings , with t = 37 c ) . energy levels of the presumptive secondary structures were then calculated with mfold ( 10 , 11 ) . alignment , analysis of the derived nucleotide sequences , and cluster analysis were performed using mega 6.0 software ( 12 ) . the length of 5.8s rrna sequence for p.skrjabini#1 , p.skrjabini#2 , h. microstoma and h. muscae was 158 , 156 , 127 and 127bp , and the dg required for the formation of the secondary structure was 70.50 , 56.40 , 41.50 and 41.40 kcal / mol , respectively . the stem loop structures were folded using the mfold web server ( http://mfold.rna.albany.edu/ ) zuker 2003 ( fig . the 5.8s rrna gene sequences in the habronematidae samples analyzed maximization of the hydrogen bonding formed solid stems , and the largest negative delta g value ( free energy ) . we predicted the motifs for 5.8s rdna of p. skrjabini and three other sequences in genebank ( p. skrjabini#2 , h. muscae and h. microstoma ) . three motifs were identified for 5.8s of p. skrjabini#1 , the first motive- aggggg ( 6bp ) , the second motive- taaaaa ( 6bp ) and the third motive- caaaga ( 6bp ) . the first motive is repeated in two positions [ 10 and 148 ] . in addition , the second motive is repeated in two positions [ 39 and 61 ] . for p. skrjabini#2 three motifs were identified , the first motive gataaatagtgcgaattgca ( 20bp ) , the second motive- gtggat ( 6bp ) and the third motive- ccatcggg ( 8bp ) . the second motive is repeated in two positions [ 13 and 29 ] . for h. muscae there are three motifs , the first motive catcccgatggt ( 12bp ) , the second motive gtcgat ( 6bp ) and the third motive cagacg ( 6bp ) . the second motive is repeated in two positions [ 3 and 122 ] . for h. microstoma we identified three motifs , the first motive cccgatggt ( 9bp ) , the second motive agctgc ( 6bp ) and the third motive cagacg ( 6bp ) . the number of different loops , motifs and the dg for formation of the secondary structure is shown in table 1 , fig . 2 . statistical information of the predicted secondary structure of parabronema skrjabini rrna phylogenetic tree of habronematidae family the secondary structures contain more information than the primary sequences and are the bases of rrna function ; have gained a lot of attention in phylogenetic analysis . in this study , the secondary structure of 5.8s rrna of p. skrjabini was predicted and the structure comparison performed by predicating the secondary structures for a p. skrjabini and two species of habronema ( h. muscae and h. microstoma ) sequences , which is located in the same family retrieved from ncbi . 5.8s ribosomal rna ( 5.8s rrna ) is a non - coding rna component of the large subunit of the eukaryotic ribosome that plays an important role in protein translation . in this study secondary structure with bulge , hairpins , helices , interior , external and multi loops of 5.8s rrna sequence of p. skrjabini was reconstructed under specific settings for base pairing and compared with secondary structure of a sequence of p. skrjabini , and two species of habronema ( h. muscae and h. microstoma ) retrieved from ncbi . the predicted ssu rrna secondary structure in the present study was the first model for p. skrjabini . however , the prediction of the secondary structure was impaired due to a few complete sequences of limited species of parabronema . in total , 41 variable sites in the 5.8s rrna gene sequence were detected in the samples analyze ( fig . p. skrjabini#2 was more similar to h. muscae and h. microstoma and was more invariable than p. skrjabini#1 . there was a 31-nucleotide absence at the beginning of the 5.8s rrna gene of h. muscae and h. microstoma . however , this insertion is present in the p. skrjabini#1and this presence is 30 for p.skrjabini#2 . the motive 2a and 2b for p. skrjabini#2 and the motive 2a and 2b for h. muscae are different in only one nucleotide ( g - c ) . the motive 3a in h. muscae and 3a in h. microstoma is common and motive 1a in h. muscae and h. microstoma had only three - nucleotide difference . we isolated p. skrjabini#1 in sheep and from sanandaj ( west of iran ) , but p. skrjabini#2 is in camel and china , h. muscae and h. microstoama are in horse and italy . the phylogenetic tree ( fig . d : h. muscae ( ay251024.1).the position of motifs is shown on the secondary structures . the nucleotide substitutions are shown by arrows moreover , some changes , such as expansions and deletions , of a certain helix could be specific to a taxon to help a lot in species identification . using mfold software , the probable secondary structure of the 5.8s rrna gene when constructing the secondary structure of the 5.8s rrna gene sequence , the sequence of p. skrjabini was used as a consensus sequence . the secondary structure of the 5.8s rrna gene has not been described for family habronematidae , specially the genus of p. skrjabini . in our study , for the first time we determined the secondary structure of 5.8s rrna in the p. skrjabini and related habronematidae species . we made a multiple alignment and found structural differences among the analyzed samples , parabronema and habronema , which could be further used in the structure modeling across habronematidae .

background : genomic dna was isolated from parabronema skrjabini . rrna region was amplified and sequenced.methods:the rna secondary structure was predicted using mfold software ( http://mfold.rit.albany.edu ) . the secondary structure with bulge , hairpins , helices , interior , external and multi loops was predicted for 5.8srdna of our sequence of p. skrjabini and a sequence of p. skrjabini and two species of habronema ( h. microstoma and h. muscae ) in genbank . rna motifs were predicted by meme program version 4.10.2.results:the length of 5.8s rrna sequence for p. skrjabini#1 , p. skrjabini#2 , h. microstoma and h. muscae was 158 , 156 , 127 and 127bp , and the dg required for the formation of the secondary structure was 70.50 , 56.40 , 41.50 and 41.40 kcal / mol , respectively . common structural elements were initially recognized with the help of mfold by screening for thermodynamically optimal and suboptimal secondary structures ( default settings , with t = 37 c ) . the energy levels of the presumptive secondary structures were then calculated with mfold at the dna level . both motifs and the sequence of p. skrjabini#1 were completely different from the other analyzed samples . this difference might be due to the differences in host and geographical area.conclusion:this is the first molecular study of p. skrjabini in sheep , which could be further used in the structure modeling across habronematidae .

it is characterized by ipsilateral pupillary miosis , facial anhydrosis , and ptosis , resulting from damage to cervical sympathetic trunk . horner s syndrome seldom leads to significant functional impairment , but the cosmetic effect may cause considerable distress . damage to sympathetic fibers at any point along their route from the posteriolateral hypothalamus through the cervical sympathetic trunk can produce horner s syndrome . accordingly , horner s serves as a clinical manifestation of a variety of underlying pathologies , from benign cluster headaches to malignant lung or thyroid cancers . in anterior cervical spine surgery , the sympathetic trunk is thought to be most frequently damaged by sectioning or prolonged retraction of the longus colli muscle . the longus colli extends from the anterior tubercle of the atlas to the lateral vertebral bodies and transverse processes between c3 and t3 . the sympathetic trunk courses over the anterior surface of the longus colli in a loose fascial layer lateral to the medial border of the muscle . stretching sympathetic fibers while retracting the longus colli to expose the lateral vertebral bodies , uncovertebral joints , or transverse foramina may produce transient or irreversible horner s syndrome . the sympathetic trunk is particularly vulnerable to injury during surgery at middle and lower cervical levels where it lies in a relatively more medial position along the longus , or during anterolateral cervical approaches when it is directly encountered . current estimates of the incidence of horner s syndrome following anterior cervical surgery are largely based on single institution , and in some instances single surgeon case series . it is best recognized as an infrequent complication of one of the most frequently performed procedures in spine surgery , anterior cervical discectomy and fusion ( acdf ) . the incidence of horner s syndrome in early acdf series varied considerably , with reported rates ranging from 0.02% to 3.8% . in more recent acdf series , the reported incidence has been more consistent ( 0.1% to 0.3% ) . following oblique corpectomy , horner s syndrome occurs transiently in approximately 15.7% ( 73/465 ) of patients and permanently in 3.4% ( 16/465 ) . fortunately , most instances of postoperative horner s syndrome improve without treatment within 3 to 6 months . due to its rarity , even experienced surgeons with large cervical spine practices may have limited experience with postoperative horner s syndrome . indeed , in many of the series described above , incidence estimates are based on a single patient developing the complication . this multicenter study was conducted to better understand the incidence , risks , and neurologic outcomes of horner s syndrome following anterior cervical spinal surgery . we conducted a retrospective multicenter case series study involving 21 high - volume surgical centers from the aospine north america clinical research network , selected for their excellence in spine care and clinical research infrastructure and experience . medical records for 17 625 patients who received subaxial cervical spine surgery from january 1 , 2005 , to december 31 , 2011 , were reviewed to identify an occurrence of 21 predefined treatment complications . the complications included reintubation requiring evacuation , esophageal perforation , epidural hematoma , c5 palsy , recurrent laryngeal nerve palsy , superior laryngeal nerve palsy , hypoglossal or glossopharyngeal nerve palsy , dural tear , brachial plexopathy , blindness , graft extrusion , misplaced screws requiring reoperation , anterior cervical infection , carotid artery injury or cerebrovascular accident , vertebral artery injuries , thoracic duct injury , tetraplegia , intraoperative death , revision of arthroplasty , pseudomeningocele , and horner s syndrome . trained research staff at each site abstracted the data from medical records , surgical charts , radiology imaging , narratives , and other source documents for the patients who experienced one or more of the complications from the list . copies of case report forms were transferred to the aospine north america clinical research network methodological core for processing , cleaning , and data entry . test was used to analyze changes in clinical outcomes at follow - up compared to preoperative status . in total , 8887 patients who received cervical spine surgery via an anterior approach were screened . postoperative horner s syndrome was identified as a surgical complication in 5 patients ( 0.06% ; table 1 ) . the average age of patients who developed horner s syndrome was 51 ( 2.6 ) years , and the majority ( 4/5 ) were female . average weight was 78.76 ( 2.6 ) kg , and average height was 168 cm . of these 5 patients , 2 ( 40% ) were treated for axial neck pain , 2 ( 40% ) for myelopathy , and 1 ( 20% ) for radiculopathy . none of the patients had spinal instability , infection , fracture , or metastatic disease . characteristics of patients experiencing horner s syndrome following anterior approaches to the cervical spine . abbreviation : acdf , anterior cervical discectomy and fusion . surgery lasted an average of 157.2 ( 39.2 ) minutes with an average of 157.50 ml of blood loss . none of the patients who developed horner s syndrome required a blood transfusion and none smoked . the cervical levels most often involved with horner s syndrome were c5 ( 5/5 ; 100% ) , c6 ( 3/5 ; 60% ) , c7 ( 2/5 ; 40% ) , c4 ( 2/5 ; 40% ) , and c3 ( 1/5 ; 20% ) . no instances of horner s syndrome occurred in cases that involved spinal levels rostral to c3 or caudal to c7 . laterality of approach was denoted in 3 of the 5 cases , with 2 occurring on the left and 1 on the right . symptoms completely resolved in 2 patients ( 40% ) , while 1 patient experienced an incomplete resolution ( 20% ) and another experienced no improvement ( 20% ; figure 1 ) . data regarding the specific measures taken to promote recovery , such as steroids , are not available . however , the complication did not lead to any hospital readmissions or subsequent surgical procedures . symptomatic recovery from horner s syndrome caused by anterior surgical approaches to the cervical spine . in total , 8887 patients who received cervical spine surgery via an anterior approach were screened . postoperative horner s syndrome was identified as a surgical complication in 5 patients ( 0.06% ; table 1 ) . the average age of patients who developed horner s syndrome was 51 ( 2.6 ) years , and the majority ( 4/5 ) were female . average weight was 78.76 ( 2.6 ) kg , and average height was 168 cm . of these 5 patients , 2 ( 40% ) were treated for axial neck pain , 2 ( 40% ) for myelopathy , and 1 ( 20% ) for radiculopathy . none of the patients had spinal instability , infection , fracture , or metastatic disease . characteristics of patients experiencing horner s syndrome following anterior approaches to the cervical spine . abbreviation : acdf , anterior cervical discectomy and fusion . surgery lasted an average of 157.2 ( 39.2 ) minutes with an average of 157.50 ml of blood loss . none of the patients who developed horner s syndrome required a blood transfusion and none smoked . the cervical levels most often involved with horner s syndrome were c5 ( 5/5 ; 100% ) , c6 ( 3/5 ; 60% ) , c7 ( 2/5 ; 40% ) , c4 ( 2/5 ; 40% ) , and c3 ( 1/5 ; 20% ) . no instances of horner s syndrome occurred in cases that involved spinal levels rostral to c3 or caudal to c7 . laterality of approach was denoted in 3 of the 5 cases , with 2 occurring on the left and 1 on the right . symptoms completely resolved in 2 patients ( 40% ) , while 1 patient experienced an incomplete resolution ( 20% ) and another experienced no improvement ( 20% ; figure 1 ) . data regarding the specific measures taken to promote recovery , such as steroids , are not available . however , the complication did not lead to any hospital readmissions or subsequent surgical procedures . symptomatic recovery from horner s syndrome caused by anterior surgical approaches to the cervical spine . we screened 8887 patients who received anterior cervical spine surgery at 21 different institutions for the presence of postoperative horner s syndrome . consistent with previous studies , the sympathetic trunk appeared to be more vulnerable at midcervical levels ( c5 , c6 ) , and most patients experienced at least a partial recovery without further treatment . however , the incidence of horner s syndrome found in this collaborative effort ( 5/8887 , 0.06% ) is well below that of most previous reports ( table 2 ) . incidence of horner s syndrome following anterior cervical discectomy ( with or without fusion ) . the first is primarily statistical . given the rarity of postoperative horner s , even a single incidence may exaggerate its true incidence in smaller case series . this trend can be easily appreciated in the existing acdf literature . in small series described by johnston and crockard ( n = 50 ) and hankinson and wilson ( n = 52 ) , 1 and 2 instances on horner s syndrome led to incidence rates of 2.0% and 3.8% , respectively . a single occurrence of postoperative horner s syndrome led to a much smaller perceived incidence ( < 0.1% ) in larger series by fountas et al ( n = 1105 ) and nanda et al ( n = 1576 ) . in the largest previously reported acdf survey ( n = 69 590 ) , flynn found 13 cases of postoperative horner s syndrome , yielding a still smaller incidence of approximately 0.02% , which is more consistent with the 0.06% found in our study . it is important to note , that like the work of flynn , our data were derived from a multi - institutional survey , which could be prone to underreporting or differences in the propensity to report . importantly , in our study complication reporting was anonymous to both operating surgeon and institution , in an effort to mitigate reporting bias . nevertheless , the retrospective nature of our data collection represents an important limitation in our study . prospective data collection will always yield a higher rate of reported complications due to the special attention paid to adverse events . when it occurs as a complication of cervical spine surgery , there is little need for diagnostic imaging or clinical testing ( such as cocaine or apraclonidine eye drops ) to more objectively document the phenomena , perhaps making it less salient in retrospective review . regardless of estimated incidence , recommendations to mitigate the risk of horner s syndrome are fairly consistent in the literature . in general , risk of injury to the sympathetic trunk when lateral exposure is needed , it is important that dissection is carried out in the subperiosteal plane . this will allow for proper placement of retractors beneath , rather than on the surface of , the longus colli . there is some debate as to whether sharp or blunt tip lateral retractors are optimal , but periodic release after retractor placement has been proposed as a strategy that might mitigate the risk of both horner s syndrome and recurrent laryngeal palsy . a sound understanding of the regional anatomy of the cervical sympathetic trunk is key to avoiding iatrogenic horner s syndrome . to this end , several cadaveric studies delineating the anatomy of the sympathetic cervical trunk and its ganglia have been published in recent years ( table 3 ) . there are 3 ganglion in the cervical sympathetic trunk : the superior cervical ganglion positioned between the carotid sheath and longus capitus muscle at the level of c2/c3 , the small cervical ganglion at c6 , and the stellate ganglion that lies inferiorly along the longus colli between the transverse process of c7 and the neck of the first rib . from these cadaveric studies , we know that the superior cervical and stellate ganglia are consistently present , but the middle cervical ganglia is only appreciable in 33% to 48% of individuals . also , the distance between the medial border of the longus colli and the cervical sympathetic trunk laterally decreases considerable in the caudal cervical spine ( c6 : 10.6 - 16.8 mm ; c7 : 12.4 mm ) , compared to more rostral levels ( c2 : 21.1 mm ; c3 : 17.2 mm ) . the mean diameter of the cervical sympathetic trunk at the c6 level ranges between 2.7 and 3.3 mm . anatomic variations of the course of the cervical sympathetic trunk based on human cadaveric studies , demonstrating the prevalence of middle cervical sympathetic ganglion , the mean distance between the sympathetic trunk ( st ) and the medial border of the longus colli muscle ( mlcm ) , and cervical sympathetic trunk diameter ( cstd ) at the c6 level . horner s syndrome is a rare but understood complication of anterior approaches to the cervical spine . a survey of 8887 anterior cervical spine surgeries from 21 different institutions suggests that the incidence of horner s syndrome is very low ( n = 5 , 0.06% ) . common causes of horner s include lateral dissection of the longus colli with monopolar cautery and placement of retractor blades above or upon the longus . accordingly , injury to the sympathetic trunk may be limited by maintaining a midline surgical trajectory when possible , and performing a subperiosteal dissection that facilitates retractor placement under the longus colli when lateral exposure is necessary . sound knowledge of the regional anatomy of the cervical sympathetic trunk is critical to limiting iatrogenic horner s syndrome . prospective data collection from a large multi - institution study might help further clarify the true incidence and risks associated with horner s syndrome following anterior cervical spine surgery .

study design : a multicenter retrospective case series.objective:horners syndrome is a known complication of anterior cervical spinal surgery , but it is rarely encountered in clinical practice . to better understand the incidence , risks , and neurologic outcomes associated with horner s syndrome , a multicenter study was performed to review a large collective experience with this rare complication.methods:we conducted a retrospective multicenter case series study involving 21 high - volume surgical centers from the aospine north america clinical research network . medical records for 17 625 patients who received subaxial cervical spine surgery from 2005 to 2011 were reviewed to identify occurrence of 21 predefined treatment complications . descriptive statistics were provided for baseline patient characteristics . paired t test was used to analyze changes in clinical outcomes at follow - up compared to preoperative status.results:in total , 8887 patients who underwent anterior cervical spine surgery at the participating institutions were screened . postoperative horner s syndrome was identified in 5 ( 0.06% ) patients . all patients experienced the complication following anterior cervical discectomy and fusion . the sympathetic trunk appeared to be more vulnerable when operating on midcervical levels ( c5 , c6 ) , and most patients experienced at least a partial recovery without further treatment.conclusions:this collective experience suggests that horner s syndrome is an exceedingly rare complication following anterior cervical spine surgery . injury to the sympathetic trunk may be limited by maintaining a midline surgical trajectory when possible , and performing careful dissection and retraction of the longus colli muscle when lateral exposure is necessary , especially at caudal cervical levels .

it is characterized by progressive inflammation and fibrosis of the intra and extrahepatic bile ducts , which leads to progressive cholestasis , hepatic injury , and eventually liver cirrhosis ( 1 ) . people with psc are at high risk of developing cholangiocarcinoma ( cca ) , the reported incidence of which varies across different areas of the world ( 2 ) . as there is no effective medical treatment for psc , and liver transplantation ( lt ) results have been excellent , lt remains the optimum treatment choice for psc patients with end - stage liver disease ( 3 , 4 ) . in this brief report , we describe our experience evaluating the incidence of cca in people with psc who have undergone lt . their explanted livers were studied over a 3 year period in the largest liver transplant center in iran , and the results were compared to the incidence of cca secondary to psc that has been found in different areas of the world . to the best of our knowledge , such a study has not previously been performed in iran . the cases of 181 people with a diagnosis of psc or cca who had undergone lt in the liver transplant unit of namazi hospital , shiraz , iran , between 2012 and 2014 were extracted from the pathology file and evaluated . during the 3-year study period , of the 181 cases of psc , 16 were found to have cca and 165 were found to be free of malignancy , following a thorough examination of the explanted livers ( figure 1 ) . two of the 16 cca cases were of very small cca ( < 0.5 cm in diameter ) , in which lt had been performed without a pre - transplant diagnosis of cca ; the diagnosis was made after pathologic examination of the explanted liver ( figure 2 ) . in the remaining 14 cca cases , this malignancy had been diagnosed pre - transplant ( figure 3 ) . table 1 shows the characteristics and demographic findings of the psc patients with and without cca . psc is a chronic cholestatic disease , characterized by inflammation and fibrosis of bile ducts , which leads to biliary strictures , stasis , and liver cirrhosis . the worst complication of psc is the development of cca , for which there is no effective non - surgical therapy , and which is considered to be a malignancy with a poor prognosis ( 5 ) . the mean age of our psc patients who did not have cca was 35.18 11.7 , which was significantly lower than the mean age for patients with concomitant psc and cca . it has been reported that development of cca in patients with psc usually occurs when these individuals are aged in their 40s . cca without psc develops later in life , when people are aged in their 70s ( 6 ) . in the largest study conducted in iran , in which 283 people with cca were followed - up between 2001 and 2004 , the mean age of the patients was 59.7 14.4 ( 2 ) . in our study , estimated that this ratio was 1.7 ( 180 males and 103 females ) in 283 iranian cca patients ( 4 ) . therefore , in people from iran , cca is more common in males , which is partly because psc ( the major risk factor for cca ) affects men more than women ( 7 ) . as has been mentioned , the prevalence of cca in psc patients in our center was 8.8 % , with 16 patients of the total number of 181 having concomitant psc and cca . it is worth noting that two patients ( 12.5% ) were diagnosed as having cca only following pathologic study of the explanted liver . the incidence rate of cca in psc patients in our center was largely similar to that found in a swedish study , in which , of 45 cases of psc , four ( 8.9% ) developed cca during a 10-year follow - up between1975 and 1984 ( 8) . the lowest prevalence has been reported in norway ( 9 ) , with four cca patients out of 75 psc cases ( 5.3% ) , and the highest prevalence has been reported in australia , where cca was diagnosed in four patients out of 11 with psc at the time of transplantation , and recurrence of tumor was observed in two patients ( 10 ) . among studies from europe , the netherlands ( 5 ) , germany ( 11 ) , and italy ( 12 ) have reported a 10.3 % , 12% , and 6% incidence risk , respectively , of cca in people with psc . studies from several us states , showed different association risks and reported prevalence rates of between 7 and 11% ( 13 - 18 ) . studies from asia reported a lower prevalence rate of cca in psc , with 3.6% shown in a japanese study ( 7 ) , and 5.3% found in turkey ( 19 ) . table 2 shows the percentage of people with psc who developed cca during the years of follow - up or at the time of liver transplantation . in some studies , significant recurrence during follow - up was reported , even after liver transplantation ( 11 ) . ( % ) the incidence rate of cca secondary to psc in namazi hospital of shiraz , the largest referral center in the south of iran , was estimated to be 8.8% , which is intermediate in comparison with other western and asian countries . although we can not explain the reason for this difference , it appears to be an ethnic and genetic issue .

background : primary sclerosing cholangitis ( psc ) is a chronic disease , characterized by chronic inflammation and fibrosis of bile duct epithelial cells . this is a significant contributory factor to the development of malignancy , most commonly cholangiocarcinoma ( cca ) , which is the second most common malignant liver tumor.objectives:for the first time in iran , we intend to describe our experience with cases of psc , with and without cca , in explanted livers , and compare our results with those found in other areas of the world.patients and methods : the study population comprised 181 individuals with a diagnosis of psc who had undergone liver transplantation in the main liver transplant center of iran , the largest center of hepatobiliary surgery in the south of that country , over a 3-year period between 2012 and 2014 . all explanted livers , with and without cca , were evaluated.results:of the 181 patients , 16 were found to have cca , two of whom had been diagnosed after pathologic study of the explanted livers . therefore it appeared that 8.8% of the patients with psc in our center had developed cca before liver transplantation.conclusions:a comparison of our results with those obtained from other centers in both western and asian countries ( which reported cca in 3.6% - 36.5% of patients with psc ) , shows that the incidence of cca in the patients we studied is intermediate .

in recent years isoflavones ( a group of phytoestrogens ) have generated much attention both in science and in public due to their potential health beneficial effects in relation to diseases such as atherosclerosis , breast , endometrial , and prostate cancer , but also osteoporosis reviewed by duncan et al . especially leguminous plants , such as clover and soya bean , have high natural contents of phytoestrogens , the most predominant being daidzein , genistein , formononetin , and biochanin . these phytoestrogens can be found in bovine milk , as a large proportion of the feed ration for dairy cows is comprised of leguminous plants . apart from these plant isoflavones , equol may also be present in bovine milk . equol is produced from daidzein in the rumen of cows and the human intestine by the micro flora [ 3 , 4 ] . however , only about one third of people in the western populations can produce equol , likely due to the large interindividual variability in the intestinal flora . as isoflavones can change the phase 1 and phase 2 metabolisms , they have the potential to change the metabolism of endogenous compounds such as hormones and xenobiotic compounds including drugs . this may cause a change in homeostasis and/or change the oxidative tress of liver which may give rise to cancer . a recent in vivo study revealed that some dietary isoflavones could change the oxidative metabolism of 17-estradiol ( e2 ) measured using microsomes from the levers , but the activity of cyp1a , cyp2b , and cyp3a did not change indicating that the changed metabolism of e2 could be caused by an altered activity of flavin - containing monooxygenases ( fmos ) . the objective of this study was to investigate if bovine milk high or low in isoflavones can alter the liver phase 1 and phase ii metabolism . the effect of purified equol and e2 was also studied to test if the effects caused by isoflavones were an estrogen - like modification . as tween 80 ( polyxyoethylene sorbitan monooleate ) was used as a solvent for e2 it was also tested . both e2 and tween 80 the effect was measured as changes in transcription of an array of liver enzymes coding for both phase i and phase ii enzymes and transporters . the high and low isoflavone milk ( him and lim ) tested in the present experiment were obtained from a grazing study described in detail by eriksen et al . . bulk milk was obtained at the end of two 3-week periods in may to june 2006 from cows grazing alfalfa ( n = 12 ) ( low isoflavon milk , lim ) and red clover ( n = 12 ) ( high isoflavone milk , him ) was pooled . the fat percentage of the milk was determined according to the method described earlier , and milk was standardized to approximately 1.5% fat to simulate low - fat milk . the crude protein content was determined as dumas n 6.25 ( 3.4 and 3.3% for him and lim , resp . ) . milk was pasteurized in water bath ( 15 min , 65c ) and stored at 20c until further use . the analysis of the milk for isoflavones was done as described by nielsen et al . . milk samples were equilibrated to room temperature before the addition of 25 l prunetin ( 120 ng / ml ) as internal standard and 100 l -glucuronidase in order to extract aglycones of phytoestrogens . the mixture was incubated at 37c for 1 hour and shaken vigorously every 15 minutes . after centrifugation ( 10 min at 4000 rpm ) , both the creamy layer and the precipitate were discarded , while the liquid phase was recovered and submitted to solvent extraction with hexane ( 3 3 ml ) followed by ethyl acetate ( 3 3 ml ) . the residue was then resuspended in 500 l acetonitrile and a lc - ms analysis was performed . cyclodextrin - encapsulated water soluble-17-estradiol ( e2 ) was purchased from sigma - aldrich a / s ( brndby , denmark ) . racemic equol ( purity ~99% ) was purchased from gentaur molecular products bvba ( brussels , belgium ) . nmri ( bomtac : nmri ) outbred albino dams with litters standardized at postnatal day one to contain 11 female pups born on the same day were purchased from taconic ( lille skensved , denmark ) . animals were delivered pooled ( four dams with 44 pups ) , and a dam was randomly assigned 10 - 11 pups and housed individually under controlled lighting ( 12 h light / dark cycles ) and temperature ( 21 - 22c ) conditions . the dams were given fresh water and fed the rm1 diet ( special diets services , witham , uk ) ad libitum until the pups were weaned at day 15 . the rm1 diet was chosen because of the low content of phytoestrogens compared with other standard rodent diets . at weaning , pups were weighed and randomly placed in cages containing 610 pups per cage and randomly assigned to test groups . the mice were euthanized by dislocation of the neck day 22 and a piece of the liver was taken out and transferred to rna later for the gene expression analysis ( quiagen , ballerup , denmark ) . the experiment and all procedures related to the handling of animals were approved by the danish experimental animal inspectorate . in experiment 1 , mice were allocated to one of the following treatments : water alone ( control ) ( n = 9 ) ; low isoflavone milk ( lim , n = 15 ) ; high isoflavone ( him , n = 15 ) ; 33 or 100 ng e2/ml drinking water ( n = 8) . in experiment 2 the treatments were as follows : water alone ( control , n = 10 ) ; 50 g / ml equol added to the drinking water containing 1% tween 80 ( polyxyoethylene sorbitan monooleate ) ( n = 10 ) to dissolve the equol . to test the possibility that the inclusion of 1% tween 80 in the drinking water could affect the water intake or gene expression , an additional group of 10 mice were given drinking water containing only 1% tween 80 . total rna was isolated from 8 animals from each group both from experiments 1 and 2 . the rna was isolated using the nucleospin kit ( macherey nagel , duren , germany ) following the manufacturer 's manual . the reverse transcription and pcr were set up using rt first strand kit and rt sybr green qpcr master mix from sabiosciences ( tebu - bio aps . the gene expression analysis was carried out using mouse drug metabolism array assay from sabiosciences . two array plates were set up for each group of animals ( 4 animals / plate ) . for each array , 4 ug total rna was used , 1 ug of total rna from each animal . in the mouse drug metabolism array , gene expression of 84 genes involved mainly in phase i and phase ii metabolism can be analyzed ( table 1 ) . the array also includes negative and positive control and the following 5 housekeeping genes : glucuronidase , hypoxyanthine guanine phosphoribosyl transferase 1 , heat shock protein 90 , glyceraldehyde-3-phosphate dehydrogenase , and actin in order to calculate expression changes . the average cp values for all 5 housekeeping genes were used to estimate the expression changes . software developed by sabiosciences especially for these arrays was used to calculate the changes in gene expression . the concentrations of isoflavones varied between the him and lim . especially for the isoflavone metabolite equol the differences were very pronounced , 1003 ng / ml and 57,4 ng / ml for him and lim , respectively ( table 2 ) . mainly due to these differences , the total cumulative concentrations also varied significantly between him ( 1215 ng / ml ) and lim ( 118 ng / ml ) . the endogenous concentration of estrogens in milk , however , did not vary significantly ( table 2 ) . from these result and based on the daily intake of milk in the two groups , ( see nielsen et al . for further details ) the total daily intake of phytoestrogens in mice was calculated to be 425 and 3767 ng / d for low and high isoflavones milk , respectively . the intake of estrogen was 323 and 186 pg / d for him and lim , respectively . the equol - treated group was given 115000 ng / d of equol and the e2-treated group was exposed to 200 ng / d of estradiol . the result for genes modulated more than 2 times compared to control ( the group given water or water with 1% tween 80 ) is presented in table 3 . one % tween 80 ( a ) and 17-estradiol ( f ) upregulated both phase i and phase ii genes by 2.19.5 times and 2.225.4 times , respectively . equol , compared to water , only upregulated 4 genes and downregulated 2 genes , but when equol was compared to 1% tween 80 , 19 genes were regulated , 17 downregulated , and 2 upregulated . him ( d ) and lim ( e ) caused a decrease in expression of genes catalyzing the phase ii metabolism by 2 . an increased expression was obtained for one gene , a transport protein ( metallothionein 2 ) in the lim group , but not in the him group . the average cp for the 5 housekeeping genes in each group varied from 20.3 to 20.9 . the potential positive effects of phytoestrogens have generated much attention by both the public and scientists , whereas other effects , that is , changes in liver metabolism have not attracted the same attention . this study is the first to look into how cow 's milk differing in content of especially isoflavones affects the expression of an array of genes in the liver . the content of phytoestrogens in milk can vary as seen for him and lim depending on the composition of the diet that cows are fed , and organic milk in general contains higher concentrations of isoflavones especially equol [ 2 , 12 , 13 ] . the amount of equol found in this studied him is the highest so far reported , most likely due to the large proportion of red clover in the fields where cows are grazing , as red clover is known to contain high amounts of the equol precursors formononetin and daidzein [ 13 , 14 ] . both e2 and 1% tween 80 affect the liver gene expression by increasing the expression of the same phase i and phase ii genes . this indicates that tween 80 affects the liver metabolism the same way and to the same extent as 100 ng e2/ml drinking water . equol , when compared to tween 80 on the other hand , seems to exert an opposite effect as this isoflavone downregulates many of the same genes as e2 upregulates . most of the genes that are modulated by equol are also altered by him and lim indicating that the concentration of equol in both types of cow 's milk might be high enough to exert an effect . no altered expressions were found for the phase i enzymes which are in concordance with earlier published results where the enzymatic activities of the p450 isoenzymes were found to be unchanged . this indicates that the enzyme activity of these enzymes is potentially only regulated ( inhibited ) at protein level . unfortunately , the decrease in expression of the following phase ii genes chst1 ( a sulfotransferase ) , ggt ( a glutamyltransferase ) , gstp1 ( a gluthathione s- transferase ) , and nat1(a acetyltransferase ) may have a negative effect . a decrease in enzymes catalysing the conjugation reactions may cause an increase in the concentration of bioactivated compounds in the liver . as these compounds can form adduct to both proteins and dna . the antioxidant level in the cell may also be altered by both milk types caused by a decrease in the levels of peroxidases and decarboxylases . the oxidative stress , that this may induce , can cause cell damage as the reactive metabolites can start a destruction of the cell membrane . hydroxysteroid ( 17-beta ) dehydrogenase 1 and 3 ( hsd17b1 and hsd17b3 ) catalyses the conversion of estrone to the more reactive estradiol and androstenodione to androgen testosterone , respectively [ 15 , 16 ] , and the concentration of this enzymes is very high in the liver . inhibitors of hsd17b1 are currently being developed for use in therapy of hormone - dependent breast cancers as this will give a lower concentration of the active estradiol . the reduction in protein level of this enzyme caused by the milk may explain the positive effect of phytoestrogens on breast cancer found in some studies . mutations in the hsd17b3 genes occur in humans and can cause male pseudohermaphroditism or feminization because of decreased function . a decrease in the gene expression of this gene is seen after exposure to both types of milk , and it may therefore be able to induce feminization . also development of cancers of colon , breast , uterus , endometrium , and prostate has been hypothesized to be promoted by loss of activity of hsd17b1 and hsd17b3 as reviewed by vihko et al . . equol and him also induced a decrease in mrna coding for amiloride - binding protein ( amine oxidase , abp1 ) . this enzyme catalyzes the oxidative deamination compounds such as histamine and may therefore affect clinical diseases related to histidin , that is , asthma and allergic rhinitis . high plasma levels of this enzyme have been observed in human cancer but as the concentration of this enzyme decreases , no carcinogenic effect with regard to this system is expected . from this study it can be concluded , that both him and lim induce changes in hepatic gene expression likely due to the presence of isoflavones since the genes affected are also affected by equol . the decrease in phase ii enzymes could potentially give rise to epigenetic actions contributing to carcinogenesis by increasing the level of reactive oxygen metabolites . the use of tween 80 in future in vivo studies should be considered because of its effect on hepatic metabolism .

isoflavones have generated much attention due to their potential positive effects in various diseases . phytoestrogens especially equol can be found in bovine milk , as feed ration for dairy cows is comprised of plants containing phytoestrogens . the aim of this study was to analyze the changes in hepatic gene expression after dietary intake of milk high and low in isoflavones . in addition to pelleted feed female nmri mice were offered water , water added either 17-estradiol , equol , tween 80 , and milk high and low in isoflavone content for a week . gene expression was analyzed using an array qpcr kit . it was revealed that tween 80 and 17-estradiol upregulated both phase i and phase ii genes to the same extent whereas equol alone , high and low isoflavone milk did not alter the expression of phase i genes but decreased the expression of phase ii genes . this study shows that dietary isoflavones can regulate the transcription of especially phase ii liver enzymes which potentially could give rise to an increase in reactive oxygen metabolites that may contribute to the development of cancer .

fever is a common reason for seeking medical attention and accounts for more than 20% of emergency department visits.1 many mothers and caregivers have perceived phobia associated with their child 's fever for reasons that include serious infection , seizure , brain damage and death.2 paediatricians have regularly advised parents to seek immediate medical attention if their children developed a fever because fever is of great diagnostic importance especially in developing countries where infectious diseases such as malaria and pneumonia are very prevalent.3 in developing countries , because of the relatively low level of literacy and financial constraint of procuring reliable thermometers , many parents rely on palpation to assess if their children have fever.4 the objective use of the thermometer to detect the presence of fever is often limited to health care settings in most resource - poor settings . an accurate determination of the absence of fever in a child assures parents and saves cost by preventing unnecessary investigations and medication . ownership of thermometer seems poor , although no study in our environment was found to support that . in a study in new york , usa , of the 78% of caregivers that owned thermometers , nearly half ( 48% ) still utilised tactile method to assess fever.4 in another study , in india in contrast , only 15% owned thermometer with 23.8% of them not knowing how to use it.5 this underscores the fact that the use of palpation as a means of assessing fever by mothers is common and universal . majority of mothers and care givers in our environment still utilise tactile assessment to determine if their children have fever . controversies over the reliability of tactile assessment of fever have been variously reported ; while a study found it accurate enough , at least in younger infants,4 others reported that it overestimates the presence of fever.67 the reliability of the use of palpation to detect fever still remains uncertain . this study was carried out to determine the reliability of tactile assessment of fever by nigerian mothers in under-5 children and also to determine if the surface of the hand used influence the accuracy . the study further ascertained if palpation of a single or multiple anatomical sites influence the accuracy of tactile assessment of fever . children under the age of 5 years presenting for care with their mothers were recruited for the study . ethical approval was obtained from the research and ethics committee of federal medical centre owerri , imo state nigeria before commencement of the study . the subjects were recruited from the children outpatient clinic and children emergency room of the hospital . information such as age and sex of the child , mother 's age and highest educational qualification ( heq ) were captured using a profoma . thereafter , each eligible child had a tactile assessment of fever by the mother . the response of the mother as regard presence or absence of fever was documented following which the child 's axillary temperature was measured and documented . the axillary temperature was measured using mercury in glass thermometer , which was left in the axilla for 5 minutes before reading . frequencies , percentages and mean were analysed where appropriate . the sensitivity , specificity , positive predictive values ( ppvs ) and negative predictive values ( npvs ) of tactile assessment was calculated using axillary temperature of 37.5c as cut - off for fever . the different hand surfaces used for palpation , as well single versus multiple sites of palpation were also compared . there were 60 males and 53 females giving a male : female ratio of 1.1:1 . seven ( 6.2% ) of the mothers had only primary school education , while 38 ( 33.6% ) and 68 ( 60.2% ) had secondary and tertiary education , respectively . fever detected by touch was reported in 81 ( 71.6% ) children by mothers while , only 65 ( 57.5% ) mothers were able to correctly predict the presence of fever in their children . there was no statistical significant difference in the ability of the mothers to correctly predict fever with respect to their heq ( = 2.66 , p = 0.265 ) . comparison of fever detection by palpation with the mothers highest educational qualification ( heq ) irrespective of the part of hand used for palpation , the sensitivity of detection of fever by palpation was 82.4% , while the specificity was 37.1% . the use of the palmer surface of the hand had a better sensitivity ( 95.2% ) than the dorsum of the hand ( 69.2% ) . table 2 shows the sensitivity , specificity , ppv and npv of the part of hand used for palpation . sensitivity , specificity , positive predictive value ( ppv ) and negative predictive value ( npv ) of the part of hand used for palpation a total of 71 ( 62.8% ) of the mothers palpated at more than one site while the remaining 42 ( 37.2% ) used only single site . table 3 shows the different sites used by the mothers in palpation , while table 4 compares the sensitivity , specificity , ppv and npv of use of single site versus multiple sites in palpation . the use of multiple sites had better sensitivity ( 86.7% ) than the use of single site ( 76.2% ) . sites used by the mothers to palpate for fever palpation of single site versus multiple sites the present study shows that mothers can be trusted to a good extent to assess for the presence of fever in children by palpation . a sensitivity of 82.4% obtained in this study is similar to those reported by okposio and abhulimhen - iyoha in benin , nigeria as well as graneto and soglin in chicago , usa , who documented sensitivity of 89.2% and 84% , respectively.89 some studies in nigeria have reported a higher sensitivity value of 96.3% and 94.6% , respectively.610 a specificity of 37.1% obtained in the present study is quite poor and is lower than the specificities reported by other workers ranging from 64.3% to 82%.489 it is , however , higher than 23% reported by akinbami et al.6 the heterogeneity in the methodology of these studies may have been responsible for the differences obtained between the present study and some of the earlier studies . for instance , akinbami et al.,6 used rectal temperature of 38c as the cut - off of fever , wammanda and onazi10 adopted axillary temperature of 37.2c as the cut - off for fever , while the present study and that of okposio and abhulimhen - iyoha8 used axillary temperature of 37.5c as the definition of fever . although the specificity in the present study was poor , the relatively high sensitivities obtained in all the studies still make maternal palpation for the presence of fever a considerably useful method of assessment of childhood fever . although , palpation overestimates fever , the elicitation of fever by mothers would encourage early presentation as it has been documented that the concern for fever is a strong motivational factor for seeking medical care.2 the educational qualification of a mother did not influence the accuracy of palpation for the presence of fever . it is therefore expected that any mother , irrespective of her educational background should be able to appreciate fever by palpation . with a npv of 71.9% , if a mother says her child does not have fever , her history of subjective assessment of fever without the use of a thermometer is about 72% reliable . the likelihood of a child adjudged to be febrile by a mother to be truly febrile measured by the ppv in the present study is 51.9% . this is higher than 39% reported by wheybrew and co - workers.7 this higher ppv reported in this study may have been influenced by the prevalence of fever in the present study . in the present study , 57.5% of the study subjects had fever , while in the study of wheybrew et al.,7 27% of children had fever . the palmer surface of the hand was the most commonly used hand surface by mothers to palpate for fever . the sensitivity , specificity , npv and ppv of palmer surface was higher than that of the dorsal surface or the use of both surfaces . this may be attributed to the fact that receptors for detection of heat and temperature are more concentrated on the palmer surface and finger tips.11 the use of both surfaces may confuse the mother as the sensation obtained from both are likely to vary , hence the reduced sensitivity obtained in this study when compared with palmer surface alone . the forehead was the most common site used for tactile assessment of fever in this study . this corroborates reports from previous studies , which also found the forehead to be the most common anatomical site used for tactile assessment of fever.4 this may possibly be explained by the fact that the head is easily accessible compared with the other parts of the body . it was observed that palpation of multiple sites was more sensitive than use of single site . this is in agreement with an earlier report by okposio and abhulimhen - iyoha as well as singhi and sood.812 this implies that if fever is to be assessed by palpation without the use of a thermometer , palpation of multiple body sites should be utilised . palpation with the palmer surface of the hand using multiple sites improves the reliability of tactile assessment of fever . clinicians should not discountenance mothers complaint of fever in their children detected by palpation without the use of a thermometer . mothers should be taught to palpate at multiple sites with the palmer surface when palpating for the presence of fever in their children to improve the accuracy .

background : many mothers still rely on palpation to determine if their children have fever at home before deciding to seek medical attention or administer self - medications . this study was carried out to determine the accuracy of subjective assessment of fever by nigerian mothers in under-5 children.patients and methods : each eligible child had a tactile assessment of fever by the mother after which the axillary temperature was measured . statistical analysis was done using spss version 19 ( ibm inc . chicago illinois , usa , 2010).result : a total of 113 mother / child pairs participated in the study . palpation overestimates fever by 24.6% . irrespective of the surface of the hand used for palpation , the sensitivity , specificity , positive predictive value ( ppv ) and negative predictive value ( npv ) of tactile assessment were 82.4% , 37.1% , 51.9% and 71.9% , respectively . the use of the palmer surface of the hand had a better sensitivity ( 95.2% ) than the dorsum of the hand ( 69.2% ) . the use of multiple sites had better sensitivity ( 86.7% ) than the use of single site ( 76.2%).conclusion : tactile assessment of childhood fevers by mothers is still a relevant screening tool for the presence or absence fever . palpation with the palmer surface of the hand using multiple sites improves the reliability of tactile assessment of fever .

major bleeding is common in patients on oat ; eg , warfarin increases intracranial hemorrhage ( ich ) risk . a 71-year - old male on warfarin ( to reduce stroke risk ) presented at accident and emergency minor injuries unit with headache after reportedly sounding drunk. on triage , the patient appeared lucid and well . prothrombin complex concentrate ( pcc ; beriplex p / n , csl behring ) with vitamin k normalized the inr within minutes of administration . the patient underwent neurosurgery without complications , and was discharged after 5 days , with no residual neurological symptoms . , inr must be established ; if 3.0 , normalization of inr and head ct are essential . pcc is the best option to rapidly reverse anticoagulation and correct inr pre - surgery . oral anticoagulant therapy ( oat ) is prescribed to large numbers of patients for the prevention and treatment of thromboembolic disease.1 in 2001 , approximately 500,000 people in the uk took oat ; the vitamin k antagonist warfarin was used in the large majority of these patients.2 warfarin has a narrow therapeutic index ; thrombosis risk increases when the international normalized ratio ( inr ) falls below 2.0 and serious bleeding risk increases when the inr rises above 4.0 . as a result , major bleeding is a common problem in people taking oat , occurring at a rate of 2.4%8.1% per patient - year.3 intracranial hemorrhage ( ich ) is perhaps the most serious complication of oat ; warfarin therapy increases both the likelihood of suffering ich and the mortality associated with it.4,5 intracranial hemorrhage associated with oat can be divided into the following types : intracerebral / intraparenchymal , subdural / epidural ( acuteorchronic ) , and subarachnoid . intracerebral hemorrhage accounts for around 70% of oat - associated ich , with subdural hematoma making up the bulk of the remainder.5,6 current therapeutic options for reversal of oat in patients with major hemorrhage are fresh frozen plasma ( ffp ) , prothrombin complex concentrate ( pcc ; which includes the vitamin - k dependent coagulation factors ii , vii , ix and x ) and recombinant factor viia , administered in combination with vitamin k.710 although ffp is still often used , pcc offers substantial benefits over ffp and is the gold standard therapy.11 whereas pcc can be rapidly prepared and corrects vitamin k antagonist - induced impairment of hemostasis within 30 minutes of administration , ffp must be thawed and large volumes infused , leading to delayed and often inadequate correction of anticoagulation.1214 pcc also offers safety advantages over ffp , such as virus reduction / inactivation and a low risk of thrombotic events.13,15,16 ffp is associated with transfusion - related lung injury , allergy / anaphylaxis , hemolysis , and bacterial contamination / sepsis.17 a randomized , multicenter , phase iiib trial ( nct00803101 ) is currently evaluating the efficacy and safety of the pcc beriplex p / n compared with ffp in patients taking oat who require emergency surgery or invasive intervention . this study has the proportion of subjects experiencing a rapid decrease in inr as a primary endpoint and is due to complete in mid-2011 . the case described below highlights that even in the absence of neurological signs , a slow - onset headache in a patient taking oat might indicate underlying ich . in this scenario , head computed tomography(ct ) is required for differential diagnosis , and administration of pcc can rapidly reverse oat to enable successful neurosurgery . a 71-year - old white british male ( weight : 80 kg , height : 178 cm ) presented at night to our accident and emergency minor injuries unit with a headache . waves of headache that had slowly worsened over the preceding five days but were not debilitating . the headache had a slow onset and was focused around both orbits and the frontal area , with no radiation . no nausea , vomiting , changes in vision , systemic symptoms or deterioration of general health were reported . . on initial triage by a nurse , the patient was speaking in full sentences , did not appear confused and looked well . the patient s medical history included atrial fibrillation , hypertension , glaucoma , gastroesophageal reflux , and hypothyroidism . the patient was taking warfarin ( 4 mg per day ) as part of his regular medication to reduce stroke risk associated with atrial fibrillation . medication history included ranitidine , bendroflumethiazide , diltiazem , levothyroxine , and no known drug allergies . the patient was an ex - smoker ( stopped smoking 20 cigarettes per day 10 years ago ) and consumed little alcohol . he was living at home with his wife and stated that he was stressed by her recent admittance to our hospital with fast atrial fibrillation . on examination , the patient s vital signs were : blood pressure , 138/82 mmhg ; heart rate , 82 beats / min ( irregular ) ; respiratory rate , 19 breaths / min ; temperature , 35.4 c ; and oxygen saturation , 97% ( on air ) . the patient s chest was clear , with normal breath sounds . heart sounds ( in rate - controlled atrial fibrillation ) were also normal , jugular venous pressure was not raised , and there were no signs of heart failure . neurological examination showed power was 5/5 in all limbs , with normal tone , sensation and reflexes . this was most likely due to the codeine given for analgesia rather than indicating raised intracranial pressure because the patient had not vomited up to that point and did not vomit again afterwards . however , considering that the patient was normally fit and healthy , had reportedly sounded head ct indicated a large right - sided acute on chronic subdural hematoma ( maximum depth , 1.9 cm ) occupying the frontal , parietal and temporal convexities , and potentially also a small subarachnoid hemorrhage ( fig . blood tests at presentation returned an inr of 4.1 , a prothrombin time of 51 seconds , and an activated partial thromboplastin time ratio of 1.69 . because reversal of warfarin and rapid correction of inr were required before surgery , 10 mg of vitamin k and 40 iu / kg of pcc ( beriplex p / n ; csl behring , marburg , germany ) were administered intravenously . blood tests subsequently showed an inr of 1.0 , at which point the patient underwent emergency transfer to the neurosurgery department at king s college hospital , london for surgical intervention . the patient was operated on approximately 10 hours after diagnosis of the intracranial bleed and there were no bleeding complications during surgery . the patient s outcome was excellent he was discharged 5 days after surgery , with no residual neurological symptoms apparent . guidelines from the american college of emergency physicians recommend that head ct should be performed in the emergency department in patients presenting with a headache if this is accompanied by new abnormal neurological findings or is new , sudden - onset , and severe.18 the case described here , however , demonstrates that patients with large subdural hematomas may present with a slow - onset headache and no neurological symptoms . without further investigation , such patients might be given analgesic treatment and discharged , with potentially fatal consequences . in patients with a headache who are taking oat and are therefore at increased risk of major bleeding , it is imperative to establish the inr ( even if the patient s inr record book is up - to - date ) . if the inr is 3.0 , the patient should be admitted for normalization of inr and head ct should be performed in order to try and identify a treatable lesion . this is a generalized approach , however , and it is important to be aware that patients with an inr < 3.0 may also suffer an ich . sound clinical judgment and availability of hospital resources are crucial in delivering effective care on a case - by - case basis . before surgery , rapid reduction of the inr is required ( normalized inr is 1.3 ) . in line with current guidelines , the protocol in our hospital is to use beriplex p / n to achieve this and stop bleeding in patients taking oat . approximate dosing of beriplex p / n can be calculated based on patient bodyweight , the inr before treatment , and the target inr . resuscitation nurses at our hospital are trained in the administration of beriplex p / n familiarity of nurses and hematology staff with the protocol is key in enabling urgent treatment . despite this , however , treatment with ffp was initially suggested and approval had to be sought from the on - call hematology consultant before beriplex p / n could be given . once administered , beriplex p / n corrected the vitamin k antagonist - induced impairment of hemostasis within minutes , enabling the patient to be transferred and operated on . the neurosurgical team was grateful for our effective pre - transfer care and communication , both being important factors in the successful outcome of this case . in emergency bleeding situations it is vital that any barriers to early treatment are removed . in this case , this delayed the second inr reading , which is critical for deciding when a patient with major bleeding can be transferred for emergency surgery . following this case , our hospital implemented a management algorithm to help accident and emergency staff in providing pcc for warfarin reversal ; this algorithm and the pcc request form are shown in figure 2 . although this algorithm states to measure inr 46 hours after administration of pcc , it is important to be aware that pcc typically normalizes inr much more quickly than this ( ie , within 30 minutes of administration).19 valuable time could also be saved by training of on - call laboratory staff to accept direct referrals ( rather than via the on - call consultant hematologist ) . other important factors in enabling early treatment include rapid triage in accident and emergency and taking an accurate medical history . the latter is especially important when assessing patients with a headache;18 in this case , ongoing warfarin therapy indicated a possible intracranial bleed . furthermore , this case highlights the importance of taking a collateral history from a close relative or friend in elderly patients who want to maintain their independence . , this case shows that patients with ich may present with no neurological signs . in patients who are taking oat , a headache and an elevated inr ( 3.0 ) pcc is widely considered to be the best option for rapid anticoagulation reversal and correction of inr . this enables potentially life - saving neurosurgery to be performed with minimal delay , increasing the likelihood of a positive outcome .

background : oral anticoagulant therapy ( oat ) is used to prevent / treat thromboembolism . major bleeding is common in patients on oat ; eg , warfarin increases intracranial hemorrhage ( ich ) risk.case:a 71-year - old male on warfarin ( to reduce stroke risk ) presented at accident and emergency minor injuries unit with headache after reportedly sounding drunk. on triage , the patient appeared lucid and well . however , international normalized ratio ( inr ) was 4.1 . head computed tomography ( ct ) indicated a large right - sided subdural hematoma . prothrombin complex concentrate ( pcc ; beriplex p / n , csl behring ) with vitamin k normalized the inr within minutes of administration . the patient underwent neurosurgery without complications , and was discharged after 5 days , with no residual neurological symptoms.conclusions:ich patients can present with no neurological signs . in oat patients with headache , inr must be established ; if 3.0 , normalization of inr and head ct are essential . pcc is the best option to rapidly reverse anticoagulation and correct inr pre - surgery .

the condom has been known as the wetsuit , the rubber , the jimmy , and even the nightcap . the utilization of condoms for various purposes has led to its dynamic development into the conventional latex type that is widely used today . the idea of safer sex has been explored in ancient and modern history , and has been used to prevent venereal diseases . from ancient greeks to wartime procedures , condoms have been deployed in pursuit of contraceptive measures as well as presentation of an individual in public hierarchy . exploring the humble and primitive beginnings of this object and its evolution with time allows us to observe and appreciate the medical knowledge of the civilizations that have preceded the modern world today . the first known documentation of the condom was that of king minos of crete in about 3000 b.c . king minos , who ruled knossos , was a figure of history from the bronze age . his mistresses died after having intercourse with him . in order to protect himself and his partners , which included his wife pasiphae , the bladder of a goat was introduced into the woman 's vagina which protected the woman from disease . prokris , king minos ' subject , understood the sadness for minos not being able to produce an heir ; upon introduction of the sheath , significant results were shown . it is said that pasiphae had given birth to eight children after the use of the goat 's bladder . another argument brought about is that the goat 's bladder was worn by minos himself and not pasiphae . egyptians were known to have a very ritualistic culture which used symbols and calligraphy to denote objective and subjective communication . for protection during intercourse , evidence from about 1000 c.e . states that linen sheaths were used , specifically to prevent tropical diseases like bilharzia . furthermore , egyptian men wore colored sheaths to distinguish social status within their complex hierarchy . the ancient roman civilization influenced the modern world in many ways , including architecture , government , philosophy , language , and even condoms . romans were very keen on the development of public health , since diseases were prevalent as the empire spread throughout the mediterranean world and beyond . health was attributed by the people to the goddess hygieia , who was the daughter of the god of medicine , asclepius . the romans did not acknowledge the contraceptive perspective of the use of bladders of animals , but they took keen interest in its effects in public health and prevention of venereal diseases such as syphilis . little did they know that employment of the sheaths made of bladder would also be contraception ; this can be seen as something that stands out or is even contradictory of the romans due to their evident appearance as a very wise and learned empire . the condoms used in ancient rome were made of linen and animal ( sheep and goat ) intestine or bladder . it is possible that they used muscle tissue from dead combatants but no hard evidence for this exists . the archaic djukas tribe that inhabited new guinea developed its own idea of the condom . they designed a distinct type of female condom that contrasts deeply with other examples in history whether it may be the egyptians , romans , or greeks . a female sheath made from a specific plant was introduced into the vagina prior to intercourse to prevent conception . the sheath was described as six inches long , chalice shaped so that one end was open and the other closed . the pressure exerted by the vagina helped to keep the sheath in a fixed position . in a more oriental perspective , the chinese civilization , with their expertise in silk , fashioned sheaths from silk paper that were applied with an oil lubrication . sheaths became more prevalent as disease and plague spread through the east from central europe . the japanese civilization utilized the kabuta - gata , which was a shell that was used to cover the glans . the kabuta - gata could also be used as a supplement to those who suffered from erectile dysfunction . the renaissance brought about significant changes in medicine . from the 15 century to the 18 century , european scientists built upon foundations that were set by the romans and greeks . essential academic figures like leonardo da vinci began formulating detailed anatomical drawings based on dissections . the latter had been known to have performed corrupt practices such as the selling of indulgences , colonialism , and slavery . europe started to acknowledge significant progression with the rise of the difference between religion and the state ; however , the church still did have control on medical and scientific advancements . gabriele falloppio , the prominent italian anatomist accredited with describing the fallopian tube , made contributions to the condom . in the book de morbo gallico , literally the french disease , he describes a sheath of linen used for protection against syphilis . the sheath which covered the glans was fastened with a ribbon ; it was also lubricated with saliva . his experiments on 1100 men showed that the sheath protected all from contracting the disease . they were crafted by butchers , who understood the high tensile strength associated with the respective intestines . during the 17 century , the use of condoms as a contraceptive was well documented . the fertility rate in england has significantly reduced due to employment of sheaths made of intestines and bladder . the jesuit , leonardus lessius stated that the use of sheaths was a sin , and was unethical . the jesuits were known to be members of the counter reformation which was set out to re - establish the church 's influence on personal , cultural , and scientific matters in christian europe . evidence discovered in dudley castle , near birmingham , england , suggests the use of sheaths made of fish and animal intestine dating to about 1640 . during the english civil war , the forces of king charles i contracted syphilis from the periodic use of prostitutes . condoms of fish , cattle , and sheep intestine were deployed to the army to reduce transmission of syphillis , since the disease was a common cause of soldier fatality at the time . king charles ii became troubled by the number of illegitimate children belonging or associated with him . to stop these illegitimate conceptions , the doctor , known as colonel condom , prescribed this with prior knowledge that sheaths were used to prevent venereal disease transmission . the etymology of the word condom is said to have been named after this doctor . other theories include the latin word condus , which means receptacle or vessel , and the persian word the theory of the origin of the condom being from england and france is in dispute between both countries . the french associate it with the english , referring to the device as redingote anglaise or english raincoat , whereas the english refer to it as the french letter . the word condom , first took appearance in the diary of a physician , daniel turner , and it later became official when the word could be found in a dictionary detailing vernacular language in the city of london in 1785 . the veneration of the word giacomo casanova , an italian traveler from a prominent venetian family , has his own story of his experience with the condom , which can be found in his memoir , histoire de ma vie . in his younger years , casanova was not too open to using the condom , which he referred to as a dead animal skin . condoms in the 18 century commonly underwent the administration of sulfur or lye to help smoothen the sheath of intestine . casanova , at a later point in his life , started using condoms after he understood their ability of protection from disease . he used to inflate them prior to use in order to test for any leaks ; this was seen as an original example of monitoring whether the condom was fit for use . condoms started to be sold wholesale in the late 18 century , and businesses such as those of a certain mrs . by the 19 century , linen condoms were out of touch , due to them being less comfortable than the animal sheaths , and their development stopped . condoms prior to the 19 century were used by the more affluent population because the lower classes were not well acquainted with the knowledge of venereal diseases , and condoms themselves could be seen as quite expense for low incoming personnel and harlots . charles goodyear , the american inventor , significantly changed the face of the condom , with the advent of rubber vulcanization during the industrial revolution . this is the process where sulfur and natural rubber are heated together to form a more malleable and durable material with a higher elasticity and tensile strength . by 1860 , condoms were produced on a large scale ; the major benefit was that they could be reused and could be afforded at a cheaper price . skin condoms made from intestines or bladder provided more comfort , but became outdated at the end of the 19 century . the cornstock laws which were passed in 1873 in the united states prohibited the vending of condoms via post , and the laws prevented the public advertising of contraception . venereal diseases were a growing concern after 1865 which saw the end of the american civil war , and a new era in history . sexual education was more widespread at this time in order to increase awareness amongst the lower working class in america . world war i saw the deployment of condoms , along with weapons and ammunition for the german army . the american and british armies did not use condoms , even having known their ability to help prevent venereal diseases . as a result , during the campaign , it was found that the american army had a mass amount of soldiers with syphilis and gonorrhea . julius fromm , a german inventor , invented the cement dipping method for condoms , creating them to be more thin with no visible lines . the american army finally deployed condoms for their soldiers in world war ii , but success in decreasing the number of cases of syphilis and gonorrhea was not achieved . this was due to the advent of penicillin , and the serene behavior shown by the public toward the development of venereal diseases . in the 1920s , latex was invented . they now have a very high tensile strength and can now be stretched up to eight times before they fail . in more modern conditions , rubber latex condoms can be produced at a swift rate of 3000 per hour and can be lubricated with spermicide and even flavored . america and european nations became open to contraception after world war ii , in the late 1940s . the discovery of aids as a sexually transmitted disease in the 1980s brought about the popularity of condoms as a contraceptive and as a use of prevention of sexually transmitted diseases . they now could be found in most stores in europe and america and are increasingly more common in developing countries . the modern world gained an improved understanding of venereal diseases as it was incorporated in health education in schools , in social magazines , and government programs promoting safe sex . the transformation of the condom , from a piece of bladder to a small , simple latex kind with high flexibility , is one that can be looked at from a medical , scientific , and social view point . the medical knowledge of time periods before ours can be looked at from the analysis of their methods of contraception and venereal disease prevention . an essential conclusion that can be drawn from this medical history is that civilization has always had a way to deal with its problems in birth control and sexually transmitted diseases , as it has affected people of all race , color , creed , and religion . this progressive device has gained such popularity that a forecast of 18 billion condoms is predicted to be used in the year 2015 alone .

condoms have been a subject of curiosity throughout history . the idea of safer sex has been explored in ancient and modern history , and has been used to prevent venereal diseases . we conducted a historical and medical review of condoms using primary and secondary sources as well as using the rsm library and the internet . these resources show that the first use of a condom was that of king minos of crete . pasiphae , his wife , employed a goat 's bladder in the vagina so that king minos would not be able to harm her as his semen was said to contain scorpions and serpents that killed his mistresses . to egyptians , condom - like glans caps were dyed in different colours to distinguish between different classes of people and to protect themselves against bilharzia . the ancient romans used the bladders of animals to protect the woman ; they were worn not to prevent pregnancy but to prevent contraction of venereal diseases . charles goodyear , the inventor , utilized vulcanization , the process of transforming rubber into malleable structures , to produce latex condoms . the greater use of condoms all over the world in the 20th and 21st centuries has been related to hiv . this account of the use of condoms demonstrates how a primitive idea turned into an object that is used globally with a forecast estimated at 18 billion condoms to be used in 2015 alone .

a left renal vein passing behind the abdominal aorta is termed a retroaortic left renal vein ( rlrv ) , and this anomaly is a relatively uncommon condition . recent advances in computed tomography and magnetic resonance imaging techniques make it possible to visualize the vascular structures in detail . additionally , the congenital anomalies of the inferior vena cava ( ivc ) and its tributaries have become more frequently encountered in asymptomatic patients . rlrv anomalies , although usually overlooked , are not rare . however , only a few cases showing clinical symptoms with this anomaly have been reported . compression of the rlrv between the aorta and the vertebra is known to be the cause of urological problems such as hematuria , varicocele , and ureteropelvic junction obstruction ( upjo ) . we retrospectively evaluated the type , frequency , clinical significance , management , and long - term follow - up of rlrv in 9 patients who were examined with multidetector computed tomography ( mdct ) owing to urological problems . twelve patients with urological problems , such as hematuria , flank and abdominal pain , varicocele , and upjo , were studied with mdct at our institution from january 2003 to december 2009 . we retrospectively reviewed these patients ' medical records and analyzed their clinical characteristics including sex , age , type of rlrv , urologic symptoms , concomitant disease , treatment , and follow - up results ( table 1 ) . type i , ii , iii , and iv of rlrv join the ivc in the orthotopic position , join the ivc at level l4 - 5 , join at the circumaortic or collar left renal vein , or join the left common iliac vein , respectively ( fig . 1 , 2 ) . the mean age and follow - up duration of the 9 patients were 46.020.1 years ( range , 17 - 65 years ) and 32.820.1 months ( range , 15 - 69 months ) , respectively , and the male to female ratio was 5 to 4 . the urologic symptoms of the initial diagnosis were various ( microscopic hematuria : 5 of the 9 patients ; left flank pain : 4 of the 9 patients ; inguinal pain : 1 of the 5 male patients ; and gross hematuria : 1 of the 9 patients ) , and the concomitant diseases were upjo in 2 of the 9 patients and varicocele in 2 of the 5 male patients . the number of patients with type i , ii , iii , and iv of rlrv were 6 , 2 , 1 , and 0 patients , respectively . in type ii , all patients had upjo and 1 of the patients had varicocele . one of these patients underwent laparoscopic pyeloplasty , and the other patient underwent laparoscopic nephrectomy owing to a nonfunctional kidney with varicocelectomy . symptoms in the five patients with microscopic hematuria continued , whereas 1 patient with gross hematuria had resolved gross hematuria after nephrectomy . the two patients with upjo who underwent pyeloplasty and nephrectomy were treated successfully , and in the other 2 patients , the pain spontaneously resolved . the symptoms in the one patient with varicocele also spontaneously improved ( table 1 ) . however , the microscopic hematuria was not resolved with conservative management for long - term follow - up . the development of the renal veins is a part of the complex developmental process of the ivc . the process starts from the fourth week of conception and ends at about the eighth week . the ivc is formed from a vast network of three pairs of parallel veins in communication . the posterior cardinal veins , the subcardinal veins , and the supracardinal veins are in the order of appearance . during the development of the ivc , there are anastomotic communications between the subcardinal and supracardinal channels that form a collar of veins encircling the aorta . if the dorsal portion of this collar persists , then the left renal vein is posterior to the aorta , forming a rlrv . the diagnostic methods for detecting ivc anomalies in previous reports were autopsy study , renal venography , color doppler ultrasonography , computed tomography , and magnetic resonance imaging . with recent advances in computed tomography technology , mdct has replaced conventional angiography and venography in most clinical conditions . mdct is a reliable , easily applicable , and noninvasive tool for demonstration of abdominal organs and vascular structures . in type i , the ventral preaortic limb of the left renal vein is obliterated , but the dorsal retroaortic limb persists and joins the ivc in the orthotopic position . type ii results from the obliteration of the ventral preaortic limb of the left renal vein , and the remaining dorsal limb turns into the rlrv . the left renal vein lies at the level of l4 to l5 and joins the gonadal and ascending lumbar veins before joining the ivc . this type is due to the persistence of subsupracardial and intersupracardial anastomoses and the dorsal limb of the left renal vein . if all small retroaortic veins that empty into the ivc are considered , the incidence of a circumaortic left renal vein could be as high as 16% . in type iv , the ventral preaortic limb of the left renal vein is obliterated , and the remaining dorsal limb becomes the rlrv . then , the rlrv courses obliquely and caudally behind the aorta to join the left common iliac vein . the incidences of left ivc , double ivc , and retrocaval ureter are 0.2 - 0.5% , 0.3 - 2.8% , and 0.1% . the incidences of rlrv type i , ii , iii , and iv are 0.3 - 1.9% , 0.4 - 0.9% , 1.5 - 8.7% , and 0.16% , respectively . rlrv type i , ii , iii , and iv in our cases occurred in 6 , 2 , 1 , and 0 patients , respectively . during the renal surgery , this kind of anatomical variation influences the technical feasibility of the operation . failure to recognize these anomalies the posterior " nutcracker phenomenon " occurs when a decreased space between the aorta and the vertebra causes compression of the rlrv . it is postulated that compression of the left renal vein leads to hematuria because of elevated pressure in the left renal vein , resulting in congestion of the left kidney and the venous communications [ 15 - 18 ] . it is well known that the gonadal , ascending lumbar , adrenal , ureteral , and capsular veins are potential collateral venous pathways in cases of renal vein compression or obstruction . in addition , vascular dilatation of the afferent venous system can result from increased drainage pressure , which men can suffer from left - sided varicocele and women from pelvic congestion syndrome [ 19 - 21 ] . in our series , 3 patients with microscopic hematuria had type i , 1 had type ii , and 1 had type iii . symptoms continued in all patients with microscopic hematuria , maybe because of increased pressure in the renal vein , that is , the posterior nutcracker phenomenon . in two patients with varicocele , symptoms spontaneously improved in one patient ( type i ) , and the other patient ( type ii ) resolved his problem after nephrectomy . in the two cases of type ii with a left - sided upjo , it was postulated that dilatation of the renal pelvis led to the upjo directly posterior contacting the dilated left gonadal vein ( fig . one patient with partial obstruction underwent pyeloplasty because of severe left flank pain , and the other patient underwent nephrectomy for a nonfunctioning kidney . in adult upjo , the incidence of aberrant vessels is 35 - 39% [ 22 - 24 ] . three of 12 patients were related to dilated gonadal vessels and 1 patient had rlrv type iii . cho et al reported the congenital absence of the ivc as a rare cause of pulmonary thromboembolism . gibo and onitsuka reported a case of rlrv that showed left renal vein hypertension by pullback pressure measurement from the rlrv to the ivc . therefore , congenital anomalies of the venous system might easily induce the congestion of the renal bloodstream , and these anomalies might be the predisposing conditions of clinical symptoms such as hematuria , flank pain , and pelvic congestion . unawareness of this situation during retroperitoneal surgery can result in bleeding , nephrectomy , and even death . surgeons prefer the left renal vein in renal transplantation because of its longer length . because of this , it is important to know the course of the left renal vein and whether it is pre - aortic or not . it is also important to be aware of anomalies of the renal vein for distinctive diagnosis of retroperitoneal tumors , retroperitoneal lymph node pathologies , and aortic dissection . before the renal surgery , careful reading of the preoperative rlrv imaging study helps to avoid fatal complications during the operation . this study was limited by the fact that it was performed retrospectively , and the data were analyzed in selected patients who had urologic symptoms . , we could not reveal the korean incidence , follow - up results , concomitant diseases , or a casual relationship between rlrv and urologic symptoms . it may sometimes cause hematuria , flank pain , and vascular dilations ( varicocele ) . the most common type of rlrv was type i. the microscopic hematuria due to rlrv is thought to be continued in the long - term follow - up . for patients with gross hematuria or flank and inguinal pain , individualized treatment such as conservative care , pyeloplasty , varicocelectomy , and nephrectomy widespread use of diagnostic mdct in retroperitoneal diseases , particularly kidney tumors , can identify changes in the renal vascularization more easily , and thus allows urologists to plan a safe and less complicated surgery .

purposea retroaortic left renal vein ( rlrv ) is located between the aorta and the vertebra and drains into the inferior vena cava . urological symptoms can be caused by increased pressure in the renal vein . to evaluate the clinical importance of rlrv , we reviewed patients ' medical records and radiologic findings.materials and methodsnine patients who were studied with multidetector computed tomography at our institution from january 2003 to december 2009 had urologic symptoms with rlrv . we retrospectively reviewed these patients ' medical records and analyzed their clinical characteristics.resultsthe patients ' mean age was 46.020.1 years ( range , 17 - 65 years ) and the male to female ratio was 5 to 4 . the urologic symptoms of the initial diagnosis were various ( hematuria : 5 of the 9 patients ; left flank pain : 4 of the 9 patients ; inguinal pain : 1 of the 5 male patients ; and gross hematuria : 1 of the 9 patients ) . the distribution among the type i , ii , iii , and iv of rlrv was 6 , 2 , 1 , and 0 patients , respectively . the concomitant diseases were ureteropelvic junction obstruction ( upjo ; 2 of the 9 patients ) and varicocele ( 2 of the 5 male patients ) . one patient with upjo underwent pyeloplasty and the other patient with upjo underwent nephrectomy due to a nonfunctional atrophied kidney . the microscopic hematuria was not resolved with conservative management for long - term follow-up.conclusionshematuria and inguinal or flank pain seem to be common in patients with rlrv . the most common type of rlrv was type i. it appeared that the microscopic hematuria continued in the long - term follow - up .

calcium pyrophosphate crystal deposition disease ( cppd ) is the most common form of crystal arthropathy second only to gout . we presented a case of bilateral olecranon bursitis in a calcium pyrophosphate crystal deposition disease . a 42-year - old female patient is presented with golf ball sized painless swellings in the posterior aspect of her elbows . excision biopsy of the swelling showed positive birefringent calcium pyrophosphate dehydrate crystals on the inner wall of the specimen on polarized light microscopy . bilateral olecranon bursitis may be part of the extraarticular manifestations of calcium pyrophosphate dihydrate crystal deposition disease with good prognosis following in toto bursa excision . calcium pyrophosphate crystal deposition disease ( cppd ) is the most common form of crystal arthropathy second only to gout . olecranon bursitis is a condition in which there is inflammation of the bursa that overlies the olecranon process at the proximal aspect of the ulna . pain at the affected site is usually reported ; however , the swelling is sometimes painless . due to the superficial location of the olecranon bursa , it is susceptible to inflammation caused by acute or repetitive trauma , and less commonly , infection1 . inflammation as part of systemic inflammatory process ( e.g. , rheumatoid arthritis ) or crystal - deposition disease ( e.g. , gout , pseudogout ) , side effect of sunitinib used to treat patients with renal cell carcinoma . although calcium pyrophosphate dehydrate ( cppd ) crystal deposition disease , also referred to as articular chondrocalcinosis , most often involves articular cartilage , extraarticular deposits have occasionally been found . they have been described in the ligamentum flavum , in the dura mater , in the achilles tendon , and in the tissues between lumbar spinous processes . other similar deposits have been reported in the quadriceps and triceps tendons in patients with articular chondrocalcinosis . we are presenting a case of cppd presenting only as chronic bilateral olecranon bursitis without any other manifestation . the case reported here points out that olecranon bursitis may also be one of the extraarticular manifestations of cppd crystal deposition disease . she suddenly noticed small pea sized swelling with pain on right elbow 3yrs back and after 2 months started on left side . both swellings gradually increased to present size of a golf ball ( fig 1a & b ) . she had no history of trauma , micro trauma , fever , discharging sinus , other joints involvement and renal stone . on clinical examination a solitary mobile globular 5 cm x 5 cm in size non tender soft to firm in consistency without any signs of inflammation present over the posterior aspect of both elbows . all other joints were clinically normal . details of investigations as per following table 1 : the bursa was excised in toto;(fig 3 ) a careful examination during surgery did not show any pedicle or communication with the elbow joint and specimen sent for histopathological examination ( fig 4a & b ) . on histological examination , showed fibrocollagenous tissue with focal collections of chronic foam cells , congested vessels and haemorrhage , multiple irregular deposits of positive birefringent calcium pyrophosphate crystals with surrounding granulomatous lesion ( fig 5 , 6 ) . on post operative follow up patient has painless full range of movements and wound healed without complications and patient satisfied ( fig 7a & b ) . she was started on cholchicine to prevent another attacks or recurrence . follow - up after 1 year shows full range of movements and x - rays were done shows no calcification . x - ray of elbow ap and lat views showing olecranon tip erosion with normal joint space . gross specimen showing the bursal sac with yellow crystals hematoxylin - eosin - stained sections , under ordinary light , original magnification x50 . crystals in layers with underlying birefringent fibrous bundles ( unstained sections under polarized light ) . postoperative photograph showing healed operative scar with full flexion gross specimen showing the bursal sac with yellow crystals follow - up x - rays after 1 year shows no calcification postoperative photograph showing healed operative scar with full flexion extraarticular deposits of cppd crystals can be found in tendons but , to our knowledge , no case of isolated bursitis has ever been reported associated with cppd . cppd crystalline deposits occur almost in and around the joints and are characterized by the presence of calcification of the articular cartilage , menisci , synovium , and periarticular tissues . these deposits may be asymptomatic or associated with chronic articular manifestations or acute episodic arthritis , as well as a wide variety of other musculoskeletal manifestations . the various clinical patterns of cpdd include pseudogout ( acute synovitis ) , pseudorheumatoid arthritis , chronic pyrophosphate arthropathy ( pseudo - osteoarthritis ) , asymptomatic cppd deposition , pseudoneuropathic joints , hemarthrosis , monoarthropathy , solitary tophaceous deposit , traumatic arthritis , and pseudo - ankylosing spondylitis have been reported in the literature . this attack may be precipitated by trauma , surgery , serious medical illness , such as myocardial infarction , stroke , and pneumonia , and arthroscopy . the knee is the most commonly involved joint , followed by the wrist , shoulder , ankle , and elbow . approximately 5% of the cpdd patients present as pseudorheumatoid arthritis with multiple joint involvements with subacute or chronic attacks lasting 4 weeks to several months . the patients with cppd usually show chondrocalcinosis and bony erosions are not apparent in uncomplicated cpdd , while the patients with rheumatoid arthritis show bony erosions and destructive joint changes . cpdd is associated with age , trauma , osteoarthritis , and some metabolic diseases , such as hyperparathyroidism , hypomagnesemia , gout , hemochromatosis , hypothyroidism , and hypophosphatasia . our observation emphasizes the fact that cppd crystal deposition disease must be considered one of the possible causes of nonseptic olecranon bursitis , in addition to local repeated mechanical friction or gout , which are much more commonly encountered . the diagnosis of cppd can be confirmed by demonstration of the weakly positive , birefringent , rhomboid - shaped calcium pyrophosphate crystals associated with typical symptoms . cppd crystals may coexist with urate or basic calcium phosphate in inflammatory rheumatoid arthritis , degenerative osteoarthritis as well as in charcot joint . treatment is primarily symptomatic , since there is no known drug that can prevent progression of the joint destruction . nonsteroid anti - inflammatory drugs ( nsaids ) and intra - articular or systemic glucocorticoids are the most useful treatments . colchicine can be effective in recurring pseudogout , and magnesium can be used prophylactically . in a small uncontrolled series methotrexate was effective and aroused interest ; it can be used when other treatments fail10 . . bilateral olecranon bursitis may be part of the extraarticular manifestations of calcium pyrophosphate dihydrate crystal deposition disease with good prognosis following in toto bursa excision . diagnosing the cause of a olecranon bursitis can be challenging .

introduction : calcium pyrophosphate crystal deposition disease ( cppd ) is the most common form of crystal arthropathy second only to gout . common clinical presentation is an acute monoarticular arthritis commonly occurring in knee joints . we presented a case of bilateral olecranon bursitis in a calcium pyrophosphate crystal deposition disease.case report : a 42-year - old female patient is presented with golf ball sized painless swellings in the posterior aspect of her elbows . elbow joints were clinically normal except for restriction of terminal flexion . x - ray showed mild erosion at the tip of olecranon . excision biopsy of the swelling showed positive birefringent calcium pyrophosphate dehydrate crystals on the inner wall of the specimen on polarized light microscopy.conclusion:bilateral olecranon bursitis may be part of the extraarticular manifestations of calcium pyrophosphate dihydrate crystal deposition disease with good prognosis following in toto bursa excision .

chronic low back pain ( lbp ) is considered a recurring human disease . in order to walk upright and keep that position , humans exert a heavy burden on the lumbar region . since many factors contribute to lbp ( multifactorial disease ) , a simple treatment is not enough to manage it1 . chronic low back pain is defined as back pain lasting for more than 12 weeks , and it affects more than 50% of the general population . it is estimated that over 70% of adults have at least one episode of low back pain during their lifetimes . the prevalence of lbp is higher in young , economically active adults . indeed , low back pain is the second most common reason for absenteeism , and one of the most common reasons for medical consultation2 . the muscles of the trunk , which are involved in maintaining stability , can be classified into the global muscle system and the local muscle system . trunk movement is controlled by the global muscle system , which supports the spine and consists shallow lumbar muscles . the local muscle system contains many muscles , such as the multifidus , longissimus lumborum , iliocostalis lumborum , intertransversalis , and interspinal muscles , medial fiber of the lumbar quadrate muscle . the internal abdominal oblique muscle ( the fibers adhering to the fascia thoracolumbalis ) is a constituent of the local muscle system . the roles in the stabilization of the lumbar region of the multifidus and transversus abdominis muscles have been reported . the activities of the inner muscles ( multifidus and transverse abdominis muscles ) are highly correlated with the stability of the lumbar region3 . an important risk factor of low back pain is its weakness and its lack of motor control in the local muscle system , which contains the lumbar multifidus and transversus abdominis muscles4 . in the case of low activity of inner muscles , the global muscle system ( erector spinae , rectus abdominis , and abdominal oblique muscles ) compensate to maintain the stabilization of the lumbar region , and this compensation is one of the causes of lbp5 . intra - abdominal pressure is increased by the tonus of the fascia thoracolumbalis , and this is affected by contraction of the transversus abdominis and multifidus muscles . the increase in fascia thoracolumbalis tonus and the intra - abdominal pressure resulting from muscle contraction also contributes to the regional support of each spinal vertebra . in particular , support of the sacroiliac joint , one of the structures which is essential for spinal stabilization , is affected by the transversus abdominis muscle and the lower fibers of the internal abdominal oblique muscle6 . when humans engage in some activities , contraction of the transversus abdominis muscle occurs ahead of the trunk muscle groups7 , and in preparation for trunk movement , the intra - abdominal pressure ( iap ) would increases . the stabilization of the lumbar region is determined by the inner unit , which is composed of pelvic floor muscles , and the transversus abdominis and multifidus muscles , and diaphragm . active approaches to the treatment of urinary incontinence and low back pain have been put into clinical practice . in clinical research , the resistance movement of the pelvis , the pattern of proprioceptive neuromuscular facilitation ( pnf ) , neuromuscular joint facilitation ( njf ) , and mobilization are always used in the treatment of lbp , and static contraction is selected in clinical treatment . however , this treatment only relieves symptoms temporarily , and its effect does not last long . njf is a new therapeutic exercise based on kinesiology which integrates the facilitation element of proprioceptive neuromuscular facilitation and joint composition movement , aiming to improve the movement of the joint through passive exercise , active exercise , and resistance exercise8 . it is used to increase the strength , flexibility , and range of motion ( rom)9 . conservative therapy is also used in the treatment of more than 90% of patients with low back pain , and postural exercise has been widely used in clinical treatments for the prevention of lumbar lordosis and strengthening of the multifidus muscle . however , because there is no objective evaluation , its efficacy is controversial . ultrasound imaging has been advocated as a noninvasive method for quantifying muscle morphology and behavior , and it has been increasingly used both in research and as a clinical tool throughout the rehabilitation process . ultrasound imaging has been validated as a measure of lumbar multifidus muscle morphology , through comparison with magnetic resonance imaging measurements , and as an indicator of muscle activation with indwelling electromyography10 . the immediate effects of different treatments of lbp have been assessed using the cross - sectional area of the multifidus muscle measured by ultrasound imaging . however , there has been no research about the efficacy of different long - term interventions11 . the aim of this study was to examine the different effects of long - term interventions using the pnf and njf patterns on the pelvis . the subjects were twelve young people ( 5 males , 7 females ) who had suffered chronic low back pain for more than 6 months on one side of their bodies . subject characteristics are detailed in table 1table 1.subject characteristicsmsd n=12age ( y)25.9 5.3height ( cm)174.0 9.4weight ( kg)70.3 17.6vas3.8 2.8 . the purpose and contents of this research were explained to the subjects , and all subjects gave their informed consent to participation in this study . the study was approved by the research ethics committee of the international university of health and welfare , and the ird number for this study is 12 - 155 . before the treatment , the subjects were evaluated for pain severity using a visual analogue scale ( vas ) , and the cross - sectional area of the multifidus muscle and the thickness of the transversus abdominis muscle of the subjects were measured using ultrasound imaging . the subjects were joined the intervention group and control group . for the control group , the subjects were divided into pnf and njf groups , two interventions were carried out : the front inferior pelvic pattern of pnf , and the front inferior pelvic pattern of njf . in the pnf group , the front inferior pelvic pattern of pnf was carried out 3 times every week . in the njf group , the front inferior pelvic of njf was carried out 3 times every week . for the front inferior pelvic pattern of pnf , the examiner placed his hands on the subjects knees and applied traction and resistance while they performed the front inferior pelvic pattern . the static resistance and the traction were applied in the intermediate position of the pnf pattern by the examiner . for the front inferior pelvic pattern of njf , one hand of the examiner was placed against the knee , and traction and resistance were applied as in the pnf pattern . the other hand of the examiner was placed on the spinous process of l3 to prevent upward curvature . all interventions were carried out by one physiotherapist . in both the pnf and njf interventions , the maximum contraction time of 5 seconds was maintained for the intermediate position in both patterns used for the interventions . before , and after one month of pnf and njf treatments , the vas scores , cross - sectional areas of the multifidus muscle and thicknesses of the transversus abdominis muscle were measured using ultrasound imaging . each measurement was carried out twice , and the average value was used for analysis . ultrasound images of the multifidus muscle wall and transversus abdominis were obtained using a sonosite ultrasound system ( sonosite180 plus , b mode , 5 mhz linear transducer ) . gel was interposed between the transducer and the skin . in order to measure the thickness of the transversus abdominis muscle , the transducer was positioned adjacent to and perpendicular to the abdominal wall , 25 mm anteromedial to the midpoint between the ribs and ilium on the midaxillary line , and parallel to the muscle fibers of the transversus abdominis12 . for the measurement of the cross - sectional area of the multifidus muscle , the transducer was placed on the skin 25 mm distal from the spinous process of l3 and vertical to the vertebral column . to avoid inter - rater errors , the same physical therapist performed all the measurements . ultrasound images were saved as still images , and the thickness and cross - sectional area measurements were performed for muscle only , that is , between the fascia boundaries . in order to determine the minimum effect of the 2 intervention methods , the factors were the vas score , the thickness of the transversus abdominis muscle , and the cross - sectional area of the multifidus muscle . the results for vas and thickness of the musculus transversus abdominis the 12 subjects are shown in table 2table 2.vas and thickness of the transversus abdominis muscle ( cm)thickness of the transversusabdominis muscle ( cm)vasa.before treatment0.460.04a < d**3.82.8b.resting0.420.05b < c.d*4.02.5c.pnf0.480.05c < d*3.12.3c < a.b*d.njf0.600.062.32.5d < a.b.c***p<0.05 * * p<0.01 . the vas score decreased significantly in the pnf and njf groups compared with before treatment and the rest of the group . the thickness of the transversus abdominis muscle increased significantly in the pnf and njf groups compared with the pre - treatment value and the rest group value , and the increase in the njf group was the most significant . the results for the cross - sectional area of the multifidus muscle are shown in table 3table 3.cross-sectional area of the multifidus(cm)pain sideno pain sidea.beore treatment7.71.8a < c.d8.52.2a < db.rest7.01.7b < a.c.d8.62.3b < dc.pnf7.92.3c < d8.81.9c < dd.njf8.72.09.52.1*p<0.05 * * p<0.01 . the cross - sectional area of the multifidus muscle on the side with pain of the pnf , and njf groups showed significant increases compared to the pre - treatment value and the rest group value . on the side without pain , the cross - sectional areas of the multifidus muscle of the njf groups showed significant increases . it is generally recognized that the multifidus muscle and transversus abdominis muscle are very important for the stabilization of the trunk . however , in clinical research , the contribution of the transversus abdominis has been comparatively ignored . traditional remedies such as traction mobilization show immediate effects , but only a few studies have investigated their long - term treatment effects . recently , special emphasis has been placed on combination therapies comprising lbp exercise and lumbar stabilization exercise , but no objective assessment of traditional methods has been performed . in this study , the effect of lbp treatment was evaluated by measuring the thickness of the transversus abdominis muscle , and the cross - sectional area of the multifidus muscle using ultrasound imaging . transverse abdominis muscle thickness and the cross - sectional area of the multifidus muscle on the side with pain increased significantly after applying the pnf technique , in the njf pattern , proximal resistance is exerted , promoting the isometric contraction of the multifidus muscle , and the transverse abdominis muscle also would be treated together with multifidus muscle contraction and increased intra - abdominal pressure . the combination of multifidus muscle and transverse abdomen is muscle treatment by njf promoted strengthening of the local muscle system , and our results suggest that imbalance of the multifidus muscle and weakness of the transverse abdomenis muscle can be effectively improved by long - term treatment with the njf pattern . future studies are still needed to investigate the persistence of treatment effects of different treatments after long - term interventions for patients with low back pain .

[ purpose ] the purpose of this study was to examine the different effects of long - term intervention between proprioceptive neuromuscular facilitation ( pnf ) and neuromuscular joint facilitation ( njf ) patterns for the pelvis on chronic low back pain as assessed by the cross - sectional area of the multifidus muscle and the thickness of the transversus abdominis muscle . [ subjects ] the subjects were 12 young people ( five males , seven females ) who had experienced chronic low back pain on one side for more than 6 months . [ methods ] the subjects were treated by resting , pnf or njf therapy , and each treatment was administered for one month . ultrasonography was used to measure the changes in the transversus abdominis muscle thickness and the multifidus muscle cross - sectional area . [ results ] the thickness of the transversus abdominis muscle and the cross - sectional area of the multifidus muscle in the njf group , after resting , increased significantly and were higher than those in the pnf group . [ conclusion ] the results show that significantly better improvement can be obtained for chronic low back pain by applying long - term intervention of njf patterns .

el solh and coworkers present an interesting study in which they evaluated use of quantitative endotracheal aspirate ( qea ) cultures as a diagnostic tool for determining presence of pneumonia in ventilated patients admitted from nursing homes . the 2005 american thoracic society ( ats)/infectious disease society of america ( idsa ) guidelines recommend that the approach to such patients should be like that in patients with ventilator - associated pneumonia ( vap ) . the study compared the diagnostic accuracy of qea with that of protected specimen brush ( psb ) and bronchoalveolar lavage ( bal ) . unfortunately , the impact of the findings on antibiotic therapy and patient outcomes was not assessed . other potential limitations not discussed in the report include the lack of evaluation of qea sample quality , which is a major problem in interpretation of study findings , and failure to consider the influence of co - morbidities such as chronic obstructive pulmonary disease ( copd ) . the study shows that bacterial counts obtained through qea correlate with those obtained by psb ( r = 0.71 ) and bal ( r = 0.77 ) . however , table 2 highlights an important weakness of aetiological diagnosis based on a threshold ; staphylococcus aureus was isolated in 50% more cases in bal samples as compared with psb samples , using the recommended threshold . furthermore , the authors constructed receive operating characteristic ( roc ) curves to evaluate the diagnostic accuracy of qea , and found a sensitivity of 90% and a specificity of 77% when 10colony - forming units / ml was used as the diagnostic threshold . the threshold of 10colony - forming units / ml is lower than thresholds recommended by idsa / ats to differentiate colonization from infection in qea cultures . use of bacterial counts as a diagnostic threshold in pneumonia has been proposed to differentiate colonization from infection . it aims to avoid over - use of antibiotics in patients with low bacterial counts on quantitative cultures , defining a cut - off for pneumonia diagnosis . the roc curve is a useful tool for evaluating performance and accuracy of diagnostic tests , but construction of roc curves assumes that there is a gold standard . in the absence of a gold standard nevertheless , michaud and coworkers found that patient selection criteria have the greatest impact on evaluation of a test 's performance in vap patients . moreover , heterogeneity among diagnostic criteria and the lack of a gold standard for vap diagnosis that could be applied across the various diagnostic studies may lead to several biases . previous antibiotic exposure and technical aspects of the diagnostic tests used may also have an effect on reported accuracy . souweine and coworkers recommended use of lower thresholds on quantitative cultures in patients who have recently started antibiotic therapy . however , whether thresholds maintain their discriminatory value in such patients requires evaluation . until proven otherwise , a strategy to rule in or rule out the presence of pneumonia based on a bacterial count threshold has not been adequately tested and should not be routinely used to make decisions regarding antimicrobial treatment . whether use of quantitative cultures of lower respiratory tract secretions has a diagnostic role to play remains controversial . ats / idsa guidelines recommend that quantitative cultures should be performed on endotracheal aspirates or samples collected bronchoscopically , and the choice of method depends on local expertise , experience , availability and cost . however , heyland and coworkers recently reported , in a randomized multicentre clinical trial , that an invasive bronchoscopy based strategy and a noninvasive non - quantitative endotracheal aspirate culture based one were associated with similar clinical outcomes and antibiotic use . the best available evidence suggests that the clinical data are insufficient to establish a definite diagnosis of pneumonia . culture of pulmonary secretions may help to refine the physician 's clinical suspicion , but it should not be used alone to confirm or refute it . microbiologic findings can help to tailor the antibiotic spectrum in selected patients , although they should not be considered alone but rather with reassessment of clinical response at 48 to 72 hours after onset of pneumonia . albert einstein ( 18791955 ) once stated that , ' things should be made as simple as possible , but not simpler ' . the dualism of colonization versus infection that results from use of a single cut - off to define pneumonia may represent an oversimplification of a complex phenomenon . exclusion of the presence of pneumonia based simply on a ' magic ' number , as a simpler way to approach diagnosis , is a dangerous policy . we should avoid being caught in this trap , because by oversimplifying the diagnostic process in this way we take on significant risk for mistreating ( over or under ) our patients . efforts should be focused on implementing bundles of measures based on best evidence for diagnosis and treatment , integrating clinical features and microbiology data , in order to obtain a simple and effective approach to management of pneumonia . ats = american thoracic society ; bal = bronchoalveolar lavage ; copd = chronic obstructive pulmonary disease ; idsa = infectious disease society of america ; psb = protected specimen brush ; qea = quantitative endotracheal aspirate ; vap = ventilator - associated pneumonia . supported by fondo de investigaciones sanitrias ( pi05/2410 ) , ciberes enfermedades respiratrias ( ciber 06/06/0036 ) and maratotv3 .

in the absence of a perfect ' gold standard ' for diagnosing pneumonia , comparing diagnostic performance between techniques remains controversial . el solh and coworkers present a study evaluating use of quantitative endotracheal aspirate culture to enhance diagnostic accuracy in pneumonia patients admitted from nursing homes . we discuss the use of quantitative cultures and thresholds to differentiate between colonization and infection in pneumonia patients ; we also consider the inaccuracy of diagnostic studies , which compromises the reproducibility of these data in clinical practice .

a 75-year - old male patient was emergently admitted to the hospital with gross hematuria , generalized abdominal pain , and oliguria of about 3 days ' duration . he had undergone multimodal treatment for muscle - invasive bladder cancer ( stage t2 , urothelial cancer with sarcomatous differentiation ) with transurethral resection ( tur ) of the bladder tumor and 6 adjuvant cycles of cisplatin - based cytotoxic chemotherapy ( gemcitabine+cisplatin ) ( fig . 1 ) , because he desired bladder preservation and had a strong fear of urinary diversion . one year after tur , a follow - up ct scan showed bladder tumor recurrence with a focal irregular margin of the bladder wall , suggestive of perivesical invasion . so he underwent tur of the bladder cancer ( stage t2 , urothelial cancer with squamous differentiation ) ( fig . 2 ) with adjuvant chemotherapy ( methotrexate , vinblastine , adriamycin , and cisplatin ) . at 10 months after the operation , he presented with acute illness with vague abdominal pain . he was febrile at 39. he did not have a history of recent pelvic trauma , instrumentation , pelvic radiation , infravesical obstruction due to benign prostatic hyperplasia , or episodes of acute urinary retention . on the physical exam , the abdomen was markedly distended with muscular guarding and rebound tenderness . the serum creatinine ( cr ) level was elevated to 5.8 mg / dl with biochemical features of acute renal failure [ k 5.7 mmol / l , na 126 mmol / l , serum blood urea nitrogen ( bun ) 53 mg / dl , bun / cr ratio 9:1 ] . the spiral ct showed a large bladder tumor extending into the perivesical space with a focal bladder wall disruption . the bladder tumor was nearly in contact with the anterior rectal wall without clear demarcation . we therefore first suspected an invasive bladder tumor with a rectovesical fistula and performed sigmoidoscopy and plain film cystography with retrograde contrast media injection through an indwelling urethral catheter . sigmoidoscopy showed no signs of fistula opening within the site of 70 cm from the anal verge except for a mild segmental mucosal edema . plain film cystography showed a refractory bowel pattern to paralytic ileus and left lateral wall irregularity with a suggestive sinus tract , but no evidence of intra- or extraperitoneal contrast media extravasation ( fig . , it was difficult for us to identify the cause of the acute peritonitis and biochemical features of acute renal failure . so we finally performed ct cystography with the patient in the prone position with 50 ml megluatmine iothalamate mixed in 500 ml of normal saline . the ct cystography showed the highly attenuated fluid in the peritoneum via a disrupted left lateral bladder wall and small bowel loop pooling with contrast media ( fig . considering the patient 's age , poor general condition , and performance status , we decided to manage him conservatively with broad - spectrum antibiotics and indwelling catheters . a 8.5 fr pigtail drain catheter was inserted into the right pelvic area under the guidance of fluoroscopy in addition to percutaneous nephrostomy catheters for adequate urine drainage . after the insertion of the intraperitoneal drain catheter , 150 ml of turbid , yellowish urine with pus was drained . after intervention , the patient 's serum creatine level and white blood cell count returned to normal values in 4 days . the patient was discharged home with successful peritonitis resolution on hospital day 28th but died 3 months later as the result of acute renal failure . spontaneous intraperitoneal bladder perforation is a very rare clinical event and is associated with high mortality . most spontaneous bladder ruptures occur as the result of long - term indwelling catheters , radiation , chronic cystitis , bladder distention due to infravesical obstruction , or neurogenic bladder dysfunction . however , bladder perforation associated with bladder cancer is an extremely rare cause of spontaneous rupture . such rupture is a surgical emergency that may be rapidly fatal if its diagnosis and treatment is delayed or missed . patients usually present with symptoms such as sudden onset of lower abdominal pain , high spiking fever , hematuria , abdominal distention with signs of peritoneal irritation , and anuria with biochemical features of acute renal failure due to auto - dialysis of urinary ascites across the peritoneum . plain film cystography is accepted as the most accurate radiological technique for diagnosing bladder rupture . but with the widespread use of ct cystography , this imaging technique is increasingly being performed as an alternate method of diagnosing bladder rupture and has been shown to be as accurate as conventional cystography . ct cystography can also distinguish the specific type of bladder rupture between extraperitoneal or intraperitoneal . ct cystography has several advantages over plain film cystography : ( 1 ) it is rapid and is easily performed at the same time as other ct studies , ( 2 ) it is less affected by overlying bone fragments , and ( 3 ) it is more sensitive to the detection of small amounts of intraperitoneal or extraperitoneal fluid . in the present case , even though an abdominal helical ct scan was performed with adequate bladder distention of intravenous contrast media injection , there was no evidence of intraperitoneal perforation even on the 10 minute delay scan . so we checked ct cystography with retrograde contrast media injection in the prone position and finally diagnosed that the intraperitoneal perforation was associated with invasive bladder cancer . urothelial carcinomas are known to demonstrate a wide range of divergent histologic differentiations into the entire spectrum of histologic variants , including squamous , glandular , micropapillary , sarcomatoid , small cell , clear cell , lymphoepithelial , and plasmacytoid components . wasco et al found that any type or amount of divergent histologic differentiation present with urothelial carcinoma was strongly associated with unfavorable prognostic features . such cancer with mixed histologic features was nearly uniformly high grade and highly invasive and was also an independent predictor of extravesical diseases . in our case , 2 tur specimens showed urothelial carcinoma with sarcomatoid differentiation and squamous differentiation , respectively . highly aggressive characteristics of urothelial cancer with divergent differentiation may explain the spontaneous bladder perforation and following early death . in summary , we encountered a case of spontaneous intraperitoneal bladder perforation associated with highly aggressive urothelial cancer with divergent differentiation . at first , the findings of conventional helical ct and plain film cystography made it difficult for us to diagnose the intraperitoneal perforation properly . although intraperitoneal bladder rupture is a serious condition due to increased urine leakage and subsequent systemic absorption , and prompt surgical repair is key for patient management , we managed the patient conservatively rather than by open surgical repair in consideration of his poor general condition and suboptimal prognosis . we successfully treated the patient conservatively with adequate urinary diversion , intraperitoneal drainage , and broad - spectrum antibiotics .

spontaneous bladder perforation is a very rare event . prompt diagnosis of this injury is very important , particularly with intraperitoneal perforation , because mortality increases if surgical repair is delayed . previous studies have reported that plain cystography is the primary modality of imaging study rather than relatively insensitive computed tomography ( ct ) when bladder perforation is suspected . we report here a rare case of spontaneous intraperitoneal perforation of the bladder associated with urothelial carcinoma with divergent histologic differentiation , as diagnosed with ct cystography .

meningiomas , first described by harvey cushing in 1922 , are used to designate tumors originating from the meninges . epidemiological studies have noticed that meningiomas represent 15% of all symptomatic and 33% of all incidental intracranial neoplasms . furthermore , it has been shown to occur two to three times more commonly in middle - aged females as compared to males . meningiomas have been known to cause parkinsonian symptoms and other movement disorders , however , this is rare . the focus of this case report is on the movement disorders known as chorea and dystonia . chorea , derived from the greek word dance , is an irregular , rapid , involuntary jerky movement that flows randomly to any part of the body . chorea can be attributed to multiple causes , including huntington 's disease , vascular disorders , electrolyte imbalance , medication infection and autoimmune diseases . when chorea is limited to one side of the body , it is referred to as hemichorea . dystonia is a disorder characterized by sustained or recurring involuntary muscle contractions generally associated with twisting or repetitive movements and abnormal postures . it can be classified according to age of onset , distribution ( focal , multifocal , segmental or generalized ) , or etiology . here , we report a rare case of a patient diagnosed with a combination of hemichorea and dystonia on the left side , and a large frontal lobe meningioma on the right side of the brain . it should be noted that although hemichoreas mostly result from a vascular malformation , tumors or tuberculoma in the basal ganglia , hemorrhagic or ischemic stroke , metastasis , non - ketotic hyperglycemia , and hypoglycemia , our patient did not have anything except for a frontal lobe meningioma . our case was a 65-year - old right handed female who started having abnormal limb movements several years ago for which she was referred to our movement disorders center . the patient had a history of generalized seizures with intermittent loss of consciousness since the age of 44 lasting several minutes . the abnormal movements involved her left hand and left foot which would occur intermittently when she was awake and disappear when she was asleep . on examination the patient had irregular , involuntary , brief , fleeting , and unpredictable movements of her left upper and lower extremities ( hand , fingers and foot ) consistent with chorea ( see supplementary video ) . examination of her gait revealed that she would hold her left arm in dystonic posturing while walking . the patient would smile and laugh at times without any reason due to frontal disinhibition . the patient 's family history was negative for any neurological conditions including huntington 's disease , chorea and other movement disorders . the patient 's physical examination showed that she had clinical features of two movement disorders , in particular chorea and dystonia . the diagnosis of neurological diseases and movement disorders are based on good clinical history and examination . the patient in our case started having abnormal limb movements several years ago , though she was not able to recall the exact starting point . there was a very negligible progression of the symptoms of chorea and dystonia in her left hand over the years along with the size of the meningioma . an mri of the brain showed a hyperintense irregular lobulated mass of 3.7 3.5 3.2 cm in the right frontal lobe with minimal leftward midline shift involving the inferior aspect of the left frontal lobe with inhomogeneous enhancement [ figures 1 and 2 ] . t1-weighted mri with contrast , axial view demonstrating right frontal lobe lesion with inhomogeneous enhancement axial view of flair mri demonstrating hyperintense right frontal lobe lesion measuring 3.7 3.5 3.2 cm with minimal mass effect and no edema extensive serological investigations for causes of chorea and dystonia were normal . furthermore , cbc electrolytes , esr , ana , rheumatoid factor , thyroid profile , and antiphospholipid antibodies were normal . benincasa et al . in 2008 presented a case with the right hemiparkinsonism due to a frontal meningioma . to our knowledge , it is a very rare phenomenon for a patient with a large frontal lobe meningioma to present simultaneously with hemichorea and dystonia without any other explainable cause . such a specific case has not yet been cited in the literature . it has been reported that intrinsic basal ganglia and thalamic lesions as well as extrinsic compressive lesions can cause movement disorders , although very rarely . primarily , movement disorders could be a direct result of basal ganglia and/or nigrostriatal pathway compression by the tumor itself or the resulting edema . moreover , the symptoms could also be due to impaired blood flow through vasculature of the basal nuclei . in a case reviewed by bhatoe , this disorder led to the patient 's parkinsonism . in another case of the same review , the authors report the presentation of meningioma of the anterior third ventricle along with parkinsonism . in congruency , the frontal lobe meningioma exerted mechanical pressure on the basal nuclei resulting in the movement disorder symptoms of chorea and dystonia . although hemichorea is a very rare form of a movement disorder , it is mostly associated with vascular malformation , tumors or tuberculoma in the basal ganglia , hemorrhagic or ischemic stroke , metastasis , non - ketotic hyperglycemia , and hypoglycemia . our patient only had a heavily calcified large meningioma , as evident from the mri , which could have compressed or impaired the extrapyramidal system leading to various movement disorders as noted in the prior research . after consultation and weighing the risks as well as benefits of the surgical removal of the large meningioma in our patient , the neurosurgeon advised against the surgical removal of the tumor . as a limitation to the study , the chorea and dystonia were purely unilateral and contralateral to the side of frontal meningioma without any other causative factors . furthermore , the symptoms were non - progressive , over several years , as well as the size of the meningioma on serial mris . the meningioma was also the likely cause of her seizures as there was no history of headaches , focal weakness or sensory symptoms on the left side of her body . nevertheless , the mechanical pressure caused by this enlargement could lead to various movement disorders , which may even coexist as presented in our case . thus , a thorough neurological examination of even a benign tumor should not be neglected in cases of movement disorders even when the clinical criteria are fulfilled . this case represents the diversity of movement disorders that can result from a benign meningioma , specifically hemichorea and dystonia .

tumors originating from the meninges , also known as meningiomas , have rarely been known to cause parkinsonian symptoms and other movement disorders . although some cases of av malformations causing movement disorders have been described in the literature , not much has been reported about meningiomas in this regard . the aim of this case report is to further highlight the importance of brain imaging in patients with movement disorders for even a benign tumor ; and also emphasize the need for a careful movement disorder examination because more than one phenomenology of movement disorders may result from the mechanical pressure caused by a tumor . we present a case report of a patient with a heavily calcified right frontal lobe meningioma . our patient had irregular , involuntary , brief , fleeting and unpredictable movements of her left upper and lower extremities , consistent with chorea . the patient also had abnormal dystonic posturing of her left arm while walking . this case report highlights the importance of brain imaging as well as careful neurological examinations of patients with benign meningiomas . moreover , it illustrates the remarkable specificity yet clinical diversity of meningiomas in presentation through movement disorders .

the majority of patients have the associated condition of primary acquired melanosis ( pam ) with atypia and are therefore prone to multiple new tumours throughout their lifetime [ 2 , 3 ] . therefore , primary conjunctival melanoma is managed by complete excision and double freeze - thaw cryotherapy . adjuvant therapy is necessary to improve local tumour control and survival of the patient especially when the histopathology reports indicate tumour is present at the surgical margins . adjuvant therapy includes cryotherapy , topical mitomycin c , brachytherapy [ 68 ] , proton beam radiotherapy , or rarely alpha 2b interferon . brachytherapy includes the use of ruthenium-106 , [ 6 , 7 ] iodine-191 , or strontium-90 beta radiotherapy . strontium-90 ( sr ) beta radiotherapy is a noninvasive treatment using a hand held applicator ( figure 1 ) . it is only available for the treatment of ocular surface tumours in the london ocular oncology service : the other two ocular oncology centres in the uk do not own an applicator as they are no longer produced by bebig . the sr ophthalmic applicators [ bebig ] ( figure 2 ) consist of a radioactive source and a shielded holder for the source . radioactive source consists of a palladium coating , an encapsulating material of silver and strontium-90 is the encapsulated material . sr is a radioactive substance with a long half - life of 28.6 years and a maximum energy of 2.3 mev . it decays to yttrium-90 with a half - life of 29 years with the emission of a beta particle of maximum energy of 0.55 mev . yttrium-90 decays to stable zirconium-90 with emission of a beta particle of minimum energy of 2.27 mev . the holder of the source consists of a shielding plate made from polymethylmethacrylate ( pmma ) , a fixation ring for the shielding plate and a holder with mechanism to grab the source . sia-1 applicator has an active disc of 18 mm and an activity of 10 mci with an approximate surface / dose rate of 2 rads / sec . sia-6 applicator has an active disc of 12 mm and an activity of 10 mci with an approximate surface / dose rate of 4 rads / sec . these applicators have an outer peripheral rim of about 2 mm that is inactive ( figure 2 ) . the data available for the usage of sr as an adjuvant treatment in conjunctival melanoma is limited . the aim of this study is to examine the efficacy and safety of sr applicators as adjuvant treatment in a cohort of patients with conjunctival melanoma . a retrospective cohort study was undertaken from 1999 to 2011 of all patients who underwent sr beta radiotherapy for incompletely excised conjunctival melanoma . the parameters assessed were the patients ' age , sex and predisposing diagnosis , pre- and posttreatment visual acuity , applicator type , and length of followup and tumour parameters including location , size , and histopathology results . all patients were treated with five fractions of 10 gy hence the total dose was 50 gy administered to the scleral surface . because the type of radiation used is not very penetrating , the dose falls of very rapidly with depth and is only around half this by the time it has reached 1 mm into the tissue . development of melanoma in other nontreated areas was not characterized as failure of treatment as many patients with conjunctival melanoma have pam with atypia . all data were entered in an excel database and statistical analysis was performed with the use of spss 13.0 . kaplan - meier analysis was performed to determine the recurrence free disease at treatment site at 5 and 10 years . over 8 years , twenty patients ( 11 males and 9 females ) with biopsy proven conjunctival melanoma were treated with adjuvant sr beta radiotherapy . median age of the patients was 68 yrs ( range 5492 yrs ) . table 1 presents patients ' clinical data . in regards to predisposing conjunctival pathology , eleven patients had associated pam with atypia , ( 12/20 , 60% ) , three patients had associated pam without atypia ( 3/20 , 15% ) , and in five patients conjunctival melanoma developed de novo without the presence of associated pam ( 5/20 , 25% ) . all patients underwent complete excision of the lesion with adjuvant double freeze - thaw cryotherapy at the margins of the lesion after initial referral . seventeen patients were treated with the sia-6 applicator ( 17/20 , 85% ) with a median duration of treatment at 236 seconds , 10 gy per fraction and three patients were treated with the sia-1 applicator ( 3/20 , 15% ) with a median duration of treatment at 767 seconds , 10 gy per fraction . cases sr beta radiotherapy was applied as adjuvant treatment . in seventeen cases ( 17/20 , 85% ) sr radiotherapy was applied as adjuvant treatment following excisional biopsy and cryotherapy of a new conjunctival melanoma . the interval between primary treatment and sr radiotherapy ranged from 1 to 12 months with a mean of 3 months . in three cases ( 3/20 , 15% ) treatment was applied as adjuvant treatment of a recurrent conjunctival melanoma following excision and cryotherapy . two of the three recurrent cases had failed treatment with excision biopsy and one had failed treatment with topical mitomycin c. none of the patients had received prior adjuvant strontium radiotherapy . in eleven patients ( 11/20 , 55% ) the tumour was located at the temporal bulbar conjunctiva , in three patients inferotemporally ( 3/20 , 15% ) and in the remaining seven patients in other locations ( table 1 ) . most of the cases presented with limbal involvement ( 15/20 , 75% ) . in 9 out of 18 patients ( 50% ) eighteen out of 20 patients ( 90% ) were tumour - free in the treated area at the end of follow - up period ( figure 3 ) . estimated percentage of recurrence free disease was 82% at 5 and 10 years ( figure 4 ) . only two patients ( 2/20 , 10% ) developed a recurrence in the treated area at 15 months and 37 months after treatment , respectively . area of recurrence was treated with lamellar scleral dissection and adjuvant cryotherapy in one case and excisional biopsy and cryotherapy in the other . following adjuvant sr beta radiotherapy , 85% of patients ( 17/20 ) suffered no ocular complications . there was no difference on the pre- and post - treatment visual acuity in any patient ( see table 2 ) . this is an important result as it illustrates that no visually significant cataract developed during the period of followup which ranged up to 12 years . one patient had transient episcleritis that responded to local anti - inflammatory treatment ( 1/20 , 5% ) , one had transient dry eye symptoms ( 1/20 , 5% ) and there was another single case of a descemetocele ( 1/20 , 5% ) . the use of sr applicators for the treatment of conjunctival melanoma has not been extensively reported [ 1317 ] . in our study all patients had an initial excisional biopsy followed by cryotherapy and received adjunctive sr beta radiotherapy . in other studies sr has been either used as primary treatment or as adjuvant treatment with or without cryotherapy [ 1317 ] . a total dose of 50 gy was administered . from other studies ( table 3 ) there does not appear to be a standardized regimen but on average , the total dose is 3660 gy and fraction size is typically 10 gy a previous study showed a success rate of 80% for a total dose of 54 gy . a recent case series had a success rate of 95% for a total dose of 60 gy and 43% for a total dose of 35 gy highlighting that delivery of less than 40 gy in the treated area is probably not sufficient for tumour control . local complications were not severe . one patient developed episcleritis and one patient developed a descemetocele . visual acuity was not affected in any of our patients at the end of follow - up period . primary sr treatment for conjunctival melanoma has been associated with telangiectasia , discomfort , and cataract [ 13 , 14 ] . sr radiotherapy appears to be safer and more effective in comparison to other proposed methods of adjuvant treatment for conjunctival melanoma . in comparison to topical mitomycin c , no patient experienced discomfort or pain after treatment and none of the long - term complications such as punctal stenosis , limbal stem cell deficiency , or keratoconjunctivitis were noted [ 5 , 18 , 19 ] . reported recurrence rates for topical mitomycin c from various case series were 2050% [ 5 , 1820 ] . in our study recurrence rate topical interferon alpha 2b results were encouraging in a small case series with no local complications ; however , no long - term data is available . ruthenium plaque brachytherapy has been used as adjuvant treatment with delivery of a high dose of 290320 gy [ 6 , 7 ] or low dose of 100 gy but these publications are confined to case reports . proton bean radiotherapy has been used widely as adjuvant treatment in recurrent conjunctival melanoma and is associated with high rates of severe local complications including sicca syndrome , eyelash loss , cataract , limbal stem cell deficiency , and squamous metaplasia of the corneal epithelium and neovascular glaucoma which sometimes necessitates removal of the eye [ 9 , 21 ] . despite the excellent therapeutic outcome , sr beta radiotherapy has limitations . the location and size of the tumour are of paramount importance in deciding which adjuvant treatment to use . custom designed iodine plaques that are reverse mounted can be used to treat tarsal conjunctival melanoma following primary excision ( communication with dr . this is a problem for ocular oncologists in new centres and glaucoma specialists , especially those practicing in developing countries . thankfully , due to the long half - life of strontium , most applicators when cared for correctly are still in use even 2030 years on . in conclusion , the present study demonstrates that adjuvant sr beta radiotherapy is safe and effective at preventing local recurrence of conjunctival melanoma .

background / aims . to report the safety and efficacy of strontium ( sr90 ) beta radiotherapy as adjuvant treatment for conjunctival melanoma . methods . a retrospective cohort study was undertaken from 1999 to 2007 of all patients who underwent sr90 beta radiotherapy for incompletely excised conjunctival melanoma . failure of treatment was defined as recurrence of a conjunctival melanoma at the same location following beta radiotherapy . results . twenty patients underwent sr90 beta radiotherapy for incompletely excised conjunctival melanoma . median follow - up interval was 59 months ( 8152 ) . all patients had conjunctival melanoma involving the bulbar conjunctiva . underlying diagnoses included pam with atypia in 60% ( 12 of 20 ) , pam without atypia in 15% ( 3 of 20 ) , and de novo conjunctival melanoma in 25% ( 5 of 20 ) . following sr90 beta radiotherapy , in 90% ( 18 out of 20 ) local control was achieved and visual acuity was not affected in any patient . three patients ( 15% ) had dry eye symptoms , episcleritis , and descemetcoele , respectively . no cataract or secondary glaucoma was reported . conclusions . sr90 treatment is a very effective adjuvant treatment after excisional biopsy and cryotherapy for conjunctival melanoma with a local success rate of 90% . the treatment is not associated with significant side effects and visual acuity is not affected .

cutaneous lupus erythematosus ( cle ) remains an ill - defined set of disorders , often grouped together based on common clinical features , histopathological findings , laboratory abnormalities , association with underlying systemic lupus erythematosus ( sle ) or combinations thereof . in 1981 , dr james gilliam and dr richard sontheimer proposed a grouping classification schema to deal with the heterogeneity inherent to this set of disorders.1 since that time , a variety of other grouping schemes have been proposed with variable uptake by the medical and scientific communities invested in cle . there is currently no uniform definition of cle upon which to base a study population for observational and interventional trials . in addition , the current grouping systems are heterogeneous , inconsistent , and none have been formally adopted by the expert community of investigators and clinicians committed to these disorders . at the 3rd international meeting on cutaneous lupus erythematosus ( iccle ) held may 2013 in edinburgh , scotland , a scientific meeting was called at which nominal groups of international cle experts were formed around stating the need for change and to generate item lists that characterise cle . facilitated , open - ended concept - mapping and brain - storming sessions were used to generate these item lists . the expressed goal was to agree upon an approach to consensus around ( 1 ) uniform definition(s ) ; ( 2 ) grouping schemes ; and ( 3 ) clarifying an understanding of the complex relationship between cutaneous and systemic disease involvement . based on the input from the iccle meeting key stakeholder groups were defined , lists of cle - defining characteristics were generated and the use of a delphi consensus method was agreed upon . the delphi technique is a method of consensus - building using a series of iterative questionnaires to collect data from a panel of selected experts / stakeholders in a given area of interest . the iterative nature of the process , together with controlled anonymous feedback at each questionnaire stage , subject anonymity and a predefined stop criterion , allow convergence towards a consensus there are many examples of relevant delphi exercises in this area of the field , including a delphi consensus process around the development of classification criteria for systemic sclerosis using experts in this disease state.4 in follow - up to the iccle meeting , a pre - delphi questionnaire was put forth to a relevant stakeholder group including paediatric and adult dermatologists , rheumatologists and dermatopathologists . the goal of this questionnaire was to further build a database of international participant stakeholders and more broadly query the relevant participant pool regarding the need for uniform definitions , revision of grouping schema and defining the cle / sle relationship as an expert community . the 12 questions presented were those outlined and agreed upon by the concept - mapping process by the participants at the iccle meeting . descriptive statistics were used to evaluate responses : the median score is reported as the preferred measure in a delphi process ( a measure of central tendency that is minimally distorted by outliers ) . survey responses were graded on a continuous scale from 0 to 100 ( 0=complete disagreement with the proposed statement , 50=neutral response , 100=complete agreement with the proposed statement ) . consensus agreement , a median response of 30 or lower was predefined as consensus disagreement , median scores between 30 and 70 were predefined as the survey response rate was ( n=60/81 ) 74% with a group comprised predominantly of dermatologists ( n=58 , 96.7% ) ; rheumatologists ( n=5 , 8.3% ) , dermatopathologists ( 2 , 3.3% ) . survey participants self - reported their geographic location to be : north america ( n=39 , 65% ) , europe ( n=15 , 25% ) , asia ( 4 , 6.7% ) , south america ( n=1 , 1.7% ) , africa ( n=1 , 1.7% ) . the middle east and australia table 1 demonstrates the median and per cent of respondents by agreement for each of the 12 questions posed . based on prespecified consensus criteria as noted above , there is consensus agreement on two - thirds of the survey items : questions 1 , 36 , 8 , 9 and 12 . complete agreement is highest for question 1 ( 46.7% ) , question 6 ( 45.8% ) and question 4 ( 45.0% ) . consensus disagreement was found to questions 2 and 7 , though variability is high for both ( iqr of 67.0 and 49 , respectively ) . of the respondents 22.4% details of the data distribution of each question are found in the histogram distribution of scores ( figure 2 ) . median and per cent of respondents by agreement cle , cutaneous lupus erythematosus ; sle , systemic lupus erythematosus . interpretation of the survey results presented above may be best described in three thematic groups : ( 1 ) the need for new definitions of cle ( questions 8 , 9 , 12 ) ( 2 ) the need to better clarify / define the relationship between cle and sle ( 1 , 2 , 3 ) ( 3 ) the need to re - evaluate current disparate grouping schema ( 47 , 10 , 11 ) . there was consensus among this group of questions , indicating that the expert panel of participants agreed that there is a need for new definitions for cle as current definitions impede communication between physician colleagues and in physician - patient interactions . with regards to the cle - sle relationship , there was consensus agreement that cle is distinct from sle and that a cle grouping scheme should remain apart from current sle schema which otherwise include mucocutaneous disease items . finally , with regards to the current grouping schema , there was consensus that the current schemes are inadequate around communication , prognostic information and to meet the needs of researchers , clinicians , patients and payers . however among this question pool , there was no consensus agreement that the current grouping schemes affected treatment decisions or failed to inform about risks during pregnancy . the pre - delphi exercise was largely about establishing ( 1 ) where confusion and gaps exist around cle terminology ( 2 ) prioritising the group 's efforts with regards to where we will focus our resources moving forward with the delphi process . we hope that this article will encourage other relevant stakeholders in the cle delphi process to come forward and take part in helping to improve the inconsistencies in the field . each of the general themes build upon one another and because the pre - delphi exercise has demonstrated consensus that even definitions are lacking , we will begin with a stepwise approach ( a ) definitions ( b ) grouping schemes/classification criteria ( c ) diagnostic criteria. building on these results , the steering committee has moved to proceed with a formal delphi consensus process with an initial focus on defining cle , which should be a good platform for the subsequent processes to achieve an international classification scheme . in the vasculitis literature , analogous processes have been used successfully to first define , then build classification and diagnostic criteria.6 these same processes may later expand to include diagnostic , classification criteria as well as outcomes measures ( distinct from sle diagnostic and classification systems ) , such as those modelled by the omeract group for developing outcome measures in rheumatoid arthritis.7

there is currently no uniform definition of cutaneous lupus erythematosus ( cle ) upon which to base a study population for observational and interventional trials . a preliminary questionnaire was derived from and sent to a panel of cle experts which demonstrated consensus agreement that ( 1 ) there is a need for new definitions for cle ( 2 ) cle is distinct from systemic lupus erythematosus and that a cle grouping scheme should remain apart from current systemic lupus erythematosus schema ( 3 ) current cle grouping schemes are inadequate around communication , prognostic information and to meet the needs of researchers , clinicians , patients and payers .

lactobacillus species is a known commensal colonizer of the mouth , gastrointestinal and occasionally , the female genitourinary tract . patients with lactobacillus bacteremia typically present with fever and clinical features localized to the affected tissues , and rarely with sepsis . the diagnosis becomes especially challenging in critically ill patients , who are at an increased risk in the setting of mucosal hypoperfusion and bacterial translocation , but are often diagnosed only after clinically significant hypotension and organ dysfunction occur . we present a case of an immunocompetent patient who was initially hemodynamically stable , while on mechanical ventilation for altered mental status . further evaluation including a colonoscopy identified ischemic colitis as the source of sepsis . to our knowledge , this is the first case of ischemic colitis presenting with confirmed lactobacillus bacteremia and sepsis . a 58-year - old man with schizophrenia , substance abuse , diabetes mellitus and a history of hypertension presented with headache and chest pain . the rest of his physical exam was unremarkable . at the emergency department , he became confused and was intubated . laboratories were unremarkable except for hyperglycemia and acute kidney injury ( creatinine 1.6 , baseline 1.1 ) . workup for altered mental status ( magnetic resonance imaging of the head with contrast and lumbar puncture ) and chest pain ( electrocardiogram and computed tomography ( ct ) chest with contrast ) was negative . the altered mental status was attributed to synthetic cannabinoid intoxication . on day 4 of hospital admission , subsequently , his abdominal distension increased . on day 6 , he became progressively hypotensive requiring intravenous fluid resuscitation . on day 8 , he became febrile and was re - intubated for respiratory distress . arterial lactate peaked at 2.1 mmol / l ( upper limit of normal : 1.6 ) . blood cultures from both the central line and the periphery grew lactobacillus species from both aerobic and anaerobic bottles . however , the patient remained febrile and had persistent bandemia . because he had progressively worsening diarrhea a noncontrast ct of his chest , abdomen and pelvis showed wall thickening of the ascending colon with surrounding inflammatory changes , and ileus . however , a colonoscopy showed diffuse edema from the hepatic flexure to cecum with intermittent areas of sparing . the involved areas had severe ulceration and a necrotic mucosa that did not bleed on biopsy , indicating severe ischemic colitis [ figure 1 ] . he improved clinically during a 14-day course of piperacillin - tazobactam and metronidazole , was extubated and discharged . colonoscopy images showing diffuse edema , severe ulceration and mucosal necrosis in the large intestine consistent with ischemic colitis . hence , it is not surprising that its presence in blood cultures is often ascribed to bench contamination . however , the attributable mortality rate in its presence can approach 30% . to differentiate true lactobacillus bacteremia from contamination , the bacteria need to be isolated either in two sets of blood cultures , or in blood and another sterile site of clinical infection . patients recently treated with immunosuppressive therapy or broad - spectrum antibiotics and those with diabetes , malignancy , organ transplants , or indwelling venous catheters are at increased risk for symptomatic bacteremia . lactobacillus bacteremia in the setting of colitis has been well - described in immunocompromised patients , but this association is extremely rare in immunocompetent patients . in addition , lactobacillus sepsis has been described with probiotic use , especially in the setting of inflammatory bowel disease and critical illness . our patient did not receive probiotics either prior to or during his admission . to the best of our knowledge , however , more important than the association itself is the recognition that lactobacillus enters the bloodstream through the mucosal translocation . thus , our case emphasizes that the presence of true lactobacillus bacteremia in a clinically deteriorating patient should prompt urgent evaluation of a pathology that facilitates this translocation such as colitis , pyelonephritis , endometritis , and their underlying etiologies . such patients should be treated empirically with broad - spectrum antibiotics , which can be subsequently narrowed down based on susceptibility testing . patients should receive antibiotics for at least 7 - 10 days from the date the first negative blood culture was drawn . most isolates are susceptible to ampicillin , piperacillin - tazobactam , carbapenems , and clindamycin . however , vancomycin , cephalosporins and metronidazole should not be the first choice without susceptibility results . sensitivities should be specifically requested , especially if the patient 's condition is not improving . moreover , endocarditis must be ruled out because it is the most common clinically reported infection in these patients . these conditions are potentially treatable and if detected early ; the underlying organ can be salvaged .

lactobacillus species is a known commensal of the mouth , gastrointestinal , and genitourinary tract . however , its isolation on blood cultures is often overlooked and attributed to bench contamination . we present a case of a 58-year - old immunocompetent male who initially presented with altered mental status , but developed sepsis from lactobacillus bacteremia during his hospital course , while on mechanical ventilation . he was found to have ischemic colitis on colonoscopy . his condition improved with antibiotics and supportive management . using this example of ischemic colitis , we stress that in the right clinical setting , lactobacillus bacteremia is a harbinger for a serious underlying pathology and should not be ignored .

congenital , traumatic or extrinsic causes can lead to paraplegia ; some of these are potentially reversible and others are not . paraplegia can cause hip flexion contracture and consequently , pressure sores , scoliosis , and hyperlordosis . scientific literature contains many studies about children with hip flexion related to neurological diseases , mainly caused by cerebral palsy ; only few papers focus on this complication in adults.1 in this study , we report our experience on surgical treatment of a 20-year - old female with paraplegic fixed flexion deformity of both hip joints of 15 years duration secondary to an irrecoverable spinal cord disease , with complete motor and sensory loss and multiple pressure sores . a 20 year old college going female student was admitted in our institution with a gradual onset of longstanding flexion deformity of 120 of both hip joints . she was paraplegic for last 15 years due to irrecoverable spinal cord disease with complete motor and sensory loss . the patient had grade zero power in both her lower limbs with complete anesthesia of both the lower limbs . she was unable to sit and lie on her back , slept on her legs [ figure 1a ] . the pressure sores were mainly on the weight bearing areas , which included the knees and the lateral part of the upper thigh in this case . clinical photographs showing ( a ) patient can not lie on her back ( b ) patient rests on her chest and elbow ( c ) pressure sores at the back of knee ( d ) patient is unable to lie on her back clinical photograph ( a ) x - ray pelvis with both hips and pelvis after surgery showing proximal femoral resection ( b ) clinical photograph immediate postoperative showing patient lying supine ( c ) clinical photograph showing comfortable wheelchair life ( d ) clinical photograph showing sitting balance restored the resection was done adequately through posterior approach without anesthesia . both the hips were done in one sitting alternatively in right and left lateral positions . the resection was approximately about 4 inches on the both sides , which was assessed intraoperatively till the deformity was corrected . in postoperative period , no splints or plaster was used , and the patient was immediately put on her back and in wheelchair after removal of stitches that is , 2 weeks [ figure 1b ( b - c ) . in short time , she started sitting on her buttocks , led a comfortable wheelchair life with a sitting balance [ figure 1b ( d ) ] . there was no recurrence of flexion deformity in either hip up at 6 weeks , 3 months , 6 months , 1 year , 2 years , and 3 years followup . hip flexion contracture beyond 90 in adult paraplegic patient is a relatively difficult condition to treat because of the marked contracture of hip flexors in addition to blood vessels and nerves anterior to hip . five cases of flexion contracture of the hip in adults have been reported by nicodemo et al.1 in their study , which were either treated by girdlestone or replacement arthroplasty or by myoarthrolysis . ackerly et al . in their study reported their experience with proximal femoral resection in 12 paraplegic children with spastic and painful dislocation of hip.2 our study is unique because our patient had painless flaccid paraplegia with complete sensory - motor loss with a longstanding flexion contracture of both hip joints . michaelis3 had good results with iliopsoas and obliquus externus myotomy ; graham et al.4 described 3 cases of recurrent dislocation of the hip in adult paraplegics successfully treated with open reduction and bone block augmentation of the acetabulum ; becker et al.5 focused on periarticular ossification in paraplegics , reporting the results of six patients treated with a total hip replacement . he recommends avoiding femoral head resection in favor of total hip arthroplasty even in complete paraplegia , as the former has the risk of posterior trochanteric dislocation and consequent formation of pressure sores . however , on the other hand , in case of hip replacement , high dislocation rates , risk of infection ( especially in presence of pressure sores ) , osteoporosis , loosening risk , and blood loss must be taken into account . in all these cases , flexion contracture was < 90. ackerly et al.2 in their study reported their experience with proximal femoral resection in seven quadriplegic nonambulatory children with spastic painful dislocation of hip.2 the operative technique of castle and schneider ( 1978 ) was employed . the proximal femur was exposed through a lateral approach , extraperiosteally dissected , and resected below the level of the lesser trochanter . the capsule was sutured over the acetabulum and femoral stump was closed by suturing the vastus lateralis over it . he performed this technique due to pain secondary to dislocation of the hips and through lateral approach with minimal resection below the lesser trochanter . we are reporting a case of a young college going girl who presented with longstanding flexion contracture of both hip joints due to irrecoverable spinal cord disease with complete motor and sensory loss . she was unable to sit and lie on her back , slept on her legs . she underwent bilateral proximal femoral resection through posterior approach without anesthesia . in our patient , proximal femoral resection , until fully straight hip joint , was accomplished through posterior approach without anesthesia . both hip joints were straight immediately after the operation , and she could lie on her back . after 2 weeks she started sitting on her buttocks , led a comfortable wheelchair life with a good sitting balance . there is no incidence of proximal femoral migration or heterotopic ossification . proximal femoral resection thus offered a sound solution to an apparently difficult orthopedic condition of flaccid paraplegic acute hip flexion contracture , never reported before .

paraplegic flexion contracture of hip joints beyond 90 is a difficult condition to treat for any orthopedic surgeon . there is no fixed protocol of treatment described , by and large it is individualized . a 20 year old female presented with paraplegia for last 15 years due to irrecoverable spinal cord disease with complete sensory and motor loss of both lower extremities and was admitted with acute flexion contracture of both hip joints with trunk resting on thighs . she underwent bilateral proximal femoral resection . both hip joints were straight immediately after surgery and patient could lie on her back . in a course of time , she started sitting on her buttocks , led a comfortable wheelchair life with a sitting balance . proximal femoral resection is an effective method to treat long standing irrecoverable paraplegic acute flexion deformity of the hip joint .

despite the medical importance of leishmaniasis , little is known about the natural breeding places of its vectors . most previous attempts to identify the preferred microhabitats for the oviposition of sand flies in the neotropical region have produced disappointing yields , resulting in a small number of positive soil samples and immature forms [ 14 ] . some recent studies ( e.g. , alencar and singh ) , however , have successfully obtained high amounts of immature forms due to the sampling of suitable places for larval development . as observed by newstead , the immature forms of sand flies are more concentrated in microhabitats that exhibited specific conditions , as the presence of organic matter , humidity , and low levels of light . studies conducted in rain forests ( e.g. , hanson , alencar et al . ) corroborate these observations , as shown by the greater numbers of immature forms found in soil with litter , between roots and under fallen trunks . similar edaphic conditions , although in different microhabitats such as soil cracks , have also been observed in studies conducted at regions with dry climates ( e.g. , deane and m. p. deane , ferreira et al . ) , to be more likely to find immature forms of sand flies . dry climate regions experience more pronounced climatic variations than regions with humid climates typical of rain forests , so the density of vectors may exhibit different characteristics as well . studies conducted in rain forest regions ( e.g. , hanson , dias - lima et al . ) observed high densities of vectors throughout the entire study period . in contrast , studies from dry climate regions presented controversial results , as the absence of correlation between climate variables and sand flies density [ 11 , 12 ] , or increasing of density soon after rainy periods [ 13 , 14 ] . the knowledge about natural breeding places for sand flies and vector density may represent useful information for directing efforts at biological control , leading to reduce the density of the vectors and consequently control the incidence of disease [ 15 , 16 ] . in the present study , we aimed to characterize the natural breeding places for sand flies in a region with a dry climate and a known incidence of visceral leishmaniasis during the past 20 years . additionally , we investigated the possibility of association between the density of adults or immature sand flies with climate variables , assessing the predictive value of these variables on sand flies density . the cavunge district ( 12.3s ; 39.3w ) is located in a semiarid region of bahia state ( figure 1 ) . this district has 63.5 km of area in which the caatinga , a type of vegetation characterized by dispersed bushes and deciduous trees , is the major biome . breeding sites were searched in five residences , as the owners allowed samplings both inside and in places adjacent to their houses . during the first period of this study , from june 2007 through july 2008 , soil samples at low - light places with apparent decomposed organic matter , were collected from areas immediately adjacent to the five residences selected by our study group . these samples were gathered with a regular spoon and stored in cylindrical receptacles with a capacity of 1 l. microhabitats from which positive samples were collected were then chosen for more intensive sampling during the subsequent study period . during the second period of our study , from august 2008 through july 2010 , approximately 64 soil samples were monthly collected at the same five residences and stored in similar receptacles . according to the results from the first year of study , the soil was sampled in the following microhabitats : cavities in rocks ; areas between the roots of a spondias tuberosa tree ; areas between the roots of a delonix regia tree ; cavities in a fallen tree trunk ; cracks around a water tank ; areas covered with chicken feces ; low - light places inside a house ( e.g : hollows in walls , floor and around clay jugs ) . all soil samples were sent to an insectarium at the centro de pesquisas gonalo moniz ( cpqgm ) , being analyzed with different techniques . during the entire period of study , three different techniques : direct - observation , flotation - sieving , and flotation technique were utilized to identify the presence of sand flies in the soil samples . the direct - observation technique was used to examine all soil samples until sixty days after their arrival at the insectarium . this technique consisted by daily observation of the receptacles containing the soil samples in two different ways : by naked eye , so to find adult sand flies through the translucent cover of the 1l receptacles , and with a stereomicroscope , aiming to find immature forms in the soil . to count the number of sand flies in a soil sample , we included immature forms that reached the adult stage , immature forms that did not reach the adult stage but were similar to other larval stages ( larvae and pupae ) present in our laboratory colony of l. longipalpis , and the adults whose previous larval stages had not been detected . after the period corresponding to the direct observation technique , all soil samples were submitted to the flotation - sieving technique or the flotation technique . the flotation - sieving technique , as described by hanson , was used only in the soil samples from the first part of the study . according to this technique the soil was then washed with tap water through the sieve and through another two sieves , consecutively , with smaller pores each . the material that passed through the three sieves was then suspended with a saturated sugar solution , in order that immature forms could be found floating in the high - density solution . due to the retention of immature forms on the sieves used to process the soil samples from the first part of the study , and consequently loss of information about the real quantity of immature forms in the soil samples , the sieves were replaced by flotation for the second part of the study . with the flotation technique , a saturated salt solution was simply added to the soil samples and allowed the immature forms to float . following floatation - sieving and flotation , the immature forms suspended by a high density solution , were collected with a brush and disposed separately in 1l capacity cylindrical receptacles , remaining there for 60 days . these vessels were one - third filled with plaster covered by a ration composed by a mixture of rabbit feces , commercial hamster ration and small quantity of soil from the original substrate . the 2 inch hole in the bottom of these containers allowed keeping the plaster constantly humid due to the directly contact with a moist paper towel . the adult sand flies gathered from direct observation , flotation - sieving and flotation techniques were stored in covered glass slides with mounting media and identified at species level based on the identification key proposed by young and duncan . during each month of the second part of the study , one day before the soil sampling , two hp light traps , one inside the residence , and another in the adjacencies , were placed in every one of the same five residences used for soil sampling . the light traps were operated from 6 pm to 6 am , period also used by other authors due to the known nocturnal activity of several sand flies species [ 18 , 19 ] . all captured sand flies were transferred to the sand fly insectarium at cpqgm . at the arrival moment , adults were individually stored in covered glass slides with mounting media , following by identification at species level based on the identification key proposed by young and duncan . climate data were obtained by the national institute of meteorology ( inmet ) from the feira de santana meteorological station , placed at about 40 km of distance from cavunge district . daily means from temperature , and relative humidity were provided directly from the inmet , which calculated these data through the arithmetic means from records of maximum and minimum temperature or relative humidity at 9 am , 3 pm and 9 pm , respectively . otherwise , daily rainfall was measured by a single record of millimeters of rain in a day . daily rainfall and daily averages for temperature , and relative humidity were used to obtain the averages of these variables on a weekly basis . weekly averages of rainfall , temperature and relative humidity were calculated through the arithmetic means of daily rainfall , mean temperature and mean relative humidity , respectively , at one up to three weeks before the soil or adult sampling days . thus , the density of immature or adult sand flies was correlated by statistical analyses with the preceding weekly averages from the climate variables . from minitab software , multiple linear regression analyzes were performed for the yield of sand flies in the soil or adult sampling in each month and the average of climate variables at one up to three weeks before soil or adult sampling days . during the first period of this study , 234 soil samples were collected from five residences in the cavunge district . nine of these samples were identified as positives by direct - observation or flotation - sieving technique in the microhabitats and included rock cavities ( 2 ) , between the roots of spondias tuberosa ( 2 ) , between the roots of delonix regia ( 1 ) , soil cracks around a water tank ( 2 ) , soil covered with chicken feces ( 2 ) . based on these results , these microhabitats were sampled intensively during the second study period , in addition to accumulated soil in cavities from a fallen tree trunk and low light microhabitats from a residence interior . during the second period of this study , a total of 1,523 soil samples were collected from different microhabitats ( table 1 ) . the direct - observation and flotation techniques yielded a total of 64 sand flies , including 40 emerged adults , 16 larvae and 8 pupae . of 58 emerged adults or immature forms that reached the adult form , 48 were identified as l. longipalpis , whereas 10 were not identified at the species level . a total of 2,002 sand flies were collected with light traps during the second period of the study . species in addition to those found in the soil samples were identified as follows : 9 l. evandroi , 2 l. fischeri , 82 l. lenti , 1,907 l. longipalpis , and 2 l. peresi ( table 2 ) . the yield of adult sand flies captured by hp light traps and the average temperature from the preceding week were associated at a moderated strength of association ( table 3 ) . however , only the average temperature of the preceding week was found to be correlated significantly . all other climate variables in the preceding weeks were not significantly correlated with adult or immature sand flies yield ( table 4 ) . natural breeding places for phlebotomine sand flies , as the most likely places for the development of immature forms , may be represented by different microhabitats in different regions . in our study at cavunge , a district with semiarid climate and caatinga vegetation , positive soil samples were collected from a fallen trunk and between trees roots , as found in previous studies conducted at rain forests [ 5 , 8 ] . moreover , novel microhabitats , such as accumulated soil in rock cavities and from cracks around water tanks , were identified as positive for natural breeding sites . rock cavities in exposed rocks and cracks around a water tank , two of the most positive microhabitats , exhibit characteristics previously identified by deane and m. p. deane and newstead as likely to favor the development of sand flies ' immature forms . additionally , water tanks are permanent filled with water , what leads to humidity and the presence of moist cracks in the soil . as expected in a region affected by visceral leishmaniasis , most of the sand flies from the soil samples or captured by the light traps were identified as l. longipalpis . in studies conducted in rain forests [ 5 , 8 ] , however , l. longipalpis is often predominant in dry or urban locations in which visceral leishmaniasis occurs [ 1320 ] . analysis of the relationships between sand fly density and climate variables resulted in moderated strength association between adult sand flies captured and the average temperature from the preceding weeks . such relationship was not observed by previous studies of associations between sand flies density and climate variables , which identified the absence of climatological influence in sand flies density [ 11 , 12 ] , or a trend for increasing soon after raining seasons [ 13 , 14 ] . this novel possible relation contributes to the still uncertain framework of possible climate variables that interferes in the sand flies density in a dry climate region . the analyses among climate data and sand flies density made by our study suffered limitations , because data gathering was not made in loci , but at approximately 40 km from the study site . likewise , the absence of replication for the microhabitats sampled was an impediment to further statistical analyses that could lead to a comparison among adult and immature sand flies density . however , our study has identified several microhabitats as natural breeding sites and elucidated some possible relationships between vector density and climate variables that jointly should provide useful information from preferred periods and sites for application of insecticides . the sand flies natural breeding places , as well as climate variables associated with vectors density , despite their potential to assist the biological control , are poorly understood so far . our study points to several microhabitats that may serve as natural breeding places for phlebotomine sand flies in a semiarid region and also elucidate that temperature decreasing may be a predictor for the increasing of vector density in a dry climate region . altogether , our results may furnish a tool for optimizing the control of the sand flies , and consequently , the anthropic and zoonotic cases of visceral leishmaniasis .

few microhabitats have been previously identified as natural breeding places for phlebotomine sand flies so far , and little is known about the influence of climate variables in their density . the present study was conducted in a dry region with a semiarid climate , where visceral leishmaniasis occurs in humans and dogs . the occurrence of breeding places in specific microhabitats was investigated in soil samples collected from five houses , which were also the location used for sampling of adults . all the microhabitats sampled by our study were identified as natural breeding places due to the occurrence of immature forms of sand flies . on a weekly basis , the number of adult sand flies captured was positively correlated with the mean temperature from preceding weeks . these results , in addition to promoting an advance in the knowledge of sand flies biology , may furnish a tool for optimizing the control of the sand flies , by indicating the most suitable periods and microhabitats for the application of insecticides .

some have compared artificial grammar learning between human and non - human primates , or have used similar grammar types to investigate songbirds ability to learn grammatical sequences . fitch and hauser ( 2004 ) were the first to investigate grammar learning in human and non - human primates using fsg and psg grammars ( figure 1 ) . testing cotton - top tamarins and human adults in a behavioral grammar learning study , they found that humans could learn both grammar types easily , whereas the monkeys were only able to learn the fsg . the neural basis for this ability in cotton - top tamarins is unknown , since there are no functional or structural brain studies on this type of monkey . there are , however , a number of structural imaging studies on macaques , chimpanzees , and humans ( catani et al . , 2002 ; anwander et al . , 2007 ; rilling et al . , 2008 ; saur et al . , 2008 ; makris and pandya , 2009 ; petrides and pandya , 2009 ) . these studies indicate that the frontal and temporal regions which are known to be involved in language processing in humans are connected via ventral and dorsal fiber bundles in both humans and non - human primates . a direct comparison , however , revealed differences between humans and non - human primates ; macaques and chimpanzees display a strong ventral and a weak dorsal pathway , whereas humans display a strong dorsal pathway and a well - developed ventral pathway . the dorsal pathway was , therefore , discussed as the crucial pathway for the language ability in humans ( rilling et al . , 2008 ) . this difference in the structure of these pathways between humans and non - human primates is of particular interest in the light of a functional and structural imaging study in humans ( friederici et al . , 2006 ) , which applied the same artificial grammar types as used in the behavioral study by fitch and hauser ( 2004 ) . in humans , the ( ab ) grammar , with its adjacent dependencies , activated the frontal operculum , which is connected via the ventral pathway to the temporal cortex . interestingly , the ab grammar additionally recruited broca s area , which is connected to the temporal cortex via the dorsal pathway ( friederici et al . , 2006 ) . these data were taken to suggest that broca s area and its dorsal connection to the temporal cortex , in particular , supports the processing of higher - order hierarchically structured sequences relevant to language . it has been argued that the processing of ab grammar does not necessarily require the buildup of a hierarchical structure , but could be based on a simpler computation involving a counting mechanism plus some memory abilities ( perruchet and rey , 2005 ; de vries et al . , 2008 ) . the empirical challenge comes from studies reporting that songbirds are able to process ab grammars ( gentner et al . , 2006 ; however , although the grammar used by abe and watanabe ( 2011 ) can be described as being asymmetric , similar to natural languages , the detection of the incorrect sequences in the experiment could , in principle , be performed based on the following computation : process the incoming sequence of ( adjacent ) elements and , upon detection of the center element , reverse - and - match the following sequence to the initial sequence ( figure 2 ) . the underlying mechanisms used to process symmetrical ab grammars thus remain speculative , both for the songbird studies ( gentner et al . , 2006 ; abe and watanabe , 2011 ) and for the human study ( friederici et al . , 2006 ) . artificial grammar used in abe and watanabe ( 2011 ) . ( a ) left panel : description of the grammar as a center - embedded structure and members of categories a , c , and f ; right panel : examples of test strings . ( b ) symmetrical description of center - embedded structure ( ces ) and violating test string ( aes ) . the center element is represented in gray . for humans , however , the argument can be made that the computation they apply to process symmetrical ab grammars does indeed involve hierarchy building . 2008 ) and also asymmetrical natural grammars , which require the buildup of a multi - level hierarchy , using the same brain area ; namely broca s area ( makuuchi et al . , 2009 ; see figure 3 ) . this brain region is part of the neural network which is dorsally connected to the temporal cortex via the superior longitudinal fascile and the arcuate fascile ( friederici et al . , 2006 ) . the finding that humans process symmetrical structures of artificial ab grammars within the same brain region used to process hierarchical asymmetrical structures in natural language leads to the conclusion that the underlying mechanism for both is that of building hierarchies . ( 2009 ) . ( a ) schematic view of non - embedded and embedded structures described symmetrically . ( c ) tree structure ( asymmetric ) for example sentence displayed in ( b ) . note that although the structure of the sentence displayed in figure 3c could be described schematically as a symmetrical one ( figures 3a , b ) , this is not an adequate description since natural grammars contain functional categories requiring an asymmetrical description ( figure 3c ) . for songbirds , the ability to learn grammatical sequences is based on a brain system mediating auditory input - to - vocal output ( fujimoto et al . , 2011 , for a review , see bolhuis et al . , 2010 ) . this auditory - to - motor circuit , which probably acts in concert with a memory component , may underlie songbirds ability to learn symmetric hierarchies ( bloomfield et al . the dorsal fiber bundle that connects the sensory auditory cortex to the premotor cortex can be viewed as a candidate neural structure of a functionally parallel auditory - to - motor circuit . this structure appears to play a crucial role in phonology - based language learning in humans during early infancy ( berwick et al . , in the past , the dorsal pathway that connects the temporal cortex to the frontal cortex , as observed in adults ( catani et al . , 2002 ) , has been proposed to not only support auditory - to - motor mapping ( hickok and poeppel , 2007 ; saur et al . , 2008 ) but also to subserve the processing of syntactically complex sentences ( friederici et al . , 2006 ; friederici , 2009 ) . lesions of the dorsal pathway result in conduction aphasia which is characterized by the inability to repeat speech ( geschwind , 1965a , b ) . on the other hand , lesions of the dorsal pathway unfortunately , however , these patient studies do not allow a functional segregation of different parts of the dorsal pathway . newborns learn simple grammatical rules from auditory input after brief exposure ( gervain et al . , infants can learn the rule - based dependency of non - adjacent elements in a novel natural language , again after brief exposure to correct sentences ( friederici et al . , 2011 ) . during production , very young infants demonstrate a language - specific prosody in their cry patterns , long before they start to babble ( mampe et al . , 2009 ) , and during the babbling phase , they continuously tune their production toward the phonology of their target language ( de boysson - bardies et al . , 1984 ) . this early phonology - based learning stage should require a circuit allowing auditory - to - motor mapping . structural imaging data shows that newborns display such an auditory - to - motor circuit in the form of a dorsal pathway which links the temporal cortex to the premotor cortex ( perani et al . , 2011 ) . this dorsal pathway connecting to the premotor cortex must be separated from an additional dorsal pathway that connects the temporal cortex to broca s area which is present in adults but not myelinized in infants ( see figure 4 ) . fiber tracking of diffusion tensor imaging data with seed in broca s area and seed in the precentral gyrus / premotor cortex in ( a ) adults and ( b ) newborns . two parts of the dorsal pathway are present in adults ; one connecting the temporal cortex via the fasciculus arcuatus ( af ) and the superior longitudinal fasciculus ( slf ) to the inferior frontal gyrus , i.e. , broca s area ( blue ) , and one connecting the temporal cortex via the af / slf to the precentral gyrus , i.e. , premotor cortex ( yellow ) . in newborns , the ventral pathway connecting the ventral inferior frontal gyrus via the extreme capsule fiber to the temporal cortex ( green ) is detectable in adults and newborns . , it is proposed that there are two functionally distinct parts of the dorsal pathway ( see figure 4 ) : one part connecting the temporal cortex to the premotor cortex ( hereafter called dorsal pathway i ) and a second , more medially located part , connecting the temporal cortex to broca s area ( hereafter called dorsal pathway ii ) . i , supporting sensory - to - motor mapping , is present at birth , whereas dorsal pathway ii is not ( perani et al . , 2011 ) . previous studies with infants between 1 and 4 months old suggested that the dorsal pathway connecting to broca s area is present early in life ( dubois et al . , 2006 , 2009 ) , although the data appear to indicate that only the part of the dorsal pathway which connects to the premotor cortex ( dorsal pathway i ) is present . the authors proposed this may be due to methodological problems and base their argumentation on functional data showing that broca s area is activated in response to speech at this age ( dehaene - lambertz et al . , 2010 ) . the study on newborns , however , indicates that this argumentation must be challenged , since for newborns although they show activation in broca s area , neither a functional nor a structural connectivity between broca s area and the temporal cortex can be found ( perani et al . , 2011 ) . thus , it remains to be demonstrated whether the connection between the temporal cortex and broca s area is fully present in infants between 1 and 4 months old , in particular , since another recent study reports that the dorsal pathway is limited to the parietal and temporal sections in early infancy ( leroy et al . , 2011 ) . ( 2011 ) indicate that in newborns , only the dorsal pathway that connects to the premotor cortex is myelinized . this connection may not only support tuning processes during babbling , but , moreover , the observed early learning of rule - based dependencies from auditory input in human infants ( gervain et al . , 2008 ; friederici et al . , 2011 ; kudo et al . , dorsal pathway ii , connecting the temporal cortex to broca s area , only develops as the brain matures , and is not even fully myelinized at the age of seven ( brauer et al . it is argued that dorsal pathway ii supports the processing of multi - level hierarchically structured sentences . first , adults activate broca s area and the posterior portion of the superior temporal gyrus and sulcus when processing syntactically complex sentences ( bornkessel et al . , 2005 ; friederici et al . , second , only adults with a mature dorsal pathway ii are able to process syntactically complex sentences correctly , whereas children under the age of seven an age at which the dorsal pathway ii is not yet fully matured are not ( hahne et al . , 2004 ; dittmar et al . , fiber tracking of diffusion tensor imaging data with seeds in brodmann area ( ba ) 44 and 45 in ( a ) adults and ( b ) 7-year - old children . the dorsal pathway connects the posterior part of broca s area ( ba 44 ) to the temporal cortex via the af / slf . the ventral pathway connects the anterior part of broca s area ( ba 45 ) to the temporal cortex via the extreme capsule fiber system . these findings in humans make it likely that grammatical rule learning and processing in infants and in adults are partly based on different brain structures . learning and processing of auditory structured sequences , as shown in infants , could be based on the ability to identify phonological statistical relations of elements in a sequence and some memory capacity . this ability may partly be based on dorsal pathway i. in adults , this automatic way of learning from the auditory input is no longer at work , and strategic processes take over ( mueller et al . , 2010 ) . finally , the question remains : what is the function of the ventral pathway in language processing ? the connection between the anterior portion of the prefrontal cortex and the middle temporal gyrus via the extreme capsule fiber system has been related functionally to semantic processing and comprehension ( saur et al . there is accumulating evidence in support of the view that this pathway is relevant for semantic processes ( for a review , see weiller et al . however , the ventral pathway also appears to be involved in the processing of some aspects of syntax ( friederici et al . the data on this issue are sparse , but it seems that the processing of simple sentences ( e.g. , the pilot is flying the plane ) does not necessarily recruit the posterior portion of broca s area , and thus the dorsal pathway ( saur et al . , 2008 ; tyler and marslen - wilson , 2008 ) . the finding that the ventral pathway supports the computation of semantic relations , as well as some syntactic dependencies , raises the question of whether there is a general underlying mechanism capturing both aspects , or whether one has to assume two ventral pathways . in light of these across species and within - human findings , we can speculate that there is a parallel mechanism for sequence learning across species , which is based on an auditory ( input)-to - motor ( output ) circuit . in songbirds , the causal relation between the auditory input - to - vocal output and sequence learning is well established ( scharff and nottebohm , 1991 ; fujimoto et al . , 2011 ) . in humans , a respective neural circuit dorsal pathway i connecting the temporal cortex to the premotor cortex is present at birth and may be responsible for rule - based sequence learning observed in young infants ( teinonen et al . , this neural network appears to support bottom - up processes such as speech perception and repetition ( saur et al . , 2008 ) . however , dorsal pathway ii , connecting broca s area to the temporal cortex , may specifically subserve the processing of language - like hierarchical structures . the supporting evidence for this is twofold : first , the dorsal pathway is generally stronger in human adults than in non - human primates ( rilling et al . , 2008 ) , and second , dorsal pathway ii , in particular , is not myelinized at birth and only fully develops at around the time children master syntactically complex sentences ( brauer et al . , 2011 ; perani et al . , 2011 ) . in adults , this pathway may be involved in fronto - to - temporal top - down predictive processes during language comprehension . the author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

in the absence of clear phylogenetic data on the neurobiological basis of the evolution of language , comparative studies across species and across ontogenetic stages within humans may inform us about the possible neural prerequisites of language . in the adult human brain , language - relevant regions located in the frontal and temporal cortex are connected via different fiber tracts : ventral and dorsal pathways . ontogenetically , it has been shown that newborns display an adult - like ventral pathway at birth . the dorsal pathway , however , seems to display two subparts which mature at different rates : one part , connecting the temporal cortex to the premotor cortex , is present at birth , whereas the other part , connecting the temporal cortex to broca s area , develops much later and is still not fully matured at the age of seven . at this age , typically developing children still have problems in processing syntactically complex sentences . we therefore suggest that the mastery of complex syntax , which is at the core of human language , crucially depends on the full maturation of the fiber connection between the temporal cortex and broca s area .

although it can affect any one , it is more common in women , especially pregnant women and those who are taking contraceptives or hormone replacement therapy . melasma is thought to be the stimulation of melanocytes to produce more melanin pigments when there is sun exposure . melasma symptoms are dark , irregular well demarcated hyper pigmented macules to patches commonly found on the upper cheek , nose , lips and forehead . when the skin is exposed to the sun the hyperpigmentation becomes darker which shows the effect of sun exposure in melasma pathophysiology . it 's most common presentation is cirrhosis , hypopituitarism , cardiomyopathy , diabetes , arthritis or hyper pigmentation , which worsens by sun exposure . both melasma and hemochromatosis have hyperpigmentation all over the body , but melasma mostly involves places , which are exposed to the sun more frequently . melasma is the most common reason of skin hyperpigmentation , which its treatments are often ineffective as it comes back with continued exposure to the sun . iron , cobalt , magnesium and selenium , vitamin e and c are known to have effect on skin diseases progress , but little data about serum iron level and melasma . although iron overload affects skin pigmentation , effect of iron deficiency on skin is not clear . hence , we evaluated serum iron level , ferritin and total iron binding capacity ( tibc ) level among nonpregnant women with and without melasma . in a cross - sectional case - control study performed in 2012 in university referral dermatologic clinic of rasoul akram and razi hospitals . we included patients who have melisma as a case group . women with the history of cardiac or thyroid disease and usage of hormone therapy , phototoxic drugs or anti convulsant drugs or pregnancy were not included . nonpregnant women without melisma were considered as the control group . after declaring sufficient information , a written consent was taken from all participants . control and case groups were matched for demographic variables ( age , marital status , body mass index and known related melasma disorder ) . the checklist included three parts to collect data regarding demographic information , medical history , and medical examination . we also checked serum iron level , tibc and ferritin level of blood in both groups . we considered serum iron level 55 - 160 g / dl , ferritin 11 - 306 ng / dl and tibc 228 - 428 g / dl as normal amounts among our patients . data were analyzed by statistical package for the social sciences ( spss ) for windows ( version 16.0 ; chicago , il , usa ) . means were compared using independent t - test and proportions were compared using chi - square test . thirty - three nonpregnant women with melasma ( case ) and 33 nonpregnant women without melasm were evaluated during 1-year study . control and case groups were matched for demographic variables ( age , marital status , body mass index and known related melasma disorder ) . demographic information compared between case and control groups mean ( standard deviation ) serum iron level , tibc and ferritin is shown in table 2 . comparison of measured variables among case and control groups in case group , 27% had a lower level of serum iron , and 10% had upper serum iron level . in the control group , 15% were in the lower level and 10% upper level of serum iron ( p > 0.05 ) . about 23% of patients in the case group had low ferritin level compared with 12% in the control group , but not statistically significant . the mean serum iron level in the case group was a lower than the control group . however , ping et al . found higher amounts of iron , magnesium , copper , and zinc among 46 nonpregnant women with melasma . however jie et al . showed higher iron and copper in women with melisma comparing with women without melasma . study with larger sample size may be suggested . in our study , melasma was more observed in the age 25 - 35 years old . melasma is a common acquired disorder characterized by symmetric , hyperpigmented patches , which are most prevalent among young to middle - aged women . we did not find any significant difference between case and control groups in tibc and ferritin between two groups . the prevalence of low iron serum was more in case group ( 27% ) compared with the control group ( 15% ) . in a research conducted in 2012 , 14.3% of patients with melasma also had low serum iron level . there are different factors that have an effect on melasma . considering the common dermatologic symptoms of iron overload disease ( hemochromatosis ) and the relationship between iron deficiency and melisma . although the serum iron level was lower in nonpregnant women with mealsma , it was not significant compared with those without melasma . considering iron deficiency anemia as a prevalent problem among young women and as the fact that there are not definite treatments for melasma furthermore , there is a need for further evaluations with larger sample sizes regarding this issue . one limitation of our study was that we did not consider family history of melasma in our demographic data among our groups , which are an important predisposing factor . eb contributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work fb contributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work se contributed in the conception of the work , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work kh contributed in the conception of the work , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work ag contributed in the design of the work , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work zacontributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work .

background : melasma is a common acquired disorder characterized by symmetric , hyperpigmented patches with an irregular outline , occurring most commonly on the face . it is most prevalent among young to middle - aged women . although iron overload affects skin pigmentation , effect of iron deficiency on skin is not clear . so , we evaluated serum iron level , ferritin and total iron binding capacity ( tibc ) level among nonpregnant women with and without melasma.materials and methods : a cross - sectional case study was conducted in 2012 at university dermatologic department on 33 nonpregnant women with melasma ( case ) and 33 nonpregnant women without melasma ( control ) . serum iron level , tibc and ferritin in the two groups was measured and compared.results:serum iron level was lower in the case group ( 85 11 ) in comparison with control group ( 102 9 ) , but the difference was not significant ( p : 0.9 ) . mean tibc and ferritin were higher in the case group ( tibc : 329.4 29 , ferritin : 6 18 ) than the control group ( tibc : 329.3 29 , ferritin : 33 6 ) without significant difference.conclusion:although the serum iron level was lower in nonpregnant women with mealsma , it was not significant compared with those without melasma .

eventration of the diaphragm is a condition where the muscle is permanently elevated , but retains its continuity and attachments to costal margin . it can be congenital or acquired , consisting of failure of muscular development of part or all of one or both hemidiaphrams . clinically eventration of the diaphragm refers to an abnormal elevation of one leaf of an intact diaphragm as a result of paresis , paralysis , aplasia , or atrophy of varying degrees of muscle fibers . in some cases complete eventration almost invariably occurs on the left side is rare on the right side . the case we present here is about a 70-year - man hypertensive presented with a history of progressive exertional breathlessness for last 1 month with worsening from last 5 days . past history was insignificant . on physical examination , patient was drowsy , tachypnic , and cyanosed with trachea shifted to right . chest examination revealed decreased movements on the left side in inframamary , infraaxillary and infrascapular areas . air entry was decreased in left infra mammary , infra axillary , and infrascapular areas . arterial blood gas analysis revealed po2 4o mmhg , sao2 60.3% , pco2 87 mmhg , ph 7.161 , hco3 30.4 , na 136 meq / l , k 4.52 meq / l . x - ray chest showed elevated left dome of diaphragm with bowel loops in left side of chest with mediastinal shift to right side [ figure 1 ] . echocardiography showed dextrocardia with concentric left ventricular hypertrophy and severe pulmonary hypertension and tricuspid regurgitation . contrast computed tomography chest confirmed complete eventration of left diaphragm with hernation of colon and stomach in the left chest [ figure 2 ] . pulmonary function test revealed restrictive pattern of lung disease with vital capacity 1.31 l , forced vital capacity ( fvc ) 1.43 l , forced expiratory volume 1 second ( fev1 ) 1.26 ( 55% ) , fev1/fvc ratio 87.7 ( 119% ) . clinical impression of eventration of diaphragm with restrictive lung disease with congestive cardiac failure and type 2 respiratory failure was made . endoscopic findings revealed normal esophagus with stomach anatomically distorted because of which scope falls short of pylorus . no mucosal lesion was seen . endoscopy was tried in right lateral position ; even then duodenum could not be entered . patient was managed with oxygen inhalation , diuretics , and bronchodilators . his oxygenation improved and arterial blood gas at the time of discharge was acceptable . x - ray chest showing elevated left dome of the diaphragm with bowel loops in the left side of chest with the mediastinal shift to right side contrast computed tomography chest showing complete eventration of the left diaphragm with herniation of colon and stomach in the left chest eventration of the diaphragm is a condition in which all or part of diaphragm is largely composed of fibrous tissue with only a few or no interspersed muscle fibers . it is generally asymptomatic in adults and is discovered incidentally as was seen in this case . symptoms may be related to gastrointestinal tract , respiratory embarrassment , and rarely cardiac dysfunction . eventration of the hemidiaphragm , although rare in adults has been reported to be a cause of progressive respiratory failure this patient presented with acute respiratory failure because of a compromised respiratory reserve secondary to long standing eventration , possibly of congenital origin . eventration of diaphragm causes reduced total lung capacity , vital capacity , expiratory reserve volume and functional residual capacity . although this patient was successfully managed medically , acute presentation have sometimes been successfully managed with surgical plication of the diaphragm . there has a report of successful nonsurgical management of eventration of the hemidiaphragm presenting with acute respiratory distress . in adults the diagnosis of diaphragmatic eventration can usually be made on standard posteroanterior and lateral chest films . a high index of suspicion , past history , previous and present imaging and physical examination of the chest should aid in early and definite diagnosis . when chest radiographs are intermediate , spiral computed tomography with thin sections are performed and is the imaging study of choice . mri is used to evaluate the diaphragm for patients with clinical suspicion of but an intermediate diagnosis after chest x - ray and spiral ct . diagnostic laparoscopy and diagnostic pneumoperitoneum are reliable and simple methods to differentiate eventration from paralysis . this condition should be recognized as a cause of both progressive and acute respiratory failure . even in asymptomatic elderly patients , a close follow - up is recommended . aim of reporting this rare entity is to highlight the importance of history taking , good physical examination and imaging in the diagnosis of diaphragmatic eventration .

eventration of the diaphragm is a rare condition where the muscle is permanently elevated , but retains its continuity and attachments to costal margin . in this condition , all or part of the diaphragm is largely composed of fibrous tissue with a few or no interspersed muscle fibers . it can be complete or partial . it is seldom symptomatic and often requires no treatment . we present a 70-year - old male who came with progressive breathlessness and was admitted with type 2 respiratory failure , and on evaluation was found to have complete eventration of the left diaphragm with herniation of colon and stomach in the left chest with dextrocardia . aim of reporting this rare case is to highlight the importance of history taking , good physical examination , and imaging in the diagnosis of diaphragmatic eventration .

recurrent pregnancy loss ( rpl ) is a common clinical problem that may occur during pregnancy . about 15% of clinically recognized pregnancies could suffer from rpl before the 20 week of gestation , with no known cause . the pathogenesis of rpl remains unknown in many patients , and approximately 55% of patients are suspected to have thrombophilic defects . laude et al . found that levels of circulating procoagulant microparticles were higher in women with rpl when compared with controls . thrombophilia might cause a syncytiotrophoblast invasion of the maternal blood vessels , which could lead to the formation of microthrombosis at the site of implantation and result in rpl and implantation failure . plasminogen activator inhibitor-1 ( pai-1 ) is the urinary plasminogen activator and principal inhibitor of tissue . sun and colleagues found that pai-1 4g/5 g polymorphism was significant positive explanatory variable for polycystic ovary syndrome ( pcos ) patients with spontaneous abortions . in addition , pai-1 4g/5 g polymorphism was associated with increased pai-1 concentrations and hypofibrinolysis and contributed to early pregnancy loss . many studies assessed the association between pai-1 4g/5 g polymorphism and rpl risk [ 829 ] . a meta - analysis found that pai-1 4g/5 g polymorphism did not increase the risk of rpl . therefore , we conducted this meta - analysis to investigate the association between pai-1 4g/5 g polymorphism and rpl risk . relevant studies were searched for in pubmed , web of science , embase , and cochrane library . the following terms and strategies were used for the search : ( plasminogen activator inhibitor-1 or pai-1 ) and ( single nucleotide polymorphism or snp or genetic variation or genetic polymorphism ) and ( recurrent pregnancy loss or rpl ) . to avoid possible missing of qualified trails , introduction and reference list of eligible trails identified through primary search were screened manually . the following criteria were used to screen eligible studies for this meta - analysis : ( 1 ) a case control study or cohort study that studied the association between pai-1 4g/5 g polymorphism and rpl risk ; and ( 2 ) sufficient data were available for calculation of allele / genotype frequency . these data included : the first author , year , ethnicity , genotype distribution , and sample size . disagreement in data extraction was resolved by group discussion by referring to original studies with a third reviewer . the odds ratios ( ors ) and corresponding 95% confidence intervals ( cis ) were calculated to assess the association between pai-1 4g/5 g polymorphism and rpl risk . the recessive genetic model ( 4g/4 g vs. 4g/5g+5g/5 g ) was chosen , because pai-1 4g/4 g genotype was significantly associated with increased pai-1 production . hardy - weinberg equilibrium ( hwe ) of genotype frequency in the control group was assessed by chi - square test . between - studies heterogeneity was assessed by the chi - square - based q test and i. p<0.1 or i>50% was considered as significant heterogeneity . if no significant heterogeneity was observed , fixed - effects model with mantel - haenszel method was used to make estimates . however , if significant heterogeneity observed , the sources of heterogeneity would be further analyzed by galbraith plots . if there were no significant clinical or methodological differences in trails , the random effects model based on dersimonian - laird method was be used . publication bias was tested using begg s test and funnel plot ( p<0.05 was considered as significant ) . statistical analysis was conducted using stata software 11.0 ( statacorp , college station , texas , usa ) . relevant studies were searched for in pubmed , web of science , embase , and cochrane library . the following terms and strategies were used for the search : ( plasminogen activator inhibitor-1 or pai-1 ) and ( single nucleotide polymorphism or snp or genetic variation or genetic polymorphism ) and ( recurrent pregnancy loss or rpl ) . to avoid possible missing of qualified trails , introduction and reference list of eligible trails identified through primary search were screened manually . the following criteria were used to screen eligible studies for this meta - analysis : ( 1 ) a case control study or cohort study that studied the association between pai-1 4g/5 g polymorphism and rpl risk ; and ( 2 ) sufficient data were available for calculation of allele / genotype frequency . these data included : the first author , year , ethnicity , genotype distribution , and sample size . disagreement in data extraction was resolved by group discussion by referring to original studies with a third reviewer . the odds ratios ( ors ) and corresponding 95% confidence intervals ( cis ) were calculated to assess the association between pai-1 4g/5 g polymorphism and rpl risk . the recessive genetic model ( 4g/4 g vs. 4g/5g+5g/5 g ) was chosen , because pai-1 4g/4 g genotype was significantly associated with increased pai-1 production . hardy - weinberg equilibrium ( hwe ) of genotype frequency in the control group was assessed by chi - square test . between - studies heterogeneity was assessed by the chi - square - based q test and i. p<0.1 or i>50% was considered as significant heterogeneity . if no significant heterogeneity was observed , fixed - effects model with mantel - haenszel method was used to make estimates . however , if significant heterogeneity observed , the sources of heterogeneity would be further analyzed by galbraith plots . if there were no significant clinical or methodological differences in trails , the random effects model based on dersimonian - laird method was be used . publication bias was tested using begg s test and funnel plot ( p<0.05 was considered as significant ) . statistical analysis was conducted using stata software 11.0 ( statacorp , college station , texas , usa ) . after searching and screening with preset criteria , a total of 22 studies with 4306 cases and 3076 controls were included for this meta - analysis . the characteristics and the hwe results of the included studies are listed in table 1 . as shown in figure 1 , we found that pai-1 4g/5 g polymorphism was significantly associated with an increased rpl risk ( or=1.89 ; 95% ci 1.342.67 ; p=0.0003 ) . in the subgroup analysis by race , pai-1 4g/5 g polymorphism was significantly associated with an increased rpl risk in caucasians ( or=2.23 ; 95% ci 1.443.46 ; p=0.0003 ) . however , no significant association was observed in asians ( or=1.47 ; 95% ci 0.842.59 ; p=0.18 ) . results of the meta - analysis are listed in table 2 . in the sensitivity analysis , when the fixed - effects model was used , the result was still positive ( or=1.87 ; 95% ci 1.642.13 ; p<0.00001 ) . when the studies without hwe were excluded , the result was not changed ( or=1.56 ; 95% ci 1.122.19 ; p=0.009 ) . furthermore , when the studies with small sample size were excluded , the result was also not changed ( or=1.98 ; 95% ci 1.253.13 ; p=0.004 ) . results from the cumulative meta - analysis suggest that the evidence was consistent over time ( figure 2 ) , indicating that the results of this meta - analysis are robust . furthermore , the result was significant ( or=1.48 , 95% ci 1.221.79 , p<0.0001 ) . no significant publication bias was found by begg s funnel plot ( figure 4 ) and egger s test ( p=0.313 ) . after searching and screening with preset criteria , a total of 22 studies with 4306 cases and 3076 controls were included for this meta - analysis . the characteristics and the hwe results of the included studies are listed in table 1 . as shown in figure 1 , we found that pai-1 4g/5 g polymorphism was significantly associated with an increased rpl risk ( or=1.89 ; 95% ci 1.342.67 ; p=0.0003 ) . in the subgroup analysis by race , pai-1 4g/5 g polymorphism was significantly associated with an increased rpl risk in caucasians ( or=2.23 ; 95% ci 1.443.46 ; p=0.0003 ) . however , no significant association was observed in asians ( or=1.47 ; 95% ci 0.842.59 ; p=0.18 ) . results of the meta - analysis are listed in table 2 . in the sensitivity analysis , when the fixed - effects model was used , the result was still positive ( or=1.87 ; 95% ci 1.642.13 ; p<0.00001 ) . when the studies without hwe were excluded , the result was not changed ( or=1.56 ; 95% ci 1.122.19 ; p=0.009 ) . furthermore , when the studies with small sample size were excluded , the result was also not changed ( or=1.98 ; 95% ci 1.253.13 ; p=0.004 ) . results from the cumulative meta - analysis suggest that the evidence was consistent over time ( figure 2 ) , indicating that the results of this meta - analysis are robust . furthermore , the result was significant ( or=1.48 , 95% ci 1.221.79 , p<0.0001 ) . no significant publication bias was found by begg s funnel plot ( figure 4 ) and egger s test ( p=0.313 ) . our previous meta - analysis investigated the association between pai-1 4g/5 g polymorphism and rpl risk . however , that meta - analysis did not find a positive association between pai-1 4g/5 g polymorphism and risk of rpl . . when these new studies were included , we found that pai-1 4g/5 g polymorphism was significantly associated with risk of rpl , indicating that pai-1 4g/5 g polymorphism carriers might have increased rpl risk . in the subgroup analysis based on race , pai-1 ethnic differences can occur in genotype frequencies , which might account for the different results . we found that the result from our meta - analysis was stable . in the sensitivity analyses , we also found the results were not altered , indicating this meta - analysis was robust . in human and animal models , pai-1 was involved not only in fibrinolysis regulation , but also in extracellular proteolytic processes during ovulation , ovarian follicle growth , and embryo implantation . much evidence has suggested that abnormal levels of pai-1 significantly increase miscarriage and complicated pregnancy rates . additionally , glueck et al . suggested that pai activity was a significant positive explanatory variable for the number of miscarriages . furthermore , glueck et al . found that administration of metformin throughout pregnancy in women with pcos reduced the risk of first - trimester spontaneous abortion . palomba and coworkers also confirmed that metformin reduced pai-1 activity in women with pcos and abortion risk . therefore , it might be possible that increased pai-1 associated with high rpl risk and pai-1 4g/5 g polymorphism might influence rpl risk first , lack of the original data limited the evaluation of gene - gene and gene - environment interactions . second , dawson et al . indicated that pai-1 level was not only changed by pai- 1 4g/5 g polymorphism , but also by concentration of blood sugar , insulin , and triglycerides . however , we did not adjust these factors in this meta - analysis due to lack of original data . thus our meta - analysis had little statistical power to assess the association between the pai-1 4g/5 g polymorphism and rpl risk . the results of this meta - analysis suggest that pai-1 4g/5 g polymorphism might be associated with rpl development in caucasians .

backgroundthe association between plasminogen activator inhibitor-1 ( pai-1 ) 4g/5 g polymorphism and recurrent pregnancy loss ( rpl ) risk is still contradictory . we thus performed a meta-analysis.material/methodsrelevant studies were searched for in pubmed , web of science , embase , and cochrane library . an odds ratio ( or ) with a 95% confidence interval ( ci ) was used to assess the association between pai-1 4g/5 g polymorphism and rpl risk.resultsa total of 22 studies with 4306 cases and 3076 controls were included in this meta - analysis . we found that pai-1 4g/5 g polymorphism was significantly associated with an increased rpl risk ( or=1.89 ; 95% ci 1.342.67 ; p=0.0003 ) . in the subgroup analysis by race , pai-1 4g/5 g polymorphism was significantly associated with an increased rpl risk in caucasians ( or=2.23 ; 95% ci 1.443.46 ; p=0.0003 ) . however , no significant association was observed in asians ( or=1.47 ; 95% ci 0.842.59 ; p=0.18).conclusionsin conclusion , this meta - analysis suggests that pai-1 4g/5 g polymorphism might be associated with rpl development in caucasians .

the medial vestibulospinal tract ( mvst ) , which descends in the medial longitudinal fasciculus ( mlf ) , may mediate the vestibular evoked myogenic potentials ( vemps ) in the contracting sternocleidomastoid muscle . we report herein abnormal vemps in a patient with medial medullary infarction ( mmi ) that appeared to involve the mlf . a patient with infarction involving the right medial medulla showed decreased p13-n23 amplitude and increased p13/n23 latencies of the vemps on the right side . these abnormal vemps recorded in an mmi patient support the theory that vemps are mediated by the mvst contained within the mlf . vemps may represent a valuable tool for investigating vestibular dysfunction originating from the saccule , even in patients with central vestibulopathies , which is not readily defined by conventional vestibular function tests . the term " vestibular - evoked myogenic potentials ( vemps ) " refers to inhibitory potentials recorded in the contracting muscles , usually the sternocleidomastoid muscles ( scm ) , when sound stimuli are applied.1 - 4 the main pathway for saccule - induced inhibitory postsynaptic potentials to ipsilateral scm motoneurons appears to be the medial vestibulospinal tract ( mvst ) , which descends within the medial longitudinal fasciculus ( mlf).5 however , vemps have not been measured in lesions involving the medullary mlf . we report herein abnormal vemps in a patient with medial medullary infarction ( mmi ) that appeared to involve the mlf . a 67-year - old man developed sudden vertigo and vomiting followed by dysarthria and left - sided weakness 9 days before admission to hospital . he had a history of diabetes , hypertension , and chronic renal failure . on admission , he had a blood pressure of 153/79 mmhg , a pulse rate of 75 beats / min , a respiration rate of 20 breaths / min , and a body temperature of 37.0. neurological examination revealed gaze - evoked nystagmus ( gen ) during both horizontal and upward gazes . both eyes deviated to the left during eye closure , and saccades were hypermetric to the left and hypometric to the right . this patient also exhibited dysarthria , dysphagia , and medical research council grade i weakness on the left side . the deep tendon reflexes were hypoactive in the extremities , but the toe sign was extensor in the left foot . laboratory tests were notable for increased serum glucose ( 279 mg / dl , normal range=70 - 110 mg / dl ) , hemoglobin a1c ( 7.7% , normal range=4.0 - 6.4% ) , blood urea nitrogen ( 71 mg / dl , normal range=10 - 26 mg / dl ) , creatinine ( 2.9 mg / dl , normal range=0.7 - 1.4 mg / dl ) , and uric acid ( 8.8 mg / dl , normal range=3.0 - 7.0 mg / dl ) . the results of bithermal caloric tests and measurements of ocular torsion and tilt of the subjective visual vertical ( svv ) were all normal . vemps exhibited decreased p13-n23 amplitude and increased p13/n23 latencies on the right side ( fig . 1 ) . mri documented a right mmi extending from the pyramid to the medullary tegmentum ( fig . 2a and b ) . magnetic resonance ( mr ) angiography disclosed diffuse narrowing of the right distal vertebral artery and focal narrowings of the left vertebral artery ( fig . our patient , who had an mmi on the right side , showed decreased vemp p13-n23 amplitude and increased p13/n23 latencies on the right side in addition to gen , saccadic contrapulsion , dysarthria , hemiparesis , and hemihypesthesia , which are characteristic findings of mmi.6 since the mlf contains the mvst , which is known to mediate vemps recorded in the contracting scms , the abnormal vemps recorded in our patient with mmi indicate disruption of the mlf in the medullary tegmentum where the mlf is located . vemps can be used to assess the sacculocollic reflex pathway , which travels downward in the lower brainstem.7 the saccule , which is a linear accelerometer in mammals , is an acoustic receptor in lower species , and the vestibular neurons sensitive to click sounds are of otolithic origin.5,8 in peripheral vestibulopathy , abnormal vemps are usually associated with canal paresis and the ocular tilt reaction ( otr).4 however , recordings of vemps in our patient with mmi disclosed decreased p13-n23 amplitude and increased p13/n23 latency on the ipsilesional side in the absence of caloric paresis , otr , or svv tilt . the principal brainstem areas of saccular nerve termination are the inferior vestibular nucleus and the lateral portion of the superior vestibular nucleus , while the principal projections from the utricle are to the laterodorsal medial vestibular nucleus , the ventrolateral superior vestibular nucleus , and the rostral portion of the inferior vestibular nucleus.9 the dissociation of abnormalities between the vemps and otr / svv tilt suggests differential involvement of the otolithic pathways in central vestibulopathies . in primates , saccule projects to the superior and inferior vestibular nuclei,9 and however , sound - evoked vemps recorded from the neck are almost completely unilateral.2,4,10 since the mvst contains inhibitory fibers , the sacculocollic inhibitory signal may travel down from the inferior vestibular nucleus mostly along the mvst to the ipsilateral scm,2,10 - 12 while the lateral vestibulospinal tract is excitatory . however , since the mvst originates mostly from the medial vestibular nucleus , the inhibitory sacculocollic responses may also be mediated by the medial vestibular nucleus.13,14 because the mlf is supplied by the anteromedial medullary arteries and is usually involved in mmi,6 damage to the mlf is most likely to be responsible for the abnormal vemps recorded in our mmi patient . this interpretation is also consistent with the associated gen and the lesion observed on mri extending to the medullary tegmentum , where the mlf is located . gen in mmi is ascribed to damage to the nucleus prepositus hypoglossi ( nph ) or cell groups of the paramedian tracts , which are also located in the medullary tegmentum.6 in conclusion , the recording of abnormal vemps in our mmi patient supports the theory that these potentials are mediated by the mvst contained within the mlf . the association between abnormal vemps and gen also indicates that the lesion in our patient involved the medullary tegmentum where the mlf and the nph are located . vemps may represent a valuable tool for investigating vestibular dysfunction originating from the saccule , even in patients with central vestibulopathies , which is not readily defined by conventional vestibular function tests .

backgroundthe medial vestibulospinal tract ( mvst ) , which descends in the medial longitudinal fasciculus ( mlf ) , may mediate the vestibular evoked myogenic potentials ( vemps ) in the contracting sternocleidomastoid muscle . we report herein abnormal vemps in a patient with medial medullary infarction ( mmi ) that appeared to involve the mlf.case reporta patient with infarction involving the right medial medulla showed decreased p13-n23 amplitude and increased p13/n23 latencies of the vemps on the right side . these abnormal vemps recorded in an mmi patient support the theory that vemps are mediated by the mvst contained within the mlf.conclusionsvemps may represent a valuable tool for investigating vestibular dysfunction originating from the saccule , even in patients with central vestibulopathies , which is not readily defined by conventional vestibular function tests .

oligodendroglial tumors have generated a large amount of interest over the past years due to their heightened response to chemotherapy and ability to be divided into prognostic subgroups based on molecular biology . several clinical studies demonstrated that losses of portions of chromosomes 1p and 19q are associated with the oligodendroglial phenotype and longer recurrence - free survival following radiation and/or chemotherapy [ 2 , 3 ] . it is believed that these chromosome regions contain tumor suppressor genes that block the development and/or progression of the tumor . radiation therapy inducing secondary oligodendroglial tumors are very rare , the approximate cumulative risk for secondary brain tumors after cranial irradiation is 1 - 3% . only a small portion of these rare tumors correspond to oligodendroglial histology ; there have been less than 10 cases reported to date . a 32-year - old man was admitted to the hospital srio - libans in june 2008 with a short history of progressive headache and left hemiplegia . the patient had a previous history of a lymphoblastic lymphoma with central nervous system involvement , and had been previously submitted to a variety of systemic chemotherapy regimens , including an autologous bone marrow transplantation in june 2002 . six months after that procedure the patient developed a cns recurrence and was treated with radiation therapy which encompassed the whole brain and the neuraxis ( 24 gy administered in 12 fractions ) , achieving a complete remission . the patient remained well and asymptomatic , without any clinical or radiological evidences of lymphoma up until shortly prior to this hospital admission , when a brain mri was performed , showing a gross mass in the right temporal lobe ( fig . a partial tumor resection was carried out and the pathologic evaluation , based on histology and immunohistochemistry , ruled out the possibility of recurrence of the lymphoma and revealed the presence of an anaplastic oligodendroglioma . the pathologic specimen was reviewed by 3 different pathologists , who concurred with this diagnosis . a fish assay was performed and showed the presence of 1p deletion , but not 19q deletion . during the postoperative period the patient developed a rapid neurologic deterioration ( ps:4 , complete left hemiplegia , severe headaches ) . as shown in the mri performed after the surgical procedure , given the dramatic clinical course and tumor development , we decided to treat the patient with temozolomide at a dose of 150 mg / m / day for 5 consecutive days every 28 days associated with bevacizumab at a dose of 10 mg / kg given on days 1 and 15 . shortly after the treatment was started six weeks after starting this therapy the patient was walking with the help of a cane and the mri showed a complete resolution of the mass effect and a complete disappearance of the contrast - enhancing tumor ( fig . the classic treatment for patients with a newly - diagnosed anaplastic oligodendroglial tumor is based on maximal surgical resection consistent with preservation of neurologic function . radiotherapy should be used in patients with large residual mass or with anaplastic lesions . for selected cases with deletions in 1p and 19q , chemotherapy should also be considered , either in conjunction with radiotherapy or as a single modality [ 7 , 8 ] . in our patient the usual approach could not be applied . an adequate tumor resection was not possible because of the size and location of the tumor , which also involved the contralateral hemisphere . in addition , radiation therapy was also not an option due to whole brain irradiation previously administered . the activity of this drug in the treatment of high grade gliomas is well recognized . in phase ii trials , temozolomide as single agent produces response rates of 50 - 60% in patients with anaplastic oligodendroglioma [ 9 , 10 ] . bevacizumab is a monoclonal antibody with important anti - angiogenic properties , which inhibits the serum vascular endothelial growth factor ( vegf ) , a cystine - knot growth factor involved in vasculogenesis . in phase ii trials , bevacizumab showed important activity and safety in patients with high - grade glioma [ 11 , 12 ] . recent data suggest that the combination of temozolomide and bevacizumab is active in high - grade gliomas with an acceptable safety profile even when given with concomitant radiotherapy [ 13 , 14 ] . the quick and significant tumor reduction seen in this patient constitutes , to our knowledge , the first report of the use of this form of therapy in an anaplastic oligodendroglioma patient . given the previous medical history of this patient and the rapid pace of tumor growth , we were afraid that unless the initial treatment could induce important and fast tumor regression , a life - threatening condition would be reached within a matter of days .

in this case report , we describe a rare case of a 32-year - old man who presented a highly aggressive , fast growing anaplastic oligodendroglioma five years after being treated with whole brain radiotherapy for a cns recurrence of a lymphoblastic lymphoma . initially , the patient was submitted to a surgical intervention and partial tumor resection , which allowed us to establish the pathologic diagnosis and the presence of a 1p deletion . shortly after the operation the tumor grew back , exerting important mass effect . since no radiation therapy or surgery could be used and the patient faced a critical condition , chemotherapy was started with a combination of temozolomide and bevacizumab . immediately after the first cycle a marked clinical and radiological improvement was documented .

calculating nonsynonymous ( ka ) and synonymous ( ks ) substitution rates is a useful way for evaluating sequence variations for protein orthologs across different species or taxonomical lineages with unknown evolutionary status . furthermore , it is often important to recognize positively selected sites and to identify genes with selective hotspots . there have been numerous methods and software tools developed for such purposes in the public domain , including paml ( 1 ) , mega ( 2 ) , dnasp ( 3 ) , hyphy ( 4 ) and certain modules from bioperl ( 5 ) . however , after careful simulations and real data analysis , we believe that a single method will not be readily identified to be used under all circumstances 6 , 7 , therefore we created the version of the kaks_calculator 1.0 ( 8) , which adopted model - selected and model - averaged techniques to compute ka / ks values by means of a group of existing nucleotide substitution models . since the majority of dna sequence sites are considered to be invariable due to functional restraints and evolutionary distances , the selective pressure varies among different sites in a sequence , thus ka / ks calculations only based on the entire gene are not enough to detect the individual sites subjected to adaptive selection . to conquer this problem , a sliding window strategy has been introduced to several web servers such as swapsc ( 9 ) and wspmaker ( 10 ) , while these tools adopted fewer ( mostly one ) models for ka and ks calculations . here we provide an updated version of kaks_calculator , which solves these two questions in a simple way . , unlike the existent ka / ks algorithms , the new software can take the variable mutation rates across sequence sites into account , which contain vital information for molecular evolutionary studies . we created seven related methods namely -ng , -lwl , -mlwl , -lpb , -mlpb , -yn and -myn by introducing gamma distribution to model the mutation rates ; the importance of the new methods has been demonstrated as the ignorance gives rise to biased computational results 11 , 12 . we therefore implemented these new methods into the updated core tool of version 2.0 , whose core toolset has seventeen algorithms including seven original approximate methods , seven gamma - series methods , one maximum likelihood method ( gy ) , and two expanding methods ( model selected and model averaged ) . the methods provide not only the values of ka , ks and ka / ks , but also other key information from paired orthologous sequences , including the number of synonymous / nonsynonymous sites , substitutions , divergence time , substitution - rate - ratio , gc content , and aicc . split , plot , dpss to evaluate adaptive selection at the gene sequence level . as an expanding toolset , they adopt a sliding window with user s definition on window length and step length . split is responsible for the division of the raw paired orthologous sequences into portions on the basis of dynamic windows in the positive direction . plot deals with the outcome of the core toolset after the nucleotide sequences from split have been computed , resulting in a massive collection of figures illustrating ka , ks and ka / ks ( omega ) in intervals . third , it should be emphasized that all above - mentioned processes are capable of handling massive data in a timely fashion . in particular , all transferrable data including sequences and resulting information are contained in a single file . we provide executable files as well as source codes for the package and tested all programs on both windows 2000/xp / vista and linux ( red hat 3.4.6 - 8 ) platforms . the toolkit is freely available ( licensed under gplv3 ) online at https://sourceforge.net / projects / kakscalculator2/. in order to conveniently update the algorithm and to friendly communicate with users , we implement the new version with a therefore , the integrated software is divided into two essential parts to better serve for different functionality : the core toolset that calculates ka and ks , and the expanding toolset that is responsible for additional computation activities based on the ka and ks calculation ( e.g. , with a sliding window strategy ) ( figure 1 ) . in the core toolset , we design the gui with visual c++ s mfc ( microsoft foundation classes ) that manages documents and allows users to view the objects , and the entire program is object - oriented . each main method has its own class in the code and the multi - thread operations among them use the cpu time allocations very efficiently . we adopt java-6 to program the expanding toolset because of its advantages across different platforms . we choose r language ( http://www.r-project.org/ ) to draw high - level graphics from inputting data . to call for the r function from java , we employ a package named rserve ( http://www.rforge.net/rserve/index.html ) , which is a program responding to requests from clients based on the tcp / ip protocol . in details , we use java to invoke the jrclient suite and connect it after rserve starts on r environment ; under this circumstance each connection has its workspace and directory . moreover , the server allows many clients to plot their data simultaneously . in consideration of the running speed , it is so fast that a graph covering thousands of data points can be plotted in a few seconds . we have evaluated the performance of the gamma - series methods in ka / ks calculations in previous studies 11 , 12 . in the process of identifying positively selected sites , we have also successfully applied the toolbox to two real cases , including the animal alpha - defensin genes investigated in lynn et al . ( 13 ) and the tas1r3 ( taste receptor type 1 member 3 ) genes reported to be responsible for the ability to recognize the sweetness ( 14 ) ( figure 2 ) . it is important to combine the gamma - series methods with a sliding window strategy ; the former represents the variation of raw mutation across sites and the latter reveals if each site is driven by different selective pressure based on the assumption that the omega ( ka / ks ) values are not equal across orthologous gene sequences . in particular , when window slices become dense enough , it approaches the site models ( 1 ) , similar to the thought of integral definition in mathematics . we believe that the software provides an excellent choice when one calculates for positively selected sites . a final note is that we will construct ancestral sequences for the measurement of lineage - specific selective strength in our next update . zz supplied several bug reports and modified schemes in the previous version of the software . zz supplied several bug reports and modified schemes in the previous version of the software .

we present an integrated stand - alone software package named kaks_calculator 2.0 as an updated version . it incorporates 17 methods for the calculation of nonsynonymous and synonymous substitution rates ; among them , we added our modified versions of several widely used methods as the gamma series including -ng , -lwl , -mlwl , -lpb , -mlpb , -yn and -myn , which have been demonstrated to perform better under certain conditions than their original forms and are not implemented in the previous version . the package is readily used for the identification of positively selected sites based on a sliding window across the sequences of interests in 5 to 3 direction of protein - coding sequences , and have improved the overall performance on sequence analysis for evolution studies . a toolbox , including c++ and java source code and executable files on both windows and linux platforms together with a user instruction , is downloadable from the website for academic purpose at https://sourceforge.net / projects / kakscalculator2/.

monteggia and galeazzi fracture - dislocations are unstable forearm injuries and represent 1%-2% and 3%-4% of forearm fractures , respectively ( 1 , 2 ) . the reported mechanism of injury for monteggia lesions in children is a fall on outstretched hand in pronated position . in adults , ulnar fractures always display either a transverse comminuted fracture or a fracture with butterfly fragment , both of which suggest a direct blow or bending force rather than torsion , and the mechanism of injury in children . the mechanism causing a galeazzi injury is generally believed to be a fall on outstretched hand with hyperpronation ( 2 ) . a 20 - year old college student who fell from a height of 13 meters ( the 4th floor of a building ) was brought to our hospital a few hours after trauma . he presented with bilateral open forearm fractures ( exposed ulnar bone ) , swollen and deformed elbows and wrists , deformity of left arm and thigh . 1 ) revealed bilateral ulnar fractures at the junction of the proximal and middle third , bilateral posterior dislocation of the radial head ( bado type iii ) , bilateral distal radius fractures and left distal radioulnar joint dislocation in addition to left femoral and left humeral shaft fracture . the left galeazzi fracture dislocation reduced and the distal radius fracture was pinned percutaneously ( fig . after closed reduction of the right distal radius fracture , percutaneous pin was inserted ( fig . three days after the trauma when the patient 's general health had stabilized , open reduction of the humerus fracture with radial nerve exploration was performed . the radial lacerated nerve at the level of the fracture was repaired with open reduction of the femoral fracture . when the forearm splints were removed after 4 weeks , the left distal radio ulnar joint ( druj ) seemed unstable and dislocated by forearm supination . consequently a closed reduction of the druj was performed in the operating room and the ulna pinned to the radius ( the pins were removed 6 weeks later ) . twelve weeks after the primary trauma the ulnar fracture in the left forearm did not progressed to union as well as that of the right side , thus plating and bone grafting were performed on the left side . six months after the trauma the healing of the fractures was completed and the patient recovered his wrist extension power ( fig . 2 ) . the patient returned to work 9 months after the accident . at the time of the last visit 18 months after trauma , the elbow , forearm , and wrist motion were all evaluated ( table 1 ) . a : right forearm after reduction of distal radius fracture , radial head dislocation and open ulnar fracture , b : left forearm after percutaneus pining of distal radioulnar joint . x - ray of bilateral elbow , forearm and wrist , six months after initial injuries . elbow , wrist and forearm range of motion 18 months after trauma . left wrist extension , mp extension of the fingers , thumb extension and abduction power were in a good condition ( 4/5 ) . according to bado ( 3 ) , monteggia lesion includes radiohumeral dislocation associated with fracture of the ulna at any level . ten cases of combined monteggia and galeazzi fracture have been reported ( 8 adults and 2 childrens ) ( 4 , 5 , 6 , 13 ) . there are few reports of combined monteggia with distal radius fracture . to the best of our knowledge the occurrence of combined monteggia - galeazzi fracture on one side and monteggia - distal radius fracture on the other side in the same patient have never been reported . because of rare occurrence of this injury and presence of multiple fractures and dislocations there is possibility of pitfalls in the operative treatment of these cases ( 13 ) . falling down on outstretched hand with pronation of left side could cause distal radius fracture , druj dislocation , radial head dislocation , ulnar open fracture , humerus fracture and radial nerve laceration at arm fracture site . moore et al believe that the exact clinical and radiological criteria for galeazzia fractures have not yet been clearly established ( 7 ) . they list 4 reliable radiographic signs of druj disruption as : basal fracture of ulnar styloid ; widening of joint space of the druj as shown on anteroposterior x - ray ; dislocation of the radius relative to the ulna as shown on a lateral x - ray ; and a shortening of the radius of more than 5 millimeters . in our patient , lateral x - ray of the left wrist , demonstrated dislocation of the ulnar head relative to the radius . because of the instability of the left druj even after 4 weeks immobilization in splint , we stabilized this joint with percutaneous radioulnar pinning . galeazzi fracture can not be controlled with closed treatment because of the deforming force of the brachioradialis , pronator quadratus , thumb extensor and abductors described by hughston ( 8) . the hand acts as a volar deforming force on the distal fragment . the brachioradialis shortens the fragment on the ulna and pronator quandratus also pulls the distal fragment volar and proximal to the ulna . moreover the thumb abductors can contribute to further shortening of the radial side of the wrist . anatomic restoration of the length and alignment to the radius is essential in the management of these injuries ( 2 , 810 ) . reduction and stability of the druj are then assessed with forearm rotation ; if the reduction is stable the forearm can be immobilized in supination for 4 to 6 weeks ( 11 , 12 ) . if , after reduction , the druj is unstable , stabilization of the joint seems necessary . this can be usually performed using open reduction and internal fixation or percutaneous pinning of druj or with ulnar styloid fragment .

we present an exceedingly rare case of left monteggia - galeazzi fracture - dislocation and right monteggia - distal radius fracture occurring simultaneously in a 20-year old male patient who had fallen 13 meters from a building . the combination of monteggia and galeazzi fracture - dislocation in the same forearm is very rare and , to the best of our knowledge , simultaneous bilateral monteggia and galeazzi or distal radius fracture in the same patient , have never been reported .

only electromagnetic waves ( visible light , x - rays , -rays , ultraviolet light , infrared light , etc ) and electrons can be used in food process , while neutrons , deuterons and -rays cause extensive damage to food . the irradiation extends the storage life of food and improves the safety via the reduction of pathogenic and spoilage micro - organisms . the ionizing radiation has the ability to start a high number of chemical changes in gas , liquid and solid phase of food . with the exposure in irradiation initially many intermediate products are formed and react each other or with other components of the system . each group of food ingredients such as carbohydrates , proteins and other nitrogen containing compounds , fats and oils , vitamins , enzymes and coloring compounds can react with certain intermediate products and form new intermediate products , many of which have high chemical activity [ 35 ] . stevenson proved that irradiation does not have repercussions in the general nutritional value of foods and the oxidative changes caused are similar to those observed with the use of conventional techniques of food treatment . nevertheless , a combination of irradiation and other methods of treatment , such as cooking , can lead to accelerating oxidative destruction of foods . the storage of irradiated lipid food , in the presence of oxygen , accelerates the autoxidation . it has been proved that irradiation accelerates the oxidation of unsaturated fatty acids and cholesterol during frozen storage of foods [ 910 ] . in lipids , many of the reactions resemble to those of the peroxidation from molecular oxygen , but special reactions can also take place owed exclusively to ionizing radiation . vitamin e is the most labile in irradiation from all fat soluble vitamins [ 1113 ] . the addition of tocopherols ( in animal feed ) leaded to the protection of phospholipids and cholesterol by breaking the chain of oxidation in meat fat . moreover , it prevented the loss of water detention , color and flavor of food during storage . as determined by fuster et al . , triacylglycerols can be used as a model system ( which provides the natural complexity of fatty distribution ) . so , a vegetable oil can be used to determine the effect of irradiation on lipids without interference of other food ingredients ( proteins , carbohydrates , etc . ) . in this work , we tried to determine the effect of -irradiation on oxidative condition and tocopherol content of lipids using various vegetable oils as model systems . the oxidative condition before and after irradiation of seed oil samples with addition of -tocopherol was also determined . -tocopherol was selected since , to our knowledge , there were no previous reports on the effect of irradiation on that tocopherol . additionally , -tocopherol was not expected [ 16 , 17 ] to show antioxidant action higher than its -homolog during irradiation since the process was carried out at room temperature . the results of induction period ( table 1 ) showed that irradiation caused a significant ( p < 0.05 ) decrease in resistance to oxidation of all samples . after irradiation with 3 kgy , the lowest decrease was observed in olive oil samples ( 9.6 % ) and the highest in soybean oil ( 34.2 % ) . the oxidative stability of olive oil is related to some extent to the presence of -tocopherol . kiritsakis and min reported that olive oil contains up to 150 mg / kg -tocopherol . however , the stability of olive oil could not be explained only on the basis of tocopherol action . it is known that the olive mesocarp contains phenolic compounds , which are present in the olive oil and considerably increase the stability against oxidation of the oil . to these compounds , -tocopherol and of course the fatty acid composition should be attributed the lowest decrease ( table 2 ) of -tocopherol in olive oil after irradiation ( 68.3 % ) in contrast to the other two oils . these results agree with those of zhu et al . who reported that depletion of -tocopherol ( during protection of low density lipoproteins against oxidation ) was delayed after addition of certain flavonoids which regenerated the vitamin . in all cases , the addition of -tocopherol significantly ( p < 0.05 ) increased the induction period ( at the same irradiation dose ) of soybean and sunflower oil ( table 1 ) . particularly , the increase of induction period was up to 28.9 % and 34.8 % at 3 kgy for sunflower and soybean oil , respectively . additionally , the reduction of induction period , during the progress of the irradiation , appeared proportional to the level of addition of -tocopherol . specifically , the reduction of induction period after 3 kgy dose of irradiation of soybean oil was from 34.2 % ( control ) to 21.4 % ( 300 ppm of -tocopherol ) and sunflower oil from 25.8 % ( control ) to 18.0 % ( 300 ppm of -tocopherol ) . these results are in line with those reported by bourgeois and czornomaz and von pongracz et al . who reported that the antioxidant activity of tocopherols is >>> in a temperature between 80 and 120 c and > > > in a temperature between 20 and 60 c . during the determination of the induction period ( rancimat method ) where the temperature was set at 90 c the highest decrease in -tocopherol was shown in soybean oil without additional -tocopherol ( up to 92.6 % ) . -tocopherol showed even higher decrease ( up to 93.1 % ) and appeared more sensitive in irradiation process than -tocopherol , while -tocopherol appeared the most resistant ( up to 92.3 % of reduction ) . however , it should be stated that in samples with low tocopherol concentration the depletion was complete ( table 2 ) . lakritz and thayer who reported a decrease in - and -tocopherol ( 30 and 15 % , respectively ) after irradiation of fresh chicken breasts . additionally , lakritz and thayer reported a decrease ( 6 % ) in -tocopherol but no significant changes in -tocopherol after irradiation . in the study of lakritz et al . , -tocopherol decreased significantly in meat irradiated with 09.4 kgy at 5 c . on the contrary , galvin et al . , who studied the retention of -tocopherol and lipid oxidation after irradiation ( 2.5 and 4.0 kgy ) in cooked minced chicken ( fed with a diet supplemented with -tocopheryl acetate ) , reported no affect of irradiation on the -tocopherol content . concerning the lipid stability , the same authors indicated that oxidation ( measured by thiobarbituric acid - reacting substances and cholesterol oxidation products ) was accelerated during storage but was possible to control it when chicken diet was supplemented with of -tocopheryl acetate . it appears that there is a disagreement between various authors on the percentage of tocopherol depletion as a consequence of irradiation which can be attributed to the different experimental conditions and samples . the results of our work are also difficult to be compared with the aforementioned studies since it was conducted under different experimental conditions ( room temperature ) and on different samples ( vegetable oils ) . the mechanism of the antioxidant action of tocopherols is thoroughly described by many authors [ 2122 ] . extensive studies have also been reported on the synergistic behavior of tocopherols and other vitamins [ 2 , 15 , 2325 ] and flavonoids [ 20 , 26 ] . niki and noguchi reported that -tocopherol acts as an antioxidant not only by itself but also in collaboration with other antioxidants . the addition of 100 , 200 or 300 ppm -tocopherol in seed oil samples , and hence the significant increase of the coantioxidant ( -tocopherol ) concentration , reduced the depletion of all tocopherols ( table 2 ) after irradiation with 1 , 2 and 3kgy . -tocopherol depletion was reduced by 15.4 % and 18.5 % ( for soybean and sunflower oil , respectively ) , -tocopherol by 19.2 % ( for soybean oil ) and -tocopherol by 5.2 % and 12.8 % ( for soybean and sunflower oil , respectively ) . these results can explain why the drop of induction period of all oils was reduced when -tocopherol was added . the results are in agreement with those of zhu et al . who demonstrated that ldl oxidation did not occur substantially until a - tocopherol was depleted . in conclusion , the present study demonstrated that the effect of irradiation on the oxidative condition of oils was minimized when -tocopherol was added . at the same time the addition of -tocopherol can reduce , in most cases , the loss of - and -tocopherols and hence retain the nutritional value of lipid foods . from a nutritional perspective , the protection of -tocopherol , which possesses over 80 % of biological activity of all tocopherols , is important since this vitamin is an integral component of biological membranes , where it acts as a highly effective chain - breaking antioxidant and inhibits phospholipids and cholesterol oxidation . further investigation on the effect of irradiation on tocopherol content and induction period of lipid foods using higher doses and -tocopherol concentrations should be carried out in combination to the mechanism of action of various tocopherols . three different vegetable oils were used , namely olive oil , sunflower oil and soybean oil ( all purchased from elais s.a , athens , greece ) . in sunflower and soybean oil samples 0 , 100 , 200 or 300 ppm of -tocopherol ( sigma chemicals company ltd . , st . each determination was also carried out on a sample of seed oil ( control ) ( with or without addition of -tocopherol ) not subjected to irradiation . oils were placed in sealed screw capped glass vials ( 5 cm in length , i.d . 2 cm ) and then irradiated with doses of 1 , 2 , and 3 kgy , at room temperature , using as gamma source co ( theratron 1000 for radiotherapy applications , mds nordion , ottawa , canada ) . the irradiation was carried out at department of oncology and radiotherapy of i.k.a . in g. genimatas oncology hospital ( athens , greece ) . the irradiated samples and unirradiated controls were stored , with nitrogen induced , at 20 c for approximately 1 day before induction period and tocopherol content determination . two and a half grams of oil were accurately weighed into the reaction vessel of the rancimat 679 ( metrhom ltd , herisau , switzerland ) . an hplc pump , waters 600e ( millipore corporation , waters chromatography division , massachusetts , usa ) , equipped with a waters -porasil column ( 125 , 10 m , 3.9x300 mm ) and a waters 486 tunable absorbance detector was used . results are displayed as means of triplicate determinations and standard deviation ( in parenthesis ) . oils were placed in sealed screw capped glass vials ( 5 cm in length , i.d . 2 cm ) and then irradiated with doses of 1 , 2 , and 3 kgy , at room temperature , using as gamma source co ( theratron 1000 for radiotherapy applications , mds nordion , ottawa , canada ) . the irradiation was carried out at department of oncology and radiotherapy of i.k.a . in g. genimatas oncology hospital ( athens , greece ) . the irradiated samples and unirradiated controls were stored , with nitrogen induced , at 20 c for approximately 1 day before induction period and tocopherol content determination . two and a half grams of oil were accurately weighed into the reaction vessel of the rancimat 679 ( metrhom ltd , herisau , switzerland ) . an hplc pump , waters 600e ( millipore corporation , waters chromatography division , massachusetts , usa ) , equipped with a waters -porasil column ( 125 , 10 m , 3.9x300 mm ) and a waters 486 tunable absorbance detector was used . results are displayed as means of triplicate determinations and standard deviation ( in parenthesis ) .

the effect on induction period and tocopherol content after -irradiation on samples of olive oil and seed oils ( sunflower and soybean ) was determined . in seed oil samples 0 , 100 , 200 and 300 ppm of -tocopherol were added before irradiation with 1 , 2 and 3kgy . the results of induction period showed that , after irradiation , all samples presented a significant decreased in resistance to oxidation . however , this decrease was minimized when -tocopherol was added . irradiation significantly decreased the level of tocopherols . -tocopherol appeared more sensitive in irradiation process than - and -tocopherol . the addition of -tocopherol significantly reduced , in most cases , the depletion of the other tocopherols .

exercise facilitates metabolic functions in the human body and benefits physical health by preventing disease , controlling weight , and maintaining homeostasis1 . the american heart association reported that a lack of exercise is one of the main factors of heart disease ( along with high blood pressure , hyperlipidemia , and smoking ) and recommended regular exercise to treat and prevent heart - related disease2 . measuring the blood biochemical indicators of myocardial damage is conventionally divided into a traditional method that measures creatine kinase myocardial band isoenzyme ( ck - mb ) and a cardiac enzyme test that measures cardiac troponin ( ctn ) . an increase in these elements indicates a strong possibility of acute cardiac infarction3 . of these elements , ctn is an enzyme specific to the heart that increases in response to very small cardiac damage4 . therefore , ctn is a standard biochemical index used for diagnosing myocardial necrosis in patients with coronary artery disease5 . the n - terminal of prohormone brain natriuretic peptide ( nt - probnp ) is an indicator that is useful for diagnosis , the evaluation of treatment effects , and the prediction of the prognosis of patients with cardiac insufficiency . nt - probnp is also known to be effective for predicting a malfunction of the left ventricle after cardiac infarction6 . the material reflects cardiac stress in clinics and has been reported to be excessively expressed over the normal range during serious exercise , such as an ultra - marathon7 . performing regular exercise before fierce endurance exercise is effective for preventing myocardial and muscular tissue damage during the fierce endurance exercise . however , few studies have examined the physiological indicator in cases of one - off high - intensity exercise after moderate- or high - intensity endurance orientation training . therefore , the purpose of this study was to investigate differences in the concentrations of ctni , nt - probnp , and ck - mb in male sprague - dawley rats during one bout of prolonged treadmill exercise ( lasting 3 h ) following different training and non - training regimens . forty male sprague - dawley rats ( age : six weeks , weight : 150180 g each ) were used in this study . all animals were housed ( three rats per cage ) at 23 2 c and 50 5% humidity with a 12-hour light dark cycle . the rats were given a seven - day period for adapting to the environment before the experiment . the rats were randomly divided into four groups ( n=10 in each group ) : control , high - intensity exercise , moderate - intensity exercise , and nonexercise . this study was approved by the institution of animal care and use committee of daegu university , and the experimental procedure complied with the management guidelines for experimental animals . the exercise intensity levels used in this study were set on the basis of the results of a study by shepherd and gollnick ( 1976 ) , in which the maximal oxygen uptakes of white sprague - dawley rats were measured using a metabolic rate - measuring instrument and a treadmill . as a result , the levels were set at 15 m / min ( i.e. , approximately 65% of the maximal oxygen uptake ) and 28 m / min based on the reference data that defined the relevant velocity as being approximately 82% of the maximal oxygen uptake8 . this study s aerobic exercise groups first performed a preliminary aerobic adjustment exercise for 20 min daily for four days and then performed their main treadmill training for 35 min / day six days per week ( except sunday ) for four weeks . the high- and moderate - intensity exercise groups maintained intensity levels of 28 m / min and 15 m / min , respectively . but , non - exercise group carried out preceding exercise for four days and since then did nt carry out intensive aerobic exercise . after the training , the high- and moderate - intensity exercise groups and the nonexercise group simultaneously performed one bout of prolonged treadmill exercise at 15 m / min for 3 h. following this bout of prolonged treadmill exercise , the animals were weighed . each animal s abdominal cavity was dissected immediately , and 10 ml of blood was collected from the main artery using a syringe . the collected blood was put into an eppendorf tube and centrifuged at 18,000 rpm at 4 c for 18 min . the collected sera were stored in a freezer at 70 c prior to analysis . , usa ) was used as a measurement device , and a dimension mmb flextm reagent cartridge was used as a reagent . the blood threshold applied to each experiment was under 0.6 ng / ml and 125 pg / ml for ctni and np - probnp , respectively . a one - way analysis of variance test was performed using pasw ( version 18.0 for windows ) to investigate intergroup differences . table 1table 1.results of prolonged intensive exercise in rats accustomed to high- and moderate - intensity trainingcg ( n=10)hg ( n=10)mg ( n=10)ng ( n=10)weight ( g)230 g220 g220 g230 gctni ( ng / ml)0.01 0.000.08 0.020.59 0.40*1.54 0.74*nt - probnp ( pg / ml)27.8 8.729.7 10.538.5 12.858.5 15.3**p<0.05 . cg : control group ; hg : high - intensity group ; mg : moderate - intensity group ; ng : non - exercise group . * significantly different compared with cg ( p<0.05 ) ; significantly different compared with ng ( p<0.05 ) presents the weights of the rats measured in each exercise group after one bout of prolonged treadmill exercise . the ctni levels differed significantly between the groups : 0.01 0.00 ng / ml for the control group , 0.08 0.02 ng / ml for the high - intensity exercise group , 0.59 0.40 ng / ml for the moderate - intensity group , and 1.54 0.74 ng / ml for the non - exercise group ( p<0.05 ) . the post hoc analysis showed that the high- and moderate - intensity exercise groups had significantly higher ctni levels than the control group ( p<0.05 ) , and the high- and moderate - intensity exercise groups had significantly lower ctni levels than the non - exercise group ( p<0.05 ) ( table 1 ) . cg : control group ; hg : high - intensity group ; mg : moderate - intensity group ; ng : non - exercise group . * significantly different compared with cg ( p<0.05 ) ; significantly different compared with ng ( p<0.05 ) the np - probnp levels differed significantly between the groups : 27.8 8.7 pg / ml for the control group , 29.7 10.5 pg / ml for the high - intensity exercise group , 38.5 12.8 pg / ml for the moderate - intensity exercise group , and 58.5 15.3 pg / ml for the non - exercise group ( p<0.05 ) . the post hoc analysis showed that the non - exercise group had significantly higher np - probnp levels than the control group ( p<0.05 ) , and the high- and moderate - intensity exercise groups had significantly lower np - probnp levels than the non - exercise group ( p<0 0.05 ) ( table 1 ) . this study examined the impact of four weeks of moderate- and high - intensity treadmill warming - up exercise on the heart s condition during serious aerobic exercise using a sample of sprague - dawley white male rats . in this study results , the blood ctni levels of the non - exercise group and the moderate - intensity training group increased significantly after long - distance running compared to the control group , which did not perform long - distance running . however , the high - intensity training group did not show a significant increase , indicating that high - intensity training in advance of long - distance running is effective at preventing myocardial damage during long - distance running . this result is consistent with the results of a study by chen et al.9 , in which ctnt concentrations in white rats decreased remarkably in an experiment group that performed high - intensity warm - up swimming training with an extra weight compared with an experiment group that swam without a weight . the study argued that performing preliminary exercise before high - intensity training can decrease myocardial damage or negative impacts in the body in case of fierce exercise . in the current study , a significant increase in nt - probnp , which is used as an indicator of cardiac insufficiency , was observed in the nonexercise group . several studies reported that elite athletes , non - elite athletes , and leisure players can show a short - term increase in nt - probnp after intense and severe long - term exercise . moreover , nt - probnp concentration increases after long - term exercise or fierce endurance exercise10 , 11 . however , nt - probnp concentrations at rest do not increase among trained athletes compared to untrained people in the same age group10 , 12 . in the current study , the moderate- and high - intensity exercise groups showed a significant decrease of indicator for myocardial damage compared to the non - exercise group when implementing serious long - distance running . among the exercise groups , the prevention effects were larger the high - intensity training than the moderate - intensity training . this implies that performing high - intensity training before severe aerobic exercise is effective at preventing myocardial damage . wannamethee et al.13 noted that the implementation of regular exercise reduced exercise - induced inflammatory responses ; this was attributed to adaptive responses to the exercise and to anti - inflammatory effects . the current study found that , compared to the nonexercise group , rats that underwent preceding exercise showed less cardiac muscle damage and inflammatory responses during prolonged intense exercise . in particular , the effects were greater after one bout of intense exercise following high - intensity training than moderate - intensity training .

[ purpose ] the purpose of this study was to investigate the effects of exercise on myocardial injury in male sprague - dawley rats . two groups of rats were trained with either moderate- or high - intensity treadmill running for four weeks . subsequently , the concentrations of cardiac troponin and the n - terminal of prohormone brain natriuretic peptide ( nt - probnp ) were examined following a single bout of prolonged intensive exercise ( lasting 3 h ) . [ subjects and methods ] the study included 40 six - week - old male sprague - dawley rats weighing 150180 g each . the aerobic exercise group was divided into high - intensity ( 28 m / min ) and moderate - intensity ( 15 m / min ) subgroups . both subgroups were trained for 35 min daily for six days per week ( excluding sunday ) over a four - week period . following training , the high- and moderate - intensity exercise groups and a nonexercise group performed one bout of prolonged treadmill exercise for 3 h at a speed of 15 m / min . [ results ] the cardiac troponin and nt - probnp levels differed significantly between the groups . [ conclusion ] the exercise groups showed lower levels of cardiac troponin and nt - probnp than the nonexercise group after the bout of prolonged intensive exercise .

castleman 's disease ( cd ) is a relatively uncommon benign disease that is characterized by lymphoid hyperplasia . we describe herein a case of cd presenting as a soft - tissue tumor in the arm and discuss with reference to the literature . we studied aspirates in which the cytology was indicative of cd and which was subsequently confirmed by histology . a 55-year - old woman with no history of major illness presented with a 2-year history of a painless , elastic soft mass in the right arm gradually increasing in size , measuring 5 cm 4.5 cm 2.5 cm . there were no systemic symptoms , draining axillary lymph nodes were not enlarged and no other organomegaly . smears were highly cellular and showed polymorphous cell population with predominance of small lymphocytes and few tingible - body macrophages [ figure 1 ] . the cytological picture was that of reactive hyperplasia with additional findings of capillaries amongst germinal center cells . a diagnosis of reactive hyperplasia with a strong indication of cd was made [ figure 2 ] . smears showing polymorphous cell population with predominance of small lymphocytes ( mgg , 400 ) smears showing fragments of capillaries along with lymphoid population ( h and e , 100 ) grossly , the excised tumor was grey tan with a homogenous cut surface . microscopically , the sections showed diffuse lymphoid cell population chiefly of small to medium cells along with many small blood vessels . smears were highly cellular and showed polymorphous cell population with predominance of small lymphocytes and few tingible - body macrophages [ figure 1 ] . the cytological picture was that of reactive hyperplasia with additional findings of capillaries amongst germinal center cells . a diagnosis of reactive hyperplasia with a strong indication of cd was made [ figure 2 ] . smears showing polymorphous cell population with predominance of small lymphocytes ( mgg , 400 ) smears showing fragments of capillaries along with lymphoid population ( h and e , 100 ) microscopically , the sections showed diffuse lymphoid cell population chiefly of small to medium cells along with many small blood vessels . cd was first described by castleman et al . as a localized mediastinal lymph node hyperplasia resembling a thymoma . angiomatous lymphoid hamartoma , angiofollicular hyperplasia , and giant lymph node hyperplasia . the most common site of involvement is lymph node - bearing tissue with a predilection for the mediastinum ( 70% ) , but also occurring in the neck , axilla , pelvis and retroperitoeum . however , a few extranodal cases have been reported in the literature , comprising nine intramuscular cases . whether previously described intramuscular cases developed actually from skeletal muscle or from ectopic lymphatic tissue remains to be discussed . in the present case , the establishment of the correct pre - operative diagnosis of cd by cytological examination is challenging due to the rarity of this entity , especially when the tumor arises in the extremities . cd is currently classified into three variants : the unicentric hyaline vascular type is the most frequent , accounting for 72% of all cases , followed by the unicentric plasma cell ( 18% ) , and multicentric type ( 10% ) . the hyaline vascular type is the more common form of cd . the fine needle aspiration cytology ( fnac ) findings are those of follicular hyperplasia with mixed cells including lymphocytes , eosinophils , and immunoblasts as well as hyalinized capillaries . follicles resembling hassal 's corpuscles containing central hyalinized capillaries are reminiscent of lollipops . occasionally , reed sternberg - like cells may be seen . in the plasma cell type , follicular hyperplasia , the possible pitfalls of this disease on cytology are missing the hyalinized capillaries with eosinophilic material in reactive hyperplasias and misdiagnosing single large cells and reed sternberg - like cells as hodgkin 's lymphoma . the differential diagnosis mostly includes all reactive hyperplasias of lymph nodes and occasionally hodgkin 's lymphoma . hyaline - vascular cd is difficult to diagnose on fnac and may be mistaken to be a lymphoreticular malignancy because of the presence of large cells having nuclei showing atypical features . mantle cell lymphomas usually show a mantle zone growth pattern with a remnant of small atrophic germinal centers and nodular growth pattern without germinal centers . the cytomorphological findings in three histopathologically documented cases of hyaline - vascular cd were evaluated by deschnes et al . to a set of cytomorphological criteria that could help in the identification of this condition on aspirate smears . after review , the following cytomorphological criteria were suggested to be indicators of the lesion : ( i ) the presence of large oval to round cells having ill - defined cytoplasmic margins and large nuclei with irregular nuclear outlines having fine or coarse chromatin , giving a crumpled tissue paper appearance ; ( ii ) a polymorphous population of lymphoid cells predominantly of small lymphocytes in the background . the authors concluded that although hyaline - vascular cd is a difficult diagnostic entity on aspirate material , the presence of large histiocytic cells with a crumpled tissue paper appearance of the nuclei in a background of small lymphocytes is a useful indicator for suspecting this lesion . however , these findings should be analyzed in larger studies to determine if they could in anyway reduce the diagnostic dilemma in cases of cd . reported that the fnacs in three cases showed branching capillaries associated with fragments of germinal center . a review of literature by them yielded 12 other case reports with over half describing similar findings . because branching hyalinized small blood vessels penetrating follicular germinal center are characteristic of cd of the hyaline vascular type on histology , this finding in fine needle aspirates should raise that diagnostic possibility . our case also had these cytological findings which helped us indicate a pre - operative diagnosis thereby guiding the clinician in management of the patient . although infrequent , it is important to bear the differential diagnosis of cd in mind when evaluating a sharply demarcated , hypervascularized lymphatic hyperplasia located in the extremities . though different authors have described many cytological findings , cd still remains a cytological dilemma .

castleman 's disease ( cd ) , a rare benign disease is characterized by lymphoid hyperplasia of uncertain etiology that may present as a nodal or extranodal mass . we describe herein a rare case of cd occurring in the soft - tissue of right arm in a 55-year - old woman . the present case is instructive in the differential diagnosis of primary soft - tissue tumors , for which the possibility of cd should be considered . on clinical examination as well as gross examination , this disease mimics lymphomas and tuberculosis . since cytological appearances vary depending on the type and extent of hyperplasia , fine needle aspiration cytology findings may not always be conclusive in all cases . we studied aspirates which revealed reactive hyperplasia with increased vascularity . excision confirmed the diagnosis .

symptomatic irreversible pulpitis is a pulpal state characterized by mild / severe pain that lingers after removal of a stimulus . in such cases , pulpectomy / extraction is required to alleviate the symptoms and prevent apical periodontitis . however , as the severity of pulpal inflammation can not be measured quantitatively , it must be based on clinical findings rather than histological diagnosis ; moreover , there is poor correlation between the two . in addition , pulps of teeth clinically diagnosed with irreversible pulpitis were shown to have the potential to heal after pulpotomy with appropriate biomaterials such as mineral trioxide aggregate ( mta ) and calcium enriched mixture ( cem ) cement.[37 ] a systematic review revealed that to reduce the risk of carious pulp exposure , partial caries removal ( indirect pulp therapy [ ipt ] ) can result in long - term success compared with complete caries removal in the deep lesion . a clinical trial demonstrated high survival rate of permanent teeth when deep carious lesions were managed without exposing the pulp by placing an indirect pulp cap . these results demonstrated that the teeth pulps remained symptomless and maintained their healing potential and defensive capacity after treatment . elimination of the bulk of the infected dentin and sealing the remaining carious lesion from oral fluids with appropriate materials is an accepted treatment for badly decayed teeth . in addition , performance of ipt is simpler / more economical than rct . cem cement has been introduced as a water - based and tooth - colored endodontic biomaterial . after mixing with liquid , the ph of cem increases to > 10 . it is assumed that in a high ph environment the calcium ions that are released from cem react with endogenous phosphates to form hydroxyapatite ; this would explain the favorable sealing ability / biocompatibility of the cement . an in vitro study revealed that the anti - bacterial properties of cem are similar to calcium hydroxide . cem has been employed as a root - end filling material , as well as direct pulp capping agent , pulpotomy agent , apical plug , in the repair of furcal perforations , management of root resorption , and regenerative endodontics . recently , an interesting report demonstrated favorable treatment outcomes of direct pulp capping with cem for management of a permanent mature molar with irreversible pulpitis and associated apical periodontitis . the following report discusses the first case of successful management of a symptomatic permanent tooth with irreversible pulpitis and associated apical periodontitis using ipt with cem , followed by a sandwich glass - ionomer composite restoration . a 12-year - old female with a symptomatic first left lower molar was observed at a private clinic . diagnostic tests were performed ; the involved tooth responded with mild pain to percussion and severe lingering pain to endo - frost cold spray ( roeko ; coltene whaledent , langenau , germany ) . radiographic examination showed a large carious lesion associated with apical periodontitis [ figure 1 ] . the adjacent / opposing teeth were asymptomatic and responded normally to all diagnostic tests . based on the clinical and radiographic examinations , the diagnosis of irreversible pulpitis with apical periodontitis was made . thereafter , ipt of the tooth was decided ; an informed consent was obtained from the patient 's legal guardian . intraoral pre - operative radiograph showing well - defined radiolucency of mesial and distal roots of symptomatic first lower left molar the patient was instructed to rinse her mouth with 0.2% chlorhexidine . the tooth was anesthetized with 2% lidocaine with 1:80,000 epinephrine ( daroupakhsh , tehran , iran ) and then isolated with rubber dam . the bulk of soft carious dentin was carefully removed by tungsten - carbide round burs ( komet , lemgo , germany ) at low speed ; medium and large spoon excavators ( ash , london , uk ) were also used . after that , the remaining carious dentin in pulpal floor was covered by 1.5 mm layer of cem cement ( bioniquedent , tehran , iran ) . the remaining tooth cavity was then restored / sealed with glass - ionomer cement and composite resin sandwich technique [ figure 2 ] . post - operative orthopantomogram ( opg ) showing threelayers ofrestorationconsistofindirectpulptherapy / calcium enriched mixture , glass ionomer and composite resin . left : higher magnification of treated first lower left molar revealing well defined periapical radiolucency of both roots the patient was re - examined clinically after 1 and 7 days . at the 1-day follow - up the patient complained of sensitivity to cold which had significantly decreased 1 week post - operatively . patient was recalled at 1 year for clinical / radiographic follow - up . clinical examination with cold test showed a vital tooth which was functional , asymptomatic , with normal physiologic mobility , normal probing depths , and a satisfactory coronal restoration . radiographic examinations showed normal periodontium , and evidence of periapical healing [ figures 3 and 4 ] . six - month follow - up radiograph showing healing process of apical pathology one - year follow - up radiograph showing complete periapical healing this study conducted ipt with cem cement for a pulp with sign / symptoms of irreversible pulpits along with apical periodontitis . though , apical periodontitis seemed evident on the radiograph , the pulp was still vital . the general consensus in cases where irreversibly inflamed pulp has been diagnosed , is that the pulp no longer has the potential to heal and will not survive with any form of treatment . however , it should be considered that irreversible pulpitis is a clinical term for the classification of pulpal diseases ; when treating the deep carious lesion clinicians have to diagnose irreversible pulpitis on the basis of indirect diagnostic methods . there is little evidence to correlate the clinical signs / symptoms with histological feature of the diseased pulp . therefore , dentists are trained to diagnose irreversible pulpitis when patient complains of pain lasting for a few minutes to several hours , pain exacerbating with hot / cold fluids , and radiating pain ; as well as tender to percussion . however , there is no information to indicate which symptom is an indication that the pulp no longer can repair itself . conversely , recent reports have demonstrated that teeth with irreversible pulpitis showed favorable treatment outcomes with pulpotomy using cem / mta as pulp cappings.[357 ] though the diseased pulps in these cases were inflamed , they were still vital ; that is they still maintained a blood supply and therefore the most important factor for healing . in the light of recent high - level evidences , the inflammatory process should be re - examined to recognize its possible or probable positive effect on pulpal healing . our clinical / radiographic follow - ups also showed favorable treatment outcomes for ipt / cem . these results reveal that severe local inflammation in pulpal tissue may heal and be repaired if the irritant is removed and the pulp is well protected from further irritants . if further studies support this , there may be a need for reclassification of dental pulp diseases . a growing body of evidence has demonstrated that ipt is successful for the management of deep caries lesion in primary molars as well as two - stage technique in immature permanent teeth ; however , some recent studies have shown similar results in mature permanent teeth . ipt reduces the risk of carious pulp exposure , diminishes the substrate for microorganisms , prevents lesion development and promotes a physiological reaction in the pulp - dentin complex . several studies have demonstrated that once cariogenic bacteria are isolated from their nutritional supply by an adequate coronal seal , they either perish or become inactive . furthermore , once a seal is applied to carious dentin , it becomes dry / hard , arresting the carious process after ipt with a one - visit method . accordingly , the second appointment may not be needed , if the coronal restoration preserves the seal of cavity . our 1-year clinical follow - up showed that the one - visit ipt coronal filling was satisfactory , and therefore a second appointment was not scheduled . several dental materials have been suggested for capping the remaining carious lesion in ipt , that is calcium hydroxide , polycarboxylate cement combined with tannin - fluoride preparation , zinc - oxide eugenol cements , resin - bonded composite , glass ionomer cements and copper phosphate cement . the ideal capping material should be anti - bacterial , non - toxic , dimensionally stable , biocompatible , and create a hermetic seal as well as be able to induce regeneration of the pulp . considerable data has shown favorable properties of cem cement namely ; anti - bacterial properties , sealing ability , dimensional stability and biocompatibility when compared with other gold standard materials such as calcium hydroxide or mta . the favorable results in this case study may be partly attributed to the patient 's age . a young patient 's tooth may have slightly open apices and the dental pulp may respond more positively to pulp capping than a mature pulp . based on our clinical and radiographic observations , we can conclude that despite apparent pulpal and periradicular inflammation from the deep caries lesion , a conservative ipt can generate pulpal repair and periradicular healing in a mature permanent molar tooth . in addition , ipt / cem of deep caries lesion in young patients is an easier , more practical and valuable treatment plan than complete caries removal which may result in pulp exposure and root canal treatment . however , well - conducted clinical trials on this proposed technique will be required for more grounding clinical evidence .

dental pulp has the ability of repair / regeneration . indirect pulp therapy ( ipt ) is recommended for pulp preservation in asymptomatic teeth with extremely deep caries as well as teeth with clinical symptoms of reversible pulpitis . in this case study , we performed ipt with calcium enriched mixture ( cem ) cement on a symptomatic permanent molar . after clinical / radiographic examinations the tooth was diagnosed with irreversible pulpitis and associated apical periodontitis . ipt involved partial caries removal , the placement of cem cement pulp cap and overlying adhesive permanent restoration . at the 1 week follow - up , patient 's spontaneous symptoms had resolved . one - year follow - up demonstrated pulp vitality , clinical function , as well as the absence of pain / tenderness to percussion / palpation / cold sensitivity tests ; periapical radiograph showed a healing periradicular lesion with newly formed bone , that is normal pulp with normal periodontium . these favorable results indicate that ipt / cem may be a good treatment option in comparison to endodontic treatment in young patients . ipt of deep - caries lesion is an easier , more practical and valuable treatment plan than complete caries removal .

the chapel hill consensus conference classification system classifies vasculitis according to vessel size and characteristic clinical and histopathological features . anti - neutrophil cytoplasmic antibodies ( anca ) have been used to further characterize the small - vessel vasculitides . large - vessel vasculitis comprises fewer clinical syndromes than medium- or small - vessel vasculitides , most commonly giant cell arteritis and takayasu s arteritis . large vessel involvement in anca - associated vasculitis is uncommon and , when present , often portends a poor prognosis , with outcomes involving aortic dissection , rupture and , possibly , stenosing arteritis . we describe a case of asymptomatic large vessel involvement in a biopsy - proven canca - associated small - vessel vasculitis . a 64-year - old greek man , previously well , presented with a 4-week history of fever , malaise , dysuria and haematuria . a trial of antibiotics ( roxithromycin and cephalexin ) from his local doctor had not improved his symptoms . at presentation relevant physical findings included crackles at the left lower lung field and minimal oedema in the lower extremities . initial laboratory investigations demonstrated a serum creatinine of 92 mol / l , with elevated inflammatory markers ( c - reactive protein 29 mg / l ; erythrocyte sedimentation rate 93 mm / h ) . initial urine microscopy revealed heavy isomorphic haematuria without cellular casts and an escherichia coli infection on culture . after treatment of the infection , urine microscopy demonstrated > 1000 10/l dysmorphic red cells and 24-h urine collection revealed significant proteinuria ( 1.05 g / day ) , with a creatinine clearance of 33 ml / min . a blurred outline of the abdominal aorta was revealed on computerized tomography ( ct ) scan , and subsequent ct aortogram revealed near circumferential soft tissue oedema of both the thoracic arch and inferior to the origin of the renal arteries . ( b ) ct scan of abdominal aorta at 2 months ( inflammation indicated by arrowheads ) . renal biopsy confirmed the presence of a pauci - immune , necrotizing crescentic glomerulonephritis with fibrocellular crescents present in 40% of the glomeruli . a positive anca titre was subsequently detected with granular cytoplasmic staining showing specificity for proteinase-3 ( 55 u / ml ) . oral cyclophosphamide ( 1.5 mg / kg / day ) and intravenous methylprednisolone ( 500 mg / day ) were commenced ; however , within a week , the patient developed diffuse alveolar haemorrhage . he required a total of six plasma exchanges > 10 days . despite treatment , the serum creatinine continued to rise ( peaking at 650 the patient was discharged on cyclophosphamide ( 1.5 mg / kg / day ) and prednisolone ( 60 mg / day ) . two months after discharge , investigations revealed a serum creatinine of 167 mol / l ( canca 30 u / ml ) , figure 2 . clinical remission was evident after 3 months treatment with cyclophosphamide , and methotrexate was commenced after the patient proved intolerant to azathioprine . twenty months later , the patient has remained well with a serum creatinine of 115 mol / l , with negligible haematuria ( 5 10/l erythrocytes on urine microscopy ) and proteinuria ( protein : creatinine ratio 0.010 g / mmol ) . there is no evidence of aortic vasculitis on ct scan , although the mid - thoracic and abdominal aorta remain mildly tortuous and ectatic . rbc , red blood cells ; hpf , high power field ; pcr , protein : creatinine ratio ; esr , erythrocyte sedimentation rate ; crp , c - reactive protein . anca - associated large - vessel vasculitis ( alv ) has rarely been reported in european and north american populations . it is possible that common pathological processes are involved in both large- and small - vessel vasculitis . intimal injury may be the initial insult , progressing to inflammation of the medial layer and then adventitia , with resulting transmural aortitis . alternatively , the large vessel wall changes seen on imaging may be a result of vasculitis of the vasa vasorum of the aortic wall [ 35 ] . the presentation of anca - associated large - vessel vasculitis is diverse but appears intrinsically different from the stenosing lesions of takayasu s vasculitis [ 69 ] . case reports of wegener s granulomatosis with large vessel involvement also include periaortitis , with resultant aortic aneurysm and dissection [ 2 , 10 ] . given the infrequent number of reports , there is no consensus on the management of patients with alv . however , apart from surgical intervention for dissection or rupture , the finding of large vessel involvement does not appear to require additional treatment . most patients have been managed with an extended period of immunosuppression using corticosteroids and cyclophosphamide , following similar regimens for small vessel disease . our patient underwent a follow - up ct aortogram 2 and 20 months after diagnosis . for patients with significant renal impairment , contrast ct scans may risk contrast - induced nephropathy , and alternative options include magnetic resonance imaging or positron emission tomography scanning . while anca - associated disease is often considered to be limited to small vessels , this case highlights that large vessels can also be affected . its true frequency is unknown as involvement appears to be asymptomatic ; however , though not seen in our patient , it can be associated with a poor outcome due to vessel rupture or dissection . this case illustrates the need for awareness of potential large vessel involvement in anca - associated small vessel disease .

anti - neutrophil cytoplasmic antibody ( anca)-associated vasculitis is traditionally viewed as a small vessel disease . we report a patient with canca antibodies directed against proteinase-3 with asymptomatic aortic involvement , in combination with diffuse alveolar haemorrhage and pauci - immune , necrotizing crescentic glomerulonephritis . a review of the literature is discussed .

in this issue of critical care , seely and macklem present a clear and concise overview of several methodologies used to characterize variability . why is this report important ? first , not only does it provide an opportunity to appreciate the principles of the analytical techniques , but it also gives clues for interpreting the results . those who are unfamiliar with this field of investigation , as well as those who participated in the early time domain and spectral analysis studies but who were somewhat overwhelmed by the complexity of the more recent and elaborate multifractal and entropy analyses , will appreciate this broad overview . this is an important aspect of the overview because such information is scarce in the medical literature . most people would be more interested in the height of the coastal waves that challenge their homes in bad weather than in the average sea level . however , as with many other elaborate research techniques , the practitioner may question the clinical relevance of cardiovascular variability , and why should he or she care about it ? the clinical relevance may be even more questionable when one takes into consideration that all of these techniques do require some time and effort . no direct , online , fully automated and sophisticated variability parameters are yet available for application in the critically ill . artifacts , ectopy , or more sustained arrhythmias will markedly affect calculations and must be carefully detected and corrected for . many of these events are unpredictable , whereas others , such as those induced by various nursing procedures , physiotherapy and catheter flushing , must be postponed during data acquisition if at all possible . this is somewhat less important for the time domain methods , but it is frequently a key element for the more elaborate variability assessment techniques . in some conditions , obtaining stable and artifact - free recordings devoid of large numbers of ectopic beats is a challenge in itself . one important reason is that variability science can be used in prognostic assessment for critically ill patients . there is abundant evidence that variability portends prognosis , longer length of stay in the intensive care unit ( icu ) and arrhythmias , as well as subsequent illness severity and organ failure . heart rate variability is maximal when there is full interplay between vagal and sympathetic drive to the sinus node . in severe heart failure even low - frequency variability in heart rate a parameter that traditionally was considered a marker of sympathetic activity in conditions of less marked sympathoexcitation disappears in patients with severe heart failure . this does not render this parameter clinically irrelevant because the disappearance of low - frequency oscillations in heart rate has important negative prognostic implications . thus , the predictive value of altered heart rate oscillations remains valid , even if they are unlikely to provide a reliable surrogate of cardiac sympathetic tone . changes in heart rate variability are not specific for cardiac failure and are observed in a wide range of common diseases in the icu ; patients who recovered with good outcome after neurosurgery also had greater low - frequency oscillations in their heart rate than those who did not . for example , organ dysfunction and - adrenergic downregulation , but also adrenergic agents , decrease heart rate variability , whereas invasive ventilation enhances respiratory oscillations . thus , variability studies may not allow one to disentangle the precise physiological mechanisms that are involved in heart rate variability alterations in the icu . in such conditions , one could even wonder how heart rate variability parameters can provide estimates of prognosis . the explanation may reside in the fact that heart rate variability represents a summary of the impact of several diseases and therapeutic interventions into single prognostic parameters . another interesting field of research that employs techniques very close to those presented by seely and macklem is analysis of the interactions between different parameters in the critically ill . under normal conditions this homeostatic mechanism becomes ineffective in several conditions , which carries independent negative prognostic information . many more interactions between systems and organs are still largely unexplored , and their study in the icu would be worthwhile . for example , heart rate fluctuations are closely related to those in electroencephalographic activity during normal sleep . however , very little is known regarding how heart rate variability relates to electroencephalographic activity in the icu patient , and whether this has any prognostic implications . further large - scale , multicentre studies are needed to delineate the prognostic significance of variability in icu patients . we may end up with a useful and widely accepted prognostic tool for the clinician .

the article by seely et al . in this issue of critical care highlights that variability portend prognosis . numerous parameters interact to modify variability in intensive care . the commentary discusses why variability can nevertheless accurately estimate prognosis and how easily this can be implemented in the critically ill .

stroke , one of three main causes of death in south korea , is a general term for cerebrovascular diseases and accidents that can lead to sudden changes in consciousness and paralysis . generally , stroke is characterized by disorders of sensory , motor , perceptive , cognitive , and language functions , as well as mobility disorders on the side of the body opposite to the stroke region1 . in particular , muscular weakness and spasticity of the upper extremities , imbalance , hypertonia , and dysesthesia can cause a loss of motor control in the upper extremities2 . the upper extremities , including the hands , are used for most activities in the workplace ; they are a means of communication and play a critical role in many cognitive activities and motor function3 . upper extremity function is closely related to the performance of activities of daily living ( adls ) , as well as social participation . therefore , by reducing upper extremity damage , it is possible to facilitate independent adls in stroke patients4 . previous studies have examined the factors that influence upper extremity function after stroke . in a study of 100 stroke patients , myotonia , proprioceptive sense , and neglect it was reported that 1617% of stroke patients had shoulder pain , more than 80% of whom had a disorder or absence of voluntary movement of the upper extremities6 . in addition , age , eyesight , perception , understanding , cognition , depression , and motivation all have an effect on functional recovery7 . many studies have been conducted on individual factors related to upper extremity function after stroke . however , there is a lack of research on how hand strength , a critical factor of recovery in stroke patients , directly influences upper extremity function and adls . in particular , there are almost no reports on hand strength in patients with right hemiplegia , which directly influences adls and determines the quality of their performance . for the most part , patients with left hemiplegia and an unaffected dominant right hand can perform self - care after stroke . however , dominant hand damage in patients with right hemiplegia directly influences their adls . therefore , by investigating the effects of hand strength on upper extremity function and adls in patients with right hemiplegia , this study aims to provide fundamental data that can be used for rehabilitation after stroke . this study was conducted from may 1 to december 30 , 2013 , and included 62 patients who received a diagnosis of stroke at the department of rehabilitation of p hospital in seoul and had been hospitalized . the research used surveys and assessment report measurements . all details of study procedures were submitted to the science research council of inje university , which approved the protocol . patients with right hemiplegia were selected , and hand strength , upper extremity function , and adls were evaluated . the subjects voluntarily agreed to participate in the study after obtaining information on the study s purpose and methods . hand strength was measured by grip , lateral pinch , and three - point pinch strength . grip strength was measured by gradations on a dynamometer , which study subjects were asked to grip as firmly as possible . sequential measurements were carried out 3 times , and the average value was calculated . lateral pinch strength was measured by pinching the thumb and forefinger together laterally as if gripping a key . three - point pinch strength was measured by pressing the middle finger and forefinger down onto the thumb8 . upper extremity function was evaluated using the manual function test ( mft ) , which is used to measure upper extremity function and mobility in stroke patients . the test consists of items involving motor function of the upper extremities ( 4 items ) , gripping ( 2 items ) , and finger gestures ( 2 items ) . adls were evaluated using the korean version of the modified barthel index ( k - mbi ) which comprises 7 self - care activities and 3 mobility activities . each area is scored on a 5-points scale , and the maximum score is 100 points10 . analysis of correlations between the 3 variables of hand strength , upper extremity function , and adls was conducted using pearson s correlation coefficient . the general characteristics of the study subjects are summarized in table 1table 1.general characteristics of the survey participants ( n=62)male ( n=39)female ( n=23)age ( years)59.5 12.468.5 14.5values are means sd .. of the 62 subjects , 39 were male ( average age , 59.3 years ) and 23 were female ( average age , 68.5 years ) . correlation analysis was conducted for hand strength , upper extremity function , and adls , and the results are shown in tables 2table 2.subjective grip and pinch strengths ( n=62)male ( n=39)female ( n=23)grip strength ( kg)6.9 7.48.1 6.3lateral pinch strength ( kg)2.1 2.12.5 1.8three - point pinch strength ( kg)1.7 2.12.0 1.3values are means sd . and 3table 3.correlation between upper extremity function , adls , and grip and pinch strengths ( n=62)mftk - mbigrip strengthlateral pinch strengththree - point pinch strengthmft10.3 * 0.7**0.7**0.6**k - mbi10.3 * 0.10.1grip strength10.9**0.8**lateral pinch strength10.9**three - point pinch strength1*significant difference ( p<0.05 ) . mft : manual function test ( upper extremity function ) ; mbi : modified barthel index ( adls ) . there was a correlation between upper extremity function and grip strength , lateral pinch strength , and three point pinch strength . mft : manual function test ( upper extremity function ) ; mbi : modified barthel index ( adls ) stroke patients have difficulty recovering complete upper extremity function and therefore have limitations in adls and social participation . for this reason , it is important to identify the factors that influence upper extremity function and adl performance and to apply the identified factors to rehabilitation . therefore , this study tried to determine how hand strength , a critical factor in recovery , directly influences upper extremity function and adls in stroke patients . this study showed that grip strengths of both the entire palm and fingers , including lateral pinch strength and three - point pinch strength , significantly influence upper extremity function . reported that hand strength improves in proportion to the complicated motor task ability of the upper extremities and suggested that hand strength is a critical indicator of functional recovery in stroke . grip strength significantly influenced adls , but lateral pinch and three - point pinch strength did not . previous studies reported that hand strength significantly influences instrumental activities of daily living ( iadls ) . some studies have shown that programs to increase hand function improved hand strength and certain areas of iadl function , and that a high level of hand strength positively influenced independence in iadls13 , 14 . in the case of iadls that require detailed hand movement , successful function can differ depending on whether the muscular strength of the fingers has recovered . however , this study revealed that grip strength directly influenced adls but that pinch strength did not . the above results indicate that in the case of basic adls , the overall recovery of body or upper extremity movement has more influence than muscular strength in the fingers . thus , the treatment with greater effect in the rehabilitation of stroke patients is to first increase the body conditions necessary for basic adls and then improve finger movement , grip strength , and pinch strength for iadl training requiring detailed hand movement . a limitation of this study is the generalizability of its results , because the subjects were limited to a portion of stroke patients in seoul . therefore , further research requires participation of more sites to reflect the outcomes for a larger number of subjects , enabling use of the data for therapy of stoke patients .

[ purpose ] the purpose of this study was to investigate the effects of hand strength on upper extremity function and activities of daily living in patients with right hemiplegia , as well as to provide important fundamental data for rehabilitation after stroke . [ subjects and methods ] this study was conducted from may 1 to december 30 , 2013 , at the department of rehabilitation of p hospital in seoul and included subjects hospitalized with a diagnosis of stroke . patients with right hemiplegia were selected , and their hand strength , upper extremity function , and activities of daily living were evaluated . hand strength was measured by grip , lateral pinch , and three - point pinch strength . [ results ] the effects of hand strength on upper extremity function were evaluated . the results showed that all types of hand strength significantly influenced upper extremity function . however , only grip strength influenced activities of daily living . [ conclusion ] in rehabilitation of stroke patients , it is necessary to first improve their general physical condition and basic activities of daily living , and then improve hand movement and hand muscle strength for instrumental activities of daily living training , which requires detailed hand movements .

caspase-2 is one of the closest mammalian homologues of the caenorhabditis elegans caspase ced-3 and shares significant homology with the drosophila nedd2-like caspase ( dronc ) , both of which are essential for developmentally programmed cell death [ 1 - 4 ] . although several studies have implicated caspase-2 as a crucial mediator of apoptosis in mammalian cells , its apoptotic function has remained enigmatic , partly due to the fact that casp2 mice are viable and fertile with only minor apoptotic defects in some cell types [ 2,5 - 7 ] . furthermore , lymphocytes and fibroblasts from mice lacking both initiator caspases , casp9 and casp2 , are no more resistant to apoptosis than cells from casp9 mice . together , these findings indicate that the role of caspase-2 in developmental cell death is redundant and can be compensated by other caspases . however , this does not rule out context - dependent and cell - specific caspase-2 functions . for example , one study found an accumulation of oocytes in casp2 mice ( although this was not reported in a second casp2 strain ) and casp2 mice display premature ageing - related traits . the activation of caspase-2 has been shown to occur both upstream ( by the piddosome ) and downstream ( by caspase-3 or -7 ) of mitochondrial outer membrane permeabilisation ( momp ) . although this is also controversial since raidd ( receptor - interacting protein - associated ich-1/ced-3 homologous protein with a death domain ) and pidd ( p53-inducible protein with a death domain ) , the protein components of the piddosome , are dispensable for caspase-2 activation . interestingly , caspase-2 activation can be mediated by caspase-8-induced cleavage following recruitment to the death receptor - inducing signaling complex ( disc ) . however , the importance of the disc as an activation platform is also unclear since caspase-2 dimerisation and self - processing are sufficient for its activation . in addition , cells from casp2 mice are normally sensitive to death receptor - induced apoptosis , indicating that caspase-8-mediated cleavage of caspase-2 is not critical for its activation . while there is limited information on physiologically relevant substrates , caspase-2 can cleave and activate the protein bid , which provides a significant link between caspase-2 and momp . furthermore , a unique feature of caspase-2 is its ability to localise to the nucleus in an importin - mediated fashion [ 18 - 20 ] . this nuclear localisation of caspase-2 is likely associated with the recently found functions for caspase-2 in cell cycle regulation and cellular dna damage response . in the absence of an overt phenotype in knockout mice , one may speculate that caspase-2 functions under specific contexts , such as under conditions of stress or in the fine - tuning of stress signaling , resulting in relatively minor aberrations in the whole animal physiology . several recent studies showing caspase-2 functions in cell cycle regulation , dna damage response , and tumor suppression seem to be consistent with these predictions . a role for caspase-2 in cell cycle regulation became apparent from observations that casp2-deficient murine embryonic fibroblasts ( mefs ) proliferate faster than their wild - type counterparts and that transformation of casp2 mefs with e1a / ras exacerbated this proliferative effect . another recent study found that caspase-2 is involved in maintaining a g2/m cell cycle checkpoint in response to ionising radiation ( ir)-induced dna damage , with cells lacking casp2 unable to completely arrest in g2/m . in addition , caspase-2 activation has been shown to be inhibited by cyclin - dependent kinase 1 ( cdk1)/cyclin - b1-mediated phosphorylation at ser340 during mitosis to allow for the repair of replication - induced dna damage . during mitotic arrest , prolonged activation of spindle assembly checkpoint results in apoptosis by mitotic slippage and prematurely exit mitosis with chromosomal abnormalities , resulting in genomically unstable aneuploid cells . in support of this , casp2 mefs show resistance to cell death induced by microtubule - disrupting drugs and also display increased genomic instability in culture compared with wild - type cells . these findings indicate that deregulation of g2/m checkpoint in casp2 cells may contribute to the accumulation of cells with damaged dna . the study by shi and colleagues found that caspase-2 is involved in dna damage repair through its interaction with a nuclear complex comprising pidd and dna - dependent protein kinase catalytic subunit ( dna - pkc ) . following ir - induced dna damage , this dna - pkc piddosome complex phosphorylates caspase-2 at ser122 , leading to its activation . activated caspase-2 is then required for the repair of double - strand dna breaks by non - homologous end - joining ( nhej ) with cells lacking casp2 unable to efficiently repair dna breaks . although it is unclear how caspase-2 mediates nhej , these important observations establish an additional non - apoptotic nuclear role for caspase-2 in dna damage signaling ( figure 1 ) . following double - strand dna breaks ( dsbs ) , the ataxia telangiectasia mutated ( atm ) and atm - related ( atr ) kinases are activated and in turn phosphorylate and activate several target proteins , including checkpoint kinase 1 ( chk1 ) and chk2 . atr also activates chk1 , which can then act in a feedback loop to negatively regulate atr and inhibit further activation of nuclear caspase-2 . dna - dependent protein kinase ( dna - pk ) is also activated by dsbs , presumably by atm / atr , and forms a complex with p53-inducible protein with a death domain ( pidd ) and caspase-2 ( dna - pk piddosome ) . this complex serves to phosphorylate and activate caspase-2 , which is then required for the initiation of non - homologous end - joining ( nhej ) and dna repair . cytosolic caspase-2 is also activated by other stress signals such as reactive oxygen species ( ros ) , metabolic stress , cytotoxic drugs , heat shock , or endoplasmic reticulum ( er ) stress . following heat shock , raidd ( receptor - interacting protein - associated ich-1/ced-3 homologous protein with a death domain ) can activate caspase-2 , which is inhibited by hsp90. ca / calmodulin - dependent kinase ii ( camkii ) acts to inhibit caspase-2 activation and cell death in oocytes . activated cytosolic caspase-2 is able to cleave bid to its truncated form ( tbid ) , which ( via bax / bak ) can induce mitochondrial outer membrane permeability ( momp ) , activation of caspase-9 and -3 , and cell death . sidi and colleagues have described an unexpected nuclear function of caspase-2 in an apparently novel pathway of apoptosis in p53-deficient cells . using zebrafish as a model system , it was found that inhibition or loss of checkpoint kinase 1 ( chk1 ) restores -radiation - induced apoptosis in p53 mutant fish embryos . a similar ataxia telangiectasia mutated ( atm)/atm - related ( atr)/caspase-2-dependent pathway seems to be present in chk1-inhibited p53-deficient human tumor cells and in mefs following -irradiation . these findings implicate caspase-2 in an apoptosis pathway downstream of atm / atr in response to dna damage , which is independent of p53 ( figure 1 ) . since atm / atr can induce phosphorylation and activation of dna - pkc , it would be of interest to investigate whether the regulation of caspase-2 phosphorylation in the nucleus finely tunes its function in either apoptosis or dna damage repair following ir exposure . the role of caspase-2 in specific cell death pathways other than dna damage is also emerging . in oocytes , the apoptotic activity of caspase-2 has been shown to be inhibited by ca / calmodulin - dependent kinase ii ( camkii)-mediated phosphorylation at ser135 . the binding of 14 - 3 - 3 to phosphorylated caspase-2 prevents ser135 dephosphorylation , thereby promoting oocyte survival . however , under nutrient - depleted conditions , the dephosphorylation at this site leads to caspase-2 activation and oocyte cell death . these findings suggest that caspase-2 is an important player in metabolic regulation of oocyte cell death and that ser135 dephosphorylation is a sensor for caspase-2 activation . caspase-2 has also been implicated in cell death induced by heat shock . a recent study assessed the real - time recruitment of caspase-2 to activation platforms during stress - induced apoptosis , including heat shock , cytoskeletal disruption or dna damage , and found that caspase-2 activation occurred in the cytosol , not the nucleus . furthermore , heat shock - induced activation of caspase-2 occurred upstream of momp and was raidd - dependent and negatively regulated by hsp90 . the caspase-2 functions in oxidative stress - induced apoptosis and ageing are also coming to light . caspase-2 , along with bid and bak , were reported to be mediators of superoxide - induced cell death in muscle and in primary neurons . in addition , caspase-2 has been shown to be involved in an age - related increase in muscle cell apoptosis in mice . consistent with these findings , zhang and colleagues found that casp2 mice show significantly higher levels of oxidised proteins in liver than wild - type mice . this indicates that lack of casp2 can antagonise apoptosis induced by reactive oxygen species , leading to accumulation of cells with oxidative damage and consequently enhanced ageing phenotypes . the reduced nhej activity in casp2 cells may also contribute to the premature ageing phenotype observed in casp2 mice . our own studies using the e-myc transgenic mouse model of b - cell lymphoma found a potential role for caspase-2 in lymphoma suppression . specifically , the loss of even a single copy of casp2 resulted in increased tumor susceptibility and markedly accelerated tumor formation in e-myc transgenic mice . these studies suggest that caspase-2 can suppress myc - induced lymphomagenesis . while the precise mechanism of caspase-2-induced tumor suppression remains unclear , it is tempting to speculate that its roles in cell cycle checkpoint , dna damage repair , and removal of oxidative damaged cells are important for this function . while the recent observations have shed light on possible physiological functions of caspase-2 , it remains entirely speculative how caspase-2 might carry out some of the apparently unrelated functions in apoptotic and non - apoptotic contexts . it is becoming clear that caspase-2 may act as a sensor to protect against cellular stress and that regulation of caspase-2 by phosphorylation or nuclear translocation or both may determine its role in cell death , the cell cycle , or nhej . it will be important to establish whether these functions also contribute to the tumor suppressor mechanism of caspase-2 . the major deficiency in caspase-2 research is that the targets of caspase-2 , which may mediate its various functions , remain largely unknown . while it remains a technical challenge to find proteins that are specifically cleaved by caspase-2 in specific contexts , identification of these substrates will be the key to unraveling the functional versatility of caspase-2

caspase-2 is the most evolutionarily conserved of caspase family members , yet its physiological function has remained unclear and is a matter of considerable debate . newly published data now suggest that caspase-2 is required for cell cycle regulation , repair of damaged dna , and in suppressing myc - induced lymphomagenesis . additionally , loss of casp2 in mice leads to features of premature ageing . these findings suggest that caspase-2 has non - apoptotic functions in addition to its context - dependent roles in cell death .

cancer of the prostate ( pca ) is the most common solid neoplasm in europe with an incidence of 21.400 cases per 100.000 men . in germany , every year pca is newly diagnosed in 58.000 men with an average age of 69 years and is currently the third most common cause of cancer death . besides radical prostatectomy ( open retropubic / open perineal / laparoscopic / robot - assisted ) , other treatment options include percutaneous radiation , brachytherapy , watchful waiting or active surveillance . radical prostatectomy , however , is the only treatment that has shown an improved cancer - specific survival compared to conservative management . the open retropubic radical prostatectomy was developed over 60 years ago and implies the removal of the entire prostate gland between the urethra and the bladder . despite improvements of the surgical approach like the ' nerve sparing ' prostatectomy there still are intra- and perioperative complications , e. g. prolonged urine leakage of the vesicourethral anastomosis in up to 15.4% of patients . to avoid injuries of the ureteric orifices many surgeons use temporary ureteral stents or administer intravenously indigo carmine dye for enhanced visualisation especially when encountering an intravesical middle lobe during prostatectomy . to improve early continence and reduce prolonged urine leakage of the vesicourethral anastomosis we use a bladder neck preserving operation technique . the aim of the presented retrospective study was to investigate , if bladder neck preservation during open radical prostatectomy in a high volume center is associated with a higher risk of ureteral injuries and if additional procedures like temporary ureteral stenting or administration of indigo carmine dye for visualisation of the ureteric orifice are necessary . 369 consecutive patients with histological confirmed pca were treated in our hospital by open retropubic prostatectomy as described before and included in this retrospective study . seven different surgeons with an experience of more than 100 radical prostatectomies each performed surgical intervention . all patients underwent routine preoperative examinations including abdominal ultrasound , chest x - ray and blood tests including creatinine value . on the first day after surgery , blood examinations were repeated routinely to exclude significant bleeding or other perioperative complications ( e. g. urine leakage due to ureteral injury or an insufficient vesicourethral anastomosis ) . if blood testing showed pathological values or the patient was clinically conspicuous , the test was repeated latest the next day . in our laboratory standard , for men a creatinine level of 0.5 to 1.2 mg / dl is defined as non - pathological . after discharge of hospital , the follow - up was performed by telephone interviews either of the patient , the visiting urologist or general practitioners one year after surgery . specifically , every patient with pathological creatinine value during hospital stay underwent repeated blood testing . furthermore it was investigated if the patient underwent any additional surgical procedure ( e. g. ureteral stenting , percutaneous nephrostomy or ureteral reconstruction ) due to a ureteral injury during prostatectomy . all data are expressed as mean standard error of mean ( sem ) calculated by using standard statistical methods . all data are expressed as mean standard error of mean ( sem ) calculated by using standard statistical methods . mean age at first diagnosis of prostate cancer was 63.7 0.3 years . during radical prostatectomy no surgeon observed any intraoperative injury of a ureter ; neither ureteral reconstruction was performed . indigo carmine dye was not applied at all . in 7/369 prostatectomies ( 1.90% ) a ureteric stent was inserted temporarily and removed either before closure of the last anastomosis sutures or 6 - 8 weeks after radical prostatectomy by transurethral cystoscopy . no patient underwent any additional surgery due to a ureteral injury during follow - up . complete laboratory data were available of 263/369 patients ( 71.3% ) . in 17/263 ( 6.5% ) patients with preoperative normal creatinine value a pathological value was observed on the first postoperative day . mean creatinine value in these patients before surgery was 1.1 0.02 mg / dl , postoperatively 1.4 0.04 mg / dl . acute postrenal renal failure was excluded by abdominal ultrasound examination , a significant hydronephrosis was not seen in any case . during the last decades , radical prostatectomy has become a standard treatment for localized prostate cancer . in high volume surgical centers complication rates tend to be lower than in small centers with fewer than 50 prostatectomies per year . with an evolving surgical technique , functional long - term results of continence and erectile function have dramatically improved . for selected patients , continence rates of up to 99% after one year and restored erectile function in up to 50% are reported . despite good functional long - term results the most common intraoperative complication is significant hemorrhage arising from venous structures and requiring blood transfusion . mean blood loss in historic series is reported to be as high as 1500 ml , more recent publications report 150 - 300 ml for experienced surgeons . besides hemorrhage , rectal injury and obturator nerve injury during pelvic lymphadenectomy are rare complications in recent series . the injuries seem to occur most often during dissection of the posterior aspect of the bladder neck especially in patients with significant benign prostatic hyperplasia and j - hooking of the ureters . in our own series consisting of 369 consecutive prostatectomies there were no ureteral injuries noticed . during prostatectomy in seven patients a ureteral stent was temporary used to protect the ureteral orifice during dissection of the bladder neck . all surgical procedures could be performed without obvious intraoperativley injuries to the ureter and without the need for a ureteral reconstruction . indigo carmine dye was not applied at all , which might be due to personal preference of the urologic surgeons . summarizing our data , there were no ureteral injuries and the use of ureteral stents was limited to single cases . this might indicate that in experienced hands a routinely stenting of ureters during prostatectomy is not necessary . in a high volume surgical center setting , the risk for a ureteral injury during open radical prostatectomy is very low .

objectives and aimsto avoid damage to the ureters during bladder neck preparation in radical prostatectomy for prostate cancer , it may be helpful to insert ureteral stents temporarily or to intravenously administer indigo carmine dye for enhanced visualisation of ureteric orifices . we evaluated our bladder neck preserving technique at radical prostatectomy with regard to ureteric injuries.patients and methodswe analysed 369 consecutive radical prostatectomies operated in our clinic in a bladder neck preserving technique . the following parameters were assessed in this retrospective study : number of prophylactic ureteric stent insertions , application of indigo carmine dye , observed injuries of the ureters by the surgeon , postoperative increase of serum creatinine and postoperative status of kidney ultrasound.resultsin 7/369 prostatectomies ( 1.90% ) a ureteric stent insertion was performed , indigo carmine was not applied to any patient at all , yet no intraoperative injury of a ureter was observed by a surgeon . no revision was necessary due to a ureteral injury within the observation period of one year after surgery . in 17 patients with preoperative normal creatinine value a pathological value was observed on the first postoperative day ( mean 1.4 mg / dl ) . in these patients no consecutive postrenal acute renal failure was observed , no hydronephrosis was monitored by ultrasound and no further intervention was necessary.conclusionsbladder neck preserving operation technique does not implicate the need of prophylactic ureteric stent insertions and has no higher incidence of ureteric injuries .

the term psychosis is often used rather broadly to encompass a group of symptoms , none of which is specific to any disorder as such , and which can manifest in anyone given certain stimuli , such as exposure to dopaminergic agonists . schizophrenia is a psychiatric disorder characterised by psychotic symptoms : pragmatically , albeit over - simplistically , these symptoms can be divided into positive ( delusions and hallucinations ) and negative ( apathetic withdrawal , reduced range of emotions , diminished thought content i.e. having a paucity of thoughts , demonstrated by lack of spontaneous speech and tendency to short unembellished conversation ) . it is the latter that is arguably the core of the schizophrenia syndrome , with positive symptoms being what may be considered cognitive deficits are also considered part of the core syndrome and , along with negative symptoms , drive most of the disability associated with the condition . there is little doubt that ingestion of the plant cannabis sativa can cause positive psychotic - like symptoms . an early study by ames using the plant product showed a fairly uniform response in human volunteers , with features including depersonalisation / derealisation , a prolonged sense of the passage of time , transient paranoid ideation and hallucinations . of course , cannabis sativa has multiple chemical constituents , but delta-9-tetrahydrocannabinol ( thc ) confers the psychotomimetic properties , acting via cannabinoid cb1 receptors , which are ubiquitously distributed in the brain . used synthetic thc and found a dose - response relationship with psychotic symptoms in most subjects , although some had an idiosyncratically profound response to even a modest dose . more modern studies using more sophisticated techniques support these conclusions , whilst elegant work from huestis et al . has shown that the psychotomimetic effects of thc are mediated by the cannabinoid cb1 receptor and that antagonism of the receptor blocks these effects . these findings suggest that some individuals are simply more prone to the psychotomimetic properties of cannabis . verdoux and colleagues confirmed this in a non - clinical sample , with the individuals degree of psychosis proneness correlating with intensity of psychosis - like symptoms upon exposure to cannabis in a daily - life situation . extrapolating from this , it would seem obvious that people with schizophrenia are very psychosis prone and they would be expected to manifest positive symptoms of psychosis ( delusions , hallucinations ) at even low doses , similar to someone with diabetes eating sugar and becoming hyperglycaemic . an association between cannabis consumption and worse psychotic symptoms and an overall more severe illness course has been pretty consistently shown in the schizophrenia literature , be it in chronic or first - episode patients ( see review by linszen et al . ) also , a distinction needs to be drawn between acute effects ( i.e. precipitation of an acute episode of illness ) and longer - term , more insidious detrimental effects : obviously the former are easier to demarcate in terms of temporal sequence of cannabis exposure and symptom exacerbation . another problem is that the literature has largely focussed on positive rather than negative or cognitive symptoms . it is clear that cannabis and related compounds can cause acute transient impairments in memory , attention , and executive function . but whether exposure to cannabinoids is associated with persistent cognitive deficits is not as clear , more controversial and difficult to study . in terms of negative - like symptoms , an amotivational syndrome has been described in chronic , heavy cannabis users . the syndrome resembles the negative symptoms of schizophrenia and is characterized by apathy , amotivation , social withdrawal , narrowing of interests , lethargy , impaired memory , impaired concentration , disturbed judgment , and impaired occupational achievement . however , polydrug use , poverty , low socio - economic status , or pre - existing psychiatric disorders confound interpretation of these studies and other investigators have argued that the syndrome does not exist . what has been consistently found is that people with schizophrenia use more cannabis than the general population . for example , in the recent australian study of high impact psychoses , people with schizophrenia had a lifetime rate of cannabis exposure of 97% , and last - year rates of 49% . this begs the question as to why people with schizophrenia should use an agent that worsens their illness course and makes their positive symptoms worse . one way of looking at this is to consider that people with schizophrenia have an excess of negative emotions and that these symptoms drive cannabis use in much the same way as those that drive its use in people without schizophrenia . so , the self - medication hypothesis may be true , but self - medication is for negative rather than positive symptoms . this conclusion is , in part at least , supported by a study of 42 patients with psychosis and 38 controls , using experience sampling methodology : both groups experienced increases in positive emotions on exposure to cannabis and , in patients , there was also a reduction in negative emotions . hence , the message must be that anyone highly prone to psychosis should avoid cannabis : the tough part is helping people with negative emotions to find alternative ways of ameliorating those symptoms . indeed , the effective management of people with schizophrenia and cannabis use remains suboptimal and requires much more research . this , of course , is very difficult to determine definitively , and the best study design is the longitudinal cohort . cohort studies have the great advantage of determining temporal sequence of putative cause and putative effect : any causal model of cannabis for schizophrenia would necessarily require the cannabis exposure to antedate the illness , as symptoms of the illness can drive cannabis consumption , as detailed above . a problem , though , even for the cohort design , is that non - specific symptoms characterised by negative emotions ( see above ) and sub - threshold positive symptoms can occur in the prodromal phase heralding the first definitive psychotic episode , and might lead to cannabis consumption ( discussed by kuepper et al . ) . but this aside , a number of cohort studies from different parts of the world have converged in finding an association between cannabis consumption in youth and later schizophrenia / schizophreniform disorder . the first of these was a study of 50,087 swedish conscripts , which showed an adjusted hazard ratio for schizophrenia of 3.1 ( ci 1.7 , 5.5 ) , with a dose - response relationship with increasing exposure to cannabis . the dunedin birth cohort is particularly instructive in that it assessed individuals from a representative birth cohort at a number of time points and had excellent participant retention . in that study , the risk of schizophreniform psychosis at age 26 was 10.3% in those who had used cannabis in their teens , as opposed to 3% in the rest of the cohort ( adjusted odds ratio 2.9 [ ci 1.2 , 7.0 ] ) . relevant to the cause - effect issue discussed above , it was those individuals who , at age 11 , had experienced psychosis - like phenomena in association with cannabis use at age 18 , who were most vulnerable to developing later schizophreniform psychosis ( age 26 ) . we believe there is a strong body of evidence from epidemiological studies that use of cannabis increases risk of psychotic disorder , supported by findings in other research fields ( pg 181 ) . thus , in a small group of people , cannabis can be the straw that breaks the camel 's back and acts as a cumulative causal factor for schizophrenia . precisely what such other risk factors are is not clear , but more and more interest is being shown in gene - environment interaction effects in mental illnesses generally , and schizophrenia in particular . in the dunedin cohort there was an intriguing interaction effect , such that individuals homozygous for the valine allele at the position coding for val158met within the gene for catechol - o - methyl transferase ( one of the determinants of dopamine metabolism ) were more likely than those homozygous for the methionine allele to develop a later psychotic illness in association with cannabis exposure . other genes of interest in this context include akt1 , but more work needs to be done in elucidating such effects . applying the cumulative causal factor model , very few cases of schizophrenia ( estimated population attributable fraction - paf- around 8% ) would actually be prevented with the global abolition of cannabis . this low paf is compatible with epidemiological findings that schizophrenia is a ubiquitous accompaniment of the human condition and rates do not vary very much between cultures and settings despite wide variations in cannabis use . at an individual level , though , it would seem important to educate people at heightened risk of schizophrenia ( e.g. through having a family history of the disorder , or having experienced psychosis - like symptoms ) of the potential additive causal risk cannabis exposure might bestow . for a full discussion of the public health implications ,

converging lines of evidence suggest that cannabinoids can produce a full range of transient schizophrenia - like positive , negative and cognitive symptoms . cannabinoids also produce some psychophysiological deficits also known to be present in schizophrenia . it is also clear that , in individuals with an established psychotic disorder , cannabinoids can exacerbate symptoms , trigger relapse , and have negative consequences on the course of the illness . increasing evidence suggests that early and heavy cannabis exposure may increase the risk of developing a psychotic disorder such as schizophrenia . the relationship between cannabis exposure and schizophrenia fulfills some , but not all , of the usual criteria for causality . however , most people who use cannabis do not develop schizophrenia , and many people diagnosed with schizophrenia have never used cannabis . therefore , it is likely that cannabis exposure is a component cause that interacts with other factors to cause schizophrenia or other psychotic disorders , but is neither necessary nor sufficient to do so alone . further work is necessary to identify the factors that underlie individual vulnerability to cannabinoid - related psychosis and to elucidate the biological mechanisms underlying this risk .

d - amino acid oxidase ( ec 1.4.3.3 , daao ) is a flavoprotein that catalyzes the enantioselective oxidative deamination of d - amino acids to yield the corresponding -imino acids , which are spontaneously hydrolyzed to -oxoacids and ammonia . reoxidation of the reduced fad by molecular oxygen is accompanied by the release of hydrogen peroxide [ 1 , 2 ] . daao is almost ubiquitous in eukaryotic organisms and fulfills different physiological functions : from a catabolic role in yeasts , which allows the use of d - amino acids as carbon and energy sources , to a regulatory role in the human brain , where it controls the levels of the neuromodulator d - serine [ 3 , 4 ] . in recent years , a major biotechnological application of daaos has emerged for the industrial production of 7-aminocephalosporanic acid ( 7-aca ) , a key starting material for the preparation of semisynthetic cephalosporin antibiotics . d - amino acid oxidases can catalyze the conversion of cephalosporin c to glutaryl-7-aminocephalosporanic acid ( glutaryl-7-aca ) , the first intermediate in the two step route that leads to 7-aca . in the second step of the process , glutaryl-7-aca is hydrolyzed to 7-aca by a glutaryl-7-aca acylase , an enzyme from the group of penicillin amidohydrolases ( ec 3.5.1.14 ) . daaos from several microbial sources have been demonstrated to work efficiently in the oxidative deamination of cephalosporin c [ 710 ] whereas daao from pig kidney ( pkdaao ) has been considered a poor catalyst in the same reaction . in fact , immobilized trigonopsis variabilis cells with d - amino acid oxidase activity are actually the most employed biocatalyst for 7-aca production in industry . cloning of the daao gene of t. variabilis in different hosts , such as escherichia coli [ 1216 ] , saccharomyces cerevisiae , kluyveromyces lactis , schizosaccharomyces pombe , and pichia pastoris [ 19 , 20 ] , has allowed obtaining the recombinant enzyme for biotechnological applications . in many cases , overproduction of hexahistidine - tagged tvdaao has been successfully achieved in order to obtain an engineered form of the protein that could facilitate its downstream processing in e. coli [ 1216 ] and p. pastoris . as reported previously , a chimeric tvdaao containing a hexahistidine tag at the n - terminal end was largely expressed as apoenzyme by a recombinant e. coli strain , and the pure apoprotein could be purified in a single step by using metal - chelate affinity chromatography . the holoenzyme could be reconstituted from the recombinant apoenzyme by addition of exogenous fad to yield a fully active enzyme . the dissociation constant ( kd ) for fad of this tvdaao , which was quite similar of that reported for pkdaao , is 10-fold larger than that for rhodotorula gracilis daao . thus , the weak noncovalent binding of fad to the recombinant enzyme might explain the observation that the flavin cofactor is lost upon dilution or prolonged dialysis . in the present paper , we report experiments demonstrating that recombinant tvdaao activity was inhibited by different salts and that the direct inhibition by nacl is due to fad dissociation as confirmed by measuring the fluorescence of tryptophanyl residues of the holoenzyme . d - alanine , 2,4-dinitrophenyl - hydrazine ( dnph ) , edta , fad , imidazolem , and 2-mercaptoethanol were supplied by sigma . potassium phosphate , potassium hydroxide , and glycerol were purchased from scharlab ( barcelona , spain ) . his - tagged d - amino acid oxidase from trigonopsis variabilis ( tvdaao ) was produced and purified as previously described in . recombinant tvdaao was largely expressed as apoenzyme ( about 90% ) , and further enzyme purification and dyalisis against the appropriate buffer lead to a 100% pure apoenzyme preparation . this apoenzyme solution was further dialyzed against 20 mm potassium phosphate buffer ph 8.0 , 20% glycerol , 5 mm edta , and 5 mm -mercaptoethanol at 4c and , then , centrifuged at 11,600 g for 5 minutes . an excess of exogenous cofactor fad ( 5-fold enzyme concentration ) was added to apoenzyme solution to obtain the holoenzyme solution . apoenzyme concentration was determined spectrophotometrically using a molar absorption coefficient at 276 nm of 276 = 70.5 mmcm . the standard method measured the release of -ketoacid from d - alanine during the reaction by the formation of the corresponding hydrazone from dnph , which could be monitored at 450 nm . the reaction mixture contained 80 l of 100 m fad dissolved in distilled water and 100 l of 100 mm d - alanine dissolved in 100 mm potassium phosphate buffer ph 8.0 . the mixture was preincubated for 5 minutes at 30c , and the reaction was started by adding 20 l of enzyme solution . after 10 minutes , the reaction was stopped with 20 l of a saturated solution ( approximately 10 mm ) of dnph in 1n hcl . after 15 minutes of incubation with dnph , the colour was developed by the addition of 180 l of 2n naoh . the activity was calculated by spectrophotometric absorption measurement at 450 nm , using a pyruvic acid calibration curve . one activity unit ( u ) was defined as the amount of enzyme producing 1 mol of pyruvic acid per minute under the conditions mentioned . the activity assay was performed under standard enzyme assay conditions as mentioned above , at a buffer concentration of 50 mm . intrinsic fluorescence measurements were performed in an slm aminco 8000c spectrofluorimeter ( spectronic instruments , usa ) equipped with a thermostated cell holder using a 2 ml cell at 25c . emission spectra were recorded using an excitation wavelength of 295 nm ( tryptophan emission ) . excitation and emission bandwidths were set at 5 nm and 6 nm , respectively . as shown in figure 1 , we observed a significant decrease of enzyme activity when nacl concentration was increased in the reaction medium . at a concentration of 300 mm nacl , the influence of buffer concentration on enzyme inhibition was ignored as no differences in activity were observed . the phenomenon of flavoenzyme inhibition by salts has been described in the literature [ 2426 ] . as reported , enzyme inhibition by high salt concentrations often occurs due to the abundance of negatively charged ions , which lead to conformational perturbations preventing holoprotein formation . in fact , flavoproteins that bind their cofactor rather weakly can be deflavinated using bromide ions at high concentration [ 2732 ] . chloride has been reported to be less chaotropic and therefore less effective in removal of flavin . in our case , as mentioned above , chloride negative charges could interfere with the weak interactions between cofactor and enzyme , favouring fad dissociation . the same deactivation was observed when kcl concentration was increased in the reaction medium ( figure 2 ) . apart from halide ions , also other negative charged groups were described to induce fad dissociation , such as cyanate or cyanide . an extensive study of the inhibition effect of recombinant tvdaao activity by nacl was carried out in order to know the inhibition type and the inhibition constant . the enzyme activity was measured with different concentrations of d - alanine in the absence and presence of several concentrations of sodium chloride under the same standard assay conditions , at 50 mm potassium phosphate buffer ph 8.0 . as shown in figure 3 , the inhibition exerted by nacl was competitive , indicating that the chloride anion diminishes the affinity of the enzyme for the substrate , probably due to conformational perturbation of the active site , which could be related to the binding of the negative ion to some residues . nevertheless , such hypothesis should be checked when the tvdaao three - dimensional structure will be available . the replot of the slope versus inhibitor concentration fitted to a straight line whose intercept in the x - axis indicated an inhibition constant value of ki = 85 mm . in order to check possible fad dissociation from the holoenzyme due to nacl , fluorescence emission spectra of reconstituted tvdaao in the presence of different nacl concentrations were measured with excitation at 295 nm ( figure 4 ) . excitation at this wavelength selectively allows measurements of the contribution of tryptophan residues to the emission spectra of the protein . fluorescence intensity was increased up to threefold when increasing concentrations of nacl were added to the enzyme solution . in addition , a small red shift from 338 nm to 340 nm was observed , indicating that the tryptophan residues were in a slightly more hydrophilic environment . such an effect may be related to the loss of cofactor fad and the corresponding exposure of tryptophan residues , which were quenched by the cofactor prior to nacl addition . as a matter of fact , tvdaao apoenzyme , which contains no fad , shows an emission maximum at 340 nm with intensity 3-fold higher than that of the holoenzyme , whose maximum is at 338 nm . the decreased fluorescence intensity of holoenzyme can be explained by a conformational transition upon fad binding or subunit association that would affect the local environment surrounding the indole ring of tryptophan residues . fad dissociation from the holoenzyme in the presence of halide anions such as iodide , bromide , or chloride has also been reported for pkdaao , in which tryptophanyl fluorescence intensity was stronger than that of apoenzyme . in our case , a significant increase of the intrinsic fluorescence intensity can be observed at salt concentrations higher than 77 mm . above this concentration this result is quite similar to the inhibition constant obtained in the kinetic experiments , strongly indicating that competitive inhibition by nacl could be related to fad dissociation . as flavin cofactor binding is essential for catalytic activity , fad dissociation induced by chloride anions would lead to enzyme inactivation . recombinant tvdaao activity is inhibited by the presence of high salt concentrations in the reaction media . sodium chloride behaved as a competitive inhibitor , leading to conformational perturbations in the active site that might induce fad dissociation .

inhibition of recombinant d - amino acid oxidase from trigonopsis variabilis ( tvdaao ) activity in the presence of different sodium salts and potassium chloride is reported . a competitive inhibition pattern by sodium chloride was observed , and an inhibition constant value of ki = 85 mm was calculated . direct connection of nacl inhibition with fad cofactor dissociation was confirmed by measuring the fluorescence of tryptophanyl residues of the holoenzyme .

laparoscopy represents the gold standard for the diagnosis and treatment of a nonpalpable intraabdominal testis ( npat ) , which makes up around 20% of cases of undescended testis . with the evolution of minimally invasive surgery , the operative approach toward orchidopexy for npat has shifted from a traditional open approach to a multiport and single laparoscopic technique . the aim of this study was to evaluate the feasibility of orchidopexy for an npat by use of a surgical glove port and conventional rigid instruments . we retrospectively reviewed all cases of patients with npat who had undergone laparoendoscopic single - site ( less ) orchidopexy at our department between january 2013 and september 2014 . throughout the study period , less all families consented to the single - incision approach and possible conversion to multiport laparoscopy . the medical records of the patients were reviewed , and data concerning age , weight , operative time , complications , and surgical outcome were collected . as we previously described , we initially made a transumbilical glove port using a flexible ring ( fr ) , a rigid larger ring ( rr ) , one powder - free surgical glove , a wire - to - skin , and standard laparoscopic trocars . the fingertips of the glove were cut off where the trocars were inserted and fixed by a vicryl 3/0 ligature wire . then , the open end of the glove was passed through the fr and turned around it in the middle of the glove ( fig . a 1-cm incision was made at the level of the umbilicus without dissection of subcutaneous tissue . after the incision , the inner fr , fitted with the glove , was introduced into the abdomen . a 30 angle laparoscope with 3-mm or 5-mm straight rigid instruments identical to those for conventional laparoscopy including graspers , scissors , and electrocautery was used to perform our less orchidopexy ( fig . we opted for the first stage of two - stage fowler - stephens orchiopexy if the testis was closer to the iliac vessels . their age ranged from 9 months to 24 months ( mean age , 18 months ) . all patients had a nonpalpable unilateral undescended testis , which was on the right side in 14 patients and on the left side in 6 patients . seventeen patients underwent laparoscopic orchidopexy without vessel division as a one - stage procedure and 3 patients had less fowler - stephens orchidopexy for the first and the second stage . average operating time was 57 minutes , with extremes ranging from 40 to 80 minutes . the mean operative time for those undergoing one - stage orchidopexy was 57.11 minutes ( range , 40 to 80 minutes ) , that for primary fowler - stephens orchidopexy was 24 minutes ( range , 20 to 26 minutes ) , and that for second - stage surgery was 56.66 minutes ( range , 56 to 58 minutes ) . neither intraoperative nor postoperative complications were seen and the patients were discharged within a few hours of surgery . no patients were lost to follow - up . the total duration of the follow - up period ranged from 3 months to 1 year , 6 months . one patient had atrophy after the fowler - stephens orchiopexy procedure , and two cases had reascension of the testicle . no scoring was done to evaluate the final scar . however , the umbilical incision was nearly invisible and much appreciated by the parents . the question arises , why did we choose this technique to perform orchidopexy for npat ? in fact , society pushes us to remain up to date and even be ahead of our time , but not at any price , in terms of potential complications and financial costs , especially in the pediatric population . it is for these reasons we chose less , which has gained popularity over the last decade . in addition , these approaches offer documented benefits including improved cosmetic outcomes , decreased pain , and the ability to easily perform combined procedures without having to place additional ports . less procedures can be performed with the r - port , uni - x port , and sils port , which are very costly . the alexis wound retractor , curved instruments , and flexible - tip laparoscope are not available in our country . therefore , we chose a less expensive access method to perform orchidopexy for npat , known as a " surgical glove port " or " homemade single - port , " which was described previously for the completion of various procedures in adults . our technique may be an alternative to the costly commercially available single - port systems , especially in a developing country . to our knowledge , this technique has been previously used for orchidopexy in a pediatric population by only four authors . sultan et al . used an r - port in a 2-year - old boy ; raju et al . and de lima et al . used rigid instruments in an 18-month - old child and for 3 boys , respectively ; and noh et al . reported a series of 17 patients in which a multichannel single port and flexible tip laparoscope were used . all of these studies showed less orchidopexy in children to be feasible , safe , and scarless , with no intraoperative complications . in terms of technical considerations , the single - incision technique allows adequate visualization and counter traction for performing orchidopexy , especially with a standard instrument . the mean operative time for less orchidopexy in this report was longer than in the series reported by noh et al . , probably because of the use of the flexible tip laparoscope , but it was shorter than the time reported by raju et al . , who reported a technique using standard trocars through a single umbilical incision with an intraabdominal time of 126 minutes . in fact , when the first 10 operative single - incision cases were compared with the second 10 cases , a trend toward a shorter operative time was noted , but this was not statistically significant . recently , zani et al . reported that less seems to be associated with more postoperative pain than standard laparoscopy . the postoperative pain score was not analyzed because this score did not correlate with the requirement for additional analgesics . this is one of the largest series of pediatrics patients to undergo less orchidopexy and the only pediatric study to have been done with a surgical glove port . our results demonstrate the safety and feasibility of this procedure , which can be an alternative to costly commercially available single - port systems , especially in a developing country .

purposewe review the literature and describe our technique for laparoendoscopic single - site orchidopexy using a glove port and rigid instruments . we assessed the feasibility and outcomes of this procedure.materials and methodswe retrospectively reviewed the case records of all children who had undergone laparoendoscopic single - site orchidopexy by use of a surgical glove port and conventional rigid instruments for a nonpalpable intraabdominal testis between january 2013 and september 2014.resultsdata from a total of 20 patients were collected . the patients ' mean age was 18 months . all cases had a nonpalpable unilateral undescended testis . fourteen patients ( 70% ) had an undescended testis on the right side and six patients ( 30% ) had an undescended testis on the left side . seventeen patients underwent primary orchidopexy . three patients underwent single - port laparoscopic fowler - stephens orchidopexy for the first and the second stage . average operating time was 57 minutes ( range , 40 to 80 minutes ) . no patient was lost to follow - up . at follow - up , 2 testes were found to have retracted out of the scrotum and these were successfully dealt with in a second operation . one testis was hypoplastic in the scrotal pouch . there were no signs of umbilical hernia.conclusionssingle-port laparoscopic orchidopexy using a glove port and rigid instruments is technically feasible and safe for various nonpalpable intraabdominal testes . however , surgical experience and long - term follow - up are needed to confirm the superiority of this technique .

patients with primary hyperparathyroidism ( phpt ) may seem to experience progression of the disease as measured by extreme elevations of serum or urinary calcium or by the advent of renal dysfunction , nephrocalcinosis or worsening osteopenia . however , neuromuscular weakness remains an infrequent association , which is often ignored due to non - specific nature of complaints . the neurological manifestations of hyperparathyroidism includes easy fatigability , weakness and amyotrophy of proximal muscles with preserved reflexes in most cases . we report an unfamiliar case of phpt with recurrent quadriparesis mirroring as periodic paralysis ( pp ) . a 29-year - old male , presented with the complaint of sudden onset weakness of all four limbs since last night . history was negative for unusually high carbohydrate intake , excessive exertion or alcohol intake in the previous night . he also denied symptoms of unexplained sweating , tremors , heat intolerance , prolonged vomiting or any drug intake over a prolonged period of time . he had a preceding history of muscle cramps and paresthesia for about a month . past history dates back in the year 2002 , which revealed that the patient had similar mode of presentation . subsequently , he had been admitted in a local hospital and improved symptomatically with conservative therapy . neurological examination revealed bilaterally symmetrical weakness ( gr 2/5 ) of all four limbs and generalized hyporeflexia with bilaterally flexor plantar response . eyes , face , tongue , pharynx , larynx , diaphragm and sphincters were not involved . the present investigations revealed serum potassium : 4.3 meq / l ( reference range : 3.5 - 5 ) , corrected calcium : 13 mg / dl ( 8.5 - 10.5 ) , phosphate : 2.6 mg / dl ( 3 - 5 ) and alkaline phosphatase : 216 u / l ( 80 - 306 ) . routine blood examinations , complete hemogram , creatinine , thyroid function tests , serum creatine phosphokinase , serologic viral markers and serum protein electrophoresis did not reveal any abnormality . however on examination of the abdomen by ultrasonography , multiple renal calculi were found in both kidneys . x - ray abdomen reassured the evidence of bilateral nephrolithiasis . on further plan , serum immunoassay for parathyroid hormone value was found to be 147 pg / ml ( reference range : 10 - 69 ) and 25-hydroxy vitamin d value was 25 ng / dl ( reference range : 11.1 - 42.9 ) . his serum calcitonin was normal ( 7.4 pg / ml ) ( reference range : < 5 ) and 24 h urinary calcium excretion reported as high ( 396 mg ) ( reference range < 300 ) . though , technetium 99 m ( 99 m tc ) sestamibi scan [ figure 1 ] could not confirm the possible etiology but ultrasound and computed tomography ( ct ) scan of neck the evidence of bilaterally enlarged parathyroids [ figures 2 and 3 ] . he improved dramatically again within 24 h and with the diagnosis of phpt , he has been planned for surgery . 99mtc sestamibi scan findings were consistent with the absence of hyperplastic parathyroid activity computed tomography neck showing enlarged the right parathyroid gland ( 0.77 cm 0.71 cm 1.4 cm ) computed tomography neck showing enlarged left parathyroid gland ( 0.65 cm 0.63 cm 1.5 cm ) pp though common among indian population varies greatly in disease spectrum and magnitude due to the heterogeneous pattern of etiology behind it . the primary hypokalemic pp is autosomal dominant and is exacerbated by strenuous exercise , high carbohydrate diet , cold and excitement , which was not found in this case . many cases of secondary periodic hypokalemic paralysis have been reported in association with gastroenteritis , diuretic abuse , renal tubular acidosis , bartter syndrome , villous adenoma of colon and hyperthyroidism . though molecular genetic studies were not done , gitelman 's syndrome , bartters syndrome and channelopathies were also ruled out by the absence of typical clinical features , hypokalemia and hypomagnesemia . the neuromuscular manifestations include progressive weakness of limbs , fatigue , exhaustion , dyskinesia , abnormal gait and muscle atrophy . some patients present with paresthesias and muscle cramps , loss of vibratory sensation with diminished reflexes and stocking - glove loss - of - pain sensation . patten and pages had reported two cases of hyperplasia and neuromuscular symptoms , but the electrophysiological findings were compatible with myopathy . the defect seems to be functional as the neurological signs disappear after surgery or clinical treatment . in most cases , there are three biochemical abnormalities : increased circulating pth , hypophosphatemia and hypercalcemia . however , the possible explanations of neurological manifestations include : ( 1 ) neuromuscular junction conduction disturbances related to hypercalcemia ; ( 2 ) abnormal trans - membrane calcium transport as a result of excessive extracellular calcium and ( 3 ) neuromuscular conduction disturbances related to hypophosphatemia . a direct effect of pth on neural tissue also has been reported as the imaginable cause . the pre - operative localization procedures include : diagnostic ultrasound of the neck ( sensitivity 55% ) ; ct of neck ( sensitivity 68% ) ; magnetic resonance imaging of neck ( sensitivity 75% ) ; and radionuclide imaging and single - photon emission computed tomography ( sensitivity 90% ) . due to superior image quality and improved accuracy , mibi has also been used prevalently in parathyroid imaging . however , not all parathyroid lesions retain mibi and abnormal parathyroid tissue becomes more visible on the delayed images . sensitivity of sestamibi scanning is poor ( < 50% ) in the presence of multiglandular disease ( hyperplasia or double adenomas ) . our patient presenting as recurrent episodic quadriparesis was subsequently diagnosed as phpt after evaluation for all possible causes . to the best of our knowledge , it would be wise to consider the phpt as one of the possible etiologies of episodic quadriparesis simulating as pp .

the natural history of untreated asymptomatic primary hyperparathyroidism ( phpt ) remains incompletely understood . increased level of parathyroid hormone produces the characteristic biochemical phenotype of hypercalcemia , hypophosphatemia and the various clinical sequelae of chronic hypercalcemia . periodic paralysis ( pp ) is a group of disorders of different etiologies with episodic , short - lived and hyporeflexic skeletal muscle weakness , with or without myotonia , but without sensory deficit and without loss of consciousness . however , phpt has rare association with episodic quadriparesis mimicking as pp .

adenomatous polyposis coli endothelin a receptor endothelin b receptor epithelial to mesenchymal transition epithelial ovarian cancer g - protein coupled receptor glycogen synthetase kinase 3 matrix metalloproteinase 2 t - cell - specific transcription factor-4 -transducin repeat containing protein vascular endothelial growth factor receptor-2 epithelial ovarian cancer ( eoc ) is a disease plagued by recurrences and progressive chemoresistance . eoc cells assure their growth advantage and resistance to chemotherapy through the appropriation of key pathways , such as those controlled by g - protein coupled receptors ( gpcrs ) . accumulating molecular and in vivo evidence demonstrates that the activation of autocrine and paracrine signaling by the binding of endothelin-1 ( et-1 , edn1 ) to its gpcrs , endothelin a receptor ( etar , ednra ) and endothelin b receptor ( etbr , ednrb ) , elicits pleiotropic effects in tumor cells and in the host microenvironment , modulating the epithelial to mesenchymal transition ( emt ) , chemoresistance , and the expansion of vascular networks . of particular interest , etar was shown to be aberrantly activated in eoc and its expression has been correlated with platinum resistance and emt marker expression . this discovery was followed by analysis of eoc samples from the cancer genome atlas ( tcga ) that showed evidence for worse survival in eoc patients with etar overexpression . in addition to etar overexpression in chemoresistant eoc cells , etbr also appears to have protumorigenic activity by promoting angiogenesis and lymphangiogenesis and evasion of the immune response . hence , etar and etbr , which are heterogeneously expressed in eoc cells , have emerged as key targets for cancer therapy . emerging evidence demonstrates that acquisition of chemoresistance is highly dependent on contextual cues such as interactions with the tumor microenvironment and crosstalk with other signaling pathways . noting that crosstalk between et-1 signaling and other growth factor pathways drives tumor progression via the scaffold protein -arrestin-1 ( arrb1 ) that serves as a co - pilot to organize complex signaling networks , we hypothesized that an -arrestin-1mediated mechanism in et-1 signaling may play a particularly important role in evasion of the drug response . to investigate the mechanism underlying this resistance , we used resistant eoc cell lines generated by prolonged treatment with cisplatinum or taxol . upon etar activation of these resistant cells , -arrestin-1 formed a nuclear complex with -catenin and p300 , resulting in histone acetylation that led to chromatin reorganization and enhanced transcription of genes such as et-1 that are responsible for regulating the rate limiting step of the drug response . similarly , 13 of 13 platinum - resistant patients had increased recruitment of -arrestin-1 and -catenin on the et-1 promoter , providing further evidence that etar/-arrestin-1 cooperates with wnt signaling to acquire a chemoresistant phenotype through amplification of the et-1 autocrine loop . this work expands what was previously known about the chemoresistance - associated functions of etar , outlining a model in which et-1 co - opts wnt components for its own agenda , thus sustaining emt , stemness features , cell invasion , and metastasis ( fig . . in chemoresistant ovarian cancer cells , binding of endothelin-1 ( et-1 , edn1 ) to its receptors leads to recruitment of -arrestin-1 ( arrb1 ) . -arrestin inhibits the destruction complex composed of glycogen synthetase kinase 3 ( gsk3 ) , axis inhibition 1 ( axin1 ) , -transducin repeat containing protein ( -trcp ) , and adenomatous polyposis coli ( apc ) , and thus promotes the accumulation of a non - ser / thr phosphorylated active form of -catenin . -arrestin-1 shuttles with -catenin into the nucleus , where it interacts with p300 histone acetyltransferase to enhance -catenin / t - cell - specific transcription factor-4 ( tcf4)-transactivation , thus promoting the transcription of genes such as edn1 , matrix metalloproteinase 2 ( mmp-2 ) , or cyclin d1 ( ccnd1 ) and leading to enhanced chemoresistance , epithelial to mesenchymal transition ( emt ) , stemness , cell plasticity , invasion , and metastasis . as a signal transducer , endothelin a receptor ( etar , ednra)/-arrestin-1 initiates transactivation of the vascular endothelial growth factor receptor-2 ( vegfr-2 ) through src . in parallel , paracrine production of et-1 activates endothelin b receptor ( etbr , ednrb ) expressed on endothelial cells , promoting expansion of vascular networks . the dual etar and etbr antagonist macitentan targets not only cancer cells ( which express etar and etbr ) but also tumor - associated stromal elements ( which express etbr ) . interplay between etar/arrestin-1 and wnt/-catenin drives chemoresistance in ovarian cancer . in chemoresistant ovarian cancer cells , binding of endothelin-1 ( et-1 , edn1 ) to its receptors leads to recruitment of -arrestin-1 ( arrb1 ) . -arrestin inhibits the destruction complex composed of glycogen synthetase kinase 3 ( gsk3 ) , axis inhibition 1 ( axin1 ) , -transducin repeat containing protein ( -trcp ) , and adenomatous polyposis coli ( apc ) , and thus promotes the accumulation of a non - ser / thr phosphorylated active form of -catenin . -arrestin-1 shuttles with -catenin into the nucleus , where it interacts with p300 histone acetyltransferase to enhance -catenin / t - cell - specific transcription factor-4 ( tcf4)-transactivation , thus promoting the transcription of genes such as edn1 , matrix metalloproteinase 2 ( mmp-2 ) , or cyclin d1 ( ccnd1 ) and leading to enhanced chemoresistance , epithelial to mesenchymal transition ( emt ) , stemness , cell plasticity , invasion , and metastasis . as a signal transducer , endothelin a receptor ( etar , ednra)/-arrestin-1 initiates transactivation of the vascular endothelial growth factor receptor-2 ( vegfr-2 ) through src . in parallel , paracrine production of et-1 activates endothelin b receptor ( etbr , ednrb ) expressed on endothelial cells , promoting expansion of vascular networks . the dual etar and etbr antagonist macitentan targets not only cancer cells ( which express etar and etbr ) but also tumor - associated stromal elements ( which express etbr ) . the challenge that lies ahead is integrating our improved understanding of the interconnected molecular mechanisms promoted by the et-1 axis in chemoresistant eoc cells with novel therapeutic options to improve patient outcomes . can et-1 receptors be directly targeted to resensitize eoc cells to cisplatinum or taxol ? treatment of resistant cells with the approved small molecule macitentan , a dual etar / etbr antagonist that prevents formation of the -arrestin-1/-catenin / p300 complex on the target , caused a strong reduction in growth and invasiveness . in vivo , macitentan significantly inhibited tumor growth , neovascularization , intravasation , and peritoneal dissemination in chemoresistant eoc xenografts by interfering with etar expressed on eoc cells and etbr expressed on endothelial cells . one striking observation is that the combination of macitentan and chemotherapy restored sensitivity to cisplatinum and taxol . consistent with the in vitro results , analysis in human platinum - resistant eoc tissues showed that etar overexpression is significantly associated with chemoresistance and poor prognosis , emphasizing etar as a potential predictive marker of drug response . taken together , the results of our study provide novel mechanistic insights into how wnt/-catenin signaling is wired to etar/-arrestin-1 to enable eoc cells to become unresponsive to chemotherapeutics . in the nucleus , the -arrestin-1-catenin connection represents the initial scaffold on which transcriptional regulatory complexes could be built to regulate epigenetic modifications . furthermore , in the cytosol , distinct -arrestin-1 complexes can recruit factors that activate crosstalk with tyrosine kinase receptor , such as vascular endothelial growth factor receptor-2 ( vegfr-2 ) , indicating that -arrestin-1 might control an intriguing spectrum of pathway interactions that regulate drug sensitivity . although these findings reveal the interplay between etar and wnt/-catenin signaling , a number of questions remain . for example , does nuclear -arrestin-1 have a common role in mediating -catenin transcription in other et-1-driven tumors ? how does -arrestin-1 translocate to the nucleus in response to etar activation and is the receptor part of the nuclear complex ? what causes the relatively high level of etar in chemoresistant eoc ? these and other issues , such as whole - genome chip - seq analysis to identify new -arrestin-1 partners , are currently being addressed to understand the early events leading to the acquisition of chemoresistance in eoc and other et-1-driven malignancies . targeting multiple networks using the dual etar and etbr antagonist macitentan to overcome compensatory mechanisms of therapy escape provides the potential advantage of targeting not only cancer cells ( which typically express etar ) but also microenvironment - associated elements , such as vascular , lymphatic , and inflammatory cells and fibroblasts , which all express etbr . the present study therefore has biological and clinical relevance for the development of new prognostic tools and novel treatments to overcome chemoresistance , and offers a strong rationale for translation of the experimental approach of combining macitentan with chemotherapy into immediate clinical evaluation in this disease setting .

knowledge of the mechanisms underlying chemoresistance is important in the development of novel targeted treatments for ovarian cancer . we recently reported that targeting endothelin a receptor/-arrestin-1 , a binding partner of wnt/-catenin , is sufficient to sensitize ovarian cancer to chemotherapy . this result highlights endothelin-1 receptor antagonists as potential anticancer therapeutics .

supernumerary teeth may be defined as any teeth or tooth substance in excess of the usual configuration of 20 deciduous and 32 permanent teeth.1 the etiology of supernumerary teeth is not completely understood . various theories exist for the different types of supernumerary teeth.2 one of the theories proposes that the supernumerary tooth is produced because of a dichotomy of the tooth bud.3 another theory - the hyperactivity theory - suggests that they are formed because of local , independent , conditioned hyperactivity of the dental lamina.4 genetics may also influence the development of supernumerary teeth.5 supernumerary teeth may be classified based on form ( conical type , tuberculate type , supplemental type , odontome ) or position ( mesiodens , paramolar , distomolar , parapremolar).6 the clinical complications of supernumerary teeth include root anomaly , malocclusion , root resorption , displacement or rotation , failure of eruption or delayed eruption of adjacent tooth , cyst formation , and pulp necrosis with loss of vitality and esthetic disturbances.7 the most common supernumerary teeth , listed in order of frequency , are the maxillary midline supernumeraries ( mesiodens ) , maxillary fourth molars , maxillary paramolars , mandibular premolars , maxillary lateral incisors , mandibular fourth molars , and maxillary premolars.8 the occurrence of multiple supernumerary teeth is often found in association with syndromes such as gardner s syndrome , fabry anderson syndrome , ellis van creveld syndrome , ehlers danlos syndrome , incontinentia pigmenti and tricho - rhino - phalangeal syndrome and developmental disorders such as cleft lip and palate and chondroectodermal dysostosis.9 the presence of supernumerary teeth may be associated with familial tendency.10 only a few examples of long - term follow - up of nonsyndromal bilateral supernumerary teeth have been reported in the literature.11 the aim of this study is to present an unusual case of a non - syndrome female patient with bilateral supernumerary teeth which occurred with an interval of several years . a 9-year - old female patient presented to our clinic complaining of pain in her primary teeth . an intraoral examination showed that the patient had a class i canine relationship on the right and left side and bilateral posterior crossbite due to bilateral constriction of the maxilla . a panoramic survey of the teeth showed an unerupted super - numerary tooth that was located on the left side of the maxillary arch ( figure 1b ) . a standard maxillary occlusal radiograph was taken to determine the position of the unerupted tooth . the radiograph showed that the tooth was in a palatal position ( figure 1c ) . following local anesthesia , a sulcular incision was performed and the supernumerary tooth was extracted via a palatal approach . the patient refused fixed orthodontic treatment and it was decided to observe the teeth and review the patient during the follow - up period . in the second follow - up period , after 3 years , radiographic examination revealed the presence of an unerupted supernumerary tooth in a palatal position on the right side of the maxillary arch ( figure 1d ) . supernumerary teeth can be defined as the teeth present in addition to the normal set of teeth . rajab and hamdam12 reported that the most frequent supernumerary teeth identified were mesiodens , followed by premolars , and fourth molars or distal molars . however , authors such as menarda et al13 reported that the supernumerary teeth of the molar group are the most prevalent type in the general population . in the present case , 2 supernumerary premolar teeth were located on the left and right side of the maxillary arch . supernumerary teeth are considered one of the most common dental anomalies , affecting the primary and early mixed dentition.12 the etiology of supernumerary teeth remains unclear , but several theories have been suggested for their occurrence . the localized and independent hyperactivity of the dental lamina is the most accepted cause for the development of supernumerary teeth . some have proposed that supernumerary teeth are formed as a result of local , independent , and conditioned hyperactivity of the dental lamina.14 the incidence of supernumerary teeth is reported to be between 0.1 and 3.6% of the general population.15 rajab and hamdan12 reported in their study that males were more frequently affected than females ( sex ratio , 2.2:1 ) . altug et al17 concluded that males are much more frequently affected than females with a 1.25:1 ratio . supernumerary teeth are more likely to be present in patients whose relatives possessed supernumeraries , although the inheritance of these teeth does not follow a simple mendelian pattern.18 batra et al5 recently reported the presence of multiple supernumerary teeth occurring as a nonsyndromic trait in a girl , her elder brother , and her father . in reviewing the literature , only a few cases of multiple supernumerary teeth were found without any associated syndromes or systemic disorders.5,8,10,19 in the present case , a non - syndrome female patient with bilateral supernumerary teeth was present . what is important is that this paper reports a case of nonsyndromic bilateral supernumerary teeth . the importance of the use of a panoramic radiograph to evaluate a patient s condition is emphasized whenever a supernumerary tooth is detected , irrespective of whether the patient has any syndrome or not.19 we observed the first supernumerary tooth during routine panoramic radiography by chance . this case also shows how important the follow - up period is . whenever supernumerary teeth are diagnosed , single or multiple , a decision regarding appropriate management should be carefully considered . spontaneous eruption following supernumerary removal is suggested to be in the range of 5475%.20 dibiase21 has suggested that most teeth experiencing delayed eruption will spontaneously erupt within 18 months of supernumerary removal alone , provided the delayed tooth is not excessively displaced . the first option involves removal of the supernumerary as soon as it has been diagnosed . this could create dental phobia problems for a young child and has been reported to cause devitalization or deformation of adjacent teeth . secondly , the supernumerary tooth could be retained until root development of the adjacent teeth is complete . the potential disadvantages associated with this deferred surgical plan include loss of eruptive force of adjacent teeth , loss of space and crowding of the affected arch , and possible midline shifts . obviously , the position , size , and nature of the supernumerary tooth and the level of co - operation of the patient will influence the surgical difficulty ; hence , each case should be individually assessed . in our opinion , it is important to initiate appropriate consultation and an interdisciplinary approach for treatment . additionaly ; we emphasized that in cases of supernumerary teeth the follow - up period and interdisciplinary approach are very important for treatment .

the presence of supernumerary teeth , also known as hyperdontia , is the condition of having teeth in addition to the regular number of teeth . the occurrence of multiple supernumerary teeth is often found in association with syndromes such as gardner syndrome , anderson - fabry disease , ellis - van creveld syndrome , ehlers - danlos syndrome , incontinentia pigmenti , and tricho - rhino - phalangeal syndrome . only a few examples of nonsyndromic multiple supernumerary teeth have been reported in literature . in this report , we present the unusual case and 9-year follow up of a non - syndrome female patient with bilateral supernumerary teeth that occurred with an interval of several years .

global prevalence of mentally challenged persons ranges from 9 to 19%.1 in the society many mentally challenged persons find it hard to survive as the nutritional status is low , and services are inadequate . mentally challenged condition is one among the main causes of dependency and deprivation in most developing countries . mentally challenged people tend to have been more or less excluded from the normal life of the community as a result of physical , social or psychological barriers erected , or at least accepted , by society . they have little access to services or to decision making that relates to their future and have no part in community production and consumption . when these patients go for dental consultation , it is important that he understands the patient s general conditions , etiology , natural history , complications , and prognosis . there is a general agreement that the population with mentally challenged children has higher rates than the general population , for poor oral hygiene , gingivitis and periodontitis.2 moderate or severe gingivitis has been found almost universally , with degree and extent increasing with age and degree of mental retardation , especially for those individuals with down s syndrome . local factors such as the macroglossia , malocclusion , tooth morphology , lack of normal masticatory function and bruxism have been suggested as contributing factors.3 the present study was undertaken to assess the intra - oral soft and hard tissue findings and oral health status of the children with down syndrome , including other anomalies and to assess the oral manifestations and oral health status of the children with cerebral palsy . an epidemiological survey was conducted to assess the oral manifestations among 6 - 15 years old mentally challenged children , attending special schools for the mentally challenged in chennai , india . the study group consisted of 150 children . among them , 70 were down syndrome patients and 80 were cerebral palsy patients ( graph 1 ) . descriptive statistics that included mean , standard deviation and percentages were calculated for each of the categories . chi - square test was used to determine whether differences were present in the oral manifestations between down syndrome and cerebral palsy patients . significance for all statistical tests was predetermined at a probability value of 0.05 or less ( data were analyzed using the statistical package spss 17.0 and minitab software 16.0 . in down syndrome , our findings showed hypertelorism in 65 cases with incidence of 92.9% , whereas in cerebral palsy hypertelorism in none of the cases with an incidence of 0.0% . flat nasal bridge was noted in 66 down syndrome cases ( 94.3% ) , whereas in cerebral palsy none of the cases had flat nasal bridge . mouth breathing in 42 cases with down syndrome ( 60.0% ) and 48 cases with cerebral palsy ( 60.0% ) . the classical intra - oral finding was macroglossia in 52 cases in down syndrome patients ( 83.6% ) and no cases in cerebral palsy . fissured tongue was seen in 55 cases in down syndrome ( 78.6% ) patients and 14 cases ( 17.5% ) in cerebral palsy patients . marginal gingivitis was found in 65 cases with down syndrome ( 92.9% ) and 49 cases with cerebral palsy ( 61.3% ) . periodontitis was noted with 25 cases with down syndrome ( 11.5% ) and 44 cases in cerebral palsy ( 55.0% ) there was no case of acute necrotizing ulcerative gingivitis seen in our study group . the oh - index was performed on each patient and scored . according to the scores obtained , they were grouped as poor , moderate , and good . high arched palate was seen in 55 cases with down syndrome ( 78.6% ) and 16 cases with cerebral palsy . hypodontia was the most common finding seen in 29 patients with down syndrome ( 41.4% ) and 9 cases with cerebral palsy ( 11.3% ) , showed high significance . microdontia was seen in 44 patients ( 62.9% ) with down syndrome and 17 cases ( 21.3% ) with cerebral palsy , which was statistically highly significant . fractured maxillary anterior teeth were the most common finding seen in 50 patients with cerebral palsy ( 62.5% ) and in none of the cases with down syndrome , which was statistically highly significant . one down syndrome patient ( 1.4% ) and four cerebral palsy patients ( 5.0% ) had decayed - missing - filled teeth ( dmft ) score of 0 . one down syndrome patient ( 1.4% ) and three cerebral palsy patients ( 3.8% ) had dmft score of 1 . three down syndrome patients ( 4.3% ) and 15 cerebral palsy patients ( 18.8% ) had dmft score of 2 . five down syndrome patients ( 7.1% ) and three cerebral patients ( 3.8% ) had dmft score of 3 . 11 down syndrome patients ( 15.7% ) and 17 cerebral palsy patients ( 21.3% ) had dmft score of 4 . 17 down syndrome patients ( 24.3% ) and 22 cerebral palsy patients ( 27.5% ) had dmft of 5 . 32 down syndrome patients ( 45.7% ) and 16 cerebral palsy patients ( 20.0% ) had dmft score of 6 ( table 1 ) . the comparison between the two age groups in down syndrome and cerebral palsy patients was statistically highly significant . mal alignment was seen 49 cases ( 70.0% ) with down syndrome and 47 cases with cerebral palsy ( 58.8% ) . anterior open bite was seen in 16 cases with down syndrome ( 22.9% ) and 18 cases with cerebral palsy ( 22.5% ) . anterior cross bite was seen in 11 cases with down syndrome ( 12.5% ) and 13 cases with cerebral palsy ( 16.3% ) and posterior cross bite was noted in 14 cases ( 20.0% ) with down syndrome and 13 cases ( 16.3% ) with cerebral palsy . despite the evidence for variations of many characters , the literature on down syndrome has exaggerated the homogeneity of this population . there has been enduring belief that people with down syndrome reach a plateau in adolescence , beyond which further developmental change is not possible.4 the number of community - dwelling down syndrome children is increasing in united states due to advances in medical science , improved educational systems , and greater social acceptance of people with disabilities in the community.5 however , the scenario in india is not clear , which may be due to lack of extensive surveys conducted on these kinds of children . in india , there are not sufficient residential institutions for these kinds of children , which results in most of the down syndrome children living in their home along with other siblings.6 the cause of cerebral palsy is poorly understood but is most likely caused by a variety of factors . prenatal factors cause 70 - 80% of cases of cerebral palsy.7 in our study , we found palatal variation in 78.6% of down syndrome patients , which is higher when compared to the study by gullikson in which he found an abnormal palate in 67.8% cases . this difference could be due to a large number of cases observed in our study . it can be suggested that there may not be an actual difference in measured height of the palatal vault , but merely different palatal form for those down syndrome patients judged to have a high vault . jairamdas et al . , described that down syndrome patients had a stair or v - shaped palate with high arch , which according to them was caused by deficient development of the midface , and it affected the length , height , depth of palate and usually the width.8 further studies are certainly indicated in regard to palatine form and vault height.2 dellavia et al . reported no significant difference in the measured vault height in his down syndrome group of patients ; however they did report narrower and shorter palates.9 cohen and winer ( 1965 ) in their analysis of 94 down syndrome cases 48.7% had abnormal tongues , 11.3% were enlarged , and 37.4% were fissured.10 they also reported that fissured tongue in down syndrome patients was a constant finding with an incidence of 50% and higher . occasionally macroglossia and microglossia were observed , but in most cases the tongue was of normal size . in the study higher incidence of fissured tongue ( 55 cases ) and macroglossia ( 52 cases ) was observed . gullikson reported large tongue in about 61% of cases , which is quite similar to that of our study . the difference could be due to increase the number of cases observed in our study.11 undeutsch et al . , postulated that inadequate lymphatic drainage was a cause for macroglossia in down syndrome patients . his study also pointed out that the dorsal surface changes of the tongue characterized by drying and chapping occurred due to mouth breathing . similar findings were seen in our study . orthodontic referral and speech therapy is also recommended for such patients.12 in this study , drooling of saliva was present in 70.0% of the individuals with cerebral palsy , which is the same as reported by nallegowda et al.13 drooling is another common problem in these children . this was due to the mal - alignment of teeth and lack of control of the muscles within the mouth . it could also be made worse by a lack of head control , poor posture , and lack of sensation around the mouth , impaired concentration or an obstruction within the nasal cavity . tahmassebi and curzon . showed that drooling of saliva in children with cerebral palsy is not due to hypersalivation but rather due to swallowing defect.14 about 35% to 55% of down syndrome patients present features of microdontia in both the primary and secondary dentition . spitzer ( 1963 ) described them as stunted with short , small crowns and roots . in our study we found 62.9% patients with down syndrome having microdontia and most of them involving maxillary lateral incisor , which appear similar to the description of spitzer that is short , conical crowns ( peg laterals ) , leading to spacing . kissling ( 1966 ) examined the tooth diameters and found that all the teeth except first molars and lower incisors were reduced in size but that root formation was always complete . in our analysis of 70 cases we found , missing teeth in 29 cases accounting for about ( 41.4% ) and most teeth being third molars followed by permanent maxillary lateral incisors similar to the findings of gullikson.11 since their study group consisted of only 28 cases , which may account for a high number of missing teeth . orner s study contrasted the dental caries experience of down syndrome patients with that of their siblings . he found that the down syndrome patients experienced < 1/3 caries than their unaffected siblings . shapiro et al . found that down syndrome adults who were caries free had significantly lower streptococcus mutants counts compared with the patients with dental caries . he mentioned that , there are several factors responsible for low prevalence of dental caries . they are : delayed eruption , reduced time of exposure to cariogenic environment , congenitally missing teeth , higher salivary ph and bicarbonate levels ( providing better buffering action ) , microdontia , spaced dentition and shallow fissures of teeth , all contribute to lower risk of dental caries.15 in this study , prevalence of periodontal disease in down syndrome patients was found to be 35.7% and the prevalence of periodontitis in cerebral palsy patients was found to be 55.0% . this finding is concurrent with the finding of brown and cunningham ( 1961 ) where they found the prevalence of periodontal disease to be 55.0%.16 a similar study by cohen and winer ( 1965 ) on 100 patients found that most significant finding in their study was the prevalence of periodontal disease condition being observed in 96 of 100 cases examined.10 it was usually characterized by chronic marginal gingivitis , gingival enlargement , materia alba , stain , calculus , gingival recession , tooth mobility and pocket formation . only four patients were free of gingival disease , three of these were under 3 years of age , 4th was an 18 year old girl whose roentgenograms showed both vertical and horizontal alveolar bone loss in all four quadrants of the mouth . in this study of 70 down syndrome cases , 65 patients had periodontal diseases which consisted mainly in the form of chronic marginal gingivitis , followed by gingival enlargement , materia alba , calculus , stains , pocket , gingival recession . the periodontal hygiene was the most relevant cause observed for the initiation and progress of periodontal disease in the majority of cases . however , the few cases where orthopantomography was performed showed early to moderate periodontitis . unlike other studies , the present finding suggests that increased periodontal disease may correlate to the poor oral hygiene awareness in our country as compared to the western countries , which may exaggerate the already compromised leukocyte function and give a high incidence of periodontal disease in down syndrome children in our country . the prominent findings like flat nasal bridge ( 94.3% ) , hypertelorism ( 92.9% ) , high arched palate ( 78.6% ) and fissured tongue ( 78.6% ) in our study , suggest that they could be used as a reliable clinical markers to diagnose down syndrome condition .

background : in general , mentally challenged children have higher rates poor oral hygiene , gingivitis and periodontitis than the general population . an investigation was undertaken to assess the oral manifestations of mentally challenged children in chennai , india.materials and methods : the study group consisted of 150 children ( 70 down syndrome patients and 80 cerebral palsy patients ) . of which , 93 patients were males and 57 were females.results:speech difficulty hindered the communication between the patient and the dentist . mastication and swallowing difficulties were also present in few children . profuse salivation was a cause for drooling of saliva down the cheeks , which was a constant finding in cerebral palsy children . the oral hygiene statuses of the patient were significantly poor . the prevalence of periodontitis was 35.7% in down syndrome and 55.0% in cerebral palsy patients . whereas , the prevalence of gingivitis was found to be 92.9% and 61.3% respectively . the prevalence of fractured maxillary anterior teeth was found to be more evident in cerebral palsy patients ( 62.9% ) when compared to down syndrome patients ( 0.0% ) . an increase in age shows an increase in the decayed - missing - filled teeth which is statistically significant.conclusion:the prominent findings like flat nasal bridge ( 94.3% ) , hypertelorism ( 92.9% ) , high arched palate ( 78.6% ) and fissured tongue ( 78.6% ) in our study , suggest that they could be used as a reliable clinical markers to diagnose down syndrome condition .

non - alcoholic fatty liver disease ( nafld ) is a public health problem worldwide , with an incidence of 20 - 30% in european countries . the spectrum of nafld ranges from usual steatosis to non - alcoholic steatohepatitis ( nash ) and eventually carcinoma . nafld is tightly correlated with overweight and is considered as a predictor of the metabolic syndrome . incidence of nafld among patients with diabetes is considered to be 65% , which is much more than its incidence among healthy individuals . clinical features of nafld encompass overweight , insulin resistance ( ir ) , and dyslipidemia . ir increases the amount of fat tissue lipolysis and the flow of free fatty acids to the liver cell . hyperglycemia induces lipid reposition in the hepatocytes by increasing lipogenesis while blocking fatty acid oxidation ( fao ) and lipid transfer in the liver . several studies have shown a significant relationship between vitamin d level and chronic heart disease ( chd ) , diabetes , metabolic syndrome , and ir . it has been shown that colon , pancreas , and also immune cells have vitamin d receptors . vitamin d has been suggested as having a main role in ir and pathology of type 2 diabetes mellitus or -cell functioning . vitamin d deficiency increases serum parathyroid hormone ( pth ) level and this , in turn , increases ir in the peripheral tissue . therefore , the aim of this study was to determine the effect of vitamin d supplementation on ir in patients with nafld . a randomized controlled trial ( irct registration code : irct2013060411763n8 ) was conducted on 60 patients with nafld . this study was conducted in metabolic liver disease research center in isfahan university of medical sciences . the study was performed with the approval of the local ethics committee of isfahan university of medical sciences . exclusion criteria of our study were : having acute illness , hepatitis c , b , or wilson 's disease ; history of chronic liver disease or other conditions that affect the gallbladder and bile ducts ; pregnancy ; history of taking any drugs affecting the level of alanine aminotransferase ( alt ) , such as valproic acid , tamoxifen , 3-hydroxy-3-methyl - glutaryl - coa reductase ( hmg - coa reductase ) inhibitors , metformin , angiotensin - converting enzyme 1 ( ace1 ) , and angiotensin - converting enzyme receptor 1 ( acer 1 ) ; and any kinds of medication addiction . patients were randomly assigned to consume vitamin d supplements ( n = 30 ) or placebo ( n = 30 ) for 6 weeks . placebo capsules were of the same appearance , color , odor , and taste as vitamin d3 capsules . intervention period was 10 weeks , and patients received vitamin d supplements or placebo every week ( 1 vitamin d or placebo / week ) . the level of serum 25-hydroxy vitamin d [ 25(oh ) d ] was measured at the beginning and end of the study . dietary records were collected every 2 weeks and intake was determined based on the estimated values in household measurements . to obtain the nutrient intake of the participants on the basis of these 5-d food diaries , we used nutritionist iv software ( version 7.0 ; n - squared computing , salam , or , usa ) , which was modified for iranian food items . five - day physical activity records were collected using 24-h physical activity record questionnaire ( one per 2 weeks ) . physical activity level was estimated as metabolic equivalent minutes per week ( met - hours / week ) . in order to calculate met - hours / week , we used the following formula : days per week multiplied by hours of exercise each time met equivalent of exercise , and summed up all met - hours / week values to estimate the total met - hours / week for each person . fasting blood samples were taken and 25(oh ) d was assessed using direct competitive immune assay kit ( diasercine italian company , monza , itsly ) at the beginning and end of the study . blood glucose level was measured using hitachi auto - analyzer , and serum insulin levels were measured with radioimmunoassay kit pars azmoon , tehran , iran ( tehran pars test ; tehran , iran ) . ir was measured on the basis of the homeostasis model assessment of ir ( homa - ir ) , and the percentage of -cell function was assessed on the basis of the homeostasis model assessment of ( homa- ) using the following formulae : homa - ir = [ fasting insulin ( mu / l ) fasting glucose ( mg / l)/405 ] % homa- = [ fasting insulin ( mu / l ) 360/fasting glucose ( mg / l ) 63 ] level of liver steatosis was measured using ultrasonography with esaote medical ultrasound machine ( convex 3.5 mhz ) at the beginning and end of the study . hepatic ultrasonography was done by someone who was blinded to the objectives of the study . for ultrasound , patients were required to fast for 8 h. ultrasonography was performed in supine position . echogenicity of the liver , presence or absence of bulky tumors , and cystic or solid calcification also were assessed . liver steatosis was scored semi - quantitatively on a scale of 0 - 3 , where 0 denoted absent , 1 was given for mild , 2 for moderate , and 3 for severe steatosis . independent - sample student 's t - test was used to detect differences in general characteristics and dietary intake between the two groups , and paired t - test was used to assess differences within groups . changes of nafld grades were analyzed by ordinal regression ( adjustment for age and sex ) . chi - square test was used to detect differences in fatty liver grades in the two groups at baseline . all statistical analyses were conducted using the statistical package for the social sciences ( spss ) , version 16 ( spss inc . ) . this study is approved by ethical committee of isfahan university of medical sciences and helsinki 's guideline is followed , completely and addicts to any kinds of drug . fasting blood samples were taken and 25(oh ) d was assessed using direct competitive immune assay kit ( diasercine italian company , monza , itsly ) at the beginning and end of the study . blood glucose level was measured using hitachi auto - analyzer , and serum insulin levels were measured with radioimmunoassay kit pars azmoon , tehran , iran ( tehran pars test ; tehran , iran ) . ir was measured on the basis of the homeostasis model assessment of ir ( homa - ir ) , and the percentage of -cell function was assessed on the basis of the homeostasis model assessment of ( homa- ) using the following formulae : homa - ir = [ fasting insulin ( mu / l ) fasting glucose ( mg / l)/405 ] % homa- = [ fasting insulin ( mu / l ) 360/fasting glucose ( mg / l ) 63 ] level of liver steatosis was measured using ultrasonography with esaote medical ultrasound machine ( convex 3.5 mhz ) at the beginning and end of the study . hepatic ultrasonography was done by someone who was blinded to the objectives of the study . for ultrasound , patients were required to fast for 8 h. ultrasonography was performed in supine position . echogenicity of the liver , presence or absence of bulky tumors , and cystic or solid calcification also were assessed . liver steatosis was scored semi - quantitatively on a scale of 0 - 3 , where 0 denoted absent , 1 was given for mild , 2 for moderate , and 3 for severe steatosis . independent - sample student 's t - test was used to detect differences in general characteristics and dietary intake between the two groups , and paired t - test was used to assess differences within groups . changes of nafld grades were analyzed by ordinal regression ( adjustment for age and sex ) . chi - square test was used to detect differences in fatty liver grades in the two groups at baseline . all statistical analyses were conducted using the statistical package for the social sciences ( spss ) , version 16 ( spss inc . ) . this study is approved by ethical committee of isfahan university of medical sciences and helsinki 's guideline is followed , completely and addicts to any kinds of drug . the study flowchart shows the screening , randomization , and follow - up of the participants [ figure 1 ] . in this study , 29 men and 31 women participated . compliance with the treatments was good in both groups and no side effects were reported . on the basis of 5-d dietary intake and physical activity records , no significant differences were seen between the two groups . laboratory characteristics in intervention and control groups when the analyses were adjusted for baseline characteristics , vitamin d supplementation resulted in increase of serum 25(oh ) d concentrations compared with placebo [ + 68 ( 12 ) compared to 1.9 ( 2.44 ) nmol / ml ; p = 0.001 ] [ table 2 ] . intake of vitamin d supplements led to a marginally significant reduction in fasting blood glucose ( fbs ) and homa - ir level [ fbs : 12 ( 4 ) compared to 3 ( 2 ) mg / dl in the intervention and control groups , respectively ; p = 0.055 and homa - ir : 1.75 ( 0.23 ) compared to 0.12 ( 0.41 ) in the intervention and control groups , respectively ; p = 0.066 ] . moreover , serum calcium was increased in the intervention group compared to the control group [ 4 ( 0.4 ) compared vs. 3.2 ( 1 ) mg / dl ; p = 0.032 ] . dietary intake and physical activity of nafld of intervention and control groups the aim of this study was to assess the effect of vitamin d supplementation on blood sugar and different indices of ir in patients with nafld . in this study , vitamin d supplementation caused a marginally significant decrease in fbs level and homa - ir , however , had no significant effect on insulin level and homa - b . there are some evidences showing that vitamin d deficiency has a relationship with the risk factors of chronic diseases , including nafld and other metabolic risk factors . it has been suggested that low serum levels of vitamin d may increase ir and , in turn , the risk of diabetes mellitus type 2 . ir elevates the amount of fat tissue lipolysis and increases the flow of free fatty acids inside the liver cell . effects of vitamin d supplementation on the metabolism of glucose have been demonstrated in several studies . our findings are similar to the results of other studies , and ir was found to decrease after vitamin d intake . inzucchi et al . demonstrated in their study a 60% reduction in ir by vitamin d supplementation , while the reduction observed on administration of metformin and troglitazone was 54% and 13% , respectively . in another study , von hurst et al . ken et al . found a negative association between 25(oh ) d concentration and fbs . however , witham et al . showed that vitamin d ( at several dosages ) had no effects on ir or on fbs . nagpal et al . showed that vitamin d supplementation had no effect on insulin sensitivity , but supplementation with vitamin d for 2 years could reduce homa - ir . in this study , they showed that long - term supplementation of vitamin d increased insulin sensitivity , while in our study vitamin d supplementation for a short term increased insulin sensitivity . differences in age and metabolic risk factors of the subjects , as well as the doses of vitamin d supplementation can explain the differences observed in the results of our study and various other studies . patients in our study were older than patients in other studies ; therefore , synthesis of vitamin d was reduced in the patients . it suggested that vitamin d increasing calcium in cells , in turns conduction to elevating glucose into the cells . vitamin d modulates nuclear peroxisome proliferative activated receptor ( ppar ) which is a key factor in the ir . vitamin d reduces the transcription of pro inflammatory cytokines that increase ir , such as interleukins like il 1 , il 6 , and tumor necrosis factor ( tnf ) ; also , vitamin d reduces the gene transcription of nuclear factor kappa light chain enhancer of activated b cells ( nf b ) . increasing these inflammatory parameters can even lead to the lipid profile disorders which can put patients with non - alcoholic fatty liver disorder in metabolic syndrome and cardiovascular dysfunctions . the strength of the present study is that it was a double - blind rct conducted in a country with a high prevalence of nafld and hyopovitaminosis vitamin d. in this study , we had several limitations . the first limitation was the use of ultrasound for the diagnosis of fatty liver disease , while for accurate diagnosis of fatty liver , liver biopsy is needed . the second limitation was the small sample size of participants , especially in grades one and two . a larger sample size with longer period of follow - up perhaps would have given more favorable results . more studies need to be conducted to demonstrate the effect of vitamin d supplementation on glycemic indicators .

background : vitamin d supplementation has been shown to decrease insulin resistance through which it might cause fatty liver . fatty liver increasingly results in type 2 diabetes mellitus ( t2 dm ) . insulin resistance and fatty liver are particularly closely related . the aim of present study is to examine the effect of vitamin d supplementation on blood sugar and different indices of insulin resistance in patients with non - alcoholic fatty liver disease ( nafld).materials and methods : this randomized placebo - controlled clinical trial was conducted on 60 patients with nafld , who were divided equally into intervention and control groups . patients in the intervention group received vitamin d3 ( 50,000 iu ) and patients in the control group received placebo capsules every week for 10 weeks . blood sugar , homeostatic model assessment - insulin resistance ( homa - ir ) , and homeostatic model assessment - beta cell ( homa - b ) were checked at baseline and after 10 weeks of the intervention . adjustment for variables was performed by analysis of covariance ( ancova).results : vitamin d supplementation resulted in increased serum 25-hydroxy vitamin d [ 25(oh ) d ] concentration in the intervention group compared to the control group [ + 68 ( 12 ) vs. 1.9 ( 2.44 ) ; p = 0.001 ] . intake of vitamin d supplements led to a marginally significant decrease in fasting blood glucose [ fbs : 12 ( 4 ) in the intervention group compared to 3 ( 2 ) in the control group ; p = 0.055 ] . also , homa - ir decreased in the intervention group compared to the control group [ 1.75 ( 0.23 ) vs. 0.12 ( 0.41 ) ; p = 0.066].conclusions : vitamin d supplementation resulted in decreased homa - ir and fbs concentration in patients with nafld ; however , it did not affect the insulin level and homa - b significantly .

the most common epithelial malignancy in the oral cavity is squamous cell carcinoma ( scc ) , which includes 90% of oral malignancies with its different varieties and also has a poor prognosis ( 1 ) . oral squamous cell carcinoma ( oscc ) is a complex malignancy of environmental factors , viral infections and genetic variations , which affect reciprocally and cause a malignant condition ( 1 ) . the effects of different oncogenic viruses such as hpv , hsv and ebv are discussed in its development ( 2 , 3 ) . it is a common pathogen that infects the majority of the population ( 4 ) . it s presented in the gingival sulcus fluid ( gsf ) in many healthy people ( 5 ) . the cmv - related disease is happened when the immune system is still undeveloped or in the immunosuppressed cases ( 6 ) . there is a high prevalence of hcmv in tumors with different sources such as brain cancer ( 7 ) and salivary gland cancer ( 8) . also , it has been proved that hcmv has the ability to control host gene expression , oncomudulatory or oncogenic function ( 9 ) . since the role of the hcmv infection in the oscc has not been investigated in the south east of iran and according to the importance of the role of viral factors in development of the oscc , we decided to investigate the matter in this study . all of the paraffin - embedded biopsies with oscc diagnosis were investigated in the oral pathology department of zahedan dental faculty ( center of the greatest southeast province of iran ) from 2005 to 2014 . the demographic information including age , gender , and location of the lesions were extracted from the patient s records . two oral and maxillofacial pathologists determined the histopathological grade of the samples by observing the microscopic h & e slides . tumors with high maturity were classified as grade i whereas tumors with high cellular and nuclear polymorphism and few or no keratin products were graded as grade iii and tumors between these two grades named as grade ii ( 10 ) . then 60 microns in diameter were cut from paraffin blocks and dna samples were extracted using the recoverall total nucleic acid isolation kit for formalin- or paraformalin - fixed , paraffin - embedded ( ffpe ) tissues ( ambion , carlsbad , california , usa ) during 4 phases of deparaffinization , protease digestion , nucleic acid isolation , nuclease digestion and final purification . specific primers amplisensebv / cmv / hhv-6-screen - frt pcr kit ( moscow , russia ) was used for quantitative assessment of cytomegalovirus real - time polymerase chain reaction ( rt - pcr ) method . data were analyzed using anova and chi - square test with spss 19 software ( inc . , chicago , illinois , usa ) . the protocol of this study was approved by the ethical committee of research deputy of zahedan university of medical sciences with code number 6156 . the mean age of the oscc samples was 58.6 13.8 . among the 48 reviewed cases , 32 cases ( 66.7% ) were female with the mean age of 56.4 12.8 years and 16 ( 33.3% ) were male with a mean age of 63 15.3 years old . twenty one cases ( 43.8% ) were histopathological grade i , 19 cases ( 39.6% ) were grade ii and 8 cases ( 16.7% ) were grade iii . in general , 32.7% of the oscc samples were found in the buccal mucosa , 32.7% in mandibular gingiva , 17.3% in maxillary gingiva , 7.7% in lip , 7.7% in tongue , and 1.9% in floor of mouth . anova and chi - square tests showed no significant difference ( p > 0.05 ) between gender , mean age and histopathological grades respectively ( tables 1 and 2 ) . ( % ) . only 3 cases ( 6.3% ) of 48 samples were positive for hcmv which included a 76-year - old male with oscc in the maxillary gingiva , a 70-year - old female with a lesion in the mandibular gingiva and a 60-year - old female with oscc in tongue . all of 3 positive cases were grade i and the load average of the virus was 57.7 10 57.6 10 . due to the low number of the hcmv positive cases the overall prevalence of hcmv in patients with oscc lesions in different areas have been reported from 0 to 91.5% ( 2 , 3 , 11 - 13 ) . the hcmv in this study was more prevalent than the study in the northeast of iran . this difference , however , could be owing to the population under study because delavarian examined only oscc in patients younger than 40 years ( 2 ) . wei reported higher prevalence of hcmv in oscc than normal oral tissues ( 11 ) . a variety of genetic , environmental , or viral agents can clarify this regional difference ( 14 ) . the presence of the hcmv near some tumors and its role in the tumor s development and progression were discussed in numerous articles ( 7 , 8) . human cytomegalovirus encodes various proteins that affect cellular processes and result in increased proliferation , inhibition of apoptosis , stimulation of cellular migration , release of stimulating factors , induction of resistance to chemotherapy and raising telomerase activity ( 15 ) . it is considered that hcmv and tumors help each other to achieve their common purpose theory nowadays ( escape from the immune system ) . one side , viruses gain weak immunological environment of tumors to avoid detection by the immune system . on the other hand hcmv creates immune tolerance in tumor cells and avoids immune surveillance by encoding viral proteins ( i.e. through non - coding rnas ) and induction of cellular factors ( 16 ) . for example several products of the primary hcmv genes block major histocompatibility complex ( mhc ) class i antigen expression that is needed for cd8 cytotoxic tumor killing ( 17 ) . studies have shown that gender , age , and location of lesions in patients with cutaneous scc are not associated with hcmv prevalence ( 18 , 19 ) . in the present study due to the small positive hcmv cases , it was not possible to survey relationship with such parameters . in general , according to the low incidence of hcmv infection in oscc , it can be concluded that the virus can infect epithelial cells but probably would not have a direct oncogenic role shown ( 3 ) . the presence of hcmv in cancerous tissues implies that the virus can increase the possibility of oncogenesis or involve cancerous tissues as an opportunistic infection ( 20 ) . prevalence of hcmv in oscc is very low in the southeast of iran and the virus probably has little or no role in the development of oscc . it is suggested that future studies be performed to investigate the synergistic effects of factors such as smoking and tobacco on hcmv infection and active protein expression of this virus in oscc .

background : carcinogenesis is a multi - step process and the role of infectious agents in this progression has not been fully identified . since human cytomegalovirus ( hcmv ) is frequently presented in the gingival sulcus fluid , we hypothesized that this virus would be important in the pathogenesis of oral squamous cell carcinoma ( oscc).objectives : the aim of this study was to investigate the presence of active hcmv in different histopathological grades of oscc in southeast of iran.materials and methods : forty eight individual specimens were evaluated in this study . serial sections were obtained from paraffin - embedded tissue samples of oscc biopsies . the frequency of hcmv was investigated using the real - time polymerase change reaction method after dna extraction from biopsies.results:the mean age of the patients ( 66.7% female and 33.3% male ) was 58.6 years . only three cases ( 6.3% ) of the grade i , oscc biopsies , were positive for active hcmv with average load of 57.7 103.conclusions:according to the low prevalence of hcmv in oscc , it seems that this virus plays a minor role in this kind of cancer at least in southeast of iran . more comprehensive studies are needed to investigate the oncomodulatory effect of this virus on oscc .

recent work has demonstrated the importance of the abdominal muscles in ensuring sufficient spine stability to prevent buckling and enhance function2 , 3 . the curl - up , performed as an abdominal exercise , has been shown to produce reasonable levels of activity in the rectus abdominis ( ra ) muscle while minimizing the resultant spine load and has been incorporated into several low back fitness programs4 . the use of unstable surfaces underneath the subject for stability training of the injured low back is becoming more popular4 . swiss balls have been incorporated into strength - training regimens and can reportedly be used to more effectively train the musculoskeletal system . performing strength exercises on swiss balls has been advocated based on the belief that a labile surface will provide a greater challenge to the trunk musculature , increase the dynamic balance of the user , and possibly train users to stabilize their spines to prevent and treat injury5 . studies have been conducted to document the loads imposed on the spine during various abdominal exercises6 , but the effect of unstable surfaces has not been examined . we believe that there is a clinical need to understand the effects of using unstable surfaces to challenge the muscular system during the curl - up exercise . recent evidence regarding the conservative management of low back pain suggests that the restoration of neuromuscular control in the transverse abdominis ( tra ) , together with minimal contraction of other superficial oblique , internal , and external abdominal muscles , is essential for effective treatment during the early stages of rehabilitation7 , 8 . previous studies have demonstrated that performance of the abdominal hollowing exercise in particular is far more effective than performance of general core - stabilizing techniques in improving the cross - sectional area of the tra9 , 10 . the abdominal hollowing exercise is designed to emphasize deep local muscle activity while minimizing the activity of the more superficial global muscles . although many studies on the effect of the abdominal hollowing exercise in rehabilitation programs have been performed , none have examined the combined effect of the abdominal hollowing exercise and curl - up exercise on an unstable surface . therefore , the purpose of this study was to investigate the effects of the abdominal hollowing exercise on trunk muscle activity during the curl - up exercise on an unstable surface by measuring electromyography ( emg ) activity . fourteen healthy subjects ( nine males , five females ) volunteered to participate in this study ( table 1table 1.summary of anthropometric characteristics and neck disability index of the study participantscharacteristiccontrol group(n = 13)mnp group(n = 14)gender ( n , male)66age ( years ) , mean ( sd)20.6 1.620.6 1.5height ( cm ) , mean ( sd)167 . 6.9168.0 8.0weight ( kg ) , mean ( sd)60.7 10.761.0 12.4neck disability index ( ndi ) ( % ) , mean ( sd)3.3 2.616.9 7.1*mnp : mild neck pain ; sd : standard deviation . all subjects were in good health and reported no history of neurological and/or respiratory diseases . none of them had undergone institutional care for any pathological back conditions during the preceding year . * significant difference between the two groups ( p < 0.05 ) emg data were collected using a biopac mp150wsw data acquisition system ( biopac systems , inc . , surface electrode pairs were oriented along the line of action of the underlying muscle fibers on the right side : ra , centered 2 cm lateral and caudal to the umbilicus ; tra , centered 2 cm cephalad to the pubic bone , just lateral to the midline , and parallel to the superior pubic ramus ; external oblique ( eo ) , centered over the tip of the eighth rib diagonally ; and internal oblique ( io ) , centered 2 cm proximal to the midpoint from the anterior superior iliac spine ( asis ) to the symphysis pubis diagonally11 . the maximum voluntary isometric contraction ( mvic ) of each muscle was measured using the maneuver suggested by kendall et al.12 for normalization . the subjects were instructed on how to perform the curl - up and abdominal hollowing exercises by the investigator . all subjects were instructed to place their hands on their abdomen for tactile feedback during both exercises . for the abdominal hollowing , the subjects were instructed to draw the lower part of the abdomen up and in toward the spine without moving the trunk or pelvis . a pressure biofeedback unit ( chattanooga group , inc . , tn , usa ) was used to ensure that the subjects were performing the exercises correctly . a pressure cuff unit was placed under their lumbar spine and inflated to 40 mmhg before the exercises were performed13 . when the subject performed the hollowing correctly , the pressure either stayed at 40 mmhg or decreased , and the subjects felt their abdomen hollow . the subjects held the trunk and pelvis in that position for 5 s while continuing to breathe normally1 . the first task was to perform a traditional curl - up exercise on a flat floor with the hips and knees flexed to 90 and legs supported on a platform . the subject s hands were placed by the sides of their body , and only the head and shoulders were elevated from the flat floor . the next two tasks varied based on the type of unstable surface . for the second task , the subjects assumed the supine position on a flat floor with the hips and knees flexed to 90 and legs supported on a gym ball . ball inflation was checked between subjects to ensure that the diameter remained at 70 cm prior to each test . for the third task , the subjects assumed the supine position on a flat floor with the hips and knees flexed to 90 and legs supported on a gym ball . only the head and shoulders were then elevated from the flat floor with performance of the abdominal hollowing exercise during the curl - up exercise . the subjects held each contraction for 5 s and then returned to the resting position . each subject had 1 min of rest between each trial and 5 min of rest between the tasks . repeated - measures anova with post hoc bonferroni correction was used to determine the trunk muscle activation during the three exercises ( p < 0.05 ) . the mean emg amplitudes of the abdominal muscles during the three curl - up exercises are presented in table 2table 2.mean relative muscle activity ( % mvic ) and standard deviation of the various abdominal muscles during three different curl - up exercisesmusclesstable surfaceunstable surfaceunstable surfacewith abdominalhollowing exerciserectus abdominis*41.6 14.649.3 15.026.2 10.5external oblique43.6 18.648.2 12.849.8 19.8internal oblique*42.1 18.047.2 16.662.6 21.2transverse abdominis*19.2 7.438.4 13.556.5 20.4*p < 0.05 . the emg activities of the ra and eo trunk muscles during the curl - up exercise were significantly higher on an unstable surface than on a stable surface . the emg activity of the ra was lower when combined with the abdominal hollowing exercise on an unstable surface than that when performing the curl - up exercise on both a stable and unstable surface . the emg activities of the tra and io were higher when combined with the abdominal hollowing exercise on an unstable surface than those during the curl - up exercise on both a stable and unstable surface . the present study showed that the combination of the abdominal hollowing exercise and curl - up exercise on an unstable surface was associated with higher emg activities of the tra and io and lower emg activity of the ra than during the curl - up exercise on both stable and unstable surfaces . the emg activities of the ra and eo were significantly higher on an unstable surface than on a stable surface during the curl - up exercise . several studies have suggested that the swiss ball may be helpful in increasing trunk muscle activity for stabilization of the lumbar spine during rehabilitation exercises5 . during the curl - up exercise on the swiss ball , the ra and eo activity may undergo more physical demand , as evidenced by the fact that the swiss ball created more perturbations in our study . contraction of superficial trunk muscles such as the ra and eo without local muscle contraction may lead to compressive loading and shearing forces during the curl - up exercise , which may induce stress on the inner tissues during the entire range of motion and serve as a major source of spinal pain . although the curl - up exercise on an unstable surface induced higher emg activities of the ra and eo , a reverse effect may be seen in individuals with spinal instability . thus , clinicians who apply an unstable surface to increase the trunk muscle activity must consider the provocation that patients endure . in this study , the emg activities of the tra and io were higher during the combination of the abdominal hollowing exercise and curl - up exercise on an unstable surface . conversely , the emg activity of the ra decreased during the combination of the abdominal hollowing exercise and curl - up exercise on an unstable surface . the abdominal hollowing exercise was developed for neuromuscular retraining and kinesthetic awareness of the tra14 . our results showed that abdominal hollowing exercise resulted in higher emg activity of local muscles than of global muscles . the local muscle system involves the tra and io , which provide dynamic stability to each spinal segment15 . the findings of the present study suggest that the abdominal hollowing exercise as a therapeutic option may be used to preferentially load certain local muscle groups during the curl - up exercise on an unstable surface , and that these effects may be favorably produced in individuals with low back pain . first , our results can not be generalized to other populations because all the subjects who participated in the study were healthy young individuals . second , surface emg was used to monitor muscle activity , leaving the possibility of crosstalk from adjacent muscles . this study provides empirical evidence that the curl - up exercise in combination with the abdominal hollowing exercise is more useful for enhancing abdominal muscle activity than is the curl - up exercise on an unstable surface . this finding offers clinical insight into the additive effect of the abdominal hollowing exercise in selectively stimulating local muscles and suggests that it may be used as an alternative core stabilization technique for the management of patients with low back pain . these findings should be considered when selecting rehabilitation exercises for neuromuscular retraining of the abdominal muscles .

[ purpose ] the purpose of this study was to investigate the effects of the abdominal hollowing exercise on trunk muscle activity during the curl - up exercise on an unstable surface by measuring electromyography ( emg ) activity . [ subjects ] fourteen young healthy adults ( nine male , five female ) voluntarily participated in this study . [ methods ] each subject was asked to perform a curl - up exercise on two supporting surfaces ( stable and unstable surfaces ) combined with the abdominal hollowing exercise on an unstable surface . the muscle activities of the rectus abdominis ( ra ) , external oblique ( eo ) , internal oblique ( io ) , and transverse abdominis ( tra ) were measured using surface emg during performance of the curl - up exercise . [ results ] the emg activity of the ra and eo was significantly higher on an unstable surface than on a stable surface during the curl - up exercise . the emg activities of the tra and io were greater in combination with the abdominal hollowing exercise on an unstable surface than during the curl - up exercise on both a stable and unstable surface . [ conclusion ] these findings suggest that the local trunk muscle activity during the curl - up exercise is more strongly affected by combination with the abdominal hollowing exercise than by performance on an unstable supporting surface .

kidney transplantation is the most effective option in patients with chronic renal failure in terms of survival and quality of life . however , during the last few years , waiting lists for this procedure have become longer due to the decrease in the number of brain - dead donors , among other factors . in this setting , living donor kidney transplantation ( ldkt ) plays a major role and represents the only real option for transplantation in some patients [ 2 , 3 ] . due to the growth of ldkt , new scenarios have been developed in which decisions on the feasibility of kidney transplantation can be difficult to make [ 4 , 5 ] . in our institution , monoclonal gammopathy of undetermined significance ( mgus ) was detected during investigation of two possible living donors , a condition potentially contraindicating donation . a review of the current literature was performed but , to date , publications on this topic are lacking . the amsterdam criteria for living kidney donation also were reviewed but this matter is not considered . after multidisciplinary evaluation , the donation was not contraindicated and two kidney transplantations from living donors with mgus were performed . she was affected by chronic renal failure stage v secondary to renal polycystic disease under renal replacement therapy with hemodialysis . other pathologic antecedents were hypertension , hypercholesterolaemia and breast carcinoma without recurrence in the 10 years prior to the pre - transplantation study . he was a 63-year - old caucasian man and showed no contraindication for donation except for mgus . the monoclonal protein was igg lambda and the bone marrow examination showed 3% plasma cells . g / l and serum free light chains lambda and kappa were 18.50 and 21.20 mg / l , respectively , with a normal ratio . angiography showed critical stenosis of the renal artery and angioplasty with stent placement was performed . renal function subsequently improved and the patient showed no further complications . at the time of writing , 42 months after kidney transplantation , serum creatinine is 1.2 mg / dl ( 106 mol / l ) and the 24-h urinary protein excretion is 140 mg . three months after the procedure , tacrolimus was switched to sirolimus due to the donor s age and to minimize the risk of malignancy . the donor s renal function is currently normal , no complications have been detected and there is no evidence of mgus progression . the patient was a 34-year - old caucasian man , without toxic habits , with chronic renal failure stage v due to membranous glomerulonephritis but he had no other remarkable medical history . study of a possible living donor ( the patient s 71-year - old mother ) was performed . no contraindications for donation were found but she carried an mgus with two monoclonal proteins , igg kappa and iga lambda . a bone marrow examination showed 8% plasma cells . g / l and serum free light chains lambda and kappa were 14.4 and 16 mg / l , respectively , with a normal ratio . kidney transplantation was carried out in may 2007 with no complications and renal function progressively improved . currently , 36 months after the transplantation , the patient has a serum creatinine level of 1.8 mg / dl ( 159 mol / l ) and a 24-h urinary protein excretion of 200 mg . three months after transplantation , tacrolimus was switched to sirolimus for the same reasons as in case 1 . the patient has developed no immunological or infectious complications and serum protein electrophoresis and serum immunofixation revealed no monoclonal proteins . no complications have occurred in the donor and there is no evidence of mgus progression . mgus is a benign condition observed in 3% of caucasians aged > 50 years old and 5% of those aged > 70 years old . this entity consists of the presence of a serum monoclonal immunoglobulin , called m protein , with no evidence of malignant disease such as multiple myeloma ( mm ) , macroglobulinemia , al amyloidosis or other plasma - cell proliferative disease . the main concern of mgus is the potential risk of progression to a malignant disease . this risk to evolve to mm is 1% per year and the main risk factor for progression is the serum m protein concentration . the risk of progression persists even after 25 years of follow - up [ 68 ] . mgus in a living kidney donor could potentially lead to complications for both the donor and the recipient . for the donor , the main complication would be the progression of mgus to mm , which could involve the kidney with risk of renal failure in a single kidney patient . for the recipient , the main complication would be transmission of mgus through the transplant , leading to a risk of malignancy . to date , neither of the two patients has developed complications at 42 and 36 months after transplantation , respectively . serum protein electrophoresis and serum immunofixation have shown no monoclonal proteins , indicating that mgus transmission has not occurred . the donors have normal renal function and there is no evidence of progression to mm . in our opinion , the appropriate immunosuppressive treatment in these patients is the use of mammalian target of rapamycin inhibitors to minimize the risk of malignancy and to avoid the nephrotoxicity of calcineurin inhibitors in donors of advanced age . in the foreseeable future , living kidney donation from donors with mgus may no longer be exceptional due to the high incidence of mgus , the increasing number of ldkt and the acceptance of greater age in donors and recipients . due to the favorable results obtained in our two patients until now , we no longer consider mgus in the donor as a contraindication for ldkt .

during the last few years , the number of living donor kidney transplants has increased and this form of transplantation is currently the only option in some patients . we report two cases of living donor kidney transplantation in which the donor carried monoclonal gammopathy of undetermined significance . neither of the two receptors has developed complications at 42 and 36 months after transplantation , respectively , and the donors have normal renal function and there is no evidence of progression to multiple myeloma .

clear cell ependymoma is a recently recognized rare variant of ependymoma that is largely composed of round clear tumor cells with few , if any , characteristic patterns of ependymomas such as true ependymal rosettes , or perivascular pseudorosettes , which may be misdiagnosed as oligodendroglioma , central neurocytoma or metastatic renal cell carcinoma of the clear cell type ( 1 ) . clear cell ependymoma is known to have a predilection for extraneural metastases and early recurrence . therefore , resection followed by local radiotherapy is the treatment of choice as operation is possible ( 2 ) . only two cases of clear cell ependymomas that developed in the spinal cord have been reported in the literature ( 3 , 4 ) . albeit being rare , distinguishing clear cell ependymoma from astrocytic tumor is important because the operation modality between the two entities is quite different ( 5 ) . here , we emphasize the cytologic , histologic , immunohistochemical , and ultrastructural characteristics of clear cell ependymoma arising in the thoracic spinal cord . a 73-yr - old woman was transferred to the gil medical center due to low back pain that had begun two months previously . spine magnetic resonance ( mr ) images revealed a 2.0 cm - sized intramedullary mass at the t12 level . the mass appeared as isosignal on t1-weighted images and high signal on t2-weighted images ( fig . after the operation , radiation therapy was initiated . during 33 months of follow - up , oval to round tumor cells had abundant fibrillary cytoplasm and euchromatic round nuclei with occasional chromatin clumping ( fig . vesicular nuclei , eosinophilic nuclear pseudoinclusions , and nuclear grooves were occasionally detected ( fig . five micrometer - thick sections were stained with hematoxylin and eosin ( h&e ) , periodic acid - schiff ( pas ) , masson - trichrome , and reticulin . histologically , the mass was moderately cellular . round to oval tumor cells had large central nuclei with indistinct nucleoli and moderate amounts of clear cytoplasm , i.e. perinuclear halo , giving a honeycomb appearance of the tumor cells ( fig . this clear cell appearance , however , was not identified in the frozen touch smear . nuclear grooves and a few mitotic figures and occasional nuclear pleomorphism were found , but did not fulfil the criteria for anaplasia ( fig . immunohistochemistry was done by the avidin - biotin - peroxidase complex method using antibodies against the antigens shown in table 1 . the tumor cells were positive for s-100 protein , glial fibrillary acidic protein ( gfap ) , neuron specific enolase ( nse ) , and vimentin , whereas they were negative for epithelial membrane antigen ( ema ) , desmin , neurofilament , synaptophysin , chromogranin , pancytokeratin , and p53 protein . for electron microscopy , fresh samples were randomly taken and fixed in 2.5% glutaraldehyde , followed by 1% osmium with propylene dioxide , and finally embedded in epok 812 ( oken shoji ltd . , the thin sections ( 1 m ) were stained with toluidine blue and azure b solutions . they were examined with a transmission scanning electron microscope ( h-7100 , hitachi high - technologies corporation , tokyo , japan ) at an accelerating voltage of 75 kv . electron microscopy revealed that round to oval tumor cells had edematous vacuolated cytoplasm with microluminas ( fig . the tumor cells showed abundant cytoplasmic long processes containing abundant glial filaments , microtubules , free ribosomes , rough endoplasmic reticulums , lipid vacuoles , and dilated mitochondria . long , zipper - like cell junctions of zonula adherens type were frequently found at the intercellular spaces that were lined by abundant microvilli with rare cilia ( fig . 4b ) . based on the above findings , a diagnosis of clear cell ependymoma of spinal cord was made . a 73-yr - old woman was transferred to the gil medical center due to low back pain that had begun two months previously . spine magnetic resonance ( mr ) images revealed a 2.0 cm - sized intramedullary mass at the t12 level . the mass appeared as isosignal on t1-weighted images and high signal on t2-weighted images ( fig . after the operation , radiation therapy was initiated . during 33 months of follow - up , on crush smears , oval to round tumor cells had abundant fibrillary cytoplasm and euchromatic round nuclei with occasional chromatin clumping ( fig . vesicular nuclei , eosinophilic nuclear pseudoinclusions , and nuclear grooves were occasionally detected ( fig . five micrometer - thick sections were stained with hematoxylin and eosin ( h&e ) , periodic acid - schiff ( pas ) , masson - trichrome , and reticulin . round to oval tumor cells had large central nuclei with indistinct nucleoli and moderate amounts of clear cytoplasm , i.e. perinuclear halo , giving a honeycomb appearance of the tumor cells ( fig . this clear cell appearance , however , was not identified in the frozen touch smear . nuclear grooves and intranuclear eosinophilic inclusions that were seen on touch smears were rarely detected . a few mitotic figures and occasional nuclear pleomorphism were found , but did not fulfil the criteria for anaplasia ( fig . immunohistochemistry was done by the avidin - biotin - peroxidase complex method using antibodies against the antigens shown in table 1 . the tumor cells were positive for s-100 protein , glial fibrillary acidic protein ( gfap ) , neuron specific enolase ( nse ) , and vimentin , whereas they were negative for epithelial membrane antigen ( ema ) , desmin , neurofilament , synaptophysin , chromogranin , pancytokeratin , and p53 protein . for electron microscopy , fresh samples were randomly taken and fixed in 2.5% glutaraldehyde , followed by 1% osmium with propylene dioxide , and finally embedded in epok 812 ( oken shoji ltd . , the thin sections ( 1 m ) were stained with toluidine blue and azure b solutions . they were examined with a transmission scanning electron microscope ( h-7100 , hitachi high - technologies corporation , tokyo , japan ) at an accelerating voltage of 75 kv . electron microscopy revealed that round to oval tumor cells had edematous vacuolated cytoplasm with microluminas ( fig . the tumor cells showed abundant cytoplasmic long processes containing abundant glial filaments , microtubules , free ribosomes , rough endoplasmic reticulums , lipid vacuoles , and dilated mitochondria . long , zipper - like cell junctions of zonula adherens type were frequently found at the intercellular spaces that were lined by abundant microvilli with rare cilia ( fig . because clear cell ependymoma of the spinal cord does not show typical histology of conventional ependymoma including perivascular pseudorosettes and ependymal rosettes or canal , it should be distinguished from other clear cell tumors of the central nervous system including astrocytoma , oligodendroglioma , central neurocytoma , hemangioblastoma , and even metastatic renal cell carcinoma on routine histologic examination with h&e stain . previously cases of clear cell ependymomas , except for two , developed in the brain ( 1 - 4 ) . astrocytomas outnumber ependymomas in the spinal cord , and they share cytologic findings such as long , bipolar glial processes , and oval to round nuclei . however , with ultrastructural and immunohistochemical aids , most cases of clear cell ependymomas can be distinguished . now , the clear cell ependymoma subtype previously classified as foramen monro ependymoma is recognized as central neurocytoma by immunohistochemical and ultrastructural studies ( 6 ) . immunohistochemically , central neurocytoma shows eosinophilic fibrillary regions showing synaptophysin and chromogranin - reactivity . under electron microscopy , central neurocytoma shows numerous cytoplasmic processes filled with microtubules and synaptic vesicles with dense core granules , and oligodendroglioma shows concentric onionskin - like lamination . tumor cells of hemangioblastoma have abundant electron - lucent cytoplasm of lipid droplets , reminiscent of neuroendocrine granules . however , the diagnosis of clear cell ependymoma is quite difficult , especially in frozen slides because of the absence of clear cell morphology ( perinuclear halo ) in frozen slides . ( 7 ) described that clear cell ependymomas take the same biologic behavior as that of other ependymomas , and a proliferation index is required for the evaluation of malignancy . here , we carefully examined ultrastructural details to find different features of clear cell ependymoma from classic ependymoma . intracytoplasmic lumen is one of the histological characteristics and ultrastructural feature of ependymoma that corresponded to microlumina with or without microvilli - lining under electron microscopy ( 8) . regardless of the type of ependymoma , the intracytoplasmic lumen is one of the common findings . one case frequently containing granulo - tubular materials has been reported , which were regarded as degraded microvilli of the tumor cells ( 8) . kumar ( 9 ) compared the cytologic findings of classic ependymomas on crush smear with those of other tumors including meningiomas , schwannomas , astrocytomas , oligodendrogliomas , medulloblastomas , pituitary adenomas , choroid plexus papilloma , craniopharyngioma , and metastatic tumors . the most common findings out of 21 reviewed cases were ependymal rosettes ( 100% ) , nuclear grooves ( 71.4% ) , perivascular pseudorosettes ( 52.4% ) , and acinar structures ( 33.3% ) . papillary clusters ( 9.5% ) , calcification ( 9.5% ) , and intranuclear inclusions ( 9.5% ) and myxomatous material ( 4.8% ) can be seen in ependymoma . intranuclear inclusions can be seen in meningiomas , and calcification is a feature shared by choroid plexus tumor , oligodendroglioma , and meningioma . among them , nuclear grooves are specific cytologic findings of ependymomas that could not found in other tumors . as described in the previous articles , small foci of perivascular hyalinizing pseudorosettes are rarely found on h&e stain of clear cell ependymomas , which were previously and frequently misdiagnosed as oligodendroglioma ( 7 ) . in retrospect , like oligodendroglioma , which show no clear cell change on frozen sections , the morphogenesis of clear cell morphology in clear cell ependymoma is not supposed to be different from those of oligodendroglioma , and this perinuclear halo does not appear in classic ependymoma , whatever the fixation artifact , thus supporting the clear cell ependymoma as a different entity from the classic ependymoma ( 10 ) . in summary , cytologic findings of nuclear grooves and eosinophilic nuclear inclusions are helpful findings in clear cell ependymoma as in classic ependymoma . here we emphasize those findings on frozen examinations as well as acellular fibrillary zones , ependymal rosettes , and acinar structure because clear cell ependymoma does not show the typical morphology of classic ependymoma and it rarely occurs in spinal cord .

clear cell ependymoma was included in the world health organization classification of the nervous system in 1993 , and all the reported cases , except for two in the spinal cord , were located in the brain , mainly in the supratentorial compartment . astrocytomas outnumber ependymomas in the spinal cord , and the two entities partly share cytologic findings such as long , bipolar glial processes and oval to round nuclei resembling those seen in pilocytic astrocytoma . here , we report the first korean case of intramedullary clear cell ependymoma of the spinal cord , which is the third case situated in the spinal cord in the literature . the crush smear revealed round - to - oval nuclei with occasional nuclear eosinophilic inclusion and rare nuclear grooves . cytoplasm had fluffy eosinophilic glial processes , and acellular fibrillary zone . on hematoxylin - eosin stain , oval to round tumor cells had large central nuclei with indistinct nucleoli and a moderate amount of clear cytoplasm , i.e. perinuclear halo , mimicking oligodendroglioma . perivascular pseudorosettes and ependymal clefts were rarely found . in retrospect , perinuclear halo was absent on crush smears . ultrastructurally , they had extensive surface microvilli and edematous cytoplasm filled with abundant glial filaments and microlumens with or without microvilli . intercellular long cell junctions of the zipper - like zonula adherens type were found .

drug - induced liver injury ( dili ) is a major health problem that poses a challenge not only to health care professionals , but also the pharmaceutical industry and drug regulatory agencies . according to the united states acute liver failure study group , dili accounts for more than 50% of acute liver failure , including hepatotoxicity caused by the overdose of acetaminophen ( 39% ) and idiosyncratic liver injury triggered by other drugs ( 13% ) . the predominant forms of dili include acute hepatitis , cholestasis , and a mixed pattern . cholestasis is characterized by jaundice with a concurrent elevation in alkaline phosphatase , conjugated bilirubin , and glutamyl transpeptidase while mixed - pattern dili includes clinical manifestations of both hepatocellular and cholestatic injury . a 24-year - old female patient with cholelithiasis was admitted in the hospital for planned cholecystectomy . the patient did not reveal a previous history of any drug allergy or hypersensitivity reactions . open cholecystectomy was performed under spinal anesthesia and aseptic dressing was done after inserting a drain . postoperatively ceftriaxone ( 1 gm intravenous ) , piroxicam ( 20 mg intramuscular ) , and ranitidine ( 150 mg intravenous ) were administered to the patient perioperatively . after 24 h , high - colored urine was observed in the urine - collecting bag attached to the catheter . liver injury was not suspected at this time and fluid input was increased . on the third day , after the morning dose , a yellowish discoloration of the skin over the abdomen was observed . patient was physically well and did not complain of nausea , discomfort , or pain in the upper abdomen or around the operative wound area . vitals were stable with pulse , temperature , and blood pressure being within normal limits . patient had received four doses of 1 gm ceftriaxone , 20 mg of piroxicam , and 150 mg of ranitidine when the diagnosis of jaundice was made . diagnosis was delayed as there was no complaint from the patient and even the drain on operated site was completely dry . immediately , after suspecting a drug reaction , ceftriaxone and piroxicam were withdrawn . liver function tests were performed and showed a total serum bilirubin of 6.5 mg / dl , both direct and indirect were raised with values 4.2 and 2.3 mg / dl , respectively ; ast 148 iu / l , alt 164 iu / l , and alkaline phosphatase was 580 total protein , albumin , globulin , lactate , amylase , and blood glucose levels were within the normal range . liver function tests after 48 h showed decrease in the levels of serum bilirubin ( 2.5 mg / dl ) without significant decrease in ast , alt , and alkaline phosphatase levels . all readings were within the range , without any residual effect of the drug [ table 1 ] . adverse drug reactions ( adrs ) are a major hazard of modern medicine . in routine clinical practice adrs remain largely unrecorded even though such documentation can significantly contribute to quality assurance in drug therapy . the increased therapeutic use of cephalosporins brings about the risk of developing allergic reactions in susceptible patients . cephalosporins can induce severe or life - threatening ige - mediated reactions in some individuals . in this case report , the patient presented with cholestatic hepatitis after intravenous administration of ceftriaxone where the exact timing of appearance of symptoms could not be explained because the patient was physically fine without any symptoms . rechallenge was not done due to inherent risk involved but the patient showed positive response to the dechallenge test . according to cioms ( council for international organizations of medical sciences ) which is used for causality assessment of dili by scoring parameters , the total score is categorized into ranges of causality as highly probable , probable , possible , unlikely , and excluded . the clinical diagnosis and prediction of dili remains a major challenge due to various confounding factors . in this case , the other possible causes of postcholecystectomy cholestatic hepatitis were accidental ligation or injury of common bile duct . patient was taking piroxicam for relief of pain preoperatively also and ranitidine was not stopped even after the reaction . so the reaction is not due to the coadministered drug and since the procedure was performed under spinal anesthesia the risk of hepatitis with general anesthetic agents was also ruled out . in cases of drug - induced hepatitis , the clinical picture of the hepatitis may represent a direct toxic effect , an idiosyncrasy , or a cholestatic reaction . according to the cioms system of causality definitions the adr in this reported case is categorized as highly probable reaction , with a drug - induced mixed injury of the liver as levels of both the alanine aminotransferase and alkaline phosphatase were increased . the effect of ceftriaxone along with other hepatotoxic drugs should be considered in any case of elevated liver enzymes and hepatitis .

drug - induced liver injury is a major health problem . its predominant forms include acute hepatitis , cholestasis , and a mixed pattern . ceftriaxone is a third - generation cephalosporin and is widely used in the postoperative period due to its wider spectrum , longer half - life , and better tissue penetrability . earlier cases of high aminotransferase levels and hepatitis have also been reported with the use of ceftriaxone . here we report a case of cholestatic hepatitis with intravenous ceftriaxone .

glucagon - like peptide 1 receptor agonists ( glp1ras ) have become an accepted part of the diabetes pharmaco - therapeutic landscape . the glp1ras are included in guidelines from various professional bodies such as the international diabetes federation ( idf ) , the american diabetes association ( ada ) , european association for study of diabetes ( easd ) , and american association of clinical endocrinologists ( aace ) . glp1ras can be used as second - line and third - line agents , in combination with metformin and insulin . there is also evidence to suggest that glp1ras should be used earlier on in the natural history of diabetes , so as to utilize their full potential . an increasing number of glp1ras are available for use , or are in advanced phases of development . while they have earlier been divided according to chemical structure , glp1ras can also be classified based on their duration of action ( table 1 ) . this approach makes it easier to compare and contrast the various pharmacokinetic and pharmacodynamic properties of these drugs . short - acting glp1ras are those with a half - life of < 12 h , which requires daily or twice daily administration [ 2 , 3 ] . intermediate - acting glp1ras are those with a half - life of > 12 h , which allow once daily injection . long - acting glp1ras have half - lives of > 24 h [ 5 , 6 ] and can be injected as once - weekly doses . the once - daily glp1ra , viz , liraglutide and lixisenatide , are also being developed as fixed ratio co - formulations with basal insulins , viz , degludec and glargine , respectively.table 1glucagon - like peptide 1 receptor agonists ( glp1ra)short acting twice - daily dosage exenatide once - daily dosage lixisenatideintermediate acting ( once - daily dosage ) liraglutidelong acting ( once - weekly dosage ) exenatide lar albiglutide semaglutidefixed ratio combinations liraglutide + degludec lixisenatide + glargine glucagon - like peptide 1 receptor agonists ( glp1ra ) various glp1ras have been utilizing differing strategies to prolong or protract their duration of action . the shortest - acting glp1ra , viz exenatide and lixisenatide [ 3 , 7 ] , achieve this by exchanging amino acids at the n2 and n3 positions , thus making them resistant to breakdown by dipeptidyl peptidase 4 ( dpp4 ) . the renal elimination of the molecule , however , continues as per physiology , and so drug levels fall to baseline prior to the next injection . the short half - life of 24 h means that peak concentrations are maintained for just 6 h. liraglutide achieves a longer half - life ( 1213 h ) and duration of action , by having a fatty acid side chain . this increases its size and slows down release of the glp 1 moiety from plasma albumin , thus prolonging its action . albiglutide uses a similar albumin - binding based approach , but binds in a covalent manner to the protein . the long half - life of the albumin glp1 conjugate allows for a long duration of action and once - weekly administration [ 5 , 9 ] . it conjugates glp-1 with the fc fragment of igg and thus achieves a longer duration of action [ 10 , 11 ] . exenatide long - acting release ( lar ) is a chemical modification of exenatide , which is coupled to microspheres that allow slow and steady release of the molecule from its subcutaneous site . in essence , a patient - centered approach implies crafting of a management strategy which involves the patient and is respectful of his or her opinion . viewed through a larger prism , patient - centered care assumes acceptance of the bio - psychosocial model of disease . it is understood that biomedical , psychological , and social factors impact not only the presentation of diabetes , but also its management . apart from biological characteristics , psychosocial reality should be taken into consideration while planning a therapeutic regime . the varieties of glp1ras available today and their unique pharmacological properties allow a patient - centered choice to be made in this class of drugs . various factors which influence the choice of a glp1ra can be categorized according to the bio - psychosocial model ( table 2).table 2comparison of glp1rashort - acting glp1raintermediate- and long - acting glp1racontrol of fasting glycemiasuitablemore suitablecontrol of postprandial glycemiamore suitablesuitablecontrol of hba1ceffectiveeffectivefrequency of dosagedaily / twice dailyweekly / once dailycombination with basal insulincomplementary effectcomplementary effect for liraglutidecombination with premixed insulinmay show beneficial effectmay show complementary effectuse as directly observed therapy ( dot)not feasiblefeasiblegauge of needlethin ( 31 g , 32g)thick ( 23 g ) for exenatide larinjection techniquesimplerequires manual dexterity for exenatide lar , injection technique is also simple for liraglutide , titrated with the same peninjection site reactionsrarecommon , seldom with liraglutidegastrointestinal symptomsmore commonless commonincrease in pulse rateless commonmore commonweight losseffectiveeffectiveimprovement in lipid profileminimalminimalantibody formationrelatively high with exenatiderelatively high with exenatide lar ; low for liraglutideability to stop in case of adverse eventsretainedlost for once - weekly injections glp1ra glucagon - like peptide 1 receptor agonists , lar long - acting release glp1ra glucagon - like peptide 1 receptor agonists , lar long - acting release the biomedical factors which inform the appropriate choice of glp1ra include efficacy , safety , tolerability , and versatility in combination with insulin . the shorter - acting glp1ras have a greater effect on postprandial glycemia , while the longer - acting molecules lower fasting glucose to a greater extent . short - acting glp1ras delay gastric emptying , decrease the rate of glucose delivery to the duodenum , blunt postprandial glycemia excursions , and reduce insulin levels as well . however , their short duration of action means that optimal glucose control may not be achieved over the full 24 h . exenatide lowers breakfast and post - dinner glucose levels to a much greater degree than post - lunch excursions . this is expected with a twice - daily dose , keeping its pharmacokinetic profile in mind . the hba1c reduction varies from 0.8% to 1.5% with the recommended dose of 10 g twice daily [ 1316 ] . lixisenatide is associated with modest improvements in postprandial glucose after each meal , and in hba1c ( 0.71.0% ) , with a once - daily dose of 20 g [ 1719 ] . this drug has a lower risk of nausea , vomiting and hypoglycemia as compared to exenatide . the intermediate - acting liraglutide , used in a dose of 1.21.8 mg / day , improves both fasting and postprandial glucose values , leading to a 1.11.8% reduction of hba1c [ 1 , 2023 ] . gastrointestinal effects and hypoglycemia are less common than with exenatide ; liraglutide also exhibits added benefits of low antibody formation , reduction in systolic blood pressure , and greater weight loss . the drug is associated with a slight increase in pulse rate , and the impact of this positive chronotropic effect on cardiovascular health is uncertain . intermediate- and long - acting glp1ras exhibit greater effect on fasting glucose levels , as they continue to act during the nighttime . they do not have a significant effect on gastric motility , as the initial slowing is abolished due to tachyphylaxis . the intermediate - acting and long - acting glp1ras cover all 24 h glucose control including fasting glucose . the short - acting glp1ras probably also achieve weight loss through central effects mediated via the hypothalamus . longer - acting drugs such as albiglutide have a lower hba1c reduction ( 0.78% vs. 0.99% ) and lower body weight reduction ( 0.62 vs. 2.21 kg ) probably because of the larger size which prevents entry into the central nervous system [ 25 , 26 ] . the weekly dose of 30 mg , facilitated by a long half - life of 68 days , is associated with low rates of nausea and hypoglycemia , but significant local injection site reaction [ 27 , 28 ] . dulaglutide , too , can be administered once weekly with its half - life of 90 h [ 11 , 12 ] . significant hba1c reduction ( 1.35% ) and weight reduction ( 2.43 kg ) have been noted with doses of 1 mg once weekly for the first 4 weeks , followed by 2 mg weekly for 12 weeks . injection site reactions such as nodule formation are most often observed with exenatide lar , which also needs thicker gauge needle for administration [ 2932 ] . while diarrhea occurs more frequently with longer - acting compounds , nausea seems to be more common with short - acting glp1ra . gastroparesis may be an indication to choose intermediate- or longer - acting glp1ra , while being a relative contraindication for the shorter - acting glp1ra . the duration of action of glp-1 analogs determines the possible combination with a short - acting insulin or a basal insulin . the short - acting exenatide can be given with a basal insulin as it has a greater effect on postprandial glucose levels because of its shorter half - life . in contrast , the longer - acting glp-1 analogs exert greater effect on fasting glucose levels than shorter - acting glp-1 analogs . the possible combination of a long - acting glp-1 analog with a short - acting insulin would also offer the advantages of complementary pharmacologies and could theoretically reduce both fasting and postprandial blood glucose levels . a positive chronotropic effect has been noted with intermediate- and long - acting glp1ra , but not with the short - acting molecules . the short - acting drugs are also associated with greater improvements in postprandial lipid excursions : these factors may encourage their use in specific patients with cardiovascular morbidity . another biomedical factor which determines the choice of glp analog prescribed is the effect on autonomic functions . liraglutide has less effect on gastrointestinal motility than short - acting glp-1 analogs like exenatide and lixisenatide [ 34 , 35 ] . thus , liraglutide is a better choice in diabetic patients with impaired autonomic functions . on the other hand , exenatide and lixisenatide thus , careful assessment of the expected efficacy ( fasting vs. postprandial vs. overall glycemic control ) , anticipated risk of side effects ( gastrointestinal symptoms , hypoglycemia , antibody formation , injection site reactions ) , effect on weight , cost and comorbid conditions ( dyslipidaemia , hypertension ) can help individualize the choice of glp1ra . the ability of the patient to self - inject , to adhere to pre - specified times of injection(30 min before meals for exenatide ) , manual dexterity , frequency of contact with health - care providers , meal pattern followed , and adherence to therapy are some of these issues . for a person who can self - inject , use of exenatide lar , however , requires some amount of manual dexterity , as it has to be self - mixed prior to injection . for those unable or unwilling to self - inject and dependent upon a caregiver for the same , a once - weekly injection of long - acting glp1ra represents a useful therapeutic strategy this once - weekly injection can be administered as directly observed therapy ( dot ) , akin to that used in tuberculosis control programs . this approach has the added advantage of encouraging regular patient provider contact , which facilitates early detection of adverse events and complications , and encourages more efficient lifestyle modification . it is also helpful in patients who may not adhere to more frequently administered therapy . patients who consume heavy breakfast and dinner may benefit from exenatide twice daily , while those who take a light dinner may wish to take lixisenatide . patients with irregular meal habit and lifestyles , which put them at risk of hypoglycemia , will respond to once - weekly drugs without major safety concerns . the different glp-1 analogs have been compared with respect to the improvement in the quality of life and treatment satisfaction . the increase in patients treatment satisfaction from baseline is significantly higher with 1.8 mg liraglutide than with sitagliptin , but the increase with 1.2 mg liraglutide versus sitagliptin is not significant . no difference was perceived in the convenience of treatment between the oral versus injectable . compared to patients on traditional therapy which was insulin , liraglutide 1.8 mg versus glimepiride improves psychological and emotional well - being and health perceptions by reducing anxiety and worry associated with weight gain . the preceding discussion provides a reasonably robust evidence - based assessment upon which an appropriate glp1ra can be chosen or changed . further research and experience will help utilize glp1ra therapy in the best possible manner for the benefit of people with diabetes .

the individualized treatment of type 2 diabetes mellitus , using various glucagon - like peptide receptor agonists ( glp1ras ) , has recently been described . as experience with existing glp1ras grows , and as newer molecules in the development pipeline continue to progress , interest related to these drugs continues to grow . this article describes a person - centered approach , using the bio - psychosocial model of health , to help individualized decision making related to choice of glp1ra . it utilizes an evidence - based approach to discuss various biomedical and psychosocial factors which may influence choice of glp1ra .

acrylic resin , in particular poly-(methyl - methacrylate ) , is a base material for dentures . it is widely used due to its good working properties such as simple preparation and fixing , accuracy of fit , stability in the oral environment , aesthetic aspect and low price.1 - 4 however , acrylic resin is a polaric molecule.5,6 pmma absorbs water and polymeric break down occurs , which causes stained and/or malodorous base material.7 another problem associated with water absorption is the ability of certain organisms to colonize the intaglio surface of an acrylic denture . loss or gain of water in the surface layers may occur quite rapidly , which contributes to surface crazing.8 also , irregularities in the acrylic resin surface are a factor in microorganism entrapment.9,10 the acrylic denture , which is ill - fitting and unhygienic , can act as a reservoir of infection.11,12 the main cause of candida - associated denture stomatitis might be related with candida species adhesion to oral epithelia and denture acrylic surfaces.11,13 - 15 denture stomatitis is one of the most common problem of old denture users , with 25 - 65% of prevalence rates.15 - 18 previous studies showed that one of the risk factor for denture stomatitis is in vivo formation of candida biofilms.14 these biofilms made up of yeast cells and their hyphae , firmly fixed to the biomaterials and they seem to play a role in the formation of biofilms.14,19 the adjacency of the biofilm and extra polymeric matrix to the oral mucosa induces localized innate inflammatory responses , causing erythema and other clinical symptoms.13 however , denture stomatitis can not be explained clinically with the presence of biofilm only.13 in fact , fungi such as candida albicans normally live as innocuous commensal until transformed into parasitic pathogens due to decreased immune response.17,20 it seems that host immune factors also play a role . although there are some evidence that denture stomatitis is associated with presence of c. albicans , other factors such as denture hygiene , traumatization , bacteria colonization , saliva production deficiency , and certain immune defects may also take a part.14 this is especially important for immune - compromised patients who are infected with human immunodeficiency virus ( hiv).12 in hiv - infected individuals , fungi have been increasingly recognized as major pathogens.17 as an increased prevalence of candidal carriage and oral candidiasis is common in cases of hiv infection , oral medical devices , especially dental prosthesis , may be more problematic for these patients because of the tendency for biofilm formation . some studies have compared the adherence of c. albicans isolates to mucosal surfaces in both hiv - infected patients and hiv - free subjects , as adherence to host surfaces is a prerequisite for subsequent biofilm formation and colonization.21,22 however , there is limited information on the adhesion of c. albicans with associated hiv positive patients ' acrylic dentures , this is a hypothesis which is not tested yet . the aim of present study is to determine the properties of biofilm formation and adherence to acrylic dentures of c. albicans strains isolated from hiv positive subjects and compares their properties with standard strains from american type culture collection ( atcc ) . in this in vitro study , the tested denture base material was a heat - cured poly methyl - methacrylate ( pmma ) acrylic resin ( acron duo , associated dental products ltd . , kemdent , purton , swindon , wiltshire , uk ) . to prepare the pmma samples , a pink modeling wax ( cavex set up modeling wax , haarlem , the netherlands ) with dimensions of 20 20 2 mm was placed in hard dental plaster ( moldabaster s , heraeuskulzer gmbh , hanau , germany ) in a two - part mold using a standard dental flask . the wax was eliminated under running hot water and the plaster surfaces were sealed with one coat of sealant . the heat - cured acrylic denture base resin was then packed in the molds and the polymerization process was carried out in a water bath at 70 for 1 hour followed by boiling for 30 minutes . in order to give as accurate representation as possible of the tissue surface of the dentures , the test sides of the polymerized acrylic resin samples were not polished after demolding . the samples were only washed with water steam under pressure to remove any possible contaminants present on the surfaces and then stored in distilled water at 37 for 24 hours , prior to adhesion assays and biofilm formation . in this in vitro study , 14 c. albicans strains which were chosen from the culture collection of ankara university faculty of medicine , department of medical microbiology laboratory were evaluated . the strains were isolated from oral rinse samples of hiv positive subjects who were seen at the infectious diseases clinic , department of internal medicine university of hacettepe between 2002 and 2004 . the identity of the isolates was verified again by using a commercially available carbohydrate assimilation tests ( api 32c identification system , biomrieux , france ) . c. albicans strains were streaked from their thawed suspension stored at -70 onto sabouraud dextrose agar ( sda , merck , germany ) and plates are left at 37 for 24 hours . a single colony was chosen and inoculated in 25 ml sterile sabouraud dextrose broth ( sdb , merck , germany ) medium and flasks containing this medium were incubated for 18 hours at 35 with agitation ( 120 rpm ) . cells were harvested by centrifugation ( 6000 rpm , 4 , 10 minutes ) and washed twice with sterile phosphate - buffered saline ( pbs , 0.15 mm , ph : 7.2 , ca and mg free ) . the yeast cells were resuspended in the same buffer and standardized to a concentration of 1 10 and 1 10 cfu / ml . adhesion assays were performed by using a modification of the technique previously described.23 briefly , pmma samples were individually put inside a petri dish . the standardized c. albicans cell suspension in pbs ( 1 10 cells / ml ) the cell adhesion was occurred in 2 hours at 37. following incubation , the acrylic resin material gently washed twice with 5 ml pbs thus the non - adherent cells were removed . afterwards , the adhered yeasts were counted . the method used to do this was to put the pmma samples in a sterile tube consisting 5 ml saline solution and then mix them using a vortex mixer at the maximum setting for 30s . following incubation , the acrylic resin material gently washed twice with 5 ml pbs thus the non - adherent cells were removed . portions ( 0.1 ml ) of dilutions were spread onto sda and the medium were left for 24 hours at 37. after the incubation period , the yeast colonies were observed and the number of colony forming units ( cfu ) per milliliter was calculated . all experiments were performed in triplicate on three separate occasions and evaluated by two independent microbiologists . biofilms were showed on pre - sterilized , polystyrene ; flat - bottom 96-well microtiter plates ( thermo scientific , usa ) . each well of the microtiter plate was filled with 100 l of a standardized cell suspension ( 10 cells / ml ) . the plate was incubated for 1.5 hours at 37 with agitation at 75 rpm thus , the yeast can adhere to the surfaces of the wells.24 for control purposes , three wells of each microtiter plate were prepared under the same conditions except that no candida suspensions were added . following the adhesion phase , the cell suspensions were aspirated and the wells were washed twice with 150 l of pbs solution to remove loosely attached cells . the washed wells were filled with 100 l sdb medium , and the plates were incubated at 37 in a shaker at 75 rpm . the sdb was replaced with fresh medium daily.21 the biofilms were left to develop for up to 48 hours . the biofilm formation was quantified by a modification of a crystal violet assay described by others.25 all assays were done in triplicate on three different occasions . the biofilm coated wells were washed twice with 200 l of pbs and were left in room temperature to dry for 45 min . the washed wells were stained with 100 l of 0.4% crystal violet solution for 45 minutes . then , each well was washed four times with 350 l of sterile distilled water to remove crystal violet and quickly destained with 200 l of 95% ethanol for 45 minutes . after destaining , 100 l of destaining solution was transferred to a new well and the amount of the crystal violet stain in the destaining solution was measured with a microtiter plate reader ( thermo labsystems , usa ) at 600 nm.21,25 means and standard deviations were calculated using the mann - whitney u test . none of the negative controls exhibited adhesion . in biofilm assays , the hiv - positive subjects ' oral isolates and the reference strains were not different from each other and both showed similar absorbance readings . none of the negative controls exhibited biofilm formation . by statistical analysis ( mann - whitney u test ) , neither the adhesion assay ( p=.52 ) nor the crystal violet assay ( p=.42 ) revealed significant differences in adhesion and biofilm formation abilities between the two groups of isolates ( table 1 , table 2 , table 3 , and table 4 ) . clinically , it is common to find c. albicans biofilms on natural host surfaces or on biomaterials , such as acrylic resins used for the construction of denture bases . biofilms , consisting of candida species and bacteria on the denture material , cause inflammation and hyperplasia of the oral mucosa.14,26 denture stomatitis is the most common form of oral candida infection among maxillary complete denture wearers with 65% of prevalence rate.27 oral endogenous bacteria and candida spp . can easily establish colonies on denture base acrylic resin.28 acrylic resin denture surfaces colonized by microorganisms might be a reservoir of infection.11,12 c. albicans adhere to polymeric surfaces by van der waals and electrostatic forces . the augmentation made by electrostatic and hydrophobic forces for adherence process varies between substrate and environments . in the beginning these forces are important in the initial adhesion and then they cause further bonding and denture plaque formation . saliva , serum , oral floara and surface topography and chemistry differences may affect this complicated process.29,30 studies by morgan and wilson31 showed that bacteria and fungus affinity to rough acrylic resins . the resultant surface will reproduce some of the surface topography of the stone and therefore will also not be particularly smooth . the intaglio surface of the maxillary denture was more prone to colonization by c. albicans and was not smooth.31 therefore , in the current study , in order to simulate tissue surface of the dentures , the test sides of the polymerized acrylic resin samples were not polished . another predisposing factor for oral mucosal candida infections is the patient 's systemic condition associated with weakened , suppressed , or underdeveloped immune systems.27 junqueira et al.17 have compared biofilm production of oral and systemic c. albicans isolates from hiv - positive patients , using an in vitro biofilm model on silicone and acrylic resin . their findings suggest that oral candida infections are serious infections because the pathogenicity of oral candida isolates is similar to systemic candida isolates , so they have the potential to cause systemic infections . in this study , we compared the properties of oral c. albicans strains isolated from hiv positive subjects and reference strains with respect to their biofilm forming ability and their adherence on acrylic dentures . jin et al.21 compared the xtt reduction assay and the crystal violet assay and their data indicated a significant correlation between the two methods . since there are several studies indicating that the adhesions of c. albicans to acrylic surfaces may be affected by several factors such as the saliva , serum , oral flora and sucrose rich diet , in vitro nature of the investigation was the limitation of our study.29 many studies have demonstrated that body fluids , proteins , enzymes , electrolytes and lipids in vivo destroy biomaterials , cause roughness and make it easy for microorganisms to attach to the surfaces.32 it is well known that when we compare with healthy controls , hiv - infected patients may carry c. albicans in their oral environment with a heightened frequency of oral candidiasis without any symptoms.10,26 one possible reason for this may be that the heightened biofilm - forming candida isolates colonize in the oral cavities of hiv - infected individuals . however , in our study , the statistical analysis shows there is no significant difference in both adhesion and biofilm formation between strains of c. albicans isolated from the oral rinse solutions of hiv infected subjects and reference strains . our results correlated with the study of jin et al.21 in that there were no significant quantitative differences in biofilm formation between c. albicans isolates from hiv infected patients and isolates from hiv - free individuals . according to our results , biofilm formation and adherence abilities of c. albicans to acrylic resin materials do not seem to be related with the cause of denture stomatitis and increased prevalence of candida carriage in hiv - infected individuals . this might be due to the number of control group , which consists of two reference strains and also the limitation of in vitro tests . further studies with larger groups consisting of healthy and hiv infected subjects are needed to elucidate how in vivo environmental factors interfere with our findings .

purposethis study evaluated the adhesion to acrylic resin specimens and biofilm formation capability of candida albicans strains isolated from hiv positive subjects ' oral rinse solutions.materials and methodsthe material tested was a heat - cured acrylic resin ( acron duo ) . using the adhesion and crystal violet assays , 14 oral candida albicans isolated from hiv - positive subjects and 2 references candida strains ( c. albicans atcc 90028 and c. albicans atcc 90128 ) were compared for their biofilm production and adhesion properties to acrylic surfaces in vitro.resultsthere were no significant differences in adhesion ( p=.52 ) and biofilm formation assays ( p=.42 ) by statistical analysis with mann - whitney test.conclusiondenture stomatitis and increased prevalence of candidal carriage in hiv infected patients is unlikely to be related to the biofilm formation and adhesion abilities of c. albicans to acrylic resin materials .

giant cell tumor ( gct ) accounts for 5 - 8% of all primary bone tumors . it usually occurs between 20 and 40 years of age and is commonly located at the distal femur , proximal tibia or distal radius . proximal humerus is a rare site of involvement , accounting for only around 4% of the disease . gct presents as a lytic and eccentric lesion at the epiphyseal region of long bones . histologically , gcts are composed of two distinct cell types : mononuclear stromal cells and osteoclast - like multinucleated giant cells . they express receptor activator of nuclear factor b ( rank ) ligand and recruit monocytes to the site of the tumor . rank ligands bind to rank receptors and induce the differentiation of monocytes into multinucleated giant cells . they mediate the bone resorption and are responsible for the purely lytic feature seen on radiographs . it is a fully human , synthetic igg antibody that binds to rank ligand with high affinity , preventing its interaction with rank receptor . the first large - scale study of its use was in osteoporotic patients . in that study , rare but major adverse effects include osteonecrosis of the jaw and hypocalcemia , which occur in around 2% of patients receiving denosumab . denosumab had been evaluated in a small scale study in patients with gct of bone . in that study , thomas et al . showed that 30 of 35 patients had a response which was defined as more than 90% elimination of giant cells or an absence of radiological progression . however , there is a little study in the orthopedic literature regarding how this is relevant to our practice . a 62-year - old man complained of spontaneous onset left shoulder pain and stiffness for around 2 weeks . x - ray showed an expansile and lytic lesion over the proximal humerus [ figure 1 ] . expansile and lytic lesion over the left shoulder with cortex poorly delineated giant cell tumor showing the multinucleated giant cells in a background of mononuclear cells ( h and e , 40 ) treatment options of extended curettage versus wide local excision were discussed with the patient . the patient also requested to try denosumab as a neoadjuvant treatment after we presented to him a few recent reports which showed that denosumab could induce ossification in gct . informed consent was obtained , and the patient received 6 doses of denosumab ( 120 mg subcutaneous injection on day 0 , day 6 , day 13 , day 29 , day 57 , and day 85 , respectively ) . he was put on calcium and multivitamin supplement , and regular blood tests showed normal renal function and calcium level . there was progressive bone deposition in the tumor , and the cortex became more clearly delineated [ figure 3a c ] . ( a ) x - ray at 1-month after initiation of denosumab . ( b ) ( c ) x - ray at 4 months after initiation of denosumab the patient received operation on day 118 ( around 4 months ) after starting denosumab . the tumor tissue inside was found to be extremely hard and was significantly different from the soft texture of the usual gct . normally for gct rongeur and scalpel were needed to remove most of the tumor tissue until the subchondral and metaphyseal bone was reached . but the difference in texture between the tumor tissue and normal bone was not distinct . cement and three intra - medullary titanium elastic rods were used to fill up the cavity and also as prophylaxis of fracture . there were interconnected broad trabeculae of bone embedding a small number of stromal cells [ figure 4 ] . posttreatment specimen showing bony matrix with small spindle cells ( h and e , 100 ) the patient received two more doses of denosumab ( 120 mg ) after the operation at 1 and 2 months respectively . upon follow - up at 2 years postoperation , the patient reported complete resolution of bone pain . the shoulder could flex up to 70 and abduct up to 90. the patient was satisfied with the functional outcome . but the local recurrence rate is still around 15 - 27% even with the use of an adjuvant . wide local excision followed by endoprosthesis reconstruction is an option to further decrease the recurrence rate to just around 2% . but it is associated with higher surgical risk and all sorts of implant complications such as infection , loosening , and osteolysis in the future . moreover , in the proximal humerus , reattachment of the rotator cuff to the metallic implant is a challenging issue . as gct is , in general , a benign disease , the extent of surgery should strike a balance between surgical morbidity , functional loss , and the risk of local recurrence . our patient was a good example of this dilemma . before denosumab treatment , salvaging his shoulder joint would be extremely difficult because the cortical bone stock was too little . fortunately , he had the progressive formation of bone after denosumab as shown on x - ray . from the literature , around 65 - 80% of the tumor would show a significantly increased fibro - osseous tissue or new bone formation after denosumab treatment . in some specimens , there was even a smooth transition from the osteoid formation in the tumor center , to irregular woven bone in the periphery of the tumor , and to the normal lamellar bone in the normal surrounding tissue . examined gct specimens in an in - vitro study and compared the stromal cell proliferation rate of patients treated and not treated by denosumab . it was shown that a specimen from patients who had completed denosumab treatment still showed the presence of stromal cells . the stromal cells would also continue to proliferate , albeit rather slowly , once they were no longer exposed to denosumab . it is clear from this study that denosumab can not be used as the sole treatment for gct . the cellular response to denosumab was so prominent that the consistency of the tumor changed . it could not be removed by curettage . instead , rongeur and scalpel were needed to remove the tumor tissue in a piecemeal fashion . first , there is an increased chance of perforation of subchondral bone resulting in an intra - articular fracture . classically , gct has a fleshy and soft texture , which can be easily distinguished from bone . traditionally , it is removed by curettage , followed by a high - speed burr to remove residual tumor tissue that is still attaching to the surrounding hard cortical and subchondral bone . however , but the surgeon actually has little tactile feeling to determine how far and how much tissue should be removed . if one goes too far , the sharp instruments can easily cut through the subchondral bone and enter the shoulder joint . usually , the cortical bone acts as a good barrier to protect these structures as long as the curettage procedure is done in the intraosseous compartment . however , when a sharp instrument is used , and the cortex is thin , it may penetrate the cortex and cut the neurovascular structure . when surgeons sense the danger of intra - articular perforation and neurovascular injury , the natural tendency would be to adopt a more conservative approach to tumor eradication . as a result fortunately , our patient did not have any evidence of tumor recurrence on the latest follow - up . we propose that surgical excision alone remains the treatment of choice for simple gct cases in which a standard extended curettage is feasible . but for advanced gcts that cause significant thinning of surrounding bone and difficulty in salvaging the neighboring joint , trial of denosumab therapy denosumab has the potential to eliminate osteolysis and allow time for some local bone reconstitution before operation . the drug is usually well - tolerated . but surgeons should also know the potential difficulties in operating on patients treated with denosumab . they should also be aware that only around 65 - 80% of patients may show response to denosumab . up to the current moment , there is no large scale study in the literature to demonstrate any benefit of this drug in reducing local recurrence in the long - term .

giant cell tumor is a benign bone tumor that is commonly encountered . the optimal treatment of a giant cell tumor which causes extensive bony destruction is controversial . recent studies on the receptor activator of nuclear factor b ligand antagonist denosumab may offer a new treatment option for these patients . we presented a patient with giant cell tumor of the humeral head . he was initially treated with denosumab and subsequently with the operation . the shoulder joint was successfully salvaged . but there are potential difficulties that surgeons may face in patients treated with denosumab .

anti - epidermal growth factor receptor antibody therapy may be ineffective in terms of survival benefit and/or tumor shrinkage in patients with expanded ras ( kras / nras ) mutations . randomized control trials ( rct ) of chemotherapy with or without anti - egfr antibody in mcrc revealed that anti - egfr antibody had no benefit on the response rate , progression - free survival and overall survival in patients with kras exon 2 ( codons 12 and 13 ) mutations.4 this finding is consistent with other anti - egfr therapies , including cetuximab or panitumumab , therapeutic lines and combined chemotherapies . although increased survival with cetuximab of the patients with kras codon 13 ( g13d ) mutation was reported,5 patients with any kras exon 2 mutations are unlikely to benefit from cetuximab or panitumumab.6 therefore , anti - egfr antibody therapy is not recommended for patients with kras exon 2 mutations . since 2013 , prospective - retrospective analyses of phase iii studies have revealed that patients with wild - type ras were expected to benefit from panitumumab , although benefits were not obtained in patients with mutations including kras exons 3 and 4 , and nras exons 2 , 3 and 4 , similar to patients with kras exon 2 mutations ( tables2 and 3).2 therapeutic effects on wild type ras ras ascertainment : ratio of randomized patients whom ras mutations were evaluated . bev , bevacizumab ; cmab , cetuximab ; hr , hazard ratio ; os , overall survival ; pfs , progression free survival ; pmab , panitumumab ; rr , response rate . therapeutic effects on mutant ras bev , bevacizumab ; cmab , cetuximab ; hr , hazard ratio ; os , overall survival ; pfs , progression free survival ; pmab , panitumumab ; rr , response rate . retrospective analyses of rct suggested that cetuximab also has a favorable survival impact only in patients with wild - type ras . furthermore , two rct that compared anti - egfr antibody therapy to bevacizumab revealed that a subgroup of patients with ras mutations , except those with kras exon 2 mutations , did not show benefits.3 based on these results , anti - egfr antibody therapy is ineffective in patients with previously known kras exon 2 mutations or those with mutations in kras exons 3 and 4 and nras exons 2 , 3 and 4 . in vitro studies revealed that the overexpression of kras transgenes with mutations in codons 12 , 13 , 59 , 61 , 117 and 146 induced constitutive ras protein activation ; however , the impact of individual mutations on the therapeutic efficacy remains unclear . while several patients with kras codon 146 mutation respond to anti - egfr antibody therapy,7 we assume that further subgroup analyses of rct may provide information to conclude these issues . thus , current procedures to detect only kras exon 2 mutations are insufficient for selecting appropriate patients . when one or some exons / codons have undetermined mutational statuses while all the other evaluable exons are determined as ras wild - type , these patients should be diagnosed as ras unknown ( table s1 ) . if the test failure is due to the sample , re - examination using the remnant or newly obtained tumor samples should be considered . if the test failure is due to technical problems , re - examination should be performed with other methods . indications for anti - egfr antibody therapy for patients with ras unknown status should be determined according to : ( i ) the reported frequency of mutations of immeasurable or unmeasured codons ; ( ii ) evidence of no expected effects on patients if they have ras mutations in immeasurable or unmeasured codons ; ( iii ) side effects of anti - egfr antibody therapy ; and ( iv ) alternative therapeutic options except anti - egfr antibody therapy . repeated tests are not required for the detection ; tissue materials of either primary or metastatic lesions are applicable for ras mutation testing . evaluating ras mutations prior to anti - epidermal growth factor receptor antibody therapy is recommended . ras mutation is an early event in the tumorigenesis , and the frequency of ras mutations might not be altered in any clinical stage ( table s2 ) . the frequency of kras exon 2 mutations is approximately 3540% in colorectal cancer patients , and the frequency of other ras mutations is 1015% ; the same trend exists in europe and the usa , and japan ( table4).8 frequencies of exon mutations kras / nras mutation ratio in wild type kras exon 2 . the concordance rate of the mutation status between primary tumors and metastatic sites reached 93% by meta - analysis.9 ras mutational status of tumor tissue from endoscopic biopsies and matched resected specimens is highly concordant and the concordant rate is 97% . the mutational status of ras was not altered by chemotherapy without cetuximab or panitumumab , whereas chemotherapies including cetuximab or panitumumab reportedly induced secondary ras mutation and amplification . the clinical implications of the secondary ras mutation , including the potential efficacy of anti - egfr antibody therapy , remain unknown . based on these findings , repeated testing of ras mutations is currently not recommended . direct sequencing with manual dissection or allele - specific pcr - based methods is currently applicable for ras mutation testing . direct sequencing is able to detect both known and unknown gene mutations , whereas the detection sensitivity of the assay is limited to 1025% , which is less sensitive than that of allele - specific pcr - based methods . therefore , direct sequencing requires the condensation of tumor cells by manual dissection of the tissue sections in which tumor cells are densely contained ( manual microdissection).10 a multiplex mutation detecting kit using luminex technology ( mebgen rasket kit ; medical and biological laboratories , nagoya , japan ) has been approved for the simultaneous detection of 48 types of ras mutations.8 in previous clinical studies , ras testing was performed using various assays ( table4 ) . the detection limit of these methods was within 1025% ( direct sequencing ) to < 1% ( beaming method ) and that of the other methods was within 110% . regardless of the difference in the detection limit between each method , the subgroup analyses of these rct consistently demonstrated that ras status is a predictive factor for anti - egfr antibody therapy . therefore , while the most suitable detection sensitivity remains to be determined , the detection limit within 110% should be practically considered for ras mutation testing . thinly sliced sections of formalin - fixed , paraffin - embedded tissue blocks are applicable for ras mutation testing . one section should be stained with h&e and provided for histological examination to confirm whether tissue contains a sufficient amount of tumor cells for testing . the paraffin - embedded ( ffpe ) tissue sample if sufficient tumor cells are confirmed histologically , the use of fresh frozen tissue samples will also be considered . it is recommended to select tissue sections containing 50% tumor cells estimated by the area of tumor cells . when performing ras mutation testing using sections with fewer tumor cells coupled with low sensitivity methods , manual microdissection should be performed to increase tumor cell / non - tumor cell ratio . if multiple samples are obtained from the same patient , select the sample that was archived for a shorter period , has a higher tumor cell ratio , and has fewer effects of prior chemotherapy or radiotherapy . these parameters should be discussed with the pathologists and laboratory staff prior to ras mutation testing . thus , sample fixation ( e.g. formaldehyde concentration , buffered or non - buffered formalin , duration of fixation , tissue size and sample segmentation ) should be carefully considered . using a 10% buffered formaldehyde solution is recommended . the duration of fixation is dependent on the sample size . in general , 648 h of fixation is recommended . ras mutation testing must be performed in laboratories well - qualified to perform both the testing procedures and specimen management . clinical laboratories are recommended to obtain a certificate of international standard ( e.g. iso / iec 17025 , iso 15189 ) from the international organization for standardization ( iso ) . the items suggested in the european qa program ( table s3 ) are used for the validation of testing procedures . finally , the items shown in table s4 should be included in the report of ras mutation testing . ky receiving honoraria for lectures from takeda pharmaceutical and received research funding from merck serono . ty received honoraria for lectures from takeda pharmaceutical and merck serono , and received research funding from merck serono . km received honoraria for lectures from takeda pharmaceutical and merck serono , and received research funding from merck serono . data s1 . supplemental references . table s1 . defined ras status with unevaluable exons .

the japanese guidelines for the testing of kras mutations in colorectal cancer have been used for the past 5 years . however , new findings of ras ( kras / nras ) mutations that can further predict the therapeutic effects of anti - epidermal growth factor receptor ( egfr ) antibody therapy necessitated a revision of the guidelines . the revised guidelines included the following five basic requirements for ras mutation testing to highlight a patient group in which anti - egfr antibody therapy may be ineffective : first , anti - egfr antibody therapy may not offer survival benefit and/or tumor shrinkage to patients with expanded ras mutations . thus , current methods to detect kras exon 2 ( codons 12 and 13 ) mutations are insufficient for selecting appropriate candidates for this therapy . additional testing of extended kras / nras mutations is recommended . second , repeated tests are not required for the detection ; tissue materials of either primary or metastatic lesions are applicable for ras mutation testing . evaluating ras mutations prior to anti - egfr antibody therapy is recommended . third , direct sequencing with manual dissection or allele - specific pcr - based methods is currently applicable for ras mutation testing . fourth , thinly sliced sections of formalin - fixed , paraffin - embedded tissue blocks are applicable for ras mutation testing . one section stained with h&e should be provided to histologically determine whether the tissue contains sufficient amount of tumor cells for testing . finally , ras mutation testing must be performed in laboratories with appropriate testing procedures and specimen management practices .

in 2005 , wood discs were cut from a discolored stump of pinus thunbergii ( fig . 1 ) grown in a forest in taean , chungnam , korea . after washing with tap water the wood pieces were surface - sterilized with 0.5% chlorine lax solution for 2 min , washed twice with sterile water , and air dried . the dried wood pieces were placed on mea ( 2% malt extract agar , bd science , usa ) supplemented with cycloheximide ( 200 g / ml ) and incubated for 10 days at room temperature . fungal isolates were obtained by taking mycelial tips grown out from the incubated wood pieces . single spore isolates were prepared from the obtained isolates grown on 2% mea at 25 for seven days . all the isolated fungi were stored at -80 in 10% glycerol for long - term storage and in water at 4 for short - term storage . to identify optimal growth media , pre - cultured isolates were transferred to the center of each of pda , mea , oa ( oatmeal agar , bd science , usa ) and omea ( 2% oxoid malt extract agar , oxoid , uk ) media , respectively , and grown for 9 days at 25. mycelial growth was recorded by measuring the diameters of the colonies . light microscopic images of the morphological features of the isolates were examined under a phase - contrast microscope ( karl zeiss , axioskop 40 ) after growing the culture on 2% mea at 25 for 5~7 days . for scanning electron microscopy ( sem ) , the fungal isolate was grown for 5~7 days at 25 on 2% mea plates overlaid with cellophane ( bio - rad laboratories , canada ) . pieces of cellophane were fixed in 2% glutaraldehyde buffered in 0.1 m cacodylate buffer for 16 h and 1% osmium tetroxide in 0.1 m phosphate for 1 h. samples were subsequently washed in 0.05 m cacodylate buffer , dehydrated in a series of ethanol washes ( 50% for 20 min , 75% for 20 min , 90% for 20 min , 95% for 20 min and 100% for 20 min ) , passed through ethanol - isoamylacetate , dried with a hitachi critical point dryer and coated with platinum - palladium at 25 nm with an hitachi e-1030 ion sputter . the specimens were examined with a hitachi s-4300 scanning electron microscope operating at 15 kv . for fungal genomic dna , fungi were grown for 5~7 days on 2% mea plates overlaid with cellophane ( bio - rad laboratories , usa ) . fungal genomic dna for pcr was obtained from the mycelium using the drilling method described by kim et al . the -tubulin gene was amplified using the primers t10 and bt12 ( o'donnel and cigelnik , 1997 ; kim et al . , 2003 ) . sequences were manually edited using the chromas v2.31 program and aligned using the clustalw 2 program . the aligned sequences were analyzed with paup 4.0 beta 10 ( swofford , 2003 ) . in 2005 , wood discs were cut from a discolored stump of pinus thunbergii ( fig . 1 ) grown in a forest in taean , chungnam , korea . after washing with tap water the wood pieces were surface - sterilized with 0.5% chlorine lax solution for 2 min , washed twice with sterile water , and air dried . the dried wood pieces were placed on mea ( 2% malt extract agar , bd science , usa ) supplemented with cycloheximide ( 200 g / ml ) and incubated for 10 days at room temperature . fungal isolates were obtained by taking mycelial tips grown out from the incubated wood pieces . single spore isolates were prepared from the obtained isolates grown on 2% mea at 25 for seven days . all the isolated fungi were stored at -80 in 10% glycerol for long - term storage and in water at 4 for short - term storage . to identify optimal growth media , pre - cultured isolates were transferred to the center of each of pda , mea , oa ( oatmeal agar , bd science , usa ) and omea ( 2% oxoid malt extract agar , oxoid , uk ) media , respectively , and grown for 9 days at 25. mycelial growth was recorded by measuring the diameters of the colonies . light microscopic images of the morphological features of the isolates were examined under a phase - contrast microscope ( karl zeiss , axioskop 40 ) after growing the culture on 2% mea at 25 for 5~7 days . for scanning electron microscopy ( sem ) , the fungal isolate was grown for 5~7 days at 25 on 2% mea plates overlaid with cellophane ( bio - rad laboratories , canada ) . pieces of cellophane were fixed in 2% glutaraldehyde buffered in 0.1 m cacodylate buffer for 16 h and 1% osmium tetroxide in 0.1 m phosphate for 1 h. samples were subsequently washed in 0.05 m cacodylate buffer , dehydrated in a series of ethanol washes ( 50% for 20 min , 75% for 20 min , 90% for 20 min , 95% for 20 min and 100% for 20 min ) , passed through ethanol - isoamylacetate , dried with a hitachi critical point dryer and coated with platinum - palladium at 25 nm with an hitachi e-1030 ion sputter . the specimens were examined with a hitachi s-4300 scanning electron microscope operating at 15 kv . for fungal genomic dna , fungi were grown for 5~7 days on 2% mea plates overlaid with cellophane ( bio - rad laboratories , usa ) . fungal genomic dna for pcr was obtained from the mycelium using the drilling method described by kim et al . the -tubulin gene was amplified using the primers t10 and bt12 ( o'donnel and cigelnik , 1997 ; kim et al . , 2003 ) . sequences were manually edited using the chromas v2.31 program and aligned using the clustalw 2 program . the aligned sequences were analyzed with paup 4.0 beta 10 ( swofford , 2003 ) . initially . several fungal isolates were obtained from the sapwood pieces of a stained stump of japanease black pine . they all grew well in the cycloheximide - supplemented mea media , indicating that they are cycleheximide tolerant . they showed the same morphology and growth pattern , thus , one of the fungal isolates coded as dkm 0514 was used for identification in this work . the isolate formed pale or red synnemata and droplets of conidia at the apex the synnemata ( fig . 2a~2f ) . the shape and size of conidia on synnema and mononema are given in table 1 . these features of synnemata are similar to synnema - forming species of the ophiostoma piceae complex . ( 2006 ) compared morphological characters of seven species of the o. piceae complex , including o. breviusculum , o. canum , o. floccosum , o. piceae , o. quercus , o. setosum , and o. subalpinum . among these compared species reported from conifers , especially , the red - brown synnema and yellow color of the conidia mass found in dkm 0514 were considered to be distinct features of o. floccosum by harrington et al . o. floccosum ( mathiesen ) hunt ( anamorph : pesotum aureum ( hedgecock ) mcnew et harrington ) , one of the common sapwood - staining species ( hunt , 1956 ; harrington et al . a sporothrix synanamorph with denticles and secondary conidia was observed from dkm 0514 by scanning electron microscopy ( fig . o. floccosum is a heterothallic species , as it can produce perithecia only through cross of two different mating type partners . in this study dkm 0514 itself did not form a perithecium , suggesting it is a heterothallic species . consequently , we could not observe a telemorph of dkm 0514 ( table 1 ) . the differentiation of the o. piceae complex is not easy based only on morphological characters . therefore , to confirm whether the isolate is the anamorph of o. floccosum , its -tubulin gene sequence was analyzed . when the determined -tubulin gene sequence was searched for homologous sequences in the genbank dna database , it matched well with the known -tubulin gene sequence of ophiostoma floccosum kuc 2412 ( accession number dq868378 ) ( 100% similarity ) . the -tubulin gene sequence of the isolate dkm 0514 was deposited in the genbank under accession no . the phylogenetic analysis based on the -tubulin gene sequences also revealed that dkm 0514 was placed in a clade with o. floccosum ( fig . the isolate dkm 0514 from this study showed better mycelial growth on mea than on pda and oa ( fig . the colony color of o. floccosum dkm 0514 incubated at 25 was creamy on pda , creamy grayish on oa , and first white then gradually turning brownish on mea and omea ( fig . it produced no culture aroma and no mycelium with concentric rings that were observed as distinguishing characteristics of o. floccosum by harrington et al . 3 ) of the - tublin gene , and physiological properties , the isolate dkm 0514 was identified as the anamorph of ophiostoma floccosum . this is the first report in korea on the detailed mycological properties of the anamorph of o. floccosum isolated from pinus thunbergii .

an ophiostoma fungus was isolated from a stump of pinus thunbergii in a forest on the west coast of korea . microscopic analysis using a light microscope , a stereo microscope , and a scanning electron microscope revealed that it had morphological features of pesotum and sporothix synanarmorphs . based on the -tubulin gene sequence analysis , the fungus was identified as the anamorph of ophiostoma floccosum . mycological properties of the species including its growth properties on different culture media were described .

gastrointestinal ( gi ) bleeding is a common emergency and bleeding from the upper gi tract and small intestine account for 75% and 210% of all gi bleeds , respectively . we describe a 29-year - old man who presented with obscure anemia due to small intestine bleeding . vascular abnormalities account for 7080% , followed by small intestinal bleeds that account for 510% , respectively . adenocarcinoma is the most common primary malignant tumor of the small bowel ( pmtsb ) [ 4 , 5 ] . however , our patient had a gastrointestinal stromal tumor ( gist ) , which accounts for < 1% of all gi neoplasms . the peak age for developing gist is 5060 years [ 6 , 7 ] , and thus gist is rarely the source of small intestinal bleeds . this report describes obscure gi bleeding due to gist of the jejunum of a young adult . a 29-year - old man presented to our hospital with a 2-week history of gross hematochezia and anemia . laboratory findings were as follows ( values are shown with range in parentheses ) : aspartate aminotransferase , 11 ( normal , 535 ) u / l ; alanine aminotransferase , 11 ( 530 ) u / l ; alkaline phosphatase , 185 ( 115359 ) u / l ; -glutamyl transferase , 49 ( 050 ) u / ml ; lactate dehydrogenase , 96 ( 106211 ) u / l ; albumin , 3.0 ( 3.75.5 ) g / dl ; total bilirubin , 0.26 ( 0.21.0 ) g / dl ; and c - reactive protein , 1.2 ( 00.3 ) mg / dl . other than c - reactive protein , almost all blood biochemistry findings were essentially within normal ranges . hematological findings were as follows ( values are shown with range in parentheses ) : white blood cells , 11,600 ( 5,0008,000)/l ; red blood cells , 165 ( 400530 ) 10/l ; and hemoglobin , 4.5 ( 1418 ) g / dl . tumor markers were as follows ( values are shown with range in parentheses ) : cea < 0 ( 05 ) ng / ml ; ca19 - 9 , 3 ( 037 ) u / ml ) ; and il-2 , 280 ( 145519 ) u / ml . all tumor markers were within normal ranges . abdominal computed tomography revealed a well - delineated 45 40-mm mass in the jejunum ( fig 1 ) . the lesion in the jejunum was resected and removal of a possible tumor was assured by lymphadenectomy ( fig 2 ) . the resected specimen initially appeared similar to diverticulosis with abscess , so we diagnosed infected diverticulosis ( fig 3 ) . histopathological assessment revealed a submucosal tumor comprising proliferative atypical spindle or epithelioid cells arranged in fascicle whorls with a dense acute inflammatory infiltrate , abscess and necrosis . immunohistochemical findings showed that the atypical cells were positive for c - kit , and some were faintly positive for cd34 and s-100 ( fig 4 ) . these features were compatible with those of low - risk gist [ 8 , 9 , 10 ] . accurate , prompt diagnosis of a bleeding source is crucial because such bleeding can result in death . the source of 35% of gi bleeds can not be identified by esophagogastroduodenoscopy and/or colonoscopy , but bleeding from the upper and lower gi tracts accounts for 75 and 15% , respectively , of all gi bleeds [ 1 , 7 ] . vascular abnormalities and small intestinal tumors account for 7080% and 510% , respectively , of small intestinal bleeds and pmtsb accounts for only 12% of all primary gi tumors [ 11 , 12 ] . the most frequent symptoms are abdominal pain ( 67.4% ) , abdominal mass ( 31.2% ) and bowel obstruction ( 24.1% ) , followed by hematochezia ( 21.3% ) , jaundice ( 16.3% ) , and fever ( 14.2% ) . leiomyoma and leiomyosarcoma in the small intestine are associated with massive bleeding , whereas lymphoma , gist and carcinoids are associated with relatively slow bleeding [ 4 , 7 ] . our patient had a 2-week history of gross hematochezia and his condition roughly corresponded to gist . mazur et al . originally described gist in 1983 . less than 1% of all gi neoplasms are gist , and they are defined as specific , generally kit ( cd117)-positive and/or platelet - derived growth factor receptor- mutation - driven tumors [ 9 , 10 , 13 ] . among mesenchymal tumors of the gi tract , gist are the most common , and primary gist can occur anywhere along the gi tract between the esophagus and the anus . between 50 and 70% of clinically manifested tumors arise in the stomach , 2030% are found in the small bowel , 515% are located in the large bowel , and < 5% are located in the esophagus and elsewhere . therefore , to initially consider gist in a differential diagnosis of gi bleeding in a younger patient is unlikely . meckel 's diverticulum and crohn 's disease are common when considering only gi bleeds in younger patients . meckel 's diverticulum is the most common congenital anomaly of the gi tract , with an incidence of 24% in the general population . meckel 's diverticulum occurs twice as often in men than in women , and acute diverticulitis can occur at any age , but the incidence peaks in children [ 15 , 16 ] . meckel 's diverticulum is always located within 1 m of the oral side of the ileocecal valve and straying ectopic stomach tissue is the key pathological feature in 27% of patients with this disease . the specimen resected from our patient macroscopically resembled diverticulitis , but it was not obtained from a location within 1 m from the oral side of the ileocecal valve . small intestinal diverticula other than the meckel type can be differentially diagnosed , but the incidence ranges from only 0.06 to 1.3% . finally , microscopic assessment ruled out these types of diverticulosis . first described this condition in 1932 as a chronic inflammatory disease of unknown origin that can occur not only in the terminal ileum but anywhere in the gi tract . it commonly affects men and women aged in the early 20s and late teens , respectively [ 18 , 19 , 20 ] . preoperative upper and lower gi endoscopy and pathological findings excluded crohn 's disease as the bleeding source in our patient . we described hemorrhage due to gist of the small intestine in a young adult male . the possibility of neoplastic disease must be considered even among young adults who present with gi bleeding . written informed consent was obtained from the patient for publication of this paper and any accompanying images .

the source of most cases of gastrointestinal bleeding is the upper gastrointestinal tract . since bleeding from the small intestine is very rare and difficult to diagnose , time is required to identify the source . among small intestine bleeds , vascular abnormalities account for 7080% , followed by small intestine tumors that account for 510% . the reported peak age of the onset of small intestinal tumors is about 50 years . furthermore , rare small bowel tumors account for only 12% of all gastrointestinal tumors . we describe a 29-year - old man who presented with obscure anemia due to gastrointestinal bleeding and underwent laparotomy . surgical findings revealed a well - circumscribed lesion measuring 45 40 mm in the jejunum that initially appeared similar to diverticulosis with an abscess . however , the postoperative pathological diagnosis was a gastrointestinal stromal tumor with extramural growth .

cox maze procedure has remained the gold standard for the surgical treatment of atrial fibrillation for almost two decades . in 1991 , james cox and associates introduced this openheart surgical approach , to block the reentrant pathways by making multiple atrial incisions and to block propagation of microreentrant wavelets ( 1 ) . after multiple modifications ( 2 , 3 ) , cox maze iii and more recently , cox maze iv operation reported success rate that ranges from 79 to 99% ( 4 , 5 ) . preoperative left atrium size and duration of atrial fibrillation have been identified as two important determinants in restoring sinus rhythm ( 6 - 9 ) . however , much of the studies were focused on the success rate and predictors of sinus conversion and less is known about the electrocardiographic characteristics in those who maintain sinus rhythm . therefore this type of procedure could alter p wave morphology in the surface ecg , which might prevent exact diagnosis of the cardiac rhythm of patients . however , characteristics of p wave in these patients have not been yet elucidated systematically . this study was aimed to describe the characteristics of p wave morphology and amplitude using standard 12-lead ecg in patients with normal sinus rhythm at 6 months after the cox maze procedure . between january and december 2007 , total 61 consecutive patients underwent the modified cox maze iii or iv operation at seoul national university hospital . the standard 12-lead surface ecg and 2-dimensional transthoracic echocardiography were performed at 6 months after the operation . six - month ecg was not available in 7 patients and 18 patients did not show normal sinus rhythm on the 6-month ecg . therefore total 36 patients were included to evaluate the p wave . in cox maze iii operation , specific ' maze ' of incisions is made along both atria by ' cut and sew ' technique , and left atrium appendage is excised . the cox maze iv operation is rather simplified by replacing many of the traditional cut and sew lesions with linear lines of ablation by using a bipolar radiofrequency energy device . the cox maze iv operation isolates right and left pulmonary veins as two islands , preserves right atrial appendage and leaves most of the left atrium in electrical continuity with remainder of the atrium . amplitude and duration of p waves of all 12 leads were measured using an electronic caliper in each patient . paired sample t - test was used to compare the preoperative and postoperative echocardiographic parameters . between january and december 2007 , total 61 consecutive patients underwent the modified cox maze iii or iv operation at seoul national university hospital . the standard 12-lead surface ecg and 2-dimensional transthoracic echocardiography were performed at 6 months after the operation . six - month ecg was not available in 7 patients and 18 patients did not show normal sinus rhythm on the 6-month ecg . therefore total 36 patients were included to evaluate the p wave . in cox maze iii operation , specific ' maze ' of incisions is made along both atria by ' cut and sew ' technique , and left atrium appendage is excised . the cox maze iv operation is rather simplified by replacing many of the traditional cut and sew lesions with linear lines of ablation by using a bipolar radiofrequency energy device . the cox maze iv operation isolates right and left pulmonary veins as two islands , preserves right atrial appendage and leaves most of the left atrium in electrical continuity with remainder of the atrium . all electrocardiograms were reviewed by two independent electrocardiographers . amplitude and duration of p waves of all 12 leads paired sample t - test was used to compare the preoperative and postoperative echocardiographic parameters . fourteen patients ( 38.9% ) were males and the mean heart rate was 7813 beats per minute . twenty patients had undergone the modified cox maze iii operation and 16 patients had the modified cox maze iv operation . twenty - three patients had been diagnosed as mitral stenosis and all patients had undergone concomitant cardiac procedures , most of which was mitral valve replacement ( 33/36 , 91.7% , table 1 ) . the preoperative and postoperative left atrium ( la ) diameters were 56.57.6 mm and 48.36.5 mm , respectively . all the medications of the patients were reviewed , which included digoxin , amiodarone , beta blockers , calcium channel blockers , ace inhibitors and arbs . neither medications nor type of the operation affect characteristics of p wave on ecg . on surface ecg at 6 months after the operation , the patients with sinus rhythm showed average p - wave axis of 6530 degrees . none of the recruited patients showed sinus node dysfunction including severe sinus bradycardia , sinus pauses , or atrial tachyarrhythmias . the average amplitude of p wave was less than 0.1 mv in all 12-leads , with highest amplitude in v1 , which was 0.070.03 mv ( table 2 ) . the morphology of p wave were mostly monophasic with positive polarity ( 49% ) , except the lead avr which appeared monophasic with negative polarity . table 3 shows frequency of different morphologies in ecg after cox maze procedure , according to each leads . p mitrale or large negative p terminal force in lead v1 , which are commonly accepted as typical ecg of left atrial enlargement , were not found in our patients . among 36 patients , when we compared the patients with la activity versus those without la activity , there were no significant differences in characteristics of p wave and echocardiographic parameters ( table 4 ) . also , the morphology of p wave did not show significant difference when two types of maze operation were compared . in this study , the morphology of p wave was different from what is usually seen in la enlargement , which is characterized by wide and notched p wave , so called p mitrale , in the leads i and ii and large p - terminal force in v1 . the most common morphology of p wave in our study was different from these , despite enlarged la . after the modified cox maze procedure , most of the la , especially posterior wall and appendage , become electrically isolated . these regions are mainly responsible for notched wide p wave in i and ii and large p - terminal force in v1 . they studied p wave morphology of patients undergoing atrial compartment operation for chronic atrial fibrillation , and found that 93% of patients showed altered p wave , which was small with average amplitude of 1.00.3 mm , and increased negative terminal force was not seen in v1 . study of lo et al . differed from our study in the aspects that their surgical management was not the cox maze operation and the number of enrolled patient was smaller ( n=15 ) than that of our study . they showed terminal negative deflection in inferior leads which corresponds to the right atrial appendage activation . this finding was not seen in our patients because the right atrial appendage as well as the left appendage is isolated or obliterated in the cox maze operation . therefore the results of the present study would be the first systematical evaluation of p wave morphology in patients with successful outcome of the modified cox maze operation . our study showed that p waves in ecg of these patients were very small with amplitude less than 0.1 mv , as a result of the cox maze procedure . the maze circuit lengthens the period of atrial depolarization which leads to small or even absent p waves and make it hard to identify p waves in a standard 12 lead ecg . the difficulty in identifying the p wave may also be due to the low gain of the standard 12-lead ecg , which can be overcome by amplifying the gain and frequency of the ecg . ( 11 ) reported that adding right precordial leads from v3r through v6r to the standard 12-lead surface ecg can improve detection of p waves and identification of atrial electrical activity . they studied 30 patients after combined cox - maze iii procedure and mitral valve surgery , and reported right precordial ecg , especially v4r , is a helpful tool for visualization p waves . our data showed 30.6% of patients with recovered la activity at 6 months after the maze operation . the low rate of la activity may be due to delayed recovery of atrial function after the atrial compartment operation , which has been reported from earlier studies ( 12 , 13 ) . this " period of left atrial paralysis " may have contributed to the low rate of atrial activity in our patients . first , this is a single - center study and the number of patients enrolled in the present study was not large . however , we think that the data would be representative enough to observe the ecg characteristics of the patients after cox maze operation because the patients were consecutively enrolled and the same design of suture or cryoablation line was applied to all patients . second , none of the enrolled patients underwent electrophysiological study , which might be the most accurate method to identify the patient 's rhythm . in our series of 61 patients , small portion of these 18 patients might have sinus rhythm with very small amplitude of p waves , thus their ecg diagnoses were considered as non - sinus rhythm such as junctional rhythm . however the effects on the overall data might be minimal . in conclusion , the morphology of p wave in patients after maze operation showed loss of typical ecg pattern of p mitrale . the characteristics of p wave morphology after maze operation was small in amplitude , monophasic and with positive polarity .

maze operation could alter p wave morphology in electrocardiogram ( ecg ) , which might prevent exact diagnosis of the cardiac rhythm of patients . however , characteristics of p wave in patients with sinus rhythm after the operation have not been elucidated systematically . consecutive patients who underwent the modified cox maze operation from january to december 2007 were enrolled . the standard 12-lead ecg and echocardiography were evaluated in patients who had sinus rhythm at 6 months after the operation . the average axis of p wave was 6530 degrees . the average amplitude of p wave was less than 0.1 mv in all 12-leads , with highest amplitude in v1 . the most common morphology of p wave was monophasic with positive polarity ( 49% ) , except avr lead , which was different from those in patients with enlarged left atrium , characterized by large p - terminal force in the lead v1 . there were no significant differences in p - wave characteristics and echocardiographic parameters between patients with la activity ( 30.6% ) versus without la activity ( 69.4% ) at 6 months after the operation . in conclusion , the morphology of p wave in patients after maze operation shows loss of typical ecg pattern of p mitrale : p wave morphology is small in amplitude , monophasic and with positive polarity .

the ct perfusion ( ctp ) is an important modality in acute stroke imaging to delineate the infarct from ischemic penumbra especially when considering tissue plasminogen activators ( t - pa ) and endovascular intervention ( ei ) . it is a very sensitive measure of cerebral blood flow dynamics playing a vital role in diagnosing stroke mimics like seizures , migraine , tumors , abscess , hypoglycemia , and posterior reversible encephalopathy syndrome ( pres ) , when they present to emergency department as a stroke . even though intravenous t - pa is the standard of care in acute ischemic strokes , if given to nonstroke patients , they may contribute to morbidity . we present a case report where ct perfusion of the brain played a significant role in the diagnosis and management . he was seen by paramedics ( ems ) as obtunded , nonverbal , with left gaze deviation , and flaccid right extremity . there was no past medical history of seizures , but ems noticed an episode of seizure on the way to the hospital and intubated him for airway protection . the brain ct perfusion ( ctp ) showed [ figures 1 and 2 ] reduced time to peak ( ttp ) , increased cerebral blood flow ( cbf ) , and volume ( cbv ) . in ischemic stroke the core infarct would show increased time to peak ( ttp ) , reduced cerebral blood flow ( cbf ) , and volume ( cbv ) whereas penumbra would show increased time to peak ( ttp ) , reduced cerebral blood flow ( cbf ) but increased blood volume ( cbv ) [ table 1 ] . ct perfusion axial view at the level of the sylvian fissure demonstrate reduced ttp ( white arrows ) in the parietal - temporal lobe with corresponding increase in cerebral blood flow ( cbf ) ( white arrows ) and cerebral blood volume ( cbv ) ( white arrows ) suggestive of increased blood flow in these areas . mean transit time ( mtt ) , is a measure of the mean time for blood / contrast to perfuse a region of tissue . ct perfusion axial view at the cerebral high convexity level demonstrate reduced ttp ( white arrows ) in the parietal - temporal lobe with corresponding increase in cerebral blood flow ( cbf ) ( white arrows ) and cerebral blood volume ( cbv ) ( white arrows ) suggestive of increased blood flow in these regions . the ct perfusion is a quick , fast imaging modality which if incorporated in acute stroke imaging will shed light not only on the infarct size and penumbra but also delineate conditions mimicking stroke . when a patient presents with stroke - like symptoms and altered sensorium is one of the presenting complaints , the differential can be wide including intra - cerebral hemorrhage , large frontal infarcts , thalamic infarcts , infarcts involving the reticular activating system , hypoglycemia , postictal states , and other stroke mimics . acute post - stroke epilepsy is not a rare entity and can present with focal neurological deficits mimicking stroke . when the patient is obtunded , intubated , or in no position to participate in the clinical assessment , imaging plays a significant role . since the ictal focus has high metabolic demand due to excito - toxicity there will be hyperperfusion , which is manifested in the perfusion studies as above . plain ct head without the perfusion in the above scenario with the described neurological examination would have wrongly led to intravenous thrombolysis . however , limitations for ct perfusion studies are exposure to additional radiation ( also intravenous contrast ) , additional delay ( 15 minutes ) in care , and cost of the procedure . the brain ctp is a very sensitive imaging in acute strokes and can also play a pivotal role in diagnosis of stroke mimics . however , caution is advised in interpretation of perfusion images and needs to be done in conjunction with the clinical story rather than in isolation .

stroke mimics constitute 15 - -20% of all cases presenting to the emergency department , prominent among them being seizures , hypoglycemia , tumors , migraines , and posterior reversible leucoencephalopathy . they have also abnormal computerized tomography perfusion ( ctp ) findings . we report a case where ctp helped us to diagnose and treat a seizure when initial presentation was that of a stroke .

coronoid hyperplasia appears clinically as a slow but progressive reduction in mandibular opening resulting from contact of the enlarged coronoid process with temporal surface of the malar bone , or with medial surface of the zygomatic arch . other clinical features described by rowe include absence of pain , no occlusal abnormality , infringement of the coronoid process on the posterior aspect of the zygomatic process , and a predilection for males . this study is a case of trismus due to bilateral hyperplasia of the coronoid process , treated by coronoidectomy , and resulting in remarkably increased mouth opening . a 31-year - old asian male visited the department of oral and maxillofacial surgery for evaluation of restricted mandibular opening . maximal effort produced 20 mm of vertical interincisal opening , which could not be increased by external force . the patient s main complaints was limited mouth opening , and he did not report pain . the limitation of mouth opening started when the patient was a middle school student , but he could not remember the exact time . initially , he could eat anything , but now he can not eat large volume food due to trismus . he denied a familial history of trismus and previous trauma to head and neck area . there was no temporomandibular joint ( tmj ) pain or tenderness and no muscular tenderness or spasm . panoramic x - ray showed elongation of right and left coronoid process . on 3-dimensional computed tomography ( 3d ct ) scan , the enlarged coronoid process overlay the zygomatic process and blocked mouth opening when the patient opened his mouth to approximately 20 mm ( fig . 1 , 2 ) . the patient was admitted to the department of oral and maxillofacial surgery after one week and surgery was performed . anesthesia was induced after a blind nasal endotracheal intubation . because mouth opening was not improved after administration of a muscle relaxant ( rocuronium ) , a full thickness mucoperiosteal incision was made along the external oblique ridge from premolar to the highest point on the anterior aspect of ramus of the mandible on both sides . mucoperiosteum was reflected to expose the medial and lateral aspect of the ramus and coronoid process . the temporalis muscle insertion was detached from anterior portion of the ramus and coronoid process . a seldin ( walter lorenz surgical instrument ; biomet , warsaw , in , usa ) retractor was used to protect medial soft tissues while sufficiently exposing coronoid process . the osteotomy cut was conducted from sigmoid notch to anterior aspect of the ascending ramus with straight saw . a bone kocher clamp ( walter lorenz surgical instruments ) was used to remove coronoid process after removal of the remaining attachments of the temporalis muscle ( fig . 3 ) . immediately after coronoidectomy , the maximum mouth opening was 41 mm and smooth excursive movement was observed ( fig . post - operatively , the patient was advised to exercise the mouth opening with tongue blades . for the first eight weeks , mouth opening was slightly decreased to less than 30 mm , but thereafter , the maximum mouth opening was maintained at about 40 mm . at the one year exam , lateral movement and protrusion were symmetric and within normal range . panoramic x - ray and 3d ct , mechanical blocking by elongated coronoid process disappeared ( fig . bilateral hyperplasia of the coronoid processes of the mandible is an uncommon condition that results in limitation of mouth opening due to impingement of enlarged coronoid processes on the zygomatic bones . the peak age of presentation is in the middle of the third decade for both unilateral and bilateral cases . however , it usually takes nine years for bilateral and almost seven years with unilateral cases for patient to seek treatment . totsuka and fukuda reported that the most outstanding features are the striking predilection for males and onset of symptom of the condition near puberty . restricted mouth opening is almost inevitable , although this is typically long - standing and of insidious onset . unilateral coronoid hyperplasia often shows facial asymmetry , and on opening the mandible may rotate to the affected side . both unilateral and bilateral cases of coronoid hyperplasia have marked male preponderance and female bilateral coronoid hyperplasia is relatively rare . shira and lister argued that this abnormality could be a developmental defect in which cartilaginous growth centers in the coronoid processes persist , causing continued growth and hyperplasia . lyon and sarnat later suggested increased activity of the temporal muscles as an etiologic factor . however , electromyographic examination in patients with bilateral coronoid hyperplasia reveals normal masticatory muscles function . suggested that elongation of the coronoid process could be either congenital or secondary to protracted disc displacement . differential diagnoses to rule out for coronoid hyperplasia include ankylosis and pseudo - ankylosis of tmj . intra - articular reasons include internal derangement , intra - articular pathology , and tmj ankylosis . coronoid hyperplasia should be differentiated from jacob disease where trismus is caused by pseudo - joint formation . microscopic examination of jacob disease shows formation of a pseudo - cartilaginous joint between coronoid process and the zygoma . this pseudo - joint is characterized by reactive new bone on the surface of the coronoid process and a fibro - cartilaginous cap , probably as a consequence of traumatic injury with chronic friction between the two bones . surgical intervention is the treatment of choice for coronoid enlargement . in bilateral coronoid hyperplasia , limitation of mandibular movement is caused by mechanical impingement of the enlarged coronoid processes on the posterior surface of the zygoma . therefore , removal of enlarged portion of the coronoid processes is the only effective form of treatment . simple coronoidectomy is enough to correct the coronoid - malar interference . when a patient presents with slow but progressive reduction in mandibular opening and clinical features and panoramic x - ray suggesting coronoid hyperplasia , ct scan is recommended without other radiographic examinations . direct axial and coronal ct scans , multiplanar reformatting of axial scans and 3d reconstruction permit precise reproduction of the shape and size of the coronoid and malar structures of interest , and relationships of all structures of the temporal and infratemporal fossae . although a cartilaginous component is found in some cases , it is thought to be reactive in origin . intraoral approach to coronoidectomy affords enough access for resection of the coronoid process and a cuff of temporalis tendon . alternatively , an external approach using a coronal flap is advantageous in reducing risk of hematoma formation and intraoral scarring that can lead to relapse . if the hyperplastic area is bulbous and large , an extraoral approach may be necessary . the intraoral approach offers direct access without the risk of facial nerve injury or scars on the face , but herniation of the buccal fat pad into the surgical site can be annoying when the dissection is carried too far superiorly and medially . due to the prolonged disuse of temporalis muscle and post - operative scarring , post - operative physiotherapy is mandatory . in addition , prognosis is associated with the range of mouth opening immediately after surgery . if post - operative mouth opening is up to 40 mm , the prognosis is excellent . however , if post - operative mouth opening is less than 35 mm , the prognosis may not be satisfactory . therefore , increasing the patient s mouth opening to over 40 mm using a mechanical device is recommended immediately after bilateral coronoidectomy . post - operative mouth opening exercise with a mechanical extensor must be started days after surgery . maintaining the mouth open over 40 mm during surgery is also effective in stretching atrophied muscles . in one study , while post - operative physical therapy increased the initial inter - incisal opening , the amount of opening returned to the preoperative situation . mouth opening exercise is required for 12 months to prevent formation of fibrous tissue that limits mouth opening . in conclusion , intraoral coronoidectomy followed by prolonged post - operative physiotherapy produced satisfactory and stable long - term results in coronoid process hyperplasia by correcting coronoido - malar interference .

bilateral coronoid hyperplasia causes painless progressive trismus , resulting from coronoid process impingement on the posterior aspect of the zygomatic bone . the etiology of coronoid hyperplasia is unclear , with various theories proposed . an endocrine stimulus , increased temporalis activity , trauma , genetic inheritance and familial occurrence have all been proposed , but no substantive evidence exists to support any of these hypotheses . multiplanar reformatting of axial scans and 3-dimensional reconstruction permit precise reproduction of the shape and size of the coronoid and malar structures , and relationships of all structures of the temporal and infratemporal fossae . this case shows remarkably increased mouth opening by coronoidectomy in a patient who complained of trismus due to hyperplasia of coronoid process .

pyoderma gangrenosum ( pg ) is an immune - mediated inflammatory skin condition occurring in about 12% of patients suffering from ulcerative colitis or crohn 's disease . the skin alterations are characterized by painful deep ulcers rapidly developing from small pustules and often triggered by a minor injury , a sequence known as pathergy . pg normally shows well - defined erythematous to violaceous borders and usually appears on the lower limbs . swabs of the wound initially prove to be sterile and histopathologic features are characterized by unspecific massive neutrophilic infiltration , hemorrhage and necrosis of the epidermis . pg is usually associated with autoimmune diseases such as rheumatoid arthritis and most commonly inflammatory bowel disease ( ibd ) , although pg can be mimicked by other autoimmune and hematological disorders such as polyarteritis nodosa , wegener 's granulomatosis , antiphospholipid syndrome and lymphoma . furthermore , pg can also be triggered by several cytokines , growth factors and medications including granulocyte colony - stimulating factor , interferons and antipsychotic drugs . the prevailing therapeutic strategy is based on systemic immunosuppression using either corticosteroids , ciclosporin or infliximab , a monoclonal antibody against tumor necrosis factor a ( tnf - a ) . however , management of pg is mainly based on clinical experience and skin lesions often turn out to be refractory to standard treatment . due to small case numbers and the lack of large randomised prospective trials , no guidelines for its treatment interestingly , patients with ulcerative colitis have only been reported to develop pg during the course of ibd but not during initial manifestation of bowel symptoms . we now report the first case of a simultaneous onset of ulcerative colitis and severe multifocal pg . a 37-year - old male patient was transferred to our department from a small community hospital with an obscure septic clinical picture showing disseminated skin ulcerations associated with bloody , watery diarrhea for 3 weeks . stool frequency was 610/day occurring during night and day and independently from food intake . simultaneously to the gastrointestinal symptoms , several pustules with a surrounding inflammatory erythema developed on the back ( fig . these lesions ( in total 10 ) rapidly progressed to large and painful cutaneous ulcerations , the largest of about 10 9.5 cm on the left thigh ( fig . further physical examination was without any pathological findings , there was no hint of any stool abnormalities in the past medical history , no fever , no night sweats , no previous dermatological diseases . leukocytes : 11.4 10/l ( 4.310 ) ; erythrocytes : 4.0 10/l ( 4.56.0 ) ; hemoglobin : 102 g / l ( 140180 ) ; mcv : 82 fl ( 8497 ) ; mch : 26 pg ( 2732 ) ; mchc : 315 g / l / ery ( 320360 ) ; platelets : 624 10/l ( 150350 ) ; hematocrit : 32% ( 4753 ) ; c - reactive protein : 172 mg / l ( < 5 ) ; albumin : 15 an infectious cause of the diarrhea was excluded by extensive stool tests including negative results for clostridium difficile , e. coli , shigella , campylobacter , salmonella , yersinia and parasites . colonoscopy . microscopic examination of the colon mucosa demonstrated characteristic features of ulcerative colitis with distorted crypt architecture , inflammatory cell infiltrates , goblet cell depletion , mucosal ulcers and crypt abscesses . cytomegalovirus was not detectable in biopsies from the colon , neither by microscopic examination nor through polymerase chain reaction . an infectious cause of the diarrhea was excluded by extensive stool tests including negative results for clostridium difficile , e. coli , shigella , campylobacter , salmonella , klebsiella , yersinia and parasites . colonoscopy and microscopic evaluation of multiple biopsies conclusively showed the characteristic picture of ulcerative colitis . the deep erythematous skin lesions initially proved to be sterile with central necrosis and well defined violaceous undermined edges . consequently , the diagnosis of pg was made , and the biopsy was consistent with the diagnosis . for visualization of the whole gastrointestinal tract we additionally performed a gastroscopy as well as a mr enteroclysis showing no relevant pathological features . ( 60 mg / day ) and azathioprine ( 2 mg / kg / day ) . however , ulcerations of the skin showed no tendency to heal despite topical tacrolimus ointment , daily dressing and wound cleansing . therefore , infliximab infusion at a dosage of 5 mg / kg was administered and repeated at weeks 2 and 6 to treat the skin ulcers . starting two weeks after the first infusion , lesions showed marked signs of improvement and disappeared four weeks later ( fig . prior to the first infliximab infusion active tuberculosis was ruled out by chest x - ray and skin test . we were able to completely taper off prednisolone while azathioprine was continued ( 2 mg / kg / day ) to maintain remission of disease . the patient is closely monitored in our ibd outpatient clinic and remains in full remission . a 37-year - old male patient was transferred to our department from a small community hospital with an obscure septic clinical picture showing disseminated skin ulcerations associated with bloody , watery diarrhea for 3 weeks . stool frequency was 610/day occurring during night and day and independently from food intake . simultaneously to the gastrointestinal symptoms , several pustules with a surrounding inflammatory erythema developed on the back ( fig . these lesions ( in total 10 ) rapidly progressed to large and painful cutaneous ulcerations , the largest of about 10 9.5 cm on the left thigh ( fig . further physical examination was without any pathological findings , there was no hint of any stool abnormalities in the past medical history , no fever , no night sweats , no previous dermatological diseases . relevant blood analysis . leukocytes : 11.4 10/l ( 4.310 ) ; erythrocytes : 4.0 10/l ( 4.56.0 ) ; hemoglobin : 102 g / l ( 140180 ) ; mcv : 82 fl ( 8497 ) ; mch : 26 pg ( 2732 ) ; mchc : 315 g / l / ery ( 320360 ) ; platelets : 624 10/l ( 150350 ) ; hematocrit : 32% ( 4753 ) ; c - reactive protein : 172 mg / l ( < 5 ) ; albumin : 15 an infectious cause of the diarrhea was excluded by extensive stool tests including negative results for clostridium difficile , e. coli , shigella , campylobacter , salmonella , yersinia and parasites . colonoscopy . histopathology . microscopic examination of the colon mucosa demonstrated characteristic features of ulcerative colitis with distorted crypt architecture , inflammatory cell infiltrates , goblet cell depletion , mucosal ulcers and crypt abscesses . cytomegalovirus was not detectable in biopsies from the colon , neither by microscopic examination nor through polymerase chain reaction . an infectious cause of the diarrhea was excluded by extensive stool tests including negative results for clostridium difficile , e. coli , shigella , campylobacter , salmonella , klebsiella , yersinia and parasites . colonoscopy and microscopic evaluation of multiple biopsies conclusively showed the characteristic picture of ulcerative colitis . the deep erythematous skin lesions initially proved to be sterile with central necrosis and well defined violaceous undermined edges . consequently , the diagnosis of pg was made , and the biopsy was consistent with the diagnosis . for visualization of the whole gastrointestinal tract we additionally performed a gastroscopy as well as a mr enteroclysis showing no relevant pathological features . ( 60 mg / day ) and azathioprine ( 2 mg / kg / day ) . however , ulcerations of the skin showed no tendency to heal despite topical tacrolimus ointment , daily dressing and wound cleansing . therefore , infliximab infusion at a dosage of 5 mg / kg was administered and repeated at weeks 2 and 6 to treat the skin ulcers . starting two weeks after the first infusion , lesions showed marked signs of improvement and disappeared four weeks later ( fig . prior to the first infliximab infusion active tuberculosis was ruled out by chest x - ray and skin test . we were able to completely taper off prednisolone while azathioprine was continued ( 2 mg / kg / day ) to maintain remission of disease . the patient is closely monitored in our ibd outpatient clinic and remains in full remission . the diagnosis of pg is primarily based on the typical clinical presentation showing deep and often painful skin ulcers with well - defined erythematous to violaceous borders and undermined edges , predominantly located on the lower extremities and the trunk . ibd is the most common underlying disorder and is found in 1520% of pg cases . of those with a chronic course of ulcerative colitis , more than 6% may develop pg independent from the presence or absence of acute intestinal inflammation . in these cases , intravenous application of infliximab , a chimeric monoclonal tnf - a antibody , has become an attractive and very effective treatment option . a first randomised , double - blind , placebo - controlled trial for the treatment of pg has recently underlined the therapeutic impact of infliximab . after administration of a single - shot infliximab infusion ( 5 mg / kg ) , 46% of the infliximab group improved within two weeks as compared to 6% of patients in the placebo group . interestingly , in another recent investigation by regueiro et al . even higher remission rates were reported , most likely due to increased number of infliximab infusions administered . in that case series , patients received a median of eight infusions of infliximab ( range 124 ) , starting with an induction dosing regimen at week 0 , week 2 and week 6 . therefore , a sequential administration of infliximab appears superior , although the optimal number of infliximab infusion for induction of healing and sustained suppression of pg in patients with crohn 's disease or ulcerative colitis remains to be determined . notably , patients included in that study had the diagnosis of ibd for at least 6 years , the earliest pg was diagnosed 5 years after the initial diagnosis and lasted 4 month before treatment with infliximab was started . interestingly , complete healing of pg , even of small skin lesions , took considerably longer and required additional infliximab infusions every 412 weeks to maintain the clinical response in 10 of 13 patients . in contrast , we started infliximab therapy in our patient immediately after the initial diagnosis of pg . we observed complete healing of all skin ulcers after six weeks ( two infliximab infusions ) and until now , there has been no sign of pg recurrence or intestinal inflammation , suggesting a particularly powerful effect of infliximab at early stages of pg . in summary , our case report is dealing with two interesting and novel aspects regarding the onset and therapy of pg in patients with ulcerative colitis . to the best of our knowledge , this is the first report demonstrating that disseminated pg can be present at the very first onset of ulcerative colitis . in fact , our patient had no history of diarrhea or extraintestinal symptoms prior to the onset of the reported episode of bloody diarrhea and multilocalized skin ulcers . in addition , we provide first evidence that infliximab may have a particularly powerful effect in early disseminated pg compared to late - onset pg , advocating an early application of this drug .

pyoderma gangrenosum ( pg ) is an immune - mediated inflammatory skin condition representing one of the most distinct extraintestinal manifestations of inflammatory bowel disease ( ibd ) . pg occurs independently from intestinal disease activity in about 12% of patients suffering from ulcerative colitis or crohn 's disease and is characterized by chronic deep skin ulcers whose exact pathogenesis is still unknown . so far , patients with ulcerative colitis have only been reported to develop pg during the course of ibd but not at the initial manifestation of bowel symptoms . this is the first report demonstrating the simultaneous onset of ulcerative colitis and severe multifocal pg . in addition , we provide first evidence that infliximab may have a particularly powerful effect in early disseminated pg compared to late - onset pg , advocating an early application of this drug .

different carbanionic nucleophiles can be reacted with -amido sulfones , affording a wide variety of amino derivatives [ 2 - 7 ] . in addition , considerable research has been conducted on the reaction of nitrogen nucleophiles and ,-unsaturated carbonyls [ 8 - 11 ] . heteronucleophiles as well as carbanionic reagents can react with -amido sulfones , thus giving the opportunity to prepare a large array of amino derivatives . furthermore , a series of amino derivatives containing 1 , 3 , 4-oxadiazole ring were synthesized by the reaction of 1 , 3 , 4-oxadiazole-2-thiol with suitably substituted amines and formaldehyde in ethanol . based on these reports , we executed an inorganic base - mediated reaction of 5-subsititued phenyl-1 , 3 , 4-oxadiazole-2-thiols as the source of nitrogen nucleophiles with n - benzoyl--amido sulfones to produce n , n - aminals . interestingly , the resulting compounds bearing a 1 , 3 , 4-oxadiazole ring are often associated with significant fungicidal and insecticidal activities [ 13 - 15 ] . nevertheless , as of today , there has been no report on antiviral activities of n - substituted benzamides bearing 1,3,4-oxadiazol unit . the synthetic route to the title n - substituted benzamides 5 is shown in scheme 1 . in order to prepare the key electrophilic component n - benzoyl--amido sulfones 4 for the final reaction , a three components reaction involving aromatic aldehyde , benzamide and sodium sulfonate was used by modifying the procedure reported by chemla . the reaction was fast , free of any significant side products formation and the pure product was isolated in moderate yield through recrystallization . the sulfones were characterized by h nmr , c nmr and ir spectral data . finally , reaction of nitrogen nucleophiles 3 with n - benzoyl--amido sulfones in the presence of basic catalyst koh in ch2cl2 at room temperature afforded the desired n - substituted benzamides 5 bearing 1,3,4-oxadiazol group [ additional file 1 ] . the effect of different solvents and bases was studied at room temperature with a fixed reaction time of 24 h ( table 1 ) . under these conditions , dichloromethane ( ch2cl2 ) provided the product in higher yield compared to toluene , tetrahydrofuran ( thf ) or acetonitrile . amongst the various bases screened for the experiment , koh gave the best result and higher conversion was achieved when 1.2 equiv of koh was used instead of 1.0 equiv . under optimized conditions , the isolated yield of the n - substituted benzamides 5a reached as high as 70% when the reaction mixture was stirred for 24 h in ch2cl2 using 1.2 equiv of koh . synthetic sequence to n - substituted benzamide analogues 5 containing 1,3,4-oxadiazole ring . effect of different solvents and bases for the synthesis of 5a unless otherwise noted , reactions were carried out with 0.5 mmol ( 1.0 equiv ) of 4a , 0.6 mmol ( 1.2 equiv ) of 3a in 5.0 ml solvent and 1 ml h2o using 0.6 mmol ( 1.2 equiv ) of basic catalyst at room temperature for 24 h. reaction was carried out with 0.5 mmol ( 1.0 equiv ) of koh at room temperature for 24 h. isolated yield after chromatographic purification . the results of in vivo antiviral activity studies of the n - substituted benzamides 5a-5u against cmv are given in table 2 . most of the compounds showed promising results in terms of curative bioactivities at 500 g / ml . the comparison of the antiviral activity of the products with commercial reference leads to the following conclusions : ( a ) the antiviral activity is affected by the type of the substituents present in the compound . the compounds containing 2-fluorophenyl or 4-fluorophenyl group showed better anti - cmv activity compared with those derived from other groups . in particular , n - substituted benzamides 5o ( r= o - f , r= p - cl ) and 5c ( r= p - f , r= m - cl ) displayed moderate curative rates ( 48.7% and 42.2% , respectively ) against cmv at the concentration of 500 g / ml . these values were comparable to the curative rate ( 53.4% ) shown by the commercial reference ningnanmycin , and superior to other compounds bearing different substituents . compared with the compounds 5o and 5c bearing suitably substituted aryl substituents , the compounds bearing an unsubstituted phenyl ring , such as 5a and 5n , showed lower inhibitory activities . ( c ) the structural modification caused by changing the substituents ( rand r ) in the phenyl ring have a wide impact on anti - viral activity of the prepared compounds . bioactivity of various compounds having the same substituents at different positions of the phenyl ring is various . thus , amongst the compounds 5b , 5c , 5o and 5p containing the same substituents at different positions of the phenyl ring , the compound 5o carrying 4-chloro and 2-fluoro groups in their respective phenyl rings exhibited better bioactivity than others . although these compounds , in general , exhibited slightly lower activity in comparison with the commercial reference ningnanmycin at the concentration of 500 g / ml , some suitably substituted n - substituted benzamides bearing 1,3,4-oxadiazol moiety showed favourable antiviral activity in the preliminary studies . subtle structural variation might lead to enhancement of activity and should be the direction of future research . curative effect of the title compounds 5 against cmv in vivo all antiviral tests were carried out at the concentration of 500 g / ml . the results of in vivo antiviral activity studies of the n - substituted benzamides 5a-5u against cmv are given in table 2 . most of the compounds showed promising results in terms of curative bioactivities at 500 g / ml . the comparison of the antiviral activity of the products with commercial reference leads to the following conclusions : ( a ) the antiviral activity is affected by the type of the substituents present in the compound . the compounds containing 2-fluorophenyl or 4-fluorophenyl group showed better anti - cmv activity compared with those derived from other groups . in particular , n - substituted benzamides 5o ( r= o - f , r= p - cl ) and 5c ( r= p - f , r= m - cl ) displayed moderate curative rates ( 48.7% and 42.2% , respectively ) against cmv at the concentration of 500 g / ml . these values were comparable to the curative rate ( 53.4% ) shown by the commercial reference ningnanmycin , and superior to other compounds bearing different substituents . ( b ) substituents have a certain influence on the activity . compared with the compounds 5o and 5c bearing suitably substituted aryl substituents , the compounds bearing an unsubstituted phenyl ring , such as 5a and 5n , showed lower inhibitory activities . ( c ) the structural modification caused by changing the substituents ( rand r ) in the phenyl ring have a wide impact on anti - viral activity of the prepared compounds . bioactivity of various compounds having the same substituents at different positions of the phenyl ring is various . thus , amongst the compounds 5b , 5c , 5o and 5p containing the same substituents at different positions of the phenyl ring , the compound 5o carrying 4-chloro and 2-fluoro groups in their respective phenyl rings exhibited better bioactivity than others . although these compounds , in general , exhibited slightly lower activity in comparison with the commercial reference ningnanmycin at the concentration of 500 g / ml , some suitably substituted n - substituted benzamides bearing 1,3,4-oxadiazol moiety showed favourable antiviral activity in the preliminary studies . subtle structural variation might lead to enhancement of activity and should be the direction of future research . curative effect of the title compounds 5 against cmv in vivo all antiviral tests were carried out at the concentration of 500 g / ml . the melting points of the products were determined on an xt-4 binocular microscope ( beijing tech instrument co. , china ) and were not corrected . the ir spectra were recorded on a bruker vector 22 spectrometer in a kbr disk . h nmr ( 500 mhz ) , c nmr ( 125 mhz ) and f nmr ( 470 mhz ) spectral analyses were performed on a jeol - ecx 500 nmr spectrometer at room temperature using tms as an internal standard and cdcl3 as the solvent . intermediate 1 , intermediate 2 and 5-subsititued phenyl-1,3,4-oxadiazole-2-thiol 3 were prepared according to the reported methods and used without further purifications [ additional file 2 ] . the leaves of nicotiana tabacum l. inoculated with cmv were selected and grinded in phosphate buffer and filtered through double - layer pledget . the filtrate was centrifuged at 8000 g and the supernatant liquid was the crude extract of virus . absorbance values were estimated at 260 nm using an ultraviolet spectro - photometer . tested compounds and 2% ningnanmycin aqua used as a reference antiviral agent were first dissolved in minimum volume of n , n - dimethylformamide ( dmf ) and then diluted with distilled water containing 1% tween 20 at 500 g / ml concentration . crude extracts of cmv were dipped and inoculated with a brush on the whole leaves , which were previously scattered with silicon carbide . the compound solution was smeared on the left side of leaves , and the solvent was smeared on the right side for control . the inhibition rate of the compound was calculated according to the following formula ( av denotes average ) : the melting points of the products were determined on an xt-4 binocular microscope ( beijing tech instrument co. , china ) and were not corrected . the ir spectra were recorded on a bruker vector 22 spectrometer in a kbr disk . h nmr ( 500 mhz ) , c nmr ( 125 mhz ) and f nmr ( 470 mhz ) spectral analyses were performed on a jeol - ecx 500 nmr spectrometer at room temperature using tms as an internal standard and cdcl3 as the solvent . intermediate 1 , intermediate 2 and 5-subsititued phenyl-1,3,4-oxadiazole-2-thiol 3 were prepared according to the reported methods and used without further purifications [ additional file 2 ] . the leaves of nicotiana tabacum l. inoculated with cmv were selected and grinded in phosphate buffer and filtered through double - layer pledget . the filtrate was centrifuged at 8000 g and the supernatant liquid was the crude extract of virus . tested compounds and 2% ningnanmycin aqua used as a reference antiviral agent were first dissolved in minimum volume of n , n - dimethylformamide ( dmf ) and then diluted with distilled water containing 1% tween 20 at 500 g / ml concentration . crude extracts of cmv were dipped and inoculated with a brush on the whole leaves , which were previously scattered with silicon carbide . the compound solution was smeared on the left side of leaves , and the solvent was smeared on the right side for control . the inhibition rate of the compound was calculated according to the following formula ( av denotes average ) : we have demonstrated a general and practical route for the synthesis of the n - substituted benzamides bearing 1,3,4-oxadiazol moiety in the presence of an inorganic base as the catalyst . the reaction of 5-subsititued phenyl-1,3,4-oxadiazole-2-thiol which serves as the source of n - nucleophile with in situ generated protected imine from n - benzoyl--amido sulfones provides a ready access to a series of structurally diverse n , n - aminals . the antiviral tests indicated that some of the synthesized compounds possessed of moderately high curative activity against cmv . the structure of the target products needs to be optimized to enhance their antiviral activity . further studies on mechanistic aspects , enantioselectivities and asymmetric variants of catalysts for this reaction are currently being investigated in our group . the current study is an outcome of constructive discussion with bas , sy , lhj and dyh who offered necessary guidance to yj to carry out his synthesis and characterization experiments . xw performed the antiviral tests ; hxq carried out the h nmr , c nmr and f nmr spectral analyses . yield and elemental analyses data for title compounds 5a - u . which contains the table about structure , yield and elemental analyses data for title compounds 5a - u . experimental details and data of title compounds 5a - u . which includes the experimental procedure , spectroscopic data of intermediate 3 , intermediate 4 , title compounds 5a - u , copies of h nmr and c nmr . we gratefully acknowledge the generous financial support received from the national key project for basic research ( 2010cb126105 , 2010cb134504 ) and the national natural science foundation of china ( 20872021 ) .

backgroundheteronucleophiles as well as carbanionic reagents can be used to react with -amido sulfones , thus giving the opportunity to prepare a large array of amino derivatives . since , novel 1,3,4-oxadiazole-2-thiol derivatives can serve as potent nucleophiles , we employed 5-subsititued phenyl-1,3,4-oxadiazole-2-thiols as the nucleophilic source of nitrogen in the reaction with -amido sulfones.resultsa series of n - substituted benzamides bearing 1,3,4-oxadiazol unit were prepared for the first time by the reaction of in situ generated protected imine from -amido sulfones with 5-subsititued phenyl-1,3,4-oxadiazole-2-thiols as the source of nitrogen nucleophile . some of the synthesized products displayed favourable antiviral activity against cucumber mosaic virus ( cmv ) in preliminary antiviral activity tests . the title compounds 5c , 5o and 5r revealed curative activity of 42.2% , 48.7% and 40.5% , respectively against cmv ( inhibitory rate ) compared to the commercial standard ningnanmycin ( 53.4% ) at 500 g / ml.conclusiona practical synthetic route to n - benzoyl--amido sulfones by the reaction of 5-subsititued phenyl-1,3,4-oxadiazole-2-thiols as the source of nitrogen nucleophiles with in situ generated protected imine from n - benzoyl--amido sulfones is presented . the reaction catalyzed by an inorganic base has considerable significance to exploit the potential of -amido sulfones in organic synthesis .

a 74-year - old woman first presented to another hospital 18 months previously with generalized tonic she was not taking anti - hypertensive medication , following instead a low salt diet on the advice of her family doctor . serum sodium on presentation was 117 mmol / l , and her seizures were attributed to hyponatraemia , which was in turn thought to be secondary to reduced salt intake . she was commenced on phenytoin in hospital which was continued after discharge . over the following weeks , she developed an unusual neurological syndrome characterized by involuntary jerking of the upper limbs , lip smacking and falls . initially , the dose of phenytoin was increased and subsequently levetiracetam and primidone were added . despite this , the episodes became more frequent , occurring > 20 times / day . the involuntary movements continued , her affect became withdrawn and her cognitive ability rapidly declined . her falls became more frequent and more severe necessitating numerous hospital visits . during this time repeat mri showed subtle increased signal intensity in the mesial temporal lobes bilaterally , raising the possibility of limbic encephalitis ( le ) . a thorough workup for latent malignancy was performed , including computed tomography imaging of the thorax , abdomen and pelvis , tumour markers and repeat lumbar puncture . while routine analysis of the cerebrospinal fluid was again normal , fluid sent for autoantibody screening demonstrated the presence of anti - leucine - rich anti - glioma 1 protein ( anti - lgi1 ) antibodies . in the absence of any evidence of malignancy , the patient was diagnosed with autoimmune encephalitis and started on intravenous immunoglobulin ( ivig ) 1 g / kg . following the first ivig infusion , serum sodium fell from 127 to120 mmol / l . serum osmolality was low at 260 mosm / l and urine osmolality was inappropriately high at 554 mosm / l . the picture was felt to be in keeping with chronic inappropriate anti - diuretic hormone ( adh ) release due to le exacerbated acutely by administration of the ivig solution . as vasopressin inhibitors were not available , the patient was managed with fluid restriction and oral salt tablets and administration of the remaining ivig was deferred until sodium normalized . serum sodium increased to 136 mmol / l , allowing for the remainder of the planned ivig to be given in a more gradual fashion . the patient s neurological symptoms and hyponatraemia resolved with monthly ivig for an initial 6 months followed by maintenance oral azathioprine . the limbic system comprises the amygdala , thalamus , hypothalamus and medial temporal lobes and is primarily responsible for modulating behaviour , governing emotions and control of neuro - endocrine functions . le typically presents with behavioural disturbance , changes in personality and cognitive impairment and may often be misdiagnosed as a psychiatric disorder . classically , le has been considered a paraneoplastic phenomenon , most frequently as a complication of small - cell lung cancers . more recently , it has become apparent that le may occur in the absence of malignancy . autoimmune le has emerged as a distinct clinical entity , and novel autoantibodies to neuronal cell surface proteins have now been described [ 35 ] . antibodies against the n - methyl d - aspartate ( nmda ) receptor , the glutamate 1 ( glur1 ) and glur2 subunits of the -amino-3-hydroxy-5-methly-4-isoxazolepropionic acid receptor and against the b1 subunit of the gamma - aminobutyric acid b receptor have all been described . the most recently implicated autoantibody is to the leucine - rich anti - glioma 1 protein ( lgi1 ) . this protein is involved in synaptic transmission and inherited loss - of - function mutations cause autosomal dominant lateral temporal epilepsy and autosomal dominant partial epilepsy with auditory features . anti - lgi1 le typically presents with movement disorder , personality change and seizure and is complicated by hyponatraemia , which may be severe in up to 60% of cases . the exact cause of hyponatraemia is unclear . certainly in the case described here , the patient behaved clinically and biochemically as if an excess of anti - diuretic hormone was present with low serum osmolality and inappropriately high urine osmolality , responding to fluid restriction and increased solute intake . animal models have demonstrated that lgi1 is strongly expressed in the hypothalamus , which might support the theory that hyponatraemia is secondary to excess adh release . however , lgi1 is also expressed in specific tubules of the kidney , which raises the possibility of a direct antibody effect on the renal tubules ( figure 1 ) . immunohistochemical analysis of the expression pattern of lgi1 in individual specific tubules in the kidney from the bacterial artificial chromosome transgenic mouse . may be misleading as a sub - section of patients with these antibodies will go on to develop malignancies and must be screened regularly . this is especially important in young women with nmda receptor - associated encephalitis where 50% of those aged 18 years will develop ovarian teratoma . in males with the same condition , the discovery of a tumour is extremely rare . in those patients in whom malignancy can not be demonstrated , le , it is important to bear in mind that ivig may itself cause hyponatraemia , which can lead to transient worsening of neurological symptoms , as observed in this case . ivig is essentially an iso - osmolar fluid , which , when administered to a patient with a fixed high urine osmolality due to inappropriate adh release , can not readily be excreted . pseudohyopnatraemia due to expansion of the solid phase of the plasma by the high protein content of ivig must be ruled out but will be associated with normal serum osmolality . in patients with renal failure receiving maltose - based ivig suspensions , maltose may accumulate in the extra cellular fluid raising the serum osmolality and drawing water out of cells , leading to hyponatraemia . in patients with normal renal function , this does not occur because maltose is rapidly broken down to glucose in the proximal renal tubules and crosses freely into the peritubular capillaries . glucose may then be taken up by cells and metabolized , such that the net effect of giving iv maltose is delivery of a hypotonic fluid . le , once thought to be a rare paraneoplastic phenomenon is being diagnosed with increased frequency in patients without malignancy . autoimmune le should now be considered as part of the differential diagnosis in adults and children presenting with new onset of behavioural disturbance , personality change and cognitive decline , particularly if accompanied by seizure or movement disorder . it should always be kept in mind that in a patient presenting with confusion and hyponatraemia , the confusion may not be secondary to hyponatraemia and that a unifying diagnosis may be present . it is an important clinical point that ivig while highly effective in treating autoimmune le may , at least transiently , worsen hyponatraemia and the neurological symptoms .

limbic encephalitis ( le ) , once thought to be a rare paraneoplastic phenomenon , is increasingly diagnosed in patients without malignancy . autoimmune le has emerged as a distinct clinical entity . autoantibodies to neuronal cell surface proteins have been described and may now be tested for . this has led to an exponential increase in the number of cases being reported . the most recently implicated autoantibody is to the leucine - rich anti - glioma 1 protein ( lgi1 ) . this protein is involved in synaptic transmission and inherited loss - of - function mutations cause autosomal dominant lateral temporal epilepsy . lgi1 is also expressed in specific tubules in the kidney . anti - leucine - rich anti - glioma 1 protein ( anti - lgi1 ) le presents with sub acute onset of progressive neurological , cognitive and psychiatric disturbance . the condition is complicated in up to 60% of cases with severe and life threatening hyponatraemia . as well as causing significant morbidity , the co - existence of hyponatraemia may confuse the initial diagnosis . we present a case of anti - lgi1 which was complicated by hyponatraemia with a comprehensive review of the literature .