Datasets:

anumafzal94

/

10k-pubmed-4096

like 0

autophagy is essentially a pro - survival , catabolic process in response to stress stimuli . it is a recycling mechanism by which cells digest damaged or effete constituents and/or organelles ( " cargo " ) and recycle the nutrients ( e.g. , metals , lipids , amino acids etc . ) back to the cell for essential processes . it is a well orchestrated system that starts with the formation of a crescent - shaped structure , known as a phagophore , around the damaged cargo ( fig . this is followed by the recruitment of lipidated lc3-ii protein on to the membrane , which then leads to formation of a double membrane - bound organelle , known as the autophagosome , that encapsulates the cargo the acidic hydrolases in the lysosomes digest the cargo and facilitate recycling of nutrients back to the cytoplasm for re - utilization . de - regulation of autophagy can lead to accumulation of damaged and toxic molecules , which can result in pathological conditions such as the neurodegenerative disorders : alzheimer 's , parkinson 's and huntington 's disease . moreover , autophagy is also known to play significant roles in tumor progression and metastasis . autophagy has been shown to have both pro- as well as anti - oncogenic effects , depending on tumor stage and its microenvironment . some studies have demonstrated the involvement of autophagy in metastasis via its protective role in anoikis ( i.e. , loss - of - anchorage - dependent cell death ) and cell dormancy , which are characteristics of metastatic cells . the autophagic pathway : when cells experience stress it leads to an increase in damaged organelles and cellular constituents ( " cargo " ) . this event triggers autophagic initiation and results in the formation of a crescent - shaped structure , the phagophore , around the damaged cargo . this is followed by lipidation of lc3-i to form lc3-ii , which is then recruited onto the phagophore membrane . it is followed by membrane elongation and formation of double membranous organelle , known as autophagosome , around the damaged cargo . the autophagosomes then fuse with lysosomes to form autolysosomes , where lysosomal acid hydrolases digest the cargo and recycle nutrients back into the cytoplasm . it is required for numerous critical processes such as dna synthesis , heme and iron - sulfur cluster synthesis etc . it also plays an important role in the active sites of various enzymes such as cytochrome c , aconitase , and ribonucleotide reductase . hence , iron is an essential bio - metal required for normal physiological functioning of the cell . however , the levels of iron in the cell need to be tightly balanced , as an excess of iron can have damaging effects due to the generation of iron - catalyzed reactive oxygen species ( ros ) . in fact , iron can participate in the fenton and haber - weiss reactions , leading to ros generation , and thus , oxidative stress . therefore , either deprivation of iron or excessive iron levels in the cell can lead to stress and this can result in up - regulation of stress - induced autophagy . in fact , khan et al . have shown that the exogenous application of iron oxide nanoparticles to cells in culture can lead to induction of autophagy due to ros generation . as lysosomes are involved in autophagic turnover of organelles and long - lived proteins ( many of which contain iron ) , they become enriched in low molecular weight iron . this increases the susceptibility of lysosomes towards oxidative stress via the fenton and haber - weiss reactions . moreover , the lysosomal vacuoles engaged in autophagic degradation of iron - rich proteins or organelles become more prone to oxidative stress than those in the resting state . the cytosol contains a number of iron - binding proteins ( such as hsp70 and ferritin ) and autophagocytosis of these proteins can potentially sequester redox - active iron in lysosomes and decrease lysosomal vulnerability to oxidative stress . cells rich in these proteins have been demonstrated to be much more resistant to oxidative stress . thus , autophagy plays a critical role in balancing the redox - status of the cell via its ability to increase lysosomal iron levels as well as by autophagocytosis of iron - binding proteins . autophagy is also known to play an important role in maintaining physiological iron balance in the cell , through its role in the degradation of the iron - storage protein , ferritin . ferritin is known to be involved in removal of excess iron from the cytoplasm and its storage in a non - redox active form . indeed , ferritin has been shown to be degraded in cells by lysosomal acid hydrolases and it is known that ferritin enters lysosomes through the autophagic pathway . thus , autophagy plays a critical role in the mechanism via which iron homeostasis is maintained in the cell for normal physiological functioning . currently , very little is known regarding the effect of the iron chelators on autophagy . this is important to understand considering the use of these agents for the treatment of iron overload disease , but also potentially other conditions , including cancer . this can be done either directly by microscopic visualization , or indirectly by measuring the levels of lipidated lc3-ii protein , which is a classical marker for autophagosomes . as autophagy is a dynamic process , the levels of autophagosomes could increase either due to elevated autophagic initiation or due to decreased lysosome - mediated degradation of autophagosomes . to determine which part of autophagy pathway ( i.e. , initiation or degradation ) is affected , it is important to utilize late - stage autophagic inhibitors , such as bafilomycin a1 or chloroquine , in the experimental protocol . a recent investigation from our laboratory has demonstrated that the chelator , di-2-pyridylketone 4,4-dimethyl-3-thiosemicarbazone ( dp44mt ) , which forms redox - active iron and copper complexes , increases autophagosomes and lc3-ii levels in pancreatic cancer cells . the effect of dp44mt on autophagy was compared with the classical iron chelator , desferrioxamine ( dfo ) . although , dfo also led to a significant increase in lc3-ii levels , it was markedly less effective relative to dp44mt . furthermore , the role of redox activity of dp44mt was assessed by its ability to induce lc3-ii . the metal complexes of dp44mt were able to induce lc3-ii levels , while the dfo metal complexes did not , as they are redox - inactive . moreover , the anti - oxidant , n - acetylcysteine , was able to suppress the dp44mt - mediated increase in lc3-ii levels . these results indicated that ros generation by dp44mt - metal complexes plays a more significant role in autophagic induction than iron chelation alone . using the late - stage autophagy inhibitor , bafilomycin a1 however , over - expression of the metastasis suppressor , n - myc downstream regulated gene-1 ( ndrg1 ) , which is also known to be up - regulated by iron chelators including , dp44mt , resulted in suppression of dp44mt - mediated autophagic initiation . it was concluded that dp44mt initially increases activation of the autophagic initiation machinery , which is then subsequently suppressed by ndrg1 up - regulation when cells were exposed to this chelator for prolonged periods of time . interestingly , a very recent study from our laboratory has compared the autophagic - induction efficacy of dp44mt relative to dfo in breast cancer cells . it was shown that both dp44mt and dfo led to an increase in autophagosome number and lc3-ii levels . while dp44mt was able to induce the autophagic - initiation pathway , it also led to permeabilization of the lysosomal membrane , and thus , rendered tumor cells unable to complete autophagy . in contrast , dfo was unable to initiate autophagy and mainly affected the lysosomal - mediated degradation phase of autophagy . in another study , wu et al . demonstrated that dfo induced autophagy and exerted its neuro - protective effects in the rotenone - treated sh - sy5y cell model of parkinson 's disease . the authors further showed that dfo leads to the induction of autophagy via a hypoxia inducible factor-1 ( hif-1)-dependent pathway . this latter investigation indicates an important role of autophagy in protein aggregatory neurodegenerative disorders such as parkinson 's disease . the difference in the ability of dfo to induce autophagy in these neuron - like cell models relative to breast cancer cells ( gutierrez et al . , unpublished data ) , is potentially due to the different cell - types examined . as discussed above interestingly , domenico et al . have shown that different iron chelators can specifically determine the pathway via which ferritin is degraded in cells . these authors demonstrated that poorly permeant dfo led to lysosome - mediated degradation of ferritin via autophagy . on the other hand , the membrane - permeant iron chelators , desferasirox ( dfx ) and deferiprone ( dp ) , diverted ferritin degradation towards the proteasomal pathway . in contrast , another recent study has shown that both dfo and dfx lead to increased autophagy by suppression of the mammalian target of rapamycin ( mtor ) signaling pathway . again , the observed differences in the effect of dfx on the autophagic pathway may be cell - type dependent . critically , examining the studies above , it is notable that both investigations only visualized lc3-ii - containing autophagosomes as a marker of autophagy . considering that autophagy is a dynamic pathway , the observed increase in autophagosomes could be either due to increased autophagic initiation or because of suppression of the lysosome - mediated autophagic degradation step . hence , in order to ascertain the reason for the observed increase in autophagosome number , it is imperative to use late - stage autophagy inhibitors , such as bafilomycin a1 or choloroquine , in combination with iron chelators . thus , more detailed and better controlled studies will be required to determine the effect of different iron chelators on autophagy . although , iron and autophagy play a crucial role under both physiological as well as pathological conditions , little work has been done to understand the intricate relationship between this important biological metal and how it influences the autophagic pathway and vice versa . more detailed investigations are required to understand the mechanisms via which de - regulation of iron metabolism can affect autophagy . d.r.r . is the recipient of a national health and medical research council ( nhmrc ) senior principal research fellowship and project grants . d.j.r.l thanks the nhmrc for an early career postdoctoral fellowship and cancer institute of new south wales ( cinsw ) for an early career research fellowship . p.j.j . acknowledges the cinsw for an early career research fellowship .

abstractautophagy is an important cell survival pathway which is up - regulated under stress conditions.1 ) it is a well regulated catabolic process and enables the cell to recycle its constituents and organelles for re - use.1 ) autophagy has been implicated to play an important role in a variety of disorders such as cancer and protein aggregatory neurodegenerative diseases e.g. , alzheimer 's disease , parkinson 's disease and huntington 's disease.2 ) iron is a critical metal required for normal cellular functioning.3 ) a very tightly regulated balance of iron levels is required for the normal physiological functioning of the cell.3 ) both an excess and deficiency of iron can lead to cellular stress , and thereby , alters the autophagic status within the cell . thus , it is important to completely understand how iron can affect the autophagic pathway and its potential implications under physiological as well as pathological conditions .

in the previous issue of critical care , moina and podbregar report that changes in thenar muscle tissue saturation ( sto2 ) in response to vascular occlusion can be used to predict discrepancy between central ( scvo2 ) and mixed ( svo2 ) venous oxygen saturation in patients with combined severe left ventricular failure and sepsis . on first read this study is conceptually difficult . essentially , scvo2 is a surrogate marker of svo2 and is widely used to assess adequacy of oxygen delivery , and to guide the initial resuscitation of septic patients . trends in scvo2 may reflect those in svo2 , but alterations in oxygen extraction and redistribution of blood flow away from peripheral and splanchnic circulations in various shock states may cause clinically important differences between these values . in these circumstances scvo2 the current study suggests a means to identify these discrepancies which may be useful in the management of sepsis / septic shock , particularly in patients with complex haemodynamic disturbances these derangements can be studied non - invasively using near - infrared spectroscopy , a technique that is able to determine the oxygenation status of tissue haemoglobin . decreased sto2 reflects the presence of severe hypoperfusion and has been used clinically to guide resuscitation during hypovolaemic shock . unfortunately , in sepsis / septic shock absolute values of sto2 do not reliably differentiate patients from healthy individuals . the discriminatory power and predictive ability of sto2 can the vascular occlusion test ( vot ) is a provocative test in which sto2 is measured at a peripheral site ( such as the thenar eminence ) whilst a transient rapid vascular occlusion is performed for either a defined time interval or until a pre - defined sto2 value is reached . the vot - derived sto2 trace can be divided into four phases - baseline , ischemia , reperfusion , and hyperemia - and parameters can be measured for each of these . these include : rate of deoxygenation ( deo2 ) , measured from the sto2 downslope during the ischaemic phase - this is generally considered to reflect local muscle metabolism and mitochondrial oxygen consumption ; and rate of reoxygenation ( reo2 ) , measured from the sto2 upslope during reperfusion - this is the time required to wash out stagnant blood and is thought to reflect the reactivity of the microcirculation . studies suggest that the response to the vot differs in sepsis , with a slower deo2 during cuff occlusion and a prolonged reo2 during reperfusion when compared to healthy individuals . furthermore , it seems that vot reflects severity of illness and is sensitive to intervention with activated protein c . according to the current study it may also have a role in guiding resuscitation and optimisation of haemodynamics . firstly , there are wide variations in sto2 and vot - derived parameters dependent upon probe position and probe size . secondly , the vot procedure has yet to be standardized ; currently , different types and degrees of deflation thresholds ( for example , absolute sto2 of 40% or 50% versus duration of 3 minutes , 4 minutes , 5 minutes ) are employed . thirdly , context - specific ranges for vot - derived sto2 parameters need to be established in health to ensure correct interpretation of responses in pathological states . high quality data are also needed on the vot parameter values for different levels of disease severity , and indeed for different diseases . finally , the mechanisms underlying differences in sto2 response observed in sepsis need to be fully characterized . dynamic sto2 monitoring is a promising technique with the potential to provide a non - invasive ' biopsy ' of microvascular and mitochondrial function . used in conjunction with global measures of oxygen delivery it could provide an integrated approach to haemodynamic resuscitation of both the macro- and microcirculation in various shock states . furthermore , it may have utility in determining disease severity , outcome prediction , assessment of the biological effects of interventions , and in guiding future research . however , as with all new technologies it is essential that operating characteristics are robustly defined and that the limitations are fully appreciated before wider application to the clinical setting . deo2 : rate of deoxygenation ; reo2 : rate of reoxygenation ; scvo2 : central venous oxygen saturation ; sto2 : tissue oxygen saturation ; svo2 : mixed venous oxygen saturation ; vot : vascular occlusion test .

sepsis and shock result in disturbances in microcirculatory perfusion and tissue oxygen utilisation that may not be reflected in global measures of haemodynamics . near - infrared spectroscopy enables measurement of tissue oxygen saturation ( sto2 ) and provides information on local microvascular and mitochondrial function . this measure could be incorporated with existing targets of goal - directed therapy to provide an integrated approach to haemodynamic resuscitation of both the macro- and microcirculation in various shock states . however , key methodological factors must be addressed before widespread clinical application .

joint replacement ( arthroplasty ) as a surgical option for end stage arthritis is well established now and millions of patients across the world have benefited . india is a country of 1.2 billion people with significant knee and hip arthritis population . according to frost and sullivan research , the arthroplasty market is expected to grow at a compound annual growth rate of 26.7% during 2010 - 2017.1 according to this survey , almost 70,000 joint replacement surgeries were performed in india in the year 2011.1 the demand for joint replacement surgery is set to rise further ; therefore , the urgent need for training of surgeons as well as monitoring the implant usage . indian society of hip and knee surgeons ( ishks ) was established in 2005 with several goals . three important ones are arthritis research , surgeon training and setting up a joints registry . it is a registered charitable trust , with 26 arthroplasty surgeons across india as founder members . orthopedic joints implants such as used for total knee arthroplasty ( tka ) and total hip arthroplasty ( tha ) are normally expected to last for more than a decade based on clinical studies.23 new implants continue to be introduced with the hope that they are better than previous ones , but not all new prosthesis are better . in fact , some joint replacement implants that were thought to be the latest and better have turned out to be failures and even recalled.45678 history of arthroplasty implants shows that many devices such as threaded acetabular shells , metal backed patellar components , first generation ceramic heads and titanium bearing surfaces all failed early . recent examples include early failure of sulzer acetabular cup and 3 m capital hip implant and asr ( articular surface replacement , depuy , usa ) hip resurfacing system.45678 the clinical impact of failures such as these could be minimized with prompt reporting and ongoing data collection through registry . the worrying part is not that there have been failures , but how long they have taken to be detected . failure of any such implants needs to be established early to reduce patient morbidity and mortality from their continued usage . past experience of early failure of some devices has shown that early warning is necessary to reduce the social and economic impact of such early failures . the registry is very important as a watchdog to register and monitor all the arthroplasty implants and assesses the long term outcome . registry data is completely confidential and no personal information about patients or surgeons is accessible to any commercial entity . several countries have already established the arthroplasty registry , swedish national arthroplasty registry being one of the oldest and most reputed one.910 other countries that already have registry include finland , norway , denmark , australia , hungary , new zealand , scotland , canada , england / wales , romania , usa , south africa and malawi.1112131415161718 all registries except england and wales have been managed by orthopaedic surgeons and without any government control . as with all registries world currently , ishks has 42 members who contribute to the registry on a regular basis . orthopedic joints implants such as used for total knee arthroplasty ( tka ) and total hip arthroplasty ( tha ) are normally expected to last for more than a decade based on clinical studies.23 new implants continue to be introduced with the hope that they are better than previous ones , but not all new prosthesis are better . in fact , some joint replacement implants that were thought to be the latest and better have turned out to be failures and even recalled.45678 history of arthroplasty implants shows that many devices such as threaded acetabular shells , metal backed patellar components , first generation ceramic heads and titanium bearing surfaces all failed early . recent examples include early failure of sulzer acetabular cup and 3 m capital hip implant and asr ( articular surface replacement , depuy , usa ) hip resurfacing system.45678 the clinical impact of failures such as these could be minimized with prompt reporting and ongoing data collection through registry . the worrying part is not that there have been failures , but how long they have taken to be detected . failure of any such implants needs to be established early to reduce patient morbidity and mortality from their continued usage . past experience of early failure of some devices has shown that early warning is necessary to reduce the social and economic impact of such early failures . the registry is very important as a watchdog to register and monitor all the arthroplasty implants and assesses the long term outcome . registry data is completely confidential and no personal information about patients or surgeons is accessible to any commercial entity . several countries have already established the arthroplasty registry , swedish national arthroplasty registry being one of the oldest and most reputed one.910 other countries that already have registry include finland , norway , denmark , australia , hungary , new zealand , scotland , canada , england / wales , romania , usa , south africa and malawi.1112131415161718 all registries except england and wales have been managed by orthopaedic surgeons and without any government control . as with all registries world over , active participation from arthroplasty surgeons is very important . currently , ishks has 42 members who contribute to the registry on a regular basis . all members of ishks are encouraged to actively participate in the registry . a simple two page knee and hip form can be downloaded from the website www.ishks.com . the information collected includes patient demographics , indication for surgery , implant details and in case of revision arthroplasty : the details of implants removed and the cause of failure of primary arthroplasty . these forms are mailed to the central registry office and the data is fed in computerized registry . data collection started in october 2006 and until april 2012 , information was collected on 34478 tkas and 3604 thas [ figure 1 ] . a bardiagram showing registry data of tka and tha data of 34,478 tkas was assessed : these included 8612 males ( 25% ) and 25,866 females ( 75% ) . average age was 64.4 years ( osteoarthritis range : 45 to 88 years ; rheumatoid arthritis range : 22 to 74 years ) . the indication for tka was osteoarthritis in 33,444 ( 97% ) and rheumatoid arthritis in 759 ( 2.2% ) . the market share of various companies in india for tka prosthesis is shown in figure 2 . a bar diagram showing market share of various companies ( tka ) 74% of primary tka implants used are posterior stabilized fixed bearing with only 11% cruciate retaining implants used . remaining 15% were rotating platform , constrained knees ( e.g. lcck , rhk from zimmer and tc 3 , noiles hinge from depuy j and j ) . with one company implant , in stark contrast , with another make of implant , only 20% patellae were resurfaced . the indication for surgery was as follows : aseptic loosing = 64%infection = 26%others = 10% . aseptic loosing = 64% pie chart showing tka revision total of 3604 tha procedures were recorded . these included 2162 ( 60% ) male patients and 1442 ( 40% ) female patients . average age was 52 years ( range 17 to 85 years ) and average bmi was 25.8 ( range : 17.3 to 38.5 ) . pie chart showing indications of tha market share of various companies for tha is shown in figure 5 . pie chart showing market share of various companies of tha pie chart showing types of prosthesis used in tha pie chart showing indications of revision tha data of 34,478 tkas was assessed : these included 8612 males ( 25% ) and 25,866 females ( 75% ) . average age was 64.4 years ( osteoarthritis range : 45 to 88 years ; rheumatoid arthritis range : 22 to 74 years ) . the indication for tka was osteoarthritis in 33,444 ( 97% ) and rheumatoid arthritis in 759 ( 2.2% ) . the market share of various companies in india for tka prosthesis is shown in figure 2 . a bar diagram showing market share of various companies ( tka ) 74% of primary tka implants used are posterior stabilized fixed bearing with only 11% cruciate retaining implants used . remaining 15% were rotating platform , constrained knees ( e.g. lcck , rhk from zimmer and tc 3 , noiles hinge from depuy j and j ) . with one company implant , 81% tkas had patellar resurfacing . in stark contrast , with another make of implant , only 20% patellae were resurfaced . the indication for surgery was as follows : aseptic loosing = 64%infection = 26%others = 10% . these included 2162 ( 60% ) male patients and 1442 ( 40% ) female patients . average age was 52 years ( range 17 to 85 years ) and average bmi was 25.8 ( range : 17.3 to 38.5 ) . pie chart showing indications of tha market share of various companies for tha is shown in figure 5 . pie chart showing market share of various companies of tha pie chart showing types of prosthesis used in tha pie chart showing indications of revision tha registry participation is entirely voluntary on the part of arthroplasty surgeons and thereby presents a problem . for the registry to provide meaningful and validated information , it should have at least 90% surgeon 's participation . apathy , lack of trust , fear of information disclosure are some of the reasons for nonparticipation by surgeons . in england and wales , registry participation is likely to be very high as it is governed by department of health . even in usa , where registry participation is voluntary , surgeon 's participation is a problem . the advantages and disadvantages of a government - run registry compared with an independently run registry are currently being debated.18 registries in sweden , great britain , australia and canada that collect outcome data through their national health care programs have all documented the early detection of joint replacement problems that led to timely interventions , preventing harm to additional patients and reducing arthroplasty revisions by as much as 10%.192021 in india , arthroplasty numbers are set to go up significantly and therefore is an ideal time to set up a national joints registry . all arthroplasty surgeons are requested to join this nationwide initiative , the fruits of which will be apparent in the years to come . in the short time that the registry has been in place , some important facts have emerged : the incidence of rheumatoid arthritis as the indication for tka is very low ( 2.2% ) . the prevalence of cemented tka is absolute with no cases using uncemented total knee prosthesis . the use of posterior stabilized prosthesis is predominant ( 74% ) with only 11% of cases are done using cruciate retaining prosthesis . the bmi of patients undergoing tka is higher than those undergoing tha ( 29.1 vs. 25.8 ) indicating an entirely different patient population . the avascular necrosis of the hip is the indication for total hip replacement is 49% patients , with primary osteoarthritis in only 10% patients . this is a completely different disease demography compared with caucasian population where primary osteoarthritis of the hip is predominant . it also reveals the preponderance of hip avascular necrosis , the etiology of which is likely to be widespread steroid and alcohol abuse . the uncemented hip prosthesis use is much higher ( 65% ) than the cemented prosthesis . the incidence for revision of total knee arthroplasty for infection is much higher than revision for infected total hip replacement . this could suggest that many cases of infected hip arthroplasty must be left as girdlestone arthroplasty . if all arthroplasty procedures across the country are registered in the registry , it will be ideal . industry participation and perhaps government legislation are some of the avenues that can be considered to improve the surgeon participation .

background : total knee arthroplasty ( tka ) and total hip arthroplasty ( tha ) are the most widely practiced surgical options for arthritis all over the world and its application is rising in india . indian society of hip and knee surgeons ( ishks ) has established a joints registry and has been collecting data for last 6 years.materials & methods : all members of ishks are encouraged to actively participate in the registry . a simple two page knee and hip form can be downloaded from the website www.ishks.com . the information collected includes patient demographics , indication for surgery , implant details and in case of revision arthroplasty : the details of implants removed and the cause of failure of primary arthroplasty . these forms are mailed to the central registry office and the data is fed in computerized registry . data collection started in october 2006.results:joint registry is a very important initiative of ishks and till date , have data of 34,478 tkas and 3604 thas , contributed by 42 surgeons across india . some important observations have emerged . data of 34,478 tkas was assessed : these included 8612 males ( 25% ) and 25,866 females ( 75% ) . average age was 64.4 years ( osteoarthritis range : 45 to 88 years ; rheumatoid arthritis range : 22 to 74 years ) . average body mass index was 29.1 ( range : 18.1 to 42.9 ) . the indication for tka was osteoarthritis in 33,444 ( 97% ) and rheumatoid arthritis in 759 ( 2.2% ) . total of 3604 tha procedures were recorded . these included 2162 ( 60% ) male patients and 1442 ( 40% ) female patients . average age was 52 years ( range 17 to 85 years ) and average bmi was 25.8 ( range : 17.3 to 38.5 ) . the indications for tha was avn in 49%.conclusion : the registry will become more meaningful in years to come . active participation of all arthroplasty surgeons across india is vital for the success of the joints registry .

the disease caused by autoantibodies with specificity for the nc1 domain of the 3-chain of type iv collagen , often referred to as anti - glomerular basement membrane disease ( anti - gbm disease ) or goodpasture 's disease , is characterized by rapidly progressive glomerulonephritis ( gn ) often accompanied by lung haemorrhage . disease progression is usually dramatic , and a substantial proportion of patients in recently published series present with oliguric or anuric acute renal failure [ 24 ] . detectable amounts of anti - gbm antibodies usually do not remain in the circulation for > 612 months , even without the use of cytotoxic drugs . after that time , the recurrence of anti - gbm antibodies as well as relapse of glomerulonephritis ( gn ) is rare [ 35 ] . here , we report a case of a clinically and histologically mild form of gn , associated with low levels of anti - gbm antibodies but complicated by a protracted relapsing course . a 71-year - old woman with a medical history that included a peripheral facial paresis and an irritable colon sought medical attention in august 2000 after a 6-month period of general malaise , intermittent subfebrility and myalgia . blood tests indicated a mild renal failure with a serum creatinine of 100 mol / l and an erythrocyte sedimentation rate of 80 mm / h . a week later her creatinine had risen to 130 mol / l and serology was positive for anti - gbm with 61 and myeloperoxidase - antineutrophil cytoplasmic anitbody ( mpo - anca ) > 320 elisa units ( above 10 is considered as positive in both the assays ) . she was transferred to the lund university hospital , where she received apheresis with protein a adsorption columns . a renal biopsy showed focal necrotizing glomerulonephritis with crescents in 6 of 16 glomeruli and a typical linear immunofluorescence pattern for igg , kappa and lambda . after 5 months , the medication was switched to azathioprine 50 mg daily , which was continued for 12 months . serum creatinine remained stable at a level of 90 mol / l and anti - gbm antibodies were below the detection limit ( figure 1 ) . 1.the solid line represents levels of anti - gbm antibodies measured by the enzyme - linked immunosorbent assay ( elisa ) and expressed in arbitrary elisa units as indicated by the right vertical axis . the serological relapses coincided with clinical relapses ; start ( and restart ) of immunosuppressive treatment is indicated by arrows . method * was used until june 2007 , then method * * was used until november the same year when method * * * , using international units , was introduced . elisa units for mpo - anca are indicated on the left vertical axis , levels differ between the three assays . the solid line represents levels of anti - gbm antibodies measured by the enzyme - linked immunosorbent assay ( elisa ) and expressed in arbitrary elisa units as indicated by the right vertical axis . the serological relapses coincided with clinical relapses ; start ( and restart ) of immunosuppressive treatment is indicated by arrows . method * was used until june 2007 , then method * * was used until november the same year when method * * * , using international units , was introduced . elisa units for mpo - anca are indicated on the left vertical axis , levels differ between the three assays . two years later in the fall of 2004 , she experienced a relapse with re - emergence of anti - gbm antibodies , return of microscopic haematuria and a slight elevation of serum creatinine ( maximum 108 mol / l ) . anti - gbm remained positive at low level , but turned negative in april 2006 . , she experienced her second minor relapse with return of anti - gbm antibodies , microscopic haematuria and a slight elevation of creatinine ( maximum 131 mol / l ) . treatment with pulse cyclophosphamide therapy was initiated , resulting in disappearance of anti - gbm antibodies and haematuria . , both haematuria and anti - gbm antibodies returned , like at previous relapses there was no malaise or other symptoms of general inflammation . this third relapse was curbed with an increase in azathioprine doses to 150 mg and reinstitution of a moderate prednisolone dose . once again , there was a response with vanishing haematuria and autoantibodies . at the most recent follow - up in october 2011 , anti - gbm was negative , there was no haematuria , and creatinine was 106 mol / l . the clinical course in this case was benign , with preserved renal function for more than a decade . most cases of anti - gbm disease are diagnosed at a more advanced stage . in our series of 75 cases , it is impossible to discern whether the benign clinical course was due to the inherent nature of the case or a direct result of the swift initiation of aggressive autoantibody lowering therapy . a finding in favour of a mild inherent nature in this case is the relatively low levels of anti - gbm antibodies , 61 elisa units , compared with a median level of anti - gbm antibodies in positive cases at the laboratory of 112 units ( interquartile range 39197 ) . previous studies have indicated that levels of anti - gbm antibodies at diagnosis are predicative of long - term outcome [ 2 , 3 ] . however , it is probable that without treatment , levels of anti - gbm would have increased along with an accelerated intensity of the glomerulonephritis . the most remarkable feature of this case is the three mild relapses . in all instances , the return of anti - gbm antibodies was associated with the return of microscopic haematuria , strongly indicating a pathogenic capacity of the autoantibodies . however , there are only a few reports of late relapses of anti - gbm disease [ 57 ] . reported two cases with relapses among 71 patients in his long - term follow - up study and we found one among 75 . in the present case , this combination is common and was found in 30% of the patients in our swedish cohort , and other studies have found similar frequencies . the mpo - anca levels fluctuated , and even though four peaks can be identified , the mpo - anca and anti - gbm curves were not parallel . a temporal separation of anti - gbm and mpo - anca in the form a sequential appearance of the autoantibodies has previously been reported [ 9 , 10 ] . the combination of anca and anti - gbm could indicate some sort of overlap syndrome between goodpasture 's disease and anca - associated vasculitis , but while there was a strict correlation between anti - gbm and microscopic haematuria , there was no obvious correlation between the mpo - anca levels and clinical findings . also in the case described by serratrice et al . , the flare of anti - gbm disease was preceded by a rise in mpo - anca levels that had peaked several months earlier . in summary , this case shows that anti - gbm antibodies might be present in cases with relatively mild renal failure , and that high vigilance is necessary as mild disease might be at hand only during a relatively short window of opportunity . even though this case might represent an overlap syndrome with anca - associated vasculitis , the return of the anti - gbm antibodies several years after successful treatment demonstrates that long - term surveillance is warranted . how the follow - up should be organized with respect to frequency of visits and anti - gbm test however , the present case suggests that negative dipstick tests for haematuria might be sufficient to rule out recurrence of anti - gbm nephritis .

anti - glomerular basement membrane disease ( anti - gbm ) is usually characterized by rapidly progressive glomerulonephritis , and when autoantibody production has ceased , relapses are rare . here , we report a 71-year - old women diagnosed at a stage of mild renal insufficiency . over a period of 10 years , she experienced three mild relapses with return of anti - gbm antibodies , haematuria and slight elevations in serum creatinine level . all three relapses responded to immunosuppressive therapy , and all were preceded by peaks of myeloperoxidase - antineutrophil cytoplasm antibodies ( mpo - anca ) . this case shows that long - term follow - up is warranted in patients treated for anti - gbm - mediated disease , but urinary dipsticks may be sufficient for early detection of relapses .

there were 9 million new tb cases and approximately 2 million deaths from tb in 2004 . more than 80% of all tb patients live in sub - saharan africa and asia . with the advent of hiv , tuberculosis is posing a serious health hazard , even in regions of the world where tuberculosis is not endemic . the sternal and coccygeal regions are rare sites for tuberculosis , and require a high degree of suspicion for diagnosis , especially when they occur in combination in an immunocompetent patient . a 20-year - old female presented with a history of pain in the chest and coccygeal region for 1 year . there were no systemic symptoms of fever , weight loss , or loss of appetite . she was negative for hiv based on an elisa method , and her erythrocyte sedimentation rate was 40 mm / h . radiograph of the sternum and coccyx revealed an osteolytic lesion in the sternum and a similar lesion in the coccyx . an mri of the sternal and sacrococcygeal regions was obtained which revealed a destructive lesion in the sternum and destruction of the coccyx with an abscess extending into the left gluteal region ( fig . 1 ) . technetium-99 m mdp bone scintigraphy was performed , which revealed photopenic areas with mildly increased tracer uptake surrounding the photopenic areas in the sternum and coccyx , with no other bony lesions ( fig . i destructive lesion in the sternum , ii destructive lesion in the coccyx with an abscess , iii abscess extending into the left gluteal regionfig . 2technetium-99 m mdp bone scan of the patient . a photopenic area with surrounding increased tracer uptake in the sternum . b photopenic area with surrounding increased tracer uptake in the coccyx magnetic resonance imaging of the sternal and sacrococcygeal regions . i destructive lesion in the sternum , ii destructive lesion in the coccyx with an abscess , iii abscess extending into the left gluteal region technetium-99 m mdp bone scan of the patient . a photopenic area with surrounding increased tracer uptake in the sternum . b photopenic area with surrounding increased tracer uptake in the coccyx tru - cut needle biopsies were obtained from the sternal and coccygeal lesions and sent for gram staining , afb staining , histopathology , and cultures , including a tubercular culture . the histologic picture was that of chronic inflammation with a caseating granuloma compatible with tuberculosis . a diagnosis of tuberculosis of the sternum and coccyx was established , based on the histopathology . the patient was started on antitubercular therapy in the form of a four - drug regimen consisting of rifampicin ( 10 mg / kg ) , isoniazid ( 10 mg / kg ) , pyrazinamide ( 35 mg / kg ) , and ethambutol ( 30 mg / kg ) for 2 months , followed by rifampicin ( 10 mg / kg ) and isoniazid ( 10 mg / kg ) for 4 months , as per the national government s guidelines . along with this , local support for the coccygeal region was provided and supportive measures to improve the nutritional status were taken . the culture reports , which were obtained after 8 weeks , were positive for mycobacterium tuberculosis bacilli . the patient showed progressive improvement within 1 month of starting the therapy , and was completely relieved of her complaints after 3 months . after successfully completing the therapy for 6 months , the patient was followed up for 3 years , and showed no recurrence of symptoms . multicentric tuberculosis is usually seen in immunocompromised patients ; other predisposing factors are intravenous drug use , diabetes mellitus , alcohol abuse , and hepatic cirrhosis . sternal osteomyelitis caused by mycobacterium tuberculosis is a rare entity , accounting for less than 1% of all cases of osteoarticular tuberculosis , and coccygeal tuberculosis is an even rarer entity , with only one reported case in the english literature . tuberculosis at both of these sites at the same time has also not been reported in the english literature previously . a painful coccyx is a common complaint in women due to the posterior prominence of the coccyx anatomically in the female pelvis , meaning that it is exposed to multiple traumas . however , physicians should also consider atypical conditions such as tuberculosis in patients presenting with coccygodynia , especially those who are refractory to treatment with conservative measures , and in association with hiv . most sacral and sacrococcygeal lesions heal with adequate local support and antitubercular therapy , but coccygectomy may be essential in refractory cases . sternal tuberculosis usually presents as tuberculous osteomyelitis or rarely as a tuberculous granuloma , or remotely as metastatic disease [ 4 , 5 ] . plain radiographs are usually insufficient , and further imaging in the form of ct or mri is usually required . however , surgical intervention in the form of resection may be required on rare occasions , followed by local rotation flaps . although no primary focus of infection could be located in our patient , the mode of involvement is most likely hematogenous , as suggested by its multicentric nature . other routes of tuberculous involvement are direct inoculation , extension from adjacent bones or joints , and lymphogenous spread . to conclude , tuberculosis can present in any form or organ of the human body . in spite of the great strides made in its management therefore , it is essential for all physicians to keep tuberculosis in the differential diagnosis of patients with atypical presentations in atypical locations , thus enabling its early diagnosis and better treatment .

the case of a 20-year - old female who presented with refractory coccydynia and sternal pain is described . she was immunocompetent , and had no systemic features . she was diagnosed with tuberculosis of the sternal and coccygeal regions based on magnetic resonance imaging and histopathology of biopsy specimens . conservative management with oral multidrug antituberculous therapy completely cured the patient , and she had not suffered any recurrence after three years of follow - up . this case highlights the possibility of the multicentric presentation of tuberculosis at two rare sites in the same immunocompetent patient , even though the differential diagnosis was coccydynia .

cutaneous soft - tissue sarcomas represent < 1% of malignant cutaneous tumors . a review of 12 , 114 cutaneous soft - tissue sarcomas showed that 2% of cases were cutaneous angiosarcomas . cutaneous angiosarcoma mostly involves the head and neck region in 59% of cases , followed by the trunk in 25% , lower extremity in 9% and upper extremity in 5%.1 the majority of cutaneous angiosarcoma cases were caucasian and male.1 the incidence of angiosarcoma increased exponentially with age from 0.1/1,000,000 person - years at the age of 45 years to 4/1,000,000 person - years at the age of 90 years.1 cutaneous angiosarcoma rarely involves periocular tissue . in a review of 269 patients with non - basal cell and non - squamous cell malignant eyelid tumors , we report a 77-year - old woman who presented with an eyelid mass , simulating basal cell carcinoma on clinical examination that proved to be angiosarcoma on histopathologic examination . a 77-year - old otherwise healthy woman noted a lesion on the left lower eyelid about 3 months prior to presentation . external examination showed a tan - colored nodule with overlying crust - covered ulcer on the nasal aspect of the left lower eyelid , measuring 12 mm 7 mm [ figure 1 ] . histopathologic examination showed vasoformative architecture with islands and sheets of spindle and epithelioid cells and little intervening stroma [ figure 2a ] . the cells showed copious amounts of either rounded or tapered eosinophilic cytoplasm with occasional intracytoplasmic lumina and contained large vesicular nuclei with prominent nucleoli [ figure 2b ] . the tumor cells showed intense positive immunoreactivity for cd34 , cd31 , factor viii , and ki-67 [ figure 2c - f ] . after 1 year follow - up , there has been no recurrence or development of metastasis . a tan - colored nodule with overlying crust - covered ulcer on the left lower eyelid nasally histopathological examination showed islands / sheets of spindle and epithelioid cells with little stroma . the cells had copious amounts of rounded or tapered eosinophilic cytoplasm and large vesicular nuclei with prominent nucleoli . ( b ) immunoreactivity was intense for cd31 ( c ) , cd34 ( d ) , factor viii ( e ) and ki-67 . ( f ) ( a. h and e , original magnification 10 , b. h and e , original magnification 100 , c. immunohistochemistry for cd31 , cd34 , factor viii and ki-67 original magnification 25 ) the presentation of cutaneous angiosarcoma can vary widely , mimicking various benign and malignant pathologies . a review of 47 cutaneous angiosarcoma cases revealed that rapidly expanding erythematous - to - violaceous mass was the most common presentation in half of the patients , followed by solitary blue - to - violaceous nodules suggestive of lymphoma ( 20% ) , keratotic flesh - toned papule consistent with squamous or basal cell carcinoma ( 20% ) , multicentric grouped nodules reminiscent of metastases ( 10% ) , and well - circumscribed vascular lesion such as pyogenic granuloma ( 5%).3 similarly , eyelid angiosarcoma most commonly presented with erythematous nodule ( 38% ) , followed by erythematous - to - violaceous maculopapular lesion ( 25% ) , red - to - violaceous plaque or infiltrative lesion ( 13% ) , yellow plaque or infiltrative lesion ( 13% ) , and yellow nodule ( 13% ) [ table 1 ] . multifocal eyelid lesions or associated diffuse eyelid involvement in the form of eyelid swelling were seen in about half of the cases [ table 1 ] . the differential diagnosis of angiosarcoma includes capillary hemangioma , epithelioid hemangioma , kaposi 's sarcoma , epithelioid hemangioblastoma , hemangiopericytoma . clinical history and examination findings are helpful in differential diagnosis , but the diagnosis of angiosarcoma is based on the histopathological evaluation . clinical findings in 22 published cases with primary eyelid angiosarcoma histopathologically , angiosarcomas show vasoformative architecture , and range from well - differentiated to poorly - differentiated lesions.4 abnormal ; pleomorphic malignant endothelial cells are the hallmark of angiosarcoma . low - grade , well - differentiated lesions are composed of vascular channels that grew in an infiltrative fashion and had plump endothelial cells with hyperchromic nuclei and infrequent mitoses.4 high - grade , poorly - differentiated lesions are densely cellular tumors with focal vascular channels . the neoplastic cells in high - grade , poorly - differentiated lesions range from spindle to epithelioid cells with large irregular nuclei with coarse chromatin and eosinophilic cytoplasm.4 by immunohistochemistry , tumor cells on angiosarcoma stain positive for factor viii - related antigen , and cd31 , markers for endothelial lineage of neoplasms , and cd 34 , marker for hematopoietic cells , endothelial progenitor cells , and endothelial cells of blood vessels . surgical excision , followed by external beam radiotherapy ( ebrt ) has been the treatment of choice for angiosarcoma . complete resection could be difficult because of invasive and often multifocal nature of angiosarcomas , tumor location , and its relation to other anatomical structures.4 neoadjuvant chemotherapy and antiangiogenic molecules have been used in the treatment of cutaneous angiosarcoma.4 lack of randomized trials and data based on few retrospective studies make it difficult to have specific management guidelines . in a review of 21 patients with cutaneous angiosarcoma of face with periorbital involvement , demartelaere et al.,5 reported that 71% of cases were treated with neoadjuvant chemotherapy and 29% underwent surgery followed by adjuvant chemotherapy or radiotherapy . following neoadjuvant chemotherapy , 93% of the patients showed complete clinical response and 60% of them did not require surgical resection . however , 60% of them had recurrences . in the patients who underwent surgical excision followed by adjuvant therapy a review of eyelid angiosarcoma cases in the literature showed that 31% of the patients were treated with chemotherapy alone in 23% of the patients , excisional biopsy followed by ebrt or plaque radiotherapy in 18% , excisional biopsy alone in 23% , excisional biopsy followed by ebrt and chemotherapy in 9% , excisional biopsy followed by chemotherapy in 9% , ebrt alone in 9% and observation in 5% [ table 1 ] . cutaneous angiosarcoma has a poor prognosis with 40% to 50% of the 5-year local regional control rate , and 20% to 40% of 5-year distant metastasis - free survival rate.6 on their review of the literature , papalas et al.7 reported that patients with isolated , nodular eyelid involvement had a survival rate of 100% at a mean follow - up of 3 years although the patients with diffuse disease had a survival rate of 57% at a mean follow - up of 3 years . this is contrary to the poorly - differentiated histopathologic features and bad systemic prognosis in angiosarcomas of face and scalp with isolated , nodular tumors . a review of eyelid angiosarcoma cases in the literature showed 45% of cases were alive without recurrence after a mean follow - up of 45 months , 23% of cases died of systemic metastasis after a mean follow - up of 28 months , and 14% of cases died of natural causes [ table 1 ] . the better prognosis of eyelid angiosarcomas could be related to the finding that more of the eyelid angiosarcomas being isolated , nodular tumors rather than facial angiosarcomas ( 51% in eyelid angiosarcomas vs. 30% in facial angiosarcomas ) . careful long - term follow - up is necessary considering the high recurrence and low local control rates at 5-years follow - up . the presentation of cutaneous angiosarcoma can vary widely , mimicking various benign and malignant pathologies . a review of 47 cutaneous angiosarcoma cases revealed that rapidly expanding erythematous - to - violaceous mass was the most common presentation in half of the patients , followed by solitary blue - to - violaceous nodules suggestive of lymphoma ( 20% ) , keratotic flesh - toned papule consistent with squamous or basal cell carcinoma ( 20% ) , multicentric grouped nodules reminiscent of metastases ( 10% ) , and well - circumscribed vascular lesion such as pyogenic granuloma ( 5%).3 similarly , eyelid angiosarcoma most commonly presented with erythematous nodule ( 38% ) , followed by erythematous - to - violaceous maculopapular lesion ( 25% ) , red - to - violaceous plaque or infiltrative lesion ( 13% ) , yellow plaque or infiltrative lesion ( 13% ) , and yellow nodule ( 13% ) [ table 1 ] . multifocal eyelid lesions or associated diffuse eyelid involvement in the form of eyelid swelling were seen in about half of the cases [ table 1 ] . the differential diagnosis of angiosarcoma includes capillary hemangioma , epithelioid hemangioma , kaposi 's sarcoma , epithelioid hemangioblastoma , hemangiopericytoma . clinical history and examination findings are helpful in differential diagnosis , but the diagnosis of angiosarcoma is based on the histopathological evaluation . clinical findings in 22 published cases with primary eyelid angiosarcoma histopathologically , angiosarcomas show vasoformative architecture , and range from well - differentiated to poorly - differentiated lesions.4 abnormal ; pleomorphic malignant endothelial cells are the hallmark of angiosarcoma . low - grade , well - differentiated lesions are composed of vascular channels that grew in an infiltrative fashion and had plump endothelial cells with hyperchromic nuclei and infrequent mitoses.4 high - grade , poorly - differentiated lesions are densely cellular tumors with focal vascular channels . the neoplastic cells in high - grade , poorly - differentiated lesions range from spindle to epithelioid cells with large irregular nuclei with coarse chromatin and eosinophilic cytoplasm.4 by immunohistochemistry , tumor cells on angiosarcoma stain positive for factor viii - related antigen , and cd31 , markers for endothelial lineage of neoplasms , and cd 34 , marker for hematopoietic cells , endothelial progenitor cells , and endothelial cells of blood vessels . surgical excision , followed by external beam radiotherapy ( ebrt ) complete resection could be difficult because of invasive and often multifocal nature of angiosarcomas , tumor location , and its relation to other anatomical structures.4 neoadjuvant chemotherapy and antiangiogenic molecules have been used in the treatment of cutaneous angiosarcoma.4 lack of randomized trials and data based on few retrospective studies make it difficult to have specific management guidelines . in a review of 21 patients with cutaneous angiosarcoma of face with periorbital involvement , demartelaere et al.,5 reported that 71% of cases were treated with neoadjuvant chemotherapy and 29% underwent surgery followed by adjuvant chemotherapy or radiotherapy . following neoadjuvant chemotherapy , 93% of the patients showed complete clinical response and 60% of them did not require surgical resection . however , 60% of them had recurrences . in the patients who underwent surgical excision followed by adjuvant therapy , a review of eyelid angiosarcoma cases in the literature showed that 31% of the patients were treated with chemotherapy alone in 23% of the patients , excisional biopsy followed by ebrt or plaque radiotherapy in 18% , excisional biopsy alone in 23% , excisional biopsy followed by ebrt and chemotherapy in 9% , excisional biopsy followed by chemotherapy in 9% , ebrt alone in 9% and observation in 5% [ table 1 ] . cutaneous angiosarcoma has a poor prognosis with 40% to 50% of the 5-year local regional control rate , and 20% to 40% of 5-year distant metastasis - free survival rate.6 on their review of the literature , papalas et al.7 reported that patients with isolated , nodular eyelid involvement had a survival rate of 100% at a mean follow - up of 3 years although the patients with diffuse disease had a survival rate of 57% at a mean follow - up of 3 years . this is contrary to the poorly - differentiated histopathologic features and bad systemic prognosis in angiosarcomas of face and scalp with isolated , nodular tumors . a review of eyelid angiosarcoma cases in the literature showed 45% of cases were alive without recurrence after a mean follow - up of 45 months , 23% of cases died of systemic metastasis after a mean follow - up of 28 months , and 14% of cases died of natural causes [ table 1 ] . the better prognosis of eyelid angiosarcomas could be related to the finding that more of the eyelid angiosarcomas being isolated , nodular tumors rather than facial angiosarcomas ( 51% in eyelid angiosarcomas vs. 30% in facial angiosarcomas ) . careful long - term follow - up is necessary considering the high recurrence and low local control rates at 5-years follow - up .

a 77-year - old woman presented with a 3-month history of a lesion on her left lower eyelid . external examination showed a tan - colored nodule with an overlying crust - covered ulcer on the left lower eyelid , nasally . the ulcer measured 12 mm 7 mm . complete surgical excision with a frozen section margin control was performed . histopathological examination showed islands and sheets of spindle and epithelioid cells with little intervening stroma . the cells had copious amounts of either rounded or tapered eosinophilic cytoplasm with occasional intracytoplasmic lumina and large vesicular nuclei with prominent nucleoli . there was intense immunoreactivity for cd34 , cd31 , factor viii , and ki-67 . the diagnosis was eyelid angiosarcoma . the patient refused any further therapy . at 1-year follow - up , there was no recurrence or development of metastasis . in conclusion , tan - colored eyelid nodules with overlying ulcer are usually a basal cell carcinoma ; however , rarely it can be an eyelid angiosarcoma .

the disease usually presents in childhood or early adolescence as asymptomatic hyperpigmented atrophic linear bands along blaschko 's lines without prior inflammation or sclerotic appearance . lam usually progresses as a linear atrophic lesion in the first few months ; then the lesion ceases to progress and persists . a 15-year - old male thai presented for a 1-month history of two progressive asymptomatic depressed linear plaques along blaschko 's lines ( fig . the first lesion was on the trunk , extending laterally from the umbilicus toward the middle of the right lower back at the level of t10 of the thoracic spine . the second lesion was on his right leg , extending from the middle of the popliteal fossa toward the medial malleolus . there was no underlying disease , and no one in his family had the same skin lesion . histopathology of the lesion revealed epidermal atrophy without any change in the dermis or collagen bundle . he agreed to try topical calcipotriol twice a day on the lesion on his abdominal wall , leaving the lesion on his back as a control . after 3 months of follow - up , clinical improvement was observed in the treated area in comparison to the untreated control area , which was appreciated by the patient ( fig . , we asked the patient to apply topical calcipotriol to all lesions ; unfortunately , there was no additional improvement of the abdominal and leg lesions after further 2 months of treatment . based on this result , we consider topical calcipotriol treatment an effective approach in the early stage of lam . lam was first described by moulin in 1992 as an acquired unilateral hyperpigmented atrophic band along blaschko 's lines . lam usually progresses as a linear atrophic lesion in the first few months ; then the lesion ceases to progress and persists . the lesion of lam usually resists most treatment options ; however , the prognosis is excellent because there is no systemic condition associated with the disease . a study of the atrophic component of lam by ultrasonography revealed that subcutaneous volume reduction was the cause of the atrophic appearance , not dermal atrophy . even though the clinical manifestation of lam is rather unique , hematoxylin and eosin staining usually shows hyperpigmentation only in basal epidermal layers without abnormal collagen or elastic fibers in the dermis or any obvious inflammation [ 1 , 3 , 4 ] . there may be some perivascular lymphocytic infiltration [ 2 , 512 ] , acanthosis [ 7 , 8 ] , epidermal atrophy , altered collagen in the dermis [ 2 , 57 , 9 , 10 , 13 ] , and decreased or fragmented elastic tissue . once there is some alteration of the collagen component , the differential diagnosis of lam includes app , linear scleroderma , lichen striatus , and focal dermal hypoplasia . abnormal collagen fibers in the histopathological findings and dermal tissue reduction in the ultrasound imaging are helpful for the diagnosis of linear scleroderma and app , respectively [ 2 , 14 ] . considering the clinical manifestation of lam , i.e. the characteristic atrophic band and hyperpigmentation , the following conditions may resemble lam : incontinentia pigmenti , nevus of ito , linear and whorled nevoid hypermelanosis , and linear lichen planus . progression of the lesions usually stops within a few months without any internal organ involvement . there are reports of variants such as multiple telangiectatic macules accompanying the atrophic plaque , bilateral lam [ 8 , 11 ] , and lam preceded by inflammation . however , partial improvement was obtained with intravenous penicillin together with topical puva therapy , oral potaba ( potassium para - aminobenzoate ) , high - dose vitamin e ( 400 iu / day ) , and topical clobetasol propionate [ 7 , 11 , 12 ] . other cases were treated with topical corticosteroids , topical corticosteroids and heparin , high - dose penicillin , and photo protection all without improvement [ 5 , 6 , 9 , 10 , 13 ] . in our case , calcipotriol is a synthetic 1,25-dihydroxyvitamin d3 , which has efficacy in the treatment of plaque - type morphea . after 3 months , the progression of the lesion stopped , and partial improvement of the treated area occurred . topical calcipotriol was applied to both the legs and abdominal area for the next 2 months , but interestingly , no further clinical improvement was observed . this finding suggests that early treatment is of great importance . in conclusion , we reported a case of classic lam with partial response to topical calcipotriol treatment . we suggest that treatment should be started early in order to achieve good response .

linear atrophoderma of moulin ( lam ) is a rare dermatosis in childhood and early adolescence . the exact etiology of lam is still obscure . several treatment modalities were reported but none was consistently successful . we report a case of lam in which a favorable outcome was obtained with topical calcipotriol . the relevant literature is also reviewed .

choroidal neovascular membranes ( cnv ) can be associated with various inflammatory chorioretinal diseases , as the cytokines together with the vascular endothelial growth factor ( vegf ) are implicated in the pathogenetic mechanisms leading to an impaired permeability and altered angiogenesis . it is assumed that cnv may occur in up to 25% of cases with serpiginous choroiditis and may be detected at the time of active choroiditis or in between the inflammatory episodes . in a systemic immunosuppressive therapy for eye disease cohort study , 81 eyes ( 2% ) had cnv at presentation among the 4,041 eyes of the 2,307 patients with posterior uveitis or panuveitis . of the 148 eyes with a diagnosis of serpiginous choroiditis , cnv was noted in 7 eyes ( 4.7% ) . the presence of cnv must be differentiated from the signs of active disease as the treatment options may differ . we hereby report a case of active serpiginous choroiditis with cnv and discuss our therapeutic approach . a 42-year - old otherwise healthy woman with a visual loss of 2 months ' duration in od in 2009 was examined by us . her best - corrected visual acuity was counting fingers ( cf ) at 1 m in od and 20/20 in os . on fundus evaluation , there were chorioretinal scars surrounding the optic disc in a serpentine - like fashion ou , together with a subfoveal grayish lesion and subretinal hemorrhage in od ( fig . a single session of photodynamic therapy and 3 subsequent intravitreal ranibizumab injections were administered in a time span of 9 months without any visual improvement . four years later , at the age of 46 , she was once again examined by us ; this time for metamorphopsia and mild visual loss of 2 weeks ' duration in os . visual acuity was cf at 1 m in od and 20/30 in os . while slit - lamp examination was normal in od , there were + + cells in the left vitreous . on fundus evaluation , there was a large macular scar and extensive chorioretinal scarring surrounding the optic disc in od ( fig . peripapillary scarring with active - looking creamy borders and a grayish lesion with a hemorrhagic rim in the papillomacular bundle were noted ( fig . 2c ) . with the help of fluorescein angiography and optical coherence tomography ( fig . 2d - f ) , we reached a diagnosis of extrafoveal classic - type cnv in association with active serpiginous choroiditis in os . in order to avoid systemic steroids , the risks and benefits of the simultaneous intravitreal injection of the 2 drugs were explained to the patient , and an informed consent was obtained . at the same time , oral mycophenolic acid 2 720 mg was commenced . a week later , visual acuity was improved to 20/25 , and optical coherence tomography showed that intraretinal and subfoveal fluid had almost totally disappeared . during the follow - up of 22 months , no further injection was required , and no injection - related complication occurred . oral cyclosporine 3 100 mg was added to the systemic therapy due to the persistent activity of the inflammation 2 months later . at the last visit visual acuities were cf in od and 20/25 in os , and the left fundus was relatively stabilized ( fig . a thorough control of underlying inflammation with the help of systemic steroids and/or immunosuppressives should be considered in eyes with active serpiginous choroiditis associated with cnv . however , local targeted therapy is often administered to treat the coexistent cnv to obtain a better anatomical and visual outcome . in earlier days , argon laser photocoagulation was the preferred method for the treatment of extrafoveal cnv and photodynamic treatment mostly for the juxtafoveal and subfoveal cnv in serpiginous choroiditis . more recently , intravitreal anti - vegfs were evaluated in eyes with serpiginous choroiditis and cnv . patients were followed up for 36 months to assess the efficacy of intravitreal bevacizumab administration in a retrospective multicenter consecutive case series comprised of 81 patients with inflammatory ocular neovascularization refractory to standard therapy . on the other hand , eyes with multifocal choroiditis and cnv required a mean of 6.3 injections , eyes with ocular histoplasmosis a mean of 3.9 , and eyes with punctate inner choroidopathy a mean of 3.4 injections . parodi et al . reported their results of intravitreal bevacizumab administration in 7 eyes of 7 patients with cnv and serpiginous choroiditis who were followed up for a year with monthly follow - ups . one eye required 5 bevacizumab injections , and the remaining eyes received only a single injection . song and roh described a 44-year - old woman with inactive serpiginous choroiditis and juxtafoveal cnv . two ranibizumab injections 2 months apart were sufficient to obtain a stable lesion without any concurrent systemic therapy . the patient was followed up for 6 more months after the second injection , and the visual acuity improved to 20/20 from the initial level of 20/40 . in a group of 16 eyes of 15 consecutive patients with an inflammatory type of cnv , both patients received 2 ranibizumab injections . in 1 eye , visual acuity remained stable , and the other eye experienced a 15-letter improvement . reported a 55-year - old man with an already established diagnosis of inactive serpiginous choroiditis with an extrafoveal classic - type cnv . following a 3-daily intravenous infusion of prednisolone 1 g , 2 sessions of argon laser photocoagulation and then 2 photodynamic therapy treatments were performed . upon worsening , the final visual acuity was 20/20 . in the present case with active serpiginous choroiditis and extrafoveal cnv the rationale for the dexamethasone implant was to suppress the active inflammation until the effect of the newly started immunosuppressive agent was commenced . there were some previous reports on the intravitreal steroid administration for the control of active inflammation in serpiginous choroiditis . injected intravitreal triamcinolone acetonide in 8 eyes of 8 patients with active unilateral serpiginous choroiditis . they reported that remission was induced rapidly , and the visual acuities were either stabilized or improved after the follow - up of 6 months . seth and gaudio placed a fluocinolone implant after the observation of a good disease control with a single intravitreal triamcinolone acetonide administration , and the visual outcome was satisfactory during a follow - up of 14 months . as there are no randomized studies for the treatment of cnv in association with inflammatory diseases , such as the ones associated with age - related macular degeneration and pathologic myopia , a tailored therapeutic approach seems to be more appropriate . it is well accepted that systemic or intravitreal steroids with or without systemic immunosuppressives should be employed in order to suppress the active inflammation . anti - vegf agents should also be administered in order to achieve a better anatomical outcome and visual acuity . the authors declare that there are no conflicts of interest regarding the publication of this article .

intravitreal anti - vascular endothelial growth factor ( vegf ) agents seem to be effective in choroidal neovascular membranes ( cnv ) in association with various entities of posterior uveitis . we herein report a 46-year - old woman who was treated with a simultaneous single intravitreal dexamethasone implant and ranibizumab administration for the treatment of unilateral extrafoveal cnv associated with an active serpiginous choroiditis . simultaneously with the intravitreal therapy , oral mycophenolic acid ( 2 720 mg ) was started , and oral cyclosporine ( 3 100 mg ) was then added 2 months later . on the other hand , the fellow eye had been treated for subfoveal cnv but with an inactive disease 4 years previously and ended up with a final visual acuity of counting fingers despite treatment with a single session of photodynamic therapy and 3 subsequent intravitreal ranibizumab injections . simultaneous administration of anti - vegf agents and a dexamethasone implant can be a viable approach in eyes with cnv and active serpiginous choroiditis .

idiopathic thrombocytopenic purpura ( itp ) is an autoimmune disorder characterized by a low platelet count and mucocutaneous bleeding ( 1 ) . the incidences of atherosclerosis and myocardial infarction in patients with congenital coagulation disorders and chronic thrombocytopenia are very low ( 2 ) . even though thrombotic events occur in patients with chronic itp , most cases were reported during or shortly after intravenous immunoglobulin ( ivig ) administration , when platelet counts began to rise ( 3 , 4 ) . thrombolytic therapy is contraindicated for a patient with itp even with acute myocardial infarction ( ami ) ( 5 ) . few cases of primary percutaneous coronary intervention ( pci ) for ami in patients with itp have been reported ( 6 , 7 ) . this report describes a case of ami that occurred during thrombocytopenia in a patient with itp and managed successfully by pci without major bleeding complications . a 47-yr - old woman was transferred to the emergency room with anterior chest pain . the patient has taken steroids for itp and an antidiabetic drug for type 2 diabetes mellitus ( dm ) . because the patient was diagnosed as type 2 dm only after she took steroids , probably , it was regarded as drug - induced dm . chest pain had developed 6 hr before an arrival at emergency room , and she had already been treated with nitroglycerin and beta blocker at other hospital . electrocardiogram ( ecg ) showed st segment elevation in the leads of ii , iii , and avf , which was consistent with an inferior wall ami ( fig . the patient was alert , her blood pressure was 140/90 mmhg with a pulse rate of 78 beats per minute , and respiration at the rate of 21 per minute . u / l ( normal range : 20 - 180 u / l ) and ck - mb 109 u / l ( normal range : 0 - 6 blood coagulation tests showed prothrombin time ( pt ) of 9.75 sec ( international normalized ratio [ inr ] ; 0.76 ) and activated partial thromboplastin time ( aptt ) of 30.6 sec . urgent diagnostic coronary angiography revealed total occlusion in the proximal right coronary artery ( rca ) ( fig . loading dose of clopidogrel ( 300 mg ) was administered and then pci was performed using a balloon and a stent for the proximal rca lesion successfully ( fig . bolus injection of 2,000 units heparin was done at the beginning of the coronary angiography and then additional 6,000 units during the pci . activated partial thromboplastin time was within normal range ( 42.8 sec ) . on the next day , platelet count was 18,000/l and ecchymoses were found around the puncture site of the right femoral artery . heparin was not administered any more in the intensive care unit after the pci , but combined anti - platelet therapy ( aspirin 200 mg and clopidogrel 75 mg ) was performed as usual . after the removal of the sheath introducers from the right femoral artery , we compressed the puncture sites for more than 30 min to achieve complete hemostasis . atherosclerosis and myocardial infarction are rare in patients with chronic thrombocytopenia . in other words , high platelet count has been correlated with high incidence of ischemic heart disease , as well as elevated hemostatic factors ( 8) . if a patient with chronic thrombocytopenia has a coronary artery disease , concomitance of known coronary risk factors such as family history for cardiovascular disease , hypertension , diabetes , dyslipidemia , or cigarette smoking , should be considered . in this case , the patient was obese and had diabetes after steroid treatment for itp . steroids are known to induce metabolic changes as well as a hypercoagulable state , each of which may promote atherosclerosis , thus steroids may play a possible role in precipitating the clinical events in this patient ( 8) . ivig therapy for itp has been associated with a very rare occurrence of thrombotic events , such as myocardial infarction and stroke . ( 3 ) suggested that the rapid rise in platelet counts in response to ivig therapy in itp may aggravate the potentially adverse effect of increased plasma viscosity leading to increased susceptibility to fatal thrombotic events . when a patient with itp needs ivig therapy for thrombocytopenia , careful attention must be paid to a rapid rise in the platelet count , which may induce myocardial infarction or stroke , particularly in the elderly and in patients with coronary risk factors . in this case , ami occurred before the patient was treated with ivig . because there is an antigenic mimicry between platelets and endothelial cells , the pathogenesis of ami in thrombocytopenic patients with chronic itp may stem from endothelial damage induced by autoantibodies directed against antigens presented on both platelets and coronary endothelial cells ( 9 ) . in this case , the result of platelet associated antigen was weakly positive . further studies about the relationship between coronary endothelial cell and platelet associated antigen are needed to confirm this hypothesis . this case reminds us of several precautions in managing a patient with itp who had ami during thrombocytopenia . first of all , when puncturing the vessels to insert a sheath introducer , it is important not to injure the vessels and be sure to compress the puncture site for longer than usual after removing the sheath introducer . percutaneous closing device can be used after pci , especially in patients with coagulation disorders . second , there is no recommended dose of heparin in managing an ami in a patient with itp , because of extremely rare occurrences of ami in itp . we used cautiously small amount of heparin before and during the procedure and ivig to prevent bleeding complications . although we did not use conventional dose of heparin , it was enough to manage the patient with ami during thrombocytopenia . maybe , small dose of heparin with ivig therapy can be recommended to treat ami during thrombocytopenia . large investigational study should be needed in patients with itp to find out the optimal dose of heparin . consequently , the current case suggests that primary pci can be a useful therapeutic strategy in acute st elevation myocardial infarction .

acute myocardial infarction ( ami ) is rare in patients with idiopathic thrombocytopenic purpura ( itp ) . we describe a case of an ami during thrombocytopenia in a patient with chronic itp . a 47-yr - old woman presented with anterior chest pain and a low platelet count ( 21,000/l ) at admission . urgent coronary angiography revealed total occlusion of proximal right coronary artery and primary percutaneous coronary intervention ( pci ) was performed successfully . this case suggests that primary pci may be a therapeutic option for an ami in patients with itp , even though the patient had severe thrombocytopenia .

a 48-year - old man was admitted to our hospital because of fever and chills . his past medical history was not notable . he had imbibed 12 beers per day for the last 20 years and had a smoking history of 30 pack - years . he was initially diagnosed with pneumonia and prescribed antibiotics , but his symptoms persisted and a thorough examination was performed . enhancement computed tomography ( ct ) imaging showed a mass lesion in the right middle lobe of the lung and hilar and mediastinal lymphadenopathy ( fig . the abdominal image revealed hypertrophic change of hepatic left lobe with inhomogeneous enhancement of sinusoidal metastasis and lymphadenopathy along the common hepatic artery ( fig . the portal vein was narrowed but seemed to be patent , and no collateral circulation was observed . a bronchoscopy revealed tumor invasion into the right middle bronchus and a sample taken was positive for adenocarcinoma . positron emission tomography ct imaging showed intense uptake in the same region pointed out by the chest ct and in some of the vertebrae . no evidence of metastasis was found in brain magnetic resonance imaging , and the patient was diagnosed as stage iv lung adenocarcinoma with liver and bone metastasis . the tumor was found to harbor an epidermal growth factor receptor ( egfr ) mutation of l858r , so he was subsequently treated with gefitinib ( 250 mg / day ) and his general condition immediately improved . one month later , he was admitted to the emergency department after experiencing fever and progressive dyspnea on exertion for several days . chest ct images showed shrinkage of the primary tumor and lymph nodes , but diffuse gland - grass opacity was also found in both lung fields ( fig . gefitinib , the most likely cause of the interstitial lung disease , was immediately discontinued . the patient was then given 500 mg / day of methylpredonisolone for 3 days , followed by 30 mg / day of predonisolone as a maintenance therapy . ct scans were performed 2 months after the start of the steroid therapy to re - evaluate his lung condition and the extent of his tumor . second - line chemotherapy with carboplatin ( auc 5 ) plus pemetrexed ( 500 mg / m ) plus bevacizumab ( 15 mg / kg ) was initiated . ten days after the administration of the 4th course of this chemotherapy , the patient had black stool and hypotension . he was readmitted to the emergency department and was found to have anemic conjunctiva on physical examination . laboratory data showed normocytic anemia ( hemoglobin 9.8 mg / dl ) , mildly elevated blood urea nitrogen [ 38.4 mg / dl ( upper limit of normal : < 20.0 mg / dl ) ] and no hepatic viral infection . mild elevation of transaminase was also noted , but no other findings were suggestive of liver failure . upper gastrointestinal endoscopy revealed beaded esophagus varices and gastric varix in the distal site with bloody gastric contents ( fig . an enhancement ct depicted an inhomogeneous enhancement of liver hepatic parenchyma that could have reflected an imbalance of the portal vein blood flow , but no evidence of ascites , collateral vein circulation , or splenomegaly was observable . a blood transfusion and elective endoscopic variceal ligation were successfully performed . lung cancer is the leading cause of cancer - related death worldwide . compared to other types of cancer , one major factor is the advanced state of the lung cancer and presence of metastatic lesions by the time of diagnosis . the most frequent sites of metastasis of this tumor are brain , bone , adrenal gland and liver . liver metastasis , with its high blood flow , is frequent not only in lung cancer but also cancers of the stomach , colon , breast , etc . primary or metastatic metastatic liver tumor has been reported , for example , to cause liver failure and extrahepatic biliary obstruction [ 3 , 4 ] . portal hypertension is usually caused by liver cirrhosis , but portal vein invasion by hepatocellular carcinoma , by other tumors , or by tumor emboli to the vein may lead to the hypertensive state in some cases . the three major complications of portal hypertension are gastroesophageal varix , ascites , and hypersplenism . patients with liver cirrhosis routinely undergo upper gastrointestinal endoscopy to screen for gastroesophageal varices because the first of these complications , gastroesophageal variceal hemorrhage , can be fatal . endoscopic variceal ligation and other prophylactic endoscopic treatments are recommended for patients with gastroesophageal varices . the progression from chronic hepatitis to cirrhosis usually takes place over a period of years . distended and engorged epigastric veins ( caput medusae ) are a typical sign found in physical examination , and ct scanning is a suitable evaluation for the portal venous system . yet no features of liver cirrhosis were found in any of our examinations or in the patient 's medical history . the evidence suggested that his portal circulation had changed rapidly and drastically , and the formation of gastroesophageal varix seemed to be caused subacutely by an abrupt increase of his portal vein pressure . the patient 's metastatic liver tumor was the most likely cause of his portal hypertension . diffuse hepatic sinusoidal metastases and the notable conformational changes brought about by chemotherapy might have induced the gastroesophageal varix hemorrhage by altering the hemodynamics of his portal circulation . recent progress in molecular targeted therapy now enables clinical oncologists to tailor therapeutic drugs to the biological profiles of the patients . the reported evidence singles out egfr as the strongest biomarker for nsclc and as the biomarker most predictive of prognosis . a recent clinical trial in japan has shown that gefitinib , a well - known egfr - tyrosine kinase inhibitor , can prolong progression - free survival and overall survival in patients positive for the egfr mutation . the frequency of the egfr mutation in nsclc is high in the japanese population , especially in adenocarcinoma histology . the japan cancer society guideline recommends first - line use of gefitinib for egfr mutation - positive patients . adding bevacizumab to cytotoxic chemotherapy may bring about a higher response rate and better overall survival than what will normally be achieved by chemotherapy without the antibody . bevacizumab should be considered an option for patients who clear exclusion criteria such as squamous histology , etc . . gefitinib shows great therapeutic efficiency in the subpopulation of so - called super - responders . the agent generally achieves notable tumor regression and improved performance status at an early stage in super - responders . our patient responded well not only to gefitinib , but also to bevacizumab - containing chemotherapy . vegf confers strong effects on liver sinusoidal endothelial cells as proliferative stimulation in vitro and supports the maintenance of sinusoidal endothelial cells . the organ - specific action in our patient may have reflected the discrepancy in his response , that is , the dramatic regression of his metastatic liver tumor versus the unchanging tumor volume in his lung . we treated a case of gastroesophageal variceal hemorrhage in a patient with metastatic liver tumor of nsclc . chemotherapy in series brought about a dramatic regression of his metastatic liver tumor but might have caused the patient 's gastroesophageal varix by subacutely inducing the hemodynamics of portal hypertension . while molecular targeted therapy generally achieves significant improvement , the strong and rapid pharmaceutical action sometimes causes unexpected adverse events . takayuki honda has received honoraria from chugai pharmaceutical co. , ltd . for speaking engagements at workshops .

gastroesophageal variceal hemorrhage is a lethal complication of portal hypertension . liver cirrhosis is often the principal cause of the portal hypertensive state . malignant tumors coexist with portal hypertension in some cases . non - small - cell lung cancer ( nsclc ) is likely to become metastatic . liver is a frequent site of cancer metastasis , but diffuse hepatic sinusoidal metastasis is uncommon as a metastatic form of nsclc . this report describes a patient with gastroesophageal variceal hemorrhage owing to a metastatic liver tumor of nsclc . the patient , a male smoker with stage iv nsclc , was free of any hepatitis viral infection and had no alcohol addiction . liver dysfunction and liver disease had never been pointed out in his medical history . his tumor harbored an l858r epidermal growth factor receptor mutation . gefitinib was initiated but had to be ceased because of interstitial lung disease . sequential steroid therapy was effective and bevacizumab - containing chemotherapy was commenced . both chemotherapy regimens produced favorable effects against the metastatic liver tumor , eliciting atrophic change regardless of the chemotherapy - free interval . one day the patient was admitted to our hospital because of black stool and hypotension . upper gastrointestinal endoscopy revealed a beaded appearance of the gastroesophageal varix with bloody gastric contents . the portal hypertension might have been caused by changes in portal vein hemodynamics induced by the conformational changes underlying the favorable response of the liver tumor to molecular targeted chemotherapy and notable regression .

the aim of this case was to describe the anesthetic approach to a patient with kabuki syndrome . a patient with kabuki syndrome had revision surgery for scoliosis . on physical examination , shown were long palpebral fissures , large , prominent fissures with an eversion of the lateral third of the lower eyelids , large , prominent malformed ears with low implantation , a short nasal septum , micrognathia , thoracolumbar scoliosis , a depressed left shoulder , a low - set occipital hairline and a short neck . anesthesiologists should be aware of possibly difficult tracheal intubation cardiac lesions , respiratory problems , neurological and musculoskeletal disorders , and a latex allergy when managing anesthesia for a patient with kabuki syndrome . kabuki syndrome ( ks ) is a rare genetic disorder associated with multiple organ abnormalities , unique facial features and mental retardation ; it was first described by niikawa et al . , and kuroki et al . the facial features of these patients were like the make - up actors in kabuki dance - drama , traditional japanese theatre ( 3 ) . ks has been estimated to occur in 1/32000 in the japanese population ; since 1981 , there have also been new reports from other countries ( 4 ) . many cytogenetic abnormalities have been reported , and the most common change is related to chromosome x ( 1 ) . the diagnosis is considered if the following features , in particular , appear : facial features with long palpebral fissures in which the outer third has an eversion , ptosis , arched eyebrows , prominent eyelashes and ears ( 3 , 5 ) . microcephaly , cardiovascular anomaly , a cleft lip and/or a cleft palate , dental anomalies , malocclusion , microdontia , a small dental arch , joint laxity , scoliosis , urinary tract malformation , hearing loss , seizures and hip dislocation are all other features seen in this syndrome ( 5 ) . the purpose of this case is to review manifestations of ks and to discuss specific anesthetic concerns related to this syndrome . a 9-year oldfemale patient , who weighed 25 kg , was diagnosed with ks and was scheduled for revision surgery for scoliosis . her past medical history revealed repeated respiratory tract infections ( no further infection during the last six months ) , a delay in motor development and thoraco scoliosis . she had undergone scoliosis surgery at age 6 and umbilical hernia surgery at age 3 . the following facial features were noted : long palpebral fissures , large , prominent fissures with an eversion of the lateral third of the lower eyelids , large , prominent malformed ears with low implantation , a short nasal septum , micrognathia , thoracolumbar scoliosis , a depressed left shoulder , a low - set occipital hairline and a short neck ( figures 1 and 2 ) . on auscultation , the bilateral lung sounds were clear , a heart murmur was not detected , and the cardiac rhythm and rate were regular . dilatation in the lower pole of the kidney , vesicoureteral reflux and a low capacity bladder were determined in her abdominal ultrasonography . our patient 's chromosomal analysis showed a 46 , xx karyotype without any chromosomal abnormality . on the assessment of an airway , we detected micrognathia and a short neck . note the long palpebral fissures with a lower lateral eyelid eversion and a short nasal septum . note the large , prominent malformed ears with low implantation , micrognathia and a short neck . anesthesia was induced with 8% sevoflurane in a 50% nitrous oxide - oxygen mixture . after maintaining a peripheral catheter , rocuronium 0.7 mg / kg and remifentanil 1 anesthesia was maintained with sevoflurane 2% in a 50% air - oxygen mixture and an infusion of remifentanil 0.1 - 0.2 g / kg / min . morphine 0.05 mg / kg and paracetamol 15 mg / kg were given intravenously before extubation for post - operative analgesia . analgesia was maintained with intravenous , patient - controlled analgesia ( continuous infusion rate 5 g / kg / hr of morphine and a lockout interval of 8 minutes ) . anesthetic concerns specific to this syndrome relate to possible airway difficulties , congenital heart disease , pulmonary function , joint laxity and a latex allergy . children with ks may be difficult to intubate as a result of a high arched palate , abnormal dentition , a cleft lip and/or a cleft palate and malocclusion . approximately one - third of patients have a cleft lip / palate , while two - thirds have a high arched palate ( 1 ) . reported on two patients : one with local stenosis of the right upper lobe bronchus and the other with severe bronchomalacia and an abnormal right bronchial tree . the anesthesiologist needs to evaluate the airway preoperatively and prepare for possible difficulty ( 2 ) . the patients with ks may have some congenital heart defects , and the prevalence of these defects in this population has been estimated to be from 40% to 50% ( 1 ) . cardiac abnormalities include atrial and ventricular septal defects , coarctation of the aorta , a bicuspid aortic valve , mitral valve prolapse and hypertrophic cardiomyopathy ( 3 ) . the selection of anesthetics is critical , especially for a patient who has poor ventricular function . patients with ks usually have normal pulmonary function , but recurrent pneumonia can be seen as being related to immune dysfunction . obstructive sleep apnea is common , and the patient may require a tonsillectomy ( 1 ) . genitourinary and gastrointestinal anomalies , including anal atresia , diaphragmatic hernia and eventrations , ptosis and strabismus , increase susceptibility to infections , autoimmune disorders , endocrinological abnormalities ( like thelarche in females ) ; feeding problems , hearing loss , seizures and hypotonia are other abnormalities associated with ks ( 1 , 4 , 5 ) . muscular hypotonia is a common feature ; there may be concern about a neuromuscular blockade and malignant hyperthermia , but the muscle biopsies have been normal . a larger dose of nondepolarizing muscle relaxant may be required because of the concomitant anti - convulsant therapy ( 6 ) . hips , patellae and shoulders are especially affected , so caution must be taken while positioning the patient ( 1 ) . teixeira et al . reported a case of a latex allergy in a patient with ks . the patient had a history of two previous reactions in different surgeries , so questions about a possible allergy to latex when taking medical history would help alert the anesthesiologist(7 ) . anesthesiologists should be aware of a possibly difficult tracheal intubation , cardiac lesions , respiratory problems , neurological and musculoskeletal disorders and a latex allergy when dealing with the anesthetic management of a patient with kabuki syndrome .

abstractbackground and objectives : the aim of this case was to describe the anesthetic approach to a patient with kabuki syndrome.case report : a patient with kabuki syndrome had revision surgery for scoliosis . on physical examination , shown were long palpebral fissures , large , prominent fissures with an eversion of the lateral third of the lower eyelids , large , prominent malformed ears with low implantation , a short nasal septum , micrognathia , thoracolumbar scoliosis , a depressed left shoulder , a low - set occipital hairline and a short neck . the skin was elastic , and joints were lax . the laryngoscopy showed a grade ii cormack and lehane view of the larynx . the trachea was intubated easily . the patient was positioned carefully . vital signs remained stable during surgery . the patient was extubated and transported to the post - anesthetic care unit.conclusion:anesthesiologists should be aware of possibly difficult tracheal intubation cardiac lesions , respiratory problems , neurological and musculoskeletal disorders , and a latex allergy when managing anesthesia for a patient with kabuki syndrome .

apoptosis mediates programmed natural death of neurons and is a physiologically important process in neurogenesis . however , premature apoptosis and/or an aberration in apoptosis regulation may be implicated in the pathogenesis of neurodegeneration in different neurological diseases , including als . mitochondria play a key role in the apoptotic process . among the two of the signaling pathways of apoptosis , i.e. , the extrinsic and the intrinsic pathways , the latter is assumed to initiate in mitochondria . its activation involves the release of cytochrome c and other pro - apoptotic factors from the mitochondrial intermembrane space . in the cytosol , cytochrome c binds to the apoptosis protease activation factor ( apaf-1 ) and forms a complex indicated as apoptosome . the complex - induced activation of pro - caspase-9 initiates an enzymatic reaction cascade leading to the execution of apoptosis in cells . activated caspase-9 cleaves downstream caspases such as caspase-3 , -6 , and -7 initiating the caspase cascade . data from the literature showed that apoptosis may play a role in pathomechanism of als and degeneration of motor neurons in this disease [ 4 , 5 ] . . demonstrated that the proapoptotic bcl-2 family member bcl-2-interacting mediator of cell death ( bim ) mediates motoneuron loss in a model of als . the apoptosis markers , including caspase-9 , are activated in the ventral horn of motor neurons in a transgenic mouse model of als [ 7 , 8 ] . according to gugan et al . the mitochondrial - dependent programmed cell death pathway , including the redistribution of bax , the cytosolic release of cytochrome c , and the activation of caspase-9 , is recruited during neurodegeneration in spinal cords of transgenic sod1 mouse model of als . it was also observed that the g93a mutant sod1 interaction with dna might induce dna damage and trigger the apoptotic response by activating p53 . this toxic activity of mutant sod1 in the nucleus may play an important role in the complex mechanisms associated with motor neuron death observed in als pathogenesis . the extracellular nucleotides mediate neuronal apoptosis via pathways involving c - jun n - terminal kinase 1 ( jnk1 ) , extracellular signal - regulated kinase ( erk ) , and caspases 8/9/3 . the balance between anti- and pro - apoptotic proteins related to endoplasmic reticulum ( er ) stress is impaired from the pre - symptomatic stage in this als mouse model , and this imbalance may be related to the pathogenesis of motor neuron degeneration in als . inoue et al . examined the effects of inhibition of x chromosome - linked inhibitor of apoptosis ( xiap ) , a mammalian inhibitor of caspase-3 , -7 , and -9 . the authors suggest that caspase-9 plays a crucial role in progression of als and constitutes a promising therapeutic target . thus , apoptosis contributes to pathology in als , and appropriate anti - apoptosis therapy might therefore be beneficial in this disease . although caspase-9 is an intracellular protein , it was suggested that serum markers of apoptosis may be noninvasive biomarkers in patients . moreover , data from the literature shows that measurement of caspases in serum could be useful in monitoring different diseases [ 1619 ] . the aim of the study was to measure serum caspase-9 levels in patients with als and to investigate whether there is a relationship of this caspase with clinical parameters of the disease . there were 23 patients with clinically definite als ( the presence of upper motor neuron as well as lower motor neuron signs in the bulbar region and at least two spinal regions , or the presence of upper motor neuron signs in two spinal regions and lower motor neuron signs in three spinal regions ) and 7 patients with clinically probable als [ upper motor neuron and lower motor neuron signs in at least two regions with some upper motor neuron signs rostral to ( above ) the lower motor neuron signs ] according to these criteria . the clinical condition of the patients was measured by the revised version of amyotrophic lateral sclerosis functional rating scale [ alsfrs - r ] . according to this scale the als patients scored from 0 to 39 points . they were divided into two subgroups : patients with a mild clinical state ( over 24 points according to alsfrs - r ) and patients with a severe clinical state ( up to 24 points according to alsfrs - r ) . the patients with the als were also divided according to the type of the disease onset ( patients with a limb - onset and patients with a bulbar - onset ) . the average duration of als was 16 months ( 3 months7 years ) . according to the duration of the disease , the two subgroups of patients were isolated ( patients with a short duration of als 12 months and patients with a long duration of als > 12 months ) . the restriction of food consumption , malnutrition , and weight loss was observed because of progressive weakening of the muscles and dysphagia . the patients from the control group were recruited out of hospitalized patients and that is why healthy persons were not included in the study . the patients from control group were admitted to the hospital because of acute headache occurred and it was necessary to exclude subarachnoid hemorrhage . the characteristics of patients are presented in table 1.table 1characteristics of patientsgroupno . of patientsage ( years)male / femalecontrol3050 715/15als : total3054 617/13als : short duration1654 39/7als : long duration1454 88/6als : bulbar onset1260 74/8als : limb onset1850 513/5als : mild clinical state1449 29/5als : severe clinical state1657 68/8 characteristics of patients the study was approved by the ethics committee of medical university and performed in accordance with the ethical standards established in helsinki . serum samples were collected into the plastic tubes , centrifuged rapidly , and stored at 70c until the analysis was performed . caspase-9 levels were measured by the enzyme - linked immunosorbent method using the commercial elisa kit for human caspase-9 ( bender medsystems , austria ) in accordance with the manufacturer s instructions . the nonparametric mann whitney rank sum test was used to examine the differences between the groups because data was not normally distributed . the study showed that the caspase-9 levels are significantly increased in the serum of the whole group of patients with als [ 5.4 ( 0.032.2 ) ng / ml ] compared with those from the control group [ 2.65 ( 0.014.3 ) ng / ml ] ( p < 0.05 ) . caspase-9 levels were still significantly increased in als patients with long duration of the disease , with severe clinical state , and with bulbar onset of als compared with controls ( p < 0.05 ) but not in als patients with short duration of the disease , with mild clinical state and with limb onset of als compared with controls ( p > 0.05 ) . the difference in the serum caspase-9 levels between subgroups of als patients according to the division of their type of als onset , severity of clinical state , and duration of the disease was not significant ( p > 0.05 ) . the median values of the serum caspase-9 levels , and a comparative analysis between subgroups are presented in fig . 1 and in table 2.fig . 1serum caspase-9 level in patients with als and control ( p = 0.03)table 2serum caspase-9 levels in patients with als and a comparative analysis between groupsgroupcaspase-9 level ( ng / ml ) ; median and rangecomparisonals : short duration4.9 ( 0.025.4)control versus als : short duration p = 0.16als : long duration9.25 ( 0.032.2)control versus als : long duration p = 0.03*als short versus long duration p = 0.31als : bulbar onset8.0 ( 0.023.7)control versus als : bulbar onset p = 0.04*als : limb onset4.90 ( 0.032.2)control versus als : limb onset p = 0.13als bulbar versus limb onset p = 0.59als : mild clinical state3.9 ( 0.015.7)control versus als : mild clinical state p = 0.33als : severe clinical state8.8 ( 032.2)control versus als : severe clinical state p = 0.01*als mild versus severe clinical state p = 0.11data is expressed as median and range . whitney rank sum test * p statistically significant , at least p < 0.05 serum caspase-9 level in patients with als and control ( p = 0.03 ) serum caspase-9 levels in patients with als and a comparative analysis between groups data is expressed as median and range . mann whitney rank sum test * p statistically significant , at least p < 0.05 the correlation between serum caspase-9 and severity of clinical state of als patients ( alsfrs - r score ) and duration of the disease was statistically significant ( r = 0.61 , p = 0.01 and r = 0.48 , p = 0.03 ; respectively ) . there was no significant difference between of the age of patients in als and controls ( p = 0.47 ) . there were also no significant differences between the age of male and female in patients with als and controls ( p = 0.35 and p = 0.28 ; respectively ) . the difference of serum caspase-9 levels between als male and female , and between younger ( 55 years ) and older ( > 55 years ) patients with als was not significant ( p = 0.61 and p = 0.14 ; respectively ) . there is evidence that apoptosis and activation of caspase-9 play a role in different neurological diseases . showed that activated caspase-9 and cytochrome c are present in the cerebrospinal fluid ( csf ) of patients with severe traumatic brain injury . it was suggested that polymorphisms in the caspase-9 gene may influence the activity of the disease . according to yu et al . , chronic extrinsic cervical spinal cord compression leads to fas - mediated apoptosis of neurons and oligodendrocytes which is associated with activation of caspase-8 , -9 , and -3 and progressive neurological deficits . spinal and bulbar muscular atrophy ( sbma ) is a motor neuron disease caused by polyglutamine expansion mutation in the androgen receptor ( ar ) . . showed that the mutant protein in mn-1 cells resulted in increased bax , caspase-9 , and caspase-3 . the pilocarpine - induced status epilepticus ( se ) results in massive degenerative death of neuronal cells in brains . the degenerating neurons , most of them also expressing apoptosis signalling molecules such as caspase-9 and activated caspase-3 . measured the activity of proapoptotic caspase-3 and -9 in peripheral blood lymphocytes ( pbls ) of parkinson disease ( pd ) and alzheimer disease ( ad ) patients presenilin 1 ( ps1 ) gene mutations are the major causes of early onset familial ad . acceleration of apoptosis , elevation of caspase-3/7 activity , and significant increases in caspase-4 , -8 , and -9 activities during apoptosis induced by several agents were found in the mutant ps1-transfected cells . rotenone caused the loss of mitochondrial membrane potential , released cytochrome c into the cytosol , reduced cytochrome c content in mitochondria , and reduced activation of caspase-9 and -3 . it was suggested that molecular targeting of the apaf-1-caspase-9 signalling pathway may be a feasible neuroprotective strategy to enhance the endogenous threshold for caspase activation and prevent neuronal loss in stroke . it was showed that acetaminophen reduces apoptosis ( and activation of caspase-9 ) in an in vivo model of cerebral ischemia reperfusion . it was demonstrated that agents that improve mitochondrial function or inhibit the permeability transition may eliminate increased caspase -3 and -9 activation and cell death associated with enhanced n - methyl - d - aspartate receptor ( nmdar ) activity in huntington s disease ( hd ) . it is known that sera from 26% of patients with sporadic als induced in vitro apoptosis of a human neuroblastoma cell line . in mixed cultures of rat embryonic brain and spinal cord cells the sera from als it was demonstrated that intrathecally infused tat - fused protein was effectively transferred into spinal cord neurons of als transgenic mice , including motor neurons , and that intrathecal infusion of tat - modified bcl - x(l ) delayed disease onset , prolonged survival , and improved motor performance . histological studies show the attenuation of motor neuron loss and decrease in the number of cleaved caspase 9- , cleaved caspase 3- , and terminal deoxynucleotidyl transferase - mediated dutp nick - end labeling ( tunel)-positive cells in the lumbar cords of tat - modified bcl - x(l)-treated g93a mice . this study showed that the caspase-9 levels are significantly increased in the serum of the whole group of patients with als compared with those from the control group . . it may be interesting to know caspase-9 levels also in the cerebrospinal fluid of patients with als but this measurement will be the subject of the next research . caspase-9 levels were significantly increased in als patients with long duration of the disease , with severe clinical state , and with bulbar onset of als compared with controls but not in als patients with short duration of the disease , with mild clinical state , and with limb onset of als compared with controls . the correlation between serum caspase-9 and severity of clinical state of als patients , and the duration of the disease was statistically significant . this indicates that apoptosis is more advanced in patients with severe clinical state , bulbar onset , and a long duration of the disease . moreover , it is known that patients with bulbar onset of als have more severe clinical state than patients with limb onset of the disease . demonstrated that caspases are present in nonactive forms in the spinal cords of wild - type mice during the early stage of the disease . in transgenic mice , the caspases are present in their active forms . during the advanced stage of the disease , data from the recent study confirm this observation and suggest that caspase-9 plays a role in pathophysiology of als , and anti - apoptotic therapy might be helpful in this disease .

it is known that apoptosis may play a role in the pathophysiology of amyotrophic lateral sclerosis ( als ) . moreover , caspase-9 is implicated in the apoptosis pathway . the aim of the study was to investigate caspase-9 levels in serum of patients with als . the study involved 30 patients with als and 30 patients from the control group . the serum caspase-9 levels were measured using the enzyme - linked immunosorbent method . the study showed that caspase-9 levels are significantly increased in serum of the patients with als comparing to the control group ( p < 0.05 ) . there was a significant correlation of serum caspase-9 levels with severity of clinical state of als patients and duration of the disease ( p < 0.05 ) . the results indicate that caspase-9 may be implicated in pathomechanism of neurodegeneration in als .

escherichia coli o157 ( o157 ) is a serious human pathogen that causes severe enterocolitis by producing verotoxin . it is sometimes complicated by hemolytic uremic syndrome ( hus ) or acute encephalopathy , which results in a poor prognosis . ordinarily , management of the disease is mainly supportive care , and there have been few surgical cases reported . a rare case of successful colectomy for hemorrhagic colitis with hus and acute encephalopathy due to o157 infection is reported . an 81-year - old man was admitted to a primary hospital with complaints of lower abdominal pain and bloody diarrhea . he was given intravenous hydration and antibiotic therapy ( cefotiam , levofloxacin ) with a diagnosis of ischemic colitis . on hospital day 2 , follow - up abdominal computed tomography showed ascites and thickness of the entire colon wall . on hospital day 4 , the patient was transferred to our hospital because of renal dysfunction and a convulsion . in the first aid station , the patient 's consciousness was slightly clouded ; temperature was 38.0c , blood pressure 140/92 mm hg and heart rate 95/min . laboratory studies revealed severe inflammation , anemia , a low platelet count and renal dysfunction . blood gas analysis showed hypoxemia , metabolic acidosis and a low co2 level due to tachypnea . colonoscopy revealed diffuse mucosal edema , ulcer formation and bleeding from the rectum to the ascending colon ( fig . there was no evidence of free air , but the whole colon wall was markedly thickened , with huge ascites on abdominal computed tomography ( fig . gradually , the patient 's vital signs deteriorated ( blood pressure 60/40 mm hg , heart rate 115/min ) , with severe disturbance of consciousness , and generalized cyanosis could be seen . he was diagnosed as having necrotic ischemic colitis with septic shock and underwent emergency surgery . the operative findings showed a large amount of ascites . from the rectum to the cecum , the colon wall was markedly edematous and sclerotic . in particular , inflammation of the transverse colon extended to the greater omentum with necrosis . there was venous dilatation and congestion of blood , which suggested ischemic colitis . in the stool culture before the operation , o157 and verotoxin were found . this case was therefore diagnosed as hemorrhagic colitis with hus and acute encephalopathy due to o157 infection . after the operation , the patient was treated in the intensive care unit with ventilation because of delayed emergence from anesthesia due to encephalopathy and poor oxygenation . however , with intensive care , the hus and encephalopathy improved gradually without dialysis . in 1977 , konowalchuk first reported a case of o157-induced colitis , and this bacterium has been recognized as a serious human pathogen that causes severe gastroenteritis by producing verotoxin . the criteria for making a diagnosis of o157 infection include ( 1 ) detection of o157 bacterial cells from cultured stool specimens , ( 2 ) detection of verotoxin from stool , and ( 3 ) confirmation of an elevation of o157 antibody titer in the blood . however , a few days are needed to confirm the diagnosis . in the present case , a recent report described a fast and sensitive enzyme - linked immunosorbent assay method to measure o157 bacteria within a few hours . it may be an alternative method to help diagnose and treat this serious disease faster in the future . in 1015% of patients with verotoxin - produced o157 colitis , the pathogenesis involves the verotoxin produced by o157 binding to the receptors on renal tubular epithelial cells and the vascular endothelial cells of the kidney or brain . typically , the diagnosis of hus is confirmed by thrombocytopenia , hemolytic anemia and acute renal failure . the present patient fulfilled these criteria , so that he was finally diagnosed as having severe hus with acute encephalopathy . retrospectively analyzed the clinical records of patients with o157-induced hus and evaluated the correlations between laboratory data and disease severity . the crp and wbc levels were high and the serum na and total protein levels were low in severe hus patients with encephalopathy . they created an scwp ( sodium , crp , wbc count and total protein ) score using these four factors to predict increasing severity : ( 1 ) crp ( mg / dl ) score 0 , < 0.5 ; score 1 , 0.5<1.0 ; score 2 , 1.0<2.0 ; score 3 , 2.0 . ( 2 ) na ( meq / l ) score 0 , > 136 ; score 1 , 132136 ; score 2 , 127131 ; score 3 , 126 . ( 3 ) total protein ( g / dl ) score 0 , > 6.5 ; score 1 , 5.86.5 ; score 2 , 4.95.7 ; score 3 , 4.8 . ( 4 ) wbc ( /l ) score 0 , < 9,200 ; score 1 , 9,200<12,100 ; score 2 , 12,10015,000 ; score 3 , > 15,000 . the average score of the severe hus group was 10 ( from 9 to 11 ) , compared to 5 ( from 2 to 7 ) in the mild cases group , and they suggested that this score may be useful to predict a high risk of severe hus . in the present severe hus case with encephalopathy , the main treatment of this disease is medical treatment including fluid replacement , antibiotics and dialysis . however , as in the present case , surgical treatment is required for rescue when severe colitis develops . sepsis induced by necrotic colitis leads to elevated serum levels of inflammatory cytokines and systemic damage to vascular endothelial cells . in fact , whitington et al . reported that colon necrosis caused prolonged hus , which finally increased mortality . therefore , it is important to perform surgery appropriately when colon necrosis is suspected , as in the present case . table 1 reviews 8 japanese cases of o157 that required surgical treatment [ 9 , 10 , 11 , 12 , 13 , 14 , 15 ] . in the review most patients underwent emergency surgery due to evidence of peritonitis on physical examination . in many cases , inflammation involved mainly the right colon , and right hemicolectomy was performed . however , in the present case , since the inflammation spread to involve the whole colon , subtotal colectomy was needed . as all of the colectomy cases showed colon necrosis or perforation in the resected specimens , surgical therapy was critical for rescue . six of eight patients ( 75% ) developed hus , and three cases developed encephalopathy . the average scwp score of patients with hus was 7.5 compared with 4 for those without hus .

an 81-year - old man was admitted to a primary care hospital due to bloody diarrhea . the findings of abdominal computed tomography indicated ischemic colitis , so conservative therapy was started . on the 4th hospital day , the patient was transferred to our hospital because of renal dysfunction . physical examination showed clouding of consciousness and abdominal distention . abdominal computed tomography revealed massive ascites and thickening of the whole colonic wall . with a diagnosis of acute abdomen , an emergent laparotomy was performed . extended right hemicolectomy was performed because of severe ischemic change and necrosis of the right side of the colon . in the stool culture before the operation , escherichia coli o157 and verotoxin were found , so this case was diagnosed as hemorrhagic colitis with hemolytic uremic syndrome and acute encephalopathy due to escherichia coli o157 infection . postoperatively , the hemolytic uremic syndrome and acute encephalopathy were prolonged . however , with intensive care , the patient recovered and was discharged on the 33rd postoperative day .

compartment syndrome has been defined as any condition in which pressure build - up within closed osteofascial space compromises tissue circulation and function . the resultant ischemia can quickly cause irreversible muscle and nerve damage leading to musculotendinous contractures and sensorimotor deficits . urgent diagnosis and surgical treatment with decompressive fasciotomy is the key to optimizing functional outcome . diagnosis of compartment syndrome heavily depends on clinical presentation and becomes increasingly difficult in patients who are unconscious , intoxicated , or have altered mental status . measurement of compartmental pressures using various devices has been shown to help facilitate diagnosis in such patients . compartment syndrome of the upper extremity has been extensively described and reported in the hand , forearm , and upper arm , with the forearm most commonly affected . a literature review returned only 4 other case reports termed compartment syndrome of the periscapular fascial compartments of the supraspinatus or infraspinatus . some authors suggest that the rarity of upper extremity and shoulder region compartment syndrome may be due to the blending of fascial communications seen between the infraspinatus , deltoid , pectoralis , and brachial fascia , which may help to dissipate pressure build - up . to our knowledge , we report the only case of a patient with a comminuted scapular fracture that developed an acute compartment syndrome of both the supraspinatus and infraspinatus , diagnosed via intracompartmental pressure measurements and treated with emergent decompressive fasciotomy . a 64-year - old male involved in a motor vehicle collision presented with left shoulder and facial pain . examination revealed a swollen , soft shoulder [ figure 1 ] with scapular and acromioclavicular ( ac ) joint tenderness and painful motion . x - rays showed a comminuted scapular body and spine fracture extending to acromion base with ac joint widening [ figures 2a , b and 3 ] . the patient 's airway later became compromised secondary to facial fracture swelling , requiring intubation . posterior view of left shoulder showing extensive swelling , ecchymosis , and abrasion ( a and b ) ap and lateral plain radiographs of left shoulder injury demonstrating ac joint widening , acromion base fracture , scapular spine and body fracture 3d reconstruction ct scan of left scapula showing segmental fracture of scapular spine and extensive comminution of scapular body later , evaluation revealed increased swelling and tenseness over the left scapula . supraspinatus and infraspinatus compartment pressures were measured at 49 mmhg and 32 mmhg , respectively , with a diastolic blood pressure of 43 mmhg . fifteen hours after presentation , emergent fasciotomy was performed . the incision extended over the scapular spine similar to a modified judet incision . upon release , the supraspinatus and infraspinatus compartments showed good muscle escape , beefy red coloration , adequate bleeding , and contracture with stimulation [ figure 4 ] . elevated serum myoglobin levels prior to fasciotomy were 2705 ng / ml , which declined to 1221 ng / ml and 630 ng / ml on postoperative day # 1 and # 2 , respectively . the combination of scapular spine , acromion base , and ac joint separation prompted plans for open reduction internal fixation ( orif ) , which were delayed until hospital day # 13 due to pneumonia [ figure 5 ] . twenty - week post - op examination revealed active shoulder motion of 50 requiring removal of the ac plate and manipulation under anesthesia . final 10-month follow - up revealed full strength and near - full flexion and abduction with complete radiographic bony healing . there were no signs of sequelae from compartment syndrome at any point . intraoperative view after fascial release of the infraspinatus and supraspinatus postoperative ap shoulder plain radiograph after scapular spine and ac joint fixation to our knowledge , we report the only case of a patient with a comminuted scapular fracture that developed an acute compartment syndrome of both the supraspinatus and infraspinatus , diagnosed via intracompartmental pressure measurements and treated with emergent decompressive fasciotomy . the diagnosis of compartment syndrome is frequently a clinical diagnosis based primarily on findings of pain out of proportion and pain on passive stretch of involved muscles . the unconscious or obtunded patient at risk of compartment syndrome presents a difficult challenge for the physician in that these findings are either unreliable or unobtainable . the use of additional diagnostic modalities of intracompartmental pressure monitors has been found to be useful in such patients . the unfamiliarity and rarity of reported scapular compartment syndrome requires adherence to thorough physical examination , a high index of suspicion , and when necessary , the utilization of compartment pressure monitoring to prevent missed diagnosis . in 1992 , landi et al . the first case described a patient with extensive necrosis of the infraspinatus encountered during exploration of a non - healing pressure ulcer . the second case described a patient with a scapular fracture with increasing pain and swelling . intracompartmental pressure measurements revealed an absolute pressure of 75 mmhg , which continued to decline on subsequent measurements . follow - up demonstrated full motion , and absence of pain with no sequelae of an untreated compartment syndrome . the diagnosis of compartment syndrome based on absolute pressure measurements alone has been challenged in several studies and its acceptance has diminished . their study measured compartment pressures in 19 lower extremity fractures , all lacking clinical signs of compartment syndrome . ninety - five percent of patients had at least one compartment measurement > 30 mmhg and 84% had measurements within 30 mmhg of diastolic pressure . to our knowledge , there is no similar study to that of prayson et al . involving baseline upper extremity fracture compartment measurements . further study may be useful to help guide treatment and evaluate injury location as a possible variable in the development of compartment syndrome . compartment syndrome is not only the result of an increased volume within a fixed space , but rather the body 's inability to compensate for a change in the microvascular pressure gradient within a compartment . once pressures have exceeded capillary perfusion pressure , the ability to exchange oxygen and clear waste is hindered . the resolving clinical signs and lack of sequelae despite the elevated compartmental pressures as seen in landi et al . 's case further substantiates that compartment syndrome is not purely related to an increase in volume but involves other confounding variables . the relationship between the measured compartmental pressure and diastolic pressure gives a more accurate insight into the dynamic compartmental environment . this pressure differential value , as originally described by whiteside et al . as significant when absolute pressure measurement is within 30 mmhg of the diastolic pressure , has become more widely accepted as the diagnostic criterion compared to the use of an absolute pressure alone . as seen in our case , patients with hypotension have lower intravascular pressures and may have inadequate tissue perfusion even at mild increases in intracompartmental pressure . a normotensive or hypertensive state in our patient may have been protective against rising compartment pressures . the patient denied any history of trauma , but admitted intensive upper extremity weight lifting prior to a plane flight . diagnosis of compartment syndrome was made based on magnetic resonance imaging ( mri ) findings of an enlarged and edematous supraspinatus . emg 15 months after insult demonstrated persistent injury to the supraspinatus with shoulder abduction limited to < 30. takakuwa et al . presented a similar case of a patient with shoulder pain after performing bayonet - thrusting exercises while wearing tight - fitting shoulder equipment . the authors made a delayed diagnosis of compartment syndrome based on mri findings of diffuse supraspinatus edema , elevated serum creatinine phosphokinase ( cpk ) and lactate dehydrogenase . . 's and takakuwa et al . 's patients were observed ; however , the latter lacked uncontrollable pain and clinical sequelae of compartment syndrome , making the diagnosis of severe overuse synfrome of the supraspinatus graves et al . made two diagnoses based on elevated creatinine kinase ( ck ) levels and mri findings of marked swelling and high - intensity supraspinatus signaling , similar to those of takakuwa et al . and the authors chose to consider these cases overuse syndromes with rhabdomyolysis instead of compartment syndrome due to the absence of tense compartments , improved symptoms without fasciotomy , and lack of compartment syndrome sequelae . four cases , termed either infraspinatus or supraspinatus compartment syndrome , have been reported in the english literature [ table 1 ] . however , several of these cases lacked clinical compartment syndrome signs of tenseness and swelling , were diagnosed via mri and lab values , or were successfully treated non - operatively . , a diagnosis of overuse syndrome may better suit some initial reported diagnoses of supraspinatus compartment syndrome , as nonsurgical management may be used to adequately treat overuse injuries of the supraspinatus that result in rhabdomyolysis and not compartment syndrome . to our knowledge , we have described here the first case of both supraspinatus and infraspinatus compartment syndrome and its successful surgical treatment with decompressive fasciotomy . due to devastating complications and functional loss of a missed diagnosis of compartment syndrome , a high index of clinical suspicion for developing compartment syndrome must be maintained in every fracture setting , regardless of anatomic location or rarity of reported cases .

acute compartment syndrome occurs when pressure within a confined fascial space rises to a level impairing microvascular perfusion to surrounding tissues.[1234567 ] the majority of the reported literature is based on lower extremity compartment syndrome , but any muscle group within an osteofascial compartment has the potential to develop compartment syndrome . we report a case of a 64-year - old male who developed an acute compartment syndrome of both the supraspinatus and infraspinatus after sustaining a severely comminuted scapula fracture . diagnosis of compartment syndrome was made after intracompartmental pressure measurements of the supraspinatus and infraspinatus revealed pressures within 30 mmhg of the diastolic blood pressure , prompting emergency decompressive fasciotomy . at final follow - up , the examination revealed full shoulder strength with near - full range of motion . there were no signs of sequelae from compartment syndrome at any point . few case reports describe compartment syndrome of the periscapular fascial compartments . however , these cases were either retrospectively diagnosed[89 ] or diagnosed via magnetic resonance imaging ( mri ) findings and lab values.[910 ] surgical management of acute compartment syndrome of the supraspinatus has been reported in only one other case.[10 ] to our knowledge , we report the only case of a patient with acute compartment syndrome of both the supraspinatus and infraspinatus compartments treated with emergent decompressive fasciotomy . due to the devastating complications and functional loss of a missed diagnosis of compartment syndrome , a high index of clinical suspicion for developing compartment syndrome must be maintained in every fracture setting , regardless of anatomic location or rarity of reported cases .

ground water is the ultimate and most suitable fresh water resource for human consumption in the urban areas of india . there are several states in india where more than 90% of the population is dependent on groundwater for drinking and other purposes . ground water can be tapped by several means , e.g. submersible pump , wells , and tube wells . in india , there are over 20 million people owned wells in addition to government tube wells . the wells are generally considered as the worst type of ground water source in terms of physiochemical contamination due to the lack of concrete plinth and surrounding drainage system . over burden of the population pressure , unplanned urbanization , unrestricted exploration policies , and dumping of the polluted water at the inappropriate place has led to infiltration of harmful compounds to the ground water . global environmental changes induced by natural variability and human activities influence both water quantity and quality at regional and local scales , as well as , at the global scale . urban growth , increased industrial activities , intensive farming , and overuse of fertilizers in agricultural production studies regarding ground water quality have shown that the high rate of exploration as compared to recharging , inappropriate dumping of solid as well as liquid waste , lack of strict enforcement of law has led to deterioration of ground water quality . it is a well - known fact that potable safe water is absolutely essential for healthy living . the problem of drinking water contamination , water conservation , and water quality management has assumed a very complex shape . attention on water contamination and its management has become the need of the hour because of far reaching impact on human health . the present study was thus carried out at the community level to evaluate physicochemical as well as a microbiological profile of tap water and filtered water in urban areas of patiala , punjab . total area under patiala district is about 3175 km and has a population of 1,892,282 . about 40.27% of those live in the urban area . as per provisional reports of census india , it is divided into 15 zones according to the water supply scheme of the municipal corporation [ figure 1 ] . each zone has its own independent tube well network , and five areas are under public health department . in this study , three zones under municipal corporation and two areas under public health department were chosen according to the simple random sampling scheme . from each area , map of the sampling area criteria for inclusion of the houses : houses which have installed the purifier for more than 1-yearwater purifier system should be either reverse osmosis [ ro ] or ultraviolet ( uv ) system or both . houses which have installed the purifier for more than 1-year water purifier system should be either reverse osmosis [ ro ] or ultraviolet ( uv ) system or both . this cross - sectional study was conducted over a period of 1-year , june 2011 to june 2012 . in this study , two samples were taken from each source one sample for the physicochemical analysis and another for bacteriological analysis . a total of four samples was taken from each house making the total number of samples 200 . water samples were taken from the tap which supplies water from the service pipe directly and not from a storage tank in the house . also , just before filling , the flow was reduced to prevent splashing when filling the bottle . samples were sent within an hour to the microbiology department in government medical college , patiala for microbiological analysis of water . samples were held < 10c during transit to the lab , according to the sample collection , storage , and transport methods given in standard methods of examination of water , apha , awwa , wef 1999 . physicochemical properties ( ph , alkalinity , total hardness , calcium hardness , chloride , fluoride , iron , and arsenic ) were tested by using water testing kits from nice chemicals private limited ( an iso : 9001 certified kits ) and judged according to drinking water specifications , bureau of indian standards ( bis ) [ table 1 ] . statistical analysis was done using microsoft excel 2007 and epi info version 7.1.4 ( cdc atlanta , usa ) freely available at cdc website . a number of water samples found to be within desirable limits with respect to physicochemical parameters were significantly more with filter water sample than tap water samples except for ph levels [ table 2 ] . in this study , 45 tap water samples and nine filter water samples showed ph values within the desirable limits according to bis ( 6.58.5 ) . 84% ( 42 samples ) of the tap water samples and 94% ( 47 samples ) of filtered water samples show alkalinity within desirable limits ( 200 mg / l ) . only 6% and 2% of tap and filter water samples had moderately hard water as per who criteria ( desirable ) . forty - five tap water samples ( 90% ) were found to be hard , and two of the tap water samples were found to be very hard out of the total 50 tap water samples . also , 43 filter water samples ( 86% ) were found to be soft [ table 3 ] . none of the tap water samples and 84% filter water samples showed calcium hardness within desirable limits according to bis ( < 75 mg / l ) . only 14% tap water samples showed chloride values within the desirable limits according to bis ( < 250 mg / l ) . 82% tap water samples showed arsenic values within the desirable limits according to bis ( 0.01 mg / l ) . excellent microbiological quality of water ( no coliforms ) was observed in only one - third ( 16 samples , 32% ) of tap water samples compared to three - fourth ( 39 samples , 78% ) of filter water samples ( p < 0.05 ) . more than four coliforms were observed in 28% ( 14 tap water samples ) and 4% ( 2 filter water samples ) , respectively [ table 4 ] . water samples within desirable limits for physicochemical parameters ( according to bis ) hardness of water samples as per who standards microbiological quality of water samples most of the filtered water samples ( 82% ) showed ph lower than the desirable limits . this is supported by the fact that the filtration technology leads to the acidification of drinking water . similar results showing ph value of neutral to slightly alkaline were reported by mishra et al . , pandey and tiwari , asadi et al . , and reza and singh . the alkalinity and hardness of most of the tap , as well as filtered water samples , were within desirable limits of the bis . similar results with alkalinity and hardness were shown in a study by pandey and tiwari . in the present study , 47 tap water samples and seven filter water samples showed hardness levels > 150 mg / l ( hard water ) requiring treatment of water before drinking . these cases also report the history of signs and symptoms suggesting arthropathies , however , no correlation can be established taking only the drinking water in consideration . also , it was seen that the 43 of the filter water samples have soft water quality . the rest of the seven samples from the filter are those which are either never serviced after installation or they have only had uv filtration system installed ( no ro or carbon filter ) . the mean calcium hardness and fluoride level of the tap water were higher , whereas , that of the filtered water was within the desirable limit of bis ( 227.0 vs. 57.6 mg / l ; 1.3 vs. 0.46 mg / l ) . in a study by pandey and tiwari , higher levels of calcium hardness of ghazipur city have been reported similar to the results of this study . also , in the present study , 16% of the filtered water samples show calcium hardness more than the desirable limits . these are mostly the uv filters without activated carbon or the ro filters which were not regularly serviced . in a study by asadi et al . , concentration of fluoride was observed to be more than 1.5 ppm near jubilee hills , sheik put , erragadda and sanathnagar , and concentration of fluoride at yellareddyguda was observed to be 3.15 mg / l . this may be due to the fact that ground water in that area usually contains fluoride dissolved by geological formation and increased fluoride may be due to the result of industrial activities and weathering of fluorine bearing minerals such as fluoride and apatite . this may be due to the presence of decaying organic matter in the pipes supplying the drinking tap water . in studies by sinha and saxena , reza and singh , and shantha kumari et al . , most of the collected water samples showed chloride within the desirable limits according to bis . in the present study , mg / l , which is higher than the desirable limit of arsenic according to bis . whereas there was no trace of arsenic in all the filter water samples . similar results of having higher levels of arsenic in drinking water from the wells have been reported from a study by zandsalimi et al . epidemiological studies show that arsenic exposure increases the mortality associated with bladder , kidney , lung , and skin cancers . arsenic exposure is also associated with greater mortalities from neoplasms of the nasal cavity , bone , liver , larynx , colon , stomach , and from lymphoma . in the present study , suspicious / unsatisfactory microbiological quality of water the microbiological contamination may be due to the fact that the sewage pipes are laid over the pipes supplying tap water . any leak from the sewage pipes can lead to contamination of drinking water . in a study by rajendran et al . , regarding the bacteriological analysis of water samples from the tsunami which hit the coastal areas of kanyakumari district , tamil nadu showed contamination in 56 ( 37% ) drinking water sources . the results indicate that certain chemical parameters such as hardness , chloride , and fluoride were beyond the permissible limits in this area , which is densely residential . the overall view of the water quality of the present study zone showed an unsatisfactory result especially with respect to microbiological quality . therefore , we recommend that home filters should be installed , serviced timely , properly , and their water quality should be checked routinely . also , any leak from sewage pipes should be promptly repaired to prevent contamination of drinking water .

introduction : ground water is the ultimate and most suitable fresh water resource for human consumption in the urban areas of india . studies regarding ground water quality have shown that the higher rate of exploration as compared to the rate of recharging , inappropriate dumping of solid , as well as liquid waste , lack of strict enforcement of law has led to the deterioration of ground water quality . the present study was thus , carried out to evaluate physicochemical , as well as a microbiological profile of tap water , and filtered water in urban areas of patiala , punjab.materials and methods : the three zones under municipal corporation and two areas under public health department were chosen according to the simple random sampling from patiala city . from each area , 10 houses were chosen according to the systematic random sampling technique ( n = 50 ) . water was taken from two sources , tap water , and from the water filter . two samples were taken from each source one for the physicochemical analysis and another for bacteriological analysis . the samples which were sent for bacteriological assessment were collected in a sterile container.results:the number of water samples found to be within desirable limits with respect to physicochemical parameters were significantly more with the filter water sample than the tap water samples . suspicious / unsatisfactory microbiological quality of water was observed in 28% and 4% of tap and filter water samples , respectively.conclusion:the results indicate that certain chemical parameters such as hardness , chloride , and fluoride levels were beyond the permissible limits . therefore , we recommend that home filters should be installed , serviced appropriately , and their water quality should be checked routinely . also , any leak from sewage pipes should be promptly repaired to prevent contamination of drinking water .

acute promyelocytic leukemia ( apl ) is characterized by reciprocal translocation t(15;17)(q22;q21 ) leading to the disruption of pml and rara followed by a reciprocal pml rara fusion in 90% of the cases.[17 ] molecular cytogenetics like interphase fluorescence in situ hybridization ( fish ) has overcome the hurdles of unavailability of abnormal and/or lack of metaphase cells , detection of cryptic , submicroscopic rearrangements due to insertion events , identification of complex variants as well as rara translocation variants that has diagnostic utility in the diagnosis as well as management of disease.[6812 ] besides diagnostic approach , we sought to analyze these cases for identification and characterization of cryptic rearrangements , deletion variants and unknown rara translocation variants by application of d - fish and rara break - apart probe strategy on metaphase cells in apl at diagnosis . the present study included 200 apl patients who belonged to the age group 170 years . patients who were diagnosed by standard morphology criteria and immunophenotype criteria , between january 2005 and december 2010 , were enrolled in this study . molecular cytogenetics - fluorescence - in - situ hybridization ( fish ) is part of the routine diagnostic criteria and also for monitoring treatment for evaluation of cytogenetic remission . interphase and metaphase d - fish were performed using lsi dual color dual fusion pml / rara and dual color break - apart rearrangement rara probe ( vysis abbott molecular , delkenheim , germany ) as per manufacturer 's protocol and instructions . for every batch of probe , studies were carried out on 10 specimens which included peripheral blood from normal individuals and marrow aspirations from bone marrow transplantation ( bmt ) donors to check the sensitivity of probe . we scored 500 interphase nuclei and 1020 metaphase cells in each normal specimen . in patients , a minimum of 100200 and 515 metaphase cells were scored for evaluation of fish signals by two observers in a blinded fashion . for pml / rara probe , presence of two separated red ( r ) and two green ( g ) signals in non - overlapping distinct nuclei were considered as pml rara negative and 1r , 1 g and 2 co - localized / fusion red / green signals were considered as pml rara dual fusion positive . for rara break - apart probe , distinct , well - separated red and green signals in non - overlapping nuclei were considered as rara gene break / split . deviation in signal pattern of pml rara in interphase cells was evaluated on metaphase cells whenever available . deletion , complex variants and rara translocation variants were additionally confirmed on inverted 4 , 6-diamidino-2-phenylindole ( dapi ) image . whenever required , molecular characterization and interpretation of pml rara fusion positive cases by d - fish using pml / rara probe is given in table 1 and figure 1 . rara , deletion variants and rara variant translocations by d - fish with pml / rara probe and rara break - apart rearrangement probe , respectively ( a ) d - fish with lsi pml rara on metaphase cell shows normal pml allele ( red signal ) , normal rara allele ( green signal ) reciprocal pml rara fusion on der(15 ) ( yellow signal ) and der(17 ) ( yellow signal ) . rara on metaphase cell shows pml rara fusion on der(15 ) ( yellow signal ) and residual pml on der(17 ) ( red signal ) ( white arrow ) . rara on metaphase cell shows pml rara fusion on der(15 ) ( yellow signal ) , also shows aqua cep 17 normal and der(17 ) ( white arrow ) . rara on metaphase cell shows pml rara fusion on der(15 ) ( yellow signal ) and duplication of pml rara on metaphase cell shows pml rara fusion on der ( 15 ) ( yellow signal ) , residual rara on der(15 ) ( green signal ) next to pml rara fusion and residual pml signal on der(17 ) ( red signal ) ( white arrow ) . ( f ) dual color rara break - apart probe on metaphase cell shows normal rara allele on 17 ( yellow signal ) , residual rara on der(17 ) ( red signal ) and residual rara on der(11 ) at band 11q23 ( green signal ) . ( g ) dual color rara break - apart probe on metaphase cell shows normal rara allele on 17 ( yellow signal ) , residual rara on der17 ( red signal ) and residual rara on der(11 ) at band 11q13 ( green signal ) . ( h ) dual color rara break - apart probe on metaphase cell shows normal rara allele on 17 ( yellow signal ) , residual rara on der(17 ) ( red signal ) and residual rara on der(2 ) at band 2p21 ( green signal ) d - fish using lsi pml / rara probe confirmed standard reciprocal pml the frequency for false - positive interphase nuclei in normal controls for 1r 1 g 2f , 2r 1 g 1f , 1r 2 g 1f , 1r 1 g 3f , and 2r 2 g 1f was 0.2% , 0.4% , 0.4% , 0.2% , and 0.2% , respectively . the specimens with 1r 1 g 2f , 2r 1 g 1f , 1r 2 g 1f , 1r 1 g 3f , and 2r 2 g 1f were considered positive if the value exceeded > 1% . the specimens with 1r 1 g 1f were considered positive if the value exceeded > 5% . rara positive or rara split positive cells were in the range of 5090% . in 12 out of 40 patients with variant pml rara pattern , proper metaphase cells were not available for characterization either due to lack of metaphase cells or presence of metaphase cells of poor morphology or presence of normal dividing cells . in 9 out of 12 cases with 2r 1 g 1f signal pattern , 17q21qter region with residual rara presence of residual pml on der(17 ) was due to reciprocal translocation ; however , derivative 17 showed lack of reciprocal fusion due to loss of 17q deletion which was confirmed by inverted dapi image [ figure 1b , table 1 ] . in six out of nine cases with 1r 1 g 1f signal pattern in metaphase cells an inverted dapi image revealed normal appearing chromosome 17 in four cases which indicated interstitial insertion of whole rara into pml on der(15 ) . rara , a common event known to occur in apl with t(15;17 ) negative cases by conventional karyotyping . in three cases , der(17 ) appeared to be small [ figure 1c ] . these findings and documented evidence of the presence of residual pml on der(17 ) in cases with 2r 1 g 1f [ figure 1b ] support the fact that loss of dna at 17q21 region occurs in a small group of apl patients . the poor morphology of metaphase cells probably masks the abnormal 17 by conventional cytogenetics as discussed by others . the signal pattern 1r 2 g 1f observed in three cases was detected on interphase cells due to unavailability of abnormal metaphase cells . the nonreciprocal fusion pattern with the presence of residual rara probably suggests deletion of 15qter region . loss of dna material on 9q is very common in chronic myeloid leukemia ( cml ) cases . we have also detected nonreciprocal bcr - abl with 9q deletion / res abl deletion / res bcr deletion in a large cml series of 2000 cases ( our unpublished data ) . our vast experience in various hematological malignancies like acute lymphoblastic leukemia ( all)[1820 ] in lymphoma which support the notion that genomic deletions followed by translocations are common events in hematological malignancies . metaphase analysis of cases with 1r 1 g 3f helped identification of duplication of pml rara on both arms of 17q as a result of i(17q ) in three cases [ figure 1d ] . additional copies of pml rara due to i(17q ) or duplication of der(17 ) are not uncommon events in apl . rara is similar to ph duplication as a result of either i(ph ) or two separate copies of ph chromosome in chronic myeloid leukemia accelerated phase ( cml - ap ) or cml - bp . d - fish strategy was found to be very efficient to detect complex variant translocation of pml rara . rara on der(15 ) at locus 15q22 as result of translocation and additionally insertion of residual rara at locus 15q15 next to pml rara and residual rara on der(17 ) [ figure 1e ] . the overall signal pattern on metaphase cell was interpreted as two sequential events : first t(15;17 ) : pml rara on der(15 ) , followed by an insertion of residual rara on der(15 ) . such atypical pml , rara rearrangement was very unusual , and not reported before to our knowledge . review of literature on deletion variants or cryptic masked / complex variants of pml rara revealed very few reports . our large series data revealed 14% incidence of deletion / complex variants of pml rara . six cases with 2r 1 g 2 dimg signal pattern revealed rara translocation with partner chromosome other than 15 [ table 1 ] . application of fish with dual color rara break - apart probe on interphase cells showed 1r 1 g 1y signal . the analysis of metaphase cells identified chromosome 11 as a partner chromosome in four cases . inverted dapi image helped in the identification of break point at band 11q23 , a locus of plzf in two cases [ figure 1f ] and band 11q13 , a locus of nuclear mitotic apparatus ( numa ) ( two cases ) [ figure 1 g ] . among the variant rara translocations , translocations involving 11q23 and 11q13 locus are frequent and found to show resistance to retinoid therapy.[2426 ] besides t(11;17(q13;q21 ) and t(11;17)(q23;q21 ) , t(2;17 ) ( p21;q21 ) was identified in our series [ figure 1h ] . the incidence of rara variant translocations in our series of apl was 3% which is similar ( 12% ) to those reported in other geographic areas . in conclusion , d - fish strategy was found to be very efficient , sensitive and reliable approach in comparison with conventional cytogenetics in the diagnosis of apl . in the present large - scale study , it helped in the identification of cryptic rearrangements like insertion of rara to pml . we also documented that translocation of 15 to 17 leads to 17q deletion which results in loss of reciprocal fusion and/or residual rara on der(17 ) . apart from deletion variants , complex variant translocations of pml rara could also be detected by d - fish interphase and metaphase approach . among complex variants , combination of d - fish and break - apart rara probe proved its ability to detect unknown variant rara translocations other than t(11;17 ) like t(11;17)(q23;q21 ) , t(11;17)(q13;q21 ) and t(2;17)(p21;q21 ) . the understanding of underlying biology will be able to focus upon the pathogenesis with respect to resistance to all - trans - retinoic - acid ( atra ) therapy in apl . these findings proved that d - fish and break - apart probe strategy have the potential to detect primary as well as secondary additional aberrations of pml and rara and other additional loci . the long - term clinical follow - up is essential to evaluate the clinical importance of these findings . also , additional large - scale studies are awaited to support the clinical and biological significance .

acute promyelocytic leukemia ( apl ) is characterized by a reciprocal translocation t(15;17)(q22;q21 ) leading to the disruption of promyelocytic leukemia ( pml ) and retionic acid receptor alpha ( rara ) followed by reciprocal pml rara fusion in 90% of the cases . fluorescence in situ hybridization ( fish ) has overcome the hurdles of unavailability of abnormal and/or lack of metaphase cells , and detection of cryptic , submicroscopic rearrangements . in the present study , besides diagnostic approach we sought to analyze these cases for identification and characterization of cryptic rearrangements , deletion variants and unknown rara translocation variants by application of d - fish and rara break - apart probe strategy on interphase and metaphase cells in a large series of 200 cases of apl . forty cases ( 20% ) had atypical pml rara and/or rara variants . d - fish with pml / rara probe helped identification of rara insertion to pml . by application of d - fish on metaphase cells , we documented that translocation of 15 to 17 leads to 17q deletion which results in loss of reciprocal fusion and/or residual rara on der(17 ) . among the complex variants of t(15;17 ) , pml rara fusion followed by residual rara insertion closed to pml rara on der(15 ) was unique and unusual . fish with break - apart rara probe on metaphase cells was found to be a very efficient strategy to detect unknown rara variant translocations like t(11;17)(q23;q21 ) , t(11;17)(q13;q21 ) and t(2;17)(p21;q21 ) . these findings proved that d - fish and break - apart probe strategy has potential to detect primary as well as secondary additional aberrations of pml , rara and other additional loci . the long - term clinical follow - up is essential to evaluate the clinical importance of these findings .

ischemic heart disease is considered as one of the most common , serious and life threatening diseases . the prevalence of the disease is increasing all over the world and it is predicted to turn into the first cause of death by 2020 . the treatment goals in this disease include explanation for and ensuring the patient , assessing and treating the risk factors , balancing the patient 's activities , pharmacologic treatment , vascular repairing and finally enhanced external counterpulsation ( eecp ) . based on the viewpoints of several investigators , eecp is used as a treating method in patients suffering from stable angina , those having symptoms despite undergoing the most appropriate pharmacologic treatments , or those who are not able to endure vascular repairing treatment . this method has healing and clinical effects , escalates the perfusion in coronary arteries , opens or forms collaterals ( small branches of blood vessels ) and increases the level of no2 in blood . it therefore enables patients to start their active life again with decreased angina severity . in iran , nasr et al . reported significantly longer exercise test time in patients with refractory angina pectoris after eecp . moreover , several studies all over the world showed that patients with angina experienced desirable effects of eecp on their quality of life for long periods after the treatment.[57 ] on the other hand , in the last the two decades , the tendency to assess and improve quality of life in chronic patients have increased substantially . quality of life studies can provide comprehensive and precise methods for increasing data related to diseases and treatment effects . moreover , the usage of quality of life surveys in clinical activities can help improve the clinical performance by suggesting treatment modifications , life prolonging factors and communicational requirements . knowledge about quality of life and factors affecting it will help nurses , as main members of therapeutic staff , to lead the care process toward quality of life improvement . as a result , existing individual problems and needs would be recognized by assessing quality of life . according to the previously mentioned facts , increased incidence of heart diseases and the important effects they have on all aspects of patients lives , studying eecp is vital . in addition , it is noteworthy that eecp , as a safe , low - cost , low - stress and noninvasive treatment method , has not yet got an appropriate attention in the treatment of patients with angina pectoris in iran . moreover , a review on the literatures demonstrates that there is not enough research investigating different aspects and benefits of this method in iran . therefore , we decided to carry out this research to determine the effects of eecp on patients quality of life . we also aimed to evaluate the effects of eecp on physical and mental components of quality of life in patients with angina . this quasi experimental ( clinical trial ) study was conducted in shahid chamran and sina hospitals which are the only hospitals having eecp device in isfahan province . all patients who referred to the two hospitals to be treated with eecp and participated in all treatment sessions ( 35 sessions ) were selected . according to clinical exams and paraclinical tests , patients had been selected for eecp by a physician . after coming to the medical center , a medical document , including clinical and demographic data , was prepared . due to insufficient number of eccp instruments in the province and the large number of required treatment sessions , each patient needs to be treated for seven weeks . therefore , considering the statistical formula , similar studies and advices from statistics professionals , the sample size was estimated as equal to 64 persons . eecp is a mechanical , outpatient and noninvasive procedure in which pneumatic cuffs , similar to those in blood pressure instrument , are tied on both legs of the patient . during the treatment procedure the patient should lie on a bed in the treatment room . three electrodes are attached to the patient 's chest skin and connected to the electrocardiogram device . cuffs are connected to an air resource to be inflated and deflated according to the electrocardiograph . therefore , they are inflated at the beginning of each diastole and deflated as a systole starts . the inflation starts from the cuffs on the calves , and continues to thighs and finally buttocks . when the cuffs are inflated , blood is pumped from the ends toward the heart . one widely used regimen in the united states is one session a day , five days a week , for seven weeks resulting in a total of 35 one - hour sessions . according to the physician 's opinion , patients were selected for eecp and thus entered in this study if they could not undergo other methods , such as coronary artery bypass graft or percutaneous coronary intervention ( pci ) , or if such methods did not significantly affect their angina pain . in addition , patients with clinical signs of coronary artery disease ( cad ) , myocardial infarction or ischemia , or congestive heart failure were also included . moreover , patients with any severe valvular heart disease , atrial fibrillation , overt congestive heart failure , uncontrolled hypertension ( blood pressure > 180/100 while on medications ) , phlebitis , deep vein thrombosis , bleeding and coagulation problems were not good candidates for eecp and therefore were excluded from the present study . in addition , patients who did not complete the eecp treatment course or died during the treatment were eliminated from the investigation list . a two - part questionnaire was used to collect data . in the first part , patients demographic and clinical data including age , sex , weight , height , employment status , the years of enduring coronary artery disease , occupied treatments , used drugs , blood pressure status , blood lipid profile , history of diabetes mellitus , familial history of coronary artery disease , smoking , history of myocardial infarction and left ventricular ejection fraction were recorded . in the second part , the standard 36-item short form ( sf-36 ) quality of life questionnaire was utilized to assess quality of life . after obtaining permissions from the patients , moreover , three months after completion of the treatment , the questionnaires were completed once more by 20 - 30 minute phone calls . finally , the data from the last phase were compared with the results before and immediately after the treatment . although it was first used in sweden , the translated versions are now being utilized in several countries . the validity of the farsi version has been determined by motamed et al . on employees of shiraz university , aging more than 15 years in tehran , and mohammadpour et al . on the healthy population aging more than 40 in mazandaran province . in these studies , the investigators reported the cronbach 's alpha to range from 0.79 to 0.90 . six questions are related to general health , ten to physical functioning , four to role limitations due to physical problems , two to bodily pain , four to vitality , five to mental health , three to role limitations due to mental problems and two to social functioning . all subscales are summarized in physical and mental scales . for scoring the questionnaire , raw scores of quality of life in each scale ( physical or mental ) are calculated separately ( range from 0 to 100 ) by adding the scores of the questions in that scale and dividing the result to the number the questions . after data were collected and both scales of quality of life were scored , data analysis was carried out using descriptive and analytic statistics in spss11.5 . in descriptive statistics , parameters such as frequency , mean , and standard deviation were used . in analytic statistics , paired t - test and repeated measure tests were utilized . the findings of this study declared that the majority of subjects ( 48.4% ) aged 56 - 71 years ( mean : 65 10.54 ) and were men ( 59.4% ) . most subjects ( 73.4% ) have had coronary artery disease for 0 - 10 years . in addition , the majority of patients had a history of hypertension ( 57.8% ) and hyperlipidemia ( 56.3% ) . the history of myocardial infarction and familial history of coronary artery disease were found among 70.3% and 73.4% of the participants , respectively . moreover , 85.9% of the patients were not smoking at the time of treatment . tables 1,2 and 3 summarize the findings related to the comparison of quality of life in the three above - mentioned stages . based on table 1 , comparison between mean scores of the subscales before and immediately after eecp by paired t - test revealed significant differences ( p < 0.05 ) . the scores 3 months after eecp significantly increased compared to before the treatment ( table 2 ) . in addition , paired t - test showed significant differences in all subscales except functional limitations due to physical and mental problems and general health ( p < 0.05 ) . likewise , the comparison between the scores immediately and three months after eecp indicated significant differences ( table 3 ) . global quality of life scores before and at the end of eecp as measured by sf-36 global quality of life scores before and at 3 months after eecp as measured by sf-36 global quality of life scores immediately and 3 months after eecp as measured by sf-36 the findings of this study showed significant improvements in quality of life among patients in all eight subscales , including physical function , role limitations due to physical problems , bodily pain , general health , vitality , mental health , role limitations due to mental problems and social function , following treatment with eecp . investigating subscales related to the physical component consisting physical functioning , role limitations due to physical problems , bodily pain , and general health indicates positive effects of eecp on patients physical status . as previous studies demonstrated,[57 ] the improvements caused by eecp will result in physical health promotion , bodily pain reduction , and eventually physical functioning development . similarly , shea et al . showed eecp to reduce angina pains , increase exercise time , improve coronary perfusion , and finally enhance physical functioning . they suggested eecp as a useful and safe method in patients with chronic and stable angina . reported eecp to increase exercise duration and improve patients functioning and quality of life without affecting the peak oxygen consumption . manchanda et al . also indicated that eecp enhanced activity endurance and left ventricular function which in turn led to improved quality of life . used sf-36 and cardiac version of the quality of life index immediately and twelve months after eecp and reported a significant improvement in doing ordinary activities , work ability , bodily pain and general health . they also suggested hemodynamic effects of eecp may stimulate intra - myocardial vessel growth and/or modify coronary perfusion similar to what is seen during vigorous exercise . moreover , nichols et al . showed eecp to improve quality of life in patients with angina and enable them to do their previous activities . they evaluated quality of life in patients immediately and two years after treatment by five - point scales . they observed a significant improvement in general health and quality of life which remained stable in the two - year follow - up period among the majority of patients . similarly , soran et al . evaluated two - year outcomes of eecp in patients with angina pectoris using five - point scales of quality of life six months , one year and two years after treatment . like michaels et al . , they reported improvements in general health status and quality of life after eecp . they therefore suggested such effects to possibly improve physical functioning and quality of life which can last for two years . assessment of mental subscales such as vitality , mental health , role limitations due to mental problems and social functioning in this study revealed higher levels of vitality , enjoyment and social functioning after eecp which could have been caused by physical health promotion . however , more accurate investigations would need further evaluations of mental health status by more specific questionnaires and comparing their results with those gathered by general sf-36 quality of life questionnaire . springer et al . used specific questionnaires such as spielberger state and trait anxiety inventory ( stai ) , beck depression inventory , the symptom check - list 90-revised ( scl-90-r ) , and general health quality index ( ghq ) to survey psychosocial effects of eecp in angina patients . they reported improvements in mental subscales of quality of life such as overall well - being , ability to work and energy level in 85% of patients . they also found eecp to have a significant impact on decreasing levels of depression as a result of myocardial perfusion improvement due to eecp . furthermore , arora et al . observed that eecp raised the energy level and the ability to engage in social activities with family and friends . linnemeier et al . studied the one - year outcomes of eecp in the treatment of angina in diabetic patients . they investigated quality of life by a five - point likert scale six and twelve months after eecp . quality of life in patients was investigated in two stages , i.e. immediately and three months after eecp sessions . most previous studies evaluated long - term effects of eecp ( for instance in two - year follow up periods ) and confirmed its efficiency . however , considering the limited number of eecp instruments in isfahan and the large number of treatment sessions for each patient leading to longer treatment courses in this study , there was no possibility to investigate more subjects for longer periods of time after treatment . according to the findings of this study , eecp can improve quality of life in patients with angina pectoris . therefore , this treatment method is suggested as a noninvasive method in reducing problems due to angina pectoris . however , it is essential to compare the effects of this method and other invasive and noninvasive treatment methods by general and specific quality of life questionnaires in order to determine whether such method has any kind of priority . moreover , based on our results , nurses can familiarize patients with positive effects of the method on physical and mental components of quality of life at the time of reception and motivate them to complete treatment sessions to attain the positive effects

background : the complicated concept of quality of life ( qol ) has been considered as an important criterion for health outcomes in chronic diseases , such as heart disease , in recent years . the aim of this study was to evaluate the qol of patients with angina pectoris after treatment with enhanced external counterpulsation ( eecp).materials and methods : this quasi - experimental study was conducted on 64 patients with angina pectoris undergoing eecp who came to shahid chamran and sina hospitals in isfahan . sampling was performed by the convenient method . data were collected using a questionnaire containing socio - demographic and clinical data . a standard questionnaire called 36-item short - form health survey was also used . questionnaires were completed through interviews and phone calls in three stages ( before , immediately and three months after the treatment ) . the results were analyzed using descriptive statistics ( frequency , mean , and standard deviation ) and analytical statistics ( paired t - test and repeated measures test ) in spss11.5.findings:the obtained results demonstrated that the majority of patients were men ( 59.4% ) and aged 56 - 71 years . in addition , 57.8% had hypertension and 56.3% had hyperlipidemia . a history of myocardial infarction was found in 70.3% of the subjects and the familial history of coronary artery disease was detected in73.4% . although qol evaluations showed improvements in all subscales immediately and three months after the treatment , the changes were not statistically significant in case of general health , role limitations due to physical problems and role limitations due to mental problemsconclusions : similar to previous research , this study showed qol to improve in patients who undergo eecp . this improvement will remain stable three months after the treatment in all subscales . therefore , eecp is an efficient noninvasive method in treating patients with angina pectoris and in developing their qol .

many studies about the hybridization of the root canal dentin are conclusive with respect to the factors that can lead to poor bonding in this environment . it is known that the cavity configuration and the dentin structure of the root canals make hybridization difficult . however , the effects of other factors such as the type of adhesive have been scarcely explored . the cavity configuration is one of the most critical variables in bonding to the root canal dentin . even though the c factor varies from 1 to 5 in coronal restorations , it might be higher than 200 when posts are luted in the three - dimensional environment of the root canal . usually , the root dentin tubules are straighter , less divergent and less dense than in the coronal dentin . because of the increasing use of fiber posts associated to dual cure resin adhesive materials the discussion was also turned towards the polymerization of the resin cement along the root canal . therefore , one must always consider such issues when using resinous materials in the root canal . the remaining factors such as the behavior of dental adhesives on dentin depend mostly on the material used . currently , several presentations of dentin adhesives are available : total dentin etching with previous acid etching followed by primer and adhesive applied separately ( three - step systems ) or in combination ( two - step systems ) ; and self - etch systems , which contain a self - etching primer and an adhesive , separately ( two - step systems ) or in one solution ( all - in - one systems ) . the increasing preference for using simplified systems ( two - step total - etch and all - in - one self - etch systems ) is due to the shortening of chair time . however , for a number of reasons , the use of these materials is always harmful to bonding when compared to multi - bottle materials ( three - step etch - and - rinse and two - step self - etch systems ) . one reason is that the acidic monomers present in the oxygen - inhibited layer of one step - self - etch adhesives are brought in direct contact with the chemical- or dual - cure composite , titrating the basic amine accelerators and inactivating them . concerning the methods to determine the degree of conversion of dental composites , the most commonly used are indirect analyses by means of flexural and hardness test , differential scanning calorimetry and direct analyses using infrared spectroscopy ( ftir ) or raman spectroscopy . microspectroscopy is obtained by using the spectroscope with a microscope , and can be used to analyze microscopic samples . in dentistry , this technique has been mainly used to evaluate the degree of conversion of methacrylate resins in the initial stages of polymerization . most studies about the incompatibility between simplified adhesive systems and dual cure resin cements measured the bond strengths at the dentin / adhesive / cement interfaces . however , no investigation determining the degree of conversion in situ has ever been conducted . with the recent interest in bondable root - filling materials to intraradicular dentin , such analysis is also of clinical importance to prevent debonding of the restoration . therefore , this study evaluated the influence of two adhesives systems ( all - in - one self - etch and three - step etch - and - rinse ) and root canal regions on the degree of conversion of dual cure resin cement by means of micro - raman analysis . it was hypothesized that the degree of conversion would be lower for the self - etch group in the deepest levels of the post space . they were randomly divided into two groups ( n=10 ) , according to the adhesive system ( figure 1 ) . the teeth had their root canals prepared with a low speed calibrated drill ( size 2 ) of a tapered quartz - frc post system ( frc postec , ivoclar , schaan , lichtenstein ) at a working length of 12 mm . the remaining 4 mm were sealed with gutta - percha . afterwards , the outer surface of each tooth was covered with black nail varnish to allow passage of light only through the most coronal portion . the cement was then applied to the root canal with a lentulo no 40 spiral ( dentsply maillefer , tulsa , oklahoma , usa ) , the frc postec post ( ivoclar ) was positioned and the set was light - cured through the post for 40 s ( optilight 600 ; gnatus equipamentos mdico - odontolgicos ltda , ribeiro preto , sp , brazil ) at a light intensity of 600 mw / cm . afterwards , the teeth were sectioned perpendicular to their long axis with a diamond saw ( microdont , so paulo , sp , brazil ) under water irrigation . three segments measuring nearly 3 mm were obtained , being one from each study region ( cervical , middle and apical regions of the root canal preparation ) . the specimens were stored in distilled water at 37c for 48 h. the degree of conversion was determined with a computer - controlled raman microscope ( system-2000 , renishaw , wotton - under - edge , gloucestershire , uk ) . each root section was excited at a wavelength of 514 nm by an ar laser through an optical microscope . the specimen was placed on the x - y stage and the laser beam was focused on the specimen surface through a 50x microscope objective with 1 m of lateral spatial resolution . after calibration of raman shift frequency , using known lines of silicon , both the spectra of the base paste of the cement ( uncured ) ( figure 2 ) and the spectra of the cement in the post space ( cured ) ( figures 3 and 4 ) were obtained ( spectral range : 1500 - 1800 cm ) . the dual - cure resin cement was scanned in three different points approximately at 1 m distance from the hybrid layer and equidistant to one another . the 1610 cm-1 and the 1640 cm-1 peaks correspond to the aromatic ring and to the c = c bonds of the uncured cement , respectively raman spectra for duo - link cured cement layer used with all bond 2 ( middle region ) raman spectra for duo - link cured cement layer used with xeno iii ( middle region ) the analyses of the acquired spectra were made using origin 7.0 with peak fitting module ( microcal software inc . , the measurement of residual double bonds was made on a relative basis by comparing the uncured methacrylate stretching vibration ( 1638 cm ) to that of the aromatic ring ( 1610 cm ) , which serves as internal reference , before ( resinuncured ) and after ( resincured ) curing . the percentage of residual double bonds was calculated using the following equations : residual double resin bonds ( % ) = resincured / resinuncured , where , the following step was to measure the degree of conversion of the resin cement in each root section : dc ( % ) = 100 - ( % of residual double resin bonds ) . in order to evaluate the influence of the adhesive and root region on the resin cement degree of conversion , the data , in percentage , were subjected to the repeated measures anova test ( rm anova , p<0.05 ) . tukey 's test ( p<0.05 ) was used to compare the mean values in the six experimental conditions . the degree of conversion values ( meanssd ) , in percentage , are presented in the dot plot and corresponding column graph ( figure 5 ) . degree of conversion values ( % ) obtained in 20 specimens ( n=10 ) , according to the adhesive system and post space regions there was no interaction between the variables " adhesive system " and " root region " ( rm anova : fdf(2;36)=1.15 ; p - valor=0.33 ) . tukey 's test ( p<0.05 ) showed no statistically significant differences between the means : all bond 2cervical = 69.3 % , all bond 2middle = 55.1 % , all bond 2apical= 56 % , xeno iiicervical = 68.7 % , xeno iiimiddle = 68.8 % , xeno iiiapical = 54.3 % . the simplified adhesives currently in use are the etch - and - rinse with primer and adhesive applied simultaneously ( two - step ) and the self - etch systems , which contain a self - etch primer and an adhesive in one solution ( all - in - one ) . the increasing preference for using simplified systems is due to the decrease in chair time . firstly , thin resin layers of these adhesives generate great amounts of uncured acidic monomers , which is a result of the resin not totally cured by the presence of oxygen . it is well known that these monomers can adversely react with the basic amine catalysts of chemically and dual cure composites , retarding the cement polymerization . secondly , the same adhesive layer inhibited by the oxygen creates an osmotic gradient capable of attracting water that can cause some delay in the resin self cure and/or degrade the adhesive / cement interface . therefore , one should expect a poor polymerization reaction from the combined xeno iii / duo - link layer , but this was not seen . this results suggests that the suboptimal bond strengths of all - in - one adhesives , rather than a cause of poor resin cement polymerization is due to comparatively more complex interface with dentin , great hidrophilicity , hydrolytic instability and ability to activate latent enzymes of the substrate ( mmps ) , destroying the collagen fibrils . recently , a practical way to minimize the effects of simplified adhesive systems has been proposed by cadenaro , et al . ( 2006 ) , who employed longer curing times than those recommended by the manufacturers . another different approach to improve bonding has been the use of an additional layer of hydrophobic adhesive on the polymerized adhesive layer . the pendant double bonds is also known ( pendant methacrylate groups tied into the network ) to lead to increased degree of conversion but not improve physical properties . however , in root canal restorations they must remain trapped to the network and eventually react to increase cement physical properties as these restorations are not exposed to the oral medium , where pendant groups tend to be leached to saliva . in spite of what was said before , a few specimens from both groups in the present study showed close to zero polymerization . we believe that the presence of residual water ( used to cleanse the root canal before hybridization ) hampered the degree of conversion in the middle and apical regions , which are very sensitive to moist control . the problem of resin cement polymerization is further aggravated by the light gradation along the root canal dentin during the post cementation . nevertheless , our results showed no differences between the degrees of conversion obtained in the three post space regions . the use of a light - transmitting glass fiber post has been claimed to improve polymerization through the depth of post spaces , explaining the absence of regional differences . 2009 ) demonstrated that the degree of conversion of a luting agent depended on the on the light transmission capacity of the posts tested , which suggests that the post herein used was appropriate . ( 2005 ) measured the knoop hardness in post spaces cemented with dual cure resin cement and found no differences between what they called " cervical " and " apical regions " . however , the microhardness test was ineffective for measuring the depth of cure of resins beyond 10 mm . on the other hand , the micro - raman analysis was proven an efficient tool to measure the degree of conversion of luting materials in apical regions . it was found that the two adhesive systems tested can be equally associated to the dual resin cement in root canal restorations . however , other aspects , e.g. , resistance to fatigue , bonding strategy to dentin and time in aqueous storage , need to be considered and are of similar importance for the study of durable restorations . no difference on the degree of conversion of the cement was observed between the two tested groups in relation to either the adhesive type or the different dentin zones .

objectivesthe aim of this study was to evaluate the influence of two adhesive systems and the post space region on the degree of conversion of dual resin cement and its bond strength to root dentin.material and methodsone three - step etch - andrinse ( all - bond 2 , bisco ) and another one - step self - etch ( xeno iii , dentsply ) adhesive systems were applied on 20 ( n=10 ) crownless bovine incisors , at 12-mm - deep post space preparation , and a fiber post ( dt light post , bisco ) was cemented using a dual cure resin cement ( duo - link , bisco ) . three transverse sections ( 3 mm ) were obtained , being one from each study region ( cervical , middle and apical ) . the degree of conversion of the dual cure resin cement was determined by a micro - raman spectrometer . the data ( % ) were submitted to repeated - measures analysis of variance and tukey 's test ( p<0.05).resultsfor both groups , the degree of conversion means ( % ) ( all bond 2cervical = 69.3 ; all bond 2middle = 55.1 ; all bond 2apical= 56 ; xeno iiicervical = 68.7 ; xeno iiimiddle = 68.8 ; xeno iiiapical = 54.3 ) were not significantly different along the post space regions ( p<0.05).conclusionneither the adhesive nor the post space region influenced the degree of conversion of the cement layer .

staphylococcus aureus has been recognized as one of the most devastating persistent human pathogen that contributes toward hospital infection worldwide . it causes variety of infections , ranging from minor skin diseases to life - threatening endocarditis . with the emergence of methicillin resistance among s. aureus during the 1960s , methicillin - resistant s. aureus ( mrsa ) is difficult to treat and has very limited treatment options . however , its high cost , difficultly in supervising intravenous ( iv ) administration , and several serious adverse drug reactions limit its routine use . in addition , there have been many reports of development of low grade to absolute resistance even to vancomycin from many parts of the globe . the quinolones antibiotics have been proposed as a possible alternative to parenteral vancomycin therapy on the basis of several in vitro and in vivo animal model data . therefore , the present study was undertaken to evaluate the utility of various commonly used fluoroquinolones against s. aureus . the study was performed between november 2009 and december 2011 in the department of microbiology at our tertiary care hospital . a total of 250 isolates of s. aureus were isolated from 2850 different clinical specimens like blood , pus , wound swabs , sputum , ear swabs , and body fluids . all the isolates were tested for their susceptibility to ciprofloxacin ( 5 g ) , ofloxacin ( 5 g ) , levofloxacin ( 5 g ) , gatifloxacin ( 5 g ) , moxifloxacin ( 5 g ) , sparfloxacin ( 5 g ) , penicillin ( 10 unit ) , tetracycline ( 30 g ) , cotrimoxazole ( 25 g ) , erythromycin ( 15 g ) , gentamicin ( 10 g ) , pristinamycin ( 15 g ) , vancomycin ( 30 g ) , and linezolid ( 30 g ) by kirby - bauer disc diffusion method using criteria of standard zone of inhibition . the mrsa isolates were tested for minimum inhibitory concentration ( mic ) to vancomycin by e - test strips ( hi - media laboratories pvt . , ltd . , mumbai ) . all the mrsa strains were sent to national staphylococcal phage - typing centre , maulana azad medical college , new delhi for phage typing . out of the 250 clinical isolates of s. aureus , maximum resistance was noted to penicillin ( 89.2% ) , followed by co - trimoxazole ( 72.0% ) and ciprofloxacin ( 57.6% ) . none of the s. aureus isolates showed resistance to vancomycin and linezolid [ table 1 ] . maximum susceptibility among the fluoroquinolones tested was to moxifloxacin ( 78.8% ) , followed by sparfloxacin ( 75.6% ) . also , 94 ( 37.6% ) isolates of s. aureus were sensitive to all the fluoroquinolones and 33 ( 13.2% ) isolates were resistant to all the fluoroquinolones tested . antimicrobial susceptibility pattern of s. aureus on disk diffusion ( n=250 ) in the present study , 107 strains ( 42.8% ) were detected as mrsa . most of the mrsa strains were isolated from pus / wound swabs and the others from blood and sputum . majority of the mrsa ( 58.8% ) were from surgical specialty , followed by orthopedics ( 40% ) , and 87.9% mrsa isolates were obtained from inpatient wards and 12.1% from opds . among the fluoroquinolones , maximum resistance in mrsa was seen to ciprofloxacin ( 92.5% ) , followed by ofloxacin ( 80.4% ) , gatifloxacin ( 53.3% ) , levofloxacin ( 49.5% ) , sparfloxacin ( 45.8% ) , and moxifloxacin ( 39.3% ) . of the 107 mrsa isolates , 26 ( 24.3% ) mrsa isolates were found to be resistant to all the six fluoroquinolones tested . only eight ( 7.5% ) mrsa isolates were susceptible to all the six fluoroquinolones [ tables 2 and 3 ] . comparison of antibiotic resistance pattern among mrsa and mssa isolates phenotypic resistance patterns of s. aureus for six fluoroquinolones the mics of vancomycin for the mrsa tested ranged from 0.5 to 2 g / ml [ figure 1 ] . vancomycin mic by e - test phage - typing pattern of 107 mrsa isolates revealed that 37 ( 34.6% ) mrsa isolates were nontypeable and 70 ( 65.4% ) were typeable . among the typeable isolates , 26 ( 24.3% ) belonged to group iii , 17 ( 15.9% ) to group i , 5 ( 4.7% ) to group ii , 15 ( 14.0% ) to mixed group , 06 to group iii and the miscellaneous group , and 1 to the miscellaneous group . over the last four decades , mrsa has spread throughout the world , and its prevalence is soaring worldwide , as evident from many studies ; however , there are considerable differences between countries . in this study , other studies have also shown such a high mrsa prevalence from various parts of the country ranging from 31 - 44% . the indiscriminate use of antibiotics , sub - therapeutic dosage , improper monitoring in the administration of various antibiotics , patient 's compliance , and unethical treatment before visiting the hospital might have been contributing factors . comparison of antibiotic resistance pattern among mrsa and methicillin - sensitive s. aureus ( mssa ) isolates showed that resistance to fluoroquinolones as well as to other antibiotics tested was significantly higher in mrsa isolates than in mssa isolates ( p < 0.0001 ) . resistance of mrsa to penicillin ( 100% ) , cotrimoxazole ( 97% ) , and erythromycin ( 61.7% ) was marked . the development and spread of multiple antibiotic - resistant mrsa have gained much attention over the years . fluoroquinolone compounds such as ciprofloxacin and norfloxacin , first synthesized in the 1980s , were found to have extended antimicrobial spectra that included gram - positive bacteria , and were hoped to be useful in eradicating mrsa . however , since these compounds became available for clinical use , resistance among mrsa has been observed in different parts of the world . in the present study , similar results of over 90% resistance have been reported in some studies from india and pakistan . mehta et al . , reported that resistance to ciprofloxacin had steadily increased from 39% in 1992 to 68% in 1996 . if such resistance is found in healthcare units , ciprofloxacin may not be useful as a first - line antibiotic . it has been reported that ciprofloxacin resistant isolates tend to show increased resistance to other antibiotics , including aminoglycosides . in the present study , 80.4% mrsa showed resistance to ofloxacin , 53.3% to gatifloxacin , 49.5% to levofloxacin , and 45.8% to sparfloxacin . lower resistance ( 39.3% ) was noted to moxifloxacin . different pattern of quinolone resistance was found among the ciprofloxacin resistant and susceptible isolates , and 24.3% mrsa isolates were found to be resistant to all six fluoroquinolones tested . this different patterns and levels of resistance may arise following exposure to different quinolones , and different strains may produce different types of resistance . in the present study , linezolid and vancomycin the mics values of vancomycin for all the mrsa ranged from 0.5 to 2 g / ml in our study . in the present study , typing of mrsa strains is necessary for thorough epidemiological investigations of sources and modes of spread of these strains in hospitals and to design appropriate control measures . in the present study , of 107 mrsa isolates , 37 ( 34.6% ) isolates were nontypeable , and 65.4% were typeable . among the typeable isolates , most strains belonged to group iii . in this study , the affinity of mrsa strains to phages of group iii was observed , although there were variations in their specific phage pattern . in view of high percentage of nontypeability among mrsa , in conclusion , s. aureus showed resistance to most of the antimicrobials in varying proportion , except to vancomycin and linezolid , to which the isolates were 100% sensitive . there is a need to develop a local set of mrsa phages for improvement of typeability . from the data , it appears that , over the period of last 15 years , mrsa have also acquired resistance to many commonly used fluoroquinolones . other members of quinolones may be used in s. aureus infections empirically in less serious selected cases . vancomycin is the mainstay of therapy in mdr mrsa infections and should be used judiciously . looking at the possibility of emergence of resistance to the drug , newer agents like linezolid and pristinamycin may provide a valuable option for the treatment of mrsa infections .

aim : the study aimed to evaluate the utility of various commonly used fluoroquinolones against staphylococcus aureus isolates.materials and methods : a total of 250 isolates of s. aureus were studied from different clinical specimens like blood , pus , wound swabs , sputum , ear swabs , and body fluids between november 2009 and december 2011 . all the isolates were tested for their susceptibility to fluoroquinolones and other antimicrobial agents by kirby - bauer disc diffusion method using criteria of standard zone of inhibition . methicillin - resistant s. aureus ( mrsa ) detection was done by cefoxitin disk diffusion method . the mrsa isolates were tested for minimum inhibitory concentration ( mic ) to vancomycin by e - test strips . all the mrsa strains were sent to national staphylococcal phage - typing centre , maulana azad medical college , new delhi for phage typing.results:a total of 107 strains of s. aureus ( 42.8% ) were detected as mrsa . multidrug resistance was observed among the mrsa strains more commonly than among the mssa stains . among the fluoroquinolones , maximum resistance in mrsa was seen to ciprofloxacin ( 92.5% ) , followed by ofloxacin ( 80.4% ) . none of the s. aureus isolates showed resistance to vancomycin and linezolid . the mics of vancomycin for the mrsa tested ranged from 0.5 to 2 g / ml . phage typing pattern of 107 mrsa isolates revealed that 37 ( 34.6% ) mrsa isolates were nontypeable and 70 ( 65.4% ) were typeable.conclusion:ciprofloxacin can no longer be used in empirical therapy against mrsa infections . use of other members of fluoroquinolone should be limited only to those strains that show laboratory confirmation of their susceptibility . vancomycin remains the drug of choice to treat mrsa infections .

to describe a case of choroidal osteoma with choroidal neovascularization ( cnv ) that was successfully treated with two intravitreal injections of bevacizumab ( ivb ) . case report on a 12-year - old japanese girl who presented with a sudden decrease in vision in her left eye . at the first visit , 2 days after the onset of her symptoms , ophthalmoscopy showed a hemorrhage of 5 disc diameters under the retinal pigment epithelium and a serous retinal detachment at the posterior pole of the left eye . fluorescein angiography ( fa ) and indocyanine green angiography ( icga ) showed several points of leakage around the fovea , which suggested a cnv . from these findings , the patient was diagnosed with choroidal osteoma with a cnv . we treated her with two injections of 1.25 mg/0.05 ml ivb with a 4-month interval . the patient s va in her left eye improved to 0.7 , and this vision was maintained for 4 years . the cnv disappeared in the fa and icga images and no recurrence was observed after 4 years . our findings indicate that ivb is effective in resolving cnv in eyes with an osteoma and prevents a decrease of vision in eyes with a choroidal osteoma with a cnv . a choroidal osteoma is a rare and benign choroidal tumor , and its clinical and histopathological features were first reported by gass et al.1 choroidal osteomata are seen in the peripapillary and macular areas of young healthy girls . the striking features of a choroidal ostroma are : well defined mass ; slightly elevated , white - to - cream or orange lesion as observed by ophthalmoscopy ; and high tissue density due to calcification as observed by ultrasonography and computed tomography ( ct ) . choroidal osteomata usually grow very slowly , but some patients have an acute decrease in vision . the main causes of this sudden decrease in vision are a serous macular detachment or a subretinal hemorrhage , with or without choroidal neovascularization ( cnv ) . a definitive treatment for the cnv associated with a choroidal osteoma has not been established . photocoagulation,2,3 surgical removal of the cnv,4 photodynamic therapy ( pdt),57 and transpupillary thermotherapy ( ttt)8,9 have been tried , but long - term vision is usually not well preserved . intravitreal injections of vascular endothelial growth factor ( vegf ) antibody ( eg , bevacizumab ) has been used to block the activity of vegf in eyes with a cnv associated with age - related macular degeneration ( amd ) . bevacizumab is a full - length vegf antibody that has been used for off - label treatment of cnvs associated with neovascular amd.10 earlier studies have shown that intravitreal bevacizumab ( ivb ) was effective in resolving the cnv associated with a choroidal osteoma.1113 but the follow - up periods in these reports were short ; that is , from 4 to 10 months . we report a case of choroidal osteoma with a cnv that was successfully treated with two injections of ivb , and good vision has been maintained for at least 4 years . a 12-year - old japanese girl presented with a sudden decrease of vision in her left eye on november 13 , 2006 . slit - lamp biomicroscopy showed no remarkable changes , including the absence of inflammation of the anterior segments . ophthalmoscopy showed a 5-disc diameter hemorrhage under the retinal pigment epithelium ( rpe ) and serous retinal detachment ( srd ) at the posterior pole of the left eye ( figure 1a ) . these findings were confirmed by optic coherence tomography ( oct ) ( figure 1b ) . fluorescein angiography ( fa ) showed a mild pooling of dye associated with a pigment epithelium detachment and several points of leakage superior and inferior to the fovea ( figure 1c ) . indocyanine green angiography ( icga ) showed leakage lateral and inferior to the fovea , which suggested a cnv ( figure 1d ) . the ophthalmoscopic , oct , fa , and icga findings were normal in the right eye . ct showed calcification and a bone - density mass in the posterior pole of the left eye ( figure 2a ) , but magnetic resonance imaging showed no unusual changes in the intra- and extraocular areas . ultrasound echography ( b - mode ) showed a flat convex elevation in the posterior pole of the eye , which produced an acoustic shadow behind the sclera ( figure 2b ) . , the patient was diagnosed with choroidal osteoma and the submacular hemorrhage was from a cnv associated with the choroidal osteoma . we treated her with 1.25 mg/0.05 ml injection of ivb ( avastin ; genentech , south san francisco , ca ) after obtaining approval from the institutional review board of chiba university . the subretinal fluid quickly disappeared 8 days after this treatment , and the elevation of the rpe disappeared . two months later , her va improved to 0.6 os , and the size of the dye leakage was reduced , although not completely . we gave a second ivb injection 4 months after the first treatment , the cnv disappeared , and no recurrence has been observed ( figure 3 ) . the patient was followed for 4 years , and microperimetry showed that the average sensitivities improved from 8.0 db before , to 6.0 db at 4 months , 4.8 db at 6 months , and 10.0 db at 42 months after the ivb ( figure 4b ) . at 4 years , her va remained good at 0.7 os . alyward et al reported that 89% of patients with a choroidal osteoma were women with a mean age of 21 years.2 this tumor is usually slow growing but can grow rapidly in some cases.14 one study reported that the va decreased in 26% of the cases at 5 years and 45% at 10 years.15 in another study , the va decreased to 0.1 in 45% of the cases at 5 years , 56%58% at 10 years , and 62% at 20 years.2,15 thus , there is a slow but progressive decrease of vision in eyes with choroidal osteoma , even those treated with photocoagulation . the decrease in vision is due to srd , cnv , atrophy of the rpe , or a combination of these . a cnv was found in 31% of the cases at 5 years , 31%47% at 10 years , and 56% at 20 years.2,15 there is no standard treatment for a choroidal osteoma . various treatments for cnv have been tried , but the treatments do not usually stop the vision decrease . the results of one study showed that photocoagulation of an extrafoveal classic cnv was successful in 25% of the cases , and the neovascular membrane was eliminated.2 however , photocoagulation can stimulate rapid vascular remodeling and anastomoses in choroidal osteoma.3 another study reported that the cnv can be surgically removed , but the postoperative va was poor at 0.06.4 pdt has been partially successful in treating cnv in eyes with choroidal osteoma . earlier studies show that 6 months after a single pdt the metamorphopsia can resolve completely ; in one study the visual acuity was not changed5 and in another study it even improved from 0.1 to 1.0.6 another study reported that four pdt applications obstructed the cnv completely , but the final va was 0.17.7 ttt was effective in obstructing the cnv but the visual outcome was also poor . an earlier report indicates that at 10 months after one ttt application , the va improved from 0.25 to 0.33 , and the vision was maintained with a scarred cnv.8 in another report , the final va was 0.1 after three ttt applications.9 the cause for the development of a cnv in eyes with a choroidal osteoma has not been determined , but it has been hypothesized that tumors with overlying hemorrhage and irregular surface were at greater risk of developing a cnv.15 because of the long duration of the tumor , the normal tissue may be slightly damaged . in addition , the mild ischemic stress and chronic inflammation of the choroidal membrane and the retina may upregulate the expression of vegf . the disruption of the rpe and thinning or loss of the bruch membrane and choriocapillaris might also contribute to the development of a cnv . a thin , degenerated rpe overlying the osteoma allows the growth of new abnormal vessels stimulated by vegf . the results of recent studies have suggested that ivb is a good treatment for reducing cnv of choroidal osteomata , with improvements in va . for example , the va improved from 0.1 to 0.8 nine months after one injection,11 and from finger counting to 0.16 at 4 months after two injections.12 in another study , the vision improved from finger counting to 0.1 ten months after two injections of ivb.13 in these three reports , the effects of bevacizumab were followed for 410 months . in our case , the effects of bevacizumab remained stable for over 4 years . in our case , the average mp1-determined sensitivities improved from 8.0 db before to 6.0 db at 4 months and to 4.8 db at 6 months after the ivbs . but the average sensitivities decreased to 10.0 db at 42 months after the ivbs , which was most likely because the retinal sensitivity of the inferior nasal side probably decreased to lower the average sensitivity . rpe atrophy occurred in the inferior nasal region of the macula , and the fovea was not affected . thus , this disagreement between va and retinal sensitivity may not be too surprising in some cases . because the fundus and fa findings showed marked rpe atrophy in the nasal inferior of the retina , the retinal sensitivity of the nasal inferior area could not be improved . in conclusion , we report a case of choroidal osteoma with a cnv that was successfully treated with two injections of ivb . our findings indicate that intravitreal injections of bevacizumab may be effective in preventing vision decrease in eyes with a choroidal osteoma with a cnv .

purpose : to describe a case of choroidal osteoma with choroidal neovascularization ( cnv ) that was successfully treated with two intravitreal injections of bevacizumab ( ivb).design and methods : case report on a 12-year - old japanese girl who presented with a sudden decrease in vision in her left eye . at the first visit , 2 days after the onset of her symptoms , her visual acuity ( va ) in her left eye was 0.2 . ophthalmoscopy showed a hemorrhage of 5 disc diameters under the retinal pigment epithelium and a serous retinal detachment at the posterior pole of the left eye . these findings were confirmed by optical coherence tomography . fluorescein angiography ( fa ) and indocyanine green angiography ( icga ) showed several points of leakage around the fovea , which suggested a cnv . from these findings , the patient was diagnosed with choroidal osteoma with a cnv . the submacular hemorrhage was from the cnv associated with the choroidal osteoma . we treated her with two injections of 1.25 mg/0.05 ml ivb with a 4-month interval.results:the patient s va in her left eye improved to 0.7 , and this vision was maintained for 4 years . the cnv disappeared in the fa and icga images and no recurrence was observed after 4 years.conclusion:our findings indicate that ivb is effective in resolving cnv in eyes with an osteoma and prevents a decrease of vision in eyes with a choroidal osteoma with a cnv .

as the majority of recent randomized controlled trials ( rcts ) have been unable to demonstrate a beneficial effect of various interventions aimed at improving outcome in end - stage renal disease ( esrd ) , novel treatment strategies need to be tested in this high - risk patient group . among several novel risk factors , inflammation has attracted considerable interest in the last 10 years . although cytokine production is necessary to protect against pathogens and promote tissue repair , excessive release or decreased clearance ( or both ) can lead to organ failure and premature death . detailed reviews on causes of inflammation in the context of impaired renal function have recently been published . prospective studies in hemodialysis , peritoneal dialysis , and renal transplantation patients show that even a single measurement of inflammatory biomarkers independently predicts poor outcome . furthermore , inflammation has been identified as a strong prognosticator of sudden death in esrd patients , which indirectly supports a link between persistent inflammation and an imbalance between the sympathetic and parasympathetic nervous system . in 2008 , a large genetic study of patients with ischemic heart disease ( and controls ) showed that c - reactive protein ( crp ) polymorphisms are not in themselves associated with an increased risk of ischemic vascular disease , therefore , available evidence suggests that although crp is a strong risk marker , it is not a risk factor of cardiovascular disease . in fact , among numerous studies that have shown that inflammatory biomarkers or cells involved in the inflammatory cascade predict outcome , interleukin ( il)-6 seems to be the strongest predictor of cardiovascular morbidity and outcome . another study showed that by defining specific cytokine ratios related to the inflammatory and immunologic states , it seems possible to fine tune the prediction of death from cardiovascular and non - cardiovascular causes . based on the observation that persistent inflammation may serve as a catalyst and magnify the risk of poor outcome via mechanisms related to self - enhancement of the inflammatory cascade and exacerbation of the wasting and calcification processes , it can be argued that the effects of different interventions should be analyzed separately in inflamed and non - inflamed dialysis patients . although inflammatory markers persistently predict outcome in dialysis patients or following kidney transplantation , few studies have studied the effect of various anti - inflammatory interventions on outcome . however , as small studies have shown encouraging results after examining the levels of inflammatory biomarkers following intervention with gamma - tocopherol , soy , green tea , cholecalciferol and sevelamer , the renal community should conduct sufficiently powered rcts to prove the concept that treatment of persistent inflammation may provide benefit in reducing uremic morbidity and mortality . in a recent rct involving 2776 hemodialysis patients , the effects of rosuvastatin versus placebo were compared . no effect on mortality was observed despite a small reduction of crp following statin treatment . however , as the interaction between crp and the effect of rosuvastatin was not checked , we do not know if the effects of statins on the outcome differ between inflamed and uninflamed dialysis patients . no large study has yet tested if anti - cytokine therapy affects surrogate biomarkers of inflammation , morbidity , and mortality . however , as therapy targeting il-1-mediated inflammation not only reduces inflammation biomarkers but also holds promise for the treatment of glycemic control in type 2 diabetic patients , it can be speculated that targeted il-1 antagonism may also benefit uremic patients . in a recent pilot study of 10 dialysis patients that were randomly assigned to receive either the tumour necrosis factor - alpha ( tnf- ) antagonist etanercept or placebo twice weekly for 44 weeks , no significant effects on inflammatory biomarkers were observed . however , as a significant difference in the time - dependent effects of etanercept on prealbumin was observed ( levels increased by 20% in the etanercept group and decreased in the placebo group ) , favorable effects on nutritional markers may be anticipated . as no adverse side effects were observed , administration of tnf- receptor antagonism seems safe in selected dialysis patients despite their documented increased risk of infectious complications . thus , larger studies are now needed to test the effects of selective anti - tnf , il-1 , and il-6 therapies , respectively , not only on inflammatory and nutritional surrogate markers but also on morbidity and outcome . no doubt , the major problem in such a rct will be to select the patients with persistent non - infectious uremic inflammation . until adequately powered rcts have been performed with anti - inflammatory treatment strategies , no specific pharmacological treatment recommendations for uremic inflammation can be advocated . however , clinicians should be aware of the strong association between persistent inflammation and outcome before carefully evaluating ( and if possible treating ) the multiple putative causes of persistent inflammation in this patient group . although the clinician may minimize some aggravating factors that promote inflammation in the context of renal disease , it may not be possible to get rid of inflammation in a clinical situation . due to the fact that causes both unrelated to dialysis ( such as intercurrent infectious and inflammatory complications , peridontitis , and ischemic heart disease ) and related to dialysis ( such as bioincompatibility , residual renal function , infections of vascular access , dialysis hypotension , impure dialysate , and volume overload ) can contribute to uremic inflammation , the clinician needs to carefully evaluate all chronic kidney disease patients with signs of inflammation such as elevated crp levels . indeed , a recent study demonstrated lower cardiovascular mortality in dialysis units in which crp was regularly monitored .

since the first reports in the late 1990s connecting elevated circulating levels of c - reactive protein in patients with end - stage renal disease with an atherogenic , wasted phenotype and poor outcome , more than 3600 publications related to the subject have appeared on the medline bibliographic database . this reflects the exponential interest that this topic has evoked in the field of nephrology , and the possibility of treating this common uremic complication has been much discussed . several small studies have implied that various nutritional and pharmacological treatment strategies have beneficial effects on surrogate markers of inflammation . however , no randomized controlled trials on anti - inflammatory treatment have yet been performed to test the hypothesis that persistent low - grade inflammation contributes to uremic morbidity and mortality .

multiple sclerosis ( ms ) is a chronic neurological disease involving the deterioration of the white matter pathways in the brain and spinal cord . ms is generally described as either relapsing - remitting ( the most common presentation form ) , characterized by episodes of neurological dysfunction followed by remissions , or as primary progressive , where patients present a continuous and progressive decline in their neurological function.1,2 lower urinary tract symptoms ( luts ) are highly prevalent and affect approximately 50 to 90% of these patients throughout the course of the disease.2 - 4 most patients report a combination of both storage and voiding symptoms5,6 caused by parasympathetic dysfunction due to brain and spinal cord damage.7 there are several treatments for this condition , such as anti - cholinergic drugs , botulinum toxin , electrical stimulation , surgical intervention , and pelvic floor muscle training ( pfmt ) . pfmt was developed by kegel in 1948 and was primarily used for treatment of stress urinary incontinence ( sui ) . few studies have evaluated pfmt for the treatment of patients with ms.3,8 these symptoms are not life - threatening , and , thus , are often neglected by health professionals . however , bladder dysfunction is responsible for a significant negative impact on the quality of life ( qol ) of affected patients.1,9 health care professionals recognizing the impact of urinary disorders on qol in patients with ms is essential for enabling appropriate investigations and judging the effectiveness of the treatment intervention.1,9,10 thus , the aim of this study was to compare pfmt and a sham procedure for the treatment of luts and their effects on qol . we performed a prospective randomized controlled trial at the neurourology clinic of the universidade estadual de campinas ( unicamp ) , campinas , brazil . the study was approved by the institutional ethics committee ( protocol number 242/2006 ) , and all of the subjects provided informed consent . the clinical history and a neurological examination , including a kurtzke 's expanded disability status scale ( edss ) evaluation , were assessed for each patient . the edss is a neurological scale that grades the level of disability in ms with a score that ranges from 0 ( normal neurological findings ) to 10 ( death due to ms).12 a questionnaire containing items asking about the presence ( yes or no ) of daytime urinary frequency and urgency , urge incontinence , nocturnal enuresis , nocturia , hesitancy , a slow urine stream , and incomplete emptying was provided to the patients . the overactive bladder questionnaire ( oab - v8)13 is a self - administered questionnaire designed to rate how disturbed patients are regarding four oab symptoms : urinary frequency , urgency , nocturia , and urge incontinence . the patients respond to each item using a 6-point likert scale ranging from 0 ( not at all ) to 5 ( a very great deal ) . the subjects were considered to have a likely diagnosis of luts if their total score was more than eight . the oab - v8 is a questionnaire that is commonly used to assess overactive bladder symptoms , but it is also an important tool for evaluating the patients ' self - perception of the symptoms caused by lower urinary tract dysfunction . the inclusion criteria were as follows : women with a definitive diagnosis of ms14 with a stable disease over the previous four months ; a relapsing - remitting form of ms ; 18 years of age or older ; an edss score12 less than or equal to 6.5 ; the cognitive capacity to complete the assessment and treatment protocol ; reporting lower urinary tract symptoms ( nine or more positive responses on the oab - v8 questionnaire ) . the exclusion criteria were as follows : pregnancy , previous vaginal prolapse surgery , stress urinary incontinence surgery , caesarean section or vaginal delivery in the six months prior to enrollment , ms relapse during treatment ( defined as any change in symptoms according to the edss evaluation ) , pelvic organ prolapse ( detected during the vaginal examination ) of grade ii or more,15 urinary tract infection ( confirmed by lab tests ) , and a post - menopausal status due to a reduction in muscle strength after menopause.16 volunteers taking anti - cholinergic or other medications for the treatment of luts were permitted to participate if they had been taking the medication for at least three months prior to enrollment and if the dosage would not change over the duration of their participation in the study . similarly , if any participant reported any worsening of double or blurred vision , increased muscle weakness , fatigue , or deterioration in coordination , he or she was re - evaluated by the neurologist using the edss . if his or her edss score increased by more than 0.5 relative to their initial score , he or she was removed from the study . all of the patients were blind to the randomization and were randomly allocated to one of the following two groups according to a computer - generated randomization list : treatment ( gi , n = 18 ) or sham ( gii , n = 17 ) . all of the assessments were performed by a physiotherapist who was blinded to the patient group assignments . the patients were unaware of which group they were participating in until the end of the study . two different informed consent procedures were prepared explaining each treatment and provided to the patients only after the randomization . patient qol was assessed using the medical outcomes study short form 36 ( sf-36 ) questionnaire,17 the international consultation on incontinence questionnaire short form ( iciq - sf)10 and the qualiveen,9 a disease - specific questionnaire . the sf-36 is a generic questionnaire with 36 questions and eight multi - item scales containing physical function ( ten items ) , social function ( two items ) , mental health ( five items ) , role limitation due to physical problems ( four items ) , role limitation due to emotional problems ( three items ) , vitality ( four items ) , bodily pain ( two items ) , and general health perceptions ( five items ) . an additional one - item measure of any self - evaluated change in health status is also available . each domain is coded , summed , and transformed into a scale from 0 ( worst ) to 100 ( best ) . the iciq - sf is a brief and subjective questionnaire that is used to assess the level and impact of urinary incontinence in the patients ' lives ; it is comprised of three questions that target the daytime frequency , severity of incontinence , and qol impact of the incontinence along with an eight - item scale assessing the possible causes or situations related to the urinary incontinence . the final iciq - sf score is the sum of the total scores , ranging from 0 to 21 ; the higher the score , the greater the impact on qol . the qualiveen is an extensive questionnaire specifically developed for use with patients with urinary dysfunction due to neurological disorders . it is divided into two major sections : the specific impact of urinary problems on quality of life ( siup ) and general quality of life ( gqol ) . the siup section is split into four domains ( inconvenience , restrictions , fears , and impact on daily life ) , with a total of 30 questions . each answer has five quantified items using a five - category ordinal likert scale , with values ranging from 0 ( no impact ) to 4 ( great negative impact ) . the average for each domain is calculated and used to determine the final siup score , which also ranges from 0 to 4 , with 4 being the greatest negative impact . the gqol section has nine questions , also using a five - category ordinal likert scale , with values ranging from -2 to + 2 ( very badly to very well , respectively ) . the final general qol value is calculated as the average of the nine questions , also ranging from -2 to + 2 . all of the questionnaires used in this study were translated into and validated in portuguese.9,10,13,17 the questionnaires were filled out by the patients at the physiotherapist 's office , but , if necessary , the assistance of the blind ( to group affiliation ) physiotherapist , who conducted the evaluations , was allowed . pelvic floor musculature was evaluated according to the perfect scheme18 ( explained as follows ) by digital examination , which includes assessments of the following : power ( p ) , scored from 0 ( no contraction ) to 5 ( contraction against strong resistance ) according to the modified oxford grading system ; endurance ( e ) , noted in seconds and referring to the duration that a maximal contraction could be held ; repetitions ( r ) , recorded from muscle exhaustion and described as the number of times ( at maximum 10 ) that contraction could be repeated without losing both power and endurance ; the number of fast contractions ( f ) with every contraction timed ( ect ) . the interventions ( treatment and sham ) were performed by a single physiotherapist for gi and gii over a period of 12 weeks , with the participants in both groups attending twice per week for 30 minutes per session . the gi patients underwent an intervention that consisted of pfmt in the supine position with the assistance of a perineometer ( perina , quark , so paulo , brazil ) . the patients were instructed to practice the exercises learned during the intervention at home three times daily , without the assistance of any device and in various positions ( such as sitting and standing ) . the regimen was evaluated weekly according to a vaginal assessment using the perfect scheme and by the physiotherapist responsible for the treatment ; the data were recorded by the blind physiotherapist before and after the intervention . the training focused on improving pelvic floor muscle awareness and contraction strength , and the exercises were individualized according to the degree of pelvic floor weakness , the loss of proprioception and the patient 's tolerance . the gii patients received a sham procedure that solely consisted of introducing a perineometer into the vagina . the patients were asked to keep the device in place for 30 minutes , with no contraction required . statistical analysis was performed using the sas ( statistical analysis system ) system for windows . the data from nine patients were used to perform a pilot study , and the desired sample size was determined using an sas program ( fpower ) . the sample size needed was calculated on the basis of the pilot study , with four patients in gi and five patients in gii . the evaluations chosen for this test were the following : pad testing , bladder diary ( number of pads ) and the iciq - sf . by setting the alpha at 5% and the power at 90% , the results of the sample size calculation showed that 10 patients were necessary for each group . to compare the baseline measurements between the two groups , a mann - whitney test was employed , and repeated - measures anova was used to compare the measurements between groups . to compare proportions , we used the chi - square or fisher 's exact test . between july 2007 and december 2008 , a total of forty - two patients consented , out of which thirty - five fulfilled the inclusion criteria . the exclusions were resulted from the following : the impossibility of attending the treatment twice per week ( six patients ) , a relapse of ms ( three patients ) , voluntary dropout ( three patients ) , treatment denial ( one patient ) , and a urinary tract infection diagnosis before ( one patient ) or during ( one patient ) the intervention . the patients who were excluded from the study but wanted to continue the treatment were treated by the physiotherapy staff . the numbers of patients in each group complaining about storage and voiding symptoms before and after the intervention , based on their initial clinical history , are shown in table 2 . after the treatment , no differences in the edss assessment were found between the groups . in contrast , there were significant differences in the oab - v8 assessment between the groups ( p<0.0001 ) ( figure 2 ) . in the sf-36 assessment , no differences were found between gi and gii . in the iciq - sf assessment , significant differences ( p = 0.0003 ) were found between the two groups ( figure 3 ) . in the qualiveen questionnaire , the specific impact of urinary problems on quality of life ( siup ) domain showed significant differences ( p = 0.0001 ) between the groups . in the same manner , the general qol domain of the same questionnaire showed significant differences ( p = 0.0443 ) between gi and gii ( figure 4 ) . compliance was based on the patients ' attendance at the clinic sessions , and there was no difference in compliance ( p = 0.9622 ) between the patients in gi ( mean+sd = 21.5 + 1.8 ) vs. gii ( mean+sd = 21.5 + 1.8 ) across the 24 sessions . in the patients who were analyzed in this study , the impairment measured by edss was unchanged . rehabilitation will not improve the neurological damage , but it will certainly reduce the disability and help patients face the disability with a better outlook.19,20 both groups had the same visit schedule . thus , the observed improvement was not due to the relationship between the health care professionals and their patients . the oab - v8 was very important for analyzing urinary symptoms in these patients with ms . this questionnaire is commonly used to assess overactive bladder symptoms , but it was observed that it is an important tool for evaluating the patients ' self - perception of luts . although movement disorders , depressive moods , and fatigue affect the qol of people with ms,19,21,22 urinary problems also have a major impact on the health - related qol of these patients.1 the patients who underwent pfmt presented improvement in their luts and qol compared with the sham group . it would seem reasonable to assume that a decrease in luts would increase qol . however , a randomized controlled trial3 found encouraging results regarding the treatment of luts but unclear results regarding any improvement in qol . the most commonly used instrument to assess general qol is the sf-36.5,20,22,23 in our study , this questionnaire was not adequately sensitive to detect any improvement in qol , which is predictable given that this is a general questionnaire and does not specifically measure the impact of urinary urgency , frequency , nocturia , and incontinence on qol . studies have shown that ms patients have a worse qol compared with non - ms populations,24 which explains the importance of identifying specific problems that have negative impacts on qol . the qualiveen questionnaire showed that pfmt improves luts and contributes to both an improved general quality of life domain and a specific impact of urinary problems on quality of life domain . the findings of this study show that , although it is subjective , the assessment of qol provides important additional information about the effects of the proposed treatment , the measure of the rehabilitation outcomes and the patient evaluation of their own health . this information will help health professionals to choose the best treatment to obtain the most improvement . the improvement of luts had a positive effect on qol in women with ms who underwent pfmt compared with a sham group . this study reinforces the importance of assessing qol to judge the effectiveness of a treatment intervention . furthermore , a disease - specific qol tool should be used to identify the specific problems that contribute to negative impacts on qol in patients with ms .

objective : to compare pelvic floor muscle training and a sham procedure for the treatment of lower urinary tract symptoms and quality of life in women with multiple sclerosis.methods:thirty-five female patients with multiple sclerosis were randomized into two groups : a treatment group ( n = 18 ) and a sham group ( n = 17 ) . the evaluation included use of the overactive bladder questionnaire , medical outcomes study short form 36 , international consultation on incontinence questionnaire short form , and qualiveen questionnaire . the intervention was performed twice per week for 12 weeks in both groups . the treatment group underwent pelvic floor muscle training with assistance from a vaginal perineometer and instructions to practice the exercises daily at home . the sham group received a treatment consisting of introducing a perineometer inside the vagina with no exercises required . pre- and post - intervention data were recorded.results:the evaluation results of the two groups were similar at baseline . at the end of the treatment , the treatment group reported fewer storage and voiding symptoms than the sham group . furthermore , the differences found between the groups were significant improvements in the following scores in the treatment group : overactive bladder questionnaire , international consultation on incontinence questionnaire short form , and the general quality of life , and specific impact of urinary problems domains of the qualiveen questionnaire.conclusions:the improvement of lower urinary tract symptoms had a positive effect on the quality of life of women with multiple sclerosis who underwent pelvic floor muscle training , as the disease - specific of quality of life questionnaires demonstrated . this study reinforces the importance of assessing quality of life to judge the effectiveness of a treatment intervention .

multiple myeloma is a monoclonal malignant neoplasm of plasma cell origin which occurs in the bone marrow and may result in extensive destruction of skeletal structures . it most commonly affects the skull , vertebrae , and pelvis , with pain , fatigue , swelling , and anemia being some of the most common clinical presentations . an 83-year - old african american female presented to the emergency department with mild pain and swelling over the posterior left mandibular alveolar ridge [ figure 1 ] . the lesion was approximately 2 cm 2 cm 1.5 cm in the area of the missing first molar . on palpation , it was firm with no fluctuance . radiographically , an ill - defined radiolucency of the alveolar bone was identified [ figure 2 ] . initial clinical presentation of the patient with gingival swelling between teeth 18 and 20 radiograph showing an ill - defined radiolucent area in the bone between teeth 18 and 20 an incisional biopsy revealed a malignant neoplasm of hematopoietic origin with sheets of malignant plasma cells ranging from mature to immature forms as well as pleomorphic - cells and occasional binucleated cells [ figure 3 ] . the neoplastic plasma cells were strongly positive with kappa light chain antibody and with cd138 [ figure 4 ] , both supporting the histological diagnosis of plasmacytoma . ( a ) low magnification shows stratified squamous mucosa on right upper end with cellular infiltrate in left lower portion of the image ; ( b ) magnification of h and e histology shows sheets of plasma cells , most are large and atypical with large nuclei and prominent nucleoli immunohistochemistry stain for cd138 antibody . note uniform positive staining with cd138 , a marker for plasma cells a bone marrow aspirate biopsy was performed on the left posterior iliac crest where sheets of neoplastic plasma cells were identified . a random urine collection showed elevated bence - jones protein ( 0.09 g ) and a subsequent 24 h urine collection demonstrated a level of 0.13 g ( normal 0.0500.080 ) . the disease is usually found in the sixth and seventh decades of life with a median age of 62 , 66 , 71 . it is a multicentric and generalized bone marrow disease that affects multiple bones and can include the jaws . in a review of 193 patients with diagnosed multiple myeloma , epstein et al . reported that out of 783 multiple myeloma patients , 14.1% had oral manifestations in the form of jaw pain , severe periodontitis , tooth mobility , bone destruction , pathologic fracture , paresthesia , and soft tissue swelling . usually , if the jaws are involved , it is an indication of an advanced stage of the disease . in the case we report , no other lesions were identified on the osseous skeletal survey performed the same month as the biopsy . this patient had a systemic manifestation of multiple myeloma despite the jaw being the only bone affected ; she had mild anemia , elevated serum calcium , and bence - jones protein in her urine . she also had sheets of neoplastic plasma cells in her bone marrow biopsy performed on the left posterior iliac crest . the neoplastic plasma cells were positive with cd138 antibody confirming the presence of the disease in an area away from the jaw . we present a case of multiple myeloma first manifesting in the mouth as a mildly painful gingival swelling with underlying irregular bone destruction . we recommended that all patients receive a routine oral examination by their dentist and primary care physician to insure early recognition of malignant neoplasms of the mouth .

it is rare that multiple myeloma ( mm ) occurs as a primary lesion in the jaws ; we report such a case in an elderly patient involving the gingiva of the left posterior mandible . multiple myeloma is a monoclonal malignant neoplasm of plasma cell origin which occurs in the bone marrow and may result in extensive destruction of skeletal structures . if the jaws are involved , it usually indicates an advanced stage of the disease.thi s makes our case very unique due to the fact no other osteolytic lesions were identified at the time of the diagnosis of multiple myeloma . we report a rare case of multiple myeloma which was diagnosed from an intraoral gingival lesion on the lower left mandible .

a reward 's value influences the effort that we will expend to acquire it . in our environment , powerfully motivating food rewards are plentiful . a crucial determinant of the value of a food is the individual 's current metabolic state . however , as is well known , this effect of satiety can be sensory - specific , such that a food with different sensory properties , for example a dessert after a heavy main course , may still be attractive and desirable , and indeed this may encourage greater consumption in environments where a variety of foods are available over a period of time . this phenomenon of sensory - specific satiety ( sss ) remains intact in amnesic patients . such individuals may eat multiple meals owing to their memory deficit but while their desire to consume may be unaffected by recent meals , their preference is , even though they may have no explicit memory for what they previously consumed . this observation raises the intriguing possibility that an explicit awareness of the current value of a food is not necessary to drive and shape behaviour . in considering unconscious motivators of food consumption first , given the evidence that with rewarding non - food stimuli ( for example , money ) motivational processes can operate outside conscious awareness and are sensitive to reward magnitude , do we find a similar effect of food stimuli outside conscious awareness ? in addition , though unconscious processes are believed to be insensitive to changes in context and reward value , the work on amnesic patients offers a clue that this may not be the case . our second question therefore was whether the unconscious motivational effects of two food stimuli were sensitive to a change in value applied to only one of those stimuli . a total of 24 healthy lean graduate students ( 12 men and 12 women , mean age 25.64.1 years , mean body mass index 21.71.8 kg / m ) were recruited from the university of cambridge after obtaining informed consent . participants ' liking for the test foods was checked with a food preference questionnaire at screening . they were informed that the purpose of the study was to see how food preferences change as people eat . participants performed two identical blocks of an incentive force task ( modified from ) in which they exerted effort to win two food rewards : pizzas ( savoury ) and cake ( sweet ) . , the prize at stake was displayed as a motivating stimulus on the computer screen , preceded and followed by a mask image . on control trials , neutral stimuli ( for example , a tape dispenser ) were shown . on half the trials , the prize was displayed for 200 milliseconds ( conscious ) and on the rest it was displayed for 33 milliseconds ( subliminal ) ( see figure 1 ) . different pictures of the prizes were used in the conscious and subliminal trials to minimise direct motor specification effects . each block featured 25 conscious and 25 subliminal presentations of the three trial types ( pizza , cake and control ) in random order . on each trial , squeezing a handgrip could win points towards the prize at stake . they were instructed to squeeze as much as they felt like on any given trial ( including control trials ) . a fluid level on the screen provided feedback on the effort . this was intended to optimise their engagement with the task but the maximum level achievable varied randomly across trials . participants were informed that this feedback was intended only as a rough indicator of their grip force but that across trials , different forces would result in different fluid levels . the latter was to ensure that participants did not simply aim for a target level on each trial . participants were instructed that they were playing for food prizes , some of which would be hidden , and at the end of each block one of their two food caches would be randomly selected , with the amount depending on their performance . in fact , the allocated food and the amount ( 30% of calculated daily calorie intake ) were predetermined and counterbalanced across participants ( 13 of them won pizzas and 11 won cake ) . both foods were modified to have identical macronutrient compositions ( 50% carbohydrate , 30% fat and 20% protein ) . following performance of the first block ( fasted ) , participants consumed the allocated food before completing the second block ( fed ) . hunger and fullness ratings were collected on a 10-point visual analogue scale at the start of the session and after consumption of the food at the end of the first block . after the second block , participants were debriefed to determine whether they had been able to see the pictures on the subliminal trials and if so to estimate on what percentage of trials they had been able to do so . they were also asked whether they were aware of having varied their effort on the subliminal trials . a formal test of awareness was then performed using a forced choice discrimination task featuring 30 masked presentations of each of the subliminal pictures , each followed by two choices . stimulus - related motivation was measured as the total force exerted on the handgrip during each trial ( the area under the force curve ) . summary force measures were calculated for each trial type in both blocks . to reduce intersubject variability , the force measures were normalised within subjects according to the maximum of these measures . corrections for nonspecific changes between the two blocks were made by subtracting responses on the control trials . we compared the effort exerted to win the food prizes before and after food consumption , using a linear mixed model with session ( fed , fasted ) and food ( sated , non - sated ) as fixed factors with a random intercept for subject , evaluating conscious and unconscious stimulus presentations separately . one further participant was excluded from the analysis of subliminal trials because of superior performance on the forced choice discrimination task . hunger and fullness ratings changed significantly after the food had been consumed ( figure 1a ) ; hunger ratings decreased ( mean change 4.27 , s.d.=1.91 , t(22)=15.357 , p<0.001 ) and fullness ratings increased ( mean change=4.84 , s.d.=2.58 , t(22)=5.155 , p<0.001 ) . the analysis of the force data showed that as predicted , on conscious trials greater force was exerted for food , compared with neutral images . there was a significant sss effect : during the second block , participants exerted less force to win the food they had just consumed , but were still working to win the other food ( figure 1b ) . crucially , we found the same pattern of significant changes even on the subliminal trials ( figure 1c ) . the mixed model analysis revealed a significant effect of session and a session food interaction for both the conscious ( session : p<0.001 , interaction : p<0.001 ) and subliminal trials ( session : p=0.045 , interaction : p=0.023 ) . the parameter estimates from the mixed model are shown in table 1 . when debriefed after the second block , 19 participants reported no awareness of the subliminal pictures and 4 reported that they thought they had seen a pizza 5% of the time ; all were unaware of having modified their exertion on these trials . performance on the test of awareness was at chance levels and the d prime index was not significantly different from zero ( mean=0.28 , s.e.=0.17 , p=0.109 ) . thus , we can conclude that on these trials participants were not able to perceive the stimuli consciously , and therefore modulations of effort for the consumed food occurred outside conscious awareness . we have demonstrated that subliminal motivation clearly occurs for food rewards . moreover , it is sensitive to the current value of the food reward as determined by the individual 's prevailing motivational state , the latter modulated by the experimental manipulation producing sss . this sensory - specific unconscious devaluation may be mediated by the orbitofrontal cortex , the neural substrate of sss , through projections to the subcortical structures such as ventral striatum that subserve subliminal motivation . these findings extend our understanding of unconscious influences on motivated behaviour by showing that they extend to food rewards , and by demonstrating that the current internal context ( satiation with a specific food ) can exert a value - dependent effect on unconscious motivation . thus , internal metabolic state , the sensory properties of consumed foods and the availability of different foods in the environment , can interact to motivate behaviour outside of our conscious awareness .

human eating behaviour is motivated and shaped by a complex interaction of internal drives such as hunger , external influences such as environmental cues and the sensory properties of food itself . thus , as is demonstrated by the example of sensory - specific satiety ( sss ) , hunger may be reduced but particular foods ( for example , desserts ) retain their attraction and their ability to prompt consumption . in considering consumption , and overconsumption , it is therefore important to understand the interaction between internal and external drives to eat . using grip force as a measure of motivation , we examined this interaction using an sss manipulation . critically , we sought to determine whether food stimuli would exert their influence even when they were subliminally presented ( and thus not accessible to consciousness ) , and whether this unconscious influence would be flexibly updated in response to changes in food reward value with satiety . demonstrating that the sss effect remains when external stimuli are not consciously perceived , our data highlight the importance of even the most subtle , fleeting and even subliminal external events in shaping our motivation towards food .

metastatic brain tumor is the most common malignant brain tumors . because of their rapid progression , early detection of metastatic brain tumors is essential for the treatment . for the early detection of the metastatic brain tumors , high - field magnetic resonance ( mr ) images such as 7.0 t mr images may be helpful since smaller tumors can be detected by virtue of higher spatial resolution and better visualization of anatomical details ( 1 , 2 ) . there have been several anecdotal reports of 7.0 t mr images in a small group of normal subjects or patients with stroke , cavernous malformations , or multiple sclerosis ( 1 , 3 - 10 ) . however , the report about the use of 7.0 t mr images for brain tumors is limited only to animal model due to technical and safety issues ( 11 , 12 ) . hereby we report a case of multiple metastatic brain tumors in a patient who was treated by gamma knife perfexion ( elekta ab , stockholm , sweden ) with the co - registered images of the 7.0 t and 1.5 t mr images . magnetization prepared rapid acquisition gradient echo ( mprage ) gadolinium - enhanced t1-weighted mr images of 7.0 t and 1.5 t were fused by using imagemerge ( elekta ab , stockholm , sweden ) , a fusion software program integrated in a treatment planning software , leksell gamma plan v8.3 ( elekta ab , stockholm , sweden ) . a right upper lung mass was detected in the routine examination of simple chest radiography of a 56-yr - old woman . her chest computed tomography ( ct ) scan revealed a 4-cm sized mass lesion in the right upper lung field with obstruction of right upper lung apical segmental bronchus . her 1.5 t brain mr images demonstrated three small mass lesions in her left parieto - temporal lobe . she refused to undergo surgical resection and received six cycles of anticancer chemotherapy over six months . after completion of chemotherapy , mass lesions in the lung and the rectum remained stable . she received gamma knife radiosurgery ( gk rs ) for brain metastases on september 1st , 2009 . she had taken 7.0 t mr images ( magnetom 7.0 t , siemens ) one day before gk rs . we received the permission from the korean food and drug administration and the institutional review board of seoul national university hospital and the neuroscience research institute of gacheon medical center ( irb number : 0802 - 046 - 234 ) . the 7.0 t mr images ( magnetom 7.0 t , siemens ) at neuroscience research institute of gacheon university of medicine and science were used for imaging of the patient . the 7.0 t magnet , with a clear bore of 90 cm , is equipped with a water cooled gradient and rf coils . the gradient system operates at 2,000 v/650 amp with gradient amplitude of 40 mt / m , a maximum slew rate of 200 mt / m / ms , and a minimum gradient rise time of 200 microseconds . t1-weighted magnetic resonance images ( mri ) was scanned before and after injection of a contrast agent . liverkusen , germany ) was used as the contrast agent by 0.2 ml / kg ( 0.01 mm / kg ) . pulse sequence used was 3d magnetization prepared rapid acquisition gradient echo ( mprage ) and the followings are the scanning parameters : tr = 4,000 ms , te = 3.92 ms , ti = 1,000 ms , thickness = 0.7 mm , flip angle = 10 , number of slice = 256 , voxel size = 0.35 0.35 0.7 mm , and matrix size = 448 448 . a leksell stereotactic frame g ( elekta ab , stockholm , sweden ) was applied to the patient head under local anesthesia . t1-weighted 3d mprage images were obtained before and after double dose gadolinium enhancement using signa excite 1.5 t mr ( general electric medical system , milwaukee , wi , usa ) . scanning parameters were : tr = 11.7 ms , te = 5.2 ms , thickness = 1.5 mm , voxel size = 0.94 0.94 1.5 mm and matrix size = 256 256 . total four metastastic brain tumors were found ; two lesions in the left parietal lobe and one in temporal lobe , and one in the right side of the pons . the measured tumor volume were 0.096 ml , 0.079 ml , 0.0314 ml , and 0.0062 ml which were treated with 22 gy , 22 gy , 22 gy , and 20 gy at the 50% isodose line , respectively . 7.0 t axial images were co - registered to 1.5 t axial images using a commercial software , imagemerge ( elekta ab , stockholm , sweden ) , which was integrated into a treatment planning software , leksell gamma plan v8.3 ( elekta ab , stockholm , sweden ) . co - registration was automatically performed by an algorithm based on the mutual information method . locations of ac and pc , and tumor volumes were measured five times with leksell gamma plan v8.3 ( elekta ab , stockholm , sweden ) in both image sets and compared . we found that in the co - registered images of the 7.0 t mr images and 1.5 t mr images , there was no significant discrepancy of the location of the ac and pc as well as the locations of four metastatic brain tumors . images of the 7.0 t and 1.5 t mprage gadolinium - enhanced t1-weighted mri are co - registered by using imagemerge ( elekta ab , stockholm , sweden ) , a fusion software program integrated in a treatment planning software , leksell gamma plan v8.3 ( elekta ab , stockholm , sweden ) ( fig . all images were realigned to midsagittal ac - pc line . in the co - registered images of the 7.0 t mri and 1.5 t mri , there was no significant difference in the location of the ac and pc between 1.5 t ( fig . difference between locations of ac measured in 1.5 t and 7.0 t image sets was 1.1 + /- maximum deviation was 1.3 mm . in the co - registered images of the 7.0 t mri and 1.5 t mri , total four metastastic brain tumors were found ; three lesions in the left parietal and temporal lobe , and one in the right side of the pons ( fig . 2e - h ) , there was no discrepancy of the position of four metastatic lesions between the 1.5 t and 7.0 t mri whereas enhanced anatomical details of the metastatic brain tumors were provided by 7.0 t mri . there was no significant discrepancy of the tumor volume ( blue line ) and its 50%-isodose volume of 22 gy ( yellow line ) in the left parietal lobe ( a lesion of fig . 2a ) between 1.5 t ( upper panel ) and 7.0 t mri ( lower panel ) , which were plotted in the axial , coronal , and sagittal view of the co - registered images ( fig . the volume of the tumor measured in 1.5 t and 7.0 t mri were 0.096 cm and 0.088 cm , respectively . among the four metastatic lesions , two lesions which were of volume 0.096 cm and 0.079 cm , respectively , were included in volume comparison because the other two were too small ( < 0.03 cm ) . volume of the bigger tumor measured in 1.5 t images were 0.096 cm and 0.088 cm in 7.0 t images , respectively . the difference was larger than standard deviation of volume measurement in each set ( 0.003 cm ) . the smaller one was measured as 0.079 cm in 1.5 t and 0.078 cm in 7.0 t , and difference was smaller than standard deviation of measurement ( 0.004 cm ) . co - registered sagittal images of the third tumor ( a lesion shown in fig . 4a , c ) and coronal images of the fourth tumor ( a lesion shown in fig . 4a , b ) , blood vessels connected to the tumors are clearly identified in high resolution images of 7.0 t mri ( fig . enhanced anatomical details of the metastatic brain tumors were provided by 7.0 t mr images . in 7.0 t mr images , we could clearly see blood vessels connected to the lesion whereas only high signal intensity regions are identified in 1.5 t mr images . we have demonstrated in this case that gadolinium - enhancing 7.0 t mr images were safely taken in a patient with mestastatic brain tumors to provide high resolution imaging . in the past , there were anecdoctal reports of high field mr images of 7.0 t or higher performed in a small group of normal subjects or patients ( 1 , 3 - 10 ) . ( 9 ) described the in vivo 7.0 t mr images of higher signal - to - noise and novel contrast to provide enhanced scrutiny of hippocampal anatomy with their microvenous structures in six normal subjects kollia et al . ( 5 ) compared the 7.0 t mr images with conventional 1.5 t mr images in twelve consecutive patients with clinically definite multiple sclerosis . they have reported that ultra - high - field imaging of patients with multiple sclerosis at 7.0 t mr images was well tolerated and provided better visualization of multiple sclerosis lesions in the gray matter . however , there is no report about the use of 7.0 t mr images for brain tumors yet and only animal brain tumor model is reported because of the technical and safety issues ( 2 , 11 , 12 ) . ( 11 ) evaluated the growth and vascularity of implanted gl261 mouse gliomas by using 7.0 t mr images with conventional t1- and t2-weighted imaging and dynamic , contrast - enhanced t2-weighted imaging in 34 c57bl6 mice at different stages of tumor development . to our knowledge , this is the first report in that the gadolinium - enhanced 7.0 t mr images were safely taken in the patients with metastatic brain tumors and detailed distortion effect was documented in comparison with low field mr images . after automatic co - registration procedures , the discrepancy of the location of ac and pc between two image sets was within 1.5 mm . errors along the cranio - caudal direction were larger than the other two perpendicular directions . the fact that slice thickness of 1.5 t axial images was more than twice thicker than that of 7.0 t images may explain the larger errors in this direction . geometric distortion due to static field and local susceptibility effects has been a major concern in high - field mr images ( 4 ) . despite these technical issues , we found that the co - registered 7.0 t mr images have only a little discrepancy in the positions of the physiological landmarks such as ac and pc as well as the locations of four metastatic brain tumors from 1.5 t mr images . we think this is an important finding for the future users of ultra - high field mr images for radiosurgery of brain tumors . recent studies reported that the 3d mprage shows the superior performance , such as contrast and sensitivity , in the brain tumor imaging compared to others ( 13 , 14 ) . our study demonstrated that the contrast enhanced t1-weighted imaging at high field 7.0 t mr images , using 3d mp rage sequence can be safely used for gk radiosurgery of metastatic brain tumors . it is expected that the superior signal to noise ratio ( snr ) of the 7.0 t mr images than the lower field mri can provide the higher sensitivity and resolution in the brain tumor imaging . we also demonstrated in this case that 7.0 t mr images taken a day before gamma knife radiosurgery can be safely utilized in targeting and the dosiplanning for the treatment of metastatic brain tumors with the fusion of 1.5 t mr images taken in the patient with the leksell frame on the day of gamma knife radiosurgery by using the image fusion program , imagemerge ( elekta ab , stockholm , sweden ) integrated in the gammaplan v8.3 of perfexion ( elekta ab , stockholm , sweden ) . in conclusion , our study demonstrates that ultra - high - field imaging of the metastatic brain tumors at 7.0 t using 3d mp rage sequence is well tolerated with reasonable scanning time and little image distortion , which provides better visualization of anatomical details than 1.5 t. we believe that combination of higher signal - to - noise ratio of 7.0 t mr images and more accurate geometrical characteristics of 1.5 t mri can provide better results for gk rs of brain metastases .

in the study we assessed the distortion of 7.0 t magnetic resonance ( mr ) images in reference to 1.5 t mr images in the radiosurgery of metastatic brain tumors . radiosurgery with gamma knife perfexion was performed for the treatment of a 54-yr - old female patient with multiple brain metastases by the co - registered images of the 7.0 t and 1.5 t magnetic resonance images ( mri ) . there was no significant discrepancy in the positions of anterior and posterior commissures as well as the locations of four metastatic brain tumors in the co - registered images between 7.0 t and 1.5 t mri with better visualization of the anatomical details in 7.0 t mr images . this study demonstrates for the first time that 7.0 t mr images can be safely utilized in perfexion gamma knife radiosurgery for the treatment of metastatic brain tumors . furthermore 7.0 t mr images provide better visualization of brain tumors without image distortion in comparison to 1.5 t mr images .

vascular and fibrous lesions are common in the head and neck area including both benign and malignant subtypes . angiofibromas are typically encountered in the nasopharynx among teenage males , accounting for the appellation juvenile nasopharyngeal angiofibroma . recently another fibrovascular lesion has been described in the genital / perineal region among females that is distinctly different from juvenile nasopharyngeal angiofibroma both histologically and behaviorally [ 18 ] . the term cellular angiofibroma has been applied to this lesion which has also been found in the paratesticular region among males and in skin [ 3 , 912 ] . one case appears to represent an early cellular stage while the second case is hypocellular with sclerosis . case 1 : a 38 year old female presented with a submucosal nodule in the soft palate thought to represent a salivary neoplasm . microscopically , surface stratified squamous epithelium was present with an underlying well demarcated and partially encapsulated mass of fibrovascular connective tissue ( fig . a submucosal well demarcated , partially encapsulated mass is comprised of fibrovascular tissue ( h&e , 50 ) , b numerous prominent , plump endothelial cells line vessels in the background of a bland hypercellular fibroblastic element ( h&e , 200 ) . c demarcated mass comprised of multiple small prominent vessels , zones of fibroblastic cellularity with desmoplasia and pockets of adipocytes ( h&e , 50 ) . e factor viii immunoreactivity in vessels ( ihc / dab , 200 ) . f cd34 immunoreactivity in both endothelial cells and fibroblasts ( ihc / dab , 200 ) case 1 . a submucosal well demarcated , partially encapsulated mass is comprised of fibrovascular tissue ( h&e , 50 ) , b numerous prominent , plump endothelial cells line vessels in the background of a bland hypercellular fibroblastic element ( h&e , 200 ) . c demarcated mass comprised of multiple small prominent vessels , zones of fibroblastic cellularity with desmoplasia and pockets of adipocytes ( h&e , 50 ) . f cd34 immunoreactivity in both endothelial cells and fibroblasts ( ihc / dab , 200 ) case 2 : a solitary submucosal mass was detected on the dorsal tongue of a 74 year old female . the lesion was stated to be painful , appearing as a dome shaped nodule with surface ulceration . the lesion was excised and submitted for microscopic examination . the excised specimen measured 1 7 4 cm and on hemisection a well defined nodule was seen in the submucosa . 1e ) and cd 34 was found in both endothelial cells and fibroblasts ( fig . s-100 protein and smooth muscle actin were negative in the fibroblastic cell population ( ihc / dab ) . the microscopic differential diagnosis for caf includes angiomyolipoma , angiomyofibroblastoma , juvenile nasopharyngeal angiofibroma , solitary fibrous tumor , spindle cell lipoma , and superficial angiomyxoma [ 1319 ] . all of these lesions are vessel rich with a fibroblastic or myofibroblastic element , variable sclerosis and harbor focal aggregates of adipocytes . angiomyolipoma is a fatty tumor with prominent muscular arterioles while angiomyofibroblastoma is a fibrovascular neoplasm with a loose , somewhat myxoid fibroblastic element . juvenile nasopharyngeal angiofibroma is uniquely confined to the nasopharynx and has a very distinct histology with a homogeneous fibroplasia and delicate immature collagen with interposed sinusoidal - like vascular channels that lack prominent endothelium . solitary fibrous tumors , comprised of cd34 fibroblasts are typically hypercellular , fasiculated and do not exhibit prominent endothelial elements , although some variants do in fact manifest a hemangiopericytoma - like pattern . angiomyxomas of deep tissues are aggressive neoplasms while superficial lesions are non - aggressive , may arise in the head and neck region as subcutaneous nodules comprised of myxoid tissue with prominent vascularity . whereas lipocytes are commonly encountered in caf , and were prominent in case 2 reported here , they are compartmentalized and not intimately interspersed with spindle cells as seen in spindle cell lipoma . caf shows a spectrum of histologic patterns which may represent progressive stages of development with more highly vascular and fibrocellular lesions representing an early stage and less vascular more sclerotic lesions being older . cafs are well demarcated or partially encapsulated , show hyperplastic vessels with prominent , plump endothelial cells , and fibroblastic hypercellularity . differentiation from reactive lesions such as pyogenic granuloma or sclerosing pyogenic granuloma is usually not problematical because these reactive lesions are diffuse or multilobular , lacking the demarcation and encapsulation of cellular angiofibroma . furthermore , caf is not infiltrated by inflammatory cells unless superficially ulcerated yet the inflammation does not pervade the tumor stroma ; rather leukocytes are zonal , in continuity with the area of ulceration . caf represents a unique lesion , common in the gentital regions yet may occur in other sites including skin and the head and neck area . in the series reported by iwasa and fletcher , the fibroblastic component of caf may be immunoreactive with antibodies to smooth muscle actin and/or cd34 . in the two cases reported here , cd34 , yet not sma was positive in the fibroblasts .

cellular angiofibroma is a benign vascular neoplasm that typically arises in the vulva , perineal , and paratesticular region . microscopically the lesions exhibit multiple small , non - dilated capillary channels , many of which contain erythrocytes . the endothelial lining cells are prominent , with monomorphic oval nuclei . interposed among the vessels are both delicate and mature collagen fibers with fibroblastic hypercellularity that is variable in older lesions where sclerosis is prominent . the lesions usually do not recur following simple excision . recent evidence indicates that cellular angiofibromas may be cytogenetically related to spindle cell lipoma . this represents the first reported instances of cellular angiofibroma in the oral cavity .

bladder transitional cell carcinoma ( tcc ) is typically a disease of older individuals and is rarely found in the first two decades of life . before 2010 , meta - analysis revealed a very favorable outcome for these patients with relatively low rates of recurrence ( 3.4% ) , progression ( 1.1% ) , and death ( 1.1% ) . however , just as in adult patients , close follow - up is necessary in pediatric patients with bladder urothelial tumors to identify tumor recurrence . unfortunately , there is no consensus on follow - up methods in pediatric patients owing to the low incidence and scarcity of reports in the literature . here we present two case studies aimed at expanding the number of pediatric cases reported and discuss follow - up methods with a review of the literature . a 13-year - old boy presented with gross hematuria of 2 days ' duration 4 months before surgery . the boy was otherwise healthy with no previous medical problems and thus the patient and his parents had ignored the symptom . the patient presented to the emergency department with right lower abdominal pain 5 days before surgery . the results of an electrolyte battery , liver function , and renal function tests were within normal limits . the urine test revealed only hematuria , and urine cytology showed no evidence of malignancy . the patient 's parents requested a computed tomography ( ct ) scan , which revealed a single bladder mass and no enlargement of the lymph nodes or metastasis to the abdomen or pelvis . preoperative cystoscopy was not performed because the patient and his parents wished to schedule concomitant appendectomy and transurethral resection ( tur ) of the bladder mass under general anesthesia . an 11-fr pediatric resectoscope and tur equipment ( karl storz gmbh , tuttlingen , germany ) were used for tur of the bladder tumor . there was a 2-cm papillary mass with a stalk beside the left ureteral orifice ( fig . microscopic examination demonstrated round to oval shaped , uniformly enlarged nuclei ; inconspicuous nucleoli ; and rare mitosis ( fig . the diagnosis was papillary urothelial neoplasm with low malignant potential ( papillary tcc , tag1 stage ) . ultrasonography , urine analysis , and urine cytology were performed every 3 months after tur of the bladder tumor . at present , 18 months after surgery , there has been no evidence of recurrence . a 16-year - old boy presented with intermittent gross hematuria of 4 months ' duration . the patient had stage 4 left neuroblastoma and had undergone left radical nephrectomy 7 years previously . five years prior , recurrence in the para - aortic lymph nodes was detected and radiation therapy was subsequently performed at the upper abdomen . at the time of presentation , there had been no evidence of tumor recurrence . a urine test revealed only hematuria , and urine cytology showed no evidence of malignancy . abdominal ultrasonography revealed a 1.2-cm bladder mass on the right posterior lateral wall ( fig . 4a ) . abdominal ct revealed a single bladder mass and no lymph node enlargement or masses of other organs . urine analysis , cystoscopy with local anesthesia , and washed urine cytology were performed every 3 months after tur of the bladder tumor . at present , a 13-year - old boy presented with gross hematuria of 2 days ' duration 4 months before surgery . the boy was otherwise healthy with no previous medical problems and thus the patient and his parents had ignored the symptom . the patient presented to the emergency department with right lower abdominal pain 5 days before surgery . the results of an electrolyte battery , liver function , and renal function tests were within normal limits . the urine test revealed only hematuria , and urine cytology showed no evidence of malignancy . the patient 's parents requested a computed tomography ( ct ) scan , which revealed a single bladder mass and no enlargement of the lymph nodes or metastasis to the abdomen or pelvis . preoperative cystoscopy was not performed because the patient and his parents wished to schedule concomitant appendectomy and transurethral resection ( tur ) of the bladder mass under general anesthesia . an 11-fr pediatric resectoscope and tur equipment ( karl storz gmbh , tuttlingen , germany ) were used for tur of the bladder tumor . there was a 2-cm papillary mass with a stalk beside the left ureteral orifice ( fig . microscopic examination demonstrated round to oval shaped , uniformly enlarged nuclei ; inconspicuous nucleoli ; and rare mitosis ( fig . the diagnosis was papillary urothelial neoplasm with low malignant potential ( papillary tcc , tag1 stage ) . ultrasonography , urine analysis , and urine cytology were performed every 3 months after tur of the bladder tumor . at present , 18 months after surgery , there has been no evidence of recurrence . a 16-year - old boy presented with intermittent gross hematuria of 4 months ' duration . the patient had stage 4 left neuroblastoma and had undergone left radical nephrectomy 7 years previously . five years prior , recurrence in the para - aortic lymph nodes was detected and radiation therapy was subsequently performed at the upper abdomen . at the time of presentation , there had been no evidence of tumor recurrence . a urine test revealed only hematuria , and urine cytology showed no evidence of malignancy . abdominal ultrasonography revealed a 1.2-cm bladder mass on the right posterior lateral wall ( fig . abdominal ct revealed a single bladder mass and no lymph node enlargement or masses of other organs . urine analysis , cystoscopy with local anesthesia , and washed urine cytology were performed every 3 months after tur of the bladder tumor . at present , a urothelial tumor in the bladder is typically located in the trigone or ureteric orifices and the lateral bladder wall . the vast majority of bladder urothelial tumors are solitary tumors ( 94% ) . in our case studies , the first symptom was also gross hematuria , and a solitary tumor was located beside the ureteral orifice . a delay in the diagnosis of bladder urothelial neoplasms seems to be common in younger patients , probably because of the relative rarity of this diagnosis and the predominance of benign causes of hematuria in this age group . bladder urothelial tumors in the first two decades of life are distinctly unusual , with most described in case reports and small series . recently , some review articles have described the clinicopathologic characteristics of pediatric bladder tcc . in this age group , these tumors appear to exhibit unique clinicopathologic features , with preferentially low - grade morphology and decreased likelihood of recurrence and progression , although some debate exists regarding their biological behavior . papillary urothelial neoplasm of low malignant potential ( punlmp ) was introduced in the world health organization/1998 international society of urologic pathology grading system and is one of the most controversial aspects of this grading system . punlmp is frequent among bladder urothelial tumors of young patients , particularly in the teenage years ; it may have a low rate of progression to higher grade and stage and thus differs from papillary urothelial carcinoma . the short follow - up period of our cases ( 12 and 18 months ) might be a limitation in a discussion of the recurrence of adolescent bladder tumors . however , considering the high recurrence rate of adult bladder tumors , two of all our cases did not experience tumor recurrence during follow - up . although tur is the treatment of choice for papillary urothelial tumors , the nature of recurrent disease and the best follow - up methods in these young patients after tur procedures are under debate . surveillance methods for pediatric patients with bladder urothelial tumors have rarely been described in the literature . we performed ultrasonography and urine analysis and cytology tests every 3 months for the 13-year - old boy and cystoscopy and urine tests for the 16-year - old boy . the results of these tests have been within normal limits . in a small contemporary series , ultrasonography was extremely effective in identifying bladder tumors , and the authors argued for its use in initial diagnosis and disease surveillance . as the technology and image quality of ultrasonography has advanced , it has become more sensitive in identifying bladder urothelial tumors in pediatric patients . ultrasonography is noninvasive and is not associated with a radiation hazard , thus providing benefits for the periodic surveillance of young patients after tur . however , the accuracy of ultrasound concerning bladder tumor follow - up has not yet been proven . intravenous urography was found to have a sensitivity of 44% in identifying a bladder mass in patients younger than 40 with urothelial carcinoma . it is also more difficult to detect a small bladder mass by intravenous urography compared with ultrasonography . whereas only cystoscopy allows for definitive diagnosis , the need for general anesthesia in young patients and the risks of urethral manipulation make its limited use preferable , especially in repeated periodic examinations . routine cystoscopy might be changed to other diagnostic methods to screen for the recurrence of bladder tumors owing to the low recurrence and indolent features of bladder urothelial neoplasm in children . ct is an accurate imaging modality for the detection of bladder cancer in patients at risk for the disease . however , radiation exposure has to be balanced against the disease likelihood in younger patients . urine cytology has not been a useful diagnostic tool in young patients mainly because of the predominance of low - grade lesions resulting in a low sensitivity rate . clinicians must remember that young patients should be periodically screened for recurrence of bladder urothelial tumors to ensure the timely identification of recurrence or metastasis . for follow - up methods , we suggest the combination of noninvasive diagnostic method such as ultrasonography , urinalysis , and cytology as diagnostic and surveillance tools for bladder urothelial tumors in younger children . if the pediatric patients can tolerate it , periodic cystoscopy may be recommended , as for adult patients , because of its standard use as a surveillance tool .

here we describe two cases of papillary urothelial neoplasm of low malignant potential in adolescent boys . one case was a 16-year - old boy with a polypoid mass beside the right ureteral orifice and the other case was a 13-year - old boy with a papillary mass beside the left ureteral orifice . the initial presentation was hematuria in both cases and the bladder mass was detected by ultrasonography . complete resection of the bladder tumor was performed by using an 11-fr pediatric resectoscope . follow - up has been performed with urine analysis , urine cytology , and bladder ultrasonography or cystoscopy every 3 months with no evidence of recurrence .

as a standard treatment for early breast cancer , modified radical mastectomy has been replaced by breast - conserving surgery ( bcs ) ( partial mastectomy ) followed by breast irradiation . in comparison to modified radical mastectomy , the 20-year survival of partial mastectomy with radiation is not statistically different [ 13 ] . for bcs , we can use different techniques , for example , quadrantectomy ( wide excision ) , segmentectomy ( wide local excision ) , and lumpectomy ( local excision ) . as demonstrated in the milan-2 trial , the local recurrence rate was lower for quadrantectomy compared to lumpectomy ( 3,1% versus 8,1% ) . the minimization of local recurrence rates is of importance , because local recurrences are associated with reduced survival and emotional distress . most local recurrences occur at the site of initial tumor excision or in the same breast quadrant . the incidence of local recurrence depends upon the tumor margin status , patients ' age , histology subtype , and adjuvant therapy ( local and systemic ) . one important factor in determining the risk of local recurrence is the molecular intrinsic subtype of the tumor . the highest risk for local recurrences was demonstrated in tumors that are er - negative , pr - negative , and her2-negative ( triple negative , tnbc ) . this risk is independent of breast - conserving therapy or mastectomy [ 7 , 8 ] . but actually the size of adequate tumor - free resection margin width is discussed controversially . in a meta - analysis of 21 retrospective studies published by houssami et al . , the impact of surgical margins on local recurrence in women was examined in early - stage invasive breast cancer treated with breast - conserving therapy . the diagnosis of positive margins was associated with an odds ratio for local recurrence of 2,42 ( p < 0.001 ) . no statistical difference was associated with tumor - free resection margins of more than 1 mm after the use of adjuvant systemic and local therapy , considering that tumor not touching ink is an adequate local resection margin for bcs . at the moment , the national guidelines require a free margin for invasive cancer of 1 mm and for ductal carcinoma in situ ( dcis ) of 2 mm . the resection of smaller tumor sizes and of unifocal localisations should lead to a favorable cosmetic outcome in the hands of a trained breast surgeon . on the other hand , approximately 10% to 30% of patients are dissatisfied with the aesthetic result after partial mastectomy and adjuvant radiation [ 1113 ] . for these failure tumor resection can produce distortion , retraction , and noticeable volume changes in the breast . also , the radiotherapy can have a strong influence on the treated breast : edema , skin erythema , hyperpigmentation , fibrosis , and retraction . to avoid these effects , a concept of oncoplastic techniques in breast - conserving surgery was introduced to combine optimized oncological local safety with optimized aesthetic outcomes concerning partial mastectomy defect reconstruction and remodelling of size , contour , and symmetry of the breast . the interrelationship between breast - tumor ratio , volume loss , cosmetic outcome , and margins of clearance is complex , and the widespread popularity of breast - conserving surgery has focused attention on new oncoplastic techniques that can avoid unacceptable cosmetic results . until now , surgical options have been limited to breast - conserving surgery or mastectomy , the choice depending on fairly well - defined indications and factors . oncoplastic procedures provide a third option that avoids the need for mastectomy in selected patients and can influence the outcome of breast - conserving surgery in three ways . oncoplastic procedures allow wide local excisions of breast tissue without risking major local defects and deformity . the use of oncoplastic techniques to prevent deformity can extend the scope of breast - conserving surgery , without compromising the adequacy of resection or the cosmetic outcome . volume replacement can be used after previous breast - conserving surgery and radiotherapy to correct unacceptable deformity and may prevent the need for mastectomy in some cases of local recurrence when further local excision will result in considerable volume loss . the choice of technique depends on a number of factors , including the extent of resection , location of the tumour , timing of surgery , experience of the breast surgeon in oncoplastic techniques , and expectations of the patient [ 13 , 1518 ] . partial mastectomy reconstruction at the same time as resection is gaining popularity . as a general rule , it is much easier to prevent than to correct a deformity , as the sequelae of previous surgery do not have to be addressed . immediate reconstruction at the time of partial mastectomy is associated with clear surgical , financial , and psychological benefits [ 2022 ] . resection defects can be reconstructed in one of two ways(a ) by volume displacement with recruiting and transposing local glandular or dermoglandular flaps into the resection site or ( b ) by volume replacement , importing volume from elsewhere to replace the amount of tissue resected . volume replacement techniques can restore the shape and size of the breast , achieving symmetry and excellent cosmetic results without the need for contralateral surgery . however , these techniques require additional operation time and may be complicated by donor - site morbidity , flap loss , and an extended reconvalescence . in contrast , volume displacement techniques require less extensive surgery , limiting scars to the breast and avoiding donor - site problems . there are more than 200 different oncoplastic techniques published . we predefined five surgical principles in targeted oncoplastic breast surgery , which are learnable and teachable in an academic institution and result in good or excellent cosmetic outcomes within breast - conserving therapy in more than 95% of treated patients . these surgical principles are glandular rotation , dermoglandular rotation , tumor - adapted reduction mammoplasty , combination of bct and thoracoepigastric flap , or combination of bct and latissimus dorsi flap to reconstruct hemimastectomy defects . conventional treatment for stages i and ii breast cancer consists of breast - conserving therapy with segmentectomy , surgical axillary staging ( sentinel lymph node biopsy ) , and whole - breast radiotherapy . postoperative adjuvant radiotherapy is generally delivered 6 weeks after surgery in fractionated daily doses during 5 - 6 weeks and also as a boost over the tumor bed . the eortc 22881 - 10882 trial showed that an additional boost of 16 gy reduces the risk of local recurrence in about 4% in 10.8 years . approximately 85% of local recurrences appear in tissue adjacent to the primary tumor after conservative surgery within 5 years of follow - up . in intraoperative radiotherapy ( iort ) , a single radiation dose is delivered under direct , visual inspection of the tumor bed . it thus improves local recurrence risk and diminishes toxicity since there is less irradiation of healthy tissue . intraoperative radiotherapy ( iort ) can be delivered in two settings : an iort boost followed by a conventional regimen of external - beam radiotherapy or a single iort dose [ 24 , 25 ] . in the lancet , present results of the targit - a trial , while in the lancet oncology , umberto veronesi and colleagues present results of the eliot trial . each trial compared a different type of single intraoperative radiotherapy with external whole - breast irradiation . this noninferiority study compared one intraoperative dose of 20 gy using a spherical applicator ( point source of 50 kv energy x - rays ) with whole - breast irradiation . breast - conserving surgery was performed using lumpectomy . in germany , a tumor - free resection margin of at least 10 mm was recommended to avoid whole - breast irradiation . overall , the 5-year risks for local recurrence in the conserved breast for intraoperative radiotherapy versus whole - breast irradiation were 3.3 ( 95% ci 2.15.1 ) versus 1.3 ( 95% ci 0.72.5 ; p = 0.042 ) . these results are acceptable in terms of the threshold of the predefined noninferiority margin of 2.5% . in the eliot trial , 1305 patients were randomised after quadrantectomy to receive either whole - breast irradiation ( 50 gy in 25 fractions followed by a boost of 10 gy in five fractions using an external electron beam without node irradiation ) or single intraoperative radiotherapy with electrons ( 21 gy in one fraction to the tumour bed using electrons of 69 mev ) . local recurrence of less than 7.5% in the intraoperative radiotherapy group was deemed to show equivalent efficacy compared with whole - breast irradiation . after median follow - up of 5.8 years , the 5-year event rate for ibtr was 4.4% ( 95 ci 2.76.1 ) with intraoperative radiotherapy and 0.4% ( 95% ci 0.01.0 ) with whole - breast irradiation . thus , the rate of local recurrence with intraoperative radiotherapy was within the prespecified equivalence margin but was significantly worse than that for whole - breast irradiation . occurrence of true local relapses , local relapses outside the index quadrant , and axillary or regional lymph node metastases was significantly increased with single intraoperative radiotherapy . of 35 local recurrences in the intraoperative radiotherapy group of eliot , 14 ( 40% ) occurred outside the index quadrant and 21 ( 60% ) were local recurrences within the index quadrant . to date , there have been only a few publications of studies with short - term follow - up in which iort , provided as a boost , demonstrated the potential to prevent local recurrences in early breast cancer ( 2.6% at 5 years ) with good to excellent cosmetic results . additional open questions are the lack of the final histopathologic report when iort is applied , the uncertainty regarding the definition of the resection margins , and the resected irradiated volume after repeat resection . to date , in the breast center of the university hospital of cologne , according to national guidelines iort is used outside clinical trials only as a boost radiation followed by whole - breast irradiation . a mobile iort device generating low - energy x - rays ( 50 kv ) has been used since 2010 for intraoperative radiation in nonlobular breast cancer . this iort system is applicable to all predefined targeted oncoplastic breast - conserving surgery principles . after oncoplastic wide local excision ( segmentectomy ) of the tumor , the applicator of the mobile device intrabeam ( carl zeiss surgical , oberkochen , germany ) is placed into the tumor bed . using purse - string sutures , the segmentally oriented resection margins of the tumor bed are narrowed to the spherical applicator . to prevent skin toxicity , skin margins were everted before starting iort . thereafter , a single dose of 20 gy was provided at the applicator surface . after complete wound healing and/or chemotherapy , outpatient treatment is shortened by 1 - 2 weeks as a result of the omission of the external - beam boost . since 2011 , a total of 149 patients were treated with iort as a boost during primary targeted oncoplastic breast - conserving surgery , followed by whole - breast radiotherapy . after mobilisation of glandular tissue , the segmental resection borders were narrowed to the iort - applicator using purse - string sutures . resection defects were definitely reconstructed after iort boost using the predefined oncoplastic principles to achieve optimal esthetic results after breast - conserving surgery ( figure 1 ) . treated tumors and methodological details of iort boost are outlined in table 1 . there were t1 and t2 tumors in 117 and 29 patients , respectively , and n0 , n1 , and n2 diseases in 111 , 26 , and 12 patients , respectively . the used iort - applicator sizes ranged between 25 and 40 mm in 79% of the patients . iort boost radiotherapy was combined with oncoplastic principles for partial mastectomy reconstruction as follows : glandular rotation ( n = 109 ) , dermoglandular rotation ( n = 29 ) , and tumor - adapted reduction mammoplasty ( n = 11 ) . seroma formation 4 weeks after oncoplastic surgery and iort boost was only observed in 2% . to achieve low short - term complication rates ( i.e. , seroma formation ) and good to excellent cosmetic results after breast - conserving surgery and iort with histologically proven tumor - free resection margins of at least 10 mm in the targit - a trial in europe , there is a need for oncoplastic breast surgery from a surgical and cosmetic perspective . despite the new international guidelines in breast - conserving surgery that adequate local surgery is achieved when tumor is not touching ink , there is a rationale for a breast - surgery concept we termed targeted oncoplastic breast surgery . depending on localisation , size of the tumor compared to the size of the breast , and skin involvement , we predefined five principles for partial mastectomy reconstruction [ 17 , 18 ] . the outcome of early breast cancer is depending on a combination of tumor biology , tumor burden , and adequate adjuvant local and systemic therapy in a multimodality treatment strategy . from our perspective , to achieve an optimized outcome in early breast cancer , iort as a boost with additional whole - breast irradiation or as a single dose should be combined with this concept of targeted oncoplastic breast surgery and evidence - based adjuvant systemic treatment . the data from targit - a and eliot reinforce the conviction that intraoperative radiotherapy during breast - conserving surgery is a reliable alternative to conventional postoperative fractionated irradiation , but only in a carefully selected population at low risk of local recurrence . since recurrence can occur after a considerable time delay , final assessment of iort will only be valid after sufficient follow - up from the prospective randomised trials . until then , a single iort dose should be considered experimental . according to national guidelines in our institution , only iort boost followed by whole - breast irradiation is performed routinely outside a clinical trial . to overcome early and late side - effects and to achieve an optimized aesthetic outcome , iort boost is performed after segmental resection in a concept of targeted oncoplastic breast surgery on a routine basis in our institution .

breast - conserving surgery followed by whole - breast irradiation is the standard local therapy for early breast cancer . the international discussion of reduced importance of wider tumor - free resection margins than tumor not touching ink leads to the development of five principles in targeted oncoplastic breast surgery . iort improves local recurrence risk and diminishes toxicity since there is less irradiation of healthy tissue . intraoperative radiotherapy ( iort ) can be delivered in two settings : an iort boost followed by a conventional regimen of external beam radiotherapy or a single iort dose . the data from targit - a and eliot reinforce the conviction that intraoperative radiotherapy during breast - conserving surgery is a reliable alternative to conventional postoperative fractionated irradiation , but only in a carefully selected population at low risk of local recurrence . we describe our experiences with iort boost ( 50 kv energy x - rays ; 20 gy ) in combination with targeted oncoplastic breast surgery in a routine clinical setting . our experiences demonstrate the applicability and reliability of combining iort boost with targeted oncoplastic breast surgery in breast - conserving therapy of early breast cancer .

depression is responsible for an estimated economic cost of more than $ 40 billion annually and has a large impact on quality of life and productivity . it has been ranked as the leading cause of disability and premature death among people aged 18 - 44 years worldwide and is expected to be the second leading cause of disability for people of all ages by 2020 [ 2 , 3 ] . yet it remains underdiagnosed and inadequately treated . only 46%-57% of patients are diagnosed and treated , and only 18%-25% receive adequate therapy [ 4 , 5 ] . there is poor adherence among patients who have been prescribed an antidepressant medication ; approximately 68% fail to fill their medications based on pharmacy dispensing data . furthermore , the sequenced treatment alternatives to relieve depression ( star*d ) trial confirmed that several sequential treatment steps are often needed to obtain remission , and when more treatment steps are required , remission rates decline . only 28%-33% of patients , using the hamilton rating scale for depression and the quick inventory of depressive symptomatology - self - report respectively , remitted after 12 weeks of adequate trial on a single agent ; switching to another agent or augmentation with a second agent was often necessary . the ccm , using care managers , has consistently been demonstrated in numerous studies to be an effective way to manage depression and achieve sustained outcomes compared to usual care . the impact program which used this model also showed its association with high probability of lower healthcare costs in a four year period . in 2008 , the minnesota institute for clinical systems improvement ( icsi ) launched a statewide program using the ccm aimed at improving depression care delivery in primary care settings throughout the state . the depression improvement across minnesota onward to new direction ( diamond ) consists of key elements that include a systematic way of screening for depression and tracking treatment response by using the patient health questionnaire-9 ( phq-9 ) , use of care managers working collaboratively with primary care physicians , use of a psychiatrist consultant who provides supervision to the care managers and makes recommendations to primary care providers , and inclusion of a registry . the initiative chose to adopt the phq-9 , a well - validated tool that can be used both to screen for depression and track treatment response in primary care practices [ 11 , 12 ] . in march 2008 as part of the icsi initiative , the diamond model was implemented at mayo family northwest clinic in rochester , minnesota . patients aged 18 and above with a phq-9 score of 10 or higher were eligible for enrollment in the program by their primary care providers . the care manager additionally administered the mood disorder screening ( mds ) , gad7 and audit screening tools at the time of enrollment . those who scored positive in mds were excluded and were referred directly to a psychiatrist . eligible patients who chose to participate were then followed by care managers under the supervision of a psychiatrist who provided consultative recommendations to the primary care providers . the model was subsequently adopted at a second mayo site in september 2008 and rolled out to the remaining primary care sites in march 2010 . this study compared the pattern of antidepressant medication utilization between eligible patients who were managed under the ccm , using care managers , and those meeting criteria for diamond but were managed under usual care . we hypothesized that the utilization of antidepressant medications among patients with depression managed under the ccm would be different from usual care ; those in ccm would be more likely to remain on medications or have changes in medications than those in usual care . from march 2008 until march 2009 , data were abstracted from medical records of patients who received a diagnosis of depression defined as a screening score of 10 or greater on the phq-9 , had given permission to have their records reviewed , and had at least a 6-month follow - up . medication utilization data were extracted from clinical notes ( medication list / admission medications ) within 2 days of the index date , defined as date of diagnosis , and 6 months after the index date . abstraction was done using sas version ( sas institute inc . , cary , nc ) which was programmed to connect to the clinical notes . data was matched with the diamond registry and the pattern of antidepressant medication utilization among patients with depression enrolled in the ccm was compared to those under usual care . there were 333 patients who met study criteria ; of those patients , 242 were enrolled under ccm and 91 were enrolled in usual care . the mean age of patients was 39 years with 75% being women , 90% caucasian and over 50% married . there was no statistical difference in demographics ( age , gender , race , ethnicity , marital status , comorbidity , initial phq-9 score ) between the two groups . fifty percent ( n=121 ) of patients enrolled in ccm had been on an antidepressant medication prior to enrollment ; citalopram was the most commonly prescribed agent . at 6 months , the mean phq-9 score of those enrolled in ccm was statistically lower compared to those in usual care ( 4.44 vs. 7.13 ; p = 0.002 ) . likewise the mean difference in phq-9 score from baseline was also greater among those in ccm compared to usual care ( table 1 ) . those patients who were followed under ccm had significantly greater utilization of antidepressant medications at the end of 6 months ( p < 0.001 ) . they likewise had more change in the number of medications from the index point or at the time of ccm enrollment to 6 months ( p = 0.006 ) as well as from pre - ccm enrollment to 6 months post enrollment ( p < 0.001 ) . more patients were switched to a different antidepressant medication at the time of ccm enrollment compared to usual care but the number is not statistically significant ( table 2 ) . at 6 months , one - third of the patients in both ccm and usual care were on citalopram ; sertraline and bupropion were the two other most commonly used medications . a subset analysis of patients aged 65 years and older ( n=35 ) showed no statistically significant difference in mean phq-9 score at 6 months ( p = 0.59 ) and antidepressant medication utilization ( p = 0.29 ) . the ccm has been shown in various studies and systematic reviews to be consistently effective in depression management , both in achieving and maintaining remission . those patients under ccm showed a statistically significant decrease in the mean phq-9 score at 6 months when compared to patients under usual care . the initial mean phq-9 score of those in ccm was 15.12 ; this decreased to a mean score of 4.44 at 6 months ( 71% reduction ) . the 6-month mean score also reflects remission which is defined as a phq-9 score of < 5.0 . although patients in usual care showed treatment response at 6 months with a decrease in mean phq-9 score of at least 50% ( mean score of 7.13 ) , the mean difference in mean score reduction was significantly greater among those in ccm . the study accepted the hypothesis that antidepressant medication utilization between the two groups ( ccm and usual care ) would be different . patients followed under ccm had significantly higher medication utilization when compared to those in usual care . at 6 months , the ccm group also had more change in medications from the index date compared to the usual care group . this observation would correlate to the close follow - ups and more aggressive medication adjustments that occur under the ccm . the star*d trial demonstrated that simply starting patients on antidepressant medications without care coordination only helped a third of these patients ; medication adjustment and changes in response to patients symptoms are hard to coordinate in usual practice . under ccm , the care managers can bring forward treatment response issues to the attention of both the primary care physicians and collaborating psychiatrist so appropriate adjustments or changes can be made . prior studies have also shown that depression care management can lead to significantly lower depression scores and a higher rate of antidepressant adherence when compared to usual care [ 14 , 15 ] . treatment adherence was not specifically analyzed in this study and may be worthwhile to evaluate along with other factors that are associated with a higher treatment response rate in ccm . interestingly , no difference in both 6-month phq-9 scores and medication utilization was seen in the subset of patients aged 65 years and older . the number of eligible subjects ( n=35 ) in this age group is too small to account for any difference in findings . it was conducted among community dwellers , mostly white , who were followed at an academic institution in midwestern united states . medication utilization data were abstracted from patients records and would not reflect prescription filling patterns which could be captured from a pharmacy - based registry data . the study likewise did not take into account adjuvant psychotherapy which could impact medication usage . the secondary outcomes of 6 month response and remission rates were obtained by comparing initial and follow - up phq-9 scores . while this is a well - validated depression tool particularly among primary care practices , it may over - estimate clinical response over a time course . a previously reported study had shown treatment superiority of a collaborative program for depression among high utilizers in primary care as compared to usual care at six months with use of patients self assessment tool such as the phq-9 but no significant difference between treatment groups when a physicians clinical assessment tool such as the hamilton depression rating scale ( hamd-17 ) was administered . however , since the adopted model primarily relied on telephone based follow - ups by the care manager and patient encounters with their primary care physicians , use of the phq-9 was most appropriate . in conclusion , the ccm for depression management is associated with greater antidepression medication utilization compared to usual care . it is also statistically significantly associated with a greater reduction in phq-9 scores at 6 months and remission when compared to usual care .

depression poses a significant economic and health burden , yet it remains underdiagnosed and inadequately treated . the star*d trial funded by the national institute of mental health showed that more than one antidepressant medication is often necessary to achieve disease remission among patients seen in both psychiatric and primary care settings . the collaborative care model ( ccm ) , using care managers , has been shown to be effective in numerous studies in achieving sustained outcomes in depression management compared to usual care . this model was adopted in a statewide depression treatment improvement initiative among primary care clinics in minnesota , which was launched in march 2008 . in this study , records of patients who were enrolled in ccm from march 2008 until march 2009 were reviewed and compared to those under usual care . patients who were followed under the ccm had a significantly greater number of antidepressant medication utilizations when compared to those under usual care . after 6 months , mean phq-9 score of patients under ccm was statistically lower than those in usual care . there was no significant difference in both mean phq-9 scores at 6 months and antidepressant utilization between the 2 groups among patients aged 65 years and older .

the objective of our study was to determine possible tse occurrence in cervids from germany from 2002 to 2005 . our target species were the 3 main cervid species , roe deer ( capreolus capreolus ) , red deer ( cervus elaphus elaphus ) , and fallow deer ( dama dama ) . since tse in young animals is unlikely ( 7 ) , only adult animals ( age > 18 months ) were studied . the target population of our 3-year study was 3,492,000 roe deer , 181,000 red deer , and 157,000 fallow deer ( table 1 ) . the population size was estimated by assuming that the annual hunting bag ( number of animals killed each year ) represents approximately one third of the population , that age distributions in the hunting bag correspond to those of the deer population , and that the annual population sizes before hunting did not change during the study period . these assumptions correspond to management regulations for hunting ( 2 ) . during the 20022003 hunting season , 1,117511 roe deer , 60,407 red deer , and 52,240 fallow deer were killed in germany ( 2 ) . on the basis of these data , the hunting bags of cervids > 18 months for the 3-year study period were estimated at 2,095,000 roe deer , 109,000 red deer , and 94,000 fallow deer ( table 1 ) . * tse , transmissible spongiform encephalopathy ; mpl , minimum prevalence level ( upper limit of the percentage of positives in the population , given no positives found in the sample ) ; hb , hunting bag ( cervids > 18 months estimated for the 3 study years ) ; eps , estimated population size ( cervids > 18 months in the 3 study years ) . data analysis was possible for 6,440 animals ; information on risk factors was lacking in 616 cases . the target region was all of germany ; the 323 administrative districts of germany were our sampling areas ( figure ) . within these districts , samples were taken from different hunting areas to ensure including as many local deer populations as possible . however , the hunting areas are not necessarily identical to home ranges of deer populations . as cwd in north america tends to occur focally , this strategy was chosen to ensure that potential foci would not be missed . distribution of free - ranging roe deer , red deer , and fallow deer tested for transmissible spongiform encephalopathies that shows the risk for each district where samples were obtained . , samples originating from a district without any risk attributes ; , samples originating from a district where bse incidence in cattle was higher than average bse incidence in germany ; , samples originating from a district with occurrence of scrapie in domestic sheep ; , samples from red deer originating from a district with high red deer density ; , fallow deer samples originating from a district with high fallow deer density ; n , number of samples from each federal state . samples came from 14 ( 88% ) of the 16 federal states ( 2 missing states are 2 major cities with almost no deer population ) and from 280 ( 87% ) of the 323 german administrative districts . accordingly , we defined 2 risk categories for each species , an increased risk and a normal risk category . animals were considered to be at increased risk for tse if > 1 of the following conditions applied : 1 ) bse incidence in cattle ( also relating to their parentage ) in the district was higher than the average bse incidence in germany , 2 ) scrapie occurred in sheep in the district , or 3 ) fallow deer or red deer were distributed in districts with high density . if the disease were endemic , this method would be more likely to detect it in these areas . moreover , special sampling efforts were directed toward animals that showed cachexia and central nervous system disorders and animals that were found dead . because we expected low prevalence or lack of tse in our target population we wanted to ensure that our sample sizes were adequate to detect tse even at a prevalence of 0.5% for cervids at increased risk and 1% for cervids at normal risk with 95% confidence . the respective sample sizes were calculated by using the approximation formula of the hypergeometric distribution ( 9 ) . data analyses were performed on the basis of the hunting bag as well as on the estimated population of cervids > 18 months of age in the 3-year study period ( table 1 ) . for each sample , we retrospectively calculated the minimum prevalence level ( mpl ) . mpl is an upper limit to the percentage of positives in the population if no positives are found in the sample ( 9 ) . it represents the detection threshold below which the survey can not detect a tse infection at the 95% confidence level . foresters , hunters , and game farmers submitted the heads of 7,056 free - living and 248 captive deer that had been hunted , found dead , or suspected of having disease . samples from free - living deer were obtained from 280 ( 87% ) of the 323 german districts . samples from captive deer originated from 43 of 6,000 german deer farms and from 12 of 16 federal states . data from collected deer included species , age ( estimated on tooth patterns ) , sex , location of kill , and health status ( table 2 ) . brain stem ( obex region ) and medial retropharyngeal lymph nodes were tested for tse by platelia bse enzyme - linked immunosorbent assay ( bio - rad laboratories gmbh , munich , germany ) according to manufacturer s instructions ( 1,11 ) . , male cervids appear to be at higher risk for chronic wasting disease than sympatric females ( 10 ) . animal came from a district where bovine spongiform encephalopathy ( bse ) incidence in cattle was higher than the average bse incidence in germany ( true for all target species ) . animal came from a district with occurrence of scrapie in sheep ( true for all target species ) . fallow deer distributed in districts with high fallow deer density or red deer distributed in districts with high red deer density . cachexia and # an animal was allocated to the normal risk category if none of the above risk factors applied . * * animals ( n = 616 ) with unknown risk attributes were not included in risk analysis . protease - resistant prion protein ( prp ) was not detected in any samples from free - living roe deer ( n = 4,250 ) , red deer ( n = 1,416 ) , or fallow deer ( n = 1,390 ) . regarding the different risk categories , data analysis was possible for 6,440 animals ( table 1 ) . mpls for the 3-year populations differed by no more than 0.001% from those calculated for the hunting bags . all 248 captive cervids were negative for tse ( table 2 ) . because of the small sample size , mpls of 1.39% for fallow deer ( n = 214 ) and 9.81% for red deer ( n = 29 ) were accordingly high . eighty - seven percent of all german districts were covered by our investigation ( figure ) . recent data show that cwd prevalence in mule deer varied , depending on whether samples had been collected in biologically relevant units or in administrative jurisdictions ( 10 ) . for logistic reasons , however , we ensured that within each district , samples were derived from different hunting areas so that potential tse foci would not be missed . moreover , our findings were below the targeted minimum prevalence levels of 0.5% for cervids at increased risk ( table 1 ) . the overall cwd prevalence observed in free - living cervids in disease - endemic areas of colorado and wyoming is 5% for mule deer ( odocoileus hemionus ) , 2% for white - tailed deer ( o. virginianus ) , and < 1% for elk ( cervus elaphus nelsoni ) ( 7 ) . in wisconsin , where cwd only occurs focally , an overall prevalence of 0.62% was detected in free - living white - tailed deer ( 12 ) . in our study , we reached lower detection limits . if cwd or any other tse were present in our target population in germany at a minimum prevalence of 0.15% to 1.02% , depending on the species and risk category analyzed , we should have detected > 1 infected animal with a 95% probability ( 8) . as no prp was detected , our study does not indicate that tse is present in free - living cervids in germany . even if tse occurs in german cervids , it is not widely distributed . the negative results seen with captive cervids in our study are of limited significance , since the sample size was small . here apart from surveillance , more experimental research on transmission of tse is required ; we have not resolved whether european deer species are susceptible to cwd or other tse ( 1 ) . as with all prion diseases , a species barrier seems to exist for cwd ( 1 ) ; moose ( alces alces ) and caribou ( rangifer tarandus ) have not been found naturally infected with disease , even in cwd - endemic areas ( 1,13 ) . a higher risk for cwd can be assumed for red deer since they belong to the same species as elk ( 1 ) . bse was only observed in different species from the families bovidae and felidae in zoos ( 14 ) but not in members of the family cervidae , even though they were most likely also exposed to bse - contaminated food ( 6 ) . our study indicates that tse is unlikely to exist in free - living cervids from germany and that the risk for tse transmission to humans from eating venison is low .

an active survey on transmissible spongiform encephalopathies was performed from 2002 to 2005 on 4,255 roe deer , 1,445 red deer , and 1,604 fallow deer in germany . all cervids tested negative . this survey has been the largest in european wildlife and provides no evidence of prion diseases in free - living german cervids .

focal segmental glomerulosclerosis ( fsgs ) is one of the most common causes of proteinuric kidney disease that eventually progresses to the end - stage renal failure . molecular studies revealed a central role of glomerular podocyte damage in the development of fsgs.1,2 a growing number of proteins , expressed by podocytes , contributing to the structure and function of the slit diaphragm ( eg , nephrin ( nphs1 ) , podocin ( nphs1 ) ) , cytoskeleton ( eg , alpha - actinin 4 ( actn4 ) ) and/or podocyte signaling ( eg , inverted formin 2 ( inf2 ) , wilms tumor protein 1 ( wt1 ) , trpc6 ( trpc6 ) , plce1 ( phospholipase c epsilon 1 , plce1 ) ) , cause fsgs when mutated.1,2 the lack of cd2-associated protein ( cd2ap ) in mice results in severe congenital nephrotic syndrome : cd2ap mice die of massive proteinuria shortly after birth , and cd2ap mice present glomerular disease at nine months with a kidney histology that mimics human fsgs.3 the renal phenotype of cd2ap - deficient animals is rescued by podocyte transfection with cd2ap.4 in spite of the clear association of cd2ap defects with a glomerular pathology reminiscent of fsgs in mouse models , little is known about cd2ap in humans . kim et al described one heterozygous nucleotide variant resulting in an aberrant cd2ap splicing in two patients with idiopathic fsgs.3 the protein product of this variant message would lack > 80% of the cd2ap protein . lwik et al described a patient affected by early onset nephrotic syndrome with a cd2ap homozygous mutation ( p.r612x ) , resulting in a premature stop codon yielding a slightly truncated protein ( by only 4%).5 the boy was born of consanguineous parents of mediterranean ancestry , each of whom was unaffected and carried the mutation in heterozygous state , indicating that heterozygosity for this mutation does not result in kidney disease . three additional heterozygous mutations in cd2ap ( p.k301 m , p.t374a , p.delglu525 ) were found in three unrelated italian patients with idiopathic fsgs.6 two recently identified mutations in cd2ap ( ivs13 - 137 g > a , ivs7135 g > a ) are likely fsgs - causing dna variants.7 overall , the mutations described so far remain unique , so it is still uncertain whether cd2ap mutations have a real clinical impact in causing an inherited form of fsgs in man . in this study , we report a german patient with steroid - resistant fsgs and identified a heterozygous cd2ap mutation ( p.t374a ) , which was previously identified in an unrelated italian patient with fsgs.6 our results show that a unique heterozygous cd2ap mutation ( p.t374a ) occurs independently in two different patients / families with fsgs , supporting the idea that p.t374a is likely a pathogenic mutation and the overall concept that cd2ap - associated nephropathy is an autosomal dominant form of fsgs in man . the 32-year - old patient presented with a nephrotic syndrome ( proteinuria > 3.5 g / day ) at the age of 28 . he had swellings around his eyes , swollen ankles and feet , and foamy urine . there was no remarkably deteriorated kidney function at the point of initial presentation ( serum creatinine , 110 mol / l ; estimated glomerular filtration rate ( egfr ) 77.7 ml / minute ) . he successfully completed 10 years of middle school education and a three - year apprenticeship ( berufsschule ) as a carpenter . the patient reported that his mother and his only brother also have a kidney disease . otherwise , his family history is not remarkable . blood samples or clinical reports of his relatives are not available because he lost all contacts with them . never theless , the family history is consistent with an autosomal dominant pattern of the disease . 1 ) . therapy with steroids was performed over a six - month period with a transient clinical benefit . concomitantly , the patient received anti - proteinuric therapy with an angiotensin - converting enzyme inhibitor ( ramipril , 10 mg / day ) . because of the relapse of proteinuria ( > 3.5 g / day ) , he received a repeated kidney biopsy , which also confirmed fsgs . neurological examination showed a remarkable cognitive decline within five years of his initial presentation . interestingly , one physician initially suspected an alcoholic etiology of the cognitive impairment in our patient , but a more detailed examination of the patient s behavior and social environment by his local nephrologists , neurologist , and assisted living staff revealed this etiology to be rather unlikely . after five years of initial presentation , the patient s mini mental state examination score was 21 out of 30 . mutational analysis revealed a heterozygote p.t374a , c.1120 a > g mutation in cd2ap ( fig . the mutation is located in the coding region of the proline - rich domain of cd2ap ( fig . the same mutation was previously identified in a patient with histology - proven fsgs , who developed nephrotic syndrome at early childhood similar to other patients with cd2ap - associated nephropathy ( table 1).6 we did not find mutations in other known fsgs genes causing autosomal dominant fsgs , including trpc6 , actn4 , and wt1 ( nphs4 ; exons 8 und 9 ) . in inf2 , we found a small deletion ( 6 bp ) in exon 8 , which results in a deletion of two amino acids ( p.ppl > l ( 427429 ) ) . small deletions in this gene region are reported in nhlbi exome sequencing project exome variant server tmp_esp_14_105173884 , but not in human genome mutation database ( hgmd pro ; www.hgmd.cf.ac.uk ) or ensembl ( www.ensembl.org ) . the significance of this deletion is unknown but is not predicted to be pathogenic by sift8 and mutationtaster9 predictions algorithms . subsequently , a therapy with steroid ( prednisolone , 5 mg / day ) and low - intermediate doses of cyclosporine a ( csa ; trough levels , 1530 g / l ) was performed . serum creatinine levels and egfr reached a plateau and did not decline during this treatment ( fig . dna was isolated from peripheral blood leukocytes , using a commercially available dna isolation kit : ez1 dna blood 200-l kit , qiagen ez1 dna blood card , as suggested by qiagen supplementary protocol . the amplification of trpc6 ( genbank accession number , ensembl transcript i d enst00000344327 ) , actn4 ( enst00000252699 ) , wt1 ( enst00000332351 ) , cd2ap ( enst00000359314 ) , and inf2 ( enst00000392634 ) exons was performed by the polymerase chain reaction ( pcr ) . the pcr products were analyzed with abi 3100-avant genetic analyzer ( applied biosystems ) by bigdye terminator reaction according to the supplier s instructions ( abi prism bigdye terminator cycle sequencing ready reaction kits version 1.1 ; applied biosystems ) . the sequences were analyzed by sequence pilot program with the seqpatient v.3.5.2 module ( jsi medical system gmbh ) . mutations in cd2-associated protein gene ( cd2ap ) have been identified in patients with fsgs ( table 1 ) . however all previous reports describe the sequence variations / mutations of cd2ap in individuals of unrelated families . however , there are no reports on unrelated patients who have any of these known mutations and fsgs . in addition , there is no proven effective therapy for cd2ap - associated nephropathy . ours is the first case of cd2ap - associated nephropathy associated with a sequence variation ( p.t374a , c.1120 a > g ) , which was previously reported for another , unrelated patient with this disorder.6 of note in the study by gigante et al , the patient presented overt proteinuria with nephrotic syndrome at pediatric age . as known for other cases of cd2ap - associated nephropathy,5,6,10 his nephropathy showed a high degree of resistance to steroids , but definitive data on progression to end - stage renal failure are not available . clinical data of his family members were not available to determine cosegration of this mutation with the phenotype.6 in contrast to the patient in gigante et al , our patient developed overt proteinuria at the adult age ( table 1 ) . accordingly , the p.t374a mutation is now the first sequence variation of cd2ap found in two unrelated patients / families with fsgs , which consolidates the idea that this mutation is a likely pathogenic mutation causing fsgs in humans.11 moreover , our findings support the concept that haploinsufficiency in cd2ap can cause fsgs in humans . in the 1000 genomes browser , the p.t374a is reported in < 0.5% of population , but clinical data are missing . the mutation ( c.1120 a > g ) produces an a - to - g nucleotide change in exon 12 , resulting in the substitution of threonine 374 with alanine ( p.t374a).6 it is a missense mutation localized in the proline - rich domain containing three core pxkp motifs that act as binding sites for the sh3 domain of other podocyte proteins . multiple alignments of amino acid sequences showed high conservation of thr-374 across animal species.6 together , the present data support the view that cd2ap p.t374a is likely a fsgs - causing mutation in humans . our patient is the first patient with cd2ap - associated nephropathy treated with low - dose steroids and low - intermediate doses of csa . although definitive data on the progression to advanced stage renal failure are not available , this reduction in proteinuria is remarkable . we believe that our report may be useful for nephrologists who treat patients with cd2ap - associated nephropathy . our data indicate that csa is a therapeutic option for patients with cd2ap - associated nephropathy . on the other hand , the csa response may explain why only very few patients with cd2ap - associated nephropathy have been identified so far.12 genetic testing is usually performed in patients with kidney disease who are distinct from these clinical features , namely patients with therapy - resistant fsgs and a positive family history . interestingly , myo1e- and plce1-associated nephropathies are the only hereditary kidney diseases known to respond to treatment with csa.13,14 the mechanism is unknown , but there is evidence that csa may exhibit protective effects in podocytes by blocking synaptopodin dephosphorylation15 and the loss of cd2ap.16 our patient displayed mild dementia in young adulthood , a phenotypic characteristic not previously associated with cd2ap - associated fsgs . it is not clear whether this feature represents a typical characteristic of those patients in adulthood or not . the majority of patients with cd2ap - associated nephropathy had onset of renal symptoms before five years of age ( table 1 ) , and there is no information about their intellectual capabilities at an adult age . it is important to know whether cognitive impairment will also develop in patients with childhood - onset , cd2ap - associated nephropathy later in life . of note , common variants at cd2ap are associated with alzheimer s disease,17 which may indicate that cd2ap mutations can be associated with or cause cognitive impairment . nevertheless , we can not rule out with absolute certainty that other factors could have caused or contributed to our patient s mild dementia . in conclusion , the results highlight the impact of cd2ap mutations also in adulthood proteinuric disease . from the clinical point of view , the genetic testing of cd2ap should be considered in adulthood steroid - resistant nephrotic syndrome / fsgs . our case shows that cyclosporin a is a treatment option for fsgs in p.t374a cd2ap - associated nephropathy . supplementary figure 1 . arrow a shows a glomerulus with normal capillary loops , regular thickness of mesangial matrix and peripheral capillary basement membrane , and flat podocytes . arrow b shows a glomerulus with segmental glomerular sclerosis . this glomerulus shows the loss of capillary lumen and the adhesion of sclerotic lesions to the bowman s capsule . no mesangial and endothelial hypercellularity , no activated podocytes . chronic unspecific inflammation accompanying with interstitial fibrosis and tubular atrophy ( pas 200 ) .

mutations in cd2-associated protein ( cd2ap ) have been identified in patients with focal segmental glomerulosclerosis ( fsgs ) ; however , reports of cd2ap mutations remain scarce . we performed sanger sequencing in a patient with steroid - resistant fsgs and identified a heterozygous cd2ap mutation ( p.t374a , c.1120 a > g ) . our patient displayed mild cognitive decline , a phenotypic characteristic not previously associated with cd2ap - associated fsgs . his proteinuria was remarkably reduced by treatment with cyclosporine a. our findings expand the genetic spectrum of cd2ap - associated disorders and broaden the associated phenotype with the co - occurrence of cognitive decline . our case shows that cyclosporin a is a treatment option for cd2ap - associated nephropathy .

metabolic encephalopathies are among one of the common causes of admission to hospital in the elderly age group . depending on the severity and rate of development of hypercalcemia , patient can present with mild drowsiness to coma . in more than 90% of cases , hyperparathyroidism is the cause ; however , in an emergency setting , malignancy related hypercalcemia is the commonest cause . milk alkali syndrome ( mas ) can cause acute , subacute or chronic hypercalcemia , which has been reported as early as in 1923 , though the term mas was coined in 1949 . though it became uncommon after some time , recently it has witnessed resurgence after increased general awareness about osteoporosis and overuse of calcium carbonate and vitamin d. injection teriparatide is known to cause transient hypercalcemia up to 6 hours of its administration ; severe hypercalcemia causing encephalopathy is not known . here , we report a case of hypercalcemic encephalopathy caused by mas in which a permissive role was played by injection teriparatide and other factors . an 82-year - old male presented to emergency with history of sudden onset with gradual deterioration of mental sensorium of 8 days duration . other history elicited from attendants revealed that the patient suffered from low impact fracture of third and fourth lumbar vertebrae 3 months back for which he was evaluated and found to have osteoporosis ( l1l4 vertebrae : t - score 3.1 , z - score 1.1 ; femur neck : t - score 3.0 , z - score 0.7 ) . during evaluation , he was detected to have prostatic carcinoma for which he was being treated with depot preparation of injection treptorelin acetate [ gonadotropin - releasing hormone ( gnrh ) analogue ] 11.25 mg once in 3 months . he was prescribed oral calcium carbonate 500 mg thrice daily and cholecalciferol 60,000 u monthly . however , the patient was consuming 56 tablets of calcium carbonate ( each tablet containing 500 mg elemental calcium ) and his diet consisted of milk ( 1.5 l / day ) and plenty of curd . he was started on injection teriparatide 20 g daily 10 days back in view of severe osteoporosis . at this time , his serum calcium ( 9.9 mg / dl ) , phosphorus ( 3.8 mg / dl ) and 25(oh ) vitamin d ( 84.4 ng / ml ) levels were normal . he had limited physical activity in view of his age and disability . on examination , he had normal vital parameters with normal systemic examination except drowsiness and disorientation . investigations revealed hypercalcemia ( serum calcium 14.3 mg / dl ) , normal phosphate levels ( 3.1 mg / dl ) , normal alkaline phosphatase ( 174 u / l ) , acute kidney injury as evidenced by raised serum creatinine ( 2.3 mg / dl as compared to basal creatinine levels of 0.9 mg / dl ) , metabolic alkalosis ( ph 7.56 , hco 39 meq / l , paco2 47 mm of hg ) and hypokalemia ( serum potassium 2.3 meq / l ) . his serum parathyroid hormone ( pth ) level was 7 pg / ml ( 10 - 74 pg / ml ) . he was euthyroid [ t3 1.2 ng/ ml , t4 9.45 g / dl , thyroid stimulating hormone ( tsh ) 4.5 iu / ml ] and eucortisolemic ( cortisol basal 8.3 g / dl , post acth cortisol 24 g / dl ) . he had low serum testosterone levels ( 0.1 ng / ml ) consistent with gnrh therapy . in view of acute hypercalcemia , hypokalemia , metabolic alkalosis , acute kidney injury and history of consumption of 34 g of calcium carbonate daily , he was diagnosed as a case of hypercalcemic encephalopathy due to mas which was probably precipitated by concomitant use of injection teriparatide and immobilization . his drugs ( calcium carbonate and teriparatide ) were stopped and he was started on intravenous forced diuresis with 3 l of normal saline and 40 mg thrice daily injection of frusemide , with monitoring of cardiovascular status . he was also given injection zoledronic acid 5 mg in 100 ml normal saline over 30 min . his clinical and biochemical parameters normalized in 72 hours ( serum calcium 8.6 mg / dl , ph 7.38 , potassium 4.6 meq / l and creatinine 0.7 mg / dl ) . he was discharged after 6 days of hospital stay on vitamin d sachet ( 60,000 u ) once monthly . hypercalcemia has various causes , and in an emergency setting , primary hyperparathyroidism , malignancy associated hypercalcemia and mas constitute most of the cases . our patient was diagnosed with mas on the basis of presence of acute hypercalcemia , hypokalemia , metabolic alkalosis , acute kidney injury and history of consumption of 34 g daily calcium carbonate , with normal phosphate and low pth levels . milk alkali therapy for treatment of peptic ulcer disease was developed by sippy in 1910 . it constituted bed rest of 4 weeks duration and multiple doses of milk and cream with alkali . because of paucity of other treatment options , milk alkali treatment rapidly became standard for treatment of peptic ulcer disease . burnett for the first time named this syndrome of hypercalcemia , hyperphosphatemia , metabolic alkalosis and renal dysfunction as mas . in pathogenesis of mas , old age , pre - existing renal dysfunction , and ingestion of large dose of calcium carbonate are all known to play a role . initially , incidence of mas was reported to be 1015% which subsequently reduced on account of availability of effective alternate therapies for peptic ulcer disease . but the last two decades have seen resurgence of a modern form of mas , where calcium carbonate constitutes the source of calcium and alkali , because many doctors are prescribing calcium supplements due to increase awareness about osteoporosis . modern mas differs from classical mas in absence of male preponderance and presence of near - normal phosphate levels . in the present case secondly , at the age of 82 , his estimated glomerular filtration rate will be compromised ( ~53 ml / min by cockcroft and gault equation ) . however , in our patient with compromised renal function , excessive calcium intake with vitamin d may have predisposed him to the development of hypercalcemia . finally , on initiation of injection teriparatide , he developed sudden worsening of sensorium and severe symptomatic hypercalcemia , along with deterioration in renal function and the biochemical features suggestive of mas . it was initially suspected that with the use of teriparatide , a synthetic analogue of pth , the incidence of hypercalcemia would increase . however , mostly transient and mild hypercalcemia is observed but persistent and severe hypercalcemia has been reported . hence , our patient developed mas secondary to excessive intake of calcium where a permissive role was played by age , immobilization and teriparatide for the development of hypercalcemic encephalopathy . therefore , it is suggested that when teriparatide therapy is begun , particularly in elderly patients who have limited physical activity , daily total , dietary and supplemental , calcium should be maintained at 1000 mg or less , so as to keep the serum calcium below 10 mg / dl .

an 82-year - old male , a known case of severe osteoporosis with vertebral fracture and prostatic carcinoma , was treated with gonadotropin releasing hormone analogue , calcium carbonate , cholecalciferol sachet and injection teriparatide . his diet consisted of milk and curd . he developed altered behavior and generalized weakness , and on investigation , hypercalcemia , hypokalemia , and metabolic alkalosis with low parathyroid hormone levels were detected . injection teriparatide was stopped and he was managed with forced saline diuresis and injection zoledronic acid . he was diagnosed as a case of milk alkali syndrome in whom teriparatide and prolonged immobilization played a permissive role in the development of hypercalcemic encephalopathy .

quantitative nuclear magnetic resonance ( qnmr ) has been widely utilized in pharmaceutical analysis [ 13 ] , natural products characterization [ 4 , 5 ] , and reference substances quality control [ 69 ] . this technique has several advantages including fast sample preparation , no necessity for reference material , and generating both structure information and quantification result in one experiment . currently , most of the qnmr reported are proton qnmr ( h qnmr ) . for some analytes , choosing a suitable internal standard ( is ) is often challenging since the response signals in h nmr are generally from 0 to 15 and signal overlapping occurs easily . when an analyte is mixed with various excipients in medicines or different metabolites in body fluids , the deployment of h qnmr might be impossible due to severe signals overlapping . some groups reported the application of heteronuclear 2d qnmr techniques which can avoid the signal overlapping mentioned previously [ 10 , 11 ] . but these 2d qnmr are time consuming ( more than two hours ) and the results are easily affected by t2 and coupling constant which are generally not a crucial parameter in 1d qnmr . f nmr has been utilized in characterizing fluorine - containing pharmaceutical and metabolites in complicated matrices [ 12 , 13 ] since drug excipients or body fluids barely contain fluorine and do not interfere with analytes . one major advantage of f nmr is that signals in f nmr barely overlap due to its broad response range ( ca . 200 to 100 ) which makes the selection of is in f qnmr much easier than in h qnmr . several groups have reported the deployment of f qnmr in characterizing pharmaceutical [ 14 , 15 ] , metabolites , and biooils . although h qnmr is potentially applicable to any analyte containing proton , the application of this method is limited when analytes are in complicated matrices . and the selection of is should be careful to avoid interference with the analyte . on the contrary , there is no direct comparison of f qnmr and h qnmr such as signal sensitivity , linearity , and rsd . to fully understand the applicable conditions of these two methods , we chose 4,4-difluorodiphenylmethanone which has both hydrogen and fluorine atoms as an is to analyze the content of atorvastatin calcium with both f and h qnmr ( figure 1 ) . directly comparing results from the same analyte and is by different qnmr experiments can avoid the influence of sample purity . besides , the method validation data from both f and h qnmr were also compared . 4,4-difluorodiphenylmethanone was purchased from tci chemicals ( > 99.0% , shanghai , china ) ; atorvastatin calcium was from ranbaxy laboratories ( 94.7% , gurgaon , india ) ; and dmso - d6 was from sigma ( 99.9% , st . 4,4-difluorodiphenylmethanone and atorvastatin calcium were dissolved in dmso - d6 to produce a concentration of about 25 mmol / ml and 8 mmol / ml , respectively . all of the f and h experiments were acquired at 298 k using a bruker ascend 500 m spectrometer with a bbo probe at 470.61 mhz and 500.15 mhz , respectively . for f qnmr , the experiments were under the following parameters : 90 pulse angle , center offset ( o1p ) = 110 ppm , spectral width ( sw ) = 100 ppm , 128 k data points , 16 scans , and relaxation time d1 = 15 s. for h - qnmr , the following parameters were applied : 30 pulse angle , o1p = 6.15 ppm , 64 k data points , 16 scans , and relaxation time d1 = 15 s. data was processed on topspin 2.1 software with 0.3 hz exponential apodization applied to fid . manual phase correction and signal integrations were performed corresponding to the is signals and analyte signals . f nmr shift was adjusted with cf3cooh ( 76.2 ) and h nmr shift was referenced to tetramethylsilane . / nsmsmrar / nrmrmspr100%,where as and ar are the signal response of the analyte and is , ns and nr are the number of spin atoms ( fluorine in f and proton in h qnmr ) in the analyte and is , ms is the molecular weight of analyte ( 1155.4 g / mol ) , mr is the molecular weight of is ( 218.2 g / mol ) , ms and mr are the mass of the analyte and is , and pr is the purity of the is . d1 should be more than 5 times of longitudinal relaxation ( t1 ) to make sure more than 99% of nuclei return to their equilibrium status . t1 of the analyte signals in f and h experiments were found to be 0.86 s and 2.18 s , respectively . t1 of the is in f and h experiments were 1.80 s and 2.97 s. so d1 in both f and h qnmr experiments were set as 15 s to make sure the full relaxation is achieved before next repulsion . transmitter offset ( o1p ) and spectral width ( sw ) are another two important parameters in qnmr experiments . in h qnmr experiments , default o1p ( 6.175 ppm ) and sw ( 20 ppm ) settings worked well . on the contrary , o1p and sw in f qnmr experiments must be manually modified . when default o1p ( 100 ppm ) and sw ( 241 ppm ) were used , the spectrum is difficult to perform phase and baseline correction . in this study , the signals of analyte and is appeared at 111.9 and 104.4 , respectively . meanwhile , it is reported that response signals should not locate at the edge of a spectrum to avoid distortion . here , sw was set at 60 ppm to fulfill the requirement . in h qnmr experiments , signals at 7.5 and 7.4 from the analyte and is , respectively ( figure 2 ) , were chosen for content calculation . meanwhile , wide response range in a f qnmr spectrum makes the selection of is easy and straightforward . generally , any fluorine - containing compound with high purity which does not react with the analyte is eligible as an is in f qnmr experiment . here , the linearity of both methods was measured by using the solutions prepared by dissolving desired amount of analyte and is in one tube . the ratio of calculated analyte mass to added analyte mass was fitted to a linear curve . the correction coefficient showed that both f and h methods had good linearity within 3.2120.34 mg / ml concentration ranges with r > 0.99 . the repeatability experiments were achieved by characterizing six independent solutions containing both analyte and is . the stability of solutions was assessed by analyzing one analyte at 1 , 2 , 4 , 6 , and 8 hours intervals . the results indicated that both atorvastatin calcium and is are stable after 8 hours in solution . loq are calculated as 10/s where is the standard deviation ( sd ) of the y intercepts and s means the slope of linearity curve . it was found that the loq in f qnmr is similar to that from h qnmr . the content of atorvastatin calcium is 93.1% from f qnmr and 95.3% from h qnmr . both f and h qnmr can generate accurate results in determining the content of atorvastatin calcium . for the first time , f and h qnmr were performed and directly compared with the same analyte and is . method validation data showed that f qnmr has similar accuracy , sensitivity , and reproducibility to h qnmr . the quantitative results from the two methods are comparable to that from mass balance measurement . f qnmr is valuable in quantitatively analyzing fluorine - containing analytes which are codissolved with excipients , body fluids , or various metabolites . f qnmr can be widely applied in early drug research and development as well as clinical trials .

quantitative nuclear magnetic resonance ( qnmr ) is a powerful tool in measuring drug content because of its high speed , sensitivity , and precision . most of the reports were based on proton qnmr ( 1h qnmr ) and only a few fluorine qnmr ( 19f qnmr ) were reported . no research has been conducted to directly compare the advantage and disadvantage between these two methods . in the present study , both 19f and 1h qnmr were performed to characterize the content of atorvastatin calcium with the same internal standard . linearity , precision , and results from two methods were compared . results showed that 19f qnmr has similar precision and sensitivity to 1h qnmr . both methods generate similar results compared to mass balance method . major advantage from 19f qnmr is that the analyte signal is with less or no interference from impurities . 19f qnmr is an excellent approach to quantify fluorine - containing analytes .

s third law of motion , every action has an equal and opposite reaction . in clinical orthodontics , different extraoral and intraoral appliances have been used to preserve anchorage during tooth movement.1 however , while appliances like headgears require patient compliance , intraoral noncompliance appliances cause reciprocal tooth movement at the anchor unit.24 since the successful improvements of implant dentistry in the recent years , different bone anchors have made their use possible as anchorage in orthodontics . osseointegrated implants need 36 months before loading.12 the somewhat complicated surgical procedure , discomfort during healing and the time needed for osseointegration are their main disadvantages.13 due to the somewhat complex insertion and healing procedures of osseointegrated implants , some researchers investigated the success of the use of screws as temporary anchorage devices . creekmore and eklund used a vitallium screw below anterior nasal spine for upper incisor intrusion.14 the bone screw remained stable in 1 year period and was removed easily at the end of treatment . researchers like byloff et al,15 karaman et al,11 gelgor et al4 and kircelli et al16 have shown successful results using intraosseous screws for upper molar distalization . screws can be used as direct anchorage unit that is connected directly to the teeth to be moved or anchorage teeth can be stabilized with the screw which acts as an indirect anchorage unit . gelgor et al4 have shown the results of 20 patients that had intraosseous screws used as an indirect anchorage unit to stabilize premolars for upper molar distalization . they used a titanium intraosseous screw , 1.8 mm in diameter and 14 mm in length as an indirect anchorage unit . the screw was placed in the anterior paramedian region of the palatal suture , 5 mm posterior to the incisive foramen and 3 mm lateral to the raphe . upper first premolars were stabilized via a transpalatal arch that was connected to the screw . distal force was applied to upper first molars using sectional arches and open nickel titanium coil springs between the stabilized premolars and upper first molars . according to the results of their study , the mean molar distalization was 3.9 mm with an average tipping of 8.7 in 3 to 6.2 months . despite their success in molar movement , since the screws receive the distalization forces directly , the failure of the screws can not be rare . this case report aims to demonstrate the treatment result of a dental class ii patient using an intraosseous screw for upper molar distalization . the distalization appliance presented here was supported by an acrylic nance button to transmit the distalizing forces to the hard palate as well as the screw . the clinical and radiographic changes of both postdistalization stage and the end of treatment will be presented . a 19 year old caucasian female who had no history of significant medical problems or any family history of hereditary disease referred to our clinic with a chief complaint of upper midline deviation and palatally displaced upper right lateral incisor . extraorally , the patient had a balanced facial profile and she had adequate gingival tissue on full smile ( figure 1 ) . intraorally she had class i canine and molar relationships on left dentition and class ii molar and canine relation on her right dentition . upper midline deviation was 4 mm to the right and lower midline deviation was 2 mm to the right . her left upper first molar had endodontic treatment and she also had big restorations on teeth 16 , and 47 . temporomandibular joint showed no signs of clicks or crepitation , and the facial and masticatory muscles were asymptomatic . cephalometric evaluation showed that the patient had an sna angle of 80.9 , an snb angle of 79.5 , and an anb angle of 1.4 the mandibular plane ( sn - gome ) angle was 25.5 , the position of lower incisors were 22 , and 4 mm relative to the na plane , and the position of upper incisors were 18 , and 4 mm relative to na plane . the upper lip was 5.0 mm behind e plane and the lower lip was 3 mm behind e plane . the nasolabial angle was 110 ( figure 4 ) ( table 1 ) . the pretreatment panoramic radiograph can be seen in figure 5 . the treatment objectives included achievement of a class i molar and canine relationships with distalization of the upper right molar . besides , her low sn - gogn angle and increased overbite would complicate any extractions . therefore the use of an intraoral distalization appliance that was supported by an intraosseous screw was planned . prior to distalization , upper left third molar was extracted . a titanium intraosseous screw ( imf intermaxillary screw , stryker , leibinger , germany ) which is 2.0 mm in diameter and the screw was inserted in the anterior paramedian region of the palatal suture , 45 mm posterior to the incisive foramen and 34 mm lateral to the median line . primary stabilization was assessed with a tweezer intraorally and screw position was checked by occlusal radiographs after insertion . one week after screw insertion , impressions were obtained and a plaster model was prepared . occlusal wires extending to the anchor first premolars were bended from 0.8 mm wire and placed to the model . a self - cure acrylic was placed on to the screw , covering the extensions of the occlusal wires . the appliance adaptation was checked clinically , and the occlusal wires were bonded to the upper first premolars using light - cure composite resin ( transbond xt , 3 m unitek , monrovia , california ) . bilateral sectional arches ( 0.0160.022 inch ) and 0.036 inch nickel - titanium open coil springs were inserted between the first premolar and the first molar with a continuous force of approximately 250 g per side ( figure 6 ) . lateral cephalometric radiograph taken at the end of distalization can be seen in figure 7 . at the end of distalization , a nance appliance was fabricated over the same screw using the method described during fabrication of the initial appliance . total treatment time was 22 months . for retention , an upper hawley retainer and a lower 33 lingual retainer , lateral cephalometric and panoramic radiographs taken at the end of treatment can be seen in figures 11 and 12 . the maxillary first molars were distalized 3.5 to super class i molar relationship in 6 months ( u6-vr distance ) . meanwhile , almost no anterior movement was observed in anchoring first premolars and upper incisor . since force application was carried out via upper first premolars , slight anterior tipping of 3 was observed in upper first premolars . mandibular plane angle decreased 1 ( sn -gogn ) during distalization and this change was still present at the completion of treatment . upper lip was slightly retruded and the lower lip retained its position at the end of distalization . total cephalometric superimposition ( sella - nasion plane at sella ) and local maxillary superimposition ( anterior nasal spine - posterior nasal spine plane at ans ) can be seen in figures 13 and 14 . dental cast measurements showed that both of the upper premolars and first molar were rotated distopalatally . slight expansion was observed in upper first premolar , second premolar and first molar widths ( figure 15 ) ( table 2 ) . despite the successful use of conventional extraoral appliances for years , the need for compliance and their unaesthetic appearance made the need to search for alternatives . the introduction of bone anchors in orthodontics has made a revolutionary change in fulfilling this need . however a majority of the reports were based on records taken at the end of distalization . anchorage preservation during retraction of the anterior segment is also quite important since some amount of the space gained is often lost during this stage . in the present case report , treatment result was evaluated both at the end of distalization and at the end of treatment . implants can be used as direct units for force application of they can be used to reinforce the anchorage teeth . in this case report , the upper first premolars were secured using a nance button to imf screw that was placed in anterior palatal region . gelgor et al4 have used a similar appliance for anchorage reinforcement during molar distalization but the forces in their appliance were transmitted directly to the screw , which might cause the failure of the screws . in this case , the screw was not loaded directly ; an acrylic button was used to reduce the amount of force that the screw received . gelgor et al4 have also found a similar rate of distalization in their controlled study . karaman et al,11 krcelli et al16 and escobar et al17 have also achieved successful distalization results with different appliances that have reinforced their anchorage with the use of a palatally placed screw . the distalization rate found in this case report was also similar to those that were found with conventional intraoral distalization appliances . several authors that have used palatal screws for distalization have placed two screws and reported less tipping values.16,18 therefore we believe that a single screw is only sufficient for cases that need less amount of distalization . the placement and removal of the screws are quite easy and well tolerated by the patients . one major drawback of this kind of appliance is the need for removal of the appliance after distalization of second premolars . the appliance should be replaced with a nance button or a transpalatal arch to free the first premolars and during anterior retraction , if needed . however if a clinician aims to use the same implant supported appliance during incisor retraction , an osseointegrated implant or a zygoma anchorage will be the appliance of choice . this kind of irritation was also reported with the use of a pendulum appliance and a nance button . the ease in placement and removal , the possibility of immediate loading and positive toleration of the appliance by the patient are the main advantages of the appliance . however , long term evaluation after removal of all of the appliances should be made with a controlled clinical study .

the use of implants has made a major change in orthodontic treatment mechanics . they have replaced conventional unaesthetic and compliance dependent extraoral appliances with well accepted intraoral mechanics . implants can be used in molar and canine distalization , intrusion and in extraoral force applications . in the present case report , treatment of a case using an intermaxillary fixation screw ( imf ) will be presented . the treatment results will be evaluated using pretreatment , post distalization and post treatment cephalometric radiographs and dental casts .

a 20-year - old female with extensive terminal ileal and colonic crohn 's disease was initially successfully managed on a drug regimen of prednisolone and mesalazine which helped to induce remission . this maintained her disease remission but was associated with neutropenic sepsis , necessitating the withdrawal of the thiopurine therapy with subsequent clinical and endoscopic disease flare . this required an infusion dose and frequency escalation to maintain clinical response . after 58 weeks of infliximab therapy , the patient was requiring 10 mg / kg 6 times weekly and hence was transferred to the fully human anti - tnf- injection adalimumab for loss of response to infliximab . initially this strategy regained disease control , but due to relapse at 40 mg every other week , the dose was increased step - wise to 80 mg weekly which fortunately maintained remission . during her treatment with adalimumab the presence of purple - coloured plaque - like lesions primarily on her abdomen figure 1 demonstrates the presence of psoriasis which is presumed to be a result of treatment with adalimumab . tnf- has been identified as a key cytokine in the pro - inflammatory pathways that drive diseases such as inflammatory bowel disease and rheumatoid arthritis . anti - tnf- agents such as infliximab and adalimumab are widely used in the treatment of these conditions and have been shown to have an impact on pro - inflammatory and apoptotic pathways . they are also effective in the treatment of the dermatological and rheumatological manifestations of psoriasis . however , there have been a number of cases reported where such agents may be responsible for new onset or worsening of psoriasis . a study of 126 patients who underwent treatment with anti - tnf- inhibitors demonstrated evidence of psoriasis in 76 individuals , palmoplantar pustular psoriasis in 37 cases and psoriasis of the nails in 6 cases . there is mounting evidence that a key innate immune pathway for triggering common human autoimmune diseases , including psoriasis , involves plasmacytoid dendritic cell precursors and type 1 interferon ( ifn ) production . a recent study involving immunohistochemical staining of skin biopsy specimens for myxovirus - resistance protein a ( mxa , a surrogate marker for lesional type 1 ifn activity ) demonstrated increased staining in tnf- inhibitor - induced psoriasis compared with psoriasis vulgaris . research suggests that a psoriasiform eruption during anti - tnf- treatment seems to be a class effect without any confirmed predisposing factors and does not specifically require treatment discontinuation . further studies are however needed to determine the exact mechanism of and appropriate treatment for anti - tnf--induced psoriasis .

anti - tnf- agents are currently utilised for the treatment of a vast array of autoimmune conditions including inflammatory bowel disease , rheumatoid arthritis , ankylosing spondylitis and psoriasis . it is however noted that such therapeutic strategies have been linked to the specific induction of cutaneous - based reactions such as dermatitis , erythema multiforme and psoriasis . here we present the case of a young female patient with crohn 's disease who developed psoriasis following treatment with the anti - tnf- drug adalimumab and highlight the possible pathogenetic mechanisms involved in such an occurrence .

highly active antiretroviral therapy ( haart ) enhances the immune state of immunodeficiency virus ( hiv ) infected patients , by suppressing the replication of hiv . this enhancement in the immune state reduces the risk of opportunistic infections , and thus haart has improved the survival and quality of life of aids patients , and now plays a central role in the treatment of hiv infection . nonnucleoside reverse transcriptase inhibitors ( nnrtis ) , protease inhibitors ( pis ) and nucleoside reverse transcriptase inhibitors ( nrtis ) are widely used for haart . it has also been reported that when antiretroviral drugs , especially nrtis are administered , that they may cause lipodystrophy syndrome due to the abnormal accumulation or diminution of lipid , dyslipidemia , lactic acidosis or even an abnormal glucose metabolism . lactic acidosis , in particular , is a life threatening adverse effect , and has been associated with almost all nrtis , e.g. , with zidovudine ( azt ) or didanosine ( ddl ) . according to recent reports , many cases of lactic acidosis have been attributed to stavudine ( d4 t ) . we present a case of severe lactic acidosis caused by stavudine and include a review of the literature . a 44-year - old woman was admitted to the hospital because of nausea , vomiting and paraplegia of both lower extremities . she was diagnosed as hiv positive in june , 2000 , when she presented with retinal necrosis caused by the varicella zoster virus . subsequently , she was started on zidovudine , lamivudine , and indinavir at a baseline cd4 positive t lymphocyte count of 16/l , a cd8 positive t lymphocyte count of 86/l and a hiv - rna of 1,129,768 copies / ml . subsequently , medication was changed to lamivudine , stavudine , lopinavir / ritonavir in april , 2002 due to leukopenia caused by the zidovudine . she remained on this medication for 8 months , prior to december 2002 , when she stopped the medication 10 days before admission due to the symptoms mentioned above . in january 2000 , the patient was diagnosed with chronic viral hepatitis b. she had no history of hypertension , tuberculosis or dm , and no medication other than antiretroviral drugs had been taken . on admission , the patient complained of general weakness , nausea , vomiting and paralysis of both lower extremities . however , she did not present fever , chills , abdominal pain , constipation or diarrhea . the patient s blood pressure was 110/80 mmhg , pulse rate 80/min , respiration rate 25/min , temperature 36c . conjunctivae were not pale , sclerae were not icteric and cervical lymph nodes were not palpable . on chest auscultation , the liver and spleen were not palpable and no palpable abdominal mass was found by physical examination . muscle strength of both legs had decreased to gii , and there were no deep tendon reflexes ( dtrs ) . a laboratory examination showed a wbc of 6,920/mm ( neutrophils 58.8% , lymphocytes 29.1% , monocytes 6.9% , eosinophils 1.3% ) , a hb of 14.7 mg / dl , a hematocrit of 42.3% , and a platelet count of 159,000/mm . blood chemistry revealed ; calcium 9.5 mg / dl , inorganic p 0.4 mg / dl , uric acid 14 mg / dl , alp 71 iu / l , amylase 48 iu / l , lipase 111 iu / l , bun 6.8 mg / dl , creatinine 0.8 mg / dl , total protein 7.0 g / dl , albumin 4.7 g / dl , ast / alt 71/60 iu / l , total bilirubin 2.7 mg / dl , direct bilirubin 1.7 mg / dl , na / k / cl / tco2 135/3.1/95/8 meq / l , total cholesterol 252 mg / dl , tg 305 mg / dl , hdl - cholesterol 16 mg / dl , ldl cholesterol 157 mg / dl , lactate 10.8 immunochemistry showed positive hbeag , hbv dna 1,321 pg / ml , afp 10.61 iu / ml ( normal 07 iu / ml ) , and cea 0.566 ng / ml ( normal 05 ng / ml ) . the cd4 positive t lymphocyte count was 117/l , the cd8 positive lymphocyte count 687/l , and a hiv - rna level of 133,000 copies / ml . her pregnancy test was negative , as were blood , urine and stool culture . a cerebrospinal fluid examination performed to rule out a central nervous system infection showed no significant findings , and neither did brain mri ( figure 1 ) . a contrast ct scan of the abdomen , performed to rule out intra - abdominal malignancy , showed only a hepatic cyst ( figure 2 ) . arterial blood gas analysis ( abga ) revealed a ph of 7.291 , pco2 12.6 mmhg , po2 142.1 mmhg , sao2 99% , and be - ecf 20.6 . intravenous sodium bicarbonate infusion and conservative treatment were immediately initiated and antiretroviral drugs were stopped . the symptoms of nausea and vomiting subsided on the third day of treatment and from the tenth day , her paraplegia of both legs also started to improve . abga results and lactate levels gradually normalized ( table 1 ) and on the 11 day , abga showed ph 7.474 , pco2 39.9 mmhg , po2 79 mmhg , sao2 96.3% , be - ecf + 5.8 , and lactate 2.9 the patient was discharged on the 14 day without any signs of lactic acidosis . at the time of discharge , total bilirubin after discharge , antiretroviral medications were resumed in the order:- of lamivudine , efavirenz , and lopinavir / ritonavir ; none of the previous symptoms recurred . the patient is still on antiretroviral therapy and is being followed up on an outpatient basis . therapy is considered if the patient is symptomatic or when the cd4 positive t lymphocyte < 350/l or hiv - rna > exceeds 55,000 copies / ml in non - symptomatic patients.for initial therapy , two nrtis are usually used in combination with pis or nnrtis . however , these drugs induce severe complications by also suppressing dna synthesis by mitochondrial polymerase-. zidovudine , the first nrti used in hiv treatment , can cause hepatic steatosis , lactic acidosis and even myopathy . didanosine is also reported to cause adverse effects , such as acute pancreatitis , in addition to those caused by zidovudine . stavudine , a derivative of thymidine , which was the fourth nrti to be used in this case , may cause peripheral neuropathy , lactic acidosis , cardiomyopathy , pancreatitis1 and guillain - barre syndrome.these complications occur due to the depletion of mitochondrial dna caused by the suppression of dna polymerase- , followed by dysfunction of cellular oxidative phosphorylation . in contrast , nnrtis and pis have not been reported to cause such adverse effects of mitochondrial toxicity , which is attributed to their selectivity for hiv reverse transcriptase . the most common complication of nnrtis is skin eruption , other include pis , hyperglycemia and dyslipidemia . lactate is the final product of glycolysis , which in a normal state does not accumulate in the body . however , under circumstances such as oxygen deprivation of tissue or impaired oxidative phosphorylation , hyperlactatemia occurs . since 1991 , when acute hepatic failure and lactic acidosis was first reported to be caused by didanosine , lactic acidosis by nrtis has been was considered as a rare , but fatal complication . the symptoms of lactic acidosis are typically nonspecific , but include fatigue , abdominal pain , vomiting , and weight loss . when such symptoms are accompanied by dyspnea on exertion , it is mandatory that serum lactate levels be measured . the presence of tachycardia at a normal body temperature is highly suggestive of lactic acidosis.since most hiv infected patients are admitted to hospital with such nonspecific symptoms , it is easy to neglect lactic acidosis . although earlier reports have been issued on lactic acidosis due to zidovudine or didanosine , stavudine is frequently the more recent reported cause . since cases of fatal lactic acidosis caused by stavudine and didanosine in pregnant women have been reported , the administration of these drugs during pregnancy is now considered with a high degree of caution . postulated a high possibility of mitochondrial toxicity due to nrtis in pregnant women , because the riboflavin concentration runs low during pregnancy . risk factors of lactic acidosis , other than pregnancy , include female sex , obesity and the duration of nrti therapy . john et al . reported that the majority of hiv - positive patients taking nrtis developed chronic asymptomatic hyperlactatemia ; their average serum lactate concentration was reported to be 1.53.5 mmol / l . the administration of and the duration of exposure to stavudine are reported to be major risk factors of hyperlactatemia and pis or nnrtis were not found to meaningfully affect the development of hyperlactatemia . . a significantly higher incidence of hyperlactatemia was observed in a group of patients treated with stavudine , and no apparent relationship was found between age , gender , cd4 positive t lymphocyte count and the development of hyperlactatemia . furthermore , in many cases , lipodystrophy , dyslipidemia , and hyperglycemia were accompanied with hyperlactatemia . according to the report of yann et al . , the annual incidences of hyperlactatemia were 0.8% and 1.2% in nrtis or stavudine administered aids patient groups , respectively . coghlan et al . reported in their retrospective study of hiv positive patients with lactic acidosis that the majority of patients took stavudine and didanosine . lactic acidosis is accompanied by myopathy , lipodystrophy , fulminant hepatic failure , and pancreatitis in many cases . and , stavudine is reported to cause guillain - barre syndrome5 , demonstrating that nrtis damage multiple organs by depleting mitochondrial dna . treatments for lactic acidosis include ; the immediate discontinuation of medication , conservative treatment and the correction of the acidosis . reported upon the successful treatment of lactic acidosis with riboflavin and l - carnitine , but the effect of this treatment is as unproven . the discontinuation of medication corrects most cases of hyperlactatemia , but the continuation of hyperlactatemia for 176 days has been reported.because our patient had no other causes of lactic acidosis ( infection , shock , malignancy , ischemia or cirrhosis ) and did not take any medication other than the anti - retroviral drugs , the lactic acidosis was ascribed to the nrti . considering that her lactic acidosis developed while she had been taking stavudine , and that the lactic acidosis did not recur while stavudine alone was replaced by efavirenz , a nnrtis , stavudine appears to have been the culprit . since the total bilirubin level of the patient upon presentation was elevated to twice the normal value , it was likely that she had hepatic steatosis . after conservative treatment , however , the bilirubin level recovered to the norm , and so a liver biopsy was not performed . therefore , we could not entirely exclude the possibility of hepatotoxicity due to lopinavir / ritonavir . the following characteristics of the paraplegic symptoms were noted ; first , a symmetric and rapid development . third no predisposing infection preceded , and fourth , the symptoms fully disappeared in two months . according to these findings , the most likely diagnosis is guillain - barre syndrome . although stavudine is suspected to be the likely cause of this guillain - barre syndrome in view of the accompanying lactic acidosis ; however , we could not confirm stavudine as the cause due to the lack of a nerve conduction velocity test . nrti , used in haart , suppresses mitochondrial dna polymerase- driven dna synthesis;. thus , it could possibly cause serious adverse effects , such as lactic acidosis , hepatic steatosis and myopathy . because we experienced this case of lactic acidosis during the administration of stavudine in an aids patient , and this was followed by a subsequent successful treatment , we report this case and include a review of the literature .

nucleoside reverse transcriptase inhibitors ( nrtis ) , which are used for the treatment of human immunodeficiency virus ( hiv ) infection have been associated with a wide spectrum of clinical manifestations , including hepatic steatosis , lipodystrophy , myopathy , and lactic acidosis . such adverse effects are postulated to result from the inhibition of mitochondrial dna gamma polymerase , which causes the depletion of mitochondrial dna and eventual the disruption of oxidative phosphorylation . although cases of severe decompensated lactic acidosis are rare , this syndrome is associated with a high mortality rate . we report upon the first korean case , of severe lactic acidosis in an acquired immunodeficiency syndrome ( aids ) patient receiving stavudine , an anti - hiv drug .

it is formed by the rami of the ischium and the pubic bone . the foramen is partially closed by a strong musculoaponeurotic barrier consisting of an internal and an external obturator membrane and an internal and an external obturator muscle . the obturator canal is situated in the cranial portion of this membrane with the pubic bone above and the membrane below . this tunnel measures approximately 0.2-cm to 0.5-cm wide and 2-cm to 3-cm long through which traverse the obturator nerve , artery , and vein . obturator hernia ( oh ) formation was first described by ronsil in 1724 . although it is considered a relatively rare hernia ( 0.07% of all hernias ) , it is the most common in the pelvic floor ( obturator , sciatic , and perineal ) . three types of obturator hernias have been described based on the anatomical defect that is present . type i oh occurs when preperitoneal fat and connective tissue ( pilot tag ) enter the pelvic orifice of the canal . type ii oh causes dimpling of the peritoneum over the canal , leading to the formation of an empty peritoneal sac . type iii oh occurs on entrance of an organ ( bowel , ovary , or bladder ) that eventually fails to reduce spontaneously . a partial or complete small bowel obstruction has historically been responsible for the diagnosis of most obturator hernias ( 88% of all oh ) . the incidence of oh is significantly higher in females ( 6:1 ) and may be due to their larger foraminal diameter . bowel obstructions from oh are usually in elderly ( average age 70 ) , thin patients . in fact , it has been called the little old lady hernia . however , with the advent of computerized tomography and magnetic resonance imaging , these hernias are being diagnosed more accurately in younger patients before the onset of bowel obstruction . a small proportion of patients may present with chronic pelvic pain and inner - thigh neuralgia . somell later reported a series of 7 patients with oh presenting with chronic pelvic pain in the groin and hyperesthesia over the obturator nerve distribution . a small preperitoneal fat plug was surgically removed from the canal alleviating symptoms in 5 of 7 patients . subsequently , more cases have been reported , and some investigators believe the condition is more common than previously recognized . pilot tags of fat have been reported in up to 64% of female cadaver dissections . the frequency of pilot tags and rarity of obturator neuralgia would suggest that most oh do not progress beyond this first stage . pain in the medial thigh with radiation behind the knee and into the hip is most common . most patients complain of increased pain on exercise , prolonged standing , and prolonged sitting . crossing the legs the physical diagnosis of obturator neuralgia includes the observation of the patient 's abnormal gait and internal palpation of the obturator canal . the neuropathic pain produced by palpating the nerve vaginally or rectally in the obturator canal will duplicate the patient 's symptoms . this is the howshipromberg sign ( figure 1 ) , and it is pathognomic for oh . although it has been reportedly positive in 25% to 50% of patients with type ii and iii oh , all of our patients with neuralgia had a positive response . vaginal compression of either or both divisions of the obturator nerve by the hernia may reproduce pain ( howshipromberg sign ) . used with permission : pelvic pain : diagnosis and management . most techniques described for oh repair involve a laparotomy with reduction of the hernia contents and repair transperitoneally . a retrospective , continuous cohort study of female patients with chronic pelvic pain and signs of type i obturator neuralgia were identified by chart review . median length of follow - up was 11 months ( range , 6 to 16 ) . average age was 36.2 years ( median , 36 ; range , 24 to 48 ) . a 1.5-cm infraumbilical skin incision is made , and the anterior rectus fascia is identified and incised . a tunnel is created under the rectus muscle , and a preperitoneal distension balloon ( surgipro , norwalk , ct ) is inflated . this is replaced after dissection into the space of retzius with a structural balloon device ( u.s . a zero - degree laparoscope is used to place a midline 12-mm port and two 5-mm lateral ports . further blunt dissection is carried out into the paravesical and paravaginal spaces until the tendineus fasciae pelvis is identified . the pilot tag of fat is teased from the obturator canal with its traversing nerve artery and vein ( figure 2 ) . surgical , norwalk , ct ) is inserted through the midline suprapubic 12-mm port , and the mesh is tacked with the spiral tacker ( u.s . surgical , norwalk , ct ) to cooper 's ligament anteriorly , and the tendineus fasciae pelvis posteriorly ( figure 3 ) . other defects can be repaired extraperitoneally at this time , including inguinal and femoral hernias . they were told to usea0to10 visual analog scale and to use 10 as their average pain before surgery . a percentage change in their neuropathic pain patients were allowed to use a score > 10 if their pain was worse than preoperative levels . retrospective estimation of reduction in patients ' pain due to obturator neuralgia * patients used a 0 to 10 postoperative pain scale with 10 as the amount of pain they experienced preoperatively . the small number of patients included in this retrospective study makes meaningful statistical analysis very difficult . therefore , it is best to view these results as a pilot study until the rest of our patients with obturator neuralgia can be followed . all but one patient experienced a greater than 50% reduction in her pain ( 86% ) . this gives a 95% confidence interval ( 56 , 98 ) , which clearly does not contain 0 . further , this interval does not contain 50% , which leads to the conclusion that we have at least 95% confidence that the pain reduction achieved is greater that 50% . realizing the limitations of a small retrospective study , we continue to follow an additional 6 patients with obturator neuralgia who have all improved after the above procedure . many of our patients have multiple pain generators including pelvic floor tension myalgia , interstitial cystitis , and adductor muscle spasm of the thigh . these pain sources are all identified preoperatively and receive the appropriate medical and physical therapy measures . groin , hip , and medial thigh pain due to obturator neuralgia may cause the patient to seek consultation with a gynecologist , orthopedist , or neurologist . unfortunately , most hernias present as type iii with life - threatening bowel obstructions carrying a high mortality rate up to 70% . this caused much disability and unnecessary suffering . with this study , it is hoped that more patients with type i oh and neuralgia will be diagnosed and treated to avoid such high risks . patients with obturator neuralgia , persisting longer than 6 months despite conservative therapy , may respond to laparoscopic reduction of the pilot fat tag and mesh overlay of the obturator canal .

background : we performed a pilot study review of 7 female patients suffering with obturator neuralgia produced by a type i obturator hernia . diagnosis and laparoscopic treatment of this rare hernia are presented.methods:patients with chronic pelvic pain and signs of obturator neuralgia were identified retrospectively by chart review . these patients had been referred to our chronic pelvic pain clinic . outcomes of their surgery from february through november 2001 were analyzed . median length of follow - up was 11 months ( range , 6 to 16 ) . a new technique using cooper 's ligament and arcus tendineus fasciae pelvis was used for the tension - free mesh hernia repair.results:in this pilot study , 6 of 7 patients ( 86% ) received greater than 50% relief of their chronic pelvic pain , which leads to the conclusion that we have at least 95% confidence that the pain reduction achieved is greater that 50% . due to the small sample size , no statistically meaningful conclusions could be reached . all of the patients have reported some pain relief and increased function since surgery.conclusion:symptomatic type i obturator hernias may be more common than previously thought . patients with obturator neuralgia , persisting longer than 6 months despite conservative therapy , may respond to laparoscopic reduction of the pilot fat tag and mesh overlay of the obturator canal .

the classic account , made by dandy & blackfan in 1914 * , where autopsies showed severe hypertentorial hydrocephalus , cystic dilatation of the fourth ventricle , small vermis , removal of the cerebelar hemispheres and absence of the roof of the fourth ventricle , thickening and opacity of the pia - arachnoid cisternae of the skull base and dilatation of the aqueduct1 . the dandy - walker syndrome ( sdw ) is a non - familial syndrome characterized by cystic dilatation of the fourth ventricle and aplasia or partial or total atrophy of the cerebelar vermis . occur other brain malformations such as agenesis of the corpus callosum , heteropsias , lissencephaly , stenosis of the aqueduct of sylvius 2 3 . gardner et al * * proposed that the sdw , along with other syndromes ( arnold - chiari malformation , cerebelar arachnid cyst and syringomyelia ) were manifestations of the same disease1 . some studies show an incidence of approximately 70% of relationship between the sdw and systemic abnormalities1 . little is known about congenital malformations of the posterior pit structures , their genetic alterations have been mapped to chromosome 3q4 5 , but the gene is not located exactly , but it is known that the basis of the development process of the structures of the pit later is nature for human cerebelar malformations5 . it is also known that structures cerebelar growth early embryo in the period until the early post - natal , this event would cerebellum susceptible to a wide spectrum of disorders of development6 . the pathogenesis of this syndrome is controversial , but the most accepted theory is that the leaf development of the foramina of magendie and lushka during the fourth month of fetal life , leading to bulging cystic fourth ventricle . new theories have proposed that the sdw result from a failure to develop the roof of the hindbrain , taking this as a cause teratogenic effect1 . some studies suggest that the use of warfarin in the long run would be responsible for the development of sdw in 1 - 2% of exposed fetuses7 . , showed no relationship between degree of hydrocephalus and the size of the cyst in the posterior pit , vermis or attenuation of the permeability of the fourth ventricle and hydrocephalus in some cases was absent1 . the sdw is an entity of heterogenic hyperplasia of the cerebelar vermis and is a newly identified gene associated with the connection with x - hprt8 also relates to the basal ganglia disease . clinically there may be moderate delayed psychomotor development , microcephaly , hypotonia , but the predominant symptoms refers to hydrocephalus , usually in the first two years of life , this however can be ignored , appearing late ( first or second decade of life)2 3 4 5 6 7 8 9 . some ocular abnormalities are described in the sdw , as coloboma corioretinian10 , nystagmus11 12 13 . there may be mental retardation ( 50% ) , spasticity ( instead of hypotonia ) , seizures , vomiting , all depending on the degree of cerebelar malformation3 . in patients with vermis fissures with two conformations and almost normal brain functions are also almost normal without association with other malformations . in patients with severe malformations of the cerebellum , vermis with only one or no crack , it is common to severe mental retardation and other malformations of the central nervous system , such as agenesis of the corpus callosum . it is divided , so the sdw into two large groups according to the previous malformations for determining the prognosis intellectual12 13 . it is reported in the literature of the coexistence of large facial coetaneous hemangioma with sdw14 . other syndromes where coexist brain and ocular malformations are reported as neuhauser syndrome ( mmmm - megalocornea , macrocephaly , mental and motor retardation ) , which are found cortical atrophy , enlargement of the fourth ventricle , hyperplasia of the corpus callosum . , there is need for magnetic resonance images of good quality axial view of the cerebelar vermis and t2 images12 . the neuroradiological findings are characteristic , such as cystic dilatation of the fourth ventricle and changes in the cerebelar vermis2 , besides others already mentioned . the bilateral sensorineural deafness can be part of the clinical picture of the syndrome and we describe a case whose patient underwent implantation cochlear by presenting profound bilateral deafness . the aim of this paper is to describe a case of female patient , 13 years with a diagnosis of this syndrome and bilateral hearing loss underwent cochlear implant surgery under local anesthesia and sedation . cgs , 13 years old female was referred to the ent department of otolaryngology institute of parana with a diagnosis of dandy - walker syndrome for ent evaluation for bilateral hearing loss with no response to the use of hearing aids . the patient performs follow up with neurology since birth , with a history of gestational rubella , cataracts in both eye and neurological surgery prior hydrocephalus , absence of parental consanguinity . child with imaging exam compatible with dandy - walker syndrome with posterior pit collection and communication with the fourth ventricle , associated with signs of hyperplasia of the cerebelar hemispheres and vermis . was not possible to detect brainstem evoked potentials bilaterally . in the absence of otoacoustic emission response bilaterally mri of the brain showing cerebelar vermis hyperplasia associated with mega cistern magna , communicating with the fourth ventricle ( figures 1 and 2 ) . the fluid spaces of the cochlea are normal thickness , ranging from 1.3 to 1.7 mm the right and 1.4 to 1.7 mm left . the cochlear nerves have been identified and normal thickness of 0.6 mm ( figure 3 ) . surgery was performed under local anesthesia and sedation by retroauricular access , creation of niche outdoor unit , closed mastoidectomy , posterior tympanotomy , chocleostomy , inserting the internal components and telemetry . all steps performed uneventfully . the implant was activated 1 month after surgery with excellent sound perception at the time of activation . the patient has excellent levels of discrimination with less need for lip reading and excellent response to therapy with spectacular mend the quality of speech . no doubt the results bring impact on quality of life of patients while providing better social integration . the field of cochlear implants is growing rapidly due to improved quality of the implants , surgery less invasive , and wider dissemination of this type of treatment of deafness . the surgery is now much faster and less invasive than some years ago , with smaller incisions and less morbidity for the patient . the patient even though the syndrome dandy - walker does not present significant deficit in neuropsychomotor development , fulfilling the criteria established in the literature for the performance of cochlear implant surgery . there are already cases of patients with the same syndrome who underwent cochlear implant surgery , complications described in the literature21 and with good results despite co morbidities . in our facility this type of surgical anesthesia brings morbidity / anesthetic besides a minor post - operative recovery and faster lower hospital costs when compared with general anesthesia and were perfect forward from the patient . we believe that the presence of dandy - walker syndrome can not be considered a contraindication to the performance of cochlear implant surgery , and there were no surgical complications due to neurological disorders with very favorable results for the patient who exhibits excellent discrimination .

summary introduction : dandy walker syndrome is a congenital abnormality in the central nervous system , characterized by a deficiency in the development of middle cerebelar structures , cystic dilatation of the posterior pit communicating with the fourth ventricle and upward shift of the transverse sinuses , tentorium and dyes . among the clinical signs are occipital protuberances , a progressive increase of the skull , bowing before the fontanels , papilledema , ataxia , gait disturbances , nystagmus , and intellectual impairment . objectives : to describe a case of female patient , 13 years old with a diagnosis of this syndrome and bilateral hearing loss underwent cochlear implant surgery under local anesthesia and sedation . case report : cgs , 13 years old female was referred to the otolaryngological department of otolaryngology institute of parana with a diagnosis of dandy - walker syndrome for otolaryngological evaluation for bilateral hearing loss with no response to the use of hearing aids . final comments : the field of cochlear implants is growing rapidly . we believe that the presence of dandy - walker syndrome can not be considered a contraindication to the performance of cochlear implant surgery , and there were no surgical complications due to neurological disorders with very favorable results for the patient who exhibits excellent discrimination . it has less need for lip reading with improvement in speech quality .

temporomandibular joint and muscle disorders are a group of conditions that cause pain and dysfunction in the jaw joint and the muscles that control jaw movement . the movement of the mandible needs coordination between them to maximize function and minimize the damage to surrounding structures . the articular disc between the condyle and the temporal bone serves to separate the structures into two separate joint cavities . in the inferior joint between the head of the mandibular condyle and the articular disc the movement is almost totally of a rotary or hinge type whereas in the superior joint between the temporal bone and the articular disc the movement is gliding or translatory . the origin and homologies of the jaws in all vertebrates were clearly outlined in the last century by gegenbauer , later a definitive statement of this was made by reichert in 1837 known as the reichert theory . fawcett has shown that in man , dermal bones ( as the name implies they directly arise in the dermal tissue ) cover the cranium , house the facial organs and form the adult jaws . remnants of the cartilaginous upper jaw have been described in the human embryo and meckel 's cartilage is the well - known embryonic vestige of the lower jaw . it is evident from the numerous epidemiologic studies on the occurrence of temporomandibular disorders in the general population that there are a number of consistent findings . firstly , signs of temporomandibular disorders appear in about 6070% of the general population and yet only about one in four people with signs are actually aware of or report any symptoms . the frequency of severe disorders that are accompanied by headache and facial pain and that are characterized by urgent need of treatment is 12% in children , about 5% in adolescents and 512% in adults . another consistent finding is that among those who seek treatment for temporomandibular disorders , by far the greatest majority are females , outnumbering males by at least four to one . it is not clear why this is so since it is suspected that temporomandibular disorders affect both males and females in almost equal numbers in the general population . severe problems are much more common among women in clinical populations , and the ratio between women and men who seeks treatment for tmj disorder is 8:1 . during the first half of the 20 century , displacement of the temporomandibular joint meniscus , with attending clinical signs and symptoms including pain and popping , were described . in 1934 , james costen described a group of symptoms that were centered on the ear and temporomandibular joint . because of his work the term costen 's syndrome was developed . in 1947 , nogaard used arthrographic techniques to demonstrate anterior displacement of the articular disk in clicking or popping temporomandibular joint . during the 1950s , schwartz coined the term temporomandibular joint pain dysfunction syndrome . later came the term the functional temporomandibular joint disturbances some terms described the suggested etiologic factors , such as occlusomandibular disturbance and myoarthropathy of the temporomandibular joint , others stressed pain dysfunction syndrome , myofacial pain dysfunction syndrome and temporomandibular pain dysfunction syndrome . subsequently , as a result of clinical observation and a variety of research studies , laskin proposed the term myofacial pain dysfunction syndrome ( mpds ) . he attributed the features of pain , joint sounds and limited mandibular movement to multiple causes and provided experimental evidence for the concept of a psychophysiologic disorder . some authors believe that the forgoing is too limited and that a broader more collective term should be used , such as craniomandibular disorders . the term craniomandibular disorders is used synonymously with the term temporomandibular disorders and is considered a major cause of nondental pain in the orofacial pain region . the wide variety of terms used has contributed to the great amount of confusion that exists in this already complicated field . fascialarthromyalgia , mandibular dysfunction , myofascial pain , masticatory myalgia syndrome and primary myalgia affecting the masticatory musculature are also used synonymously . factors that increase the risk of temporomandibular disorders are called predisposing factors and those causing the onset of temporomandibular disorders are called initiating factors and factors that interfere with healing or enhance the progression of temporomandibular disorder are called perpetuating factors . in some instances a single factor may serve one or all of these roles . the successful management of temporomandibular disorders is dependent on identifying and controlling the contributing factors which include occlusal abnormalities , orthodontic treatment , bruxism and orthopedic instability , macrotrauma and microtrauma , factors like poor health and nutrition , joint laxity and exogenous estrogen . psychosocial factors like stress , tension , anxiety and depression may lead to temporomandibular joint disorders . a case controlled study conducted in a dental school used clinical and neurophysiologic evaluations to examine the role of sleep dysfunction and depression alone or in combination with temporomandibular joint disorders . the resulting analysis demonstrated that depression was significantly more common in the temporomandibular joint disorder group than in the control group . costen concluded that overclosure was the cause of symptoms in temporomandibular disorders . because of this reason he and other contemporary dentists adopted bite raising dental procedures as the treatment for temporomandibular disorder , which however failed to give expected relief to the patients . its role is widely considered as contributing by initiating , perpetuating or predisposing of temporomandibular joint disorders . initiating factors lead to the onset of the symptoms and are related primarily to trauma or adverse loading of the masticatory system . in the perpetuating factors the following may be included : behavioral factors ( grinding , clenching and abnormal head posture)social factors ( could effect perception and influence of learned response to pain)emotional factors ( depression and anxiety)cognitive factors ( negative thoughts and attitudes which can make resolution of the illness more difficult ) . behavioral factors ( grinding , clenching and abnormal head posture ) social factors ( could effect perception and influence of learned response to pain ) emotional factors ( depression and anxiety ) cognitive factors ( negative thoughts and attitudes which can make resolution of the illness more difficult ) . predisposing factors are pathophysiologic , psychological or structural processes that alter the masticatory system sufficiently to increase the risk of development of temporomandibular disorders . pullinger , seligman and gornbein applied multiple factor analysis , which indicated the low correlation of occlusion to temporomandibular disorders . however , the following occlusal factors had a slight relation : open biteoverjet greater than 6 - 7 mmretruded contact position / intercuspal position with sliding greater than 4 mmunilateral lingual cross - bitefive or more missing posterior teethfaulty restorations and ill - fitting prosthesis . overjet greater than 6 - 7 mm retruded contact position / intercuspal position with sliding greater than 4 mm unilateral lingual cross - bite five or more missing posterior teeth faulty restorations and ill - fitting prosthesis . with regards to the distribution of occlusal contacts , the symmetry of their intensity rather than the symmetry of their number in the posterior occlusion seemed to be more important in relation to temporomandibular function . increased number and more frequent headaches in individuals with few occlusal contacts have also been noted . pullinger and seligman further estimated that occlusal factors contribute about 1020% to the total spectrum of etiological factors which differentiates between healthy persons and patients with temporomandibular joint disorders . decreased disk : eminence ratio ( antero - posterior length of the disk in relation to the length of the articular eminence ) is associated with advanced stages of temporomandibular joint internal derangement . in a patient with a flat eminence there is a minimum amount of posterior rotation of the disk on the condyle during opening . as the steepness increases , more rotational movement is required between the disk and condyle during translation of the condyle . therefore patients with steep articular eminences are more likely to demonstrate greater condyle - disk movement during function . this exaggerated condyle - disk movement may increase the risk of ligament elongation that leads to disk derangement disorders . perhaps this predisposing factor is only significant when combined with other factors that relate to the amount of joint function and loading . this can occur during any dental procedure in which there is prolonged opening like orthodontic treatment , single - sitting root canal treatment or because of factors like relapse which causes a functional imbalance between the temporomandibular joints , muscles and occlusion . to avoid this type of damage to the temporomandibular joint , we should always perform an examination of the joint [ tables 1 and 2 ] . palpation of the muscles and joints are best accomplished with the operator standing behind the patient . bilateral palpation is the method of choice , since movements of the joints demand contralateral action of the joints and muscles . auscultation of the joints can be accomplished simply by listening for any abnormal sounds of snapping , grating or clicking that may occur during the movements . a stethoscope may be of value to one trained in its use for temporomandibular joint sounds . percussion of the jaws may be of value when cavities , fractures or reflexive movements of the mandible are to be evaluated . percussion should be indirect when testing for cavities and fractures of the bone and direct when testing for reflex action of the mandible . temporomandibular joint disorders do not constitute one particular or single abnormal condition ; rather they are multifactorial , and include stressful activities , emotional diseases , structural mal - relationships , trauma , malocclusion and various types of arthritis or viral diseases . perfect harmony between the teeth , muscles , nerves , supporting tissues and temporomandibular joints must be established to provide health , functional efficiency , esthetics and stability to the entire stomatognathic system .

the temporomandibular joint receives its name from the two bones that enter into its formation , namely the temporal bone and the mandible . this complex synovial system is composed of two temporomandibular joints together with their articulating ligaments and masticatory muscles . this articulation affects other synovial joints that relate specifically to masticatory function . the causes of temporomandibular disorders are complex and multifactorial . there are numerous factors that can contribute to temporomandibular disorders . in some instances a single factor may serve one or all of these roles . iatrogenic injuries can act as both initiating as well as predisposing factors . the term craniomandibular disorder is used synonymously with the term temporomandibular disorders and is considered a major cause of nondental pain in the orofacial pain region . the successful management of temporomandibular disorders is dependent on identifying and controlling the contributing factors . the temporomandibular disorders are more common in females , the reason is not clearly known . the following article provides detailed information regarding temporomandibular joint disorders .

according to the brazilian institute of geography and demography ( instituto brasileiro de geografia e estatstica or ibge),1 brazil presents an aged population that corresponds to 9.7% of its total population . the aging index grew from 0.11 in the 1980 s to 0.25 in 2004.1 these values show that brazilian society is aging , but it can still be considered young when compared to other countries , such as italy , japan and germany , which present larger elderly populations.1 the aging process has been widely studied in the last decade , enhancing the understanding of diseases that affect elderly people and , therefore , promoting a shift towards a healthier and more independent aging process . amongst the physiological modifications observed during aging , the loss of functional capabilities and the modifications of metabolic functions are the most important.2,3 studies show that regular physical activity is a key feature for more healthful aging.3,4 the risk of disease and health problems can decrease with exercise,3,4 which may also help the immune system recover in the elderly , reducing the prevalence of infections and neoplasias among exercisers.3 regular exercise can also decrease fat mass and increase lean mass and aerobic performance.5 in general , physical exercise has proven to be beneficial for diseases associated with aging , and these benefits may result from any type of physical activity . however , resistance exercises , as the most effective method for developing muscle strength , have shown specific benefits and are currently prescribed by many major health organizations to improve health and fitness.3 when sedentary for a long time , elderly people can present significant alterations in body composition and physical fitness , compromising their quality of life in many important ways . some chronic diseases , for instance aids , can even worsen this situation because such diseases exacerbate the effects of aging on body composition and muscle strength . recovering strength and physical fitness is the major goal of exercise in patients with aids wasting syndrome . therefore , a resistance training program could form the basis of an exercise prescription for this group of patients . it should be progressive , so resistance increases as the patient becomes stronger.6 some studies involving hiv - positive adults and resistance training have been carried out , but no studies focusing on elderly hiv - positive people have been conducted yet.79 the present study aims to describe a case series of hiv - positive elderly people who participated in a progressive resistance training program and to evaluate their body composition , muscular strength , physical fitness and evolution of cd4 and cd8 cell counts . this is a case series study10 describing the effects of a one - year resistance training program among elderly hiv - positive patients . all hiv - positive patients , 60 or more years old and who were being treated for hiv / aids at the hospital das clnicas da faculdade de medicina da universidade de so paulo by the end of 2003 were invited to participate in this study . the first invitation was made either by telephone or directly at the medical consultation , followed by written correspondence to their homes . after obtaining their written agreement to participate in the research , orientation to the program the institutional research ethical committee approved the study after review , and all participants signed a formal written , informed consent form . inclusion criteria were the following : hiv - positive , older than 60 years by july 2003 , lack of regular physical activity practice and agreement to participate . exclusion criteria were the following : medical contraindication to perform exercises , any physical condition that limited resistance of training , use of corticosteroids or other anabolic steroids and non - adhesion to the training program ( defined as an absence of at least three consecutive months from the training program ) . after the initial interview , patients were questioned about the time since their hiv diagnosis , in addition to their health and life conditions . patients were clinically followed by their own infectious disease - specialized physicians throughout the study . both immunological evaluations , by means of t - cd4 and t - cd8 lymphocytes counts , and virological evaluations , by means of quantitative hiv - rna pcr , were standard practice and performed every four months for those who attended the clinic . the anthropometric measurements collected in this study were body mass , circumferences and skinfolds , assessed according to protocols previously described.11,12 body composition assessments by dual - energy x - ray absorptiometry ( dexa ) were carried out before and after the training period , following the methods described by ellis.13 the supervised progressive resistance training program consisted of four different exercises ( muscles trained ) : 1 ) leg press ( quadriceps ) , 2 ) seated row ( latissimus dorsi ) , 3 ) lumbar extension ( paravertebral muscles ) , and 4 ) chest press ( pectoralis major ) . exercises were performed using free weight machines ( maxiflex biodelta , joinville , sc , brazil ) . exercises were performed in three sets of 812 repetitions at light , moderate and heavy resistance , respectively , with 12 minutes of rest between the series , twice a week for one year , from march 2004 to september 2005 . according to our protocol , adapted from the american geriatric society recommendations,14 all subjects were submitted to five training sections , prior to the beginning of the training program , in order to assure an adequate and safe evaluation of their initial working load.15 sub - maximum weight supported ( in the heavy resistance series ) was defined as the maximum weight lifted smoothly without valsalva maneuver , apnea or isometry . for the purposes of this work , it was a surrogate of muscular strength . patients were also submitted to two functional tests every four months in order to better evaluate their physical performance evolution along the training period . the tests included an assessment of a timed 2.4-meter walk ( walking 2.4 m ) at a normal pace and a timed test of five repetitions of rising from a chair and sitting down ( sit - standing ) , according to the protocol described by guralnik et al.16 data were recorded and stored in an excel sheet and analyzed with statistica for windows , version 7.5 . the differences seen in strength , anthropometric variables and functional tests before and after the one - year training period were compared with wilcoxon matched pair test , considering the entire sample and controlling for age and gender effects as well as for baseline hiv infection stage and co - morbidity presented by them . one hundred and eight hiv - positive patients , more than 60 years old by the end of 2003 , were invited to participate in the study . of those , two refused , two died , and two did not have the physical condition necessary to participate in the training program . in addition , 88 patients did not show interest or were unable to participate in the study because they lived outside so paulo city and/or presented poor clinical conditions . thus , only 14 patients , aged 6271 years ( mean sd : 65.6 2.9 ) , of both genders and with average of nine years duration of hiv infection , agreed to participate . in addition , three of these patients abandoned the training program for more than three months and were excluded from the study protocol . therefore , only 11 completed the period of training and remained in the study for the final analysis . among those 11 participants , only one did not report previous use of highly active antiretroviral therapy ( haart ) , and four presented previous histories of hiv - associated diseases . on average table 2 shows the weight load variation after one year of resistance training program with four different exercises . the average load of each muscular group trained increased significantly : leg press 97% , p = 0.004 ; seated row 78% , p = 0.021 ; lumbar extension 122% , p = 0.003 ; and chest press 74% , p = 0.003 . the increased muscular strength is reflected in the results of the two functional tests performed . there was a significant reduction in both the sit - standing ( 2.00 1.57s , p=0.003 ) and the walking 2.4 m ( 9.25 6.58s , p=0.003 ) times when comparing before and after the year of resistance training , as shown in figures 1 and 2 . weight did not change significantly , nor did most of the body composition measures analyzed ( see table 3 ) , with the exception of triceps and thigh skinfolds , which both showed significant reduction ( 11.4 9.2 mm , p = 0.037 ; and 13.9 12.1 mm , p = 0.011 , respectively ) , as shown in figure 3 . the differences seen in all variables described above were not affected by age , gender , hiv infection stage or co - morbidity with the exception of strength variation in seated row , which increased more among men ( p=0.02 ) . in addition , no significant adverse effect related to the exercise program or any new ( or worsening of previously existent ) aids - related condition developed during the training period . finally , with respect to the evolution of virological and immunological markers of hiv infection , all but two patients ( patients aap and afs of table 1 ) had persistently undetectable viral loads . also , there were significant increases in the cd4 cell counts ( 388 163 before vs. 539 225 after , = 151 cells , p=0.008 ) and in the cd4/cd8 ratio ( 0.63 to 0.81 , p=0.009 ) and a non - significant increase in the cd8 cell counts ( 762 423 before vs. 816 376 after , = 54 cells ; p=0.464 ) . to the best of our knowledge , this is the first study to investigate the influence of progressive resistance training in hiv - infected people older than 60 years . the training protocol followed the recommendations of american college of sports and medicine3 , which suggest a progression model for resistance exercises in healthy , older adults . for this population , the studies show favorable changes regarding the risk factors associated with osteoporosis , heart disease , cancer and diabetes and also show a reduction in fat mass and an increase in lean mass and muscular strength.4,18 as mentioned in the results , only 11 out of 14 hiv - infected people , aged 60 years or more , completed the one - year training period . among them , those who experienced some intercurrence during the training period did not suffer deconditioning . when they restarted training , it was easy for them to continue with the same loads they used before . a substantial strength increase was seen for all exercises in every patient who completed the training program regardless of their age , gender , baseline hiv infection stage or the presence of any hiv / aids - associated morbidity , and this was not different for the only patient who did not use antiretrovirals . the average increase in the load supported after 12 months of resistance training varied from 74 to 122% ( p0.0030.021 ) , depending on the muscular group considered . in addition , the functional tests results , which showed significant improvement in the sit - standing and walking 2.4 m times ( p= 0.003 ) , reflected this increase . before starting the training program , the patients were all sedentary and , in spite of having different baseline hiv infection stages and co - morbidity histories , they had stable clinical conditions . thus , the strength increase observed could hardly be attributed to any other cause but the training program . the strength increment is important for the quality of life of the aged population because it improves biomechanics and cardiovascular responses , thus facilitating daily life activities . our sample was comprised of elderly hiv - positive individuals who were experiencing a stable clinical evolution , almost all of them under haart treatment for more than one year prior to the beginning of the study . however , despite the significant benefits associated with haart , hiv infection and its therapy have been associated with the development of several metabolic complications : increased central adiposity , peripheral lipoatrophy , peripheral insulin resistance , diabetes , dyslipidemia and hypertriglyceridemia , osteoporosis and osteopenia . these complications may predispose patients to a premature risk of metabolic and cardiovascular diseases.19 in addition , aging predisposes them to the same biological effects,20 and one could expect that aging could act as a potentiator of those hiv infection- and haart - related alterations . on the other hand , resistance training improves many of those alterations in our study , no changes were seen either in body composition , assessed by dexa after 12 months of resistance training , or in anthropometric measures with the exceptions of triceps ( p=0.037 ) and thigh ( p=0.011 ) skinfolds . weight did not change significantly ( p=0.84 ) either . we are well aware that this could be simply an effect of the lack of power of the study due to the small size . however , the low intensity of the alterations seen in table 3 and the fact that some of them are opposite to what is the expected effect of resistance training could suggest that the absence of statistical significance may be true . finally , the effects of exercises on immune function have been studied in both adult and elderly healthy populations , showing that moderate levels of training are helpful for both populations.21,22 in our study , assessment of immune response , which is usually performed for hiv patients , showed a significant increase in both cd4 counts ( =151 cells , p=0.008 ) and in the cd4/cd8 ratio ( 0.63 to 0.81 , p=0.009 ) in addition to a non - significant increase in the cd8 counts ( = 54 cells ; p=0.464 ) after one year of resistance training . those are important variations in the number of cells , considering that there were no significant changes in viral load or haart use among them during the training period . almost all patients had undetectable viral load and were on haart therapy before , during and after the training period . therefore , the observed changes in the numbers of cd4 and cd8 cells , together with the absence of new hiv - related morbidity , should most probably be attributed to their stable hiv infection conditions . in conclusion , despite the relatively small sample , our results indicate that a progressive resistance training program can benefit elderly people living with hiv without any major adverse effects or worsening of hiv / aids related conditions , which favors its recommendation for such a population .

backgroundelderly people present alterations in body composition and physical fitness , compromising their quality of life . chronic diseases , including hiv / aids , worsen this situation . resistance exercises are prescribed to improve fitness and promote healthier and independent aging . recovery of strength and physical fitness is the goal of exercise in aids wasting syndrome.objectivethis study describes a case series of hiv - positive elderly patients who participated in a progressive resistance training program and evaluates their body composition , muscular strength , physical fitness and the evolution of cd4 + and cd8 + cell counts.methodssubjects were prospectively recruited for nine months . the training program consisted of three sets of 812 repetitions of leg press , seated row , lumbar extension and chest press , performed with free weight machines hts , twice / week for one year . infectious disease physicians followed patients and reported all relevant clinical data . body composition was assessed by anthropometric measures and dual - energy x - ray absorptiometry before and after the training program.resultsfourteen patients , aged 6271 years old , of both genders , without regular physical activity who had an average of nine years of hiv / aids history were enrolled . the strengths of major muscle groups increased ( 74%122% , p=0.0030.021 ) with a corresponding improvement in sit - standing and walking 2.4 m tests ( p=0.003 ) . there were no changes in clinical conditions and body composition measures , but triceps and thigh skinfolds were significantly reduced ( p=0.037 ) . in addition , there were significant increases in the cd4 + counts ( n=151 cells ; p=0.008 ) and the cd4+/cd8 + ratio ( 0.63 to 0.81 , p=0.009).conclusionresistance training increased strength , improved physical fitness , reduced upper and lower limb skinfolds , and were associated with an improvement in the cd4 + and cd4+/cd8 + counts in hiv positive elderly patients without significant side effects .

hepatitis b virus is one of the most important factors for infected diseases in the world . it was estimated that 350 million people infected with hepatitis b virus and almost 75% patients are living in asia ( 1 ) . nearly one million people die annually from chronic liver diseases such as , chronic hepatitis b , cirrhosis and hepatocellular carcinoma ( 2 ) . the prevalence of hepatitis b is reported various in different parts of the world , so this virus existed as hyper endemic in most asian countries . throughout the world , carrier variability rate for hepatitis b infection is estimated to be 0.1% to 20% which is different in various areas and is classified into three regions : the first group with areas as having low ( < 2% ) , the second group with intermediate prevalence ( 2 - 7% ) and with high prevalence ( > 8% ) ( 3 ) . the prevalence of hepatitis b infection is high in africa , southeast asia , the middle east , southern and western pacific island , ( they are of endemic regions ) intermediate areas consist of south central and southwest asia , israel , japan , eastern , southern europe and russia and prevalence of hepatitis b infection is low in northern and western europe , north america , australia , new zealand , mexico and southern america ( 4 ) . in iran , a study showed that 35% of population were infected with hepatitis b and the percentage of chronic carriers is about 3% ; although after implementing control programs and public vaccination , the prevalence of hbv infection has reduced to less than 2 % ( 5 ) . the hbv has ten genotypes ( a - j ) , multiple subtypes and serotypes ( adr , adw , ayr , ayw ) , showing genotypes vary in different geographic areas worldwide . there is a relation between serotype and genotype in the world ( 6 ) . it seems that infected persons with different genotypes show various responses to therapy ( 7 ) . also different in genotypes have shown influences in sever course of disease , infection and vaccination ( 8) . some studies suggested that genotype d could increase the risk of cirrhosis than genotype c(9 ) , on the other hand some evidences showed no difference between these types in infection risk to hcc(10 ) . moreover some researches found that genotype a is more associated with higher risk of hcc than genotype d(11 ) . recent study showed that genotype c was more strongly associated with hcc than infected patients with genotypes a , b and d ( 12 ) . pre - core stop codon and basal core promoter mutations are of another difference in risk of hcc in various hbv genotypes . pre - core stop codon a1896 is less in genotype c than genotype b. basal core promoter mutations in x gene upstream of pre - core area is more in genotypes c ( 13 ) . this mutation increases the risk of hcc in patients with chronic hepatitis ( 14 ) . hbv genotypes have different distinguished biological and are able to influence the expression of antigen and immune functional , so recognizing hbv genotypes is important in a country . this article has investigated the hbv genotyping and was carried out iran based on papers that identified hbv genotype in iranian population published in english and persian languages . this genome of hbv includes circular dna that some part of it is bi - string and contains reverse transaction enzyme and/or polymerase dna full string genome contains 3020 - 3320 nucleotides and short length strand is 1700 - 2800 nucleotides . there are four areas encoded by hbv genome c , x , p , s . some mutants have found in hepatitis b. in many of this , mutation in pre - core genome is associated with inactivation of hbe ag ( ymdd , s mutant ) ( 15 ) . in patients , this mutant is associated with severity of disease and less response to therapy ( 16 ) . ymdd region in virus polymerase is located in places influenced by most of reverse transcriptase inhibitor such as lamivudine and lamivudine . variation of ymdd occurred as a result using lamivudinethus , after one year therapy with lamivudine , nearly 24% of patients have showed ymdd mutations ( 17 ) . many of pre - core mutations are related to g - a changing in the 1896 nucleotide , causing the stop codon and preventing the functional of hbe ag genome . a study has reported that 58% of infections are the type of pre - core infection in iran(19 ) . negative hbe ag carriers have been heterogeneous ; most of them have had less dna level and normal alanintransferase ; so they could not be able to completely respond to therapy . some evidences showed that 15 - 20 of hbe ag carriers have a high level of alt and hbv dna in mediterranean , eastern asia and southern europe ( 20 ) . genotype a is divided into two sub - genotypes aa ( a1 ) , ae(a2 ) . sub - genotype aa ( a1 ) was found in africa / asia and philippine . genotype b is also divided into two sub genotype ba / b2 ( asia ) and bj / b2 ( j - japan ) and the prevalence of them has been reported in different areas . ba has classified to four classb2-b4 , these sub genotypes have more virulence than bj ( 21 ) . cs ( c1 ) is more common in south east of asia and ce ( c2 ) was observed in japan , china , korea , east of asia ( 22).c3 was reported in polynesia , caledonia areas and c4 was detected in australia , and c5 and c6 were found in philippine ( 23 ) . genotype c , is associated with hepatocellular carcinoma in japanese patients and it was not found in taiwanese patients less than 50 years of age ( 24 ) . genotype d is divided into seven sub - genotype ( d1-d2 ) which are prevalent in pakistan , india , afghanistan , mediterranean areas ( 26 ) . studies show that sub genotypes d1and d2 were found in turkey ( 27 ) but sub genotype d3 was observed more in asia ( east india ) , south of africa and europe and sub genotype d4 was identified in australia ( 28 ) . recently sub genotype d5 has been reported in east of india and japan ( 29 ) . a study suggested that genotype d and serotype ayw2 with 94/4% are predominant in hbv positive in iran ( 30 ) . genotype f has been divided into four sub genotype ( f1-f4 ) , also sub genotype f1 was classified to two sub genotype 1a , 1b . sub- genotypes f2 , f1 were observed in venezuela and sub genotype f3 was found in east and west of america . some evidences showed that sub genotype 1a from f1 is derived from center of america , sub genotype f3 is found in north of america and sub genotype f4 had been identified from south of america , but sub genotypes of 1b from f2 is prevalent in most of united states instead of north of southern america and north of america ( 31 ) . genotype f is predominant in brazil and genotype g is reported in france and united state ; also 4 - 8 % difference in subtypes of genotype e and f has been reported ( 32).genotype h is limited to center of america , mexico and california(33 ) . it has been reported that genotype i was found in north east of india and genotype j was detected in japanese patients ( 33 ) . epidemiology of hbv genotypes in the world ( 34 ) there are some significant differences in clinical characteristics and virology of infected patients with various genotypes . in this study we found 22 studies that were discussed about serotypes and genotypes of hbv in iran . in six studies , serotype ayw2 was reported as the predominant serotype with relatively abundance more than 94% ( table 1 ) . the first study about genotypes of hbv was done in 2005 in iran and genotype d is defined as predominant genotype in iran ( table 2 ) . in this article , 22 studies were discussed about serotypes and genotypes of hbv in iran . the results of these studies indicate that the predominant genotype and serotype in iran is d and ayw2 , respectively . in other studies , there is genotype d in south asia and east asia , such as iran , afghanistan and india ( 57 ) . this genotype was found the oldest type widely spread in the world . also , addition to ancient civilization , evolving a special genotype for hbv shows its evolution . in addition , the importance of geographical distribution by presenting genotype d has been reported 46 % in the areas surrounding iran such as pakistan , north india ( 58 ) . in the south of japan ( okinawa ) it was indicated that genotype b is the predominant genotype ( 59 ) while in mainland genotype c is predominant ( 60 ) . this relations show that factors for the area of human and racial populations are more important than the geographical factors . in asian countries such as india genotype d and sub - genotype d3 genetically research dna mitochondria chromosome y in indians showed the integration of migrators ' genotypes from europe countries that defines in the northern area more than india ( 62 ) . other studies have showed that abundance of genotype hbv can be the reflection of geographical close relation among this transformation . genotype d is the oldest type that has spread widely in the world ( nicobar and andaman islands ) . also , there are genotypes a and d in the north of india and much more probably it is due to migration from europe which resulted in high prevalence of genotype d in most parts of india . in iran , it can be deduced that aryans was first habitants of caspian sea , then migrated to the other areas of india and europe . it is possible that some persons infected with genotype d were infected before migration and caused to spread it . therefore , in iran , india and most of europian countries , genotype d is seemingly prevalent ( 63 ) . besides the old civilization ; genotype b is predominant in southern japan ( okinawa ) ( 64 ) ; while genotype c has been reported as the dominant type in mainland japan ( 65 ) . in various areas of japan genetic studies of mitochondrial dna and y chromosome in indian population indicates the integration of immigrants gene from european countries and in northern parts is more than of south india(67 ) . another study showing the prevalence of hbv genotype and changing geographical ; so that genotype d is more prevalent in west india . that genotypes a and d are in the north of india , is likely related to the migration of people from europe to india and led to genotype d is replaced by genotype a in main areas . in iran , we can know that the aryans have been in the north caspian sea , and then they moved to other parts of iran , india and europe . it seems that genotype d patients have been infected with virus before migration , and then they led to increasing this genotype so genotype d is prevalent in iran , india and most of europe ( 68 ) . because hbv genotypes show distinct geographical distribution , genotype d is predominant in iran . despite the different geographical areas in different parts of iran , genotype d is considered as the predominant genotype . with regard to surveillance , hepatitis in iranian health system , defining sequences among different isolates of hbv by appropriate intervals or disease outbreaks also , knowing infection to hbv genotypes can help in the standardization of treatment interference and selection of proper regimens for this disease .

hepatitis b virus ( hbv ) infection is a public health problem as a cause of liver diseases including hepatocellular carcinoma and cirrhosis . it is estimated that 350 million people live with chronic infection and about one million people die every year from complication of this chronic disease in the world . so far , ten hbv genotypes ( a - j ) has been identified which show a geographical distribution . throughout the world , carrier variability rate for hepatitis b infection is estimated to be 0.1% to 20% , with regions classified as having low endemicity ( < 2% ) , intermediate endemicity ( 2 - 7% ) and high endemicity ( > 8% ) . the prevalence of hepatitis b infection is estimated at 2 to 7 percent in iran . after hbv vaccination program the prevalence of hepatitis b infection has been reported less than 2% , so iran can be considered one of the countries with low hbv infection endemicity . in iran several studies were shown that the only genotype of hbv(100%)was found genotype d as the prominent type in some provinces , but some studies reported genotype b(5%)as well as genotype d(95%).the distribution of hbv genotypes may guide us in determining disease burden , prognosis and antiviral responses . so , it is important to know the epidemiologically of hbv genotyping as well .

bulawayo is the second largest city in zimbabwe after the capital city harare , with a population of 653,337 as of the 2012 census.1 it is located in matabeleland , 439 km southwest of harare , on the way to victoria falls . severe preeclampsia / eclampsia has grave consequences for both maternal and neonatal health , associated with 50,000100,000 annual deaths globally , as well as serious fetal and neonatal morbidity and mortality.2 these disorders of pregnancy have a predominance in low- and middle - income countries.3 there were an estimated 287,000 maternal deaths worldwide in 2010 . the biggest killers of pregnant women being hemorrhage , hypertensive disorders , and sepsis.4 sub - saharan africa has the highest maternal mortality ratio at 500 per 100,000 live births.5 in zimbabwe , preeclampsia and eclampsia are the third leading causes of death after aids - defining conditions and postpartum hemorrhage.6 hypertensive disorders also indirectly contribute to maternal deaths by being a common risk associated with postpartum hemorrhage.7 the incidence of preeclampsia / eclampsia in zimbabwe has not been documented in the literature before . the incidence in tanzania , a sub - saharan african country , was found to be 1.7%8 and in the united kingdom , in europe , it was 0.5%.9 this was a retrospective descriptive cohort study carried out at mpilo central hospital , a tertiary teaching referral government hospital in a low - resource setting in bulawayo , zimbabwe . data were obtained from the birth registers in labor ward , intensive care unit ( icu ) , and neonatal intensive care unit ( nicu ) of patients who had a diagnosis of severe preeclampsia or eclampsia for the period january 1 , 2016 , to december 31 , 2016 . severe preeclampsia was diagnosed in those patients with high blood pressure ( diastolic 110 mmhg ) and either severe headaches , epigastric pain , or deranged biochemical / hematological blood indices . eclampsia was diagnosed in women who had a grand mal seizure with features of preeclampsia and no previous history of a seizure disorder such as epilepsy . the case notes were retrieved , and the demographic , clinical , and outcome data were gathered . the spss version 21 ( ibm corp . , armonk , ny , usa ) statistical tool was used to calculate the mean and standard deviation ( sd ) figures . the ethics committee of mpilo central hospital approved this study and waived the need for patient consent to review their medical records due to the non - interventional nature of the study , with all data being anonymous . the ethics committee of mpilo central hospital approved this study and waived the need for patient consent to review their medical records due to the non - interventional nature of the study , with all data being anonymous . there were 9,086 deliveries at the institution during the period january 1 , 2016 , to december 31 , 2016 . the mean age was 27.7 years ( sd 7.4 ) and the mean parity was 1.0 ( sd 1.0 ) for the studied group of patients . the mean systolic blood pressure was 168 ( sd 27 ) and the mean diastolic blood pressure was 113 ( sd 18 ) . the majority of cases ( 57.9% ) were of early - onset preeclampsia ( eop ) < 34 weeks gestation ; 42.1% were of late - onset preeclampsia ( lop ) 34 weeks gestation ; 15.7% of cases were hiv seropositive ; 78.5% of the cases were delivered by lower segment cesarean section ( lscs ) ; and 6.6% had a hystorotomy . all the patients received magnesium sulfate chemotherapy for the prevention and treatment of eclamptic seizures . the most common major maternal complication was hellp syndrome ( 9.1% ) and the majority of cases had no major complication ( 85.1% ) . there were 127 babies born with six sets of twins during this period of the study among the studied cohort . the mean gestational age was 33.4 weeks gestation ( sd 4.4 ) and the mean birth weight was 1,906 g ( sd 785.8 ) for the studied group of patients . approximately 22% of the babies were stillborn , and 54.5% of the live babies were admitted to nicu . the vast majority of those admitted ( 81.5% ) were due to a combination of prematurity , low birth weight , and respiratory distress syndrome ( rds ) , and 18.5% were due to low apgar scores . out of the total number ( 127 ) of babies born , 35 ( 27.6% ) were early neonatal deaths . table 4 shows the differences between maternal and fetal / neonatal morbidity and mortality . there was a statistical difference between antepartum hemorrhage in severe preeclampsia and eclampsia ( 100% vs 0% , p<0.05 ) . there was no statistical difference between the two groups in terms of renal failure , hellp syndrome , and maternal mortality . there was a statistical difference between the two groups in terms of stillbirths ( 85.7% vs 14.3% , p<0.05 ) . there was no statistical difference between the two groups in terms of low apgar scores , prematurity / low birth weight / respiratory distress syndrome , and early neonatal deaths . this study shows that the incidence of severe preeclampsia / eclampsia at mpilo central hospital , bulawayo , zimbabwe , was 1.3% , which is similar to the one found in tanzania ( 1.7% ) . in the uk in low - resource settings , patients fail to book due to financial constraints , and this may lead to poor outcomes . the hiv prevalence among this cohort was 15.7% and a significant proportion ( 10.7% ) presented to the labor ward with an unknown status mainly because more than a quarter of them were unbooked ( 26.4% ) . the prevalence of hiv infection among the obstetric patient in the unit is 16% , and the national figure for zimbabwe is 15% among adults 15 years.10 the patients presented with gross disease , most of the time with proteinuria ( +++ ) , mean systolic blood pressure of 168 ( sd 27 ) , mean diastolic blood pressure of 113 ( sd 18 ) , or with eclampsia ( 21.5% ) . , eop constitutes the majority of cases at 57.9% while in the developed world eop represents 10%11 of preeclamptic cases . the predominance of eop or lop has huge geographical differences.12 maternal complications of severe preeclampsia / eclampsia can be serious , leading to maternal , fetal , and neonatal morbidity and mortality . severe preeclampsia was found to be associated with an 8.7-fold risk of composite maternal complication.15 the risk of a woman in the developing world dying from a maternal - related cause is 33 times higher than a woman in the developed world.16 maternal mortality results from cerebral hemorrhage,17 pulmonary edema,18 acute renal failure , hepatic rupture , or dic . long - term effects may include chronic renal failure , cardiovascular disease,19 or cortical blindness . the most common maternal complication was hellp syndrome at 9.1% and no patient died from it . most of the patients were delivered by cesarean section ( 78.5% ) due to the seriousness of the condition , and in most cases , there would be delayed presentation ; hence no further time would be available to consider vaginal delivery . despite having 75% of the patients being booked , there was a combination of sudden presentation of the disease , missed diagnosis by poor attenders , patients own delay to seek treatment due to either taking the condition lightly or lack of money . all the patients with severe preeclampsia / eclampsia were treated with magnesium sulfate for 2448 hours20 and were admitted to icu as per the labor ward protocol for the unit . the two patients who died had acute renal failure , and there was delay in reaching the hospital due to the distance between the referral centre and the hospital . considering the serious nature of the disease and its complications , and the low - resource setting , maternal mortality seems to be curtailed and 98.3% survived the disease . the blanket use of magnesium sulfate seems to have good maternal outcomes as most of the very sick patients survived . no maternal deaths were reported in similar studies in rich - resourced countries such as kuwait21 and uk.9 fetal / neonatal complications include stillbirths , iatrogenic prematurity and its complications , and very low / low birth weight.22 about 22% of the babies were stillborn showing the serious harm that these hypertensive disorders can inflict on fetal health . more than half ( 54.5% ) of the live babies were admitted to the nicu showing continued strain on neonatal health . early neonatal deaths were caused by severe prematurity , very low / low birth weight , and respiratory distress syndrome . the patients presented late and were very sick , giving no time for interventions such as corticosteroids for fetal lung maturation to be administered . being born abruptly prematurely , having very low / low birth weight in a low - resource setting , the odds weigh heavily against the tender , fragile lives of the neonates . it is worrying that nearly half of the babies were lost through stillbirths and early neonatal deaths . this is mainly due to the majority of cases presenting with eop ( 57.9% ) . in these hypertensive disorders of pregnancy , . it would be ideal to have outcomes favorable both to the mothers and to their babies . in low - resource setting , there are few health workers who are not well - trained to recognize and manage serious maternal and fetal complications early enough to prevent poor perinatal outcomes . the health workers are also not well - paid and are not well - motivated . ultrasonography , a piece of equipment that would aid in screening for fetal growth , is not widely available . the instrument for fetal heart rate monitoring remains the pinard stethoscope , which may not be properly used causing missed diagnosis in fetal heart rate abnormalities . first , there is no similar detailed study that exists in the literature that sheds light about the profound serious impacts that severe preeclampsia / eclampsia has on maternal , fetal , and neonatal health in low - resource setting . it is imperative to provide universal antenatal care to pregnant women as a preventative step to educate women about the dangers of severe preeclampsia / eclampsia . second , it gives global policy makers an insight into helping tackle one of the major contributors to global maternal and neonatal morbidity and mortality . tackling such huge problems needs global efforts involving brainstormers , field experts , financial institutions , health organizations , governments , and international organizations . the most common maternal complication was hellp syndrome , and none of the patients died of it . the most common fetal / neonatal complications were stillbirths , prematurity , very low / low birth weight , and respiratory distress syndrome . nearly half ( 49.6% ) of the babies were lost through stillbirths and early neonatal deaths . to tackle these figures on maternal , fetal , and neonatal health , governments in low - resource settings must focus on development and enabling women to be in an economic position to access health care easily . there should be affordable and accessible antenatal care services where women are taught about the dangers of preeclampsia / eclampsia so that they present early to hospitals . neonatal health must be placed on the global agenda and given the same attention as maternal health . global efforts must involve developmental aid and debt relief to poor countries so that these countries can channel the funds to women s and neonatal health issues .

backgroundsevere preeclampsia is a disorder of pregnancy characterized by high blood pressure and significant proteinuria after 20 weeks gestation . severe preeclampsia and eclampsia have considerable adverse impacts on maternal , fetal , and neonatal health especially in low - resource countries . hypertensive disorders of pregnancy are the third leading cause of maternal deaths in sub - saharan africa . significant avoidable maternal and neonatal morbidity and mortality may result.objectivesthis study aimed 1 ) to determine the incidence of severe preeclampsia / eclampsia in a low - resource setting ; 2 ) to determine the maternal complications of severe preeclampsia / eclampsia in a low - resource setting ; 3 ) to determine the perinatal outcomes of severe preeclampsia / eclampsia in a low - resource setting.methodsthis was a retrospective descriptive cohort study carried out at mpilo central hospital , a tertiary teaching referral government hospital in a low - resource setting in bulawayo , zimbabwe . data were obtained from the birth registers in labor ward , intensive care unit , and neonatal intensive care unit of patients who had a diagnosis of severe preeclampsia or eclampsia for the period january 1 , 2016 , to december 31 , 2016 . the case notes were retrieved and the demographic , clinical , and outcome data were gathered.resultsthere were 9,086 deliveries at the institution during the period january 1 , 2016 , to december 31 , 2016 . there were 121 cases of severe preeclampsia / eclampsia . the incidence of severe preeclampsia / eclampsia was 1.3% at mpilo central hospital . the most common major complication was hellp syndrome ( 9.1% ) . maternal mortality was 1.7% . there were 127 babies born with six sets of twins , 49.6% of the babies were lost through stillbirths and early neonatal deaths.conclusionthe incidence of severe preeclampsia / eclampsia at mpilo central hospital was 1.3% . the most common maternal complication was hemolysis elevated liver enzymes low platelet syndrome . maternal mortality was 1.7% due to acute renal failure . nearly half ( 49.6% ) of the babies born were lost to stillbirths and early neonatal deaths .

retinal redetachment , especially in a silicone oil - filled eye , continues to be among the most frustrating and challenging conditions faced by vitreoretinal surgeons . the recurrence rate of retinal detachment in silicone oil - filled eyes is approximately 20% [ 14 ] . the major cause of redetachment in these cases is attributed to originally severe retinal injury and subsequently inferior proliferative vitreoretinopathy ( pvr ) ; in such cases , stiffness and foreshortening of the retina are often observed [ 58 ] . conventionally , relaxing retinotomies and retinectomies , first introduced by machemer in 1979 , are often required to treat retinal shortening ( figures 1(a ) and 1(b ) ) [ 9 , 10 ] . to reverse this shortening , the retinectomy should extend into the normal retina on each end of the contractive area , resulting in the exposure of a large area of the rpe and further injury to the normal retina . potentially serious complications , such as intraoperative hemorrhage from the choroid , large retinal defects , and hypotony , are associated with these conventional procedures [ 1216 ] . therefore , a new surgical method that balances reattachment with preservation of the retina is greatly needed . here , we propose a novel procedure consisting of radial retinotomies with endodiathermy as a potentially less invasive alternative to this conventional approach ( figures 1(c ) and 1(d ) ) . briefly , rather than a sequential cut with scissors , endodiathermy is applied to relax the shortened retina . specifically , based on a complete vitrectomy , endodiathermy is used to perforate the centers of contraction to relax the asteroidal retina . subsequently , a series of retinotomies are created via endodiathermy in a radial pattern to relax the stiff and foreshortened retina . this procedure allows the individual round retinal incisions to elongate in an oval fashion . in turn , the retina is permitted to stretch , resulting in the coverage of the rpe below the previously detached , foreshortened retina . theoretically , this modified method of retinotomies avoids extensive cutting of the normal retina and preserves the shortened retina to cover the underlying rpe , consequently reducing certain complications of relaxing retinectomy . to our knowledge , no reports have discussed this modified surgery . therefore , we conducted an exploratory study to preliminarily evaluate the feasibility , efficacy , and safety of this procedure . this study was a single - center , open - label , nonrandomized , prospective clinical trial ( registered with the identifier nct02201706 at clinicaltrials.gov ) designed to preliminarily evaluate the feasibility , efficacy , and safety of a modified procedure of radial retinotomies with endodiathermy for the treatment of recurrent retinal detachment in patients with severe proliferative vitreoretinopathy . approval was obtained from the sun yat - sen university medical ethics committee ( zhongshan ophthalmic center medical ethics , number 2014meky018 ) . patients with severe proliferative vitreoretinopathy for whom conventional treatment methods had failed were enrolled . to limit the inconsistency of ocular conditions , only patients with inferior retinal redetachment in silicone oil - filled eyes patients were excluded if they had an unobservable fundus due to severe corneal opacity , a nonfunctional contralateral eye , only one eye , or serious heart , lung , liver , or kidney dysfunction . the surgical procedures varied depending on the vitreoretinal pathology ; however , certain general principles were followed ( figures 1(c ) and 1(d ) ) . in brief , after the silicone oil was removed through the scleral incision , complete vitrectomy and membrane peeling were performed ( alcon laboratories , inc . , fort worth , tx , usa ) . next , endodiathermy was performed to perforate the centers of contraction to relieve focal contractions . subsequently , endodiathermy was applied continually to generate a series of retinotomies in a radial or fan - shaped pattern to completely mobilize the stiffened retina . afterwards , the retina regained elasticity and floated in the vitreous body . during the water - air exchange , the individual circular incisions were elongated into an oval shape to cover the rpe below the previously detached , foreshortened retina . finally , three rows of argon blue - green endophotocoagulation were applied to the edges of the retinectomy , and silicone oil was injected to completely fill the vitreous cavity . the primary outcome was complete retinal reattachment , as determined by ophthalmoscopic assessment , fundus photography , and optical coherence tomography ( oct ) at the end of the 6-month observation period . all of the photograph - derived outcomes were determined via the independent grading of retinal photographs by scorers at the fundus photograph reading center which were unaware of the treatment assignments . the secondary outcomes included visual acuity ( va ) , intraocular pressure ( iop ) , intraocular hemorrhage , and degree of recurrent pvr . visual acuity was stratified into the following categories : no light perception was scored as 0 , light perception was scored as 1 , hand motion perception was scored as 2 , finger count perception was scored as 3 , 20/400 was scored as 4 , and 20/200 was scored as 5 . vision was considered as improved when va progressed to the next category ; the same when the va category was unchanged ; or worse when va regressed to a lower category . intraocular pressure greater than 25 mmhg was considered to be elevated , and the eye was considered to be hypotensive when iop was 5 mmhg or less . the pvr grade was defined according to the updated classification of retinal detachment with pvr . the adverse events recorded during this clinical trial were severe ocular inflammation , endophthalmitis , and sympathetic ophthalmia . the efficacy and safety variables were assessed at 1 day before surgery ( baseline ) and at 3 days , 1 week , 2 weeks , 4 weeks , 3 months , and 6 months after surgery . generalized estimating equations ( gees ) for small samples were used to estimate the changes in va and iop from one day before surgery to 6 months postoperatively and at specific time points . all effect estimates , 95% confidence intervals ( cis ) , and p values ( = 0.05 ) were generated using spss ( version 16 ; spss inc . , chicago , il , usa ) . a total of 9 eyes of 9 consecutive patients were included . the baseline demographic and ocular characteristics are summarized in table 1 . seven of the nine patients suffered from ocular penetration , and three underwent intraocular surgery twice . the mean duration of silicone oil tamponade was 9.22 14.61 months ( range 248 months ) . the mean duration from retinal redetachment to the surgery described herein was 47.78 44.64 days ( range 4150 days ) . all of the eyes exhibited established pvr ( grade c ) , but the pvr types of these eyes varied . retinal redetachment was located in the inferior hemifield in all of the patients , and redetachment extended to the macula in two patients . the mean clock length of the detached retina was 5.78 1.64 clock hours ( range 49 clock hours ) . the surgeon completed this modified retinotomy procedure using conventional ppv instruments , and the surgery required a mean 28.00 9.06 minutes from the end of original silicone oil removal to the end of fresh silicone oil application ( rang 2045 minutes ) . seven of the nine patients exhibited retinal reattachment by the 6-month follow - up assessment ( success rate , 78% ; 95% ci , 40%97% ) . specifically , all of the adults ( 100% ) , but only one of three children ( 33% ) , exhibited retinal reattachment . oct images showed the retinal attachment at 3 and 6 months postoperatively ( figure 3 ) . visual acuity ( va ) improved in 6 patients and was preserved in 1 patient ; however , va was decreased in 2 children ( table 3 , figure 4 ) . gee analysis showed that the average va changes were not significant over the 6-month study period ( = 0.11 ; 95% ci , 0.18 to 0.40 ; z = 0.75 ; p = 0.45 ) , but it improved and peaked at 2 weeks after the operation ( = 0.20 ; 95% ci , 0.03 to 0.37 ; z = 2.36 ; p = 0.018 ) and remained stable for the following 6 months . slight intraocular hypertension was observed in five patients ( 55% ) , but no hypotension was observed ( 0% ) ( table 3 , figure 5 ) . gee analysis showed that the average iop fluctuated from 15.69 to 19.62 mmhg ; these changes were not significant over the 6-month study period ( = 0.006 ; 95% ci , 0.35 to 0.48 ; z = 0.30 ; p = 0.76 ) . no intraocular hemorrhage was observed during or after surgery . postoperatively , the inflammation of the conjunctiva was similar to that observed following conventional surgery , and the inflammation resolved within 1 or 2 weeks after surgery ( figure 6 ) . the edges of the defective retina rolled inwardly and induced peripheral retinal redetachment . in one child who preoperatively presented with a large , 6-optic disc area defect of the peripheral retina , redetachment was observed as early as 3 days after surgery . retinal redetachment of silicone oil - filled eyes is a complicated type of detachment . relaxing retinectomy was formerly required in these cases , but this procedure may be accompanied with serious complications . the current study proposed a modified technique of radial retinotomies with endodiathermy and preliminarily explored its feasibility , efficacy , and safety for the treatment of severe pvr . retinectomy is essential for the relief of extensive retraction , and the reattachment rate associated with this procedure is increasing . in the silicone study , more recent case series have reported better anatomic outcomes , with success rates ranging from 47 to 85% based on heterogeneous collections of retinal detachment cases [ 6 , 12 , 15 , 21 ] . the current study examined a homogeneous group of patients with recurrent , inferior retinal detachment of silicone oil - filled eyes that had been traumatized . thus , results indicate that this modified surgery can lead to favorable outcomes in adults with severe pvr when conventional methods have failed . however , the retinas of two children ( a 7- and a 12-year - old ) failed to reattach . importantly , one child with a 6-optic disc area defect of the peripheral retina exhibited redetachment as early as 3 days after surgery , although the surgeon cut the inward curling edge of his retina during the surgery . these results indicate that this modified surgery might have low success rates specifically among children with large peripheral retinal defects . the va results of retinectomy in previous case series have varied markedly , with va improving in 2089% of patients but deteriorating in 1341% of patients [ 20 , 21 ] . in a mixed series of 41 eyes , lewis and iverson identified larger retinectomies as a risk factor for poorer final visual function [ 22 , 23 ] . in the current study , stabilization or improvement of va this result might be attributed to the reduced number of cuts , which were limited to the shortened retina , and might indicate that this novel surgery remains worthwhile . retinectomy has been advocated to treat intractable glaucoma because the absorption of intraocular fluid from the large area of the exposed rpe can reduce iop [ 24 , 25 ] . in the silicone study , hypotony occurred approximately twice as frequently in eyes undergoing retinectomy than in those that did not ( 35% versus 17% ) . recent studies reported hypotony rates in retinectomy case series ranging from 11% to 43% [ 1214 ] . the current study did not observe any cases exhibiting hypotony , and 5 patients displayed slight intraocular hypertension . the preserved retina between the incisions helped to cover the underlying rpe , potentially reducing the absorption of intraocular fluid . the blades of the scissors are typically tangentially directed into the subretinal space to lift the retina away from the rpe . however , no intraoperative hemorrhage was observed in the current study . using this modified procedure , more importantly , the cut was limited to the detached retina , avoiding the dangerous separation of the normal retina from the choroid . this modified retinotomy is based on meticulous dissection of vitreous base , preretinal and subretinal membranes . to inferior recurrent retinal detachment induced by vitreous base fibrosis alone , this approach is unnecessary and will cause multiple iatrogenic retinal tears . it should be noted that we did not carry out random clinical trials to compare the difference between relaxing retinectomy and this modified retinotomy . besides , side effect as postsurgery hypotony is avoidable in relaxing retinectomy if the retinectomy is large circumferentially but not anteroposteriorly . one other important limitation of this procedure was that all the eyes continued to be filled with silicone oil . eyes that require retinotomy are usually accompanied with severe pvr and extensive atrophy of retina . in retrospective studies recruiting 56 and 145 patients for retinectomies , silicone oil is still the tamponade agent in the eyes of 50% patients [ 14 , 26 ] . we attempted to remove the silicone oil in patients whose retina appears to be well attached . however , considering the severe ocular trauma and retinal atrophy , we have to maintain the silicone oil tamponade in place to guarantee a surgical benefit to the patients . in conclusion , radial retinotomies with endodiathermy was shown to be feasible , effective , and safe in selected cases of inferior contracted retina without vitreous base fibrosis over a 6-month observation period .

purpose . retinal redetachment of silicone oil - filled eyes continues to be a frustrating condition that typically requires retinectomy . we proposed radial retinotomy as a potentially less invasive surgery . here , we preliminarily explored its feasibility , efficacy , and safety . methods . totally 9 eyes of 9 consecutive patients were included in a prospective noncomparative trial . a series of retinotomies were created by endodiathermy in a radial pattern to relax the foreshortened retina . the eye was refilled with fresh silicone oil . the treated eyes were examined via visual acuity ( va ) tests , tonometry , slit - lamp microscopy , and fundus photography during a 6-month observation period . results . the procedure was completed in an average of 28 minutes from silicone oil removal to fresh silicone oil placement . fundus photography demonstrated that 7 of the 9 eyes ( 78% ) exhibited retinal reattachment . on average , va was significantly improved within the first 2 weeks ( p = 0.02 ) and remained stable for the following 6 months . the change in intraocular pressure was not significant ( p = 0.76 ) , and no adverse event was observed ( 0% ) . conclusion . radial retinotomies with endodiathermy were shown to be feasible , effective , and safe in selected cases of inferior contracted retina without vitreous base fibrosis over a 6-month observation period . this trial is registered with nct02201706 .

corneal hydrops is a condition of acute stromal edema that occurs after a rupture in descemet 's membrane . this is not an uncommon sequelae of late keratoconus and is a frequent indication for penetrating keratoplasty ( pkp ) . approximately , 3% of keratoconus patients experience one or more episodes of corneal hydrops.1 rarely , it can occur in a corneal graft and is frequently an extension of a break in descemet 's membrane from the host cornea to the donor graft . this has been reported in two separate case reports.23 to the author 's knowledge , hydrops in a donor corneal graft has not been described outside of the context of keratoconus . we present two patients with no history of keratoconus that developed acute hydrops in the donor corneal graft . a 44-year - old human immunodeficiency virus positive hispanic male with undetectable viral load presented to the clinic with a 5-week history of decreased vision , 1 year after undergoing pkp in the left eye . the patient had a history of herpes keratitis complicated by severe glaucoma in that eye . he had received a corneal transplant 2 years before for corneal decompensation . on the day of presentation , his best - corrected vision was 20/20 in the right eye and hand - motion at 6 feet in the left eye . his corneal graft was very edematous , opaque , and protuberant making it impossible to measure the intraocular pressure in the left eye . ocular coherence tomography ( oct ) of the anterior segment showed a deep stromal cystic cavity consistent with hydrops in the left eye [ figure 1a ] . ultrasound biomicroscopy ( ubm ) of the anterior segment revealed a descemet 's membrane detachment and severe corneal edema with stromal cystic cavities [ figure 1b ] . , the glaucoma drainage tube was noted to be positioned close to the cornea and was trimmed under the host cornea rim . pathology examination revealed a rupture and recoil of descemet 's membrane centrally and a near perforation with a substantial amount of corneal stromal edema , consistent with hydrops [ figure 2 ] . ( a ) high - definition anterior segment optical coherence tomographic image of corneal hydrops . there is marked fluid within the corneal stroma ( b ) ultrasound biomicroscopy of acute corneal hydrops . note the apparent break in descemet 's membrane pathology slide showing a focal break in descemet 's membrane and large amounts of stromal edema a 91-year - old caucasian male with a history of pkp in the right eye was referred to the clinic for descemetocele evaluation . , he had light perception with projection in the right eye and 20/25 best - corrected vision in the left eye . intraocular pressure was not measurable in the right eye and was 14 mm hg in the left eye . a very large pedunculated cyst was seen within the corneal graft in the right eye [ figure 3 ] . oct of the anterior segment revealed a deep stromal cystic cavity consistent with the hydrops . ubm of the anterior segment showed the presence of an anterior chamber intraocular lens and a large cystic cavity with a suspected break in the superior region of descemet 's membrane . the anterior chamber intraocular lens was an open - loop kelman - style and was left in place . a 44-year - old human immunodeficiency virus positive hispanic male with undetectable viral load presented to the clinic with a 5-week history of decreased vision , 1 year after undergoing pkp in the left eye . the patient had a history of herpes keratitis complicated by severe glaucoma in that eye . he had received a corneal transplant 2 years before for corneal decompensation . on the day of presentation , his best - corrected vision was 20/20 in the right eye and hand - motion at 6 feet in the left eye . his corneal graft was very edematous , opaque , and protuberant making it impossible to measure the intraocular pressure in the left eye . ocular coherence tomography ( oct ) of the anterior segment showed a deep stromal cystic cavity consistent with hydrops in the left eye [ figure 1a ] . ultrasound biomicroscopy ( ubm ) of the anterior segment revealed a descemet 's membrane detachment and severe corneal edema with stromal cystic cavities [ figure 1b ] . , the glaucoma drainage tube was noted to be positioned close to the cornea and was trimmed under the host cornea rim . pathology examination revealed a rupture and recoil of descemet 's membrane centrally and a near perforation with a substantial amount of corneal stromal edema , consistent with hydrops [ figure 2 ] . ( a ) high - definition anterior segment optical coherence tomographic image of corneal hydrops . there is marked fluid within the corneal stroma ( b ) ultrasound biomicroscopy of acute corneal hydrops . note the apparent break in descemet 's membrane pathology slide showing a focal break in descemet 's membrane and large amounts of stromal edema a 91-year - old caucasian male with a history of pkp in the right eye was referred to the clinic for descemetocele evaluation . the patient reported frequent eye rubbing . on examination , he had light perception with projection in the right eye and 20/25 best - corrected vision in the left eye . intraocular pressure was not measurable in the right eye and was 14 mm hg in the left eye . a very large pedunculated cyst was seen within the corneal graft in the right eye [ figure 3 ] . oct of the anterior segment revealed a deep stromal cystic cavity consistent with the hydrops . ubm of the anterior segment showed the presence of an anterior chamber intraocular lens and a large cystic cavity with a suspected break in the superior region of descemet 's membrane . the anterior chamber intraocular lens was an open - loop kelman - style and was left in place . hydrops within a corneal donor graft is a rare complication after corneal transplant for patients with a history of keratoconus . in prior reports , it was believed to occur in patients who developed a tear in descemet 's membrane within the host corneal rim . this break would then extend into the donor cornea and allow the cornea to imbibe the fluid . corneal edema after corneal transplant can also be secondary to corneal graft failure from endothelial dysfunction or corneal transplant rejection . in those occasions the large fluid clefts in this case series demonstrated by anterior segment oct and ubm show focal collections of fluid rather than a diffuse distribution consistent with corneal edema secondary to rejection or endothelial failure . those cases highlight the importance of clinical suspicion and thorough diagnostic evaluation to rule out these other causes since the treatment would be markedly different . we could not find other reports of patients without a history of keratoconus who developed hydrops in the donor corneal graft . an anterior chamber intraocular lens and a glaucoma drainage tube were the suspected culprits in the two patients who were surgically treated . the common feature in these patients was eye rubbing , which might be implicated in the unexpected dislocation of intraocular devices and damage of the descemet 's membrane .

a 44-year - old hispanic male and 91-year - old caucasian male presented to the clinic with acute vision loss and pain years after penetrating keratoplasty ( pkp ) . neither patient had a history of keratoconus . both patients had a history of eye rubbing and intraocular device present in the anterior chamber . the first patient had a history of a glaucoma drainage tube and the second patient had an anterior chamber intraocular lens implanted . anterior segment ocular coherence tomography showed deep stromal cystic cavities . both patients exhibited breaks in the endothelium by ultrasound biomicroscopy and the histopathologic examination after repeat pkp . those findings were most consistent with acute corneal hydrops in the donor graft .

candida was the third most common pathogen in a point prevalence study including icu patients from 75 countries . the clinical presentations include candidemia , spondylodiscitis , endophtalmitis , chronic and acute disseminated candidiasis , endocarditis and meningitis . the most common infecting species are candida albicans , followed by candida tropicalis and candida glabrata . current recommendations for treatment of candida osteomyelitis are fluconazole 6 mg / kg daily for 612 months , which may be preceded by liposomal amphotericin b ( l - amb ) 35 mg / kg for at least 2 weeks . treatment of bone infections with c. albicans is described with a high cure rate , whether treated medically or with surgery . however , no randomized clinical trials on candida bone and joint infections have been undertaken , and the management guidelines are based on case reports . we report a case of c. albicans candidemia complicated by spondylitis with no effect of fluconazole combined with caspofungin and with a relapse after 6 weeks of l - amb . prolonged treatment ( 6 months ) with high dose ( 6 mg / kg ) l - amb combined with flucytosine ( 5-fc ) for 11 weeks cured the patient . to our knowledge , relapse of c. albicans bone infection after fluconazole combined with an echinocandin has not previously been described . a 32 year old pregnant woman ( 11 weeks ) , previously healthy , was hospitalized with hyperemesis . she developed sepsis and disseminated intravascular coagulation and was thus admitted to the intensive care unit ( day 0 ) . c. albicans was cultured from blood ( 6 positive out of 6 blood cultures ) and urine . mg / l and caspofungin 0.125 mg / l , both performed by e - test following the manufacturers recommendations ( etest biomerieux , france ) , anidulafungin 0.015 mg / l , fluconazole 0.125 mg mg / l and 5-fc 0.125 mg / l using the eucast reference method edef 7.2 . treatment with l - amb ( initially 4 mg / kg , subsequently 2 mg / kg due to creatinine increase to 340 mol / l ) , caspofungin 70 mg and broad - spectrum antibiotics was initiated . the patient was treated with the combination for 12 days , and l - amb and antibiotics were continued for 9 more days . on day 18 , she was discharged from intensive care unit to the department of gynecology and obstetrics with a fluctuating c - reactive protein ( crp ) ( 400600 mg she lost her fetus , and her kidney function never recovered making her dependent on hemodialysis . on day 43 , she was discharged from the hospital , with no fever , a wbc of 7.6910 l and a crp of 188 , she was admitted to department of infectious diseases with lumbar back pain located over the lumbar spine and pyrexia . the crp was 150 mg / l , and a bone scintigraphy on day 85 showed uptake around the right hip , left sacroiliac joint and lower spine . magnetic resonance imaging ( mri ) revealed vertebral infection at th1112 and l34 with no involvement of the discs or spinal cavity , and a fungal etiology was suspected ( day 90 ) ( fig . 1 ) . treatment with caspofungin ( 70 mg as loading dose , subsequently 50 mg ) and fluconazole ( initially 200 mg daily due to kidney function , subsequently 400 mg daily ) was initiated . pcr and culture from the biopsy ( obtained one day after initiation of antifungal treatment ) were negative . the back pain progressed during the next 14 days of treatment , the crp was only declined from 100 to 60 mg / l and a new mri showed no regression ( day 106 ) ( fig . 2 ) . the patient was considered to have a treatment failure , and treatment was changed to l - amb 4 mg / kg / day . the patient slowly improved during six weeks of treatment . when discharged on day 148 , she was asymptomatic and with normal crp ( < 8 she was continuously in hemodialysis ( hd ) three times a week , and during the following two months , 600 mg of fluconazole was administered after each hd . two weeks after the last dose of fluconazole ( day 233 ) , the patient experienced malaise , vomiting , fluctuating temperature ( 3738 c ) and low back pain radiating to right hip . after another two weeks ( day 247 ) , she was readmitted to hospital with increasing back pain and pyrexia ( 39.5 c ) . crp was < 8 mg / l , increasing in one day to 80 mg / l , and erythrocyte sedimentation rate ( esr ) was 50 ( normal < 20 mm hour ) . l - amb 4 mg / kg daily was initiated on day 252 and led to temporal relief of her symptoms . after four weeks of treatment , the pain returned and increased , and the l - amb dose was increased to 5 mg / kg a day . , l - amb dose was increased to 6 mg / kg and combined with 5-fc ( 3500 mg , corresponding to approx . 50 mg / kg ) after each hd ( 3/week ) for 11 weeks ( from day 301 to day 378 ) . when 5-fc treatment was discontinued , the pet - ct was unchanged , mri showed minimal regression , but a bone scintigraphy showed regression of the th12-l1 uptake ( fig . 4 ) . high dose l - amb ( 6 mg / kg ) was continued for 3 more months until day 465 ( a total period of 6 months ) . at this time , leukocyte scintigraphy as well as mri showed further reduced enhancement and edema of l34 ( fig . 5 ) . she was considered for a kidney transplant requiring full clearance of the fungal infection proven before transplantation . three months later , esr remained normal ; bone scintigraphy showed minimal activity , and no progression was detected on mri . she successfully received a family donor kidney transplant six months after her anti - fungal treatment was terminated ( day 678 ) ( fig . 6 ) , gave birth to a healthy child two years after transplant and has now been without signs of relapse for 5 years ( fig . risk factors for candidaemia have been identified ; critical illness with a prolonged stay at the icu , abdominal surgery , low birth weight , acute necrotizing pancreatitis , malignant disease , organ transplantation , candida colonization , treatment with broad - spectrum antibiotics , central venous catheter , receipt of parental nutrition , hd , burns and neutropenia / immunosuppression . for the vertebral infection with candida , prior to the candidemia and the bone infection , the patient was treated in an icu with broad - spectrum antibiotics , received hd and had a central intravascular catheter . for candidemia , the use of an echinocandin and removal of central venous lines were significantly associated with improved outcome in a recent quantitative review of randomized trials but this case clearly demonstrates that the combination of caspofungin and fluconazole was not effective . a case report has described failure of fluconazole monotherapy in sternal osteomyelitis , subsequently cured with amphotericin b , but there was no information regarding the susceptibility of the c. albicans isolates . the c. albicans in the blood cultures from our patient was susceptible to all antifungal agents , and the candida septicemia resolved on 2 mg / kg liposomal amphotericin b , a low dose according to current guidelines . it is uncertain whether a higher dose or longer treatment with amphotericin b could have prevented this . according to recent guidelines , the appropriate treatment would have been fluconazole 6 mg / kg for 612 months possibly preceded by l - amb 35 mg / kg for at least two weeks . hence , according to todays recommendations , the fluconazole duration ( two months ) was suboptimal which may have contributed to the unsuccessful outcome . a review of 53 cases of osteomyelitis reported a mean treatment duration of only 54.9 days . pharmacokinetic / pharmacodynamic animal models suggest that the combination of amphotericin b and 5-fc has an additive effect when treating disseminated candidiasis . the additive fungicidal effect of 5-fc was neglectable when the amphotericin b dose was high . furthermore , short course treatment with l - amb has shown to be effective in a few cases , suggesting that this drug may be superior in bone infections . a combination of 5-fc and fluconazole successfully treated a case of candida discitis . 5-fc has great penetrance due to its small size and is thus recommended in combination with amphotericin b for treatment of candida endocarditis , candida cns - infections and ocular candidiasis . further studies are needed in order to determine the role of this drug in the therapy of candida osteomyelitis . in conclusion , although it is not possible to determine whether it was the increased dose , prolonged therapy of l - amb or the addition of 5-fc that finally resulted in eradication of the infection , it is likely that the combination of the three factors played in concert . in cases with a relapse of candida osteomyelitis , prolonged therapy with high dose l - amb combined with 5-fc seems to be an effective treatment option . none related to this particular work , but outside this maiken cavling arendrup has the following disclosures : mca has received research grants and served on the speakers board for astellas pharma us , gilead sciences , msd and pfizer , and been a consultant for gilead , msd and pcovery .

a patient with candida spondylitis failed two weeks of fluconazole combined with caspofungin , and the infection relapsed despite six weeks of liposomal amphotericin b followed by two months of fluconazole . six months therapy with high dose liposomal amphotericin b combined with flucytosine effectively cured the patient .

a total of 150 tcl patients diagnosed at the cancer institute & hospital , chinese academy of medical sciences between january 1992 and april 2009 were enrolled in this study . the subjects had t - lymphoblastoma or leukemia , anaplastic large cell lymphoma , mycosis fungoides , adult t - cell leukemia or tcl , and peripheral tcl . all patients underwent chop regimen ( cyclophosphamide , adriamycin , vincristine , and prednisone ) or chop - based chemotherapy . patients ' clinical information , including age , sex , tumor classification and stage , and ipi were obtained from medical records . overall survival was measured from the date of diagnosis to the date of last follow - up or death . whether and when a patient died were obtained from inpatient and outpatient records , patients ' families , or local public security census register office through follow - up telephone calls . this study was approved by the institutional review board of chinese academy of medical sciences cancer institute . genomic dna was extracted from patient peripheral blood samples or paraffin - embedded lymphoma biopsy samples . blood dna kit ( catalog number : dp319 - 02 ) was provided by tiangen biochemical technology co. , ltd . the wizard magnesil genomic dna purification system ( catalog number : md1490 ) was provided by promega company . snps within the tnfrsf genes and their 2-kb upstream and downstream with the minor allele frequency ( maf ) 0.05 were selected according to the hapmap database of chinese population ( ncbi build 36 ) . all snps on the same chromosome were compared pairwise to measure the linkage disequilibrium , and r > 0.8 was used to determine the tag snps . the tag snps located in gene regulatory and/or coding regions were genotyped and relevant association analysis was performed . by using these criteria , 38 snps in 18 tnfrsf genes were chosen and genotyped using the sequenom platform by capitalbio co. ( beijing , china ) . cox regression under a log - additive genetic model was performed for genotypes with adjustment for covariates , including sex and ipi score , that might influence patients ' survival . hazard ratios ( hrs ) and their 95% confidence intervals ( cis ) were calculated . kaplan - meier survival estimates were plotted and p values were assessed using log - rank tests . the survival package in r a total of 150 tcl patients diagnosed at the cancer institute & hospital , chinese academy of medical sciences between january 1992 and april 2009 were enrolled in this study . the subjects had t - lymphoblastoma or leukemia , anaplastic large cell lymphoma , mycosis fungoides , adult t - cell leukemia or tcl , and peripheral tcl . all patients underwent chop regimen ( cyclophosphamide , adriamycin , vincristine , and prednisone ) or chop - based chemotherapy . patients ' clinical information , including age , sex , tumor classification and stage , and ipi were obtained from medical records . overall survival was measured from the date of diagnosis to the date of last follow - up or death . whether and when a patient died were obtained from inpatient and outpatient records , patients ' families , or local public security census register office through follow - up telephone calls . this study was approved by the institutional review board of chinese academy of medical sciences cancer institute . genomic dna was extracted from patient peripheral blood samples or paraffin - embedded lymphoma biopsy samples . blood dna kit ( catalog number : dp319 - 02 ) was provided by tiangen biochemical technology co. , ltd . the wizard magnesil genomic dna purification system ( catalog number : md1490 ) was provided by promega company . snps within the tnfrsf genes and their 2-kb upstream and downstream with the minor allele frequency ( maf ) 0.05 were selected according to the hapmap database of chinese population ( ncbi build 36 ) . all snps on the same chromosome were compared pairwise to measure the linkage disequilibrium , and r > 0.8 was used to determine the tag snps . the tag snps located in gene regulatory and/or coding regions were genotyped and relevant association analysis was performed . by using these criteria , 38 snps in 18 tnfrsf genes were chosen and genotyped using the sequenom platform by capitalbio co. ( beijing , china ) . cox regression under a log - additive genetic model was performed for genotypes with adjustment for covariates , including sex and ipi score , that might influence patients ' survival . hazard ratios ( hrs ) and their 95% confidence intervals ( cis ) were calculated . kaplan - meier survival estimates were plotted and p values were assessed using log - rank tests . the survival package in r the clinical characteristics of the patients are presented in table 1 . among the 150 patients , the numbers of stage i , ii , iii , and iv patients were 37 , 49 , 19 , and 45 , respectively . a total of 149 patients had ipi scores : 38 scored 0 ; 51 scored 1 ; 40 scored 2 ; 16 scored 3 ; and 4 scored 4 . by february 2011 , 69 patients ( 46.0% ) died of tcl : 16 had precursor tcl ( median survival : 22 months ; 5-year survival rate : 18% ) , and the other 53 had mature tcl ( median survival : 48 months ; 5-year survival rate : 47.8% ) . precursor t - cell neoplasm includes precursor t - lymphoblastic lymphoma / leukemia ; mature t - cell neoplasm includes peripheral t - cell lymphoma , anaplastic large - cell lymphoma , mycosis fungoides , and adult t - cell leukemia / lymphoma . mean survival time is provided because median survival time is not reached . in total , 38 tag snps in 18 tnfrsf genes were genotyped ( table 2 ) . the results of association analysis between these 38 snps and the survival of tcl patients are presented in table 3 . three snps ( rs3759333c > t at ltr , rs2017662c > t at tnfrsf17 , and rs2071336c > t at tnfrsf17 ) were associated with the tcl patient survival ( table 4 ) . . the total number of individuals may not be the same because of genotyping failure . the 5-year survival rates of patients carrying the rs3759333cc , tc , and tt genotypes were 51.7% , 43.0% , and 25.2% , respectively . the hr of death for patients carrying the tt genotype was 2.46 compared to patients with the cc genotype ( 95% ci : 1.22 - 4.97 ; p = 0.012 ) . the 5-year survival rates of patients carrying the rs2017662cc , tc , and tt genotypes were 34.3% , 56.7% , and 66.7% , respectively . the hr of death for patients carrying the tt or tc genotype was 0.53 compared to those carrying the cc allele ( 95% ci : 0.29 - 0.97 ; p = 0.039 ) . the 5-year survival rates of patients carrying the rs2071336cc and tc genotypes were 38.9% and 63.2% , respectively . the hr of death for patients carrying the tt or tc genotype was 0.45 compared to those carrying the cc allele ( 95% ci : 0.21 - 1.00 ; p = 0.049 ) . the clinical characteristics of the patients are presented in table 1 . among the 150 patients , the numbers of stage i , ii , iii , and iv patients were 37 , 49 , 19 , and 45 , respectively . a total of 149 patients had ipi scores : 38 scored 0 ; 51 scored 1 ; 40 scored 2 ; 16 scored 3 ; and 4 scored 4 . by february 2011 , 69 patients ( 46.0% ) died of tcl : 16 had precursor tcl ( median survival : 22 months ; 5-year survival rate : 18% ) , and the other 53 had mature tcl ( median survival : 48 months ; 5-year survival rate : 47.8% ) . precursor t - cell neoplasm includes precursor t - lymphoblastic lymphoma / leukemia ; mature t - cell neoplasm includes peripheral t - cell lymphoma , anaplastic large - cell lymphoma , mycosis fungoides , and adult t - cell leukemia / lymphoma . in total , 38 tag snps in 18 tnfrsf genes were genotyped ( table 2 ) . the results of association analysis between these 38 snps and the survival of tcl patients are presented in table 3 . three snps ( rs3759333c > t at ltr , rs2017662c > t at tnfrsf17 , and rs2071336c > t at tnfrsf17 ) were associated with the tcl patient survival ( table 4 ) . . the total number of individuals may not be the same because of genotyping failure . adjusted for sex , subtype , and ipi score . the total number of individuals may not be the same because of genotyping failure . the 5-year survival rates of patients carrying the rs3759333cc , tc , and tt genotypes were 51.7% , 43.0% , and 25.2% , respectively . the hr of death for patients carrying the tt genotype was 2.46 compared to patients with the cc genotype ( 95% ci : 1.22 - 4.97 ; p = 0.012 ) . the 5-year survival rates of patients carrying the rs2017662cc , tc , and tt genotypes were 34.3% , 56.7% , and 66.7% , respectively . the hr of death for patients carrying the tt or tc genotype was 0.53 compared to those carrying the cc allele ( 95% ci : 0.29 - 0.97 ; p = 0.039 ) . the 5-year survival rates of patients carrying the rs2071336cc and tc genotypes were 38.9% and 63.2% , respectively . the hr of death for patients carrying the tt or tc genotype was 0.45 compared to those carrying the cc allele ( 95% ci : 0.21 - 1.00 ; p = 0.049 ) . in this study , we investigated the association bewteen snps in tnfrsf genes and prognosis of tcl . the binding of tnf to tnfr can induce two opposite signaling pathways : one activates cell death process through the combination of tnfr i and fas - associated death domain ( fadd ) , leading to cell apoptosis ; the other activates nuclear factor - kappa b ( nf - kb ) and c - jun n - terminal kinase ( jnk ) through the combination of tnfr and tnfr - associated factors ( traf ) , promoting cell survival and proliferation . hence , the complex biological effects induced by the binding of tnf to tnfr play significant roles in cell fate . it has been shown that tnfr family members are involved in the development and progression of malignant tumors and play an important role in cell apoptosis and inflammatory reactions , . previous studies have reported that snps in the tnf and tnfrsf genes are associated with susceptibility to human cancers , including nhl. wang et al . systematically examined the relationship between 500 tag snps in tnf and tnfrsf genes and susceptibility to nhl and noted that the snp in 6p21.3 region was related with patient survival . this study systematically analyzed the association between tag snps in 18 tnfrsf genes and the survival of patients with tcl . our results indicated that three snps in the ltr and tnfrsf17 genes were associated with the survival of tcl patients . ltr plays an essential role in the genesis of secondary lymph tissues and t cells and can activate the nf - kb pathway and induce cellular physiologic changes. tnfrsf17 , mainly expressed in mature b cells , plays a vital role in b - cell development and immune response . tnfrsf17 can directly combine with cytokine baff ( also known as b - cell activating factor ) to activate the nf - kb and mapk / jnk pathways . moreover , tnfrsf17 can combine with traf family members to induce cell apoptosis and proliferation . other studies have also shown that tnfrsf17 can promote cell apoptosis by t - cell dependent activation of memory b cells . rs3759333 located at ltr might affect the binding of transcriptional factors to dna , influencing ltr transcription , thereby resulting in the differentiation of unconventional t cells expressing the t - cell receptor . such unconventional t cells play a vital role in regulating host immune responses , including resisting viral infection and cancer cell invasion . for example , synonymous mutation may create microrna - binding sites to facilitate mrna degradation and influence the efficiency of protein translation , eventually affecting the expression of gene products . however , more studies need to be done to elucidate the exact biological mechanism underlying the relationship between genetic variations and the survival of tcl patients . in summary , we found 3 snps in 18 tnfrsf genes associated with the survival of patients with tcl . our results might have potential application in clinical care of tcl patients . however , further studies with large sample size are needed to confirm our results .

the prognosis of t - cell lymphoma ( tcl ) has been shown to be associated with the clinical characteristics of patients . however , there is little knowledge of whether genetic variations also affect the prognosis of tcl . this study investigated the associations between single nucleotide polymorphisms ( snps ) in tumor necrosis factor receptor superfamily ( tnfrsf ) genes and the survival of patients with tcl . a total of 38 tag snps in 18 tnfrsf genes were genotyped using sequenom platform in 150 patients with tcl . kaplan - meier survival estimates were plotted and significance was assessed using log - rank tests . cox proportional hazard models were used to analyze each of these 38 snps with adjustment for covariates that might influence patient survival , including sex and international prognostic index score . hazard ratios ( hrs ) and their 95% confidence intervals ( cis ) were calculated . among the 38 snps tested , 3 were significantly associated with the survival of patients with tcl . these snps were located at ltr ( rs3759333c > t ) and tnfrsf17 ( rs2017662c > t and rs2071336c > t ) . the 5-year survival rates were significantly different among patients carrying different genotypes and the hrs for death between the different genotypes ranged from 0.45 to 2.46 . these findings suggest that the snps in tnfrsf genes might be important determinants for the survival of tcl patients .

pc12 cells were transiently transfected using lipofectamine 2000 ( invitrogen ) ( 1:3 dna to lipofectamine ratio ) , with gfp - fused wt or mutated syns or with gfp - containing control vector ; the quantity of dna was chosen according to previously reported data , as the syn expression level was low and comparable to the average physiological levels of the protein in the brain . after sds - page , proteins were transferred onto polyvinylidene difluoride membranes and immunostained with the following antibodies : anti- tubulin mouse igg ( clone b-512 , sigma - aldrich ) ; anti - tyrosinated tubulin mouse igg ( clone tub-1a2 , sigma - aldrich ) . immunostaining was revealed by enhanced chemiluminescence super - signal west pico chemiluminescent , pierce ) . quantification was performed by image j software ( nih ) and subtracting the background around bands . transfected pc12 cells were fixed with cold methanol ( 6 min at 20c ) ; to remove unassembled tubulin , before fixation , some slides were extracted in pem buffer ( 80 mm k - pipes , 5 mm egta , 1 mm mgcl2 , ph 6.8 , containing protease inhibitors ) with 0.5% triton x-100 , 0.2 m nacl and 10 m paclitaxel ( sigma - aldrich ) . pc12 cells were stained with anti- tubulin mouse igg or anti - tyrosinated tubulin mouse igg and alexa fluor 568 donkey anti - mouse . by using image j software , total fluorescence intensity the region of interest was manually drowned and the analyses of the surface extension revealed that there were no significant differences between control cultures and wt - expressing pc12 cells ( data not shown ) . pc12 cells were transiently transfected using lipofectamine 2000 ( invitrogen ) ( 1:3 dna to lipofectamine ratio ) , with gfp - fused wt or mutated syns or with gfp - containing control vector ; the quantity of dna was chosen according to previously reported data , as the syn expression level was low and comparable to the average physiological levels of the protein in the brain . after sds - page , proteins were transferred onto polyvinylidene difluoride membranes and immunostained with the following antibodies : anti- tubulin mouse igg ( clone b-512 , sigma - aldrich ) ; anti - tyrosinated tubulin mouse igg ( clone tub-1a2 , sigma - aldrich ) . immunostaining was revealed by enhanced chemiluminescence super - signal west pico chemiluminescent , pierce ) . quantification was performed by image j software ( nih ) and subtracting the background around bands . transfected pc12 cells were fixed with cold methanol ( 6 min at 20c ) ; to remove unassembled tubulin , before fixation , some slides were extracted in pem buffer ( 80 mm k - pipes , 5 mm egta , 1 mm mgcl2 , ph 6.8 , containing protease inhibitors ) with 0.5% triton x-100 , 0.2 m nacl and 10 m paclitaxel ( sigma - aldrich ) . pc12 cells were stained with anti- tubulin mouse igg or anti - tyrosinated tubulin mouse igg and alexa fluor 568 donkey anti - mouse . by using image j software , total fluorescence intensity the region of interest was manually drowned and the analyses of the surface extension revealed that there were no significant differences between control cultures and wt - expressing pc12 cells ( data not shown ) . the authors are grateful to all the members of the lab and to all the people which contribute in delineating the syn functions . this work was supported by fondazione grigioni per il morbo di parkinson , milan , italy [ to g.c . ] ; dote ricerca ,

abstractthe partitioning between tubulin dimers and microtubules is fundamental for the regulation of several neuronal activities , from neuronal polarization and processes extension to growth cone remodelling . this phenomenon is modulated by several proteins , including the well - known microtubule destabilizer stathmin . we recently demonstrated that -synuclein , a presynaptic protein associated to parkinson 's disease , shares structural and functional properties with stathmin , and we showed that -synuclein acts as a foldable dynamase . here , we pinpoint the impact of wild type -synuclein on the partitioning between tubulin dimers and microtubules and show that parkinson 's disease - linked mutants lose this capability . thus , our results indicate a new role for -synuclein in regulating microtubule system and support the concept that microtubules and -synuclein are partners in the modulation of neuronal health and degenerative processes . furthermore , these data strengthen our hypothesis of the existence of a functional redundancy between -synuclein and stathmin .

the day before the surgery patients were informed about the epidural anesthesia technique . for premedication , midazolam 0.07 mg / kg and atropine 0.01 mg / kg were administered intramuscular ( i m ) 45 minutes before the surgical procedure . extremely obese patients ( body mass index > 40 ) , those who refused to join the study , patients who had contraindications for neuraxial block or had complications during the operation such as respiratory depression or unsuccessful block were excluded from the study . ramsey scale was used as a measure of sedation : 1 = anxious , agitated , restless ; 2 = cooperative , oriented , tranquil ; 3 = responds to comments only ; 4 = brisk response to light glabellar tap or loud noise ; 5 = sluggish response to light glabellar tap or loud noise ; and 6 = no response . the patients were given oxygen at the rate of 5 liters / minute through a face mask . after setting up monitoring with non - invasive arterial pressure , ecg , and finger pulse oximetry and using an aseptic technique , with the patient in sitting position , 2 ml of 1% lidocaine was infiltrated into the subcutaneous area . the epidural space was identified at the lumbar 3 - 4 or lumbar 4 - 5 interspace by the loss of resistance technique using midline approach and an 18-gauge tuohy needle with cephalad orientation . perifix soft tip 701 filter set ( b braun melsungen ag ) and 20 gauge epidural catheter with three lateral eyes were used . inadvertent dural puncture was diagnosed by the free flow through the needle and checking the warmness of cerebrospinal fluid ( csf ) . following dural puncture we verified this place as epidural place by 0.9% saline injection and after negative aspiration for blood or csf , an epidural catheter was inserted . after test dose of 0.1 ml / kg of 0.25% bupivacaine with 1:200.000 epinephrine , patients were observed for any increase in heart rate that would indicate intravascular injection of epinephrine and were questioned about tinnitus , dizziness , metallic taste in mouth or sudden warmth or numbness in legs . if these responses were negative after 10 minutes we injected 16 cc of the solution of bupivacaine 0.5% with 100 mcg fentanyl . the patients were observed throughout 72 hours in the postoperative period and questioned about pdph . a 100 point visual analog scale ( vas ) was used to score the postoperative pain level . 0 when the pain score was above 30 in vas , a bolus dose of 3 mg morphine with 15 mg of 0.5% bupivacaine in 15 ml saline via epidural catheter was administered . all patients received an additional 1 gr oral paracetamol every six hour in order to obtain multimodal analgesia . by this method when pdph was occurred , bed rest , hydration , analgesics and caffeine were recommended . bed rest for one week , hydration as 3 liters per day orally , paracetamol or non - steroidal anti - inflammatory drugs as analgesics and three cups of coffee per day were recommended . 3 patients from hip arthroplasty group and 2 patients from knee arthroplasty group had accidental dural puncture . mean age was 64 4.8 ; 83 patients were male ( 45% ) and 99 patients were female ( 55% ) . 21% of patients were included in asa 1 group , 43% in asa 2 group and finally 36% in asa 3 group ( table 1 ) . the incidence of dural puncture was 2.1% . 1 of the patients who had accidental dural puncture had pdph ( 20% ) ( table 2 ) . we searched the possibility of intracranial hemorrhage or any tumors but there was no abnormality in cranial magnetic resonance images . as epidural block decreases mortality , cardiovascular morbidity , incidence of deep vein thrombosis , pulmonary embolism and provides a short hospital stay ; it is widely used for hip and knee replacement surgeries.3 when dural puncture occurs , several management methods are applied by physicians . the anesthesia can be converted to spinal anesthesia with subarachnoid injection via the epidural needle ; general anesthesia can be applied or the epidural catheter can be inserted from a different intervertebral area . nevertheless patients are exposed to be pierced second time and no precaution for pdph is taken by this method . cesur et al lessened the incidence of pdph by epidural catheter implantation but the disadvantage of this study was again the pain of patients exposed to repeated epidural needle insertion.4 intrathecal catheterization by epidural catheter is another management skill.5 subarachnoid microcatheterisation seems to be a rapid and effective method . in several retrospective studies it is proved that it reduces pdph and epidural blood patch incidence.6 inserting epidural catheter into subarachnoid space , giving back csf through epidural needle and sf injection by intrathecal catheter were also attempted . it is a useful method in preventing dural puncture when the distance between skin and ligamentum flavum is correctly measured.7 fiberoptic - guided epidural anesthesia is another new technique and seems to be a safe method.8 on the other hand , one needs time to gain experience on its usage . the incidence is nearly 70%.9 being young , female , or pregnant , using thicker needle , and number of dural holes , increase this incidence.10 therefore migraine , hypertension , pneumocephaly , sinusitis , meningitis , cortical venous thrombosis and intracerebral pathologies must be excluded when any kind of headache occurs . drawing back the needle after inadvertent dural puncture , provides us the facility to place an epidural catheter . when the patient 's benefits are considered , as a rapid and safe method , we recommend this technique after accidental dural puncture . although the final epidural space can be checked by a test dose of bupivacaine or lidocaine , there is a potential risk for high sensorial level for the patients . this disadvantage can be eliminated by anes - thesiologists experience . in our experience of 5 cases of inadvertent dural puncture however , a large double - blind randomized trial is necessary to prove its ultimate safety . in conclusion according to our experience for 5 cases of inadvertent dural puncture , we found it safe to practice . however , a large double blind randomized trial is necessary to prove its ultimate safety . kts and as carried out the design and coordinated the study and prepared the manuscript . fk and vf provided assistance in the design of the study and participated in manuscript preparation .

background : accidental dural puncture during epidural blockade is a rare complication . since postdural puncture headache ( pdph ) is the most frequent complication , a wisely management method will also reduce the incidence of pdph.methods:five patients who had inadvertent dural puncture during the epidural procedure before hip or knee arthroplasty were included in this study . after dural puncture we drew back the epidural needle and placed an epidural catheter into the epidural space.results:epidural anesthesia and postoperative epidural analgesia have been provided successfully in all cases . 20% showed pdph.conclusions:these results demonstrate the effectiveness of management skills after inadvertent dural punctures .

diverse . many topics are of interest to the navy , and at their core each of them has fundamental aspects that need to be explored and understood . our focus is on trying to identify the fundamental questions behind the navy 's needs and then try to answer them . the true significance of this study is that by using ( tetrahydrofuran2yl)methyl methanesulfonate in the synthesis of bis(tetrahydrofurfuryl ) ether , we demonstrated that this intermediate allows one to synthesize pure tetrahydrofurfuryl ethers with bulkier substituents in a relatively straightforward manner . bis(tetrahydrofurfuryl ) ether , in particular , is interesting because its structure suggests that it may act as a chelating agent for cations , which could be useful in organic synthesis or energystorage applications . our biggest challenge was finding out why our initial elemental analyses were slightly out of the calculated range . we sent multiple samples to multiple companies and , while the elemental analyses were close to the predicted values , they did n't quite fit with our nmr and gc / ms analyses all indicating at least 99.5% purity . it turns out that the samples picked up a little moisture during the trip to the elemental analysis facility . once we figured this out and requested that the samples be dried , the elemental analyses matched the predicted values . the biggest surprise that we faced , as noted in the text , is that the intermediate , ( tetrahydrofuran2yl)methyl methanesulfonate , reacts violently with air , but only when it is at an elevated temperature . at room temperature , it appears to be relatively stable , or at least the reaction is much slower .

abstractinvited for this month 's cover are researchers from the naval air warfare center weapons division ( usa ) . the cover picture shows the elusive symmetric molecule bis(tetrahydrofurfuryl ) ether ( bthfe ) in the making . for more details , read the full text of the communication at 10.1002/open.201600013 .

human respiratory syncytial virus ( rsv ) is the leading viral cause of acute lower respiratory tract illnesses in infants and young children worldwide1 and is associated with annual or biannual epidemics.2 rsv isolates can be classified into two genetically and antigenically distinct groups , a and b , within which further diversity is reported.3 rsv repeatedly re - infects individuals throughout life , and the strains involved are often genetically distinct.4 the differences occurring both between and within the groups are most pronounced at the attachment ( g ) protein gene , which encodes a surface - expressed protein of the virus known to be targeted by the host neutralizing antibody response.1 in the last two decades , sequencing and phylogenetic analysis of the g gene have allowed identification of several genotypes within the two groups.3 it has also been noted that the circulating diversity within the groups is dynamic , and new genotypes periodically emerge , but also some previously circulating genotypes appear to have become extinct.3 locally , over successive epidemics , predominant genetic variants within the groups become replaced.3 continued observation of the dynamics of circulating rsv genetic and antigenic diversity is essential for the design of better rsv control approaches . a new group b strain with a 60-nucleotide duplication within the g gene was first observed in buenos aires , argentina , in 1999 ( named ba genotype ) and spread around the world in 34 years.5 interestingly , the ba genotype appeared to replace all the other group b genotypes in rsv epidemics that occurred in the second half of the last decade.6 the cause of the remarkable ba genotype epidemiological success remains unknown.7 few non - ba cases were observed after 2005,810 these occurring in cambodia , brazil and china between 2007 and 2009 . the epidemiological dynamics of the ba genotype have indicated that ( i ) new rsv strains can transmit to all parts of the world in a relatively short time period , and ( ii ) there is ongoing within - group competition between rsv genotypes . monitoring the transmission and evolutionary dynamics of group b rsv strains after the ba genotype emergence allow the study of an rsv genotype from emergence to , potentially , its extinction . hospital - based rsv surveillance at coastal kenya , 2002to date , was established with the objectives of documenting rsv disease burden and rsv molecular and immuno - epidemiology11 within the region . the surveillance period overlaps with the period when changes have been observed in circulating rsv b genotypes around the world . here , we report the results from sequencing and genotyping of all group b rsvs that we identified over the 11 years of the surveillance , and the results of analysis of novel non - ba strains we observed in three patients infected in early 2012 . the samples analyzed were obtained from under five - year - olds admitted with pneumonia to the kilifi district hospital11 and span the period between january 2002 and mid-2012 ( the latter marking the end of the 20112012 epidemic ) . either a parent or a guardian provided informed consent on behalf of each child . the specimens ( nasal washings , aspirates , or swabs ) were screened for rsv using an immunofluorescence assay ( ifat ) , and samples positive for rsv were subtyped into groups a and b using a conventional multiplex rt - pcr or a multiplex real - time pcr assay . group b rsv - positive samples were sequenced in the ectodomain region of the g gene as previously described.4 sequences were aligned using bioedit software ( http://www.mbio.ncsu.edu/bioedit/bioedit.html ) . the dates to the most recent common ancestor ( mrca ) between sequence clusters were estimated using bayesian methods within the beast software version 1.74,12 and convergence was confirmed in tracer program version 1.5 . representative strains of previously identified group b genotypes were included in the analysis to help classify the kilifi strains . over the period january 1 , 2002 , to june 31 , 2012 , 574 group b rsvs were identified among the rsv ifat - positive samples , and 488 ( 850% ) of these were successfully sequenced in the g ectodomain region . early in the surveillance , ba strains were detected as a rare genotype , making only 73% ( 3 of 41 ) of the sequenced group b genotypes between january 2002 and june 2004 . the prevalence of ba strains dramatically increased to 973% ( 108 of 111 ) in the 20042005 epidemic , and thereafter , all the group b samples identified and sequenced between june 2005 and december 2011 possessed the ba duplication . however , in sequencing b specimens from the first half of 2012 , three lacked the ba duplication . this was an unexpected finding occurring after multiple epidemics of non - ba genotypes absence ; thus , we undertook further analysis of these three sequences to ascertain their possible origin and phylogenetic relationship with other rsv sequences deposited in public databases . the distribution of the different group b genotypes at kilifi during the 11 consecutive epidemics of the surveillance numbers in brackets represent the proportion of group b rsv - positive samples that were sequenced of all those that were identified and subtyped as group b. numbers in brackets represent percentage of the sequenced group b genotypes that genotyped into ba . the three patients were admitted on march 1 , on march 23 , and on may 16 , 2012 , and were aged 145 , 17 , and 55 months , respectively , at the time of admission . two of the patients were admitted with severe pneumonia , and the third patient had very severe pneumonia ( see ref.11 for syndromic definitions ) . all three nucleotide sequences ( ken/201/mar/2012 , ken/202/mar/2012 and ken/203/may/2012 ) obtained from the three patients were identical across the entire 633 nucleotides sequenced . a blast search to track their ancestry ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) querying the second hypervariable region of g gene found that these three non - ba sequences were closely related to strains from brazil collected in between 2004 and 2007 with the top matches being those isolated in 2007 . these brazilian 2007 strains were non - ba type and have been classified under the gb3 genotype in their genbank annotation . the phylogenetic relationship of the kilifi 2012 non - ba sequences , the other group b genotypes identified at kilifi ( ba and sab1 ) , the top 25 of the blast hits , and representative sequences of all previously described group b genotypes around the world is given in figure 1 . the kilifi 2012 non - ba sequences and the previously circulating non - ba sequences at kilifi ( sab1 ) fell on separate branches that were distant from each other . the kilifi 2012 non - ba sequences and the non - ba sequences that were isolated in cambodia ( 20082009 , designated sab49 ) and china ( before 2005 ) alongside the brazilian sequences ( 20042007 ) fell into one cluster but with only moderate support ( bootstrap value 50% ) although clearly separated from the other group b rsv genotypes , figure 1 . a maximum - likelihood tree of 53 sequences including the top 25 blast hits , the 3 new non - ba kilifi sequences , 10 sequences representative strains previously collected at kilifi ( both ba and non - ba ) , and 15 representative sequences of all the previously described group b genotypes . the tree is derived from an alignment of the carboxy terminus region nucleotide sequences of the rsv g protein gene [ 264-nt - long region ( 324 for ba ) ] . the nodes of branches with exclusively kilifi sequences are indicated with a red - filled square box , and the associated branches of these kilifi sequences are also colored in red . the nomenclature of the taxa is a three - letter code for the country of sequence origin / genbank accession number / strain name . the average between - group genetic distances between the kilifi 2012 non - ba sequences and the brazilian , chinese , and cambodian non - ba viruses were 28% , 64% , and 94% , respectively . these distances imply significant diversification between these sequences despite the relatively close relationship on the tree . the mrca analysis predicted the kilifi 2012 non - ba viruses and that the brazilian viruses diverged from june 2007 ( 95% hpd , january 2002february 2012 ) , while the divergence with the cambodian 2008 - 2009 non - ba viruses was predicted to have occurred much earlier august 2000 ( 95% hpd , february 1985may 2009 ) . however , these estimates should be interpreted with caution as the hpd confidence intervals are very wide and overlapping . within the carboxy terminus region of the encoded g protein , the brazilian 2007 viruses and the kilifi 2012 non - ba viruses differ by six amino acids , figures 2 and 3 . interestingly , three of these changes affect sites that were previously shown to be under positive selection in group b rsv,13,14 that is , positions 223 , 251 , and 258 . studies with rsv a strains have previously noted that multiple epitopes lie in this region of the rsv g gene recognized by human convalescent sera , and changes affecting some particular positions , some of which were identified as positively selected , can have profound effect on the overall antibody recognition.3 thus , these substitutions in the 2012 non - bas could be of considerable significance . the figure shows an alignment of partial g - protein - predicted amino acid sequences for the brazilian , chinese , and cambodian non - ba sequences that were identified in the second half of the last decade and the kilifi non - ba sequences [ both the new 2012 and the old ( sab1 strains ) ] . the sequences are compared with gb1 strain ( usa / ch10b ) given at the top of the alignment as a reference strain . where the amino acid sequence is similar to the gb1 strain sequence the asterisks denote stop codons . at the bottom of the columns , positions previously identified as positively selected in group b rsv are indicated with a plus ( + ) symbol.13,14 gray - highlighted columns show amino acid sequence positions that changed and were also identified to be positively selected . the taxa nomenclature is a three - letter code for the country of sequence origin / genbank accession number / strain name . panel ( a ) shows a maximum - likelihood tree from 232 sequences comparing 599 nucleotide positions of the rsv g protein gene . this includes all unique ba sequences observed at kilifi between 2003 and 2012 ( 224 sequences ) , the 3 kilifi 2012 non - ba strains ( marked red ) , and 5 of the close brazilian non - ba sequences collected in 2007 that span this length ( marked green ) . in the alignment used to generate this tree , the 60-nucleotide insertion of the ba strains was removed to investigate whether the remaining nucleotide positions were highly similar to ba , which could then suggest that the new non - ba strains emerged by spontaneous deletion of this region from ba genotype . however , we observe that these new kilifi non - ba strains cluster far away on the tree from the current ba strains and are close to the brazilian non - ba strains boxed in ( a ) with a dashed rectangle and expanded as panel ( b ) . panel ( c ) shows the seven amino acid changes in the kilifi 2012 non - ba strains from the brazilian 2007 strains and their respective positions that they were observed ( six of the seven changes occur in the second hypervariable region ) . we have previously reported the detection of minority genomes within two patients sampled in 2008 that showed a 60-nucleotide deletion at the exact position where the insertion occurred in the ba variant , and we speculated this as a potential mechanism by which strains without the duplication could re - emerge.15 our phylogenetic analysis comparing the new non - ba strains with the circulating ba strains at kilifi from which the 60-nucleotide duplication sequence was excised found the new strains were only distantly related to ba ; that is , they do not represent ba strains that have recently lost their duplication ( figure 3 ) . this observation of wild - type non - ba viruses still in circulation provides a mechanism for replacement of the ba strains if the ba selective advantage diminishes . in conclusion , we report the total dominance of the ba genotype at coastal kenya among group b isolates over six epidemics and re - appearance of non - ba strains during the first half of 2012 . these new non - ba strains appear to have been circulating globally , albeit as a minority genotype , for several years and are not emerging de novo from the ba genotype . compared with their closest relatives in genbank , the new strains were found to have undergone changes at positions believed to be located in immune epitopes , and it will be interesting to observe whether these variants will increase in prevalence over time and succeed in dominance over the ba genotype . these observations raise questions on the amount of undetected rsv diversity existing and the mechanisms driving changes to population - level rsv diversity . the g sequences of the kilifi strains reported in this study are deposited into genbank under the accession numbers kc263040kc263051 .

respiratory syncytial virus ba genotype has reportedly replaced other group b genotypes worldwide . we report the observation of three group b viruses , all identical in g sequence but lacking the ba duplication , at a coastal district hospital in kenya in early 2012 . this follows a period of six consecutive respiratory syncytial virus ( rsv ) epidemics with 100% ba dominance among group b isolates . the new strains appear only distantly related to ba variants and to previously circulating sab1 viruses last seen in the district in 2005 , suggesting that they were circulating elsewhere undetected . these results are of relevance to an understanding of rsv persistence.please cite this paper as : agoti et al . ( 2013 ) identification of group b rsvs that lack the 60-nucleotide duplication after 6 consecutive epidemics of total ba dominance at coastal kenya . influenza and other respiratory viruses 7(6 ) , 10081012 .

it classically occurs in the second decade of life , has its onset during puberty , and affects both sex and all ethnicities . the estimated prevalence in the general population is 54 per 100,000 . using a combination of four indices , ie , central k ( descriptive of central steepening ) , the i - s value ( inferior - superior dioptic asymmetry ) , sim k , and the srax index ( skewed radial axes ) , rabinowitz was able to distinguish 98% of keratoconus videokeratographs from a group of normal controls,1 and in marked keratoconus , simple observation of the presence of keratometry over 47.20 d can make the diagnosis.2 sensory strabismus occurs due to temporary or permanent loss of vision in one or both eyes . we present the case of a 17-year - old boy with bilateral keratoconus , exotropia , and a nodular lesion of the bulbar conjunctiva in the left eye . a prism cover test revealed a 45 prism d exodeviation ( figure 1 ) . the aligned eye was the right eye and the keratoconus in this eye was of late onset . vision in the left eye was poor and the keratoconus was advanced in this eye . the patient has a corrected visual acuity of 6/9 in his better and aligned eye and an acuity of 1/60 in the affected eye . keratometric measures were 42.75 d at an axis of 28 and 49.0 d at an axis of 118 in the right eye , and 52.0 d at an axis of 154 and 58.75 d at an axis of 64 in the left eye . simk1 was 45.24 d at an axis of 113 and sim k2 was 42.75 d at an axis of 25 in the right eye . sim k of the left eye could not be obtained because of a high steep keratometry value . refraction in the right eye was + 1.5 , 7.5 25 and refraction in the left eye could not be obtained ( figure 2 ) . a search of pubmed yielded only two studies reporting development of sensory strabismus after keratoconus . in these reports , binocular function in patients with longstanding asymmetric keratoconus was investigated by the authors . the first of these reports was by sherafat et al , who investigated a database of approximately 350 patients with keratoconus.4 only 20 of these patients were identified as having abnormal binocular function.4 the abnormalities described in their study were central suppression of the deviating eye , reduction or loss of stereopsis with a microtropia when wearing a scleral lens , and a manifest exotropia with suppression when the poorer eye was uncorrected . sherafat et al accepted the age of diagnosis as being the age of onset of keratoconus , and suggested that the adult visual system in these cases had been affected by prolonged visual deprivation . however , it has generally been assumed that the sensitive period ends at about 7 years of age and that the adult human visual system is not affected by visual deprivation.59 it is possible that the age of onset in the patients reported on by sherafat et al may have been earlier than puberty and therefore their visual deprivation may have settled . the second report was by khan and al - shamsi , who investigated a database of 103 patients with keratoconus and identified abnormal binocular function due to longstanding keratoconus in only seven patients.10 in their series , six patients had persistent exotropia . after intervention to improve visual acuity , six patients complained of constant binocular diplopia that resolved after successful surgical alignment . the authors explained that resolution of diplopia by realignment of the eyes enabled suppression of scotoma and freedom from diplopia . the major limitation of their study was the lack of information provided on age at onset of keratoconus and a lack of explanation regarding the etiology of suppression of keratoconus . in our study , neither the patient nor his parents knew when the keratoconus had started , but did give two clues , ie , a history of childhood - onset strabismus and vernal conjunctivitis with eye rubbing . this lesion had invaded the cornea , was surrounded by injected blood vessels , and looked like pseudoepitheliomatous hyperplasia or a sequel of keratoconjunctivitis in childhood ( figure 3 ) . pseudoepitheliomatous hyperplasia is an inflammatory lesion that usually occurs on the eyelid , but rarely in the bulbar conjunctiva . however , there was no active inflammation of the conjunctiva in our patient , so this lesion may have been a sequel of keratoconjunctivitis in childhood . the causes of poor eyesight are varied , with chorioretinal atrophy , congenital cataract , optic atrophy , retinal disease , complicated cataract , leucoma , coloboma , high myopia , congenital glaucoma , penetrating trauma , contusional eye trauma , and traumatic cataract being the more common causes.11 sensory strabismus also appears to have various causes , but is not a consequence of keratoconus,1,12 which typically commences at puberty and commonly affects both eyes . however , when one eye is more severely affected than the other , visual loss can be prevented by glasses or contact lenses . the visual loss is gradual and occurs primarily as a result of irregular astigmatism and myopia.13 the sensitive period for development of suppression ends when the keratoconus has settled . the presence of a nodular lesion of the bulbar conjunctiva and a history of vernal conjunctivitis and eye rubbing in this patient confirms vernal keratoconjunctivitis in childhood . rabinowitz1 and sugar12 consider that atopic conjunctivitis and eye rubbing are a cause of keratoconus . the probable scenario in this patient is that vernal keratoconjunctivitis caused the childhood keratoconus , which became advanced in the left eye , and the prolonged visual loss was not corrected before the age of 7 years . we believe that the abnormal binocular function due to keratoconus in our patient and in the cases reported by other authors occurred before the age of 7 years . review of the relevant literature suggests that keratoconus seldom begins in the sensitive period during which abnormal visual experience affects visual development and may induce sensory exotropia . in our patient , sensory exotropia had developed because of prolonged visual loss based on the keratoconus in his poorer eye . if keratoconus occurs before the age of 7 years and prolonged visual loss is not corrected , sensory strabismus can develop , as in our patient .

this case report describes a 17-year - old boy with sensory strabismus due to keratoconus and an ipsilateral nodular lesion of the bulbar conjunctiva . the aligned eye was the right eye and keratoconus in this eye was of late onset . vision in the left eye was poor and keratoconus was advanced in this eye . due to the longstanding nature of the keratoconus and its occurrence in a developmentally sensitive period , sensory exotropia had developed in the left eye . there was a nodular lesion of the bulbar conjunctiva in the ipsilateral eye . if keratoconus occurs before the age of 7 years and the prolonged visual loss is not corrected , sensory strabismus can develop , as in this patient .

oral levodopa is the cornerstone of the treatment of parkinson 's disease . in some situations , oral administration of levodopa is not possible , for example after bowel surgery or in case of an ileus . the treatment options in these situations are limited . in these circumstances , the hospital pharmacy in the martini hospital manufactures a rectal formulation of levodopa / carbidopa 100/25 mg / ml , citric acid , glycerol ( 85 per centum ) and purified water , based on the case report of cooper et al . . we describe a patient with parkinson 's disease with an improvement of his parkinson symptoms after rectal administration of levodopa / carbidopa . a 64-year - old male with parkinson 's disease was admitted to the surgical ward for a laparoscopic sigmoid resection because of a volvulus caused by a dolichocolon . in 2007 , after surgery , the patient developed a paralytic ileus for which he was on a after consultation of the neurologist and pharmacist , the surgeon decided to start rectal administration of 100/25 mg levodopa / carbidopa once daily , in accordance with his oral levodopa / carbidopa dose . the patient gave informed consent for this treatment . as he was unable to take his other parkinson drugs ( dopamine agonist , amantadine ) too , an increase of the parkinson symptoms was seen , since he only used 100/25 mg levodopa / carbidopa the dose was increased to rectally administered levodopa / carbidopa 100/25 mg 5 times a day . optimal control of his parkinson symptoms was not pursued , but alleviation of the most severe tremor and rigidity was seen , which was confirmed by the neurologist , nurses and patient . on day 3 , a blood sample was drawn 1 h after administration of the rectal levodopa in order to determine the serum levodopa concentration . we found a levodopa serum concentration of 17 nmol / l ( determined with liquid chromatography - mass spectrometry / mass spectrometry ) . when levodopa is combined with a decarboxylase inhibitor , the half - life of levodopa is 1.5 h. in this patient , the oral levodopa formulation was stopped 24 h before the rectal formulation was started . the blood sample was drawn 3 days after the rectal formulation was started , which is 96 h after the last oral levodopa gift . since the half - life of levodopa ( combined with a decarboxylase inhibitor ) is 1.5 h , it can be assumed that after 96 h ( 64 half - life ) ; all levodopa due to the oral administration was washed out . therefore , the detected levodopa in this patient is not due to the oral medication . however , it is not sure whether the detected levodopa is endogenous or due to the rectal administration of levodopa , since one study described an endogenous concentration of levodopa of 38 32 increase of the levodopa concentration after rectal administration of the formulation we used in human are not described in the literature . the serum levels of levodopa described after oral administration are much higher , in the range of 1,400 - 12,000 nmol / l . a couple of case reports describe the successful rectal treatment with levodopa / carbidopa . theoretically , the advantage of administration via the rectum compared to the small intestine is the lower level of decarboxylase activity in the rectum . this supposedly leads to a lower conversion of levodopa to dopamine in the rectum , and thereby to an increase of the amount of levodopa available for absorption . the study of leppert et al . showed no effect of rectal carbidopa on the levodopa serum concentration after different routes of administration of levodopa . this makes us assume that carbidopa is not absorbed rectally , which leads to a higher conversion of levodopa to dopamine peripherally . it is recognized that levodopa is well absorbed in the small intestine by a specific amino acid transport system . whether this transport mechanism or another mechanism for absorption is present in the rectum is not known . the serum level in this patient is low compared to the serum levels found in the literature ( after oral administration ) . despite that the parkinson symptoms were not officially scored with the use of the movement disorder society - sponsored revision of the unified parkinson 's disease rating scale ( mds - updrs ) , the clinical status of the patient improved . whether this effect is due to the levodopa or is a placebo effect must be revealed in further research . part of this research should include determination of the endogenous levodopa concentration at baseline , and multiple blood samples should be drawn to study the pharmacokinetics of rectally administrated levodopa . the development of new administration forms of levodopa such as subcutaneous or inhaled levodopa would be an alternative in the treatment of these kinds of patients . at this moment , rectal administration of levodopa / carbidopa is worth considering , if there are no other treatment options .

objectivethe aim of this report is to discuss whether or not rectal levodopa administration is useful in some situations.backgroundin situations where oral intake of levodopa formulations is not possible , the treatment options of parkinson 's disease patients are limited . the literature describes no or low rectal absorption of levodopa.case descriptiona patient with an ileus was unable to take oral medication . after consulting the neurologist and pharmacist , the surgeon decided to describe a rectal formulation of levodopa / carbidopa ( 100/25 mg ) once daily . on day 3 of the therapy , 1 h after administration of the rectal formulation of levodopa / carbidopa , a blood sample was drawn . the patient was unable to take his other parkinson medication ; therefore the dose of the rectal levodopa / carbidopa was increased to 5 times a day.resultsfull control of the symptoms was not achieved , but alleviation of the most severe tremor and rigidity was seen , which was confirmed by the neurologist , nurses and patient . the levodopa concentration detected was 17 nmol / l . compared to levodopa concentrations described in the literature ( 1,400 - 12,000 nmol / l ) , the concentration is very low . there are some possible explanations for the low concentration detected . the presence of a specific amino acid transport system in the rectum is not known , which could lead to no or reduced absorption . the poor rectal absorption of carbidopa leads to a higher conversion of levodopa to dopamine peripherally.conclusionsin situations where patients are unable to take oral medication , rectal administration of levodopa / carbidopa is worth considering .

primary treatment includes surgical excision with partial or total cystectomy along with removal of umbilicus , urachus tract with or without pelvic lymphnode dissection . common metastatic sites include lung , liver , and bone . here , we report a case of urachal carcinoma treated with surgical excision , which presented after 2 years of primary surgery , with skip metastasis to colon and lung , and was managed by palliative chemotherapy . a 62-year - old male presented to the radiotherapy department of our institute with complaints of pain abdomen and loss of appetite for past 1 month . his past treatment details revealed that he had similar complaints 2 years back for which he underwent contrast enhanced computed tomography ( cect ) scan of chest abdomen and pelvis which showed mass in the upper outer surface of urinary bladder extending anteriorly to the abdominal muscles . he underwent laparoscopic partial cystectomy along with excision of urachus , umbilicus , and bilateral pelvic node dissection . postoperative histopathology [ figure 1b ] was suggestive of urachal adenocarcinoma of size 5 cm 4 cm 2.5 cm , with tumor cells infiltrating the deep muscle , serosal aspect being free of tumor ; and all 10 lymph nodes dissected were also free of tumor . diagnosed as a case of urachal adenocarcinoma stage - i according to mayo staging system , he was kept on regular follow - up and presented 2 years later with above - mentioned complaints . ( a ) contrast enhanced computed tomography scan showing mass in the upper outer surface of urinary bladder extending anteriorly to the abdominal muscles . ( b ) postoperative histopathology report showing tumor arising from the urachus epithelium and are arranged in form of glands and are infiltrating into the submucosa ( right : low power view h and e , 100 and left : high power view h and e , 400 ) repeat cect scan of abdomen and pelvis showed a large mass involving sigmoid colon extending for a length of approximately 10 cm with maximum thickness of 4.6 cm . surrounding fat stranding was seen with extension up to anterior abdominal wall . the thickened loop showed loss of fat planes with left psoas posteriorly , and was abutting the distal external iliac artery ; however , no definite infiltration was seen . lower gastrointestinal endoscopy was suggestive of a large polypoidal growth at 23 cm from the anal verge with ulcerated mucosa ; scope was negotiable beyond the growth . positron emission tomography ( pet)-ct scan suggested intensely fludeoxyglucose ( fdg ) avid well - defined large heterogeneous enhancing soft tissue mass ( maximum thickness ~4.9 cm ) in the proximal sigmoid colon , with pericolic fat stranding - likely primary [ figure 2a ] . there were ill - defined fat planes with left external iliac blood vessels and adjacent bowel loops . intensely fdg avid asymmetrical mural thickening with skip lesions were noted in the descending colon [ figure 2a ] . ( a ) axial positron emission tomography - computed tomography image showing intensely fludeoxyglucose avid well - defined large heterogeneous enhancing soft tissue mass in the proximal sigmoid colon , with pericolic fat stranding with infiltration in the left psoas muscle . ( b ) axial positron emission tomography - computed tomography image showing increased fludeoxyglucose uptake in the hypodense soft tissue mass in the apical anterior segment of left upper lobe with thin contrast enhancing periphery increased fdg uptake was noted in the thin contrast enhancing periphery of large hypodense soft tissue mass noted in apical anterior segment of the left upper lobe [ figure 2b ] . fine needle aspiration cytology from the left upper lobe lung mass was suggestive of mucinous adenocarcinoma . his carcinoembryonic antigen ( cea ) level was normal ( 9.39 ng / ml ) . after multidisciplinary discussion , he was diagnosed as urachal adenocarcinoma with metastasis to colon and lung . the patient was started on chemotherapy with irinotecan , 5-fluorouracil ( fu ) and leucovorin . after first cycle , patient developed sub - acute intestinal obstruction , for which he underwent diversion loop colostomy ; and later chemotherapy was continued . urachal adenocarcinomas are typically located in the midline , either anteriorly or in the dome and , although often discrete , can form a large mass on the anterior abdominal wall . urachal carcinomas have higher incidence in men and typically present in the fifth or sixth decade of life . although the pathogenesis is not well understood , exposure of remnant urachal epithelium to intravesical carcinogens is an unlikely etiology . common presenting symptoms are hematuria , pain abdomen , irritative symptoms ; mucinous or serous discharge from the tract in the umbilicus . the final diagnosis is made only after exclusion of adenocarcinoma in any other site . kapoor et al . analyzed six cases of urachal carcinoma diagnosed over a period of 7 years treated with partial cystectomy with bilateral pelvic lymph node dissection and adjuvant radiotherapy . the study illustrated the need for adjuvant therapy to decrease the chances of recurrence but demonstrates the limited availability of prospective trials . the significance of the present case lies in its unusual way of recurrence after 2 years of primary surgery , at a site ( colon ) , which can easily be misinterpreted as the second primary . though pet scan clearly demonstrated the extent of disease , but histopathology and immunohistochemistry correlation greatly impacted the true diagnosis of the case , confirming it to be a recurrence , rather than second primary . this is all the more important while choosing chemotherapy drugs in this case . to date , there are no randomized trials on the management of urachal carcinomas and < 300 cases have been reported in the literature . as both urachal and colon carcinoma share a common histopathological features , most of the literature suggested using chemotherapy regimens similar to those recommended for colon malignancies . the first case report from japan which showed the effectiveness of irinotecan in urachal adenocarcinoma was published by kume et al . in 2006 . they confirmed the resemblance of mucin producing urachal carcinomas with colorectal carcinomas pathologically and in rise of cea levels in both adenocarcinomas . they found that with effective administration of irinotecan cea levels decreased from 98.3 to 38.7 ng / ml and pulmonary metastatic lesions were reduced by 60% . mohile et al . in the literature review suggested the effectiveness of ifl ( irinotecan , 5-fu , leucovorin ) and suggested that this regimen was clinically effective for 5 months following the initiation of treatment for recurrence but the long - term efficacy of chemotherapy for systemic urachal carcinoma is still unknown . recently treated a case of metastatic urachal adenocarcinoma with a novel regimen ( gem - flp : 5-fu , leucovorin , gemcitabine , and cisplatin ) and showed regression in the size of liver lesions in the interval imaging post 4 cycles of chemotherapy . we present a rare case of urachal carcinoma with skip metastasis to the lung and colon . chemotherapy regimen with irinotecan , 5-flurouracil , and leucovorin is found to be effective in the metastatic setting , but the long - term efficacy of this regimen is still unknown .

urachal carcinoma is a rare malignancy constituting < 1% of bladder malignancies . the disease arises from a malignant transformation of rests of enteric epithelium in the urachus . most common sites of metastasis are lung , liver , and bone . we report a postoperative case of urachal carcinoma presenting with distant metastasis to lung and skip lesions in colon . as both urachal and colon carcinoma share common histopathological features , most of the literature suggested using chemotherapy regimens similar to those recommended for colon malignancies . there are no randomized trials till date regarding the management of urachal adenocarcinomas except for the primary treatment being surgery .

orthodontic treatments may induce oral ecologic changes , leading to increase of streptococcus mutans in saliva and plaque [ 1 , 2 ] . orthodontic brackets play a significant role in gathering microbial plaque [ 3 , 4 ] . caries - preventive measures , good oral hygiene , noncariogenic diet , and regular fluoride supplementation are often insufficient in preventing the occurrence of new carious lesions in orthodontic patients with high caries activity [ 5 , 6 ] . also , it has been shown that orthodontic treatment with fixed appliances results in enamel demineralization and increased numbers of carious lesions , predominantly in sites adjacent to brackets . preventive efforts in these risk groups have been focused on direct suppression of the cariogenic microflora by chemotherapeutics as an adjunct to improved oral hygiene . chlorhexidine is a potent documented antimicrobial agent against streptococci and dental caries [ 810 ] . it has been suggested that applying chlorhexidine in the form of varnish reduces the number of ms in plaque and saliva for 4 weeks , but this effect has been tested on teeth without orthodontic appliances . on the other hand , studies performed on high - risk orthodontic patients with highly concentrated varnish treatment , another mouthrinse , which has clinically - proven effectiveness in decreasing microbial plaques , is listerine . studies have shown that listerine effectively decreases formation of microbial plaque and gingivitis [ 13 , 14 ] . studies on microbiological effectiveness of listerine showed that listerinecan not affect the structure of microbial plaque . yet , no studies regarding listerine , ortho - kin , and oral - b have been found evaluating this issue . in this study , we addressed the clinical effectiveness of ortho - kin , listerine , and oral - b on mutans streptococcus ( ms ) existing in plaque around the orthodontic brackets and in saliva , and also on decreasing dental plaque ( pi ) . a double - blind randomized cross - over clinical trial on 25 orthodontic patients , classified into 6 groups was done to assess ms in plaque and saliva with the side specific modified strip - mutans technique and the plaque ( pi ) was measured before and after using 3 types of commercial mouthrinses . a washout period ( 3 weeks ) patients with fixed orthodontic appliances , inserted at least 2 months prior to the start of the study were chosen agreeing with the terms and conditions and completing the information sheets . conditions of termination of this study were use of antibiotics , illness , treatment with topical fluoride , use of mouthrinse in the last month , and dental caries . after selecting the patients , the plaque ms scores were determined with the side - specific modified strip - mutans as originally described by wallman and krasse and modified by twetman . selected teeth for plaque sampling were isolated with cotton rolls and dried , and then , samples were carefully taken with a sterile curette on the sites around the brackets of teeth 15 , 25 , 35 , and 45 . all brackets had been placed by the same orthodontist with orthophosphoric acid 37% ( swiss coltene ) , and glass ionomer fuji ( ortho l.c , g.c . ) . sampled plaque was immediately spread on the roughened side of the plastic strip with square tip from the strip - mutans kit ( orion diagnostica , strip - mutans , finland ) . additionally , a saliva strip - mutans test was performed and evaluated on each participant . the strips were allowed to dry for 5 minutes at room temperature and were then incubated for 96 hours in a liquid medium . the composition of the medium was similar to the composition of mitis salivarius agar , with a sucrose concentration increased to 30% . addition of a bacitracin disc from the kit , resulted in a final concentration of 0.36 u / cc of bacitracin per ml of medium . after 96 hours of incubation in the liquid medium , the scores of ms in plaque and saliva were recorded with the aid of a stereo - microscope with 1025x magnification . the number of colony - forming units ( cfu ) with characteristic morphology was screened and scored on the scale of 03 . scores were allocated as follows : 0 indicates no cfu ( ms below detection level ) ; 1 indicates 110 cfu , corresponding to approximately < 1010 cfu ; 2 indicates 10100 cfu , corresponding to approximately = 1010 cfu ; 3 indicates > 100 cfu , corresponding to > 10 cfu . in clinical exams , the dimensions of dental plaque were measured by disclosing solution ( dentsply , usa ) . afterwards , the patients were classified into 6 groups and 3 mouthrinses , ortho - kin ( kin company spain ) , listerine ( warner - lambert company usa ) and oral - b ( p&g company england ) , prepared in white pet glasses and filled and coded by a third person , were applied to these groups . the patients used these mouthrinses in each group according to rules below : code 1 : group 1 1 2 3 n = 4 oral - b group 2 1 3 2 n = 5 code 2 : group 3 2 1 3 n = 4 listerine group 4 2 3 1 n = 4 code 3 : group 5 3 1 2 n = 5 ortho - kin group 6 3 2 1 n = 3 3 weeks 3 weeks ( wash out period ) each mouthrinse was used for 3 weeks . after this period , patients waited a 3-week wash out period ( without using any mouthrinse ) for liquidation of mouthrinse effectiveness and the dimension of ms returning to baseline values again . at the end of 3 weeks , the dimensions of ms existing in plaque and saliva and also the dimension of pi was measured and recorded . it was requested that the patients use each of these 3 mouthrinses in the morning and evening after brushing their teeth and 15 ml for 30 seconds to rinse the mouth and then , not to eat or drink for 30 minutes . ill patients or those who used drugs , or for any reason did not follow the instructions , were eliminated from the study . this study on 25 patients , 5 men and 20 women , with an average age of 19 6/3 assessed the effectiveness of mouthrinses on ms . plaque sampling from each patient measured on 4 teeth ( 100 samples ) , surveyed 300 teeth because the design of research was a cross - over for 3 mouthrinses . our results showed that ortho - kin had a better effect than oral - b and listerine ( p < 0/09 ) . ortho - kin also had better effects than oral - b and listerine on plaque accumulation ( p < 0/001 ) . the dimension of changes in accumulation of ms on each tooth according to kind of mouthrinse is shown in table 1 . the dimension of ms changes in person 's saliva given according to the kind of mouthrinse in figure 1 , shows that the dimension of changes , percentage of increase , without change , and decrease of streptococcus mutans in saliva in 3 groups were similar and without statistical differences ( p < .4 ) . the amount of microbial plaque in the subjects and the changes according to the kind of mouthrinse are shown in table 2 . it shows that oral - b ( about 10.9 5.61 or 20.7 percent ) , listerine ( about 12.2 9.76 or 24 percent ) , and ortho - kin ( about 14.5 9.99 or 31.7 percent ) caused reduction of dental plaque , with significant statistical differences in each group ( p < .01 ) . in this study , the effectiveness of 3 mouthrinses , ortho - kin ( with combination of chlorhexidine de gluconate , sodium fluoride , zinc acetate ) , and oral - b ( with combination of methyl paraben , cetyl pyridinium chloride , sodium fluoride , propyl paraben , alcohol ) , and listerine ( with combination of tymol , eucalyptol , methyl salicylate , and menthol ) was assessed on accretion of streptococci mutans existing in plaque and saliva and the amount of pi . the results showed that in decreasing the accretion of streptococci mutans existing in plaque around orthodontic brackets , ortho - kin was better than oral - b and listerine . in several studies , it has been shown that following treatment with highly concentrated chx , streptococci mutans can be suppressed effectively for a prolonged period of time [ 1820 ] . also in a study by maltz on subjects who were not orthodontic patients , it was shown that chx was effective in decreasing streptococci colonization and also in decreasing dental caries [ 10 , 21 ] . it should be noted that studies performed in high - risk orthodontic patients did not demonstrate any significant differences in caries after repeated application of high or low concentrated chx varnishes [ 1 , 5 ] . although chlorhexidine therapy , prior to or during orthodontic treatment has been shown to significantly reduce colonization of streptococci mutans it had no effect on caries activity [ 1 , 2 ] . the duration of streptococci suppression , partly depends on the extent to which retention niches are coated with chx . the presence of bands and orthodontic brackets prevents the effective function of chx in all areas with streptococci mutans [ 2225 ] . the results of our study showed that all three mouthrinses were similar in their effect on streptococci in saliva , without significant statistical differences . also , ortho - kin with chx could not decrease the streptococci in saliva and could not act better than listerine or oral - b . in another study , a layer of polyurethane sealant was placed over the chlorhexidine containing layer to retain it on the teeth . since the polyurethane sealant also slows the loss of chlorhexidine into the saliva , it causes increased effectiveness on saliva ms without increase in the concentration of chx . listerine , well known as an antiseptic since the last century , did not show any bactericidal effects in brecx et al . study . , who found no significant reduction in the number of bacteria in dental plaque formation in subjects using listerine as compared to a placebo . in our study , listerine was not effective on accumulation of ms in plaque or saliva and ortho - kin was more effective than listerine and oral - b in decreasing pi . ortho - kin showed better effects on decreasing ms and pi because it contained chlorhexidine .

background and purpose . fixed orthodontics may be associated with accumulation of mutans streptococci ( ms ) , enamel demineralization , and an increased number of carious lesions , predominantly in sites adjacent to brackets . this study was undertaken to assess the effectiveness of listerine , oral - b , and ortho - kin on the accumulation of ms in plaque around orthodontic brackets . materials and methods a double - blind randomized cross - over clinical trial on 25 orthodontic patients , classified into 6 groups was done to assess ms in plaque and saliva with the side specific modified strip - mutans technique and the plaque ( pi ) was measured before and after rinsing using 3 types of commercial mouth - rinses . a washout period ( 3 weeks ) was awaited between using each mouth - rinse and the data was analyzed via wilcoxon and kruskal wallis statistical tests . results . this study of 25 patients , 5 men and 20 women , with an average age of 19 6/3 assessed the effectiveness of mouth - rinses on ms . our results showed that ortho - kin had a better effect than oral - b and listerine ( p < 0/09 ) . ortho - kin also had better effects than oral - b and listerine on plaque accumulation ( p < 0/001 ) . conclusion . ortho - kin showed better effects on decreasing ms and pi because it contained chlorhexidine .

we report here 2 patients with a common history of abdominal pain that was associated with acute onset of intestinal obstruction . in both patients , histopathology reports were consistent with pancreatic tissue in the submucosal part of the small bowels . a 72 year - old man presented to the er , because of acute onset of nausea , vomiting , gradual abdominal distention and severe abdominal pain . on physical exam , there were no signs of peritoneal irritation . blood tests were consistent with leukocytosis ( 17,000/mm ) , and a high crp level . ct - scan showed signs of mechanical obstruction , with some features of intestinal suffering ( fig . 1 ) .the patient was sent to the operating room after he had signed the informed consent . upon laparotomy , a well circumscribed mass about 100 cm proximal to the ileo - caecal junction , was found as the cause of this obstruction . the post - operative course was uneventful , and the histopatholgy exam was consisted with a submucosal pancreatic tissues , organized in clusters ( fig . 2 ) . a 24 year - old healthy man presented to the er for recurrent episodes of epigastric pain associated with nausea and vomiting . on physical exam ct scan showed layering effect on the small bowel consistent with enteroenteric intescusuption ( fig . the patient was sent to operating room after he had signed the informed consent . upon diagnostic laparoscopy there was a jejuno - jejunal intussusception and well circumscribed mass on the jejunum about 20 cm from the ligament of treitz . the post op course was uneventful and the histopathological exam was consistent with heterotopic pancreatic tissue on the small bowel ( fig . it s noteworthy mentioning , that both cases were reported in line with the scare criteria . a 72 year - old man presented to the er , because of acute onset of nausea , vomiting , gradual abdominal distention and severe abdominal pain . on physical exam , there were no signs of peritoneal irritation . blood tests were consistent with leukocytosis ( 17,000/mm ) , and a high crp level . ct - scan showed signs of mechanical obstruction , with some features of intestinal suffering ( fig . 1 ) .the patient was sent to the operating room after he had signed the informed consent . upon laparotomy , a well circumscribed mass about 100 cm proximal to the ileo - caecal junction , was found as the cause of this obstruction . the post - operative course was uneventful , and the histopatholgy exam was consisted with a submucosal pancreatic tissues , organized in clusters ( fig . a 24 year - old healthy man presented to the er for recurrent episodes of epigastric pain associated with nausea and vomiting . on physical exam there were no signs of peritoneal irritation . ct scan showed layering effect on the small bowel consistent with enteroenteric intescusuption ( fig . the patient was sent to operating room after he had signed the informed consent . upon diagnostic laparoscopy there was a jejuno - jejunal intussusception and well circumscribed mass on the jejunum about 20 cm from the ligament of treitz . the post op course was uneventful and the histopathological exam was consistent with heterotopic pancreatic tissue on the small bowel ( fig . it s noteworthy mentioning , that both cases were reported in line with the scare criteria . ectopic pancreas is congenital anomalies , in which pancreatic tissues lacking anatomical continuity with the pancreas , are found anywhere within the abdominal cavity . patients usually present with vague abdominal pain , , or with signs of obstruction . in 3 cases of gastric ep , in these 3 cases , patients presented signs of non - specific vague abdominal pain , and the diagnosis was made only post - operatively . in some papers , regarding its association with intestinal obstruction , few similar cases have been reported in the literature , , , , . in two cases , the obstruction was at the jejunal level , , and in two other patients it was at the level of the ileum , . laparotomy was performed on emergency basis in two cases , , where intussusception and peritonitis were diagnosed . in a young patient , ep caused gastric outlet obstruction , and patient lost about 15 kg in a short period of time . in about all cases reported in the literature , it s the best therapeutic option , for both , symptoms palliation and definitive diagnosis , especially to rule out malignant conditions . regarding our cases , both patients presented symptoms of intestinal obstruction , however , in one patient the occlusion was mechanical and situated distally , whereas in the other , the ep served most probably as an intussusceptum . in both cases , ep are rare condition , and symptomatic ones , causing intestinal occlusion are even rarer . both cases were diagnosed as intestinal occlusion and managed accordingly , and in both patients , the diagnosis was made after resection of the affected bowel segments . preoperative diagnosis is impossible , and in some cases reported in the literature , malignancy has been suspected . surgery is the best treatment option , for both , symptoms palliation and definitive histological diagnosis .

highlights2 cases of intestinal obstruction secondary to ectopic pancreas.ectopic pancreas causing intestinal occlusion is a very rare entity.in the first case , the ectopic tissue caused mechanical luminal occlusion in the distal ileal part , whereas the 2nd case presented intussusception sign , 20 cm distal to the treitz ligament.ectopic pancreas can serve as a lead point for ileo - ileal intussusception .

thyrotoxicosis occurs in approximately 0.2% of pregnancies , and the most common cause of thyrotoxicosis is graves ' disease ( gd ) [ 1 , 2 ] . gd is common in young women of childbearing age , and poorly controlled gd during pregnancy can cause serious complications in both the mother and the fetus . the differential diagnosis of gd from gestational thyrotoxicosis is supported by a typical goiter , the presence of tsh receptor antibody ( trab ) , and signs of graves ' ophthalmopathy . thiamazole ( mmi ) and propylthiouracil ( ptu ) are antithyroid drugs ( atds ) that are used to treat gd . atds are associated with a rather high frequency of adverse events ; hepatotoxicity , cutaneous reactions , and agranulocytosis are the main adverse events . frequencies of adverse events in japanese gd patients after initial atd treatment have recently been reported [ 3 , 4 ] , and according to the reports the percentage of patients with aspartate aminotransferase ( ast ) and alanine aminotransferase ( alt ) levels more than twice the upper limit of the reference range was 25.826.9% among patients treated with ptu as opposed to 6.69.0% among patients treated with mmi , and the percentage of patients with a cutaneous reaction ( skin eruption or urticarial eruption ) was 18.322.1% among the patients treated with ptu and 6.631.9% among the patients treated with mmi . there have been no reports on the frequencies and types of adverse events of initial atd treatment during pregnancy . in this study we investigated the frequency of adverse events in untreated pregnant gd patients after initial atd treatment during pregnancy . we reviewed the cases of 91 untreated pregnant women who came to our hospital for the first time and were newly diagnosed with gd during the period between january 1 , 1999 , and december 31 , 2011 . the diagnosis of gd was made on the basis of elevation of the serum free triiodothyronine ( ft3 ) level and free thyroxine ( ft4 ) level , suppression of the serum tsh level , a typical goiter , ophthalmopathy , and the presence of tsh receptor antibody ( trab ) . patients visited our hospital every two weeks for two months after initiation of their treatment . then , they were followed up every 1 to 2 months according to their thyroid function and symptoms . serum thyroid hormone levels , tsh , ast , and alt and hematological values were measured and a blood examination was performed at each outpatient visit . ast and alt levels more than twice the upper limit of their reference ranges were considered evidence of hepatotoxicity as an adverse effect of the atd . data were statistically analyzed by using the chi - squared test or fisher 's exact test . calculations were performed using the jmp software program , version 10.0.0 ( sas institute inc . , mmi was used to treat 40 patients , and 51 patients were treated with ptu . there were no significant differences between the two groups in serum ft3 , ft4 , serum trab , ast , or alt values ( data not shown ) . the characteristics of the 91 patients are shown in table 1 . among 40 patients treated with mmi , 21 patients started treatment during the first trimester , 18 patients started during the second trimester , and one patient started during the third trimester . adverse events occurred in 5 patients ( 5/40 ; 12.5% ) treated with mmi , and they consisted of cutaneous reactions . three of them started mmi during the first trimester of pregnancy and the other 2 patients started during the second trimester of pregnancy . two of the 5 patients in the mmi group who had cutaneous reactions continued taking mmi , and their pruritus and drug rashes resolved . treatment in the other 3 patients was switched from mmi to ptu or potassium iodide and their symptom resolved . the cutaneous reactions in these 5 patients had occurred two to six weeks after the start of mmi . all 5 patients successfully delivered full - term healthy infants . as shown in table 1 and figure 1 , there were no significant differences between maternal age and the starting dose of mmi in the group that developed adverse events and the group that did not develop adverse events . figure 1 shows the starting dose of mmi in the group that developed adverse events and the group that did not develop adverse events . the rate of preterm delivery was 7.5% ( 3/40 ) , and one newborn had a congenital abnormality , an omphalocele . the mother of the infant with the omphalocele had started taking a 30 mg dose of mmi daily at 4 weeks of pregnancy and had continued until delivery . among 51 patients treated with ptu , 26 patients started treatment during the first trimester , 22 patients started during the second trimester , and 3 patients started during the third trimester . adverse events occurred in five patients ( 5/51 ; 9.8% ) ; four of them started ptu during the first trimester of pregnancy and the other one patient started during the second trimester of pregnancy . no patients experienced hematologic side - effects including agranulocytosis or anca - related vasculitis . ptu was started from the fourth week of pregnancy and the ast and alt levels had increased to more than twice the upper limit of the normal range at 9 weeks after the start of treatment . in the other patient , ptu was started from the fourth week of pregnancy and the ast level had increased to 3 times the upper limit of the normal range and the alt level to more than 5 times the upper limit of the normal range at two weeks , and ptu was discontinued . treatment in these two patients was switched from ptu to potassium iodide , and their thyroid status was well controlled . her treatment was switched from ptu to potassium iodide , and she successfully delivered a full - term healthy infant . the cutaneous reactions in these three patients developed two to ten weeks after the start of ptu treatment . as shown in table 1 and figure 1 , there were no significant differences between maternal age and the starting dose of ptu in the group that developed adverse events and the group that did not develop adverse events . the rate of preterm delivery was 7.8% ( 4/51 ) , and none of the infants of the mothers treated with ptu were born with a congenital abnormality . hyperthyroidism in pregnancy is a serious condition that entails an increased risk of adverse obstetric outcomes , including miscarriage , stillbirth , preterm birth , and intrauterine growth restriction . atds should be used to treat hyperthyroidism due to gd during pregnancy . in the last decades , mmi and ptu have been used equally to treat gd during pregnancy , regardless of trimester . in recent years , ptu has been the preferred drug because of concerns about teratogenicity associated with mmi during the first trimester of pregnancy . the ata recommendation suggests using ptu during the first trimester and mmi during the second trimester . the majority of cases in our study were treated before the recommendation was published , and in 21 patients treatment with mmi was started in the first trimester . the only infant born with an omphalocele was delivered by a mother treated with mmi starting in the first trimester , and this congenital abnormality may be related to administration of mmi starting in the first trimester of pregnancy . the rate of preterm delivery by patients treated with an atd was high in comparison with the rate of 5% in the general population . before treating patients with an atd they should be informed of the possible development of adverse events such as pruritic rashes , liver dysfunction , and agranulocytosis . in japan , a physical examination and blood testing are mandated every two weeks especially within 2 months after the start of atd treatment to enable early detection of agranulocytosis and liver dysfunction . this practice may be useful for early detection of mild cutaneous reactions and liver dysfunction associated with atd treatment . a previous study of the frequency of adverse events of mmi and ptu in nonpregnant gd patients at our hospital reported the development of cutaneous reactions in 31.9% of the patients treated with mmi and in 18.3% of the patients treated with ptu . the frequency of hepatotoxicity was 9.0% in the mmi group and 25.8% in the ptu group . our study in pregnant gd patients showed that the frequency of cutaneous reactions among the patients treated with mmi was 12.5% and 5.9% among the patients treated with ptu . no patients treated with mmi developed hepatotoxicity , and the frequency of hepatotoxicity among the patients treated with ptu was 3.9% . since the study design was completely different , it is difficult to compare the frequencies of adverse events between the pregnant patients and the nonpregnant patients . comparison with the expected rate of adverse events in nonpregnant individuals showed that the frequency of adverse events in pregnant individuals was low . at least , the frequencies of adverse events in the pregnant patients were not higher than in the nonpregnant patients . the reason for the lower frequencies of adverse drug reactions in the pregnant women is unclear . reduced immune reaction during pregnancy may be the cause of low frequency of adverse reaction . however , whether the mechanisms of the rashes or hepatotoxicity induced by atds are related to immune reactions has never been investigated . it should be noted that the occurrence of severe liver injury in patients treated with ptu is rare . it has been estimated that 4 of the approximately 4000 pregnant women treated with ptu each year in the united states develop ptu - related severe liver injury . six cases of ptu - induced hepatitis during pregnancy have been reported in the medical literature [ 1013 ] . based on this small sample the outcome appears to be particularly poor in pregnancy , because there was 1 maternal death and 2 patients required a liver transplant . one case of neonatal hepatitis as an adverse effect of maternal treatment with ptu has also been reported . limitation of this study was that the number of subjects was relatively small because we selected untreated hyperthyroid pregnant women diagnosed with gd for the first time during their pregnancy . prospective study is preferable ; however , it seems to be difficult because pregnant women newly diagnosed as gd during pregnancy are rare , and initial mmi administration to untreated gd patients during the first trimester of pregnancy is not recommended from guideline of endocrine society and guideline of the american thyroid association [ 15 , 16 ] . in conclusion , this is the first study that studied the frequencies of adverse events after initial treatment with an atd during pregnancy in newly diagnosed gd patients .

the frequency and types of adverse events after initial antithyroid drug ( atd ) therapy during pregnancy have never been reported , nor has whether the frequency of adverse events is the same as among nonpregnant subjects ever been investigated . we investigated retrospectively the frequency of adverse events after initial atd administration to previously untreated graves ' disease ( gd ) patients during pregnancy . we reviewed the charts of cases of 91 untreated pregnant women who came to our hospital for the first time and were newly diagnosed with gd during the period between january 1 , 1999 , and december 31 , 2011 . thiamazole ( mmi ) was used to treat 40 patients and 51 patients were treated with propylthiouracil ( ptu ) . adverse events occurred in 5 patients ( 5/40 ; 12.5% ) treated with mmi , and they consisted of cutaneous reactions in 5 patients . adverse events occurred in five patients ( 5/51 ; 9.8% ) treated with ptu , and they consisted of hepatotoxicity in two patients and cutaneous reactions in three patients . no patients experienced agranulocytosis or anca - related vasculitis . comparison with the expected rate of adverse events in nonpregnant individuals showed that the frequency of adverse events in pregnant individuals was low .

the regeneration and healing of bone is a gradual process , and are constantly prone to soft tissue infiltration , particularly in large defects . in order to enhance the healing process , and at the same time , to prevent the migration of unwanted cells , it has been suggested that segregation of the defects via a membrane barrier is effective [ 1 , 2 ] . membranes also sustain blood clots in place and allow time for bone forming cells to reconstruct bone unobstructed , which is beneficial for applications such as implant placement in fresh extraction sockets . the surgical and restorative advantages of placing dental implants in fresh extraction sockets have been discussed clinically by various authors [ 37 ] with a sufficient number of in vivo studies supporting that successful osseointegration can be achieved in these situations [ 812 ] . the so - called immediate implant placement is less invasive and potentially more efficient than the classic approach , where multiple surgeries may be needed if using a graft material for the initial bone healing process . however , one of the surgical limitations of an immediate implant placement procedure is that often a socket presents dimensions that may be greater than the diameter of a conventional implant , which at many times results in the presence of a substantial gap between the implant and the socket wall and resorption of the buccal bone wall . it has been proposed that minimizing the gap itself by the use of a conical or a wide diameter implant may be one of the solutions to overcome this problem [ 15 , 16 ] . however , it has been suggested that full regeneration of the bone is a difficult task , since it seems that alveolar bone resorption to a certain extent is unavoidable regardless of the type of the implant placed . therefore , the use of a membrane material to create a contained atmosphere could prevent alveolar bone alteration , and simultaneously promote osseointegration . today , a wide variety of membrane materials are commercially available from nonresorbable synthetic to naturally derived membranes . nonresorbable synthetic membranes , such as polytetrafluoroethylene ( ptfe ) , require removal after 3 - 4 weeks in order to prevent an immunogenic response . for longer periods , there will be a potential risk of gingival dehiscence , resulting in membrane exposure , moreover infection . on the other hand , naturally derived membranes on the market are mainly manufactured from animal - derived collagen , more specifically , porcine - derived , which are suggested to be biocompatible and biodegradable [ 19 , 20 ] . this degradation minimizes an immunologic response , possibly reduces patient follow - up visits , and prevents further gingival tissue damage , which has been suggested to be beneficial as compared to the nonresorbable membranes . studies using the nonresorbable membranes have indeed shown successful bone regeneration due to their excellent space - making and growth factor sustaining properties . however , a recent study showed that even with the resorbable naturally derived membranes , similar biologic outcomes may be expected . membranes , derived from the porcine peritoneum , are mechanically weaker than their pericardium counterpart . moreover , since peritoneum - derived membrane barriers naturally present a smooth side and a rough side , the membrane should be oriented in a specific , unidirectional fashion to ensure clinical success . when compared to dermis and other dual - layer membranes , the structure of fibrous pericardium is unique ; it has a basement membrane on both sides , resulting not only in a smooth yet porous surface for cellular attachment and proliferation , but also in sufficient density for soft tissue exclusion . in this study , the bone morphometry and/or morphology around implants placed in fresh extraction sockets and covered with pericardium derived collagen membrane was evaluated and compared to a group without a membrane , to investigate whether the unique feature of the membrane could provide enhanced bone regeneration . this study used a commercially available pericardium membrane ( vitala , osteogenics , lubbock , tx , usa ) and 24 commercially available endosseous implants of 3.3 13 mm ( dt implants- ossean surface , intra - lock international , boca raton , fl , usa ) . following approval of the bioethics committee for animal experimentation ( enva , france ) , six beagle dogs with closed growth plates ( ~1.5 years of age ) in good health were acquired for the study and allowed to acclimate for two weeks before surgery . all surgical procedures were performed under general anesthesia . the preanesthetic procedure comprised of an intramuscular administration of atropine sulfate ( 0.044 mg / kg ) and xylazine chlorate ( 8 mg / kg ) . general anesthesia was then obtained following an intramuscular injection of ketamine chlorate ( 15 mg / kg ) . the procedure involved a full thickness mucoperiosteal flap ; teeth were sectioned in the buccolingual direction so that individual roots could easily be extracted by root elevators and forceps without any damage to the alveolar bone wall . following extraction , implants were placed lingually ( to replicate the clinical situation ) in the mesial and distal sockets , at the buccal bone crest level ( figure 1(b ) ) . upon measuring with a periodontal probe , it was made sure that a gap of at least 3 mm ( range 3.2 to 4.5 mm ) was present between the implant body and the buccal side of the alveolar bone . on the right side of the mandible , the implants were covered with vitala ( figure 1(c ) ) ; the implants on the contralateral side were used as controls . all implants were placed following the manufacturer 's surgical protocol , and primary closure was achieved with resorbable sutures ( 3 - 0 vicryl , ethicon ; figure 1(d ) ) . postsurgical medication included antibiotics ( penicillin , 20.000 ui / kg ) and analgesics ( ketoprofen , 1 ml/5 kg ) for a period of 48 hours postoperatively . the bone blocks were kept in 10% buffered formalin solution for 24 hours , washed in running water for 24 hours , and gradually dehydrated in a series of ethanol solutions ranging from 70% to 100% . following dehydration , the samples were embedded in a methacrylate - based resin ( technovit 9100 ; heraeus kulzer , wehrheim , germany ) according to the manufacturer 's instructions . the blocks were then cut into slices ( 300 m thickness ) aiming at the center of the implant along its long axis with a precision diamond saw ( isomet 2000 ; buehler , lake bluff , il ) , glued to acrylic plates with an acrylate - based cement , and a 24-hour setting time was allowed before grinding and polishing . the sections were then reduced to a final thickness of ~30 m by means of a series of sic abrasive papers ( 400 , 600 , 800 , 1200 , and 2400 ; buehler ) in a grinding / polishing machine ( metaserv 3000 , buehler ) under water irrigation . the histologic features were qualitatively evaluated at 50x to 200x magnifications ( leica dm2500 m ; leica microsystems , wetzlar , germany ) . the amount of bone - to - implant contact ( bic ) and buccal bone loss ( bbl ) were calculated by means of a computer software ( leica application suite , leica microsystems gmbh , wetzlar , germany ) . the regions of bone - to - implant contact along the implant perimeter were subtracted from the total implant perimeter , and calculations were performed to determine the bic . the surgical procedures and followup demonstrated no complications or other immediate clinical concerns . there were no signs of infection or inflammation at the surgical sites or surrounding tissues throughout the duration of the study . at 6 weeks , the qualitative analysis of the histologic sections showed for both groups , regions of direct bone - to - implant contact and new woven bone bridging the gap between implant and the old bone of the socket walls ( figure 2 ) . apical migration of soft tissue resulting in lower cervical to apical bone to implant first contact was observed for the implants in the control group ( figure 3 ) . in the experimental group , where the implants were covered by the membrane at the time of placement , an intimate contact between implant and bone was observed throughout the implant level ( figure 4 ) . higher magnification optical micrographs of an experimental group section are presented in figure 5 . quantitative analysis of the test group rendered a significantly higher bic in comparison to the bic observed for the control group , 75% versus 45% ( p < 0.02 ) , respectively . the sites that were covered with the membrane presented a 0.7 mm buccal bone loss which was significantly lower than the control group that showed a 2.5 mm loss in buccal plate ( p < 0.02 , figure 6 ) . the implantation site within arch ( mesial or distal ) did not influence bic or bbl in either control or test groups ( p > 0.80 ) . immediate implant therapy has been proven to be a successful clinical treatment , since it is less invasive and is beneficial in shortening the treatment period [ 24 , 25 ] . the survival rate of immediately placed and loaded implants over a 710 year followup varies between 85 and 91% , depending on location of the implant . following tooth extraction , a discrepancy between the diameter of the extraction socket and an immediate implant renders a gap that can influence the osseointegration of the implant by allowing apical soft tissue migration . in this study , the implants placed in the fresh extraction sockets of dogs showed appropriate osseointegration with direct bone - implant - contact when an occlusive collagen pericardial membrane barrier was used . previous studies have shown that the gap width was one of the decisive factors in order to achieve implant osseointegration ; for instance , a gap ranging 0.351 mm was shown to result in incomplete bone healing around the implants [ 28 , 29 ] . knox et al . evaluated the coronal positioning of the bone - to - implant contact in dogs , in gaps up to 2 mm without the placement of a membrane . their results showed that the level of coronal bone position along the implant surface was dependent on the initial gap between alveolar bone and implant . these conclusions are supported by the results obtained from the current study where , by eliminating apical soft tissue migration over the implant by means of a membrane barrier , higher levels of bic , lower buccal bone loss , and a more coronal direct bone apposition was observed compared to controls . although implant surface and implant design play an important role in the osseointegration and survival of implants in fully healed bone , the data may not be fully applicable in sites such as implant placement in extraction sockets or in immediate loading conditions . under progressive and dynamic ridge alteration , the effect of the state of the art surface architecture may be less effective , and the biological reassembly takes initiative in the configuration procedure . thus , in order to successfully obtain bone fill and osseointegration in a gap created during implant placement in fresh extraction sockets , additional regenerative procedures such as the guided soft tissue / bone regeneration ( gtr / gbr ) with the use of occlusive membranes may be necessary to maintain space for blood clot infiltration and maturation , further to exclude soft tissue invasion . the appropriate bone regenerative outcomes around the implants placed in fresh extraction sockets of the current study has indicated that the use of membrane to cover the gap is an effective procedure . this is in agreement with other studies using a commercially available bioresorbable membrane , which presented that the use of such membrane contributed to the preservation of the buccal outline of the alveolar process [ 33 , 34 ] . moreover , the structural characteristics of the pericardium - derived porcine membrane may have been responsible for further bone enhancing effects since our histologic sections did not show extensive membrane collapsing into the gap between the socket wall and implant bulk . mechanical property wise , it has been reported that these membranes possess a better tensile strength and ball burst than other collagen membranes derived from small intestine submucosa ( peritoneum ) or acellular dermal matrix . with regards to the structure of the membrane , the noncross linked matrix derived from the porcine pericardium has a bionic feature , which has been suggested to be a key factor for cell migration and morphogenesis . to conclude , the findings of the present study showed that using a bioresorbable , pericardium membrane resulted in significantly higher bic and a closer fit between the bone margin and the abutment - fixture margin as compared to sites without membrane coverage . although it has not been compared to other membrane materials in the present study , the outcomes of this study strongly suggests the bioeffectiveness of the biologically inspired design membrane in challenging cases such as implant placement in the fresh extraction sockets . another aspect to further clarify the effect of the membrane is to identify the time course changes in relation to the anatomical landmarks as presented in numerous studies conducted by arajo et al . [ 3840 ] . in order to bring in clinical benefits , further investigations comparing the pericardium membrane to other membrane materials which are clinically used

objective . to investigate whether porcine - derived bioresorbable pericardium membrane coverage enhances the osseointegration around implants placed in fresh extraction sockets . study design . twenty - four commercially available endosseous implants were placed in the fresh extraction sockets of the mandibular first molar of mature beagles ( n = 6 ) . on one side , implants and osteotomy sites were covered with porcine - derived bioresorbable pericardium membranes , whereas on the other side , no membranes were used . after 6 weeks , samples were retrieved and were histologically processed for histomorphometric analysis . results . the histological observation showed that bone loss and soft tissue migration in the coronal region of the implant were evident for the control group , whereas bone fill was evident up to the neck of the implant for the membrane - covered group . bone - to - implant contact was significantly higher for the membrane - covered group compared to the control group , 75% and 45% ( p < 0.02 ) , respectively . conclusion . the experimental membranes proved to regenerate bone around implants placed in fresh extraction sockets without soft tissue intrusion .

auricular acupuncture is a diagnostic and treatment system based on normalizing the body 's dysfunction through stimulation of points on the ear . resulting amelioration of pain and illness is believed to be through the reticular formation and the sympathetic and parasympathetic nervous systems ( 1 ) . ear acupuncture , is an acupuncture technique similar to reflexology , and is speculated that the technique works because groups of pluripotent cells contain information from the whole organism and create regional organization centers representing different parts of the body , through recruitment of more cortex cells dedicated to specific areas of the body . thus stimulation of a reflex point in the ear can relieve symptoms of distant pathology with a reliable duration . rudimentary forms of acupuncture which probably arose during the stone age have survived in many parts of the world right down to present day . primitive sharp stones and bamboo were replaced by fish bones , bamboo clips and later various shapes of needles made of metal . when stones and arrows were the only tools of war , warriors wounded in war found that some diseases that affected them for many years were gone , as probably testify scars on the skin of the mummified body of similaun , italy . the bantus of south africa scratch certain areas of their skin to allay the symptoms of many illnesses , while in brazil there is a tribe whose method of treating illness is to shoot tiny arrows from a blowpipe to specific areas of the skin . the practice of cauterizing a part of the ear with a hot metal probe has also been reported among certain tribes in arabia . this is probably a vestige of the acupuncture practiced in ancient egypt and saudi arab . ( now in the british museum ) describes a system of channels and vessels in the body which approximates more closely to the chinese system of channels than to any known system of blood vessels , lymph vessels or nerves . the egyptologist alexandre varille ( 19091951 ) has documented that women in ancient egypt who did not want any more children , had their external ear pricked with a needle or cauterized with heat . gold earrings worn by mediterranean sailors were not just used as decorations , but were said to improve vision . hippocrates , the father of of greek medicine , reported that doctors made small openings in the veins situated behind the ear to facilitate ejaculation and reduce impotency problems . the greek physician galen introduced hippocratic medicine to the roman empire in the second century ce , and commented on the healing value of scarification at the outer ear . after the fall of roman empire , the medical records of egyptian , greek and roman medicine were best preserved in ancient persia and arabian world . included in these persian records were specific references to medical treatments for sciatic pains and sexual related disease produced by cauterization of the external ear . during renaissance sporadic clinical reports in europe the dutch east india company actively engaged in trade with china from 1600s to 1800s , and its merchants brought chinese acupuncture practices back to europe . doctors working with the company had become impressed by the effectiveness of needles and moxa , and cauterization of the external ear , or by cutting the veins behind the ears for relieving conditions such as sciatic pains and arthritis of the hip . in 1637 probably for the first time in europe was described by the portugese physician zacatus lusitanus the treatment of sciatic pain by cauterization of the ear after that bloodletting had failed . the italian anatomist and surgeon antonio maria valsalva ( 16661723 ) , who made the first modern anatomical description of the ear ; in 1717 published the aura humanus tractatus , where he describes the treatment of toothache by scarification of antitragus . in 1810 ignazio colla of parma , italy , reported the observation of a man stung by a bee in the antehelix which resulted in dramatic relief of pain in the legs , and in the same year dr cecconi , another italian physician , performed cauterization to help treatment of sciatic pain . in 1850 the french journal des connaissainces medico - chirurgicales reported 13 different cases of sciatic pain that had been treated by cauterization with a hot iron applied to the ear . but it was not until a century later that paul nogier rediscovered this type of treatment . in 1957 , dr paul nogier a physician resident in lyons , france , first presented his observations of the somatotopic correspondences of the ear . dr nogier ( 2 ) originated the concept of an inverted fetus map on the external ear ( fig . he developed this theory after noticing that some patients attending his clinic had a small scar from a burn on part of their ear . on inquiring into this , he was told that a very small area of their ear had been cauterized by a certain madame barrin for treatment of sciatic pain a treatment that they proved very rapid and effective . later his first great insight was the recognition of the homunculus , the man in the ear , the representation and anatomical correlation of the inverted fetus in the ear . points on the body , for example the knee , corresponded precisely with the fetal representation of the knee in the auricle . auriculotherapy following nogier 's theory uses the ear to help determine whether the right and left hemispheres of the brain are functioning as a dynamic whole , whether there are specific neurological , musculo - skeletal or organ systems that are in imbalance , and whether there are any blockages to treatment , such as scar tissue or emotional disorders and it should be a new diagnostic system too ( 2,3 ) . figure 1.this drawing illustrates the concept of an inverted fetus map on the external ear . then dr nogier noticed that there was a distinct change in the amplitude and dimension of the pulse when certain points on the auricle were stimulated . being able to detect the vas on the radial pulse of the patients left hand enables the practitioner to precisely determine the location of a point , whether there is a pathology in the region of the body that relates to specific points , and whether certain substances are indicated . accurate employment of the vas would be essential in diagnosis and treatment following the principles of nogier 's auricolomedicine . nogier collaborated with a group of medical colleagues who , in a spirit of cooperation and discovery , shared their experiences . one of those colleagues , dr jacques niboyet , convinced nogier to introduce his discoveries to the congress of the mediterranean society of acupuncture in february of 1956 . attending that congress was dr grard bachmann who published nogier 's research , translated into german , in a acupuncture journal in 1957 . this journal had an international circulation and it was not long before japanese acupuncturists became familiar with nogiers reflex system . the discovery of the system spread to china and led to intensive research by the chinese medical authorities at a time of renewed interest in traditional chinese medicine . after learning about the nogier ear charts in 1958 , a massive study was initiated by the nanjing army ear acupuncture research team . this chinese medical group verified the clinical effectiveness of the nogier approach and assessed the conditions of over 2000 clinical patients , recording which ear points corresponded to specific diseases . the outcome of that research was very positive and resulted in the utilization of this therapy by the was published an ear chart remarkably similar to that of dr nogier in 1958 ( 4 ) . nogier acknowledged that chinese traditional medicine had been using ear points for acupuncture prior to his discovery , but these had been considered empirical points for particular treatments and were not associated with a somatotopic representation of the homunculus in the ear . this oversight appears to have inhibited awareness of options laid open to recognize and treat other points in the ear following an anatomical relationship to the points already known at the time . later the american physician td oleson has published a very important paper that is a real milestone in ear acupuncture ( 5 ) . to experimentally evaluate the claims by french and chinese ear acupuncture that a somatotopic mapping of the body was represented in the external ear , 40 patients were examined to determine areas of their body where there was musculoskeletal pain . each patient was draped with a sheet and a physician conducting the auricular diagnosis had no prior knowledge of the patient 's medical condition , but simply examined the patient 's ear for areas of elevated skin conductivity or tenderness . the concordance between the established medical diagnosis and the auricular diagnoses was 75.2% ( 5 ) . these results thus supported the hypothesis that there is a somatotopoic organization of the body represented upon the human auricle , but represented following definite areas not meridian lines or other energetic concepts . in the last years modern clinical and basic research is confirming the efficacy of ear acupuncture mostly in the treatment of pain both acute and chronic ( 69 ) , and of anxiety related disorders ( 1012 ) . while the treatment of irritable bowel syndrome , obesity , smoke cessation , alcohol withdrawal and other types of substance abuse disease is still waiting definitive confirmation ( 1317 ) . basic research is trying to explain the effect of therapeutic reflexes induced by ear acupuncutre so behavioral analgesia produced by auricular acupuncture can be blocked by the opiate antagonist naloxone , indicating the role of endorphinergic systems in understanding the underlying mechanisms of auriculotherapy analgesia ( 18 ) ; and ear stimulation in healthy persons is associated with changed activity in the sympathetic and parasympathetic nervous system depending on the site of stimulation and period of observation ( 19 ) . auricolotherapy is a treatment diffusing in all over the world , and its patterns follow the principles of chinese acupuncture , revised and updated , with chinese maps of the ear ; the principles of paul nogier and also the principles of reflexology basing on somatotopic maps that do not recognize energetic - based stimulation , while just the evocation of a reflex stimulating precise areas of the ear ; moreover are used for stimulation of ear skin many different tools : finger acupressure , laser , electricity , different types of needles , magnetic balls , seeds . actually one of the many methodological problems with auricular acupuncture is that there are so many maps of the ear and little agreement exists regarding point location , lacking definitive anatomic study on ear skin and its somatotopic correspondences . another problem is that all correspondence or reflex systems do not correlate to the knowledge of anatomy and physiology based on the patterns of mainstream medicine ( 20 ) .

auricular acupuncture is a diagnostic and treatment system based on normalizing the body 's dysfunction through stimulation of definite points on the ear . rudimentary forms of acupuncture which probably arose during the stone age have survived in many parts of the world right down to present day . it was used in the ancient egypt , rome , greece and all the mediterranean area . it is a microacupuncture technique similar to reflexology , and was first described in france in 1950 by paul nogier who is considered the father of modern ear acupuncture . it was speculated that the technique works because groups of pluripotent cells contain information from the whole organism and create regional organization centers representing different parts of the body . nevertheless stimulation of a reflex point in the ear seems relieve symptoms of distant pathologies . modern research is confirming the efficacy of ear acupuncture for analgesia and anxiety related disease , while tobacco dependence and other substance abuse still need confirmation . actually main methodological problems with auricular acupuncture are that exist too many maps with little agreement regarding point location in the ear , and that the correspondence or reflex systems does not correlated with modern knowledge of anatomy and physiology .

urinary tract infection ( uti ) is one of the most important and serious infections in children . it occurs in 35% of girls and 1% of boys up to 5 years , and peaks during infancy and toilet training period[1 , 2 ] . uti may lead to renal scarring , impaired glomerular function , early hypertension , and end stage renal disease in the future[36 ] . the periurethral area is colonized by both anaerobic and aerobic bacteria from the gastrointestinal tract , which serve as part of a normal defense barrier against pathogenic microorganisms . the most common risk factor leading to uti is urinary stasis that deranges this equilibrium . this can result from vesicoureteral reflux , bladder dysfunction , habitually infrequent or incomplete voiding , stones , and outflow obstruction due to labial adhesion or constipation[8 , 9 ] . other probable risk factors in girls include back to front wiping , poor perineal hygiene and bubble baths . in only one prospective case control study in 1996 that we found in literature , there was no difference in incidence of uti in children using different types of diapers . this study was done to investigate if the type of diapers used in infancy is a possible risk factor in uti in young girls . we compared the use of different types of diapers in two groups , ie children with definite uti and the control group without uti . this case control study was performed in girls under the age of two years hospitalized in mofid children 's hospital from october 2007 to march 2008 . female children under the age of two years admitted with their first uti were selected as cases and girls hospitalized for some other reasons ( mainly elective surgery ) , served as controls . we considered definite uti when the child had fever with positive pyuria ( urine wbc > 5 in hpp ) and positive urine culture ( colony count > 10/cc ) in clean catch or bag specimen . two groups were matched for age ( 1 month ) and for known risk factors for uti , like labial adhesion , constipation , style of buttock wiping and bubble bath . children with renal dysfunction or structural urinary tract anomaly except labial adhesion were excluded from this study . questionnaires were completed by a trained nurse ; relevant information included details of the types of diapers used prior to the first diagnosed uti , ie the use of superabsorbent , standard disposable or washable cotton diapers . the type and number of diapers used daily as well as the time of diaper change after defecation were documented . the study protocol was approved by the ethics committee of the shahid beheshti university of medical scinces . also , the data was summarized as follows : proportional values for qualitative variables and median ( minimum - maximum ) for quantitative variables . comparisons between the two groups were performed by paired t - test and mcnemar test and differences considered significant if p - value < 0.05 . one - hundred and eighteen children between 1 to 24 months were included in the study . fifty - nine pairs of cases , ( children with uti ) , and controls were matched . mean age was 9.57 months ( sd=6.06 ) in cases and 9.60 months ( sd=5.80 ) in control group . as shown in table 1 , superabsorbent diaper was used more frequently in cases than in controls ( 62.71% vs. 35.59% ; or=3.29 , p - value=0.005 ) . the difference between number of diapers used per day in controls ( 6.4 + 3.4 ) and cases ( 7.9 + 7.3 ) was not statistically significant ( p - value=0.15 ) . the time between defecation and diaper change was less than 5 minutes in majority of the children in both groups and was almost similar ( 89.83% in cases vs. 77.97% in controls , p - value=0.014 ) . there were no significant differences in other factors like level of family income and mother 's occupation in the two groups ( table 1 ) . the epidemiology of uti during childhood varies by age , gender and various other factors . the incidence of uti is highest in the first 2 years of life but decreases later in this study we have shown that the type of diaper could be a risk factor for uti in little girls . uti was seen more frequently with the use of superabsorbent diapers as compared to using other diapers . in one prospective case control study in 1996 , there was n't any difference in incidence of uti in children using three different types of diapers . the odds ratios for risk of contracting uti according to different diaper types used prior to the first uti diagnosis were 0.95 for superabsorbent diapers , 1.04 for standard disposable diapers and 1.00 for washable cotton diapers however , during the course of that study , use of cotton washable nappies had been replaced by the superabsorbent diaper , thus producing a bias and making the results unreliable . one explanation that could account for the different results in our study is the frequency of diaper changes in both groups . we expected that because of the high price of superabsorbent diapers , these types of diapers would be changed less often . however our study showed that there was no difference in number of daily diaper changes between the two groups . a logical explanation for difference in the incidence of uti between children with different types of diapers is insufficient ventilation in genital area with the use of superabsorbent diapers . the main source of uti is through the ascending route and it usually occurs as a consequence of colonization of the periurethral area by a virulent organism that subsequently gains access to the bladder , in superabsorbent diapers there is a suitable environment for bacterial overgrowth due to incomplete evaporation of urine , thus providing a ready source of infection . poor perineal hygiene and insufficient ventilation due to tight clothing is a predisposing factor for uti . in addition , it seems prudent to advise parents to keep the infant 's genital area dry thus reducing bacterial overgrowth and the consequent risk of infection . limitation of our study was an underestimation of case and control patients with washable cotton diapers , therefore we gathered children with this type of diapers and disposable diapers in one group known as ordinary diapers as washable cotton diapers are not ordinarily used nowadays , we recommend the use of diapers equipped with ventilation or with alarm systems such as a color change when wet . we also recommend that , to decrease bacterial overgrowth , the perineum should be dried thoroughly after washing all authors have no conflicts of interest to declare , and did not have any financial or non - financial conflict of interest .

objectiveurinary tract is one of the most common sources of infection in children under the age of two years . many known and unknown risk factors predispose to this important disease in children . this study was conducted to determine whether using a specific type of diaper plays a role in urinary tract infection ( uti ) in girls under the age of 2 years.methodsthis case control study was performed in hospitalized children ; girls with their first urinary tract infection were selected as cases , and those admitted for other reasons comprised the control group . two groups were matched for age ( 1 month ) , and other known risk factors for uti . type of diapers ( superabsorbent , standard disposable and washable cotton ) , used for these children during six months , from october 2007 to march 2008 , were compared in both groups.findings59 matched pair infant girls less than 2 years were selected . it was revealed that in cases with uti superabsorbent diapers were used more frequently than in controls ( odds ratio=3.29 , p - value=0.005 ) there were no significant differences in other factors like number of diapers used per day , the time between defecation and diaper change , mothers educational level , level of family income and mother 's occupation.conclusionthe use of superabsorbent diapers could be a risk factor for urinary tract infection in infant girls .

a recent report from the progress registry warned readers of potential danger associated with the use of corticosteroids in patients with severe sepsis or septic shock . in this retrospective analysis , 3,051 out of 8,968 ( 34% ) patients received treatment with low dose corticosteroids . corticosteroid - treated patients were older , had more co - morbidities and greater severity of illness than patients who did not receive corticosteroids . subsequently , there were more deaths among corticosteroid - treated patients even after controlling for various confounders . a recent cochrane systematic review of corticosteroid treatment for severe sepsis and septic shock found 17 randomized controlled trials ( n = 2,138 ) and 3 quasi randomized trials ( n = 246 ) . computing data from the 17 randomized trials yielded a significant survival benefit from corticosteroids with a risk ratio ( rr ) of 0.84 ( 95% confidence interval ( ci ) , 0.71 to 1.00 ; p = 0.05 ) . there was a strong heterogeneity across the studies ( i= 53% by random - effects model ) , which was mainly explained by differences in treatment strategies . indeed , the meta - regression using dose and treatment duration showed that survival benefit was strongly dependent on the dose of corticosteroids ( p = 0.02 ) - the lower the better - and the duration of treatment ( p = 0.01 ) - the longer the better . then , subgroup analysis based on 12 trials ( n = 1,228 ) of prolonged treatment ( 5 days or more at full dose ) with low dose ( lower than 300 mg per day of hydrocortisone or equivalent ) corticosteroids found that 28-day mortality for treated versus control patients was 236 out of 629 ( 37.5% ) versus 264 out of 599 ( 44.1% ) ( rr , 0.84 ; 95% ci , 0.72 to 0.97 ; p = 0.02 ) without heterogeneity across the studies ( i= 15% ) . in this systematic review , there was no evidence for increased risk of gastrointestinal bleeding ( n = 1,594 ; rr , 1.12 ; 95% ci , 0.81 to 1.53 ; p = 0.50 ) , superinfection ( n = 1,917 ; rr , 1.01 ; 95% ci , 0.82 to 1.25 ; p = 0.92 ) or neuromuscular weakness ( n = 811 ; rr , 0.63 ; 95% ci , 0.12 to 3.35 ; p = 0.58 ) , while corticosteroids were associated with hyperglycaemia ( n = 1,434 ; rr , 1.16 ; 95% ci , 1.07 to 1.25 ; p < 0.001 ) and hypernatraemia ( n = 805 ; rr , 1.61 ; 95% ci , 1.26 to 2.06 ; p < 0.001 ) . of note , normalizing blood glucose levels in corticosteroid - treated septic shock did not affect mortality . thus , it is unlikely that corticosteroids increased the risk of death in severe sepsis or septic shock as suggested by beale and colleagues . nevertheless , given the opposite findings of the two largest trials of low dose corticosteroids , which might be explained by differences in severity of illness , current recommendations suggest that low dose corticosteroids should be considered only in patients who are poorly responsive to fluids and vasopressors . as highlighted by the authors , this was a retrospective analysis of data from a registry that was set up to assess the routine use of activated protein c and not to investigate the benefit to risk ratio of corticosteroids . there is no information on the time of treatment initiation , the exact dose and the duration of treatment . of note , the recent cochrane systematic review showed that the benefit to risk ratio of corticosteroids was favourably influenced by early treatment , lower doses and longer duration . as the use of corticosteroids was not controlled in patients included in the progress registry , any conclusion about treatment benefit or harm is severely flawed . the most valuable information from the study of beale and colleagues is the apparently high proportion ( 14% ) of vasopressor - free patients who received treatment with corticosteroids . there is some evidence to support the use of corticosteroids in target populations regardless of the presence of shock , including patients with bacterial meningitis , typhoid fever , pneumocystis pneumonia , or severe community acquired pneumonia . unfortunately , the study by beale and colleagues includes no information on the type of infections in the vasopressor - free patients who were treated with corticosteroids . we should worry about the unnecessary use of corticosteroids in patients with sepsis and without shock only in those with infections other than those cited above . there are ongoing trials to confirm the benefit of corticosteroids in septic shock ( aprocchs , nct00625209 ) or in severe sepsis without shock ( hypress , nct00670254 ) . while waiting for the results of these trials , the current evidence supports the use of low dose corticosteroids ( 200 mg of hydrocortisone or equivalent per day for at least 5 days ) in patients with septic shock who require 0.25 g / kg / minute or more of norepinephrine ( or equivalent ) and in adults with bacterial meningitis or severe community acquired pneumonia .

a recent report from the progress registry highlighted that low dose corticosteroids are widely used in patients with sepsis around the world . in this report , corticosteroids may be associated with increased morbidity and mortality . however , these findings should be viewed with caution given that this study has several inherent flaws because of its retrospective nature and the lack of controlled use of corticosteroids . in this commentary , these findings are contrasted with those of a recent cochrane systematic review .

the chronic diseases like cardiovascular diseases , diabetes and cancer contributes to almost half of the all - cause mortality in india . weighted prevalence of ischemic heart diseases was observed as 25.3/1000 population , and 118.0/1000 population for diabetes mellitus in an urban area of india . it was observed due to common risk factors like physical inactivity , unhealthy diet , tobacco use and stress . along with growth and development , reduction in common risk factors was considered to be one of the essential preventive and control strategies for chronic diseases . like modern medicine , the complementary and alternative medicine ( cam ) - ayurveda ( knowledge or science of life ) - primarily concerned with the body . it had been mentioned in ayurveda , about the three pillars for healthy and long life ; proper diet ( ahar ) , proper activities ( vihar ) , and divine life - style and control of sexuality ( brahmacharya ) . improper and unbalanced diet like undigested , junk , and accumulated food was also considered toxic for the body . ayurveda had been oldest and most organized scientific discipline , which was providing health - care . once upon a time , their classical text like charak samhita ( 100 ad ) is an excellent source of information about the holistic health , herbs , diseases , and surgical treatment for the entire country and the world . like yoga , ayurveda derived its origin to the hoary vedas and considering one of the sub - vedas ( upa - veda ) . therefore , its traditional holistic approach and principles observed to be have a potential in order to reduce the risk factors of chronic diseases in the community . it was already evident that cam had been widely used in africa ( 80.0% ) , australia ( 49.0% ) , indonesia ( 40.0% ) , france ( 75.0% ) , and even in united states ( 29.0 - 42.0% ) . in india as well , people are using the cam services through 2860 large hospitals across the country . cam has been integrated into primary health - care of the country under the national rural health mission . pattern of reported diseases at the cam facilities has not been shared with the modern medicine in india despite the provision of care to a significant group of the population . therefore , the present study was undertaken to describe the clinical profile of patients with chronic diseases at a tertiary care ayurvedic hospital in north india . the study was a part of assignment for the fellows appeared for 3 months course on non - communicable disease and health promotion at department of community medicine , dr . total 4 fellows appeared for the course and a 1 month field based assignment was allotted . during the course period fellows were assigned a mentor and a topic for study . present study was hospital based record based descriptive study carried out at department of kayachikitsa , rajiv gandhi post graduate ayurvedic college , kangra , himachal pradesh . as per census 2011 , the provisional population of the himachal pradesh was 68 56 509 ( 49.3% females ) and 15 07 223 ( 50.3% females ) of kangra district of the state . complied monthly data were accessed from the outpatient department ( opd ) records section from january 2011 to october 2011 . a single person collected the number of patients with an available diagnosis for every month . in addition , 30 case records ( patient file ) of admitted patients of hypertension and diabetes mellitus were selected randomly - using a random number table - from the inpatient department ( ipd ) . a total 30 case records were decided to study treatment practice at a tertiary care center . data were entered and analyzed by epiinfo 3.2 statistical software . before the data collection , ethical clearance form institution ethics committee and consent from studied health institutions was obtained . significantly ( p = 0.00 ) more males ( 51.1% ) reported at opd more than males . total 10,276 ( 15.8% ) children up to 5 years of age also sought treatment . almost half ( 53.1% ) of the patients were remained unclassified and kept under other category . commonly reported morbidities were related to respiratory ( 10.5% ) , neuromuscular ( 9.5% ) , digestive ( 9.2% ) , circulatory ( 9.1% ) , and eye ( 8.4% ) system . monthly trend of reported patients in the opd of kayachikitsa at rajiv gandhi post graduate ayurvedic college , kangra , himachal pradesh , 2011 ipd records of 30 hypertensive patients at ayurvedic tertiary hospital showed that the chest pain was the chief complaint ( 63.3% ) with mild to moderate intensity ( 70.0% ) and of radiating ( 56.7% ) in nature . it was observed that more than half ( 56.7% ) of the patients sought treatment from private practitioners before the admission [ table 2 ] . admitted patients had a history of hypertension for average 9 months and were on regular treatment for 21.3% of disease duration . diabetes mellitus had long standing history of average 145 month among the admitted patients , and since diagnosis ( 90.3% ) were on regular treatment . majority of patients with hypertension were being managed with aswaganda ( 66.0% ) and tagar powder ( 56.6% ) . symptomatic and management profile of patients in ipd of kayachikitsa at rajiv gandhi post graduate ayurvedic college , kangra , himachal pradesh , 2011 elevated blood pressure along with overweight and high cholesterol is a known risk factor for many chronic diseases . the chronic diseases are contributing about 46.0% of the all - cause mortality in india . evidence from india reported prevalence of chronic diseases up to 30.0% in the general population . it had been found to be prevalent in urban ( 36.4% ) along with slum ( 25.4% ) and rural ( 24.0% ) area . the present study at rural tertiary care health institute of ayurveda , showed that most of the patients were suffering from disorders related to respiratory , neuromuscular , and circulatory system , mostly suggestive of chronic diseases . based upon the grouped opd data it was observed to be difficult to further ascertain the causes of morbidity such as heart attack , brain attack , diabetes mellitus etc . , majority of patients were even not classified at all despite the complete diagnosis at the opd . it hindered the information that could ascertain that whether these patients were affected with the exact cause of chronic or acute disease . in the studied state , a total 27 ayurvedic hospitals with 580 beds , 1105 dispensaries and 7326 registered practitioners exist at the time of study . in the country , a total of 254 graduate and 64 post graduate ayurvedic colleges were producing 1197 under and 1110 post graduates every year . in addition , a total of 2458 hospitals with 44820 beds , 15353 dispensaries , 478750 registered practitioners . in ayurveda , dietary factors like unhealthy diet considered as a known risk factor for chronic diseases like consumption of high glycemic index , junk and salted food . however , food was being considered as medicine in ayurveda like barley / turmeric for obesity , kulatha for rheumatoid arthritis , ashwagandha as a general tonic . ayurveda had been playing a vial - role in the provision of treatment for common morbidities in india . ayurvedic products like jams , jellys , juices , biscuits , ice - cream , candies , chocolates , granules , flour , tea etc . , were recommended as healthy food and to be promoted to the crowd out the junk food in the existing market . therefore , with a vast human resource and the available ayurvedic treatment potential in the country , the rising trend of chronic diseases due to non - healthy life - style and dietary behavior could be managed successfully . furthermore , the actual burden and types of chronic disease in cam discipline need to be studied and shared . in this respect , standard method of case reporting modified as per the discipline to integrated disease surveillance project ( idsp ) at all levels and types of cam health facilities would certainly help to capture exact disease burden . as , government of india had already declared the mainstreaming of cam in modern health - care delivery system as it had recommended by appointment of at least one cam specialist at the community health center . ayurveda was being the oldest and the largest cam discipline in india , so , the integration of information from the ayurvedic health institution through idsp would be required to help for formulation of healthy public policy .

since a very long time , a significant number of patients have been seeking treatment at complementary and alternative medicine health facilities , but the disease burden at these facilities has never been assessed and documented . present cross - sectional study was carried out at ayurvedic tertiary care hospital to document and to assess the rationale of disease reporting at ayurvedic institutions of the northern state of india from january 2011 to october 2011 . almost half of the patients morbidities were not classified at all into any of the disease categories . the common reported morbidities at study hospital were : respiratory ( 10.5% ) , neuromuscular ( 9.5% ) , digestive ( 9.2% ) and circulatory ( 9.1% ) disorders . as the majority of diseases were unclassified , so mainstreaming of the effective disease surveillance would be required to understand the morbidity pattern and successful treatment practices at health facilities .

monitoring the patient s condition during surgery under a general anesthesia is crucial . an anesthesiologist continuously obtains information from the anaesthetized subject . cardiac and respiratory function is one of this information [ 1 - 5 ] . in general , such information is obtained by measuring and listening to the respiratory and heart sounds . heart sounds reflect the blood turbulence created when the heart valves are closed . in healthy adults , there are two major heart sounds often- the first heart sounds ( s1 ) and second heart sound ( s2 ) . specifically , the s1 sound is caused by : a ) the rapid block of reverse blood flow due to closure of atrio - ventricular valves ( the tricuspid valve and mitral valve ) ; b ) oscillation of blood between the root of the aorta and the ventricular walls ; and c ) vibrations caused by turbulence in the ejected blood flowing rapidly through the ascending aorta and the pulmonary artery . the s2 sound is occurred at the end of ventricular systole and the beginning of ventricular diastole . this sound is caused by closure of the semilunar valves ( the aortic valve and pulmonary valve ) . the snap shut of these valves causes sudden block of reversing flow blood and ultimately cause vibrations in the arteries and ventricles . in addition to s1 and s2 , in some cases a third heart sound ( s3 ) and the fourth heart sound ( s4 ) may be heard . the former is caused by oscillation of blood between the walls of the ventricles in the ventricular rapid - filling phase . finally , the s4 sound is caused by atrial contraction displacing blood into the ventricles . the heart sounds provide important information on myocardial contractility , hemodynamic status , vascular resistance , and pulmonary artery . in anesthesia , heart sounds can be used as indicators of cardiovascular status and anesthetic depth [ 1 - 4,6 - 10 ] . with cardiovascular depression from deep anesthesia , in addition to heart sounds , auscultation of lung sounds enables the anesthesiologist to immediately detect minor disturbances that could ultimately cause patient harm such as airway obstruction and disconnection [ 1,3,4,11 - 14 ] . difficult or labored harsh noises , whistles or squeaks may indicate narrow or obstructed airways or the presence of fluid in the airways . therefore , heart and lung sounds provide valuable information to the anesthesia provider , and these two parameters should be continuously monitored . the simple and low - cost instrument to monitor heart and lung sound is a stethoscope [ 3,12,13,15 - 17 ] , but there are several issues with using this device during operation . it may not provide clear heart and lung sound due to existence of various noises in operating rooms . the stethoscope is not applicable for continues monitoring . finally , it is impossible for the anesthesiologist to be completely observant at all times . esophageal stethoscope is an instrument for measuring and monitoring heart sound or respiratory sound during operation . this device consists of a thin , flexible , blind - ended tube attached to a regular stethoscope usually by a small plastic adaptor . there is a thin plastic membrane over the perforated area to prevent fluid entering the lumen of the tube . the advantages of the esophageal stethoscope are that it is less invasive and easy to handling . moreover , the anesthesiologist has to sit down beside the patient all throughout the operation that may not be practical . recently , several electronic esophageal stethoscopes have been developed for auscultation of the heart and lung sound during anesthesia [ 15,18 - 22 ] . experimental results of qualitative evaluation of these devices revealed that these instruments resolved low signal to noise ratio of the acquired signals . . however , in using these instruments still the anesthesiologist has to sit down beside the patient all throughout the operation that may not be practical and may affect the performance of the anesthesiologist . moreover , monitoring of the heart and lung sounds during anesthesia using these developed stethoscopes is difficult when x - ray examinations ( e.g. , ct scanning ) of the patient is required . in this paper , we proposed a wireless electronic esophageal stethoscope for continues auscultation of the heart and lung sounds in anesthetized patients . the remainder of this paper includes a description of the instrument developed for this purpose followed by experimental evaluation , discussion and conclusions sections . as shown , the instrument consists of two parts , a transmitter and a receiver . block diagram of the designed wireless electronic esophageal stethoscope the transmitter acquires , filters , amplifies and wirelessly sends the heart sound and lung sound data to the receiver . a microphone with a 20 hz to 20 khz frequency range was selected to capture all the frequency characteristics of the heart and lung sound . figure 2 the signal from the microphone is contaminated by noise and is very feeble too . interference and low amplitude of the acquired signal may cause difficult for the anesthesiologist to differentiate every sound . therefore , low pass filter with cut off frequency of around 27 khz is used to reduce the effect of noise and a pre - amplifier is employed to increase the input signal amplitude by a gain factor of 50 . the designed pre- amplifier is also an active low - pass filter that boosts signals and enhances the signal - to- noise ratio of the captured signal simultaneously . transmitter circuit diagram of the designed wireless electronic esophageal stethoscope the output signal from the pre - amplifier is amplified by an amplifier and a power amplifier to supply the necessary power to drive the headphones and for further processing . this amplifier has a variable gain that helps adjusting the amplitude of the signal for the correct analysis . as discussed , the main objective of this work was to design a system that can be used for observing inaccessible patients during ct scan . for this purpose , the system wirelessly sends the acquired signals ( heart and breath sounds ) to a receiver if needed . the output of the pre - amplifier is band - pass filtered and then is delivered to the frequency modulation ( fm ) unit and radio frequency ( rf ) amplifier . the output of the rf amplifier is then sent to the receiver via an antenna . if the receiver is not receiving signal correctly , the transmission frequency can be adjusted using three dip switches to get a desirable signal . as shown the hardware design of the receiver consists of an rf amplifier , a demodulator , a low - pass filter and an audio amplifier . therefore , the signal is amplified using a rf amplifier and then is filtered using a simple rc low filter ( r5 and c1 in figure 3 ) . the filtered output signal is boosted by a digitally controlled programmable gain power amplifier to pick up this signal and helps drive the sound for a head phone . on figure 3 the transmitter acquires , filters , amplifies and wirelessly sends the heart sound and lung sound data to the receiver . a microphone with a 20 hz to 20 khz frequency range was selected to capture all the frequency characteristics of the heart and lung sound . figure 2 the signal from the microphone is contaminated by noise and is very feeble too . interference and low amplitude of the acquired signal may cause difficult for the anesthesiologist to differentiate every sound . therefore , low pass filter with cut off frequency of around 27 khz is used to reduce the effect of noise and a pre - amplifier is employed to increase the input signal amplitude by a gain factor of 50 . the designed pre- amplifier is also an active low - pass filter that boosts signals and enhances the signal - to- noise ratio of the captured signal simultaneously . transmitter circuit diagram of the designed wireless electronic esophageal stethoscope the output signal from the pre - amplifier is amplified by an amplifier and a power amplifier to supply the necessary power to drive the headphones and for further processing . this amplifier has a variable gain that helps adjusting the amplitude of the signal for the correct analysis . as discussed , the main objective of this work was to design a system that can be used for observing inaccessible patients during ct scan . for this purpose , the system wirelessly sends the acquired signals ( heart and breath sounds ) to a receiver if needed . the output of the pre - amplifier is band - pass filtered and then is delivered to the frequency modulation ( fm ) unit and radio frequency ( rf ) amplifier . the output of the rf amplifier is then sent to the receiver via an antenna . if the receiver is not receiving signal correctly , the transmission frequency can be adjusted using three dip switches to get a desirable signal . as shown the hardware design of the receiver consists of an rf amplifier , a demodulator , a low - pass filter and an audio amplifier . therefore , the signal is amplified using a rf amplifier and then is filtered using a simple rc low filter ( r5 and c1 in figure 3 ) . the filtered output signal is boosted by a digitally controlled programmable gain power amplifier to pick up this signal and helps drive the sound for a head phone . on figure 3 the designed transmitter and recivear circuit was frist evalued using a computer simulation via pspice software and then fabricted and tested in real world . the parts were delicately transferred to a designed printed circuit board ( pcb ) shown in figure 4 . the designed printed circuit board ( i.e.,pcb ) for transmitter ( top ) and the receiver ( bottom ) of the developed wireless electronic esophageal stethoscope . the transmitter ( top ) and receiver ( bottom ) of developed wireless electronic esophageal stethoscope . the usability and effectiveness of the designed system was qualitatively evaluated by five anesthesiologists in namazi hospital and shahid chamran hospital , shiraz , iran on 30 patients . five well experienced anesthesiologists have been asked to qualitatively provide feedback on the user friendly being of the instruments and on the quality of the heart sound heard from a headphone connected to the output of transmitter / reciever . the system was tested in different conditions in an operating room ; e.g. , when electro surgery instruments were working . the experts , fortunately , on average they ranked good quality for the heart sound and very good on the user friendly . as show , both heart and lung sounds were captured and amplified with clear audibility such that proper auscultation is possible that means the instrument be an effective and suitable device for observing inaccessible patients in several conditions such as during ct scan . electronic esophageal stethoscopes have been developed for the purpose of real - time monitoring of this information visually , but these devices are unsuitable for observing inaccessible patients during mri or ct scan . in this work , an embedded wireless digital stethoscope consists of a transmitter and a receiver is designed and fabricated to resolve this issue . in experimental evaluation of real word operating environment , heart and lung sound was successfully recorded , transmitted and delivered to a head phone to be heard and analyzed by the anesthesiologist . the developed instrument provides wireless auscultation , therefore this instrument could be an effective and suitable device for observing inaccessible patients in several conditions such as during ct scan .

background : the basic requirements for monitoring anesthetized patients during surgery are assessing cardiac and respiratory function . esophageal stethoscopes have been developed for this purpose , but these devices may not provide clear heart and lung sound due to existence of various noises in operating rooms . in addition , the stethoscope is not applicable for continues monitoring , and it is unsuitable for observing inaccessible patients in some conditions such as during ct scan . objective : a wireless electronic esophageal stethoscope is designed for continues auscultation of heart and lung sounds in anesthetized patients . the system consists of a transmitter and a receiver . the former acquires , amplifies and transmits the acquired sound signals to the latter via a frequency modulation transmitter . the receiver demodulates , amplifies , and delivers the received signal to a headphone to be heard by anesthesiologist . results : the usability and effectiveness of the designed system was qualitatively evaluated by 5 anesthesiologists in namazi hospital and shahid chamran hospital , shiraz , iran on 30 patients in several operating rooms in different conditions ; e.g. , when electro surgery instruments are working . fortunately , the experts on average ranked good quality for the heard heart and lung sounds and very good on the user friendly being of the instrument . conclusion : evaluation results demonstrate that the developed system is capable of capturing and transmitting heart and lung sounds successfully . therefore , it can be used to continuously monitor anesthetized patients cardiac and respiratory function . since via the instrument wireless auscultation is possible , it could be suitable for observing inaccessible patients in several conditions such as during ct scan .

they are pigmented fungi and differ from chromoblastomycosis and are seen in all regions of india . the term phaeohyphomycosis was first coined by ajello et al . in 1974 . by broad definition , phaeohyphomycetes are fungi that produce brown - black structures , particularly spores , at least at some period in their life cycle . phaeohyphomycosis is an infection caused by dematiaceous fungi involving skin , subcutis , paranasal sinuses , brain and other viscera . the term subcutaneous phaeohyphomycosis is applied to involvement of skin and subcutaneous tissue and is characterized by a nodular or cystic lesion . here we report two cases of phaeohyphomycosis that involved multiple sites and in one case an uncommon organism of the group i.e. aureobasidium pullulans was cultured from the lesion . this was a case of a 65-year - old male , a farmer by occupation and a known diabetic of 5 years duration , who presented with multiple , non - tender swellings in left leg and right hand of 4 years and 6 months duration respectively . on admission , the leg swelling measured 6 cm 6 cm and was seen discharging pus [ figure 1 ] . swelling in the hand was multiple and nodular and measured 3 cm 4 cm [ figure 2 ] . serological tests were found to be negative for syphilis and human immunodeficiency virus ( hiv ) . left leg swelling measuring 6 cm 6 cm and discharging pus multiple , nodular right hand swelling measuring 3 cm 4 cm a 55-year - old male agriculturist presented with painless swellings over left elbow of 2 years duration , right heel of 1 year duration and right leg of 2 months duration . 4 cm 3 cm over right leg , 4 cm 3 cm 3 cm swelling over left elbow [ figure 3 ] and a cystic swelling over heel about 5 cm 4 cm 3 cm [ figure 4 ] . serological tests were found to be positive for hepatitis c virus and hepatitis b surface antigen and negative for syphilis and hiv . the lesions were excised and sent for histopathological examination . left elbow swelling measuring 4 cm 3 cm 3 cm cystic swelling over right heel about 5 cm 4 cm 3 cm in both cases , there was no regional lymphadenopathy . x - ray showed soft - tissue swelling with no evidence of involvement of underlying bone . excised surgical specimens from both the cases were cystic masses ranging in size from 4 to 6 cm with smooth gray - white external surface [ figure 5 ] . cut surface showed uniloculated or biloculated cysts with thin walls measuring 1 - 2 mm with yellowish , necrotic material adherent to the walls . round to oval thick walled brown cells with septate hyphae were seen intra and extracellularly [ figure 7 ] . in essence , the microscopy showed a suppurative granuloma caused by pigmented fungi with septate hyphae and yeast forms . cystic mass 6 cm 4 cm 3 cm with smooth gray - white external surface cut surface showing thin , yellow wall with greyish , gelatinous material in the lumen intra and extracellular , round to oval , thick walled brown cells with septate hyphae ( h and e , 40 ) giant cells contained single or groups of organisms ( h and e , 40 ) in the second case , initial potassium hydroxide preparation identified branched , septate , hyaline hyphae . culture colonies appeared on sabouraud 's dextrose agar , which were velvety , elevated dark brown to black with black pigmentation on reverse . lactophenol cotton blue preparations revealed septate , thick walled , dematiaceous hyphae forming arthroconidia along with delicate , hyaline , thin walled septate hyphae with few elliptical conidia [ figure 9 ] . lactophenol cotton blue preparation - showing septate , thick walled , dematiaceous hyphae forming arthroconidia , and few elliptical conidia malachite green preparation - highlighting the spores with the above features , a diagnosis of subcutaneous phaeohyphomycotic cyst was made and the specific organism was identified as a. pullulans in the second case . this was a case of a 65-year - old male , a farmer by occupation and a known diabetic of 5 years duration , who presented with multiple , non - tender swellings in left leg and right hand of 4 years and 6 months duration respectively . on admission , the leg swelling measured 6 cm 6 cm and was seen discharging pus [ figure 1 ] . swelling in the hand was multiple and nodular and measured 3 cm 4 cm [ figure 2 ] . serological tests were found to be negative for syphilis and human immunodeficiency virus ( hiv ) . left leg swelling measuring 6 cm 6 cm and discharging pus multiple , nodular right hand swelling measuring 3 cm 4 cm a 55-year - old male agriculturist presented with painless swellings over left elbow of 2 years duration , right heel of 1 year duration and right leg of 2 months duration . a local examination showed nodular swelling of 6 cm 4 cm 3 cm over right leg , 4 cm 3 cm 3 cm swelling over left elbow [ figure 3 ] and a cystic swelling over heel about 5 cm 4 cm 3 cm [ figure 4 ] . serological tests were found to be positive for hepatitis c virus and hepatitis b surface antigen and negative for syphilis and hiv . the lesions were excised and sent for histopathological examination . left elbow swelling measuring 4 cm 3 cm 3 cm cystic swelling over right heel about 5 cm 4 cm 3 cm in both cases , there was no regional lymphadenopathy . x - ray showed soft - tissue swelling with no evidence of involvement of underlying bone . excised surgical specimens from both the cases were cystic masses ranging in size from 4 to 6 cm with smooth gray - white external surface [ figure 5 ] . cut surface showed uniloculated or biloculated cysts with thin walls measuring 1 - 2 mm with yellowish , necrotic material adherent to the walls . round to oval thick walled brown cells with septate hyphae were seen intra and extracellularly [ figure 7 ] . in essence , the microscopy showed a suppurative granuloma caused by pigmented fungi with septate hyphae and yeast forms . cystic mass 6 cm 4 cm 3 cm with smooth gray - white external surface cut surface showing thin , yellow wall with greyish , gelatinous material in the lumen intra and extracellular , round to oval , thick walled brown cells with septate hyphae ( h and e , 40 ) giant cells contained single or groups of organisms ( h and e , 40 ) in the second case , initial potassium hydroxide preparation identified branched , septate , hyaline hyphae . culture colonies appeared on sabouraud 's dextrose agar , which were velvety , elevated dark brown to black with black pigmentation on reverse . lactophenol cotton blue preparations revealed septate , thick walled , dematiaceous hyphae forming arthroconidia along with delicate , hyaline , thin walled septate hyphae with few elliptical conidia [ figure 9 ] . lactophenol cotton blue preparation - showing septate , thick walled , dematiaceous hyphae forming arthroconidia , and few elliptical conidia malachite green preparation - highlighting the spores with the above features , a diagnosis of subcutaneous phaeohyphomycotic cyst was made and the specific organism was identified as a. pullulans in the second case . dematiaceous fungi include three different types of infection , i.e. phaeohyphomycosis , chromomycosis and mycetoma and their distinguishing pathologic features are summarized in table 1 . unlike chromomycosis or mycetoma , there are neither muriform cells nor grains in phaeohyphomycosis . phaeohyphomycosis is a mycosis that commonly presents as solitary cyst in the distal parts of extremities . it is often seen in immunocompetant individuals , but immunocompromise increases the risk for infection with less pathogenic organisms and may also cause systemic disease . traumatic implantation of wood splinter or vegetable matter are considered to be the cause in many cases of phaeomycosis . more than 130 fungal species belonging to 70 diverse genera have been reported as causative agents in humans and animals . in india , the climate ranges from tropical to temperate and the disease has been reported from extreme north to south except for the western region . this genus includes 14 species , among which a. pullulans is the only well - known pathogen causing subcutaneous infection or phaeohyphomycosis . however , it has also been reported as a causative agent of phaeohyphomycosis . in our case , the occupation of agriculture with much exposure to soil and trauma is probably the cause for multiple lesions in different sites and our case also shows a rare subgroup namely a. pullulans as the causative organism , which is hitherto not reported in western literature , but has been reported from india . pathologic differences between phaeohyphomycosis and other dematiaceous fungi phaeohyphomycosis commonly presents as solitary cyst and the causative organisms are bipolaris , curvularia . in our cases , the lesion was multiple and in one case a rare causative organism namely aureobasidium pullulans

phaeohyphomycosis comprises a spectrum of mycotic infectious diseases caused by heterogeneous group of phaeoid fungi . a subcutaneous cystic swelling with histological hallmark of pigmented hyphae in tissues accompanied by pyogenic granuloma is diagnostic of phaeohyphomycosis . we present two cases of phaeohyphomycosis in 65- and 55-year - old male agriculturalists , who presented with multiple , cystic soft - tissue masses involving extremities . culture was done in one case and the specific organism was identified as aureobasidium pullulans .

in contrast to other il-1 family members , il-33 was mostly described as th2 type response - inducing cytokine [ 13 ] . it binds to the st2 receptor that is expressed on various cells of the immune system , such as th2 lymphocytes , mast cells , basophils , or eosinophils [ 1 , 2 , 4 ] , but not th1 cells . however , th1 immune response can be also initiated by il-33 . il-33 alone or in synergy with il-12 upregulates ifn- expression in nk or nkt cells [ 6 , 7 ] , which in turn promotes the activity of th1 lymphocytes . so , despite the lack of st2 receptor , il-33 may have an indirect effect on the induction of th1 immune response . it was suggested that st2 deficiency alters th1/th2 balance and leads to enhanced inflammatory response [ 8 , 9 ] . in addition , it was shown that deletion of st2 gene is accompanied by greater susceptibility to t cell mediated organ - specific autoimmune diseases . balb / c mice treated with anti - st2 antibodies showed weakened th2 immunity and overactive th1 response . the role of il-33 in different diseases is dual and depends on the immune mechanism underlying the pathogenesis of each condition . in mice model of type 2 diabetes ( ob / ob ) or crohn 's disease , conditions which are characterized by profound th1 immune response , il-33 induced th2 cells and thus protected against inflammation [ 13 , 14 ] . however , in mice model of ulcerative colitis , whose pathophysiology is linked to th2 cytokines , the harmful effect of il-33 was seen , despite its ability to inhibit th1-related cytokines in these mice . the overactive th1 immune response is controlled by regulatory t cells ( tregs ) , which play a crucial role in maintaining immune homeostasis . however their quantitative and/or qualitative defects are frequently observed in several autoimmune and/or inflammatory diseases including type 1 diabetes ( dm1 ) [ 16 , 17 ] . therefore , new biological agents need to be analyzed with respect to their ability to increase treg number and function . the only published data on the role of il-33 on regulatory t cells come from studies on animal models [ 14 , 18 , 19 ] . the use of il-33 in those studies showed promising results in promoting regulatory phenotype [ 14 , 18 , 19 ] . type 1 diabetes is characterized by the enhanced inflammatory response as well as regulatory t cell deficiency [ 16 , 20 ] . moreover , there are no data regarding the influence of il-33 on regulatory t cell subset in dm1 patients . taking into account these facts , the aim of the current study was to analyze the in vitro effect of il-33 on the quantitative properties of regulatory cd4cd25foxp3 t cell population in patients with type 1 diabetes . the study group consisted of 16 young patients recruited from the clinic of pediatrics , department of diabetology and endocrinology , medical university of gdask , with diagnosed type 1 diabetes and 8 healthy individuals treated as a control group . the diagnosis of type 1 diabetes was made in accordance with the american diabetes association criteria . at the time of sampling , a blood glucose level along with biochemical measurement of renal function , crp , and glycosylated hemoglobin ( hba1c ) was taken . all dm1 patients enrolled in the study were free of microvascular complications and any other autoimmune , chronic , and acute inflammatory diseases . the control group consisted of age and sex matched healthy individuals recruited during control visits in outpatient clinic . no signs of autoimmune , chronic , inflammatory , or neoplastic disease at the time of sampling and no evidence of dm1 in their families were disclosed as confirmed by medical records , laboratory examination , and laboratory tests . the study followed the principles of the declaration of helsinki and was approved by the ethics committee of the medical university of gdask . heparin - stabilized venous blood samples were collected aseptically and used to isolate peripheral blood mononuclear cells ( pbmcs ) by histopaque-1083 ( sigma ) density gradient centrifugation . cells were suspended at a density of 1 10 cells / ml and cultured in 1 ml rpmi 1640 supplemented with 5% heat - inactivated fetal calf serum ( fcs ) . for each study individual , the following pattern of stimulation was used : 1st control well designated as nonstimulated and 2nd well designated as stimulated . cells in both wells were treated with anti - cd3 ( clone ucht1 , biolegend , usa ) and anti - cd28 ( clone cd28.2 , biolegend , usa ) antibodies , both at 5 g / ml . in addition , recombinant il-33 ( biolegend , usa ) at a concentration 25 ng / ml was added to wells designated as stimulated . cell cultures were incubated at 37c with 5% co2 for 24 h. cells were harvested , washed with cell staining buffer ( biolegend , usa ) , and stained with antibodies for treg analysis : anti - cd4 ( igg1 , mouse apc , clone rpa - t4 , biolegend , usa ) , anti - cd127 ( igg1 , mouse pe - cy7 , clone a019d5 , biolegend , usa ) , anti - cd25 ( igg1 , mouse percp - cy5.5 , clone bc96 , biolegend , usa ) , and anti - st2 ( igg1 mouse pe , clone 97203 , r&d , usa ) antibodies . after 20 minutes of incubation at room temperature , cells were washed and stained for intracellular expression of foxp3 ( igg1 , mouse fitc , clone 206d , biolegend , usa ) . intracellular staining for foxp3 was performed according to the manufacturer 's suggestions ( biolegend , usa ) . expression of cell surface and intracellular markers was assessed using flow cytometry ( lsrii , becton dickinson , usa ) after gating on live cells determined by scatter characteristics . in addition , the expression of foxp3 and st2 in the cd4cd25foxp3 gate was quantified by determining mean fluorescence intensity ( mfi ) . it was quantified as a ratio of mean fluorescence intensity for foxp3/st2 to mfi for appropriate isotype control . serum level of st2 ( sst2 ) was measured by elisa method ( quantikine r&d systems , minneapolis , mn , usa ) according to the manufacturer protocol . minimum detectable concentration was determined by the manufacturer as 5.1 pg / ml . the results were read on the automated plate reader ( multiscan mcc/340 , labsystems , helsinki , finland ) . spearman 's correlations were used to compare the associations between analyzed parameters . the level of significance was set at p 0.05 . in a group of patients with type 1 diabetes in vitro il-33 treatment induced regulatory cd4cd25foxp3 cells ( figures 1 and 2 ) . after stimulation with il-33 , the frequency of cd4cd25foxp3 has increased significantly ( table 2 ; p = 0.0004 ) . this was in contrast to the control group , which showed no significant changes in treg frequencies after il-33 treatment ( figure 2 ; table 3 ) . in addition , we have noticed that in vitro il-33 treatment significantly induced the frequency of tregs expressing st2 molecule , which was seen only in type 1 diabetic group ( table 2 ) . what is more , the expression of foxp3 transcription factor defined as mean fluorescence intensity ( mfi ) was higher in il-33 stimulated cells in comparison to their nonstimulated counterparts ( figures 1(c ) and 1(d ) ; table 2 ) . it was upregulated on cells from patients with type 1 diabetes cultured in medium containing il-33 ( figures 1(f ) and 1(g ) ; table 2 ) . in a healthy control group , tregs showed some level of st2 expression , which however did not change significantly after il-33 treatment ( table 3 ) . to extend our study , we analyzed the concentration of soluble st2 in serum of all individuals enrolled in the study . we found that st2 level was significantly higher in patients with type 1 diabetes compared with healthy subjects ( figure 3 ; p = 0.0001 ) . moreover , type 1 diabetic patients with higher frequency of st2 expressing cd4cd25foxp3 t cells had lower serum st2 level ( r = [ 0.25 ] ; pearson correlation ) . analysis of an association between foxp3 and st2 expression in il-33 stimulated and nonstimulated cell cultures showed that in both cases foxp3 expression was positively correlated with the expression of st2 molecule ( figure 3 ) . to date , there are no data on the influence of il-33 on foxp3 regulatory t cells in patients with type 1 diabetes . there are only few studies which showed il-33 immunoregulatory effect on this cell subset in mouse model of inflammatory bowel disease and in mice after heart transplantation . in both of these studies , il-33 was shown to upregulate cd4foxp3 tregs by increasing their numbers , enhancing suppressive activity , as well as st2 surface expression . in addition , two recently published papers have confirmed that il-33 has the ability to induce regulatory phenotype by promoting the expansion of st2 tregs [ 19 , 22 ] . surface st2 expression can be found on th2 lymphocytes , as well as tregs , though to a lesser extent , but not th1 cells [ 5 , 18 , 22 , 23 ] . interestingly , regulatory t cells also require stat5 as well as gata3 for their proper function [ 25 , 26 ] . one may suspect that if tregs have impairments in stat5/gata3 signaling pathway , the reduced st2 expression may attenuate their suppressive activity . all the more so because st2 tregs represent an activated subset of foxp3 cells with high suppressive activity . in the current study , we found low level of st2 expression on tregs treated only with anti - cd3/anti - cd28 antibodies , which confirms available published data that tregs express st2 receptor . in vitro il-33 treatment however increased the frequency of cd4cd25foxp3 cells expressing st2 molecule as well as its surface expression . moreover , the expression of st2 increased along with the expression of foxp3 , which suggests that genes encoding both of these molecules might depend on each other . st2foxp3 tregs have been shown to express high levels of gata3 transcription factor which is activated exactly by il-33 . studies by matta et al . showed that il-33 stimulated dendritic cells secrete il-2 to selectively expand st2 suppressive tregs . il-2 increased st2 expression on both dendritic cells and interacting tregs , which may be due to activation of gata3 transcription factor . it seems then that levels of st2 and foxp3 expression are tightly related , and such correlation was shown by us ( figure 4 ) . in agreement with previous research [ 18 , 19 ] , our study indicates that il-33 upregulates st2 expression on treg cells , inducing at the same time foxp3 transcription factor . based on our study results and other available data , we can suspect that expression of foxp3 along with st2 may reflect treg activity level , and this should be analyzed in more detail in future experiments . certainly , this is a right direction for additional research to further explore the association between st2/il-33 axis and tregs . it was shown that patients with autoimmune diseases , as well as those with type 2 diabetes , have elevated levels of soluble form of st2 [ 2830 ] . patients with type 1 diabetes had higher level of serum st2 in comparison to healthy individuals . moreover , the lower the st2 tregs frequency was , the more the sst2 in a serum was observed . this may suggest that in inflammatory microenvironment st2-positive cells shed this molecule from the cell surface and thus lose their phenotypical and/or functional properties . this is more likely in view of the studies , which showed that deletion of st2 gene in balb / c mice leads to enhanced susceptibility to streptozotocin - induced diabetes [ 8 , 9 ] . moreover , the diabetic st mice produced elevated levels of proinflammatory cytokines [ 8 , 9 ] . proinflammatory cytokines enhance the secretion of sst2 , which was shown both in vitro and in vivo . based on the available scientific data , one can not say with certainty that il-33 has pro- or anti - inflammatory activity ; however one can suspect that its action may depend on the cytokine microenvironment responsible for the disease pathology . in our previous study , we have reported that inflammatory environment might be responsible for treg quantitative and qualitative defects . we found that treatment of tregs with anti - tnf antibody restored their impaired phenotype and induced the frequency of foxp3 expressing cells . here , we propose an additional factor to be examined that may induce regulatory t cells and thus become new immunotherapeutic tool for the adoptive therapies of type 1 diabetes , as well as other autoimmune and inflammation - related diseases that are characterized by defects in treg - mediated regulation . il-33 could induce treg cells in patients with type 1 diabetes ; however , more studies including qualitative characterization of il-33 treated cd4cd25foxp3 on a larger group of patients need to be done . it would help further understand the relationship between tregs and st2/il-33 axis . to our knowledge , this is the first study that suggests the association between st2/il-33 axis and regulatory t cells in human type 1 diabetes .

il-33 is an il-1 cytokine family member , with ability to induce both th1 and th2 immune responses . it binds to st2 receptor , whose deficiency is associated with enhanced inflammatory response . the most recent studies have shown the immunoregulatory effect of il-33 on tregs in animal models . as type 1 diabetes is an autoimmune , inflammatory disease , where treg defects have been described , we aimed to analyze the in vitro influence of recombinant il-33 on quantitative properties of regulatory cd4+cd25highfoxp3 + t cells . cd4+cd25highfoxp3 + as well as cd4+cd25highfoxp3+st2 + tregs were analyzed by flow cytometry . in a group of patients with type 1 diabetes in vitro il-33 treatment induced regulatory cd4+cd25highfoxp3 + cell frequencies as well as upregulating the surface expression of st2 molecule . in addition , the number of cd4+cd25highfoxp3 + cells carrying st2 receptor increased significantly . similar effect was observed in case of the foxp3 expression . we did not observe any significant changes in il-33 treated cells of healthy controls . the level of st2 was higher in serum of patients with type 1 diabetes in comparison to their healthy counterparts . we propose that il-33 becomes an additional immunostimulatory factor used to induce treg expansion in future clinical trials of adoptive therapy in type 1 diabetes .

hus and thrombotic thrombocytopenia purpura ( ttp ) constitute a group of diseases known as thrombotic microangiopathies in which organ damage results from platelet aggregation and fibrin plugs in small vessels . hus , in particular , is characterized by microangiopathic hemolytic anemia ( damage to red blood cells as they travel through narrowed capillaries ) , consumptive thrombocytopenia ( exhaustion of platelets as they become enmeshed in platelet - fibrin thrombi ) , and microvascular glomerular thrombosis ( formation of thrombi in the kidney ) . the thrombotic microangiopathy is particularly severe in the renal microvasculature and leads to acute renal failure . patients with ttp carry mutations in the metalloproteinase adamts13 or have autoantibodies against this metalloproteinase , allowing for an etiologic distinction between ttp and hus . the most common form of hus is associated with a diarrheal illness caused by infection with strains of escherichia coli that produce shiga - like toxins ( stx-1 and stx-2 ) and hence is called stx - hus or diarrhea - positive hus . less common is atypical hus ( ahus ) in which there is no preceding diarrhea ( nonenteropathic hus ) . precipitating factors commonly implicated in the pathogenesis of ahus include infections , use of endothelial - damaging drugs , malignancies , transplantation , and pregnancy . these triggers can all cause endothelial cell activation and injury . although there is some pathophysiologic overlap , stx - hus induced pathology is predominant in the glomerulus , whereas the predominant pathology in ahus involves the renal and interlobular arterioles . the prognosis of stx - hus is favorable , with the majority of patients recovering renal function , whereas in ahus there is 25% acute mortality and most of the survivors develop end - stage renal disease inheritance was thought to be predominantly recessive , but it is now recognized that most families feature dominant inheritance with 50% penetrance . in 1998 , ( 2 ) published the results of a linkage study in three families with ahus . this pivotal study showed segregation of the disease to the q32 region of chromosome 1 , which contains genes that regulate complement activation . a possible link between complement abnormalities and ahus one study in particular showed that low levels of the complement protein c3 and glomerular deposition of c3 fragments were associated with disease ( 3 ) . however , these clinical reports were not widely appreciated , as most patients had normal levels of circulating complement . and a role for innate immunity was not considered . ahus mutations have since been described in the genes encoding five complement proteins , including fh , membrane cofactor protein / cd46 ( mcp ) , factor i ( fi ) , factor b ( fb ) , and c3 ( 48 ) . functional studies have shown that the mutations in the three regulators fh , fi , and mcp lead to loss of function and thus more complement activation , whereas the mutations in fb are gain of function . this has provided unequivocal evidence that complement dysregulation is involved in the pathology of ahus . with this knowledge in hand , pickering et al . ( 9 ) have now developed a faithful model of human ahus in an fh - deficient mouse . the new mouse model , described in this issue ( p. 1249 ) , is sufficiently human - like so that key questions related to immune pathogenesis can now be addressed and potential therapeutic interventions assessed . the complement system ( as one of our students recently informed us ) is a simple little proteolytic cascade when compared with cytokine biology and signal transduction pathways . it is an ancient innate immune network of plasma proteins that began evolutionarily as a host defense system of hemolymph . the goal of the oldest cascade , the alternative pathway , is to rapidly coat invading microbes with large quantities of the opsonic complement fragment c3b ( fig . this process is facilitated by a feedback or amplification loop that allows several million molecules of c3b to be deposited on bacteria within a few seconds . complement activation also occurs , albeit usually in a more limited fashion , on altered self - tissue , such as on cells undergoing apoptosis and at sites of injury and infection . to prevent the accumulation of undesirable quantities of deposited c3b , the host synthesizes a family of regulatory proteins that inhibit the feedback loop both on cell surfaces and in plasma . these regulatory proteins are particularly designed to prevent c3 activation , and heterozygous mutations ( haploinsufficiency ) in these regulators predispose humans to ahus . in individuals carrying these mutations , expression of even 50% of normal levels of these inhibitors is inadequate to prevent disease at times of injury and stress in the renal microvasculature . ( a ) c3b binds fb , which is then converted to bb , by the serine protease factor d ( not depicted ) . the resulting c3bbb is the alternative pathway c3 convertase that cleaves additional c3 to c3b , thus amplifying the process . it decays bb from c3b and is a cofactor for degradation of c3b to ic3b by the serine protease fi . fh attaches to surfaces through its heparin / anionic - binding sites in its carboxyl - terminus ( ccps 1620 ) while the decay - accelerating activity and cofactor activity sites are at the amino terminus ( ccps 14 ) . the first candidate gene in the regulators of complement activation ( rca ) cluster that was linked to ahus was fh , a complement control protein ( ccp ) that protects host tissue from complement attack ( 2 , 4 ) . the surfaces of foreign particles , such as viruses and bacteria , are vulnerable to complement activity , as they lack fh and other complement regulatory proteins . this cleavage reaction produces a fragment , ic3b , which has no hemolytic or amplification potential ( fig . second , fh both prevents the formation of and accelerates the disassociation of the alternative pathway c3 convertase , c3bbb . finally , fh binds to polyanions on host cell surfaces and tissue matrices , such as basement membranes , thus blocking deposition of c3b . fh and other proteins within the rca cluster share a common structural motif consisting of contiguous , homologous , independently folding modules called short consensus repeats or ccp modules . fh consists of 20 such repeats of 60 amino acids each that are held together by short 2 to 6amino acid linkers . previous reports had shown a possible association between ahus and reduced plasma concentrations of fh ( 10 , 11 ) . the interactive fh - hus mutation database ( http://www.fh-hus.org ) lists 71 disease - associated mutations ( 12 ) . these are present in 30% of patients , including those with sporadic and familial forms of the disease . the majority are heterozygous missense mutations that cluster in the carboxyl - terminal exons and are associated with normal levels of circulating fh . the remaining mutations are mostly heterozygous deletions or missense mutations that result in either a truncated protein or impaired secretion of the protein and thus cause a 50% reduction in plasma levels of fh . this clustering of missense mutations in the c - terminal region , which is crucial for fh binding to host surfaces , is remarkable . functional and structural studies of mutants indicate that the reduced interaction between fh and cell surfaces leads to inefficient cofactor activity ( 12 ) . there are two existing animal models of total fh deficiency : the norwegian yorkshire pig ( 13 ) and a knockout mouse model ( 14 ) . in both , this form of glomerulonephritis is similar to the disease seen in humans with homozygous fh deficiency in which dense deposits of c3 fragments accumulate in the glomerulus ( 15 ) . this illness can present in a variety of ways , including asymptomatic urinary abnormalities , nephrotic syndrome , and chronic kidney disease . a series of studies has shown that polymorphisms in the fh gene are associated with increased susceptibility to amd ( 1619 ) . in particular , a polymorphism in exon 9 ( rs1061107:1277t > c ) that results in a tyrosine to histidine change ( y402h ) in the seventh ccp , has been shown to be a susceptibility factor in all these studies . describe a mouse model of ahus in which the disease is remarkably similar to that seen in human patients . taking advantage of the fh mouse they had previously developed ( 14 ) , the group produced a transgenic mouse in which the fh gene lacks the exons encoding the five c - terminal ccp modules . as noted above , in humans with fh - associated ahus , a majority of the mutations occur in these c - terminal repeats and disrupt a heparin - binding site . homozygous fh - deficient mice have very low circulating levels of c3 and fb because these proteins are consumed as a result of excessive complement activation . consequently , these mice have minimal complement - activating capacity . by introducing the c - terminal truncation of fh into the fh knockout animals , pickering et al . , the mice did not develop glomerulonephritis , and their circulating levels of c3b and fb were partially restored . the combination of functional alternative pathway activation coupled with a deficiency in the capacity of fh to bind anionic targets led to spontaneous ahus in mice homozygous for the transgene ( cfh.fh16-20 ) . many parameters of disease in the mice , including the hematologic abnormalities and glomerular pathology , closely resembled human ahus . of note , however , the mice heterozygous for expression of the mutated fh ( cfh.fh16-20 ; i.e. , 50% of fh carrying the deletion of ccps 1620 and 50% wt fh ) , which most closely resembles the situation in humans , did not develop ahus . comment , it is becoming apparent that ahus in humans is not a straightforward monogenic disease , but rather a disease in which mutations may be found in more than one complement gene in an individual patient . thus , such mutations must be considered to be predisposing rather than causative , as a triggering factor is necessary to initiate the disease ( 12 ) . this murine model of ahus affords a unique opportunity to resolve some of the conundrums of ahus . the model will also facilitate testing of novel therapies , such as targeted complement inhibitors . in the second of the original three families reported by warwicker et al . , a mutation in mcp was identified ( 5 ) . screening of multiple cohorts established that 15% of patients with ahus have a mutation ( usually heterozygous ) in the mcp gene ( 12 ) . mcp is expressed by most cells and , like fh , acts as a cofactor for the inactivation of c3b . the activity of mcp is intrinsic , meaning that it only has cofactor activity for c3b when it is bound to the same cell ( 20 ) . an analysis of the initial 25 mcp mutations in ahus patients has recently been reported ( 21 ) . mutations in fi , the protease required for c3b cofactor activity , also predispose to ahus . heterozygous changes in fi account for 5% of the known mutations in ahus ( 6 , 22 ) . fi is a disulphide - linked , two - chain serine protease consisting of a 55-kd heavy chain and a catalytic 38-kd light chain . fi cleaves c3b but only if c3b is associated with a cofactor protein such as fh or mcp ( fig . one mutation stabilized the alternative pathway c3 convertase by increasing the affinity of the interaction between fb and c3b . mutations in c3 itself have also been described in a select group of ahus patients with low c3 concentrations in their plasma but without mutations in fh , mcp , fi , or fb ( 8) . these analyses of ahus - causing mutations in complement proteins establish several points of interest . first , although fh and mcp both harbor cofactor activity for fi , they do not have overlapping activity , as mutations in either protein predispose to disease in the renal microvasculature . it is also clear that half the normal levels of fh , mcp , or fi is not sufficient to protect the renal endothelium after injury ( i.e. , there is an evolutionary reason why these proteins are maintained at a certain level and not 50% less ) . in addition , anionic ( heparin)-binding sites are required for fh to efficiently bind to damaged cells , exposed tissue matrices , and the basement membrane , and thus to prevent a thrombomicroangiopathy . it is noteworthy that the above insights came about by screening the human genome in multiplex families . the common theme that emerges relative to the specific functional deficiency in these complement regulators is a decrease in overall cofactor activity for c3b . the major difference between the stx - hus and ahus may be secondary to the degree or type of damage to the endothelium required to cause disease . less injury may be sufficient to cause ahus in individuals with predisposing mutations , such as those in fh . a more severe degree of injury , such as that caused by shiga toxins , may be required for hus associated with e. coli epidemics . however , it is important to note that only 1015% of patients in these epidemics develop hus ( 23 ) . minor variations in the expression levels or functional activity of one or more members of the alternative pathway may be one explanation for this finding . we recently identified a young girl with a heterozygous mutation in mcp who developed stx - hus . e. coli o157:h7 was isolated from her stool , and shiga toxin was identified in her blood and stool . the patient died 4 days after presentation . at autopsy , she had multiorgan failure secondary to a diffuse microthromboangiopathy . this informative case illustrates the interplay between a predisposing regulatory protein deficiency and the potency of the trigger in the pathogenesis of hus . we still have much to learn about the interplay among endothelial injury / stress , complement activation , and thrombosis in the microvasculature . what , for example , is the nature of the damage induced by bacterial toxins and other triggers ? which parts of the complement activation cascade ( opsonins , anaphylotoxins , membrane attack complex ) induce thrombosis ? how do the complement and clotting systems interact , and what is unique about the kidney microvasculature ? this field of investigation was broken open by analyzing a few families using whole genome screens . based on these findings , a mouse model has now been developed that can be used to address outstanding questions about the pathogenesis and treatment of this complex human disease .

immune recognition is coupled to powerful proinflammatory effector pathways that must be tightly regulated . the ancient alternative pathway of complement activation is one such proinflammatory pathway . genetic susceptibility factors have been identified in both regulators and activating components of the alternative pathway that are associated with thrombotic microangiopathies , glomerulonephritides , and chronic conditions featuring debris deposition . these observations indicate that excessive alternative pathway activation promotes thrombosis in the microvasculature and tissue damage during debris accumulation . intriguingly , distinct genetic changes in factor h ( fh ) , a key regulator of the alternative pathway , are associated with hemolytic uremic syndrome ( hus ) , membranoproliferative glomerulonephritis ( dense deposit disease ) , or age - related macular degeneration ( amd ) . a mouse model of hus designed to mirror human mutations in fh has now been developed , providing new understanding of the molecular pathogenesis of complement - related endothelial disorders .

the da vinci surgical system was approved by the food and drud administration in 2000 . in urology , it has since been used clinically to perform radical prostatectomies , pyeloplasties , simple nephrectomies , donor nephrectomies , and recipient renal hilar anastomoses . purported advantages include 3-dimensional stereoscopic optics , computer elimination of tremor , 6 degrees of motion at the distal end of the instruments , and improved surgeon ergonomics . as a pilot study , we set out to look at the feasibility of performing da vinci robotic laparoscopic partial nephrectomies . prior to embarking on this study , the authors performed approximately 50 standard laparoscopic or hand - assisted laparoscopic ( hal ) partial nephrectomies , and several other urologic procedures using the da vinci system . both surgeons participated in a 3-day animal training laboratory with the da vinci system prior to undertaking procedures in humans . our first patient for partial nephrectomy was chosen based on the relatively small and exophytic nature of his renal tumor . the patient was a 69-year - old male with a 2-cm , left , upper pole enhancing renal mass ( figure 1 ) . he was american society of anesthesiologists ( asa ) class iii with mild obesity and stable coronary artery disease , as well as a remote past surgical history of open cholecystectomy . he was typed and crossmatched for 4 units of packed red blood cells and received bowel preparation prior to surgery . he was placed in the semilateral , flexed position , padded , and strapped to the table with 3-inch cloth tape . a hassan technique was used to gain access . in an effort to expedite the robotic set up , allow flexibility for the surgeon , and ease placement of the robotic arms , we utilized four 12-mm ethicon endosurgical nondilating trocars ( figure 2 ) . during the robotic aspect of the operation the 2 robotic arms were attached to their specialized trocars and then placed through the ethicon trocar ( figure 3 ) . coronal t1 mri of left renal lesion ( a ) ; transverse t2 mri of same lesion ( b ) . schematic diagram of port placement . the goals include isolating the renal hilum and exposing the renal capsule surrounding the tumor . during the standard laparoscopic dissection , a circulation nurse and an intuitive clinical specialist draped , set up , and calibrated the robot in an attempt to minimize operative setup time . the second stage of the procedure was performed utilizing the da vinci surgical system . during this period , it is imperative that an experienced table - side surgeon ( assistant ) be present . the console surgeon ( primary surgeon ) the table - side surgeon must know and understand all the steps , be able to aid in dissection with a suction irrigator , exchange robotic instruments , pass sutures , retrieve sutures , be capable of suturing laparoscopically and/or of converting if an emergent operative situation occurs . the console surgeon utilized a flat cautery blade on the left robotic arm for retraction and dissection and a hook electrode on the right arm for electro - dissection . the console surgeon scored the capsule and then retracted the kidney , placing the hilum on stretch while the table - side surgeon placed a laparoscopic bulldog on the left renal artery . ( for a right - sided lesion , we clamped both artery and vein . ) immediately after clamping , we switched out the hook electrode for scissors in the right robotic arm . the tumor was excised with the robotic endoshears while the cautery / dissector ( flat blade ) in the left arm retracted the lesion and helped to elevate it during resection ( figure 4 ) . the table - side surgeon utilized a suction / irrigator to help expose the bed and remove any blood from the field . once excised , the deep margin of the specimen was visually inspected to assess completeness of excision . we took biopsies of the deep renal bed with the robotic endoshears for pathologic confirmation . these specimens were collected by the table - side surgeon and sent for frozen section immediately . a 3 0 vicryl suture on a ct-1 needle was introduced by the side surgeon through the accessory port , and a large perforating vessel was suture ligated . the argon beam coagulator was then introduced through the accessory port by the side surgeon , and the base of the renal defect was cauterized . the side surgeon then introduced fibrin ( haemacure , montreal , canada ) soaked gelfoam ( pharmacia , peapack , nj ) , and the console surgeon laid it into the defect using the robotic needle drivers . a percutaneously placed spinal needle was guided by both the table - side surgeon and console surgeon into the fibrin soaked gelfoam , and thrombin ( haemacure , montreal , canada ) was injected to create a gelfoam / fibrin - glue plug . two mattress sutures were placed over the plug through the renal capsule by using 2.0 vicryl suture on a ct-1 needle . the kidney was placed back on stretch , and the table - side surgeon released and retrieved the vascular bulldog . hemostasis was confirmed while a mean arterial pressure above 90 mm hg was documented , an intraperitoneal pressure of 6 mm hg of co2 was documented and a valsalva maneuver was performed . finally , gerota 's fascia overlying the excision site was reapproximated with a running 2.0 vicryl suture on a ct-1 needle . the robot was then removed from the patient , the specimen was retrieved with a 10-mm endobag ( ethicon endosurgical , cincinnati , oh ) via the hassan trocar , and the abdomen was reinspected . finally , a jackson - pratt drain was placed through a port site , and all trocars were removed and closed . demographics , lesion size , location of tumor , depth of penetration , and indication for surgery were recorded . intraoperative parameters included blood loss , complications , need for open conversion , and operative time . operative time was defined as time of first incision to closure of all trocar sites and was subdivided into standard laparoscopic time , robotic docking time , and robotic surgery time . the operative time , including da vinci setup ( 14 minutes ) , was 230 minutes . warm ischemia time was 32 minutes , and robotic docking time performed prior to clamping was 4 minutes . estimated blood loss was 150 ml , and no intraoperative or postoperative complications occurred . the patient was managed with intravenous patient - controlled analgesia for 24 hours after the procedure . a regular diet and ambulation were successfully resumed by postoperative day 1 , and the patient was discharged home on postoperative day 2 with a hematocrit of 40.0% and a creatinine of 1.3 mg / dl . by postoperative day 10 , the patient had resumed normal activities . we did not perform a collecting system reconstruction ; however , suturing was necessary to control hemorrhage from a terminal artery and close the renal capsule and gerota 's fascia . two urologic surgeons with approximately 2 to 3 years of laparoscopic experience ( approximately 150 and 60 cases each ) participated in this procedure . both surgeons had been previously trained on the da vinci in a 3-day animal laboratory . we chose to perform this complex laparoscopic procedure using the da vinci because of its several purported advantages , mentioned earlier , over standard laparoscopy . even so , those with extensive laparoscopic experience at a limited number of centers may feel more facile with a straight laparoscopic approach to partial nephrectomies . regardless , the indications for partial nephrectomies and for minimally invasive surgery are both expanding , and the above described approach offers another tool in the armamentarium . in this case , we found the da vinci to aid us in wedge excision by allowing for perpendicular scoring and cutting through renal parenchyma . this is not always feasible with standard laparoscopic instruments secondary to the limited ability to angle the instrumentation . suturing was felt to be easier to perform secondary to 3-dimensional vision , improved angulation , dexterity , loss of tremor , and precise control of the robotic needle driver due to the endowrist technology . potential disadvantages of the da vinci include cost , training , setup time , and lack of tactile sensation or haptics . another potential disadvantage , should conversion be required , is having the surgeon unscrubed and away from the patient . we also placed the robotic trocar ports through standard laparoscopic trocars to decrease docking time and , potentially , conversion time to standard or hand - assisted laparoscopy if it were necessary . the time required for robotic preparation can be minimized by having an experienced nursing staff set up the device , while the surgeon enters the abdomen using standard laparoscopic trocars . we report the first robot - assisted laparoscopic partial nephrectomy . potential benefits of the da vinci system may include a more accurate means of lesion resection and easier reconstruction of the renal defect . it is yet to be proven whether this technology can decrease ischemia time , expand the indications for laparoscopic partial nephrectomy , and/or decrease complications like bleeding and collecting system leak . as we continue to utilize this technique , our hypothesis of

the indications for nephron - sparing surgery and for minimally invasive surgery are continually expanding . nephron - sparing surgery , also known as partial nephrectomy , presents a challenge to the minimally invasive surgeon . herein , we describe our technique of robot - assisted laparoscopic partial nephrectomy . this approach may have potential advantages of including easier excision and suturing . moderate training is required .

coarctation of the aorta ( coa ) occurs in 1 in 2000 live births in the usa and is the fifth most common congenital cardiac defect . it is more common in males ( m : f ratio : 1.7 : 1 ) and affects caucasians seven times more than other races . seventy five percent of children with coa have another cardiac anomaly , most commonly patent ductus arteriosus ( pda ) , bicuspid aortic valve , ventricular septal defect ( vsd ) and mitral valve anomalies . coa is usually diagnosed in childhood and early adulthood , and there is a reduced life expectancy in patients who have not undergone correction . there are only a few cases of elderly patients with uncorrected coa, and management strategies in such patients are controversial . we describe the case of a man first diagnosed with coa and total occlusion of the aorta at an advanced age . an 81-year - old man was referred to our clinic for evaluation and treatment of typical angina during exercise . his medical history included arterial hypertension for many years ; there was no history of traumatic injury or takayasu 's arteriitis . the patient denied symptoms of claudication and weakness of his legs and reported to walk more than one kilometer without any problems . concentric left ventricular hypertrophy , a normal tricuspid aortic valve , a normal mitral valve , and normal left ventricular systolic function could be demonstrated on echocardiographic examination . coronary angiography ( figure 2 ) was performed via the radial route , and severe triple - vessel disease was detected ( syntax ( synergy between pci with taxus and cardiac surgery ) score of 35 points ) . aortography ( figure 3 ) revealed a postductal coa with total occlusion of the aortic arch . simultaneous pressure tracings in the aortic arch and the descending aorta demonstrated a pressure gradient of 70 mmhg . there was no evidence of clot formation in the blind end of the aorta distal to the coarctation . ( a ) : aortic coarctation with total occlusion of the descending aorta ; ( b ) : simultaneous pressure tracings obtained proximal and distal of the aortic occlusion demonstrating a pressure gradient of about 70 mmhg . magnetic resonance ( mr ) angiography was performed and confirmed the aortic occlusion just below the origin of the left subclavian artery , showed slight post - stenotic dilatation , and distinct collateral circulation ( figure 4 ) . the patient refused operative treatment of his triple - vessel coronary artery disease , and underwent finally a staged percutaneous coronary intervention procedure . surgical correction of the coa was not performed because the patient was asymptomatic with a good exercise tolerance and his hypertension was well controlled with a combination of three antihypertensive agents ( -blocker , diuretic , and angiotensin - receptor - blocker ) . at clinical follow - up after 8 months the patient remained free of symptoms . coarctation of the aorta is a relatively common defect that accounts for 5%8% of all congenital heart defects , and should be diagnosed and corrected early in life . among 2192 coa patients reported to the pediatric cardiac care consortium from 19851995 , 1337 were infants , 824 were children , and 31 were adults . associated problems that may contribute to death or morbidity include hypertension , cardiovascular disease , intracranial hemorrhage , aortic rupture or dissection , endocarditis , and congestive heart failure . early repair of coa in juvenile patients improves both quality of live and long - term survival . therapeutic goals in old patients with uncorrected coa are symptomatic improvement and control of hypertension whereas the presence of any survival benefit from coa repair in the age group older than 70 years is unclear . there are few reports of patients initially diagnosed with uncorrected coarctation at very late age ( > 70 years ) , and there is no consensus on how to manage them . historical studies suggest that the mortality rate in patients in whom coarctation of the aorta is not surgically repaired is 90% by age 50 years , with a mean age of 35 years . two case reports of a 72 years and a 76 years old patients without surgical repair reported follow - up for several years with both patients dying for non - cardiac reasons . in contrast , some surgeons have performed successful correction in these older patients. aris , et al . and bauer , et al . reported good surgical outcomes for coa repair in 8 and 15 patients , respectively , older than 50 years ; however , only 2 and 3 patients , respectively , were older than 60 years . these studies demonstrated that symptomatic improvement occurred , and hypertension was well controlled after correction in these older patient groups although most of the patients still needed antihypertensive medication at late follow - up . survival of a patient to 81 years of age is exceptional in cases of uncorrected coarctation . our patient had severe triple - vessel disease but refused coronary artery bypass grafting and underwent finally a staged percutaneous coronary intervention procedure . surgical repair of the coa , or balloon angioplasty / stentimplantation , was not indicated in our case , because of his good exercise tolerance and his well - controlled arterial hypertension .

survival to advanced age is exceptional in patients with unrepaired aortic coarctation . we report the case of an 81-year - old man with aortic coarctation and total occlusion who was otherwise asymptomatic . coarctation was suspected when a femoral - radial pulse delay was noted during his routine physical examination . a 70-mmhg systolic blood pressure gradient between the upper and lower extremities was detected . subsequent magnetic resonance angiography , aortography , and coronary angiography revealed severe coarctation of the aorta , well - developed collateral vessels , and severe coronary artery disease . a staged percutaneous coronary intervention procedure was performed and the coarctation was managed conservatively with antihypertensive medication .

batf mice were generated by homologous recombination , deleting exons 1 and 2 of the batf gene on the pure 129svev genetic background . the neomycin resistance cassette was removed from the targeted batf allele in es cells before generation of mice . nave cd4cd62lcd25 t cells were isolated by cell sorting and activated with plate - bound anti - cd3 and soluble anti - cd28 antibodies . cultures were supplemented with anti - il-4 ( 11b11 ; hybridoma supernatant ) , ifn- ( peprotech ; 0.1ng / ml ) and il-12 ( genetics institute ; 10u / ml ) for th1 ; anti - ifn- ( h22 ; bioxcell ; 10g / ml ) , anti - il-12 ( tosh ; bioxcell ; 10g / ml ) and il-4 ( peprotech ; 10ng / ml ) for th2 ; anti - il-4 , anti - il-12 , anti - ifn- , il-6 ( peprotech 20ng / ml ) and tgf- ( peprotech ; 0.5ng / ml ) for th17 differentiation . unless otherwise indicated , three days after activation cells were restimulated with pma / ionomycin for 4h for intracellular cytokine analysis by flow cytometry . for intracellular cytokine staining , cells were stained for surface markers followed by fixation with 2% formaldehyde for 15 minutes at room temperature . cells were then washed once in 0.05% saponin and stained with anti - cytokine antibodies in 0.5% saponin . anti - phospho - stat3 antibody ( bd pharmingen ) was used according to the manufacturer s recommendations . briefly , cells were stained for surface markers followed by fixation with 90% methanol at 20c overnight . cells were then washed and stained for phospho - stat3 in pbs containing 3% fcs . foxp3 staining was performed according to the manufacturer s recommendations using foxp3 staining buffers ( ebioscience ) . mice ( 710 weeks old ) were immunized subcutaneously with 100 g mog3555 peptide ( sigma ) emulsified in cfa ( ifa supplemented with 500 g mycobacterium tuberculosis ) . one and three days later mice were given 300ng pertussis toxin ( list biological laboratories ) intraperitonally ( i.p . ) . for t cell transfer experiments mice were injected with either pbs or 10 batf cd4 t cells 4 days prior to mog3555 immunization13 . batf mice were generated by homologous recombination , deleting exons 1 and 2 of the batf gene on the pure 129svev genetic background . the neomycin resistance cassette was removed from the targeted batf allele in es cells before generation of mice . nave cd4cd62lcd25 t cells were isolated by cell sorting and activated with plate - bound anti - cd3 and soluble anti - cd28 antibodies . cultures were supplemented with anti - il-4 ( 11b11 ; hybridoma supernatant ) , ifn- ( peprotech ; 0.1ng / ml ) and il-12 ( genetics institute ; 10u / ml ) for th1 ; anti - ifn- ( h22 ; bioxcell ; 10g / ml ) , anti - il-12 ( tosh ; bioxcell ; 10g / ml ) and il-4 ( peprotech ; 10ng / ml ) for th2 ; anti - il-4 , anti - il-12 , anti - ifn- , il-6 ( peprotech 20ng / ml ) and tgf- ( peprotech ; 0.5ng / ml ) for th17 differentiation . unless otherwise indicated , three days after activation cells were restimulated with pma / ionomycin for 4h for intracellular cytokine analysis by flow cytometry . for intracellular cytokine staining , cells were stained for surface markers followed by fixation with 2% formaldehyde for 15 minutes at room temperature . cells were then washed once in 0.05% saponin and stained with anti - cytokine antibodies in 0.5% saponin . anti - phospho - stat3 antibody ( bd pharmingen ) was used according to the manufacturer s recommendations . briefly , cells were stained for surface markers followed by fixation with 90% methanol at 20c overnight . cells were then washed and stained for phospho - stat3 in pbs containing 3% fcs . foxp3 staining was performed according to the manufacturer s recommendations using foxp3 staining buffers ( ebioscience ) . mice ( 710 weeks old ) were immunized subcutaneously with 100 g mog3555 peptide ( sigma ) emulsified in cfa ( ifa supplemented with 500 g mycobacterium tuberculosis ) . one and three days later mice were given 300ng pertussis toxin ( list biological laboratories ) intraperitonally ( i.p . ) . for t cell transfer experiments mice were injected with either pbs or 10 batf cd4 t cells 4 days prior to mog3555 immunization13 .

activator protein 1 ( ap-1 ) transcription factors are dimers of jun , fos , maf and activating transcription factor ( atf ) family proteins characterized by basic region and leucine zipper domains1 . many ap-1 proteins contain defined transcriptional activation domains ( tads ) , but batf and the closely related batf3 ( refs 2 , 3 ) contain only a basic region and leucine zipper and have been considered inhibitors of ap-1 activity38 . here we show that batf is required for the differentiation of il-17-producing t helper ( th17 ) cells9 . th17 cells comprise a cd4 + t cell subset that coordinates inflammatory responses in host defense but is pathogenic in autoimmunity1013.batf /mice have normal th1 and th2 differentiation , but show a defect in th17 differentiation , and are resistant to experimental autoimmune encephalomyelitis ( eae).batf /t cells fail to induce known factors required for th17 differentiation , such as rort11 and the cytokine il-21 ( refs 1417 ) . neither addition of il-21 nor overexpression of rort fully restores il-17 production in batf/ t cells . the il-17 promoter is batf - responsive , and upon th17 differentiation , batf binds conserved intergenic elements in the il-17a / f locus and to the il-17 , il-21 and il-22 ( ref 18 ) promoters . these results demonstrate that the ap-1 protein batf plays a critical role in th17 differentiation .

it has long been known that axonal signals control the induction and maintenance of the schwann cell myelin sheath that surrounds the large - diameter axons in peripheral nerves . however , until very recently , the nature of these signals has remained obscure . in contrast , the identity of the transcription factors in schwann cells that organise the myelination programme is much better characterised . well - established transcriptional regulators of this programme include krox-20 ( early growth response gene 2 , or egr-2 ) and its associated proteins , nab ( nucleic acid - binding protein ) 1 and 2 , sox-10 , oct-6 and brn1 and brn2 . current knowledge of the mechanisms by which these factors exert their effects on myelination has recently been reviewed . unlike most other cell types , schwann cells can readily dedifferentiate . thus , when myelinating schwann cells are deprived of axonal contact in injured nerves , they adopt a molecular and morphological phenotype that is similar , though not identical , to the phenotype of immature schwann cells prior to myelination . depending on circumstances , therefore , schwann cells either provide support for mature axons by elaboration of a myelin sheath or provide an environment through which axons can regrow after injury and subsequently remyelinate . we are just beginning to form a more comprehensive picture of how schwann cells transit between these two phenotypes , with an emerging picture of a mechanism involving cross - inhibitory interactions between positive and negative transcriptional regulators of myelination . an important advance in our understanding of axonal signalling mechanisms that control myelination has occurred in the past five years . several papers have shown that the axonal surface protein neuregulin 1 ( type iii1 ) , acting via its receptors erbb2 and erbb3 , controls the thickness of the schwann cell myelin sheath and is part of the mechanism that controls the expression of myelin genes and the induction of myelination [ 3 - 7 ] . this factor also controls the survival of schwann cell precursors and is a potent mitogen for schwann cell precursors and schwann cells . it remains a challenge to understand the mechanism by which the schwann cell switches its response to neuregulin from a non - myelinating proliferative phase to a non - proliferative myelination mode . some evidence suggests that a balance between erk ( extracellular signal - related kinase ) 1/2 and jnk ( c - jun n - terminal kinase)/c - jun ( pro - dedifferentiation ) and pi3 kinase ( phosphatidyl inositol-3 kinase)/akt ( pro - myelination ) signalling may be involved , but the picture is far from clear [ 8 - 12 ] . to add complications , soluble neuregulin isoforms at high concentrations can also promote demyelination . although neuregulin is required in peripheral nervous system myelination , it is not required for myelination by oligodendrocytes in the central nervous system . recent evidence suggests that neuregulin 1 type iii expressed by axons also regulates the formation of mature non - myelinating schwann cells ( remak bundles ) . genetic inactivation of neuregulin 1 type iii in small - calibre unmyelinated c - fibres , using nav1.8-cre mice , results in aberrant remak fibres that contain abnormally large numbers of axons , and the altered morphology is reflected in a reduced response to noxious pressure stimulation . in these mice , this resulted in an increase in the number of axons in this size category which remained unmyelinated , despite achieving a 1:1 relationship with schwann cells . this is in line with earlier evidence that neuregulin 1 type iii promotes myelination , as discussed above . despite the altered morphology , one of the ways in which neuregulin signalling is likely to control myelination is by increasing the ca level in schwann cells . this activates the phosphatase calcineurin , which dephosphorylates nuclear factor of activated t cells ( nfat ) c3 and c4 , resulting in translocation to the nucleus . kao and colleagues show that deleting calcineurin b specifically in the schwann cell lineage results in defects in radial sorting and hypomyelination in newborn mice . because the mice die shortly after birth , it is not possible to say whether the hypomyelination is transient or permanent . lack of calcineurin b prevents neuregulin - induced dephosphorylation and activation of nfat c3 and c4 . furthermore , nfat c4 complexes with sox-10 , a transcription factor required for myelination , to activate the promoter and myelin - specific enhancer of the krox-20 gene , which globally regulates peripheral myelination [ 11,18 - 20 ] , and also with the promoter of the myelin protein zero ( p0 ) gene , all of which underline the involvement of nfat proteins in myelination . it has long been known that elevation of intracellular cyclic amp levels induces cultured schwann cells to express myelin proteins and adopt many other aspects of the myelinating schwann cell phenotype , suggesting that camp is part of the signalling system that promotes myelination . a recent paper now provides important in vivo evidence for this proposition . in experiments using mutant zebrafish , the authors found that the g protein - coupled receptor gpr126 is essential for myelination in the peripheral nervous system and that the defect is confined to signalling within schwann cells rather than axons . significantly , treatment of the developing mutant fish with forskolin , which elevates intracellular camp levels , restores myelination , suggesting that this orphan receptor acts by controlling schwann cell camp levels . because levels of neuregulin and erbb3 receptors remain normal in the mutant fish , it is likely that gpr126 functions independently of neuregulin to regulate myelination . additional evidence for the involvement of camp and camp - dependent protein kinase a ( pka ) in myelination comes from studies of the transcription factor nuclear factor - kappa - b ( nf-b ) . in schwann cell - dorsal root ganglion ( drg ) co - cultures , inhibition of nf-b activation inhibits proper association of schwann cells with axons and myelination , and co - cultures using cells from mice lacking the p65 active subunit of nf-b show marked inhibition of myelination . significantly , phosphorylation of the p65 subunit by pka increases transcriptional activity but not dna binding and is required for upregulation of oct-6 by camp . although the experiments remain to be confirmed in vivo , the results suggest that this factor transduces camp signals within schwann cells and promotes myelination at early stages of myelin induction . linking these findings to those from zebrafish , it may also be significant that there are two binding sites for nf-b within the gpr126 promoter . cell - cell interactions between axons and schwann cells are vital to the process of myelination . two recent papers reveal new roles for nectin - like cell adhesion molecules ( necls ) , members of the immunoglobulin superfamily of cell adhesion molecules , at the onset of myelination . necl2 and necl4 are expressed in schwann cell membranes , principally in the internodal region and in schmidt - lanterman incisures while necl1 and necl2 are expressed by axons . knockdown of necl4 by shrna ( short hairpin rna ) severely inhibits myelination in drg - schwann cell co - cultures . although schwann cells can line up along the axons and even enclose them , they fail to make even 1.5 turns around the axons , pointing to a requirement for these proteins at the early stages of myelination to ensure proper wrapping and spiralling of the schwann cell membrane . in addition , levels of the transcription factors oct-6 and krox-20 remain low in these co - cultures . it remains to be determined , however , whether this phenotype will be reproduced by knockout of necl4 in vivo . in addition to transcription factors that promote myelination , such as nfat , nf-b , sox-10 , krox-20 and oct-6 ( discussed above ) , there is increasing evidence that myelin differentiation is subject to negative transcriptional regulation . in vivo , selective inactivation of notch 1 in schwann cells accelerates myelination while overexpression of the active intracellular domain of notch ( nicd ) delays it , indicating that myelination is negatively controlled by notch signalling . the major role of negative regulation is likely to be that of driving schwann cell demyelination / dedifferentiation . nicd levels rise rapidly in injured nerves , and the resulting demyelination is slower if the nicd elevation is prevented . another transcription regulator , c - jun , is similarly elevated in the schwann cells of injured nerves , and as with notch 1 , demyelination is delayed when this elevation is prevented . c - jun is also required for the generation of the characteristic molecular and morphological phenotype of the dedifferentiated cell . other transcription factors that negatively regulate myelin differentiation in cell culture include sox2 and id2 and id4 . lipids form major components of the myelin sheath and we are just beginning to explore how myelin lipid synthesis is synchronised with that of the myelin proteins [ 30 - 32 ] . the pathways activated by established schwann cell signals , such as camp and neuregulin , are actively being clarified as exemplified by the work on gpr126 and nf-b mentioned above and by the recent identification of bace1 ( -site app cleaving enzyme ) , the pdz ( post - synaptic density 95-discs large - zonula occludens 1 ) domain protein erbin and the tyrosine phosphatase shp2 ( src homology 2 domain - containing protein tyrosine phosphatase 2 ) as participants in neuregulin signalling and myelination [ 33 - 36 ] . the downstream targets of novel schwann cell signalling molecules ( for example , the necl proteins ) will also have to be determined . we can expect to learn more about the role of epigenetic mechanisms in myelination and to understand more about how positive and negative transcriptional regulators of myelination are integrated at the molecular level and how they exert control over the promoter regions , intronic elements and downstream elements of myelin genes . the mechanisms that control radial sorting and the generation of the pro - myelin cell , a prerequisite for myelination , are the focus of extremely active investigation outside the scope of this commentary . surprisingly , recent work shows that normal prion protein is involved in the control of myelin maintenance . ablation of this prion protein in mice results in a chronic demyelinating neuropathy , although myelin is initially formed normally . the authors show that depletion of prion protein in neurons but not schwann cells triggers the neuropathy , and that cleavage of the protein at the amino terminal end is required . it remains to be determined whether axonal prion protein interacts directly with schwann cells or whether this protein affects myelin maintenance indirectly .

schwann cells ensheath all axons of peripheral nerves . only around large - diameter axons do they elaborate myelin , forming insulating sheaths that are vital for fast conduction of axon potentials . a series of recent papers has illuminated some of the ways in which the process of myelination is controlled , both by signals from axons and by positive and negative transcriptional mechanisms within the schwann cells themselves .

tallahassee , fl , usa ) were set up on dry , arable lands or scrublands surrounding the cities of lusaka ( 152630.85s , 282651.09e ) , namwala ( 154301.37s , 264233.41e ) , and mfuwe ( 13647.92s , 314817.24e ) . we captured 57 , 48 , and 158 rodents in each of these cities , respectively . rodents were euthanized with diethyl ether , and kidney tissues were harvested and stored at 80c . for species identification of the rodents , dna was extracted by using the dneasy blood and tissue kit ( qiagen , chuo - ku , tokyo ) . two primers , mcytb - f ( 5-acccactgtttaaaattattaaccactc-3 ) and mcytb - r ( 5-ctccgattcaagttagtactagtag-3 ) were used for pcr amplification of cytb . blast ( www.ncbi.nlm.nih.gov/blast.cgi ) search analysis against the amplified cytb fragments showed that 23 of 57 rodents from lusaka , 24 of 48 from namwala , and 143 of 158 from mfuwe were m. natalensis . the qiagen onestep rt - pcr kit ( qiagen ) was used to screen arenaviruses under the following conditions : 30 min at 50c , 15 min at 95c , 45 cycles of 20 s each at 95c , 30 s at 50c , 1 min at 72c , and 10 at 72c . the primer sequences used were 5-cacatagttgggccccacttgctgtgatc-3 and 5-aggataagtgaaagagagagtaattc-3 , which were designed on the basis of a consensus sequence of the large ( l ) gene among african arenavirus strains ( old world arenaviruses [ owas ] ) , including lujo virus . the region of the l gene has been reported as well conserved among owas ( 7 ) . total rna samples were extracted from kidney tissues by using trizol reagent ( invitrogen , carlsbad , ca , usa ) . reverse transcription ( rt ) pcr results indicated that 4 ( 17% ) of the 23 rodents captured in lusaka and 1 ( 4% ) of the 24 captured in namwala were positive for arenavirus , but none of the 143 rodents captured in mfuwe were positive . overall , 5 ( 3% ) of the 190 m. natalensis rodents trapped in zambia were positive for arenavirus . we used rna samples extracted from kidney tissues of representative lusaka and namwala strains to determine full - genome sequences . after several attempts to amplify the virus genome cdna of owas by using deduced universal primers , we obtained some virus fragments and determined the full - genome sequence by the gap closing and rapid amplification of cdna ends methods . genbank accession numbers for the lusaka strain are ab586644 and ab586645 , and for the namwala strain , ab586646 and ab586647 . sequence analysis indicated that the genome of the lusaka and namwala strains have a typical bisegmented structure containing 2 open reading frames in each segment , and the genes in the segments are separated by a stable stem - loop structure ( data not shown ) . the small segments of the lusaka and namwala strains are both 3,377 bp , and the large segments are 7,230 and 7,236 bp , respectively . the shortage in the lusaka strain genome , compared with the namwala strain genome , was in a noncoding region between the stem - loop and the l gene . we used mega5 software ( 8) to calculate values of diversity between the genomic small segment of the lusaka strain and several owas . the lowest value , 0.13 , was for namwala strain ; values ranged from 0.365 to 0.640 for the owas ( table 1 ) . the divergence among each virus strain , except for the zambian strains , ranged from 0.279 to 0.670 ( table 1 ) . phylogenetic analysis based on the deduced amino acid sequences of the 4 virus proteins showed clearly distinct sequences between owas and south american strains ( new world arenavirus ) ( figure 1 , panels a d ; owas indicated in the gray area ) . the lusaka and namwala strains were classified as members of the owas ; both strains are closely related to the mobala , morogoro , and mopeia viruses . thus , we concluded that the zambian strains belong to the same virus species and that the novel arenavirus differs from other known strains . we propose that these zambian strains be designated luna virus ( lusaka - namwala ) . nc_007903 ) ; morv , morogoro virus ( nc_013057 ) ; mopv , mopeia virus ( nc_006575 ) ; lasv , lassa virus ( nc_004296 ) ; lujv , lujo virus ( fj952384 ) . the number of nucleotide substitutions per site is shown . phylogenetic analysis of luna virus proteins based on the amino acid sequence , zambia , 2009 . phylogenetic tree of a ) glycoprotein precursor ( gpc ) , b ) nucleoprotein ( np ) , c ) z protein , and d ) l protein . data from which amino acid sequences used for phylogenetic analyses were deduced : danv , dandenong virus ( genbank accession nos . eu136038 and eu136039 ) ; ippyv , ippy virus ( genbank accession nos . nc_007905 and nc_007906 ) ; lasv , lassa virus ( genbank accession nos . nc_004296 and nc_004297 ) ; lujv , lujo virus ( genbank accession nos . fj952384 and fj952385 ) ; lcmv , lymphocytic choriomeningitis virus ( genbank accession nos . eu480450 and eu480453 ) ; mwv , merino walk virus ( genbank accession nos . gu078660 and gu078661 ) ; mobv , mobala virus ( genbank accession nos . nc_007903 and nc_007904 ) ; mopv , mopeia virus ( genbank accession nos . nc_006575 and nc_006574 ) ; morv , morogoro virus ( genbank accession nos . nc_013057 and nc_013058 ) ; gtov , guanarito virus ( genbank accession nos . ay129247 and ay358024 ) ; junv , junin virus ( genbank accession nos . ay746353 and ay746354 ) ; macv , machupo virus ( genbank accession nos . ay624355 and ay624354 ) ; parv , parana virus ( genbank accession nos . af512829 and nc_010761 ) ; picv , pichinde virus ( genbank accession nos.ef529746 and ef529747 ) ; pirv , pirital virus ( genbank accession nos . eu542420 and nc_005897 ) ; sabv , sabia virus ( genbank accession nos . nc_006317 and nc_006313 ) ; tcrv , tacaribe virus ( genbank accession nos . nc_004293 and nc_004292 ) ; tamv , tamiami virus ( genbank accession nos.nc_010701 and nc_010702 ) ; and wwav , whitewater arroyo virus ( genbank accession nos . nc_010700 and [ nc_0107003 ) . the characteristic functional motifs of the z and glycoprotein precursor ( gp - c ) were well conserved in luna virus . the z protein has a critical role in arenavirus budding , and 2 conserved late - domain motifs , p(t / s)ap and pppy , in the c - terminal have been reported ( 9,10 ) . luna virus also exhibited the p83tap and p93ppy motifs , which are present in other owas , excluding lujo , dandenong , and lymphocytic choriomeningitis viruses ( table 2 ) . gp - c was posttranscriptionally processed by s1p ( the cellular proprotein convertase site 1 protease ) to yield the glycoproteins , and the consensus motif r-(r / k / h)-l-(a / l / s / t / f ) was identified as the s1p recognition site of luna virus glycoprotein ( 11,12 ) . luna virus gp - c contained r257rlm , which is apparently cleaved in a similar fashion ; however , its cleavage mechanism has not yet been confirmed . the rrlm sequence is also conserved in the mobala and ippy viruses ( table 2 ) . the details of this protein motif suggested that luna virus is more similar to mobala virus than to mopeia and morogoro viruses . * s1p , cellular proprotein convertase site 1 protease ; lunv , luna virus ; - , s1p cleavage site ; mobv , mobala virus ; mopv , mopeia virus ; morv , morogoro virus ; lasv , lassa virus ; ippyv , ippy virus ; lcmv , lymphocytic choriomeningitis virus ; danv , dandenong virus ; lujv , lujo virus . conserved p(t / s)ap and pppy motifs in the z protein are in boldface . r(r / k)lm is considered a putative , although unconfirmed , s1p cleavage site . stap is considered a putative , although unconfirmed , ptap motif . positive tissue samples . each kidney homogenate was injected into vero e6 cells in dulbecco modified eagle medium supplemented with 2% fetal bovine serum . the culture medium was changed every 6 days , and the supernatant was harvested after 28 days of cultivation . the harvested culture supernatant was injected into new vero e6 cells . during the cultivation period , culture supernatant was sampled every 2 days and tested for the presence of luna virus rna by 1-step rt - pcr . finally , the amount of viral rna in the culture supernatant of 1 lusaka sample was increased during days 612 ( figure 2 ) . during this time , distinct cytopathic effect was not observed ( data not shown ) . to observe the virus particles , the culture supernatant was ultracentrifuged at 100,000 g , and the precipitates were negatively stained with 2% phosphotungstate . transmission electron microscopy indicated typical round - shaped , enveloped particles , 75 nm in diameter , with electron - dense dots inside the envelope ( data not shown ) . detection of increasing viral rna by 1-step reverse transcription pcr in a novel arenavirus , zambia , 2009 . viral rna was extracted from 100 l of culture supernatant on the indicated days ( top ) and eluted in 20 l of distilled water . the rna sample was subjected to 1-step reverse transcription pcr with the specific primers 5-tgagagacattgcttcacaattgacatcc-3 and 5-tgacccattcttgatgtattgtgactcc-3 , which were designed to amplify a 1,000-bp fragment within the determined large gene segment of luna virus . dna size markers are shown in the far left lane ; sizes in kb are indicated at left . we isolated a novel nonpathogenic arenavirus , which we propose be designated luna virus , from m. natalensis rodents in zambia . comparison of the genetic backgrounds of luna virus and lujo virus , a novel pathogenic arenavirus also found in zambia , showed that luna virus is genetically different from lujo virus . luna virus was closely related to nonpathogenic arenaviruses that have been found from central to eastern africa . to elucidate the epizootiologic aspects of arenaviruses in zambia , the number of rodent and other species samples must be expanded . such elucidation can lead to discovery of new arenaviruses , as demonstrated by isolation of a pathogenic new world arenavirus from bats during a study to increase knowledge of the geographic range and genetic diversity of arenaviruses naturally associated with the mexican woodrat ( neotoma mexicana ) in the western united states ( 13 ) .

to investigate arenavirus in zambia , we characterized virus from the kidneys of 5 arenavirus rna positive rodents ( mastomys natalensis ) among 263 captured . full - genome sequences of the viruses suggested that they were new strains similar to lassa virus related arenaviruses . analyzing samples from additional rodents and other species can elucidate epizootiologic aspects of arenaviruses .

the inappropriate application of acupuncture may damage surrounding tissues or organs due to the penetration of the acupuncture needle , may cause a pneumothorax or cardiovascular trauma , and may cause a bacterial infection like endocarditis [ 3 , 4 ] . therefore , an exact depth of penetration is recognized to be essential for acupuncture , and finding the depth of the acupoint that is safe and can have the most appropriate effect is important . gender , age , body weight , body length , body mass index ( bmi ) , direction and angle of the magnetic needles , right / left side points , and different measuring methods have been identified as factors affecting the safety depth . the dangerous depth of fengfu , which is the sixteenth acupoint of the governor vessel meridian , has been reported to differ with gender , to have significant correlations to weight , bmi and neck circumference , but no correlation to tong shen cun or height . yamen , which is the fifteenth acupoint of the governor vessel meridian ( gv15 ) , is located superior to the spinous process of the second cervical vertebra . it has been reported to have effects for treating sudden deafness or headache [ 7 , 8 ] . recently , regarding cerebral hemodynamics , acupuncture at gv15 was reported to increased regional cerebral blood flow , so new light has been shed on its effectiveness . gv15 is anatomically close to the medulla oblongata , so finding the safety depth of the acupoint is very important ; however , few studies on the safety depth of gv15 have been performed , and especially , there has been no research on koreans . this study tried to measure the safety depth of gv15 by using mri scans and to analyze the factors affecting the safety depth through multiple regression analyses . this study was carried out for patients who had a brain mri scan while visiting jeonju wonkwang hospital , korea , from november 2001 to march 2013 . this study was approved by the institutional review board ( wkujj - irb-2013 - 0003 ) at jeonju wonkwang hospital . these patients mostly had scans to detect brain diseases such as ischemic stroke , cerebral hemorrhage , cerebrovascular malformation , brain cancer , acute brain injury , etc . individual patients age , gender , body weight and height were taken from their chart histories . the distance from the glabella to the occipital protuberance ( dgo ) , the distance from the glabella to the back of the head ( dgb ) and the dangerous depth ( dd ) were measured from the sagittal view of the mri images . the dgo is the shortest distance from the glabella to the occipital protuberance , the dgb is the horizontal distance from the glabella to the back of the head , and the dd is the horizontal distance from the skin s surface at gv15 to the spinal dura mater . the safety depth ( sd ) was defined as 75% of the dd ( fig . gv15 was defined as the posterior of the neck , the depression superior to the spinous process of the second cervical vertebra , on the posterior line . the t - test was used for the comparison of the means of the continuous variables by gender . the relationships between the sd and age , bmi , dgo , and dgb were measured through correlation analyses and multiple regression analyses were carried out to extract significant variables in determining the sd . the 69 subjects consisted of 24 males and 45 females . as a result of the t - test by gender , height , weight , dgo , dgb , dd and sd showed significant differences between the sexes ( p < 0.001 ) while age and bmi did not ( table1 ) . the correlation analyses showed positive correlations between sd and dgo ( r = 0.677 ) , dgb ( r = 0.579 ) , and bmi ( r = 0.346 ) , but no correlation between sd and age . in addition , the dgo and the dgb had a high correlation ( r = 0.953 ) ( table2 ) . bmi = body mass index ; dgo = distance from the glabella to the occipital protuberance ; dgb = distance from the glabella to the back of the head ; dd = dangerous depth ; sd = safety depth . * p < .05 ; * * p < .01 . bmi = body mass index ; dgo = distance from the glabella to the occipital protuberance ; dgb = distance from the glabella to the back of the head ; sd = safety depth . multiple regression analyses using the enter method were carried out to evaluate the associations of the variables with the sd . because multicollinearity existed between the dgo and the gdb , the dgb was eliminated , and the other three variables were used . the durbin - watson value to check independence was 1.953 ( data not shown ) , the regression model was judged to be appropriate . the model suggested that the sd was significantly associated with gender ( = 0.474 , p < 0.0001 ) , dgo ( = 0.272 , p= 0.027 ) , and bmi ( = 0.249 , p= .005 ) and that the combination of the three variables can explain the sd , with r = 0.571 ( table3 ) . a longer sd was associated with males and with greater bmi and dgo . bmi = body mass index ; dgo = distance from the glabella to the occipital protuberance . this study analyzed the correlations between the length of the sd and age , bmi , dgo , and dgb to analyze the factors affecting the sd of gv15 . this was consistent with a previous report that the dd of gv15 differed significantly by gender . the sd of gv16 fengfu on the head close to gv15 yamen was deeper in males , and on the chest , the sd was deeper in females than males . also , the deqi depth on the abdomen , back , arm or leg was deeper in males than females therefore , gender is considered as a factor affecting the sd not only for gv15 but also for other acupoints , yet no significant differences between gender for acupoints on the low back have been reported . the total soft tissue volume of the neck was larger in men than in women , and this difference was due to non - fat soft tissue , the actual volume of fat being similar in the two sexes . thus , the differences in the sds for acupoints on the head and the neck by gender might be assumed to be due to non - fat soft tissue , especially muscle thickness . our multiple regression analyses showed that bmi , as well as gender , had a significant effect on the sd . although there have been no studies on the correlations between the sd at gv15 and the bmi , correlations of the sd at gv16 with body weight and bmi have been reported . in addition , significant differences in the deqi depth and the sd on the chest and the back by body weight have been reported , as has significant differences in the t / s ratios ( therapeutic depth / safety depth ) for the abdominal acupuncture points by body weight and waist circumference . the dgo , as well as the gender and the bmi , had a significant effect on the sd . in addition , the dgb was excluded from the multiple regression analyses because it had a high collinearity ( data not shown ) . this result means that head length and circumference , as well as other factors , have correlations with the sd , which is similar to results of other studies on the correlations of sds at abdominal acupoints with waist circumference and of sds at acupoints on the head with neck circumference . also , the correlation between tong shen cun and of the sds at acupoints is still controversial [ 6 , 13 ] . because this study was based on retrospective measurements on mri scans , future studies that measure the head circumference and the tong shen cun of patients and that look into their correlations with the sd are necessary . this study suggests that gender , bmi and dgo may be important factors when the sd of gv15 is considered clinically through a multiple regression analysis of gv15 .

objectives : yamen is the fifteenth acupoint of the governor vessel meridian ( gv15 ) . it is anatomically close to the medulla oblongata , so finding the safety depth of the acupoint is very important . however , few studies on the safety depth of gv15 have been done.methods:this study tried to measure the safety depth of gv15 by using magnetic resonance imaging ( mri ) scans and to analyze the factors affecting the safety depth through multiple regression analyses . this study was carried out for patients who had a brain mri scan while visiting jeonju wonkwang hospital , korea . the shortest distance between the glabella and the occipital protuberance ( dgo ) , the horizontal distance between the glabella and the back of the head ( dgb ) and the dangerous depth ( dd ) were measured from the sagittal views of the mri images . the dd is the horizontal distance from the skin s surface at gv15 to the spinal dura mater.results:the model suggested that the safety depth ( sd ) was significantly associated with gender ( = 0.474 , p < 0.0001 ) , dgo ( = 0.272 , p= 0.027 ) , and bmi ( = 0.249 , p= 0.005 ) and the combination of three variables can explain the sd , with r2= 0.571 ( table3 ) . a longer sd was associated with males and with greater bmi and dgo.conclusion:this study suggests that gender , bmi and dgo may be important factors when the sd of gv15 is considered clinically through a multiple regression analysis of gv15 .

a spinal subdural hematoma ( sdh ) is a rare clinical entity that accounts for only 4.1% of all spinal hematomas . it can be caused by major or minor trauma and iatrogenic injuries , such as those resulting from spinal punctures performed for diagnostic or anesthetic purposes5 ) . simultaneous intracranial and spinal sdhs are rare and may be a distinct subgroup , and only 12 cases have been reported in english literature1 - 3,6,7,9 - 14 ) . among them , only two cases of spontaneous concomitant cranial and spinal sdhs were reported in a patient receiving anticoagulant therapy who did not have a history of antecedent head or back injuries or lumbar spinal puncture3 ) . here , we report on a case of patient with a spontaneous nontraumatic spinal sdh that occurred with a simultaneous intracranial subacute sdh . the pathophysiological mechanisms of this uncommon entity are discussed , and the relevant literature is reviewed . a 67-year - old female who complained of back pain and both leg radiating pain was referred to our emergency room . she also complained of a severe bitemporal headache at the same time . during the previous 3 years she was treated with combined low dose aspirin and 75 mg clopidogrel bisulfate ( plavix ) per day . examination of blood tests had shown a platelet count of 14210/l , a prothrombin time of 10.4 sec ( range 9.4 - 12.5 ) , an international normalize ratio of 1.2 ( range 0.9 - 1.27 ) and partial thrombolplastin time of 40.2 sec ( range 28.0 - 44.0 ) . they were all within normal ranges . upon physical examination , she was alert and fully oriented in spite of the severe headache . the neurological examination revealed slight motor weakness ( grade iv ) and numbness in the lower extremities . an immediate magnetic resonance imaging of the brain and spine revealed a subacute sdh in the left fronto - temporo - parietal area that was 8 mm at its thickest point and a well - circumscribed intradural lesion , which was isodense with the dural sac , that measured 8 mm at its maximum diameter and compressed the cauda equina at l4-s1 . the intradural lesion showed high signal intensities on t1 weighted images and low signal intensities on t2 weighted images . no contrast enhancement was seen on fat - suppressed t1-weighted images ( fig . 1 , 2 ) . based on these magnetic resonance ( mr ) findings , the patient was diagnosed with concomitant cranial and spinal sdhs . the hematoma was evacuated under local anesthesia through one burr hole using a 5-l catheter 7 days after admission . the spinal sdh was treated conservatively . to distinguish this case from other conditions for differential diagnosis , the cerebrospinal fluid ( csf ) analysis revealed 190000 red blood cells / mm and 267 white blood cells / mm . a brain computed tomographic scan and lumbar spine mr images taken 14 days after admission revealed that the spinal sdh had completely resolved ( fig . 3 ) . the patient was in good health and free of neurological deficits during the 12-month follow - up period . unlike the cranial counterpart , the spinal subdural space lacks the bridging veins that act as an origin for a sdh . the lower incidence of sdh in the spine has been attributed to the protection of the spinal subdural space by the vertebrae and broad paravertebral muscles and to the rare passage of blood vessels , such as bridging veins , through the subdural space3,14 ) . moreover , a concomitant intracranial and spinal sdh is extremely rare , and , to the best of the authors ' knowledge , a total of 13 cases of the concomitant occurrence of intracranial and spinal sdhs have been reported so far in the english literature ( table 1 ) . among them , most cases were attributed to head injury or changes of csf hydrodynamics , and there has been only two reports , including our report , associated with anticoagulation in the absence of trauma3,4 ) . when using antiplatelet agents , the adp receptor antagonists prevent adp - induced fibrinogen binding to platelets , a necessary step in the platelet aggregation process . they would not influence the coagulation profiles of our patient , so the patient 's coagulation status remained normal . the exact etiology of the simultaneous occurrence of intracranial and spinal sdhs has not been clearly elucidated . initial hemorrhage in the subarachonoid space is thought to be the primary lesion that eventually dissects into the subdural space , and the subarachnoid hemorrhage is washed out by cerebrospinal flow3 ) . however , the causal relationship between cranial and spinal bleeding is not clearly documented by this theory . hung et al.2 ) hypothesized that a rise of intracranial pressure may also increase shearing force between spinal subdural and subarachnoid spaces so that the inner dura may tear and bleed . either high or low intracranial pressure has been proposed as a predisposing factor for this migration . raised intracranial pressure due to brain swelling the anatomic continuity between the intracranial and spinal subdural spaces can be observed using an electron microscope8 ) . a spinal sdh and rebleeding might have occurred in the cranial lesion before the onset because mr imaging of the brain suggested that the hematoma was in the subacute phase on admission . oral antiplatelet therapy and brain atrophy with aging may have facilitated the rebleeding and migration of the hematoma . the limitation of this study is that even though we discard the possibility of a minor trauma and thoroughly educate the patient , there is not enough to rule out the possibility of chronic subdural hematoma due to an accidental minor injury to the head . although rare , concomitant intracranial subacute sdh and spinal sdh should be included in the differential diagnosis of nerve root compression in a patient receiving anticoagulant therapy .

simultaneous intracranial and spinal subdural hematomas are extremely rare . in most cases , they are attributed to major or minor trauma and iatrogenic causes , such as those resulting from spinal puncture . to the best of the authors ' knowledge , there has been only two reports of spontaneous concomitant intracranial and spinal subdural hematomas in a patient receiving anticoagulant therapy who had an absence of evident trauma history . we report on a case of spontaneous concomitant intracranial and spinal subdural hematomas that occurred in association with anticoagulant therapy and present a review of the relevant literature .

self - cloning , an asexual form of reproduction is found in some species of nematodes , gastropods , insects , fishes , amphibians and reptiles 1 , while in crayfish species it was reported only in marbled crayfish in aquarium 2 . red swamp crayfish , procambarus clarkii native to south - central united states and northeastern mexico , has been transplanted to hawaii , japan , europe and even the river nile 3 . this crayfish has rapidly spread to most provinces of china , and has established dense populations due to translocation by humans for food and lack of local predators 4 . however , the species has caused serious problems to local fish , crustacean , aquatic plants and freshwater ecosystem , and their burrows lead to the loss of irrigation water and destroy rice field , leading to substantial economic loss in china 4 , 5 . during the genotyping of 120 adult individuals collected in nanjing , jiangsu province and tongxiang , zhejiang province in china using five tetra - nucleotide microsatellites 6 to know the population structure of this alien invasive species , we surprisingly discovered four natural clones of p. clarkii . we collected 62 and 58 adult p. clarkii individuals captured in ponds and ditches in two locations of china : nanjing ( jiangsu province ) and tongxiang ( zhejing province ) . these individuals were sexed based on their external morphological genital opening located on the third pair of pereiopods in females , the fifth or last pair of pereiopods in males . a single third pleopod of every individual was collected and stored in absolute ethanol for dna extraction 7 . five tetra - nucleotide microsatellites ( pclg03 , pclg07 , pclg09 , pclg12 and pclg18 ) were selected from a published paper 6 . one primer of each pair was labeled with either fam or hex fluorescent dyes ( 1 base ) . pcr amplification was performed on a ptc-100 machine ( mj research ) in 25 l reaction volumes containing 40 ng dna , 1 x pcr buffer including 1.5 mm mgcl2 , 200 nm of each primer , 50 m of each dntp and one unit dna polymerase ( finnzymes ) . cycling conditions were as follows : 94c for 2 min followed by 35 cycles of 94c at 30 s , 50c at 30 s and 72c at 30 s , with a final extension at 72c for 5 min . sizes of the pcr products were determined against the size standard gs - rox-500 ( applied biosystems ) using an abi3730xl sequencer and its software , genemapper v3.5 ( applied biosystems ) as described previously 7 . the cytochrome c oxidase subunit 1 mitochondrial region ( cox i ) is emerging as the standard barcode region for higher animals 8 . therefore , the cox i gene was used to confirm that the self - cloning crayfish was the red swamp crayfish in this study . to amplify the partial sequence of the mitochondrial cox 1 gene , one pair of primers ( f : tttttggacaccctgaagttta , r : tataagcatcgggataatctgaata ) ay701195 ) of the gene of p. clarkii . pcr was conducted in 25 l reaction volumes containing 40 ng total dna , 200 nm of each primer , 200 m dntps , one unit taq dna polymerase ( finnzymes ) and 1x buffer with 1.5 mm mgcl2 on a ptc-100 pcr machine ( mj research ) . the pcr program was 94c for 2 min , then 34 cycles of 94c for 30 s , 55c for 30 s and 72c for 1 min , followed by a final extension of 72c for 5 min . pcr products were cleaned using glassmilk ( bio 101 ) and sequenced in both 5 ' and 3 ' directions using the bigdye 3.0 chemicals ( applied biosystems ) and an abi3730xl sequencer ( applied biosystems ) . forward and reverse sequences of each individual were assembled using sequencher ( genecodes ) . to confirm that the self - cloning crayfish is the red swamp crayfish , the partial sequences of the mitochondrial cox i gene of 10 crayfish species ( details see figure 1 ) were downloaded from genbank . the data set including the sequences of the four clones of p. clarkii collected in china was analyzed with maximum parsimony ( mp ) , neighbor - joining ( nj ) , and minimum evolution ( me ) as implemented in mega 9 . to understand the origin of the four clones , genetic relationships among the four clones and individuals sexually produced were analyzed based on microsatellite allele sharing index 10 . we collected 62 and 58 adult p. clarkii individuals captured in ponds and ditches in two locations of china : nanjing ( jiangsu province ) and tongxiang ( zhejing province ) . these individuals were sexed based on their external morphological genital opening located on the third pair of pereiopods in females , the fifth or last pair of pereiopods in males . a single third pleopod of every individual was collected and stored in absolute ethanol for dna extraction 7 . five tetra - nucleotide microsatellites ( pclg03 , pclg07 , pclg09 , pclg12 and pclg18 ) were selected from a published paper 6 . one primer of each pair was labeled with either fam or hex fluorescent dyes ( 1 base ) . pcr amplification was performed on a ptc-100 machine ( mj research ) in 25 l reaction volumes containing 40 ng dna , 1 x pcr buffer including 1.5 mm mgcl2 , 200 nm of each primer , 50 m of each dntp and one unit dna polymerase ( finnzymes ) . cycling conditions were as follows : 94c for 2 min followed by 35 cycles of 94c at 30 s , 50c at 30 s and 72c at 30 s , with a final extension at 72c for 5 min . sizes of the pcr products were determined against the size standard gs - rox-500 ( applied biosystems ) using an abi3730xl sequencer and its software , genemapper v3.5 ( applied biosystems ) as described previously 7 . the cytochrome c oxidase subunit 1 mitochondrial region ( cox i ) is emerging as the standard barcode region for higher animals 8 . therefore , the cox i gene was used to confirm that the self - cloning crayfish was the red swamp crayfish in this study . to amplify the partial sequence of the mitochondrial cox 1 gene , one pair of primers ( f : tttttggacaccctgaagttta , r : tataagcatcgggataatctgaata ) ay701195 ) of the gene of p. clarkii . pcr was conducted in 25 l reaction volumes containing 40 ng total dna , 200 nm of each primer , 200 m dntps , one unit taq dna polymerase ( finnzymes ) and 1x buffer with 1.5 mm mgcl2 on a ptc-100 pcr machine ( mj research ) . the pcr program was 94c for 2 min , then 34 cycles of 94c for 30 s , 55c for 30 s and 72c for 1 min , followed by a final extension of 72c for 5 min . pcr products were cleaned using glassmilk ( bio 101 ) and sequenced in both 5 ' and 3 ' directions using the bigdye 3.0 chemicals ( applied biosystems ) and an abi3730xl sequencer ( applied biosystems ) . to confirm that the self - cloning crayfish is the red swamp crayfish , the partial sequences of the mitochondrial cox i gene of 10 crayfish species ( details see figure 1 ) were downloaded from genbank . the data set including the sequences of the four clones of p. clarkii collected in china was analyzed with maximum parsimony ( mp ) , neighbor - joining ( nj ) , and minimum evolution ( me ) as implemented in mega 9 . to understand the origin of the four clones , genetic relationships among the four clones and individuals sexually produced were analyzed based on microsatellite allele sharing index 10 . of the 62 individuals from nanjing , 36 were females and 26 were males . from tongxiang , 33 individuals were females while the remaining 25 were males . the nanjing population showed more alleles than the tongxiang population ( 49 vs. 35 ) . the observed heterozygosity was 0.59 and 0.58 in the nanjing and tongxiang population , respectively , while the expected heterozygosity was 0.72 and 0.66 respectively . we surprisingly found that four clones , containing five ( clone 1 ) , six ( clone 2 ) , two ( clone 3 ) and two ( clones 4 ) genetically identical female individuals , respectively ( table 1 ) , while the remaining 105 individuals each showed a unique genotype group . re - genotyping of dna re - extracted from tissues by another person detected the same results , thus the possibility of dna contamination would be excluded . according to the frequency of 49 alleles at the five loci in the 120 individuals , thus , these 15 individuals sharing the four genotype groups ( clones ) must be generated through self - cloning . these data indicate that self - cloning individuals of red swamp crayfish have already existed in freshwater ecosystems in china . whether self - cloning individuals exist in other populations in china the four clones were most probably diploid due to presence of one or two alleles per locus at all five loci ( table 1 ) . the four clones showed higher observed heterozygosity ( 0.60 - 1.00 ) ( table 1 ) than the average observed heterozygosity ( 0.59 ) of individuals sexually produced in the two populations where the four clones came . natural cloning could be generated by different forms of asexual reproduction including parthenogenesis 11 , gynogenesis 12 and hybridogenesis 13 . however , hybridogenesis is hemiclonal , only half of the genome , the maternal one , is transmitted asexually . in the marbled crayfish 2 , offspring were genetically identical to the parent , indicating it reproduces by apomixis 11 , whereas , in komodo dragons , offspring was instantaneous homozygosity of the entire genome produced by automixis with pure terminal fusion of nuclei 14 . wolbachia infections have been reported to cause self - cloning in different invertebrate groups including arthropod species 15 . the self - cloning of p. clarkii may be generated by apomixis or automixis 16 . the high observed heterozygosity of the four clones in p. clarkii suggests that hybridization might also have played a major role in the formation of the four clonal lineages . the mechanisms underlying the self - cloning of p. clarkii remain to investigate . to confirm that the four clones were from the species procambarus clarkii , we sequenced the mitochondrial gene cox i of all 15 self - cloning individuals and compared the sequences with those of other closely related crayfish species 2 . phylogenetic analysis 9 indicated that these self - cloning crayfish individuals were really from the species procambarus clarkii ( figure 1 ) . phylogenetic analysis using microsatellite allele sharing index 10 revealed that the four clones were clustered with individuals sexually produced in different branches ( figure 2 ) . these data suggest recent origin of the four clones . as self - cloning in this crayfish has not yet been observed in other countries , we suspected that self - cloning in this crayfish was induced by specific environment factors ( e.g. wolbachia infections ) in china . the discovery of self - cloning in this crayfish species provides an opportunity to study environmental factors that induce self - cloning . self - cloning individuals could be more dangerous than crayfish sexually produced to freshwater ecosystem and rice field , as a single self - cloning individual may be enough to found a population . hence , translocation of this crayfish among different regions must be banned to prevent its spread , and self - cloning individuals in the wild must be identified and eradicated in situ .

self - cloning is quite rare in shrimp , lobsters , crayfish and crabs . here we report the discovery of four natural clones of red swamp crayfish ( procambarus clarkii ) , each containing 2 - 6 genetically identical individuals , during the genotyping of 120 individuals with five microsatellites . the four clones were heterozygote at most of the five microsatellite loci . phylogenetic analysis using microsatellite genotypes suggests recent origin of the four clones . sequencing a part of the mitochondrial gene cox i confirmed that the four clones were from the species procambarus clarkii .

recent advances in array - based and sequence - based instrumentation have opened up new ways to monitor the inner molecular world of the cells and tissues that might be relevant to human diseases . yet it is far from evident how these large datasets should be analyzed and how they can be integrated with other sources of data in order to become informative . conversely , the medical community expects nothing less than a list of predictive biomarkers reflecting the risk of disease or its progression and an understanding of the cellular mechanisms involved in disease . however , comparing microarray samples from healthy and diseased individuals using a differential gene expression protocol generates a list of thousands of genes , and it is not clear which genes are important for what . a key idea , originating from engineering science in general and computer science in particular , is the notion of ' divide and conquer ' , which refers to first breaking down a problem into smaller sub - problems that are simple enough to allow an analysis and then combining the solutions to the subproblems , which gives the solution to the original problem . modular analysis of genomic data implements this strategy by dividing the original genomic data into smaller number of modules and then conquering the reduced complexity by using these modules for prioritization to give a shorter list of disease - associated genes . such genes could either be causal drivers of disease or secondary reactions to disease that could potentially be useful biomarkers . benson and colleagues , in a recent paper in bmc systems biology , have used a modular approach to study allergic asthma . they managed to divide the complexity and arrive at the gene encoding the interleukin-7 receptor ( il7r ) as a putative key regulator in allergic asthma . here , i put their analysis in the context of other modular approaches and discuss the possible use of this methodology for finding and prioritizing useful candidates for therapeutics . not surprisingly , there are several different ideas on how to divide and conquer high - throughput functional genomics data . i will restrict my discussion here to gene expression data , although similar remarks could be made for sequence data . one is : given a module of disease - associated genes , how can we compute and/or experimentally predict which genes are good candidates for therapeutics ? before discussing this problem i will first give an overview of different approaches to the other problem : identifying a module of genes . a module is a group of genes that are related in some way to each other and therefore a module is effectively a measure of similarity . for example , if similarity is defined as the distance in a network , then a graph theoretical calculation will be used . however , if gene functional associations are used , then gene similarity will be measured in terms of gene ontology ( go ) or correlation in gene expression values . therefore , different algorithms are used for dividing the genes into modules , a fact that could be confusing for the clinical researcher . the need to reduce the complexity of the original high - throughput gene expression data applying established engineering concepts , such as principal component analysis ( pca ) and singular value decomposition ( svd ) , reduced the dimensionality of the data . instead of analyzing scattered points ( the samples ) in a high - dimensional space equaling the number of genes , the data could thereby be projected into a two- to four - dimensional space . however , it turned out to be difficult to make a biological interpretation of the resulting linear combinations of large numbers of genes . this problem forced the development of different strategies in which the available knowledge on a limited number of genes could be used to predict the functions of as - yet uncharacterized genes . the use of hierarchical clustering in the classic compendium study on yeast data by rosetta inpharmatics grouped genes ( shown as rows ) by their similarity of expression across several experimental conditions ( columns ) . novel gene function was then predicted by inspecting genes in the same cluster as genes with known functions . subsequent work by eran segal and colleagues developed more statistically sound procedures for identifying robust modules using a bayesian formalism applied to microarray data generated from cancer samples . it became clear , however , that a similarity measure based only on correlations was insufficient , because the clusters ( modules ) or bayesian modules did not have an internal network structure that could be used for a more refined analysis . as a consequence , a large number of studies addressing this problem appeared in the literature at the beginning of 2004 . the idea was that if we could identify the wiring within cellular networks , various different algorithms could be applied to find ' connected groups ' in such networks . now , how can such networks be found using only a small number of experimental samples with a large number of genes ? this is an impossible problem from the point of view of engineering system identification , because the number of possible networks consistent with the data is prohibitively large . the key simplifying insight came from ideker and lauffenburger and was later developed by nicolas luscombe and colleagues in a pioneering paper . here , the edges ( or connections ) in the network were simply defined by transcription factor binding experiments , and gene expression data were used to select the subsets of edges that were active under different conditions . this idea of defining edges in a network using a static scaffold has since been reused using various data types ( protein - protein interaction data , pathways from a database , text mining and dna variants ) . the network of interest is then defined by combining the gene expression data with the scaffold , leaving only the active edges . by searching through such an active network using graph algorithms it is then possible to define ' more ' connected parts in a well defined manner , thereby providing modules with an intrinsic network structure . all the above approaches basically begin with a large , complex dataset , which is then simplified by dividing the data into smaller modules . they instead began with four well characterized breast cancer genes and , by using these ideas , constructed a module in which the genes were ' close ' as defined by expression and proteomic data in several species . benson and colleagues have now contributed to a disease - oriented modular analysis by combining several of the above ideas in a novel manner , as summarized in the flow chart in figure 1 . first , because allergic disease involves multiple cells in different tissues and because no prior characterization of key genes was available , they turned to several different sets of gene expression microarray data in order to find a reference disease - associated gene around which they could construct a module . using the idea that disease - associated genes tend to interact , they could search for other disease - associated genes that were ' close ' . for this purpose , the authors used a graph algorithm that identified a connected clique of 103 disease - associated genes from the microarray data . integration of several public gene expression datasets revealed a group of shared ( blue ) and closely connected clique ( red and black ) disease - associated genes . a subset of these genes were found to share the t - cell receptor signalling pathway , an observation that was then validated by independent experimentation . to identify a transcription factor ( gata3 ) regulating one of this subset , the itk gene , the final module of 37 disease - associated genes consisted of genes listed in public databases as having relevant expression patterns and interacting with gata3 . the t - cell receptor signaling pathway turned out to be a pathway shared by these 103 genes , as detected by the ingenuity pathway analysis tool , which identifies physical , transcriptional and enzymatic interactions from the literature . experimental analysis of this pathway in patient - derived cells revealed strong activation of the itk gene , which is also known to be located in the genomic susceptibility region for allergy . combining a promoter analysis of the itk gene with expression data revealed that the transcription factor gata3 regulated itk . the expression data were used to filter out 10 inactive genes , thus leaving a final module of 37 disease - associated genes around the gata3 transcription factor . the construction of this module was accompanied by several experimental tests at various stages , providing confidence to the analysis . the problem of selecting therapeutic targets within a module has not received much attention in studies that have used a modular approach for reducing complexity . there are various ideas from graph theory on how to compute mathematically defined properties , such as clustering and connectivity in large networks , which then could suggest which nodes are essential . however , essentiality is not necessarily equivalent to disease association . experimental investigators have instead performed target selection using the full dataset in combination with extensive experimental testing . the analysis by benson and colleagues is important because it highlights the difficulty of selecting a disease - associated target from a module of 37 genes despite the elegant prior reduction of complexity . they resorted to using a connectivity criterion , selecting the il7r gene because it had the largest number of connections , and they were also able to demonstrate that perturbing the il7r gene affected other genes and the t - cell phenotype . there are probably several other disease - associated genes in their module that warrant further experimental investigation . benson and colleagues have introduced a useful procedure for defining a module of disease - associated genes . as with most complex diseases , the study of allergy is complicated by the fact that the disease affects several cell types and tissues . the process of identifying such modules therefore requires the kind of stringent experimental validation as was performed by the benson team . despite their careful analysis , because there are other transcription factors for the itk gene that are active in the expression datasets there is a significant risk that several disease - associated genes remain that were not captured in their module . the second step of selecting a gene for therapeutics from a module is even more problematic because we are currently lacking systematic tools for this selection problem . furthermore , it is not unlikely that an efficient therapy could require targeting of several disease - associated genes simultaneously . however , the number of combinations of three genes that can be chosen from a small ten - gene module , for example , quickly exceeds what is experimentally feasible to study . in conclusion , benson and colleagues have devised an interesting method for finding disease - associated genes , but it needs to be evaluated on other complex diseases . their study also makes clear that the problem of prioritizing disease - associated genes within a module for therapeutic studies in the clinic is still unsolved .

complex diseases such as allergy change gene expression in several cell types and tissues . benson and colleagues have now shown , in a paper in bmc systems biology , that this complexity can be studied effectively using an integrated experimental and computational modular analysis . their strategy revealed a core of allergy - associated genes of potential therapeutic value .

renal cell carcinoma ( rcc ) also known as hypernephroma or adenocarcinoma of renal cells is the most common type of kidney tumour found in adults . it originates in the proximal convoluted tubules , typically affecting men with a peak incidence in 5070 year olds . the tumour is recognized to metastasize to common sites which include the lungs , liver , bone , adrenal glands and the brain . the authors present a case of a gentleman with rcc metastasis to the lower lip after a recent nephrectomy . a 64-year - old male was referred by his general practitioner with concerns over an increasing swelling on his lower lip following unsuccessful control with antibiotics and antifungal treatment . at presentation he reported a 3-week history of an asymptomatic growth on his lower right lip , which he originally attributed to trauma whilst shaving . the lesion was 4 cm in diameter , soft , erythematous with overlying crusting ( see fig . 1 ) . pre - operative rapidly growing tumour in the lower right lip . at the time of presentation the provisional diagnosis based on history and appearance was of a rapidly growing squamous cell carcinoma or keratoacanthoma . an initial biopsy however showed features consistent with a metastatic adenocarcinoma consistent with the previously removed rcc ( see fig . 2 ) . figure 2:photomicrograph of a specimen from the lower lip demonstrating the presence of rcc cells . further staging with a computed tomography of the chest revealed a 15 mm pulmonary nodule in the right upper lobe anterior segment also consistent with metastatic disease . the patient was discussed at the head and neck multidisciplinary team meeting with consultation from his urology team . a decision was made to resect the rapidly growing lip metastases as part of local control of disease for functional and aesthetic reasons . the lip metastasis was excised using a wedge excision with 1 cm clearance margins ( see fig . 3 ) . the lung nodules were later treated with chemotherapy and the patient is still under regular review . figure 3:post - operative following resection and repair of the lower lip . rcc metastasis to the skin can present before diagnosis of the primary site but are typically found after the initial primary tumour identification [ 3 , 4 ] . as in this case metastases can develop after initial nephrectomy . it is reported that 2050% of patients having had a nephrectomy for rcc will develop distant metastases in the future . this potential for distant metastases after primary treatment of rcc is one of the reasons for the poor prognosis in this type of tumour . rcc metastases have been documented in the nasal cavity , lower lip , hard palate , tongue and maxillary sinus . presentation of skin lesions can be varied and lead to a wide variety of differentials . these could include pyogenic granuloma , haemangioma , melanoma , basal cell carcinoma and other vascular lesions . imaging is of little use for skin lesions but can help locate other sites of metastases . one review of cutaneous metastases in rcc showed 90% of patients had secondary tumours in non - cutaneous sites such as the lungs and bones . treatment of skin lesions can vary depending on the site ; however , excision is recommended if the scalp or face is involved . multi - disciplinary team discussion is critical in deciding the mode of treatment of other secondary sites of metastasis , e.g. lung and bone . skin metastases from rcc are rare but some cases have been documented . they can present before or after rcc diagnosis and despite removal of the primary tumour metastases can present many years later . a high index of clinical suspicion is needed and a thorough history and examination should be obtained . patients with known rcc should be monitored due to the likely appearance of metastases at multiple secondary sites .

we present a case of a 64-year - old gentleman who developed a renal cell carcinoma ( rcc ) metastasis to his lower lip following successful treatment of the primary tumour . rcc is a common kidney tumour but skin metastases are considered rare . the authors describe the findings of this case and discuss the presentation , investigations and management of rcc skin lesions .

gratification disorder also known as benign idiopathic infantile dyskinesia is a form of masturbatory behavior that is often mistaken for epilepsy , abdominal pain , paroxysmal dystonia , or dyskinesia . though often called a disorder, it is a normal behavioral variant seen in early childhood . it occurs in children between age of 3 months and 3 years with a second peak incidence at about the adolescent age . its exact mechanism is poorly understood , but has been associated with self - tension , boredom , excitement , genital infection , and lack of stimulation . gratification behavior in children is quite common , and has been reported in 90 - 94% of males and 50 - 55% of females . however , it has variable clinical presentations in early childhood and failure to recognize these behaviors may result in unnecessary investigations and treatment . despite the documented occurrence of self - genital stimulation in children in western literature , there is paucity of literature depicting its exact physical characteristics in our environment , this may be due to few or nonparental complaint of these problems because issues bothering on genital stimulation may be considered as a taboo in some african society . we therefore report a case of gratification disorder in an 18-month - old girl who was initially diagnosed to have epilepsy , but subsequently turned out to be gratification behavior . a 18-month - old toddler was brought to the neurology clinic of aminu kano teaching hospital , kano by her mother with complaints of abnormal body movements of 2 months duration . movements were described as stiffening with arching of the back , rocking and twisting of the body with scissoring of the lower limbs [ figure 1 ] associated with grunting , hyperventilation , and sweating . she is said to be fully conscious [ figure 2 ] and responds to call during each episodes which lasts between 1 - 5 min . movements are said to be occasionally stopped by gentle restraints and are not present during sleep . she was seen initially at the pediatric outpatient department and a diagnosis of epilepsy was made though , she had not been placed on anticonvulsants before referral to the neurology clinic . a home video recording showed typical features consistent with gratification behavior [ video 1 ] . childhood gratification disorder was diagnosed and mother was reassured , counseled , and advised to distract the child with interactive play during episodes ; especially if it occurs in public places . she is currently being followed - up at the pediatric neurology clinic with significant reduction in the frequency of episodes . scissoring of the lower extremities with stretching of the body evidence of being conscious during the event gratification disorder is common in children , but could pose a diagnostic challenge in early childhood if the clinician is not aware of its possibility because unlike in adolescents , it does not usually involve manual genital manipulation and its clinical presentations are variable , therefore it could be wrongly diagnosed as epilepsy , nonepileptic paroxysmal movement disorder , or even gastrointestinal disorder like gastroesophageal reflux disease . our index case was initially misdiagnosed as epilepsy and she had electroencephalography done which was normal . this observation is similar to that of nechay et al . , in their review of 31 cases of masturbatory behavior in children found that majority of the patients were initially misdiagnosed with seizure disorder ; while fleisher and morrison in their case series , reported movement disorder as the commonest initially diagnosis . however , the typical clinical features in children as reported by yang et al . , include : ( 1 ) onset after the age of 3 months and before 3 years ; ( 2 ) stereotyped episodes of variable duration ; ( 3 ) vocalizations with quiet grunting ; ( 4 ) facial flushing with diaphoresis ; ( 5 ) pressure on the perineum with characteristic posturing of the lower extremities ; ( 6 ) no alteration of consciousness ; ( 7 ) cessation with distraction ; ( 8) normal examination ; and ( 9 ) normal laboratory studies . videotaping of these episodic events is invaluable in the diagnosis of gratification behavior because parent may use the wrong descriptive terminology for some of these postural features , therefore giving semblance to seizure disorder , movement disorder , or gastrointestinal disorder . the diagnosis was made possible only after the video clip was seen in our patient . therefore , clinicians should form the habit of requesting video clips for neurologic disorders that involve seizures or movement disorders . treatment usually involves counseling and educating the parents for them to understand that it is a normal behavior in children and that they will often outgrow it . therefore , scolding the child could result in positive reinforcement of such behavior and low self - esteem ; rather they should be gently talked to on the need to avoid such behaviors especially in public places , then subsequently even in privacy . furthermore , attempts could be made to engage the child in other play activities which could redirect their attention from masturbatory activities . clinicians should be aware of its existence otherwise it could be misdiagnosed as seizure , movement or even gastrointestinal disorder and videotaping of these episodic events are invaluable in making a correct diagnosis in neurologic disorders .

gratification disorder is common in younger children , but is often unrecognized because unlike in adolescents , it does not involve manual genital manipulation and the clinical features are quite variable ; therefore a thorough history , physical examination , and video recording of the events will go a long way in making the correct diagnosis , otherwise it could easily be misdiagnosed as epilepsy , nonepileptic paroxysmal movement disorder , or even gastrointestinal disorder .

are commonly used on the other hand an opioid consumption is traditionally common in iran . the effects of different addictives on body systems have been reported ; however , there is not enough information about different blood parameters ( 2 ) . the effect of some psychoactive substances on commonly observed diseases like coronary artery disease , diabetes mellitus and some psychiatric disorders has been investigated , but effects of long - term use of these substances on endocrine system have not been studied enough ( 3 ) . studies have demonstrated controversial results about effects of psychoactive substances on hypothalamic - pituitary axis and thyroid function ( 4 ) . psychoactive substances have many different effects on physiologic and neuroendocrine functions in humans ( 5 ) . it has been demonstrated that endogenous opioids like -endorphin , enkephalins and opiate receptors influence neuroendocrine regulation ( 6 ) . previous studies showed that some psychoactive substances modulate immune function and affect resistance to bacterial , viral and protozoan infections ( 7 , 8) . monitorization of the psychoactive substance use can be done objectively by urine analysis . since substance concentrations in urine are higher than blood , urine is the preferred material for determination of substance use . testing schedules and determination of cut - offs are important for confirmation of the psychoactive substance use ( 9 ) . since polydrug abuse is common worldwide , determination of the effects of only one drug is difficult ( 10 ) . recent studies demonstrated controversial results about the effects of opium on serum electrolytes , lipid markers and glucose metabolism . defining the real side effects of these psychoactive substances may increase awareness about disadvantages of consumption ( 11 ) . studies about the effects of psychoactive substances on different biochemical and hematological parameters were limited in number ( 2 , 12 ) . this study was conducted to determine the effects of different psychoactive substances on serum biochemical parameters . this study was conducted on 324 patients and 69 controls admitted to erenkoy mental health and neurology training and research hospital between january 2013 and january 2014 . patients were determined according to the diagnostic and statistical manual of mental disorders , fourth edition dependent group involves subjects determined as at least one or more than one type of psychoactive substance users . in the control group urine toxicology results were negative . levels of toxicology parameters were determined using a hitachi model 902 automatic analyzer ( hitachi high - technologies corporation , roche diagnostics ) with an enzyme immunoassay ( microgenics cedia fremont , california , usa , for urine toxicology ) . after hospitalization , each patient s first urine and blood sample before treatment were taken into account for comparison . cases and controls with accompanying diseases like diabetes , cancer , metabolic disorders etc . are excluded from the study . urine samples were tested simultaneously for heroin , cannabinoids , cocain , benzodiazepins , opiates , buprenorfine , amphetamines , extacy and ethyl glucuronide . routine biochemistry parameters were measured using the architect ci 4100 ( abbott diagnostics products ) automatic biochemistry analyzer . this study was approved by the ethics committee of erenkoy mental health and neurology training and research hospital . spss ibm 20.0 software ( chicago , illinois , usa ) was used for statistical analysis . spss ibm 20.0 software ( chicago , illinois , usa ) was used for statistical analysis . a total of 324 patients ( 316 males and 8 females ) and 69 controls ( 64 males and 5 females ) were involved in this study . the median ages of psychoactive substance users and controls were 26.5 ( 23 - 34 ) and 27 ( 20.5 - 34.5 ) years , respectively ( table 1 ) . the concentration of biochemical parameters in the serum of the substance - dependent group was compared to the control group ( table 2 ) . we found a statistically significant difference in gamma - glutamyl transferase ( ggt ) , uric acid , creatinin , urea , albumin , aspartate aminotransferase ( ast ) medians between the patient and control groups ( p < 0.05 ) . abbreviations : alp , alkaline phosphatase ; alt : alanine aminotransferase ; ast : aspartate aminotransferase ; crp , c - reactive protein ; ggt , gamma - glutamyl transferase ; hdl , high density lipoprotein ; ldh , lactate dehydrogenase ; and ldl , low density lipoprotein . forty - six out of 424 addicts tested positive for only opium ( cut - off , 300 ng / ml ) . several biochemical parameters in the opium - dependent group were compared to the control group ( table 3 ) . there was a statistically significant difference in the serum concentrations of sodium and albumin between the opium - dependent and the control groups ( p < 0.05 ) . moreover , sixty - nine patients were tested positive for only cannabinoids ( cut - off , 50 ng / ml ) . biochemical parameters did not show any significant difference in the cannabinoid - dependent group compared to the control group ( p > 0.05 ) . thirteen out of all addicts were tested positive for only benzodiazepine ( cut - off > 300 ng / ml ) . there was a statistically significant difference in ggt , urea , glucose , sodium , total protein , and ast levels between the benzodiazepine - dependent group and control group ( p < 0.05 ) . also , 12 patients were tested positive for only ethyl glucuronide ( cut - off > 500 ng / ml ) . a statistically significant difference was found in triglyceride and ggt levels between the ethyl glucuronide and control groups ( p < 0.05 ) . clinical observations demonstrated that adverse effects of psychoactive substances were associated with the addiction period and route of administration . psychoactive substance users commonly have nutritional problems since they spend their money largely for drugs ( 13 ) . coexistence of psychiatric disorders in drug addicts is also important since some psychiatric disorders may cause loss of appetite and poor nutritional status and changes in biochemical parameters ( 14 ) . clinical studies showed that long - term use of opium and heroin can affect serum glucose , potassium , calcium , uric acid and cholesterol levels ( 12 ) . in our study , we found a significant difference in ggt , uric acid , creatinine , urea , albumin , and ast medians between the dependent and control groups ( p < 0.05 ) . studies about the effects of opium addiction on blood glucose showed that the opium - dependence decreased fasting blood glucose temporarily without any effect on hemoglobin a1c ( 15 ) . we found a statistically significant decrease in glucose levels only in patients tested positive for benzodiazepine ( p < 0.05 ) . some psychoactive substances may affect gluconeogenesis so that blood glucose levels may decrease , especially in cases with poor nutrition . some people believe that psychoactive substances like opium can have beneficial effects on blood lipid profile and cardiovascular disease , but clinical observations demonstrated that opium can increase risk of atherosclerotic plaque formation and adversely affect lipid profile in animal models ( 16 ) . we found a statistically significant increase in triglyceride levels in ethylglucuronide group ( p < 0.05 ) . in our study , we did not found statistically significant difference in total cholesterol , low density lipoprotein ( ldl ) , and high density lipoprotein ( hdl ) levels between dependent and control groups ( p > 0.05 ) . cardiovascular side effects of some psychoactive substances may not be attributed to changes in lipid profile . there is a need to conduct a prospective study with the larger sample size for the prevalence of the cardiovascular disease . another study , which was performed on opium addicts showed that serum adiponectin levels were decreased but no significant change was observed in serum leptin levels . it was also indicated in previous studies that a decrease in adiponectin levels can be associated with an increased risk of metabolic disorders like insulin resistance and cardiovascular disease since it has known antidiabetic and antiatherogenic effects ( 17 ) . changes in nutritional patterns may also be related with changes in albumin levels in these patients ( 18 ) . we found a statistically significant difference in albumin levels between the drug - dependant and control groups . in our study , the amount of total protein showed a significant difference only in the benzodiazepine dependent group ( p < 0.05 ) . since in our study , patients with significant derangements were referred to specialized medical centers for further assessment and excluded from the study , changes in their albumin levels may not be due to viral infections or metabolic disorders . in a previous study , it has been demonstrated that morphine consumption for long period in animal models increases uric acid and creatinine levels ( 19 ) . we found a statistically significant decrease in uric acid and creatinine levels in the dependant group compared to the control group ( p < 0.05 ) . poor living conditions and nutritional factors like low protein intake may likely to contribute to changes in biochemical parameters in psychoactive substance users . these effects on renal system include changes in urinary output and urinary sodium excretion ( 20 ) . divsalar et al . showed that a sodium level in the heroin - dependent group did not change ; however , it was significantly high in the ex - heroin dependent group compared to the control group . however , no significance difference was found in potassium and calcium levels between the ex - heroin dependent and control groups ( 14 ) . we found that the concentration of sodium in the serum of the opium - dependent and benzodiazepine dependent groups was significantly increased compared to the control group ( p < 0.05 ) . no statistically significant difference was observed in calcium levels between the dependent and control groups ( p > 0.05 ) . routine biochemistry , and hematology parameters , and vitamin , and mineral levels are affected by nutritional factors . determining the differences in biochemical parameters , vitamin and mineral levels between addicts and healthy subjects may help to define individuals at nutritional risk and provide these patients with the corrective nutritional programs ( 18 ) . in this study we tried to describe the extent of changes in various blood parameters due to psychoactive drug use . our study involves a range of psychoactive substances like heroin , cannabinoids , cocaine , benzodiazepine , opiate , buprenorphine , amphetamine , extacy , ethyl glucuronide and their potential effects on many biochemical parameters . raising awareness about potential adverse effects of psychoactive substances health problems associated with physiological side effects of these substances may increase economic burden on health care resources . therefore , in psychoactive substance users defining the real need for intensive monitoring and treatment programs are extremely important .

background : psychoactive substances affect mainly central nervous system and brain function causing changes in behavior.objectives:the purpose of this study was to determine the effects of different psychoactive substances on serum biochemical parameters.patients and methods : the study included 324 drug dependents , and 69 controls . the patient group was determined according to dsm - iv ( the diagnostic and statistical manual of mental disorders , fourth edition ) criteria . all patients and control subjects were tested for routine biochemical parameters and urine toxicology parameters for psychoactive substance use . cases and controls with accompanying diseases like diabetes , cancer , metabolic disorders etc . are excluded from the study . moreover , an association between urine toxicology results and changes in biochemical parameters was evaluated for statistical significance.results:there was a statistically significant difference in the gamma - glutamyl transferase ( ggt ) , uric acid , creatinine , urea , albumin , aspartate aminotransferase ( ast ) medians between the dependent and control groups ( p < 0.05 ) . we found a statistically significant difference in sodium and albumin levels between the opium - dependent and control groups ( p < 0.05 ) . in the benzodiazepin dependent group , we found a significant difference in ggt , urea , glucose , sodium , t protein , and ast levels ( p < 0.05 ) . moreover , a statistically significant difference was observed in triglyceride and ggt levels between the ethyl glucuronide and control groups ( p < 0.05).conclusions : in psychoactive substance dependents , serum routine biochemistry parameters can be used to predict the need for intensive monitoring and treatment programs .

rosacea is a common , progressive , chronic , and in many cases cyclic , inflammatory skin disorder that presents with a variety of clinical manifestations that are primarily localized to the central face . rosacea affects up to 10% of the us population and occurs most commonly in adults between 30 and 60 years of age and in fair - skinned individuals of celtic and northern european heritage [ 1 , 2 ] . the disorder is divided into four main subtypes based upon groupings of primary and secondary features : ( 1 ) erythematotelangiectatic ( centrofacial redness ) ; ( 2 ) papulopustular ( acne - like inflammatory papules and pustules ) ; ( 3 ) phymatous ( marked skin thickening and distortion of facial contours , more often in men ) , and ( 4 ) ocular rosacea ( eye redness , pruritus , or irritation ) . granulomatous rosacea is a variant of rosacea ( yellow - brown or pink papules ) . the cause of rosacea is unclear , and many hypotheses have been proposed based upon the numerous contributing factors and triggers that lead to flare ups of rosacea , including sun exposure , extreme temperature , spicy food , alcohol , stress , topical irritation , and drugs ( vasodilators , nicotinic acid ) . multiple lines of evidence in recent years have led many experts to believe that rosacea is primarily caused and exacerbated by an overactive inflammatory immune response . it has been hypothesized that excessive upregulation of inflammatory mediators and/or dysregulation of innate immune function may underlie the diverse range of rosacea signs and symptoms including vasodilation , redness , angiogenesis , edema , and the formation of papules and pustules [ 4 , 5 , 6 ] . in this model , environmental stressors ( ultraviolet light radiation , heat , cold , spicy food , and alcohol ) , microbes , and certain types of bacteria stimulate an innate immune system signaling cascade leading to the overproduction and activation of cytokines , chemokines , antimicrobial peptides ( cathelicidins ) , and other proinflammatory mediators that result in tissue destruction and infiltration by inflammatory cells such as neutrophils and lymphocytes . this excessive , uncontrolled inflammatory response is believed to be responsible for the clinical manifestations of rosacea , and many researchers suggest that targeting and controlling excess inflammation should be the goal for new rosacea therapeutics in development [ 4 , 6 , 7 , 8 ] . regardless of the etiology , the consequent redness and inflammation of the face in rosacea is difficult for the patient , does not respond particularly well to treatment , and is frustrating for both physician and patient . topical and oral medications used to treat rosacea have equivocal clinical efficacy , and there is a recognized need for more effective , safe , and well - tolerated long - term treatment options . compounds that alleviate or control excessive inflammation in the skin are likely to provide relief from many of the symptoms of rosacea , and many rosacea sufferers are beginning to experiment with new , non - prescription treatments with unproven safety or efficacy . briefly put , there are no current effective ways for a patient with rosacea to reliably improve the appearance of their skin . anatabine is a minor alkaloid found in plants of the solanaceae family , including peppers , tomatoes , potatoes , eggplant , and tobacco , that is being investigated as a modulator of systemic inflammation . researchers have shown that anatabine exhibits anti - inflammatory effects in a number of in vivo and in vitro studies . in a transgenic model of alzheimer 's disease , anatabine administration resulted in the downregulation of the proinflammatory molecule amyloid due to reduced activation of nuclear factor b ( nf-b)-dependent pathways , and anatabine significantly lowered plasma levels of the inflammatory marker c - reactive protein in these animals . anatabine has also been shown to block the production of proinflammatory cytokines such as il-1 , il-6 , and tnf- in the blood and tissues of mice injected with lipopolysaccharide by blocking the activation of the transcription factors nf-b and stat3 . investigated the effects of anatabine in a mouse model of autoimmune thyroiditis and found that anatabine significantly reduced several markers of systemic inflammation . although the precise mechanism underlying the diverse immunomodulatory effects of anatabine is unclear , a topical cream containing anatabine may provide anti - inflammatory benefits when applied to the skin by interfering with proinflammatory signaling pathways . the purpose of this open - label case series study was to examine the safety , tolerability , and effects of a facial cream containing anatabine in patients with mild to moderate rosacea , principally to determine if it could improve the appearance of the skin . this case series was conducted at a private dermatology clinic located in bradenton , fla . , patients interested in taking part in this case series provided written informed consent , which included consent to use facial photographs for scientific presentation or publication , before any study - related procedures took place . each patient was treated as clinically indicated , and patient confidentiality was protected . on day 1 , patients came to the clinic for baseline assessment , had photographs taken , and received instructions for using the anatabine cream . for the duration of the 30-day study period patients rated 6 components of their baseline skin appearance and rosacea symptoms ( overall skin appearance ; appearance of rosacea ; redness / blotchiness ; skin tone and color ; blemishes , and dryness / flakiness ) on a 4-point scale from 0 ( absent ) to + 3 ( severe ) by filling out the patient global assessment ( patga ) , and the physician rated the cardinal signs of rosacea using the physician 's global assessment ( phyga ) , as described by wilkin et al . . clinic staff called patients approximately 2 weeks after day 1 to ask about their experience using the cream . patients returned to the clinic approximately 30 days after day 1 for final assessments and photographs . at this visit , patients and the physician rated the effectiveness of the cream by filling out the patient efficacy assessment ( patea ) and the physician 's efficacy assessment ( phyea ) , respectively . the patea and phyea each consisted of a 5-point rating scale from 1 ( worse ) to + 3 ( cleared up ) . all patients were questioned for any adverse events , side effects , or complaints they experienced during the 30-day treatment period . a total of 10 acne rosacea patients ( 7 women , 3 men ; mean age 69.0 8.58 years ; age range 5181 years ; all caucasian ) took part in this case series . at baseline , all study patients self - reported the overall appearance of rosacea to be either mild ( 1 of 10 , 10% ) or moderate ( 9 of 10 , 90% ) on the patga . redness and blotchiness were reported as mild for 5 ( 50% ) of the patients and moderate for the remaining 5 ( 50% ) patients ( fig . the physician assessed that all of the patients had either subtype 1 ( erythematotelangiectatic ) or subtype 2 ( papulopustular ) rosacea , or a combination of the two ( table 1 ) . the majority of patients ( 8 of 10 , 80% ) had moderate subtype 1 rosacea . other results from the phyga indicated that , for all patients , flushing was mild ( 4 of 10 , 40% ) or moderate ( 6 of 10 , 60% ) ; erythema was mild ( 2 of 10 , 20% ) or moderate ( 8 of 10 , 80% ) ; papules and pustules were absent ( 4 of 10 , 40% ) , mild ( 3 of 10 , 30% ) , or moderate ( 3 of 10 , 30% ) , and telangiectasia was moderate ( 9 of 10 , 90% ) or severe ( 1 of 10 , 10% ) . secondary features of rosacea were noted to be absent in these patients . at the end of the 30-day period , rosacea improvement was noted in 7 of the 10 ( 70% ) patients ; no improvement was observed in 2 ( 20% ) patients , and worsening occurred in 1 ( 10% ) patient ( fig . five ( 50% ) patients reported rosacea improvement , 4 ( 40% ) patients reported no improvement , and 1 ( 10% ) patient reported worsening of their skin ( fig . representative before and after photographs showing marked improvement in overall rosacea appearance for 2 patients following 30 days of anatabine cream use are shown in figure 3 . in the present open - label case series study , twice daily application of a topical facial cream containing the minor alkaloid anatabine was shown to improve the appearance of the skin in patients with mild to moderate rosacea . as rated by the physician , skin appearance improved in 70% of the patients , and 50% of the patients self - reported an improvement following 30 days of topical application . there were no complications or adverse events reported by any of the patients in the case series , indicating that the investigative product was safe and very well tolerated . anatabine has been shown in multiple in vitro and in vivo models of excessive inflammation to attenuate the production of proinflammatory mediators through a reduction in the activation of the transcription factors nf-b and stat3 [ 9 , 10 , 11 , 13 ] . research has shown that nf-b is involved in the upregulation of the antimicrobial peptides ( cathelicidins ) and other proinflammatory mediators believed to be involved in the progression and severity of rosacea [ 14 , 15 ] . . showed that the topical rosacea treatment azelaic acid inhibited ultraviolet light - induced activation and translocation of nf-b and reduced the production of proinflammatory cytokines in human keratinocytes . therefore , anatabine may provide anti - inflammatory benefits when applied topically by interfering with nf-b activation , or through inhibition of some other related proinflammatory signaling mechanism ( fig . an important consideration when evaluating a topically applied product containing a plant - based compound for a condition characterized by sensitive skin such as rosacea is its risk of inducing contact dermatitis [ 17 , 18 ] . anatabine is an alkaloid found in a wide range of solanaceae family plants , including many commonly consumed food staples such as tomatoes and potatoes , but to date , there have been no published reports of any hypersensitivity or allergic reactions directly attributed to the ingestion of or skin exposure to anatabine . results from this case series suggest that contact dermatitis was not an issue for the patients using the anatabine cream ; however , future studies of the cream in larger populations of patients should further evaluate this possibility . most patients in this case series had moderate erythematotelangiectatic rosacea , which is characterized by persistent flushing and redness , and may include stinging , burning , and swelling . these particular signs and symptoms of rosacea could be due to excessive , uncontrolled inflammation in the skin , and thus may respond particularly well to treatment with a topical anatabine preparation . it is uncertain if other subtypes of rosacea , particularly those involving papules and pustules and/or tissue / vascular damage , would respond as favorably . further studies focusing on the effects of an anatabine - based cream on other subtypes of rosacea would provide more insight into the actions of this compound . it must be noted that interpretation of the results of this case series is limited due to the small sample size and lack of a control group . the primary objectives of this case series were to determine if twice daily application of the anatabine cream was safe and if it would improve the appearance of the skin in a small sample of patients primarily suffering from persistent erythema due to rosacea . both objectives were met , although there was some disparity in the perceived effectiveness of the cream between the patients and the physician , as indicated by the patea and the phyea assessment scores . the physician rated a greater degree of improvement ( i.e. 1 or 2 points ) than the patient in 6 of 10 cases , whereas only 1 patient 's self - reported rating of improvement was greater than the physician 's rating . this difference in perceived outcome could be due to the fact that patients saw themselves every day and might not have noticed changes happening over time , whereas the physician saw them once at baseline , and then again after 30 days . other studies of rosacea treatments have resulted in a similar phenomenon in which investigator ratings of success or improvement were typically of a greater magnitude or frequency than study subjects ratings , although not necessarily statistically different [ 19 , 20 , 21 , 22 ] . a possible solution to reduce or eliminate this type of rating disparity between observer and self - reported measures would be the use of before and after photographs for comparison purposes for both physician and patient use . in conclusion , results from this open - label case series show that daily application of a topical facial cream containing the minor alkaloid anatabine is safe and well tolerated and can reduce the signs and symptoms of mild to moderate rosacea . improving the appearance of the skin by reducing persistent erythema , and possibly other signs and symptoms of rosacea , could lead to an overall increase in the quality of life for those dealing with this chronic disease . a larger , double - blind , vehicle - controlled trial of the anatabine facial cream in subjects with mild to moderate rosacea appears to be warranted . s.h.w . received no funding for this study from rcp , and has no conflicts of interest to declare .

backgroundcurrent medical and scientific research indicates that rosacea , a chronic and often debilitating skin condition that primarily affects the central face , may be caused by an overactive or excessive inflammatory immune response . regardless of etiology , the accompanying redness and inflammation is unsightly and difficult for the patient . anatabine is an alkaloid from the plant family solanaceae that has been shown in several preclinical studies to modulate proinflammatory signaling pathways.objectivea cream containing anatabine was developed and evaluated in an open - label case series study for safety and effects on the appearance of the skin in 10 patients with mild to moderate rosacea.methodspatients applied the cream to the face twice daily for a period of 30 days . patients and the study physician completed safety and efficacy assessments at study end.resultsresults showed that 50% of the patients self - reported improvement in the appearance of their skin , and the physician noted improvement in 70% of the patients . photographs taken before and after 30 days of cream use provide visual evidence of the improvement in several patients . there were no complications or adverse events reported by any of the patients in the study , indicating that the anatabine cream was safe and very well tolerated.conclusionthe results of this open - label case series show that a facial cream containing anatabine can improve the appearance of the skin in patients with mild to moderate rosacea and suggest that a double - blind , vehicle - controlled trial in a larger number of subjects is warranted .

physician counseling positively influences patients ability to change lifestyle behaviors including smoking , physical activity , and diet.13 several studies have observed that physicians who have healthy lifestyles or are attempting to improve their own personal wellness are more likely to provide advice to their patients on lifestyle modification.46 however , few physicians provide such counseling to their patients on a regular basis.711 lifestyle modification , with a healthy diet high in fruits and vegetables and regular physical activity is the cornerstone of cardiovascular disease prevention . studies such as the diabetes prevention program ( dpp ) and the dash study have observed significant reductions in risk for cardiovascular disease ( cvd ) risk factors including diabetes and hypertension.12,13 yet many americans do not meet recommended goals for physical activity . together with poor portion control and calorie - dense foods , this has created a situation in which obesity is now an epidemic in today s society . thus a better understanding of how to improve providers counseling frequency and effectiveness is warranted . understanding the barriers reported by healthcare professionals regarding their ability to maintain healthy lifestyles may have implications for their ability to advise patients regarding important lifestyle modification . we previously reported a significant association between provider exercise behaviors and counseling efforts related to physical activity.4 in this current study we examined barriers to healthy behaviors among resident and staff physicians at a tertiary medical center . we hypothesized that physicians level of training , and gender would influence the type of barriers reported . physicians affiliated with the university of michigan health system were eligible to complete an online survey which was sent via email . physicians who were listed as internists , family practitioners , endocrinologists , and cardiologists were the primary recipients for the survey , as they are most likely to care for patients at risk for coronary heart disease ( chd ) or with risk factors for chd . physicians who did not regularly provide prevention care ( ie , radiologists or pathologists ) , surgeons , and those who were at the medical center for less than 3 months were excluded . an estimated 500 physicians were currently practicing within the departments of internal medicine and family medicine at the time of the survey administration . physicians considered trainees ( residents and fellows ) included residents from internal medicine ( or the medicine this study was approved by the institutional review board at the university of michigan health system . providers were asked to identify their practice type ( internal medicine , cardiology , endocrinology , family medicine , or other ) , training level ( resident or fellow ) or postgraduate year , and practice type ( hospital based vs private practice ) . questions related to exercise included number of days per week in which exercise was performed and estimated number of minutes per week of aerobic exercise , in addition to the type of exercise performed . dietary questions included the number of fast food meals consumed per week , average number of servings of fruit and vegetables consumed per day and barriers to consuming a healthy diet . in addition , respondents were asked to report the barriers which prevented them from exercising regularly , or consuming a healthy diet . - square tests were used to compare differences in baseline physical and clinical characteristics between trainees and staff physicians . analysis of variance was used to evaluate the differences between trainees and staff physicians in personal lifestyle behaviors such as number of fast food meals consumed per week and number of servings of fruit and vegetables consumed per day , and reported lifestyle barriers . logistic regression models were used to investigate relationships between physician training , lifestyle , and barriers to healthy behaviors . all analyses were performed using sas ( v 9.1 ; sas institute inc , cary , nc ) . a total of 183 physicians completed the survey , of whom 102 ( 56% ) were in training ( residents and fellows ) and 81 ( 44% ) were staff physicians ( table 1 ) . staff physicians more likely than trainees to have had their blood pressure and/or lipids checked within the previous year . the mean body mass index ( bmi ) was 23.3 kg / m for trainees and 24.7 kg / m for staff physicians . 20.6% of trainees and 27.2% of staff physicians were overweight , defined as a bmi between 25 kg / m and 29 kg / m . differences between trainees and staff physicians included factors related to both diet and physical activity ( table 2 ) . trainees reported an average of 1.2 fast food meals per week , while staff physicians reported less than one fast food meal per week ( p = 0.04 ) . the average number of fruit servings per day was 1.7 for trainees and 2.2 for staff physicians ( p = 0.005 ) . the average number of vegetable servings was 2.1 for trainees and 2.6 for staff physicians ( p = 0.002 ) . although neither group would be considered to have good compliance with current guidelines , staff physicians were more likely to meet current recommendations for physical activity per week as compared to trainees . only 7.8% of trainees and 25.9% of staff physicians completed > 150 minutes of aerobic exercise per week ( p < 0.001 ) . self - reported barriers to healthy lifestyle behaviors also differed among trainees and staff physicians ( table 3 ) . trainees were more likely to report barriers to a healthy diet as time or cost related . almost 50% of trainees reported time spent shopping as a barrier to healthy diet , and 87.3% reported the time to prepare healthy foods as a barrier to a healthy diet . over 20% of trainees reported cost of healthy foods as a barrier to a healthy diet . in contrast , staff physicians reported the time to prepare foods ( 59.3% ) and food preferences ( 39.5% ) as top barriers to a healthy diet . however among trainees , work schedule was the leading barrier to exercise . for staff physicians , work schedule was reported as the top barrier , though not to the same frequency as in the trainees . in assessing what factors would help to improve their lifestyle behaviors , trainees were more likely to respond that healthy options in vending machines and the cafeteria would be helpful ( table 4 ) . staff physicians also suggested healthy beverages at work , and lunchtime walking or exercise programs . we also examined these data for differences in lifestyle behaviors and barriers to healthy behaviors by gender . women had lower blood pressures and were less likely to be overweight or obese than men . however , women reported family commitments as a barrier to exercise more often compared to men ( p = 0.005 ) . in terms of diet , men reported the cost of food as a barrier more often than women ( 28.2% vs 8.6% , p = 0.001 ) . factors related to improvements in lifestyle were similar between men and women , with the exception that women were more likely to report lunchtime walking or exercise programs as helpful compared to men ( 41.9% vs 23.1% , p = 0.008 ) . women also tended to report having a dietitian available for consultation as helpful more than men ( 12.4% vs 3.8% , p = 0.06 ) . using survey data from a major teaching hospital , we observed few physicians met current recommendations for physical activity , and a healthy diet high in fruits and vegetables . self - reported barriers to healthy lifestyle behaviors differed between the trainees and staff physicians . trainees were more likely to report time as a major barrier to exercise , while family commitments were cited as a barrier more often for staff physicians . male physicians reported cost of food and not wanting to exercise at lunch as barriers to healthy behaviors , while women reported family commitments as a barrier . while the annual death rate due to coronary heart disease has declined over the past two decades , heart disease remains the leading cause of death for us adults.14 with increases in the prevalence of obesity , the likelihood that the decline in chd mortality will continue is in doubt.15 physicians personal habits regarding their medical care and lifestyle behaviors correlate with their attitudes towards preventive care . previous studies have shown that providers personal health habits correlate to their recommendations counseling to patients.4,6,16,17 this includes exercise and counseling on physical activity as well as other behaviors related to diet and alcohol use . the women physicians health study ( wphs ) , which surveyed over 4500 women physicians , nationally , demonstrated that exercise habits were positively associated with frequency of counseling patients about the benefits of exercise.6 confidence in providers ability to effectively counsel providers smoking habits have also been shown to impact their frequency of counseling patients to stop.18 other factors related to personal health can be influenced by provider behaviors including compliance with screening recommendations . in one study of women physicians , those who regularly obtained mammograms themselves were more likely to order such screening tests for their patients.19 similar associations have been observed for medical students as well.20 in a study of us medical students provided with a personal health promotion intervention , students reported improved health behaviors such as healthy dietary and exercise patterns with reductions in smoking , as compared to a control group.2 health - related counseling practices were positively correlated with the intervention . the relationship between provider behaviors and their counseling practices suggests that understanding the barriers to health among medical workers may have significant consequences for patients . to date , few studies have examined interventions to improve health of providers and how such interventions impact patient care . previous studies have suggested a benefit to interventions such as this . in one study , the investigators found students who completed the intervention reported increased scores for empathy for their patients compared to the control group.21 a different study found physicians enhanced their ability to motivate patients with their own personal health habits such as exercise.5 personal barriers ( including methods to overcome such barriers ) may also enhance patient s motivation . these data represent a sample of providers from one tertiary hospital system , and as such may not be generalizable to a larger population of physicians or to other health care providers . due to the voluntary nature of our survey , the statistical power of our results was limited by the relatively small sample size , which prevented us from examining specific subgroups such as specialists . lastly the information presented in this study was entirely through provider self - report ; thus recall biases may have been present . these data suggest significant barriers to healthy lifestyles are experienced by providers and that such barriers differ by level of training and gender . given the potential for improving patient - related lifestyle counseling by improving provider health , further research and efforts in this area are warranted .

objectivephysicians personal health habits are associated with their counseling habits regarding physical activity . we sought to examine physicians own barriers to a healthy lifestyle by level of training and gender.methodsphysicians at a major teaching hospital were surveyed regarding their lifestyle habits and barriers to healthy habits . the frequency of reported barriers was examined by years in practice ( trainees vs staff physicians ) and gender.results183 total responses were received . over 20% of respondents were overweight . work schedule was cited as the greatest barrier to regular exercise in 70.5% of respondents . trainees were more likely to cite time constraints or cost as a barrier to a healthy diet compared to staff physicians . staff physicians were more likely to report the time to prepare healthy foods as a barrier . for both trainees and staff physicians , time was a barrier to regular exercise . for trainees work schedule was a barrier , while both work schedule and family commitments were top barriers cited by staff physicians . women were more likely to report family commitments as a barrier than men . respondents suggested healthier options in vending machines and the hospital cafeteria , healthy recipes , and time and/or facilities for exercise at work as options to help overcome these barriers.conclusionwork schedules and family commitments are frequently reported by providers as barriers to healthy lifestyle . efforts to reduce such barriers may lead to improved health habits among providers .

pheochromocytoma ( pcc ) is a rare catecholamine - producing neuroendocrine tumor originating from the chromaffin cells of the adrenal medulla . even if a pcc is initially diagnosed as benign on the basis of histopathological findings , it is possible for metastasis to occur in other organs after resection . the standard treatments for malignant pcc include surgical resection , radiotherapy , local ablation , chemotherapy , radionuclide therapy ( e.g. , metaiodobenzylguanidine [ mibg ] ) and molecular targeted therapy . although surgical resection constitutes the best treatment option , inoperable cases are much more common than operable cases . however , there is currently no consensus on the optimal treatment strategy for inoperable metastatic pcc . accordingly , some patients are overtreated , while others are undertreated . despite the liver being the second most frequent site of distant metastasis , reported cases of liver metastasis in pcc are relatively rare . additional case reviews and long - term studies are necessary to reach a consensus on the most appropriate treatment strategy for these lesions . herein , we report a case of inoperable liver metastasis in pcc for which transcatheter arterial chemoembolization ( tace ) was performed rather than other treatment modalities such as chemotherapy or radionuclide therapy . a 69-year - old man was admitted to the department of gastroenterology for evaluation of an incidental hepatic mass in august 2013 . in 2005 , he had been admitted to the department of endocrinology because of cold sweating , facial flushing , and uncontrolled blood pressure . a ~7 cm right adrenal mass had been observed on computed tomography ( ct ) and there had been no distant metastasis on an mibg scan . , he had been followed up in the outpatient clinic until 2007 . during that period the patient had also been treated for hypertension and type 2 diabetes mellitus for 3 years and had a history of coronary stent insertion for non - st - elevation myocardial infarction in march 2012 . at admission to the department of gastroenterology , he experienced dizziness , diaphoresis , general weakness , and poor oral intake ; his blood pressure was 130/80 mm hg and his heart rate was 78 bpm . they revealed a ~10 cm hepatic mass in the right lobe of the liver that had a high signal intensity on t2-weighted images and early arterial enhancement and delayed washout on dynamic contrast - enhanced images . also , it had a low signal intensity on the hepatobiliary phase and high cellularity on the diffusion phase ( fig . the hepatic mass was considered to be hepatocellular carcinoma rather than malignant pcc . for these reasons , the patient was given the -adrenergic antagonist phenoxybenzamine to prevent a hypertensive crisis before biopsy because we could not completely rule out the possibility of metastatic pcc . pcc was finally confirmed on the basis of morphological and immunohistochemical findings , with the specimens staining positive for chromogranin a and synaptophysin . laboratory tests revealed the following serum metabolite levels on the day of admission : aspartate aminotransferase , 29 iu / l ( normal , 10 to 40 ) ; alanine aminotransferase , 24 iu / l ( normal , 6 to 40 ) ; alkaline phosphatase , 97 iu / l ( normal , 40 to 129 ) ; total bilirubin , 0.42 mg / dl ( normal , 0.1 to 1.2 ) ; direct bilirubin , 0.16 mg / dl ( normal , 0.09 to 0.30 ) ; and -glutamyltranspeptidase ( ggt ) , 150 iu / l ( normal , 11 to 73 ) . these levels , obtained by performing a liver function test , were all in the normal ranges , except for the mild elevation of ggt . hepatitis virus markers were negative and tumor markers for hepatocellular carcinoma ( -fetoprotein and protein induced by vitamin k absence or antagonist ii ) were in the normal ranges . furthermore , at admission we measured the patient 's serum / urine levels of catecholamines , which were as follows : serum epinephrine , 0.078 pg / ml ( normal , < 50 ) ; serum norepinephrine , 1.473 pg / ml ( normal , 110 to 410 ) ; serum metanephrine , 2.47 nmol / l ( normal , < 0.5 ) ; serum normetanephrine , 44.97 nmol / l ( normal , < 0.5 ) ; 24-hour urine epinephrine , 43.8 g ( normal , 0 to 20 g / day ) ; 24-hour urine norepinephrine , 339 g ( normal , 12.1 to 85.5 g / day ) ; 24-hour urine metanephrine , 35.931 mg ( normal , 0.0 to 1.3 mg / day ) ; and 24-hour urine vanillylmandelic acid , 120 mg ( normal , 1.20 to 6.52 mg / day ) . the total urine volume collected in one day was 1,900 ml , and contained 1,171.16 mg of creatinine . an i - mibg scan revealed increased uptake of i - mibg in the right adrenal gland bed and adjacent liver parenchyma ( fig . surgical resection was impossible because the tumor had invaded the portal vein and the adjacent lymph nodes . however , the isolated ward needed for that was not available for at least 6 weeks . finally , tace was performed for the liver metastasis . an emulsion of 10 ml of lipiodol and 50 mg of doxorubicin ( an anticancer drug ) was injected ( fig . the tumor was well lipiodolized , as observed by post - tace imaging ( fig . after tace , he was transferred to the intensive care unit for 6 days for management of a hypertensive crisis and postembolization syndrome . his high blood pressure and tachycardia were strictly controlled by infusion of nitroprusside , nifedipine , and labetalol ( fig . although the size of the metastatic hepatic mass had not decreased , it showed lipiodol uptake ( fig . 3c ) . however , follow - up abdominal ct 7 months after tace showed that the diameter of the hepatic mass had decreased from 10 to 8.3 cm ( fig . although the response was that of stable disease on the basis of modified recist criteria , the tumor seemed to have responded to tace because of its decreased size . the serum catecholamine levels were followed up 2 months after tace and were as follows : serum epinephrine , 0.091 pg / ml ; serum norepinephrine , 0.842 pg / ml ; serum metanephrine , 4.26 nmol / l ; and serum normetanephrine , 22.27 nmol / l . pccs and paragangliomas ( pgls ) are catecholamine - producing tumors derived from the sympathetic or parasympathetic nervous system . they are the cause of hypertension in 0.2% to 0.6% of patients and are present in 4% of adrenal incidentalomas . while most pccs / pgls are benign , 10% to 15% of pccs and 20% to 50% of pgls are reportedly malignant . moreover , these tumors are likely to be underdiagnosed . according to the mayo clinic autopsy study , conducted over a 50-year period , only 13 ( 24% ) of 54 it was also noted that 54% of the remaining 41 individuals reportedly experienced hypertension in their lifetime . the signs and symptoms of pccs include sympathetic nervous system hyperactivity , including elevated heart rate , elevated blood pressure , palpitations , diaphoresis , and anxiety . the prognosis in malignant pcc is poor and is related to the metastatic site and the relative levels of circulating catecholamines . the pcc of the adrenal gland scaled score ( pass score ) is usually used to estimate the prognosis in pcc . several treatments for malignant pccs have been reported , including surgical resection , chemotherapy , radiotherapy , i - mibg therapy , tace , and molecular targeted therapy . some studies report that surgical resection , if possible , is the most effective treatment , while other studies recommend that chemotherapy be used as the first - line therapy for rapidly progressive metastatic pcc . on the other hand , if progression is slower , i - mibg therapy is preferred for patients with positive results on an mibg scan . while mibg therapy and chemotherapy are reported relatively frequently , reports of tace for liver metastasis in pcc are rare . herein , we reported a case of inoperable hepatic metastasis in pcc for which tace was performed . although the follow - up after tace was short , it is clear that tace was effective in our patient in terms of the improvement of symptoms and decreased levels of catecholamines . therefore , we suggest that tace may constitute a useful treatment option for hepatic metastases in pcc , especially for inoperable tumors . imaging modalities such as ct , mri , and positron emission tomography are limited in terms of distinguishing metastatic lesions from the primary malignancy , and liver biopsy should not be performed when metastatic pcc is suspected . appropriate laboratory measurements and an mibg scan should be performed for correct diagnosis of pcc . similar to other treatments , such as surgical resection and chemotherapy , tace may result in excretion of large amounts of catecholamines into the systemic circulation . in the present case , third , routine follow - up , including both endocrinologic and imaging examinations , is necessary . in the present case , the patient was diagnosed with hepatic metastasis of pcc 8 years after adrenalectomy . similarly , morikawa et al . reported a 30-year - old woman who developed a de novo hepatic tumor 10 years after resection for pcc of the left adrenal gland . she had been followed up annually by ultrasonography and examination of her plasma catecholamine levels , and she had no symptoms or endocrinologic abnormalities . however , a hepatic mass was detected through routine abdominal ultrasonography , indicating that follow - up by endocrinologic examination alone is insufficient to detect newly developed lesions . therefore , the use of routine diagnostic imaging , as well as measuring catecholamine levels , is important during the follow - up period . about 25% to 30% of patients with a malignant pcc / pgl have an inherited syndrome . genetic mutations associated with pccs and pgls include mutations in the rearrangement during transfection ( ret ) , von hippel - lindau ( vhl ) , neurofibromatosis type 1 ( nf1 ) , succinate dehydrogenase ( sdh ) , transmembrane protein 127 ( tmen127 ) , myc - associated factor x ( max ) , and hypoxia - inducible factor 2 ( epas / hif2a ) genes . the correlation between genetic mutations and biochemical phenotype in pccs / pgls may provide an opportunity for earlier identification of malignant potential and novel targeted therapy . because of the relatively high prevalence of familial syndromes among patients who present with pccs or pgls , it is useful to identify germline mutations in patients without a known family history . unfortunately , we did not test for germline mutations in the present case . in conclusion , this case report shows that tace might be a useful treatment option for inoperable hepatic metastases in pcc . however , further evidence supporting the use of tace is lacking . therefore , additional case reports and long - term studies are necessary to reach a consensus on the optimal therapeutic strategy for malignant pcc .

malignant pheochromocytoma ( pcc ) is a rare condition . although the liver is the second most frequent site of metastasis in malignant pcc , no definite treatments have been established . herein , we report a case of liver metastasis of pcc that was successfully treated by transcatheter arterial chemoembolization ( tace ) . a 69-year - old man was admitted to the department of gastroenterology for evaluation of an incidental hepatic mass in august 2013 . he had undergone right adrenalectomy in may 2005 and pcc had been confirmed on the basis of histopathological findings . liver biopsy was performed , and metastatic pcc was diagnosed . the lesion appeared inoperable because of invasion of the portal vein and metastases in the lymph nodes along the hepatoduodenal ligament . thus , tace was performed instead . after tace , symptoms including dizziness and cold sweating improved , and the patient 's serum catecholamine levels decreased . on the basis of this case , we believe that tace may be a useful treatment for liver metastasis in malignant pcc .

nanoscale materials and devices are a rapid growing field of research with large impact for knowledge , technology , and economy , and for environment as well . the performance of most of the optoelectronic and photonic devices , e.g. , nanocrystalline photovoltaic cells , photo - electrochromic devices , oled , pled and others , may be improved by incorporating nanotechnology during the materials synthesis and device fabrication . promising alternatives for solar energy utilization are thin film technologies involving various new materials , which are currently attracting considerable attention . of all the thin film photovoltaic materials , the ternary semiconducting materials such as cuinse2 , cuins2 , and cugase2[cis and cgs ] , and their multinary alloy cu(in , ga)x(s , se)y [ cigs ] have been recognized to be the most promising materials designed for high - efficiency photovoltaic devices due to their high absorption coefficient , radiation stability , and low gap of these materials . the highest energy conversion efficiency of these materials - based solar cells has reached up to 19.5% ( 692 mv , 35.2 ma / cm , ff 79.9% ) at nrel . very recently new cuinxb1xse2[cibs ] thin film materials have been fabricated that have the potential to overcome the bandgap limitations and exceed the energy conversion efficiency of the cuinxga1xse2 class of materials . the main problems preparing these materials are , however , that almost all the preparation technologies for these alloy materials involve high temperature and high cost . it would thus be very desirable if one could use a reliable , simple , and low - temperature synthetic method to prepare soluble cis and/or cigs functional materials . the first structurally characterized molecular precursor compounds ( ph3p)2cuin(qr)4 ( q = s , se ; r = ethyl , isobutyl ) was synthesized by hirpo and his coworkers . these materials have higher solubility in common organic solvents , which makes them good candidates for solution spray pyrolysis for thin film deposition at relatively low temperature . in the single crystal structure of ( ph3p)2cuin(qr)4 , which feature tetrahedrally coordinated indium and copper atoms bridged by thio(seleno)lates forming a planar core , the terminal ligands are two phosphines on the cu and two thiolates or selenolates on the in . five years later , czekeliu et al . developed a simple low cost colloidal route to nanocrystalline zno / cuins2 bilayers on indium tin oxide ( ito ) glass . the triphenyl phosphite ( ( pho)3p ) coordinated cuins2 ( cis ) complex was prepared in a three - step synthesis in acetonitrile solution . the resulting deep red solutions were stable against aggregation and oxidation , which allowed further handing in air . following czekeliu s research work , arici and his co - workers incorporated ( pho)3p - stabilized nanoparticles of cuins2 into polymer matrices to fabricate cuins2-based hybrid solar cells , which show better photovoltaic response with external quantum efficiencies up to 20% . in this contribution , we use one - pot synthetic method to prepare soluble triphenyl phosphine ( tpp)-coordinated cigs ( tpp - cigs ) nanorods ( see eq . organic solvents were purified , dried , and distilled under dry nitrogen . the operations for synthesis prior to the termination reaction were carried out under purified argon . the uv / vis spectral measurements were carried out with a jasco model v570 ds spectrophotometer . the sample for the fluorescence measurement was dissolved in the dry toluene , filtered , transferred to a long quartz cell , and then capped and bubbled with high pure argon ( without o2and moisture ) for at least 15 min before measurement . maldi - tof - ms measurements were performed on a bruker reflex iii - s ( preparation method of sample : the samples were dissolved in dry thf , then mixed 1:1 ( 0.8 l each ) with a methanol solution of -cyano-4-hydroxycinnamic acid as matrix ) ; elemental analyses : carlo - erba elemental analyser 1104 , 1106 . transmission electron microscopy ( tem ) image was recorded on a hitachi h-800 tem system operated at 100 kv . the differential scanning calorimetry ( dsc ) curve was obtained on the perkin - elmer dsc-7 instrument . the redox values were measured using the differential pulse voltammetry ( dpv ) technique by applying bas cv-50w voltammetric analyzer ( japan ) . a platinum disk electrode was used as working electrode , while a platinum wire served as a counter electrode . all measurements were carried out in different solvents containing 0.1 m tetra - butylammonium perchlorate [ ( n - bu)4nclo4 ] as a supporting electrolyte . the scan rate used is 0.1 v s. in a typical synthesis , to the stirred solution of cui ( 1.0 mmol ) , incl3(1.0 mmol ) , gacl3(1.0 mmol ) and ph3p ( 3.0 mmol ) in anhydrousn , n - dimethylacetamide ( dma , 100 ml ) was added dropwise an excess of hexamethyldisilathiane ( 10.8 mmol ) in dma over 2 h at 170 c under argon . the reaction mixture was then heated under reflux for 20 h. the resulting solution was filtered to remove the insoluble materials ; the filtration was evaporated to dryness under high vacuum to give brown - black solid . organic solvents were purified , dried , and distilled under dry nitrogen . the operations for synthesis prior to the termination reaction were carried out under purified argon . the uv / vis spectral measurements were carried out with a jasco model v570 ds spectrophotometer . the sample for the fluorescence measurement was dissolved in the dry toluene , filtered , transferred to a long quartz cell , and then capped and bubbled with high pure argon ( without o2and moisture ) for at least 15 min before measurement . maldi - tof - ms measurements were performed on a bruker reflex iii - s ( preparation method of sample : the samples were dissolved in dry thf , then mixed 1:1 ( 0.8 l each ) with a methanol solution of -cyano-4-hydroxycinnamic acid as matrix ) ; elemental analyses : carlo - erba elemental analyser 1104 , 1106 . transmission electron microscopy ( tem ) image was recorded on a hitachi h-800 tem system operated at 100 kv . the differential scanning calorimetry ( dsc ) curve was obtained on the perkin - elmer dsc-7 instrument . the redox values were measured using the differential pulse voltammetry ( dpv ) technique by applying bas cv-50w voltammetric analyzer ( japan ) . a platinum disk electrode was used as working electrode , while a platinum wire served as a counter electrode . all measurements were carried out in different solvents containing 0.1 m tetra - butylammonium perchlorate [ ( n - bu)4nclo4 ] as a supporting electrolyte . in a typical synthesis , to the stirred solution of cui ( 1.0 mmol ) , incl3(1.0 mmol ) , gacl3(1.0 mmol ) and ph3p ( 3.0 mmol ) in anhydrousn , n - dimethylacetamide ( dma , 100 ml ) was added dropwise an excess of hexamethyldisilathiane ( 10.8 mmol ) in dma over 2 h at 170 c under argon . the reaction mixture was then heated under reflux for 20 h. the resulting solution was filtered to remove the insoluble materials ; the filtration was evaporated to dryness under high vacuum to give brown - black solid . the maldi - tof - mass spectrum of the resulting complex shows a number of peaks atm / z = 1274 , 1256 , 1258 , 1242 , 1230 , and so on . the peak atm / z = 1274 can be logically assigned to { [ cu2in2ga2s7(ph3p)2 ] + li + na}. it can be commonly observed that [ m(n = 1 , 2 , 3 ... ) + na ] adduct peak appears in fd , fab , and maldi - ms spectra . most importantly , the appearance of [ m + na ] adduct peak in ms mainly depends on the intrinsic nature of parent compound , e.g. , affinity for impurity sodium cations . if the parent compound structure has a very high affinity for na , it will result in the production of abundant [ m + na ] ions even when sodium cations are only present as impurities . this compound is soluble in some common organic solvents such as acetone , chloroform and others , and stable in the solid state at room temperature . figure 1 compares the influence of the long - term uv irradiation on the uv / vis absorption spectrum of tpp - cigs in chloroform . when the solution of tpp - cigs complex in chloroform is exposed to the uv light for several days , the absorption intensity decreased gradually with increased exposure to the ultraviolet light , but the band position is almost unchanged . this result is associated with the partial removal of the organic ligands tpp under the uv illumination . furthermore , the absorption band at 264 nm of pure tpp in chcl3 was not detected in the uv / vis absorption spectrum of the tpp - cigs complex in which its main absorption bands are located at 320 and 400 nm in the same solvent . upon the excitation with a laser of 350 nm , its fluorescence spectrum exhibits a strong emission band at 441 nm , while the pure tpp displays an emission band at 315 nm at the same conditions . smirnov et al . systematically studied the spectral - luminescent properties and the nature of electron states of ph3 m ( m = n , p , as , sb , and bi ) . the fluorescence spectrum of the products of photo - dissociation shows a weak broader emission band centered at 400 nm . in our work steady - state absorption spectra of tpp - cigs ( 0.2 mm ) in chloroform before ( solid line ) and after ( dashed line ) long - term uv irradiation . 2 , dsc thermogram of the tpp - cigs complex shows two endothermic peaks : one is located at 65.45 c and another at 214.14 c . upon heating at 100 c for several minutes , the solid crystalline phase of this complex is transformed into a viscous birefringent liquid . basically , the homo / lumo values of materials can be experimentally estimated by the onset of the redox potentials taking the known reference level for ferrocene , 4.8 ev below the vacuum level , according to the following equation : homo / lumo = eonset eox.(ferrocene ) 4.8 ev . in our electrochemical experiments , ferrocene exhibits an oxidation peak with an onset of 103 mv vs. ag / agcl . from the onset values of the oxidation potential ( eox ) and reduction potential ( ered ) of tpp - cigs complex , which are 564 mv and 682 mv , respectively , the homo / lumo values are calculated as 5.26 ev and 4.02 ev , respectively . 3 , the polarized optical image of tpp - cigs complex , which was taken at room temperature , shows a typical image of a feather - shaped texture . transmission electron microscope ( tem ) image of this complex looks like a comb in which the rods pack parallel to each other and stack together . the electron diffraction pattern displayed in fig . 3c exhibits a pattern composed of hexagonal - lattices , this suggesting the highly ordered structure of tpp - cigs complex , which is favorable for the hole and/or electron transportation in the photovoltaic cells . ( a ) polarized optical light microscopy photograph , ( b ) tem image , and ( c ) electron diffraction pattern of tpp - cigs thin film in summary , we have synthesized a soluble triphenylphosphine - coordinated cigs complex with highly ordered structure by one - pot synthetic method . this complex is stable in the solid state under the irradiation of the ambient light , but its solution becomes a little bit unstable under the illumination of the low intensity laser . the homo - lumo gap of this complex is about 1.24 ev . the further studies on the photovoltaic properties of this complex and the influence of the different organic ligands on the materials structure and performance are currently in progress . the online version of this article ( doi:10.1007/s11671 - 007 - 9108-y ) contains supplementary material , which is available to authorized users . we are grateful for the financial support of national natural science foundation of china ( 20676034 ) , ecust ( yj0142124 ) , new century excellent talents in university ( ncet-050413 ) , shanghai municipal educational commission ( smec-05sg35 ) and science and technology commission of shanghai municipality ( stcsm-05xd14004 ) , respectively .

promising alternatives for solar energy utilization are thin film technologies involving various new materials . this contribution describes an easy and inexpensive synthetic method that can be used to prepare soluble nanoscale triphenyl phosphine - coordinated cigs ( tpp - cigs ) photoactive functional materials . this complex is stable in the solid state under the irradiation of the ambient light , but its solution becomes a little bit unstable under the illumination of the low intensity laser .

pyogenic granuloma ( pg ) is a common reactive inflammatory and pseudotumoral neoangiogenic process [ 1 , 2 , 3 ] . pg may present as a single or multiple lesion(s ) and sometimes develops as a giant tumor . pg usually follows minor trauma , sometimes related with chronic irritation [ 1 , 2 ] . it may also be drug - induced or is observed during pregnancy . to this day , infectious triggers of pg are not reported . as far as we know , this case report is the first to suggest a partial link between chronic herpes simplex virus type - i ( hsv - i ) infection and cutaneous pg . a 52-year - old woman was diagnosed with hairy - cell leukemia in 1999 and treated with cladribine [ 2-chlorodeoxyadenosine ( 2cda ) ] , which led to complete remission . two recurrences occurred in 2005 , both successfully treated with 2cda and lenograstim , a recombinant granulocyte colony - stimulating factor . in 2006 , another recurrence was treated with lenograstim without obtaining complete remission . in 2007 , due to persisting grade-2 pancytopenia and medullar infiltration , interferon alpha-2a was initiated . in 2008 , remission was obtained with the chimeric anti - cd20 monoclonal antibody rituximab ( 8 cures ) , but leuconeutropenia persisted . since june 2011 , no further treatments have been administered , although the patient still presents moderate leuconeutropenia ( without any infectious complications , however ) . three months previously , a slow - growing vascular lesion appeared on the lower lip following an episode of labial herpes . clinical examination revealed a large , unilateral , annular , ulcerated , painful , indurated and easily bleeding lesion on her left cheek ( fig . the treatment consisted of aldactazine once daily , elthyrone 100 gamma / day , lutenyl once daily and bisoprolol 2 2.5 mg . the laboratory counts were as follows : red blood cells 3.26 10/mm ( 3.904.90 ) ; platelets 146,000/mm ( 150,000353,000 ) ; white blood cells 2.33 10/mm ( 4.6010 ) ; neutrophils 31.1% ( 42.271.0 ) ; lymphocytes 67.2% ( 17.543.5 ) ; sedimentation rate 57 mm / h ( < 21 ) ; c - reactive protein 21.6 mg / the t - cell population did not reveal any aberrant phenotype , and the cd4/cd8 ratio was 0.91 . immunophenotyping revealed the virtual absence of b cells , and the tricholeucocyte phenotype cd103 percentage was 0.2% . various treatments , including topical antifungals , antibiotics , antiseptics and corticosteroids , were unsuccessful . histology confirmed pg , revealing a vascular neoplasm characterized by small vessel ectasia with thin walls , normal endothelial cells and a dense lymphocytic and neutrophilic inflammatory infiltrate . these epithelial cells sometimes showed signs of cytopathic effects ( cpe ) , including intranuclear inclusions and giant syncytial cell formation , suggesting an alpha - herpesviridae infection ( fig . immunohistochemistry ( ihc ) was performed according to an earlier published protocol with the antibody panel shown in table 1 . a strong nuclear and cytoplasmic signal for hsv - i was evidenced in some epithelial cells ( fig . 2d ) , whereas the hsv - ii and varicella zoster virus stainings remained negative . some of the hsv - i - positive cells presented cpe , whereas others did not ( fig . no immunohistochemical signal for hsv - i was evidenced in the endothelial cells or vessel walls of the pg . ihc using the ulex europaeus lectin revealed a strong signal on the cell membranes of the hsv - i - infected epithelial cells as well as on the endothelial cells of the pg ( fig . 3a , red signal ) . mac 387 immunostaining was positive for hsv - i - infected epithelial cell membranes . the vascular endothelial growth factor ( vegf ) immunostaining provided a positive signal in the hsv - infected keratinocytes as well as in endothelial cells ( fig . 3b , red signal ) . the epidermal growth factor receptor ( egfr ) immunostaining revealed intense membranous expression on hsv - i - infected epithelial cells ( fig . the ki67 marker revealed a strong signal in the nuclei of some epithelial and endothelial cells ( fig . ihc with antibodies against cd45 evidencing the leucocyte common antigen and cd3 t - cells provided an intense staining of the inflammatory infiltrate of the pg , but no signal surrounding the hsv-1-infected epithelial cells was observed . in contrast , ihc with cd45r0 demonstrating activated t cells revealed a very dense infiltrate among the epithelial cells . the markers cd68 and mac 387 were positive in the inflammatory infiltrate surrounding the epithelial cells and the pg . using the identical antibody panel for a post - traumatic labial pg of a patient without recurrent herpes labialis , the staining patterns were similar , except for the absence of signals for hsv - i , egfr and cd45r0 . following the discovery of the hsv - i antigens in the pg , oral treatment with valaciclovir ( 1,000 mg , thrice daily for 15 days ) was initiated , and the lesion promptly resolved after 15 days ( fig . pg consists of a pseudotumoral neoangiogenic process and is often linked to pregnancy , various drugs ( cyclosporine , lamivudine , indinavir , isotretinoin , docetaxel and the egfr inhibitors ) , traumatism , preexisting vascular lesions , food impaction or total periodontosis [ 1 , 2 , 3 ] . flt4 , a tyrosine kinase receptor associated with pathological angiogenesis , is also specifically related to pg . the rapid vascular growth during pg is related to angiogenesis enhancers such as vegf and fibroblast growth factor , and angiogenesis inhibitors including thrombospondin-1 and angiostatin . in addition , the vessel morphogenic factors tie-2 ( tyrosine kinase with immunoglobulin - like and egf - like domains 1 ) , angiopoietin-1/2 , ephrin b2 and b4 are upregulated in pg lesions . there are no previous reports on hsv - i infections related to pg in the literature . however , other members of the human herpesviridae group , the epstein - barr virus and the kaposi 's sarcoma - associated herpesvirus ( hhv-8 ) , are also capable of inducing neoangiogenesis and neolymphangiogenesis by directly stimulating various signalling pathways via the vegf protein family and their receptors . in the eye , hsv - i may cause a chronic immunoinflammatory process with secondary corneal neoangiogenesis called stromal keratitis , potentially leading to blindness . in addition , herpetic stromal keratitis may even progress without the actual presence of replicating hsv - i . in fact , hsv - i dna persistence in tissue and hsv - igg complexes may upregulate vegf and mmp-9 production as both intervene in the neoangiogenic process . in parallelism , a similar pathogenic role of hsv - i in the development of pg the nuclear and cytoplasmic hsv - i staining patterns in non - cpe - presenting epithelial cells are in line with a chronic , low - productive type of hsv infection , as observed in other chronic hsv infections . the strong expressions of egfr and ki67 in the epithelial cells suggest that these cells are still replicating . the rapid response to antiviral treatment , the 3-month evolution and the failure of previous non - antiviral treatments favor the hypothesis of a chronic but active hsv replication rather than the presence of persistent viral dna or igg complexes in the pg . in fact , the prior corticosteroid - based anti - inflammatory therapy was not successful , although it is known to be efficacious for treating granulomatous reactions linked with persistent herpetic glycoproteins . the fact that no hsv - i antigens were detected in the pg endothelial cells but only in the epithelial cell aggregates favors an indirect stimulation of neoangiogenesis by hsv-1 infection . vegf , a potent pro - angiogenic factor , is sourced by histiocytes but is also expressed at stand - by levels in epidermal keratinocytes . hence , the presence of vegf in hsv - i - infected keratinocytes may play a stimulating role of the pg angiogenesis . yet , vegf is also produced by histiocytes , but the rapid regression after antiviral therapy suggests that the hsv - i - infected keratinocytes are a predominant source of vegf . this case shows some parallelism with anogenital herpes vegetans , a chronic condition due to hsv - ii that is usually associated with hiv infection and occasionally with other immunodeficiencies . some anogenital hsv lesions may present as pg - like lesions [ 1 , 13 ] . in contrast , atypical hsv - i oro - lingual - facial lesions are far more exceptional and always associated with immunosuppression . although tk - dependent antiviral resistance is a common event in chronic anogenital hsv infection , this patient responded well to oral valaciclovir . tk - dependent antiviral resistance does not seem common in oro - facial chronic hsv - i infections . this report possibly illustrated a new face of hsv infection besides the common cytopathic infection as well as other , more unusual hsv - related cutaneous patterns , including verrucous , granulomatous , lichenoid and follicular reactions ( table 2 ) . the presence of hsv - i antigens in epithelial cell islands scattered throughout the pg , the particular pattern of hsv - i antigen distribution in epithelial cells suggesting a low - productive hsv infection , the simultaneous vegf expression in the pg endothelial cells and in hsv - i - infected keratinocytes as well as the prompt regression following oral valaciclovir after repetitive failure of all prior non - antiviral treatment options raised the hypothesis that , under certain circumstances , hsv - i might play an indirect role in the triggering of pg , presumably via an vegf - dependent pathway .

pyogenic granuloma ( pg ) is a vascular endothelial growth factor ( vegf)-related neoangiogenic process . minor trauma , chronic irritation , certain drugs and pregnancy may favor pg . viral triggers have not been reported up to date . a 52-year - old woman with hairy - cell leukemia presented because of a 3-month history of a giant pseudotumoral lesion on her left cheek . all prior antibacterial , antifungal and anti - inflammatory treatments had failed . histology revealed pg with sparse and isolated epithelial cell aggregates . immunohistochemistry ( ihc ) identified herpes simplex virus type - i ( hsv - i ) antigens in the nuclei and cytoplasm of normal - appearing as well as cytopathic epithelial cells , suggesting a chronic , low - productive hsv infection . no hsv - i signal was evidenced in the endothelial cells of the pg . furthermore , ihc revealed vegf in the hsv - i infected epithelial cells as well as within the pg endothelial cells . these results incited oral treatment with valaciclovir , and the pg promptly resolved after 2 weeks . these findings suggest that a chronic hsv - i infection might play an indirect , partial role in neoangiogenesis , presumably via hsv - i infection - related stimulation of keratinocytic vegf production .

secondary syphilis presents with generalized lesions on the skin and mucous membranes , primarily macules and then progressing to papules . when the papules become hypertrophic and coalesced on macerated skin or mucous membranes , they are called condyloma lata , which more commonly occur around the anus and vulva . we report a case of condylomata lata occurring on the ankle , an unusual site . a 43-year - old japanese man presented at a dermatology clinic with multiple erythema on the legs , which had been noticed for three months . because treatment with a topical glucocorticosteroid , betamethasone butyrate propionate ointment ( antebate , torii pharmaceutical , tokyo ) , was not effective and several nodules were also present on the left ankle the patient was referred to our university hospital . the family history and patient s past medical history were not remarkable . when asked , the patient denied contracting syphilis by a non - sexual route . his work history indicated he was a field superintendent and wore protective shoes throughout the workday . physical examination showed an indurated reddish nodule measuring 30 25 mm with an 8-shaped raised border and partly covered by yellowish crust ( figure 1a ) . there was another yellowish , crusted nodule measuring 15 5 mm near the heel . multiple scaly reddish macules measuring up to 5 mm were noted on the palms and soles ( figure 1b ) . dermoscopy of the largest nodule demonstrated red to milky red globules and some glomerular vessels and a whitish pink network on the raised border ( figure 2 ) . a yellowish structureless area was noted at the periphery and multiple white , small , round structures were noted in the center . laboratory data showed a white blood cell count of 10400/ml ( normal , 3900 to 9800 ) . the assays were positive with the following titers : blood rapid plasma reagin ( serological test for syphilis ) at 1:64 ( normal , 1:<1 ) , t. pallidum hemagglutination assay at 1:20480 ( normal , 1:<80 ) and fluorescent treponemal antibody - absorption test at 1:1280 ( normal , 1:<20 ) . the histopathological findings included irregular acanthosis and papillomatosis , a parakeratotic horny layer , and dense lymphocytic and plasma cell infiltration in the papillary and upper dermis ( figure 3a ) . pallidum antibody ( figure 3c ) stains revealed many spirochetes in the lower epidermis and the papillary dermis . based on the above clinical , serological , and histopathological findings , the diagnosis of secondary syphilis ( condylomata lata on the ankle and syphilitic psoriasis on the palms and soles ) was made . one week after treatment with oral benzylpenicillin benzathine hydrate ( bicillin g granules 400,000 units ; banyu pharmaceutical co. , ltd , tokyo , japan ) 1.6 million u daily , the ankle lesions had almost resolved with a small ulcer and pigmentation remaining . condylomata lata consist of flat - topped eroded weeping papules occurring mainly on the perianal area and the vulva . unusual sites of occurrence include the axilla , palms , face , umbilicus , and toe webs [ 27 ] . the reason for the unusual or widespread lesions could be attributed to mechanical friction and local hyperhidrosis [ 2 , 3 ] . this rare occurrence of condylomata lata on the ankle could be explained by the patient s work history of wearing protective shoes that cause a hyperhidrotic environment coupled with the physical friction associated with walking . we hypothesize that the cause for condyloma lata in this case might be due to the patient s work history of wearing protective shoes that provide an ideal environment for the proliferation of the treponemal spirochetes . the pathological features of prominent acanthosis seemed to correspond to the whitish - pink network on dermoscopy . the capillary dilatation in the papillary dermis appeared to be corresponding to red to milky - red globules . the yellowish structureless area at the periphery and multiple whitish clods in the center could be explained by the macerated horny layer and keratin plugs .

a 43-year - old japanese man presented with reddish nodules on the ankle . the nodules had a yellowish crust and eroded surface . dermoscopy revealed red to milky - red globules at the periphery and some glomerular vessels in the center and a whitish - pink network , which corresponded to capillary dilatation in the papillary dermis and prominent acanthosis , respectively . these structures were surrounded by a yellowish peripheral structureless area and multiple white , small , round structures in the center , corresponding to the macerated horny layer and keratin plugs . blood samples were positive for rapid plasma reagin ( 1:64 ) , treponema pallidum hemagglutination assay ( 1:20480 ) , and fluorescent treponemal antibody - absorption ( 1:1280 ) . a lesional skin biopsy specimen showed irregular acanthosis and papillomatosis . the warthin - starry and anti - treponema pallidum antibody stains on the biopsy specimen revealed many spirochetes in the lower epidermis and the papillary dermis . a diagnosis of secondary syphilis with condylomata lata was made . after one week of treatment with oral benzylpenicillin benzathine hydrate ( bicillin g granules 400,000 units ; banyu pharmaceutical co. , ltd , tokyo , japan ) , 1.6 million units ( u ) daily , the ankle lesions had resolved with a small ulcer and pigmentation . although syphilis is a relatively common disease , this case study reports an unusual presentation as well as dermoscopy findings .

medical family therapy is defined by mcdaniel , hepworth , and doherty ( 1992 ) as the biopsychosocial treatment of families who are dealing with medical problems . as we conceptualize it , medical family therapy works from a biopsychosocial systems model and actively encourages collaboration with other healthcare professionals . ( p. 2 ) medical family therapy , a subspecialty of marriage and family therapy , is a quickly rising phenomenon recognized by the fields of psychology , counseling , and behavioral medicine . the current evidence suggests there are numerous potential benefits to including medical family therapy across settings for a diverse presentation of disorders and health issues . solution - focused therapy ( sft ) is a directive , brief therapeutic approach focused upon building on patient strengths and established coping skills , applying them to future and present goals around the presenting issues . motivational interviewing ( mi ) is a therapeutic technique that is directive - based and nonjudgmental and uses ambivalence of the patient to further explore potential barriers , how to address these barriers , and increase intrinsic motivation to support self - efficacy , and eventually lead to change in the patient . evidence exists for mi effectiveness within medical settings and solution - focused effectiveness in the treatment of families . due to the overlap and similarities between the two interventions and the successful utilization of both of them in medical settings and with families , a marriage or combination of the field of nursing has demonstrated success using interventions drawn from sft and mi in patient care . next , the authors present a review of the medical family therapy and its fit with sft and mi , specifically looking at their efficacy in medical settings . a review of the literature explored the following databases for medical family therapy : proquest , ebsco , medline , and psychinfo . the search term medical family therapy was used with the following secondary terms : healthcare , collaborative care , integrated care , and palliative care , which were implemented using the and function . in addition , the search included supporting articles for mi and sft in family - centered medical conditions ( using the corresponding therapeutic title with and with medical family therapy ) . this review will conclude with clinical implications for successful implementation of solution - focused and mi strategies within medical family therapy in a medical setting . ( 2007 ) , sft contains several defining elements , including patients as the expert of their situations , solution talk versus problem talk , focus on exceptions to the problem , and the belief that families are resilient and resourceful . sft believes that conflict occurs for everyone and the key to adaptive functioning is how one falls into one of the three categories : customers with clear complaints who are ready for action , complainants who blame others , need redirection , and may become customers , and visitors who are not yet ready for treatment and it is actually best to wait . the goal of sft is to create a safe environment where families respond and cope with conflicts . treatment focuses on the solution rather than the problem , moving patients forward toward their treatment goals as assessed by the miracle question . the stages of sft include assessment , implementation of therapeutic techniques , and amplification , measuring progress and addressing barriers while using the patient 's strengths as the foundation for progress . the assessment stage includes the miracle question , assessing the family member 's vision of what the solution would look like allowing the therapist to better understand his or her motivation to change , discuss problem clarification , and identify the potential strengths possessed by the patient . sft focuses on the past only to determine the patient 's strengths as illustrated in exceptions . the therapeutic techniques implemented are brief and fall into two categories : development of well - focused goals and generating solutions based upon exceptions . developing well - focused goals include identification of a problem description that can lead to setting measurable goals using the patient 's language and exploring what the patient has previously tried . once the problem is defined and realistic , measurable goals for solutions are established and exceptions to the problem are used as strengths from which to build . the remaining sessions of sft focus upon identification , amplification , and measurement of progress of solutions developed through the previously mentioned processes . many of the techniques and premises of sft are similar to the work of miller and rollnick ( 2002 ) in mi . the premise of mi is that resistance is not strong - armed , but addressed and utilized through collaboration , evocation , and respect for the patient 's autonomy . mi implements clinician directness toward enhancing intrinsic motivation by exploring patient 's values , and assessing current ways for health behaviors to change to be more consistent with his or her values . similar to sft , mi includes the exploration of what has or is working and a rating of symptoms and confidence in their ability to address the symptoms . similar to scaling questions in sft , mi contains an element that implements readiness to change measurement where clinicians ask patients how confident and ready they are to change , asking the patient to rate his or her response on a scale of 1 to 10 . the outcome dictates the direction the therapist will go , which appears to be a brief and effective manner of addressing resistance and identifying ways patients and families may be struggling as well as motivating change toward treatment goals . mi implements similar techniques as those used in sft , differing primarily by the capitalization of ambivalence in the patient and the emphasis on increased intrinsic motivation . miller and rollnick ( 2002 ) emphasize on the importance of leading the patients to their own reasons and identified benefits of change . by leading the patient to advocate for his or her own change , intrinsic motivation is enhanced , leading to amelioration of barriers to beginning or sustaining change . collaboration is the focus of the shared decision - making , empowering the patient 's involvement and voice in the therapeutic process . evocation focuses on clinicians implementing attending skills , such as open - ended questions , affirmations , reflections , and summarizations , to draw on the patient 's values , goals , and attitudes . supporting patient autonomy effectively encourages self - efficacy throughout the therapeutic process for the patient , and in this case , his or her families , through supporting patient decision - making and avoiding challenging or encouraging resistance in the patient . mi approaches resistance uniquely , generally seen as an indicator that the provider should use a different approach , with the goal of leading the patient to argue for change and develop confidence to change . current research also indicates the effectiveness of multidisciplinary training and implementation of mi across settings for various mental health and medical occurrences . a recent meta - analysis described rating outcomes of effectiveness for different providers and practitioners ( i.e. nurses , ba students , ma / phd level practitioners ) , along with group , individual , manualized versus non - manualized , and various settings for implementation of mi techniques . the meta - analysis focused upon eight broad health outcomes , with psychological well - being and treatment engagement of depressed patients a focus of their analysis . moderators for the analysis included comparison group , patient distress , mi type ( i.e. pure mi or motivational enhancement therapy [ met ] ) , role of mi in patient treatment ( additive , adjunct , primary ) , who delivered mi , and delivery mode . overall utility for mi in treating emotional and psychological well - being resulted in increased treatment motivation and engagement in patients at significant ( g = 0.19 , p < 0.001 ) and moderate ( g = 0.21 , p < 0.001 ) levels of distress . mi ( g = 0.43 , p = 0.04 ) was also an effective prelude to therapy . last , and perhaps the most interesting , mi did not demonstrate significant treatment effects in 13 studies comparing treatment administrators composed of bachelor 's level ( g = 0.19 , p = 0.36 ) , nurse ( g = 0.1 , p = 0.35 ) , or student ( g = 0.23 , p = 0.15 ) . but significant improvements were observed from doctoral and master 's level ( aggregate ) practitioners with mi ( g = 0.39 , p < 0.001 ) . based upon these findings , medical family therapists education attainment is well suited to prepare them to be the primary individuals to implement mi when working with families in medical settings . the similarities in interventions and objectives between sft and mi strategies have been proven to fit well within the medical setting . as such , medical family therapists who are trained in the biopsychosocial - spiritual systems model , including sft and prior to describing mi and sft effectiveness in working with families in medical settings , discussing what exactly medical family therapy is seems essential to promote an in - depth understanding of the main points of this text . focus and attention on medical family therapy has increased as a result of managed care and the desire and need for integration of care and services in medical settings . additionally , the recognition of the importance of the patient 's family system as essential to best medical outcomes has promoted medical family therapy as a profession . research supports the effective treatment of these conditions such as chronic pain , eating disorders , and depression by family - based interventions . the effectiveness of these practitioners and interventions demonstrates an enormous need in the current healthcare system and supports the continued integration of medical care with mental health interventions such as sft and mi . patients experience multiple interworking systems , which include biological , psychological , social , and spiritual components ( bpss ) , all of which have the potential to influence the family system , and provide essential sources of coping and support . bischoff et al . ( 2011 ) highlighted three areas of family - centered care needs ; recognition and respect of a patient 's multisystemic experience of a disease , developing a caring relationship with the patient , and elevating the patient in their role of the healthcare team these needs corroborate with the fit of sft and mi for treating patients in medical family therapy settings . sft allows for autonomy of the patient and his or her family , as well as providing a family - centered approach that focuses on reaching solutions rather than engaging in problem - saturated talk . medical family therapist can work collaboratively and in conjunction with the medical providers and with patients in medical settings promoting adherence to treatment recommendations . sft and mi are excellent interventions to elevate the patients in their role of the healthcare team . mi specifically achieves this by focusing on autonomy , increasing intrinsic motivation , and enhancing patient self - efficacy . autonomy is bolstered in healthcare settings by including the patients and their families in decision - making processes , delivering information with tact and care , and asking the patient permission to discuss certain issues . this leads to empowerment of the patients and their family , enhanced rapport and validation of their status as valued individuals in the process . rather than speaking at them , the clinician is speaking with them and expressing empathy for the patients . mi in healthcare settings is present - focused , leading to a directive style that empowers and validates the patients and their families , capitalizing on strengths and change talk ( i.e. identifying statements indicating steps taken and desires to change ) , and providing empathetic responses to new - found abilities and strengths within the context of their therapy . sft focuses on capitalizing on these patient strengths by involving the patients and their families in the decision - making process through exploring and advocating for patient goals and aspirations within the therapeutic process . sft is present - focused ; validating the current presence of the patients and their families , and building upon their strengths and successes , ultimately leading them to feel more involved in the shared decision - making process . empathy is an important aspect of both mi and sft that is enhanced by the present focus that builds upon strengths and goals of the patient leading to fully involved and autonomous patients participating in the healthcare team . some examples of current implementation of sft and mi include the field of nursing 's implementation of sft as a modality of care into diabetes , cancer , and other common and chronic presenting problems in medical settings . sft contains a degree of overlap in principles and desired outcomes for treatment as demonstrated by current implementation with other medical providers ( i.e. nurses , nurse practitioners , behavioral health consultants , and other mental health clinicians in healthcare settings ) . nurses , for example , aim to improve trust , promote positive patient orientations and perceived control in managing their illness , emphasize and bolster patient strengths , and develop health - directed goals . as previously noted , research supports sft principles previously used in in - patient settings as resulting in less behavioral conflicts , decreased length of stay , increased levels of collaboration between nursing and other medical staff , and decreased readmission rates . mi has also been successfully used by nurses for improving treatment adherence and self - monitoring when necessary . furthermore , medical family therapists receive extensive training in counseling and de - escalation techniques and have demonstrated lower dropout rates and recidivism , and were more cost - effective than medical doctors , nurses , or psychologists in providing family interventions . mi is useful in healthcare settings in establishing brief , effective rapport and trust with patients , and can be a critical aspect of the stages needed for nurses to establish a present , solution - focused approach to patient care . implementing mi techniques and interventions with previously developed sft nursing models due to the past success , buy - in , and familiarity with the sft by nurses , this type of therapy may lend itself well to medical family therapists making the collaborative transition easier to accomplish between medical family therapists and traditional members of the medical team . another important clinical implication , as suggested by anderson , huff , and hodgson ( 2008 ) , is medical family therapists are dedicated to two metagoals consistent with those of medical ethics and practices : agency ( commitment to and involvement in one 's own care ) and communion ( emotional bonds , which may be adversely effected by chronic and long - term illness ) . these underlying premises of care and goals lend themselves well to a collaborative team , and their utilization can bolster professional integration of services based upon delivery models and general aims of service . currently , a shortage in the evidence for an sft and mi blended approach to treating families in a medical family therapy setting exists in the literature reviewed , indicating it to be a recommended area for future research and programmatic development based upon the proven utility and success of both of these interventions for better medical outcomes using medical family therapy . the potential for increased acceptance and amplified reimbursement abilities may be possible through the implementation of mi and sft by medical family therapists . in this review , the authors have highlighted the literature utilizing the components of mi and sft that have been proven to be effective in marriage and family therapy , medical settings , and by medical professionals . future research efforts should focus on establishing cost - effectiveness and the ability for sft and mi to fit into the already established and fiscally supported millieu channels in medical settings . results of these findings can be applied to future developments in medical family therapy training programs . while only a handful of medical family therapy programs currently exist in the united states , the evidence supports it to be an area of need and an under - utilized service by the medical and mental health systems . this review found evidence supporting sft and mi as the perfect marriage of the collaborative approach for the future implementation and use of specific interventions in medical family therapy . sft provides a wide range of coping skills and behaviors to assist families with the maladaptive nature of many of the potential presenting problems that can arise in a medical setting . mi is an effective skill used by therapists and medical professionals to evoke motivation on the part of the patient and his or her family . as with many other emerging collaborative endeavors , being able to motivate and educate policy makers , physicians , mental health professionals , and if consistent with previous positive evidence for sft , marriage and family therapy interventions , and mi , future clinical trials may demonstrate the ability to increase clinical effectiveness and comprehensive , family - centered care for patients resulting in better medical outcomes consistent with the bpss approach of medical family therapy .

medical family therapy has many potential uses in behavioral medicine and primary care . current research was reviewed to determine the most advantageous way to apply solution - focused therapy and motivational interviewing as a perfect marriage in medical family therapy . an extensive literature review was done in the following databases for medical family therapy : proquest , ebsco , medline , and psychinfo . the search resulted in 86 relevant articles , of which 46 of the most recent were selected for review . medical family therapy lacks current research that supports solution - focused therapy or motivational interviewing . however , evidence supports the use of solution - focused therapy as a brief format , as well as the closely related intervention , motivational interviewing . while medical family therapy presents many hopeful possibilities in the fields of behavioral medicine , psychology , and marriage and family therapy , little evidence currently exists for the most effective implementation . this review found evidence supporting solution - focused therapy and motivational interviewing as the perfect marriage of the collaborative team approaches for the future implementation and use of specific interventions in medical family therapy .

in 1922 , stevens and johnson first described stevens johnson syndrome ( sjs ) as an immune complex hypersensitivity reaction that can be caused by many factors such as infections , drugs and malignancies . it is a progressive , fulminating , severe variant of erythema multiforme with other variant being toxic epidermal necrolysis ( ten ) . reported incidence rates of sjs are 1 - 6 cases/106 person - years , and for ten 0.4 - 1.2 cases/106 person - years . sjs refers to cases with less than 10% of body surface involvement and ten to those with more than 30% involvement . burning sensation , edema , erythema of the lips and buccal mucosa are some of the first signs . skin lesions are initially erythematous macules that rapidly develop central necrosis with vesicles , bullae and denudation on the face , trunk and extremities . the most common sites include labial mucosa , buccal mucosa , tongue , floor of the mouth and the soft palate . ten and sjs are acute life - threatening conditions with a significant impact on high mortality rate ( 5 - 35% ) . human immunodeficiency virus ( hiv ) infected patients on exposure to nevirapine ( nvp ) have significantly increased risk of sjs or ten . the underlying mechanism for cutaneous reactions is not clear , but the probable hypothesis could be drug - specific cytotoxic lymphocytes . ten cases of hiv - seropositive patients were reported to voluntary counseling confidential testing center ( vcctc ) , with fever and mucocutaneous ulcerations with a mean duration of 10 days . all the patients were diagnosed as hiv positive one year back ( approximately ) . out of 10 patients , 6 were males and 4 were females with age range of 22 - 46 years . on examination , multiple erythematous papules , plaques were present all over the body in nine patients [ figure 1 ] . the entire skin covering the body surface was denuded and peeled off with minor manipulation and appeared blackish in color in one patient [ figure 2 ] . intraorally , multiple oral ulcers of the buccal mucosa , tongue , palate , labial mucosa , soft palate and floor of the mouth were seen in patient with ten [ figures 3 and 4 ] . there was a gradual onset of the lesions between 7 and 14 days following the initiation of the highly active anti retroviral therapy ( haart ) . all the laboratory findings ( total white blood cell count , ( twbc ) , total red blood cell count ( trbc ) , differential count ( dc ) and platelet count ) were in normal limits , but erythrocyte sedimentation rate ( esr ) and hemoglobin ( hb)% were altered . based on the history and clinical presentation , a diagnosis of sjs and ten was given . haart was discontinued and 2 ml dexamethasone ( 4 mg / ml ) was given to manage mucocutaneous rashes . summary data for nine patients with sjs and one patient with ten induced by nvp has been listed in table 1 . multiple erythematous papules , plaques were present all over the body entire body surface skin denuded and peeled off with minor manipulation and appeared blackish in color ( ten ) multiple oral ulcers present on the tongue multiple oral ulcers present on the palate hemorrhagic crusting of the vermillion zone of the lips noted summary of nine cases of sjs and one case of ten induced by nevirapine sjs and ten are cytotoxic hypersensitivity reactions resulting in systemic disease , characterized by sloughing of the skin and mucous membranes at the dermal - epidermal junction . there is a growing evidence that sjs and ten belong to a single group of diseases with common causes and mechanisms . recent reports have linked sjs to the use of drugs rather than other etiologic factors . antibiotics ( sulphonamides ) are the most common cause of sjs , followed by analgesics , cough and cold medication , nonsteroidal antiinflammatory drug ( nsaid ) , and psycho - epileptics . individuals with antigens like human leukocyte antigen bw44 , hla - b12 , and hladqb1 * 0601 appear to be more susceptible to developing sjs . sjs in children is frequently attributed to infectious agents but may also be related to drug intake . granulysin is a cationic cytolytic protein released primarily by cytotoxic t cells ( ctls ) and nk cells . it is the key molecule responsible for the disseminated keratinocyte death and tissue damage and results in the unique clinical presentation of sjs / ten . nvp is a nonnucleoside reverse transcriptase inhibitor approved by the us food and drug administration ( fda ) used in haart , combination regimens for the treatment of hiv infection . major adverse reactions , including skin rashes and hepatotoxicity occur in approximately 3% of hiv - infected individuals who receive long - term course of nvp . there is persistence of a high risk of sjs or ten in relation to hiv infection associated with exposure to nvp . upregulation of keratinocyte fas l expression is the critical trigger for keratinocyte destruction during ten . according to the euroscar , study was designed as an international multicenter study aiming at an ongoing surveillance of medication risks for sjs and ten based on a case - control methodology . prescribing any one of the following drugs requires thorough evaluation of expected benefits : nevirapinelamotriginecarbamazepinephenytoinphenobarbitalcotrimoxazole and other antiinfective sulfonamidessulfasalazineallopurinoloxicam - nsaids cotrimoxazole and other antiinfective sulfonamides a delay of 4 - 28 days between beginning of drug use and onset of the adverse reaction is the most suggestive timing supporting drug causality in sjs or ten . in our 10 cases , the lesions developed between 1 and 2 weeks after the initiation of haart , which consisted of nvp . burning sensation , edema and erythema of the lips and buccal mucosa are some of the initial signs . diffuse oral ulcerations of the labial mucosa , buccal mucosa , tongue , floor of the mouth and the soft palate are present . skin lesions are initially erythematous macules that rapidly develop central necrosis with vesicles , bullae and denudation on the face , trunk and extremities . mucosal erosions can occur in at least two sites , including conjunctivae , mucous membranes of the nares , mouth , anorectal juctions , vulvovaginal and urethral meatus . other clinical features include pneumonitis , productive cough , fever , headache and malaise . in all 10 cases , the mucocutaneous manifestations were similar and associated prodromal symptoms were fever , headache and malaise . the clinical differential diagnosis of sjs includes staphylococcal scalded skin syndrome , kawasaki disease , acute graft - versus - host disease and bullous systemic lupus eythematosus . biopsy of peri - lesional tissue , with histological and immunofluorescence examination are essential if a specific diagnosis is required . all the 10 cases revealed classic clinical presentation of sjs / ten . as the patients were in a severe debilitating condition we could not subject to histopathology and immunofluorescence . treatment of these two life - threatening conditions includes prompt recognition and withdrawal of suspected drugs and hospitalization . infection control , isolation measures and management of cutaneous coverage mucosal hygienic measures are of prime importance to increase the patient 's comfort and to prevent complications . after recovery , patients should be advised to avoid not only the suspected drug(s ) , but also chemically related compounds . nvp was stopped in all the 10 cases and patients were treated symptomatically by administering intravenous 5% dextrose , dexamethasone 2 ml and high protein supplements were included in the diet . haart ( lamivudine , efavirenz , zidovudine / staruvudine ) was initiated again and continued without rechallenge of nvp . all the patients were followed up regularly for 6 months and the response to the treatment was satisfactory . sjs and ten are two rare but severe blistering mucocutaneous diseases that share common clinical and histopathological features but vary in the extent of epidermal detachment . both are frequently associated with drug use . close monitoring and follow - up for patients placed on nvp for hiv are paramount not only for therapeutic response but also for the development of severe complications such as sjs / ten . as documented in our cases , prompt recognition and institution of appropriate therapies , including transfer to a burn centre , can positively impact survival of patients affected by sjs / ten . as efforts continue in the development of medications with more favorable adverse effect profiles , one must be careful and suspect sjs , if a patient is on haart regimen containing nvp and presents with symptoms arising from irritation of the skin and mucous membranes .

stevens johnson syndrome ( sjs ) and toxic epidermal necrolysis ( ten ) are closely related severe , acute mucocutaneous reactions usually caused by drugs . they are acute life - threatening conditions and cause widespread necrosis of the epithelium . there is persistence of a high risk of sjs or ten in relation to human immunodeficiency virus ( hiv ) infection associated with exposure to nevirapine ( nvp ) . in this article , we present nine cases of sjs and one case of ten in hiv - seropositive individuals who developed cutaneous , oral , ocular and genital lesions while being treated with nvp .

angiodysplasia can be a major source of gastrointestinal bleeding , responsible for 6.0% of cases of lower gastrointestinal bleeding and 1.2 - 8.0% of cases of upper gastrointestinal bleeding . small bowel angiodysplasia includes a large number of cases of gastrointestinal bleeding of unknown origin , in approximately 30 - 40% of patients.1 a small bowel varicosis is an uncommon cause of lower gastrointestinal bleeding . in addition , most cases of small bowel varicosis have cirrhotic causes and are usually located in the duodenum . extrahepatic causes are result from occlusion of one of the major vessels.2 we present a rare case of congenital angiodysplasia of the jejunum that did not show the features characteristic of angiodysplasia angiographically but presented with idiopathic jejunal varicosis . the patient complained of abdominal pain , dyspnea and dizziness and a 4 kg weight loss over one month . this was the first episode of melena for the patient . on physical examination , the conjunctiva was pale and the abdomen was soft but showed hyperactive bowel sound . the laboratory findings showed haemoglobi 5.9 g / dl , leukocytes 4,140/mm ( 68% neutrophils ) and platelets 432,000/mm . assessment of anemia showed a low level of iron ( 11 ug / dl , normal value 50 - 130 ug / dl ) but normal levels of tibc ( 284 ug / dl , normal value 280 - 400 ug / dl ) and low levels of ferritin ( 2.4 ng / ml , normal value 13 - 150 ng / ml ) . a transfusion of 540 ml of red blood cells was given , and the hemoglobin level reached 10.2 g / dl . esophagogastroduodenoscopy and colonoscopy were within normal limits except for old blood clots in the ascending colon ; however , there was no definite bleeding source identified . an abdominal ct angiography showed varicosis at the jejunal mesentery of unclear etiology ; there was no sign of active bleeding ( figs . a superior mesenteric artery ( sma ) and inferior mesenteric artery ( i m a ) arteriography showed tortuous and dilated jejunal and ileal branch in the venous phase ( figs . 1e , f ) , suggesting a vascular malformation , such as varicosis of the jejunum . however , the patient declined the exploration because the bleeding stopped and she was discharged . two weeks later , the patient presented to the emergency room again with the same problem ; presenting with melena for two days . this time the hemoglobin level was 8.6 g / dl , and surgery was performed immediately . on careful visual and manual examination of the small intestine , diffuse engorged veins were found 60 cm from the ligament of treitz and 100 cm from the ileocecal ( ic ) valve . to determine the exact focus of bleeding , finally , a 1.0 cm sized superficial ulcer covered with a blood clot was found on 70 cm from the ligament of treitz ( fig . the gross examination of the resected specimen revealed a 0.9 cm sized ulceration of the mucosa as the bleeding focus and one blue - black lesion in the submucosal layer with venous distension ( fig . histological examination revealed dilated and distorted vessels in the submucosa and mesentery and variable amounts of smooth muscle cells in the vascular walls . some foci of thin - walled vessels were lined by a single layer of endothelium ( fig . angiodysplasias are vascular abnormalities frequently found in the gastrointestinal tract ; they are a source of significant morbidity from bleeding , particularly in the elderly . the taxonomy of vascular abnormalities has been inconstant ; there has been confusion regarding arteriovenous malformation , vascular ectasia , vascular malformation and telangiectasia.3,4 in cases with angiodysplasia and arteriovenous malformation , the two terms are frequently used interchangeably in the clinical literature because of equating angiographic with histologic documentation . however , in terms of pathological features , eastman et al . stressed that they are distinct entities and not interchangeable . angiodysplasia may represent a degenerative condition among elderly patients , with abnormal vessels present in the mucosa and submucosa . by contrast , arteriovenous malformations demonstrate aberrant vessels with thickened , hypertrophic walls that vary in their thickness . an elastic segment can demonstrate areas with arterial features such as an internal elastic layer that interconnects with segments of veins with no internal elastic layer.5 the prevalence of angiodysplasia has been reported to be approximately ~6.0% in patients with lower gastrointestinal bleeding , and 1.2 - 8.0% of cases with hemorrhaging from the upper gastrointestinal tract . small bowel angiodysplasia accounts for 30 - 40% of cases of gastrointestinal bleeding of unknown origin , and represents the most common cause for hemorrhage in this subset of patients . lesions in the large bowel occur most frequently in the right colon.1 small bowel varicosis is an uncommon cause of lower gastrointestinal bleeding . most cases of small bowel varices are located in duodenum , and they are usually associated with liver cirrhosis . in the absence of liver cirrhosis jejunal varicoses are associated with the occlusion of one of the major vessels in the area including the splenic , portal or superior mesenteric vein.2 however , in the present case , an abdominal ct showed normal liver parenchyma and the angiographic findings showed tortuous and dilated jejunal and ileal branches in the venous phase , similar to varicosis but without obstruction of major vessels . angiography performed as an initial method of investigation can be used in patients with massive bleeding that might impair endoscopic inspection . however , in the present case , the characteristic angiography features of an angiodysplasia were absent.6,7 there was no visible late - draining vein . since the portal circulation was normal and no liver pathology was found , we were inclined to congenital angiodysplasia as a very rare case of idiopathic jejunal varicosis . angiographic diagnosis was in disagreement with the histopathology diagnosis of angiodysplasia ; this was probably because a congenital venous abnormality progresses to venous distension under the circumstance with portal hypertension . one theory is that angiodysplasias may develop in response to chronic low grade venous obstruction . this is consistent with the observation that angiodysplasias often occur in the right colon where the wall tension is highest.8 another theory is that angiodysplasias may be a complication of chronic mucosal ischemia , which can occur during episodes of bowel obstruction or straining at stool.9 the third is that angiodysplasias can develop as a result of a complication of local ischemia associated with cardiac , vascular or pulmonary disease , such as end - stage renal disease , von willebrand 's disease , aortic stenosis , and liver cirrhosis.10 the last is that angiodysplasias may be congenital origin , which is probably more likely in young patients . in this case , the patient was 42-year old with no medical illness including constipation . furthermore , there was no family history of gastrointestinal bleeding , and the lesion was located in the jejunum . the bleeding focus was thought to be the congenital jejunal angiodyspalsia based on the following four reasons . first , the 1.0 cm superficial ulcer covered with a blood clot was found 70 cm from the ligament of treitz . second , no further bleeding occurred 1 year after the resection of this lesion , in spite of the two consecutive profuse episodes of melena . fourth , no definite bleeding focus was found in the intraoperative small bowel endoscopy except for the 1.0 cm ulcer on a background of diffuse angiodysplasia . in conclusion , we report a rare case of congenital angiodysplasia of the jejunum in a young woman , presenting with idiopathic jejunal varicosis on angiography but pathologically angiodysplasia . the current classification of intestinal angiodysplasia is subject to confusion and revision should be considered .

angiography is a useful diagnostic tool in cases with massive gastrointestinal bleeding such as angiodysplasia and varicosis when endoscopy is not available . angiodysplasia and varicosis have distinguishable characteristic features on angiography , such as the presence of a nidus , visible late - draining veins , and the typical vascular tuft . we recently treated a rare case of congenital angiodysplasia without the characteristic angiodysplasia features on angiography . instead , the patient presented with a very rare case of idiopathic jejunal varicosis . a 42-year - old woman visited the emergency room with the chief complaint of melena for three days and a hemoglobin level of 5.9 g / dl . an abdominal ct angiogram showed varicosis at the jejunal mesentery . angiography of the superior and inferior mesenteric arteries showed tortuous and dilated jejunal and ileal branches during the venous phase , suggesting a vascular malformation such as varicosis of the jejunum . surgical exploration with intraoperative endoscopy revealed diffuse engorged veins and a 1.0-cm - diameter superficial ulcer covered with a blood clot that was 70 cm from the ligament of treitz . a 100-cm segment of jejunum was resected . histological examination revealed that the lesion was angiodysplasia , not varicosis . the final diagnosis was congenital angiodysplasia .

a 32-year - old female visited our hospital due to her nonspecific neck discomfort for several years . sonography was performed on an acuson unit with a 15-mhz linear transducer ( acuson , mountain view , ca ) , and a 0.5 cm sized hypoechoic nodule with ill - defined margins and a taller shape was found in the right portion of the thyroid gland . another 1.8 cm sized anechoic cystic lesion with oval shape and well - defined margin was also noted at the posterior aspect of the mid - portion of the thyroid , and it was superior to the suspicious malignant nodule ( figs . the patient underwent sonography - guided fine needle aspiration of the suspicious malignant nodule . at the same time , we also aspirated the cystic lesion in right portion of the thyroid gland . the aspirated fluid was measured as 1 cc and showed as a thick yellowish pus - like fluid material . the cystic lesion was thought of parathyroid cyst or other complicated cyst , so aspirated fluid was sent for cytology cultures for bacteria and a check of the parathyroid hormone ( pth ) level . the cytology results of the suspicious malignant nodule were consistent with a papillary cancer ; there were no follicular cells and a few squamous cells in the cytology results of the cystic lesion . the pth level of cystic fluid showed to be normal and there were no bacteria on culture . histopathologic examination about the suspicious malignant nodule on us revealed micropapillary carcinoma , the same as the preoperative cytology report . the 1.8 cm sized cystic lesion superior to the cancer was lined by ciliated pseudostratified columnar epithelial cells , and its diagnosis was a branchial cleft cyst ( fig . branchial anomalies may result from the abnormal persistence of branchial apparatus remnants , and they present around each of the developed brachial derivates . a branchial cleft cyst is an epithelial - lined structure without an external opening , and it is usually located in the lateral areas of the head and neck ( 1 , 2 ) . first branchial cleft cysts are intimately associated with the external auditory canal and the parotid gland ( 1 ) . second branchial cleft cysts are found along the anterior border of the sternocleidomastoid muscle and most commonly present just lateral to the internal jugular vein at the level of the carotid bifurcation ( 3 ) . anomalies of the third and fourth branchial clefts are relatively uncommon and the distinction between third and fourth branhcial anomalies remains controversial , primarily because both lesions similarly present around the piriform sinus ( 1 ) . the exact histogenesis of a intrathyroidal branchial cleft cyst is unclear , but probably the failure of the third or fourth branchial pouches to atrophy and dissipate in utero results in the cysts or the sinus tracts that lie in close proximity to , or inside , the thyroid gland ( 2 , 5 ) . whatever their origin , histologic analysis reveals that they are generally well - circumscribed cysts lined by straight squamous or pseudostratified columnar epithelium , and they have abundant lymphoid tissue and follicles beneath the epithelium . the cystic contents may be clear , watery to mucinous fluid , or the cyst may contain desquamated , granular cellular debris and if this becomes infected , it may be yellowish pus - like fluid ( 3 , 4 ) . generally , the diagnosis of branchial cleft cysts is relatively easy when it is located in its classical position , and sonographically the cyst appears as an anechoic mass or a predominantly hypoechoic , cystic mass with faint internal debris and posterior enhancement . however , on real - time images , after the application of transducer pressure on the cyst , the entire contents may shift , suggesting their true cystic nature ( 4 ) . preoperatively , how can we arrive at the the diagnosis of intrathyroidal branchial cleft cyst ? although some prior reports have suggested that intrathyroidal branchial cleft cysts should be considered in the differential diagnosis of thyroid cystic lesions , and especially in the patients with hashimoto 's thyroiditis , yet in view of the rarity of the lesion , the diagnosis can be suggested only by histopathologic confirmation , as was the case in all the previous case reports ( 2 , 6 ) . generally , in clinical practice , when thyroid cysts are detected by sonography , we first suggest that it is a colloid cyst or a true epithelial thyroid cyst . if cysts are presented in the posterior portion of the superior or inferior pole of the thyroid , we also should consider the possibility of parathyroid cysts ( 7 ) . but , fine - needle aspiration of yellowish , green viscous fluid or the sonographic appearances of a pseudosolid , cystic nodule in the thyroid should alert the sonographer to the possibility of a congenital developmental cyst ( 6 ) . thyroglossal duct cysts , the one of congenital developmental cysts , also have been reported to present as thyroid masses . the distinguishing features between a thyroglossal duct cyst versus a branchial cleft cyst include presentation of the mass , with thyroglossal duct cysts more likely to be midline neck masses while branchial cleft cysts are typically lateral neck masses , and frequency of infection , branchial cleft cyst are more likely to be infected ( 8) . histology of the cellular components of the cyst wall and surrounding tissue is the most valuable method of differentiating the two ( 8) . but , preexisting inflammation may cause metaplasia of the lining of a thyroglossal duct cyst , while may make histologic differentiation from a branchial cleft cyst difficult ( 8) . when we reviewed the previous case reports for intrathyroidal branchial cleft cysts , there was no specific finding on the sonography studies . but in a few cases , there was creamy green or turbid yellowish fluid aspirated during fine needle aspiration cytology for intrathyroidal branchial cleft cyst , as like our case ( 4 , 8) . in conclusion , the differential diagnosis for a cystic lesion that lies in close proximity to , or inside , the thyroid gland on sonography includes colloid cyst , true epithelial thyroid cyst and parathyroid cyst . the definite diagnosis of thyroidal branchial cleft cyst will be made postoperatively ; yet if on fine - needle aspiration of the cyst a yellowish , pus - like viscous fluid is aspirated , branchial cleft cyst should be considered in the differential diagnosis of the thyroid cystic lesion .

we report here on an extremely rare case of an intrathyroidal branchial cleft cyst . intrathyroidal branchial cleft cyst is rare disease entity and it has nonspecific findings on sonography , so the diagnosis of the lesion is very difficult . however , during aspiration , if pus - like materials are aspirated from a thyroid cyst , we should consider the possibility of intrathyroidal branchial cleft cyst in the differential diagnosis .

pentatomomorpha is a large group of many phytophagus as well as seed - eating insects , commonly called as plant bugs , with more than 10,000 species worldwide ( dolling , 1991 , schuh and slater , 1995 ) . morphology - based study of pentatomomorpha has a long history and several workers have recognized different superfamilies in this infraorder ( schuh and slater , 1995 ) but there is little agreement on their relationships . 2012 ) reported phylogeny of this infraorder based on fossil and extant species morphology . molecular work to facilitate identification and to seek relationship amongst the various families is necessary in this vast group . initial work on coi - based identification of some heteropteran groups ( damgaard , 2008 , memon et al . , 2006 ) reported limited utility of this technique but recent work from jung et al . ( 2011 ) have confirmed the efficacy of dna barcoding for identification of true bug species . whilst damgaard ( 2008 ) considered coi sequences from the 3 end , the species in memon et al . ( 2011 ) presented coi variation in species from korean peninsula and park et al . there are some notable previous reports incorporating molecular data into phylogeny studies of pentatomomorpha ( hua et al . , 2008 , li et al . , 2005 ) . our search showed that efforts have been initiated to barcode true bugs from india ( rebijith et al . , 2012 ) but were restricted to a few species from a single family miridae . therefore the present work was undertaken to identify more species using coi barcodes covering wider taxa range . for this , bug species were collected from the pune and other parts of western ghats , which is a well - known biodiversity hotspot with thousands of plant and animal species ; many of them being still unexplored . in spite of the fact that many plant bugs are economically very important and also considerable previous work ( distant , 1904 ) has been done on traditional taxonomy of this group in india , hardly any molecular data is available for these species . therefore , the present study aims to check the utility of molecular techniques in identification of true bugs and in this context feasibility of dna barcoding is explored . analysis of seventy three taxa representing five superfamilies and ten families was carried out for barcoding studies of infraorder pentatomomorpha . voucher numbers of specimens used , their taxonomy , genbank accession numbers and collection sites are shown in table 1 . all attempts were made to include more than one representative of all taxa , but sample availability was a major constraint . two taxa ( rhynocoris ornatus and rhynocoris marginatus ) that belong to cimicomorpha ; a sister group of pentatomomorpha , were used as outgroups . samples were then dried , pinned , kept as voucher specimens and lodged in the department of zoology , modern college , pune , india . photographs of 9 bug specimens , each representing one family , are shown in fig . 1 and the remaining photographs are provided in supplementary information ( figures sm1 and sm2 ) . dna was extracted using dneasy kit ( quiagen ) as per the manufacturer 's protocol . pcr was conducted in 25 l volume containing 2 l of dna , 0.2 l taq polymerase ( bangalore genei ) , 1.25 l 10 m primers , 2.5 l 2.0 mm dntps and 2.5 l 10x buffer . the primer pair lco1490 ( 5-ggtcaacaaatcataaagatattgg-3 ) and hco2198 ( 5-taaacttcagggtgaccaaaaaatca-3 ) was used ( folmer et al . , 1994 ) and amplification conditions were 1 cycle , 95 c ( 5 min ) , 35 cycles , 94 c ( 30 s ) , 47 c ( 30 s ) , 72 c ( 1:30 min ) , and 1 cycle 72 c ( 10 min ) . pcr products were identified on 1% agarose gel electrophoresis with etbr staining under uv light , purified by peg - nacl method ( sambrook et al . , 1989 ) and sequenced in an automated sequencer ( 3730 dna analyser , abi , hitachi ) using big dye terminator cycle sequencing with same primers used for amplification . the sequences were checked for consistency , gaps , and non - sense codons and manually edited in chromas pro . nucleotide database of genbank was searched for coi sequences of true bug species from india . the sequences were aligned in bioedit ( hall , 1999 ) and divergence amongst individuals , divergence at species , genus and family level were analysed by k2p model of base substitution in mega 5.1 ( tamura et al . , 2007 ) . neighbour joining ( nj ) analysis using k2p distance method was carried out in mega 5.1 . no stop codon or frame shifts were detected indicating that sequences were not pseudogenes ( numts ) . sequences of more than 500 bp were obtained from all specimens . the final aligned data , after incorporating genbank sequences , had 114 coi sequences of 542 bp length representing 73 species . except for nezara viridula and riptortus pedestris , all the sequences from our studies were new addition to barcode database of this group as we could not find conspecific sequences when blast and nucleotide search was made ( supplementary information table sm1 ) . a hierarchical increase in k2p mean divergence across different taxonomic levels was observed ( table 2 ) . intraspecific divergence averaged 0.4% ( se 0.2% ) with a range of 02.1% , whilst interspecific distance showed an average of 11.7% ( se 1.3% ) divergence ( range 019.8% ) . divergence amongst genera in family averaged 14.9% ( se 1.2% ) with a range of 11.824.4% . the distance between different families was in the range of 18.030.2% with an average of 21% ( se 1.3% ) . pentatomoidea showed the highest mean divergence ( 19.6% ) and pyrrhocoroidea showed the lowest divergence ( 18.1% ) . blast search carried out as an early test resulted in many of our sequences matching with the congeneric species from genbank . this indicated that sequences are useful in diagnosing the genus if the database is robust . for those species where there was no sequence in database , the nearest match was always from the same family . in some cases , such as some coreidae ( physomerus , homoeocerus ) the blast search gave only a rhopalidae match . in nj tree ( fig . 2 ) , closely related species and genera clustered cohesively and distinctly from the rest of the species . except for eocanthecona , eocanthecona furcellata mtcoi sequence generated in our studies did not cluster with that of its congener eocanthecona japanicola reported from korea ( gq292274 ) . all members , except for four cases , of different species and genera showed distinct barcode in our studies . two species of leptocorisa ; leptocorisa acuta and leptocorisa chinensis showed barcode sharing even though later species has been reported from korea . another instance of barcode sharing was observed in genus nariscus where two of its species nariscus fumosus and nariscus fasciatus showed identical barcode . two more cases showed little variation ( < 2% ) in barcode ; coi sequence from an unidentified species of genus tessaratoma in our study ( not identified as javanica by us ) showed 99% similarity with coi sequence from tessaratoma javanica reported by other group ( genbank accession number kf534924 ) . two species of genus plautia ; plautia splendens and plautia stali also showed low interspecies divergence ( 1.3% ) . on the other hand , two cases showed more than 2% intraspecific divergence . in the case of nezara viridula ; although no divergence was observed for haplotypes of our specimens , when coi sequence from genbank ( collected from usa ; accession number jx548495 ) was added for analysis , it showed 2.1% divergence indicating a genetically distinct population . similar case was found in two riptortus species ; riptortus pedestris and riptortus clavatus also showed 2.1% divergence although they have been synonymised recently and treated as r. pedestris on the coreoidea website ( livermore et al . ) . a distinct barcode gap was observed for intra and interspecies divergence ; at higher taxonomic levels , however , there was an overlap in sequence divergence . to resolve this problem , two more phylogenetic trees based on different methods ( ml and mp ) were constructed ( supporting information figure sm3 and sm4 ) . although congeneric and conspecific taxa clustered cohesively in all trees , at family and superfamily level , however , there was no congruence in these trees . only pentatomidae , lygaeidae and pyrrhocoridae showed monophyly in nj tree while other families showed problematic relationship . plant bugs are known to damage a wide range of plants by sucking nutrients from them ( hori , 2000 ) . lygaeus pandurus , for example , is highly polyphagus and is reported from more than 10 plant families ( sweet , 2000 ) whilst dysdercus koneigii is regarded as damaging pest of cotton ( schaefer and ahmad , 2000 ) . dna barcoding may help in quick identification of such pests and therefore the present study focuses on this important insect group . it provides a greater representation of pentatomomorpha bugs by adding more species from western ghats to the existing database . congeners clustered distinctly and coi sequences with same species name clustered cohesively in our present data . both n. viridula and r. pedestris are such a widespread species that it is quite likely to show considerable genetic variation in distant populations resulting in high intraspecies divergence . on the other hand , little variation in barcode for tessaratoma javanica and an unidentified species of same genus in our study indicate the possibility of misidentification or poor genetic differentiation . though our specimen is morphologically very similar to javanica , some of its taxonomic characters do not match with javanica and therefore we believe it to be different from t. javanica . as far as nariscus ( formerly akbaratus ) is concerned , distant ( 1918 ) added two species fasciatus and fumosus to the genus akbaratus which was later synonymized with nariscus ( livermore et al . , 2014 ) ; however , these two species described in distant 's fauna were left out and are still not included in nariscus . identical barcode for these species indicate that they are not separate species and need to be synonymised . little variation in two plautia species ; plautia splendens and plautia stali suggests that these species are very close , although these are considered as separate species ( pentatomoidea website of david rider ) . for species - level identification , the intraspecific divergence must be much less than the interspecies divergence . in this dataset , intraspecific divergences are usually less than 1.0% as observed for 97% of the taxa studied ( only 2 notable exceptions ) , in contrast interspecific divergences always exceeded 3% ( only 3% taxa showing less than 3% interspecies genetic divergence ) . thus , distinct intra and interspecific divergence obtained in the present study indicates that barcode can be used for identification of true bugs at species level . however , at higher taxonomic level , coi - based trees are not satisfactory and may not resolve relationship clearly . though the theme of the present paper is only to suggest the usefulness of coi sequences in identification , we have looked at the possible relationship here . monophyly of family pentatomidae was not supported in ml and mp trees ; also some taxa of superfamily pentatomoidea , for example , a dinidorid cyclopelta always formed a separate cluster from its other family members in all trees indicating problematic relationship in dinidoridae . ( 2008 ) made similar observation based on morphology as well as molecular studies of this group . superfamily coreoidea and family coreidae were polyphyletic as observed by other groups ( li et al . , 2005 , park et al . , 2011 ) . although , pyrrhocoridae and lygaeidae formed a coherent cluster , comments on superfamilies pyrrhocoreoidea and lygaeoidea can not be made because no specimen beyond these two families could be incorporated in the present study . distinct barcode gap and nj clustering analysis in the present data confirms that dna barcoding is helpful in species level identification of true bugs . this technique may be used for quick identification of many more unexplored species from western ghats of india provided that mtcoi sequence database is rich and easily accessible . the study contributes significantly to the barcode data of pentatomomorpha bugs by adding sequences from indigenous true bug species of india and also calls for additional efforts to make more comprehensive reference library . it is unfortunate that hardly any sequence data is available in databases in spite of the fact that all these bugs are economically very important and need quick identification .

recent studies from east asia and canadian national collection of insects have established the utility of dna barcoding technique in identification of true bugs . the present study is an expansion of the database by adding mitochondrial cytochrome c oxidase i ( mtcoi ) sequences from forty three species of indigenous true bugs of india . mtcoi gene analysis of infraorder pentatomomorpha covering a total of seventy three species that belong to five superfamilies ; pentatomoidea , coreoidea , pyrrhocoroidea , lygaeoidea and aradoidea revealed more than 3% interspecific distances in all the taxa studied except for two cases which showed barcode sharing . less than 2% intra - specific divergence was observed in 97% of the taxa analysed and the average interspecies genetic distance was about 29 times higher than the average intraspecies genetic divergence . distinct sequence divergence pattern at generic level and nj clustering analysis suggests that coi barcode is an excellent molecular marker for species level identification of unknown taxa ; however it may not be useful for resolving deep levels of divergence . species identification even at nymphal stage could be achieved confirming the efficacy of this technique .

a previously healthy 59-year - old woman presented with abdominal pain in the lower left quadrant that had persisted for 3 months . additionally , a whole - body positron emission tomography scan showed abnormal hyperuptake lesions in the left 10th rib and 10th vertebral body , suggesting metastasis ( fig . laboratory tests indicated elevated levels of several serum tumor markers ( carbohydrate antigen [ ca ] 19 - 9 , 252.2 u / ml ; ca125 , 62.9 iu / ml ; and carcinoembryonic antigen , 8.73 ng / ml ) . the surgeon prioritized surgery for this patient not only because of her aggravated symptoms , but also because the tumor had invaded the left brachiocephalic vein . approached through a median sternotomy , an extended thymectomy and combined resection of the pericardium were performed . incomplete resection was inevitable because of tumor invasion into the pericardium , phrenic nerve , innominate vein , and aorta . microscopic examination revealed that the tumor was surrounded by normal thymic tissue and was composed of various - sized glandular structures ( fig . the tumor cells were columnar and oval , forming cystic , tubular , and cribriform structures containing necrotic material . immunohistochemical staining showed focally positive ck7 staining and diffusely strong positive staining for ck20 and cdx2 ( fig . 2c g ) but negative staining for thyroid transcription factor 1 ( ttf-1 ) and napsin a. cd5 staining was positive for both tumor cells and t lymphocytes in the normal thymus parenchyma and stroma between tumor cell nests ( fig . clinically , the possibility of metastatic adenocarcinoma from the lung was raised ; however , the multiple small lung nodules measured less than 1 cm , and the tumor cells were negative for ttf-1 and napsin a. furthermore , the pathologic features suggested metastatic adenocarcinoma of enteric origin ; however , physical and radiologic examinations did not reveal primary tumors elsewhere , including in the gastrointestinal tract . these observations collectively led to a pathologic diagnosis of primary thymic adenocarcinoma of enteric immunophenotype with tubular morphology . adjunctively , extensive sampling revealed no mucin pools or papillary structures and no other histologic components such as thymic cysts , thymomas , or teratomas . the patient is alive with aggravated bone and lung metastasis after 11 months of follow - up . it was first reported in 1989 by moriyama et al . but was not accepted as a valid histologic subtype until 1997 . nonpapillary adenocarcinomas include a heterogeneous group of tumors , such as mucinous adenocarcinoma , adenocarcinoma with glandular differentiation , adenocarcinoma with adenoid cystic carcinoma features , and hepatoid carcinoma . this heterogeneity , coupled with the rarity of the carcinoma , has led to a paucity of information on the specific clinicopathologic features of thymic adenocarcinoma . according to a series of case reports in which descriptive classifications are commonly used , thymic adenocarcinomas comprise papillary [ 4 - 6 ] , mucinous [ 3,7 - 9 ] , glandular ( or tubular ) [ 10 - 12 ] , and papillotubular adenocarcinomas . in 2003 , maghbool et al . reviewed 26 previous cases of reported thymic adenocarcinomas and demonstrated that the mucinous type shows a significantly worse prognosis than the papillary type . moser et al . recently reported two cases of primary thymic adenocarcinoma with ck20 and cdx2 expression , which reflects enteric differentiation , and suggested this is a novel subtype along with 11 reported thymic adenocarcinomas with enteric immunophenotype . for this study , we also reviewed english literature of thymic adenocarcinomas , except for thymic carcinomas with adenoid cystic carcinoma features . in analysis of clinicopathologic features , including the current case , there are currently 39 reports of primary thymic adenocarcinomas , consisting of 16 mucinous adenocarcinomas ( 41.0% ) , 13 papillary adenocarcinomas ( 33.3% ) , seven tubular adenocarcinomas ( 17.9% ) , and three papillotubular adenocarcinomas ( 7.7% ) . among these cases , information on ck20 and/or cdx2 expression was available for 20 cases , revealing that 15 were enteric type and five were not . the morphology of these enteric - type adenocarcinomas was mucinous in 11 cases , tubular in three cases , and papillotubular in one case . furthermore , the enteric - type adenocarcinomas and mucinous / tubular adenocarcinomas have similar clinicopathologic features . a total of seven of the 14 cases of mucinous / tubular adenocarcinomas were accompanied by thymic cysts . moreover , mucinous / tubular adenocarcinomas showed cd5 expression more frequently ( 76.4% ) than papillary adenocarcinomas ( 33.3% ) . similarly , 12 of 15 enteric - type adenocarcinomas ( 80% ) showed cd5 expression , and eight ( 53.3% ) were accompanied by thymic cysts . in general , low - grade histology ( well - differentiated squamous cell carcinoma , mucoepidermoid carcinoma , and basaloid carcinoma ) , low masaoka stage , and complete resection are factors known to be associated with better survival from thymic carcinoma . kaplan - meier analysis of thymic adenocarcinomas revealed that modified masaoka stage i or ii disease had better disease - free survival than stage iii or iv disease ( p=.040 ) . additionally , we found that mucinous / tubular subtype showed a trend toward poorer overall survival than papillary or papillotubular subtype , in line with previous findings ; however , this result failed to reach statistical significance in kaplan - meier analysis ( p=.610 ) . interestingly , the non - enteric type seemed to have worse prognosis than the enteric type ( mean survival time , nonenteric vs enteric type , 22.17.4 months vs 85.623.1 months ) , especially for those with mucinous morphology ( mean survival time , nonenteric vs enteric type , 7.34.2 months vs 91.924.4 months ) ; however , the number of cases was too small to analyze for statistical significance . other factors of sex , tumor size , associated thymic cyst or thymomas , serum tumor marker elevation , or c - kit or cd5 immunoexpression were not related to prognosis . in summary , we report a rare case of primary tubular adenocarcinoma of the thymus with enteric immunophenotype . to the best of our knowledge , there have been only two such cases worldwide . we believe that identification of more cases is essential in order to investigate the clinicopathologic characteristics of primary thymic adenocarcinomas .

thymic carcinomas are uncommon malignant tumors , and thymic adenocarcinomas are extremely rare . here , we describe a case of primary thymic adenocarcinoma in a 59-year - old woman . histological examination of the tumor revealed tubular morphology with expression of cytokeratin 20 and caudal - type homeobox 2 according to immunohistochemistry , suggesting enteric features . extensive clinical and radiological studies excluded the possibility of an extrathymic primary tumor . a review of the literature revealed only two global cases of primary tubular adenocarcinomas of the thymus with enteric immunophenotype .

a 37-year - old woman presented to us complaining of sudden right flank pain and lower abdominal pain that had lasted for 1 week , as well as nausea and vomiting . two years previously she had undergone a laparoscopic right partial nephrectomy at another hospital owing to a small right renal mass that was diagnosed as renal cell carcinoma ( t1an0m0 ) . postoperatively , she had gradually acquired lower urinary tract symptoms , such as urge incontinence , urgency , frequency , and nocturia . three months earlier , she had been checked with abdominopelvic computed tomography ( ct ) for regular follow - up of the renal cell carcinoma and heard that there were no definite abnormal findings in the ct scan . in the physical examination , the results of a urine test showed 5 to 10 red blood cells per high power field , and plain x - ray of the kidney , ureter , and bladder revealed metallic surgical clips on the right upper abdomen and a possible right renal stone , but no abnormal density on the ureteral courses ( fig . 1 ) . the abdominopelvic ct scan revealed a 0.5 cm1.0 cm opacity on the right proximal ureter with borderline hydronephrosis and a tiny right renal stone ( fig . 2 ) . ureteroscopy with the patient under general anesthesia showed a white rectangular parallelepiped foreign body at the proximal right ureter ( fig . the foreign body was removed by use of a ureteroscopic stone basket device and was identified as a medium - sized surgical clip ( fig . 3b ) . there was no extravasation of the renal pelvis during contrast media instillation via the channel of the ureteroscope . a ureteral stent was placed for 1 week , and the patient had no more flank pain . currently , partial nephrectomy is considered a standard treatment for small renal tumors with the benefit of preserving renal function ; improving overall survival , especially for patients younger than 65 years of age ; and decreasing the overall mortality rate . for t1b tumors , more clinical data are required to establish the oncological and functional benefits of partial nephrectomy ( pn ) . lpn has come to represent comparable perioperative and oncological outcomes in the recent era and has gained popularity , although it remains a challenging and highly advanced laparoscopic procedure . the most demanding step during lpn is the repairing of the collecting system and renal defect because this repair requires advanced laparoscopic skills and is performed under time pressure to minimize the warm ischemia time . there is a report of the migration of absorbable lapra - ty suture clips in the collecting system after lpn , and massoud also reported the migration of a metal surgical clip into the ureter after opn , all of which were passed spontaneously . furthermore , intravesical migration and stone formation of a surgical clip after laparoscopic radical prostatectomy has been reported , but there have been no reports of ureter migration of a surgical clip after partial nephrectomy . reviewed the different sealants and laparoscopic instruments that are available for achieving hemostasis of the renal parenchyma in lpn and determined that there is no gold standard single agent or combination that can be applied to all cases . the decision as to which technology to use and how to manage the hilum should be made on a case by case basis . hem - o - lok or metal clips that are used to repair the collecting system and the renal defect in lpn can migrate postoperatively and cause secondary complications , such as urinary stones . ureteral stones following lpn can be managed conservatively with hydration and narcotics , but if symptoms do not improve , surgeons may consider more aggressive ureteroscopic management .

we report a case of ureteral migration of a surgical clip after partial nephrectomy in which the clip was misdiagnosed as a ureteral stone . a 37-year - old woman had undergone laparoscopic partial nephrectomy of right renal cell carcinoma at another hospital 2 years previously . postoperatively , she had gradually acquired lower urinary tract symptoms . then , she complained of sudden right flank pain for a week . a plain x - ray and enhanced abdominopelvic computed tomography scan were performed . a 0.5 cm1.0 cm right upper ureteral opacity with borderline hydronephrosis was seen but could not be found on the x - ray . ureteroscopy revealed a medium - sized hem - o - lok clip on the right upper ureter that was removed with a stone basket . we concluded that a hem - o - lok clip used for collecting system sealing had migrated to the ureter and had been misdiagnosed as a ureteral stone on a computed tomography scan .

inability to accurately determine which sequences are present in a sample , and hence the abundances of rare taxa , greatly inhibits our ability to infer important ecological parameters such as rank - abundance curves , yet ironically the portion of the rank - abundance curve that can be inferred , i.e. of the common taxa , provides a solution to the conundrum of the expense of denoising . empirical rank - abundance curves , especially from human - associated samples , tend to be dominated by a relatively small number of abundant taxa . given this feature of actual microbial communities , performing all - on - all comparisons for clustering is exceedingly inefficient : instead , a subset of reads suffices to identify the common otus , which can then be iteratively removed by recruitment to an existing cluster . consequently , we can rapidly determine the otus that are most likely to be abundant , concentrate initially on comparing reads to the small number of abundant otus ( removing matches from the analysis ) , and then cluster only the leftover reads representing more divergent sequences . we can thus reduce the total number of sequence comparisons using empirical features of the abundance distribution of real datasets as follows . first , we devised a fast pre - filter , removing reads that are strict prefixes of other reads , and compute an initial sequence distribution . we then sort the prefix clusters in descending order of abundance , and use this initial distribution to cluster similar reads , comparing each additional unclustered read to the most abundant clusters first because we expect the abundant clusters to yield a larger number of erroneous near - matching reads due to their numerical dominance alone . for a more detailed description of the algorithm , see supplementary methods . a similar method of pre - clustering on the sequence level and subsequent sequence clustering along the abundance distribution has been proposed recently11 . the method introduced here is a major improvement over previous flowgram - based denoising routines10 in terms of compute resources , yet retains the advantage that singletons are not discarded entirely , allowing exploration of the rare biosphere12 . previously , a mid - size 24-core cluster was needed to analyze a small dataset of around 40,000 sequences in around 10 hours . our method allows the same dataset to be denoised in less than an hour on a single laptop computer ( table s1 ) . we can also denoise full 454 runs with 500,000 sequences on a mid - size cluster in 1 day . we can thus address questions in community ecology that were previously intractable . applying these new methods to the most comprehensive survey of human - associated body habitats yet performed4 , we find that denoising produces a substantial decrease in the diversity both at the otu level and in terms of the phylogenetic diversity ( the total branch length associated with each sample on a phylogenetic tree14 ) . however , the results from the non - denoised ( but filtered ) and denoised data are highly correlated ( r = 0.97 , p < 10 for phylogenetic diversity ) , suggesting that relative results concerning diversity within each sample are robust to the types of errors introduced by pyrosequencing ( fig . 1a f ) . interestingly , in spite of this high correlation , denoising changes the relative order of otu richness of individual body habitats . although the gut exhibits the highest otu richness without denoising , it falls back into the middle ranks after denoising . the drastic reduction after denoising might be an effect of the sequence composition of the dominant otus in the gut ( see supplementary methods for a more detailed discussion ) . similarly , when clustering the samples using unifrac , the non - denoised and denoised reads produce very similar patterns ( fig . h ) , reinforcing the point that errors introduced into each sample by noise or chimeras have little effect on beta diversity because they inflate the distances among all samples rather than introducing artifactual similarities between specific pairs of samples15 . we conclude that the availability of these new methods will make more accurate assessments of alpha diversity available to a wide range of researchers ( especially in conjunction with improved chimera - checking methods such as chimeraslayer , http://microbiomeutil.sourceforge.net/ ) , and will greatly improve our understanding of microbial communities in habitats with scales ranging from global to extremely personal . the efficiency of the new techniques and the fact that they can change conclusions about the relative diversity in different habitats suggests that they should be applied routinely in all pyrosequencing studies where estimates of diversity within each sample are the goal .

we developed a fast method for denoising pyrosequencing for community 16s rrna analysis . we observe a 24 fold reduction in the number of observed otus ( operational taxonomic units ) comparing denoised with non - denoised data . ~50,000 sequences can be denoised on a laptop within an hour , two orders of magnitude faster than published techniques . we demonstrate the effects of denoising on alpha and beta diversity of large 16s rrna datasets .

medicinal plants have been employed in various traditional medicines throughout the world since ancient time . they have been a rich source of chemicals and thus many bioactive compounds have been isolated in their pure form . flavonoids are a class of naturally occurring plant secondary metabolites imparting protection to the reservoir [ 1 , 2 ] . they are compounds of low molecular weight and are chemically polyphenolic in nature presenting a common benzo--pyrone structure . they have enormous biological and pharmacological activities conferring many health benefits to the human [ 1 , 2 ] . they are the group of compounds which received considerable attention from the researchers as depicted from the scientific literature . mostly they are present in plants as glycosides but can also be isolated in free aglycon form [ 4 , 5 ] . dracocephalum heterophyllum benth . is a small perennial aromatic herb belonging to the family lamiaceae and has been of medicinal importance in chinese traditional medicine . it is used in traditional way of treatment of tracheitis and cardiovascular disease in xinjiang and in tibet region of china [ 46 ] . the plant used has been extensively used in amchi system of medicine in the ladakh region of the himalaya for a long period . the decoction of dried flowers and leaves is used in cold , cough , and headache treatment . the essential oil of the plants has been shown to possess antimicrobial and antioxidant activities and thus can be used in cosmetics , food , and pharmaceutical industries . considering the importance of the phytochemicals responsible for the medical properties of dracocephalum heterophyllum benth . , the investigation was carried out for antioxidative , antidiabetic , and anticancer activity and the presence of phytochemicals with biological activity . aerial part of dracocephalum heterophyllum is said to contain as many as 10 types of flavonoids , and among these are luteolin , kaempferol , diosmetin , and chrysosplenetin . we have isolated 9 flavonoids from plant which were named chrysosplenetin , diosmetin , luteolin , acacetin 7-o - rutinoside , diosmetin 7-o - glucoside , rutinoside , kaempferol , kaempferol 3-o--d - glucoside , and quercetin [ 4 , 5 ] . various methods have been employed for the determination of flavonoids based on the electrophoresis and chromatography [ 1 , 2 , 915 ] . hplc is the method of choice among the chromatographic techniques for the analysis of flavonoids which needs no derivatization and thus reduces the time consumption in comparison to gc [ 1 , 2 , 10 ] . moreover , it is safe for flavonoids as it can be operated even at room temperature thus avoiding the risk of decomposition of compounds like flavonoids at high temperature . the present paper deals with the quantification of four flavonoids , namely , luteolin , kaempferol , diosmetin , and chrysosplenetin , which are available in free aglycon forms in the plant under study , using the hplc in a single run . further , this is the first paper describing the quantification of these four flavonoids in the plant extract under study . the aerial parts of dracocephalum heterophyllum were collected from atush in xinjiang , china , in august 2010 , respectively . after being air - dried in nature , the plant was ground with a laboratory mill and then passed through a 20-mesh sieve . the standards of chrysosplenetin , diosmetin , kaempferol , and luteolin were isolated from d. heterophyllum in the pure form . acetonitrile , hplc grade , was purchased from lichrosolv , merck , darmstadt , germany ; the methanol and formic acid ( lichrosolv , merck , darmstadt , germany ) were of analytical reagent grade . extraction efficiency was determined based on the total extractive percent value using different compositions of aqueous ethanol as 50% , 70% , 80% , and 95% at room temperature for 48 hours . afterwards , one hundred grams of above ground part of d. heterophyllum was weighed accurately and extracted with 400 ml of 80% aqueous ethanol for 48 hours at room temperature . the extract was filtered , decolorized , and defatted by petroleum ether for several times . the extract was reduced to dryness through rotary evaporator under reduced pressure yielding 20 mg dried extract . the extract was reconstituted in 1 ml of pure methanol and injected 10 l into the column . one g of plant material was extracted with 50 ml of methanol under reflux and the extract obtained was reduced to dryness . the residue was reconstituted in 10 ml of methanol and this extract was used for the determination of total flavonoids contents . briefly , 0.5 ml of plant extract / standard solution was mixed with 1.5 ml of methanol in a test tube . 0.1 ml of 10% aluminum chloride , 0.1 ml of 1 m potassium acetate , and 2.8 ml of distilled water were added to the test tube and mixed thoroughly after each addition . it was allowed to react for flavonoid - aluminum complex formation for 30 minutes at room temperature . afterwards , the absorbances of the reaction mixtures were measured at 415 nm using the uv - visible spectrophotometer . quercetin was used as standard and six working standard solutions were prepared in the concentration range 0.01 mg / ml to 0.1 mg / ml for constructing the calibration curve . the four flavonoid standards , that is , luteolin , kaempferol , diosmetin , and chrysosplenetin , were mixed and stock solution of standard flavonoids mixture was prepared in methanol having 1 mg / ml concentration of each standard . from this stock solution , four working standard solutions with a concentration range 0.00011 mg / ml were prepared . hplc analysis was performed using a dionex ultimate 3000 hplc system ( thermo - fisher , usa ) equipped with autosampler and coupled to variable uv wavelength detector . the chromatography was performed on sunfire c18 column from waters , usa , having the following specifications : internal diameter 4.6 mm , height 250 mm , and particle size 5 m . the chromatographic column was protected by a sunfire c18 guard column of the following dimensions : internal diameter 4.6 mm , height 20 mm , and particle size 5 m obtained from waters , usa . the control of the instrument and the data analysis was performed by chromeleon version 7.2 software provided by the supplier . chromatographic conditions were optimized in order to reach baseline separated peaks of the target analytes . for this purpose , different mobile phases with varying gradient elution were employed . the mobile phase consisting of a : methanol and b : 0.1% ( v / v ) formic acid in water with the gradient set up as mentioned below delivered good baseline separation of the targeted peaks . the gradient used was as follows : zero time condition was 8% a and it was increased to 78% a in 50 minutes . 10 l of the sample extract and the standards were injected into the chromatographic column maintained at 35c . the flow rate used was 1 ml / min and detection of the eluted peaks was performed at 254 nm . the method of extraction by soaking the plant material in solvent was selected due to its simplicity and easy manageability . ethanol in combination with water was used as extracting solvent because of its less toxicity and easy availability . different combinations of ethanol with water as 50% , 70% , 80% , and 95% aqueous ethanol were evaluated in order to determine the extraction efficiency and to reach optimized solvent for extraction . figure 1 shows the graphical comparison of the extraction yields of various compositions of aqueous ethanol . 80% ethanol delivered the highest extraction yield ( 3.76 mg / g ) among the tested solvents . the extractive values for 50% , 70% , and 95% ethanol were 3 mg / g , 3.4 mg / g , and 2.35 mg / g , respectively , from dry d. heterophyllum plant . total flavonoids contents were determined using the published method in the literature using alcl3 as complexation reagent forming a complex with flavonoids which has a maximum absorption at 415 nm . total flavonoids contents were quantified as equivalent of quercetin and calibration curve was produced with an r value 0.9971 . the calibration curve was passed through zero and the contents of flavonoids were calculated using the regression equation obtained from the calibration curve . the total flavonoids contents yielded in the aerial part of d. heterophyllum were 0.324 mg / ml of the final extract . preliminary separation of the standard mixture and the extract was performed with mobile phase consisting acetonitrile and 0.1% ( v / v ) formic acid in water using the gradient mode of elution . this mobile phase did not deliver good resolution as in figure 2 it is clear that at 48 min two target peaks of luteolin and quercetin and at 58 min two target peaks of diosmetin and kaempferol are coeluting and are merged . therefore , quantification of these four flavonoids was not possible as baseline separated peaks are required for the quantitative determination . therefore , the mobile phase was changed to methanol and 0.1% ( v / v ) formic acid in water using the conditions as described in experimental section . with this optimum baseline separation of the target analytes the peaks of target flavonoids luteolin , kaempferol , diosmetin , and chrysosplenetin eluted at retention times 38.8 min , 41.5 min , 42.3 min , and 45.8 min , respectively , in the sample extract . using the optimized chromatographic conditions calibration curves for the four flavonoids were established through analyzing working standard solutions in triplicate . regression equations and r values and percentage concentrations of the flavonoids in the plant extract obtained from these analyses are tabulated in table 1 . contents of individual flavonoids were calculated as percentage of the dried extract using the regression equations . contents of the diosmetin ( 0.28% ) and chrysosplenetin ( 0.79% ) were significant and luteolin yielded the lowest amount ( 0.08% ) in this study while the amount of kaempferol was 0.14% . standard deviation and the % rsd are the results of the five replicate injections of the plant extracts . lod and loq were calculated using microsoft excel sheet based on standard deviation ( table 1 ) . reproducibility and accuracy of the method were tested by analyzing the sample extract five times and their standard deviation and % rsd were calculated based on retention times and area under the curve for each target analytes individually . table 2 shows the data obtained from the five replicate injections of the sample extract . in no case , the % rsd was higher than 1 taking retention time as a factor while in the case of area under the curve maximum % rsd was noted in the case of diosmetin as 2.85 ( table 2 ) . percent recovery of the optimized hplc method was determined through injecting the two concentrations ( 1 mg / ml and 0.1 mg / ml ) of each individual flavonoid standard under study . this experiment resulted in the recovery percentage within the acceptable range of 95% to 105% according to the ich guidelines for validation of analytical methods . from our literature review regarding the plant species under study , it appears that these flavonoids have not been quantified before and are reported for the first time in this paper . the study proved the presence of biologically and pharmacologically important flavonoids in quantifiable amount making the plant dracocephalum heterophyllum b. beneficial for the preparation of phytopharmacon . the results of the study can be used for developing the quality control profile by the pharmaceutical and phytopharmaceutical industries . further , the method applied is reliable and reproducible and can be used for the determination of flavonoids in plant extracts .

quantification of the four flavonoids , namely , luteolin , kaempferol , diosmetin , and chrysosplenetin , has been performed for the first time in 80% ethanolic extract of dracocephalum heterophyllum b. through hplc coupled to uv detector after optimization of extracting solvent and chromatographic conditions . total flavonoids quantified were 0.324 mg / ml of the extract . hplc analysis delivered contents of the luteolin , kaempferol , diosmetin , and chrysosplenetin as 0.08% , 0.14% , 0.28% , and 0.79% of the dried extract , respectively . lod ( % ) values calculated were 0.04 , 0.03 , 0.03 , and 0.08 and loq ( % ) values were 0.08 , 0.12 , 0.11 , and 0.28 for luteolin , kaempferol , diosmetin , and chrysosplenetin , respectively . the recovery percentages for these flavonoids were within the acceptable range of 95% to 105% . standard deviation and % rsd were calculated for each target analytes individually in extract for determining the reproducibility and accuracy of the method . in no case the % rsd was higher than 1 taking retention time as a factor while in the case of area under the curve maximum % rsd was noted in the case of diosmetin as 2.85 . from our literature review regarding the plant species under study , it appears that these flavonoids have not been quantified before and are reported for the first time in this paper .

traumatic basal ganglia hemorrhage ( tbgh ) is uncommon in head injuries and is reported in about 3% of patients.3 ) tbgh is associated with poor prognosis than other types of posttraumatic intracranial hemorrhages . we report a case of a child with bilateral tbgh and discuss our experience concerning treatment and hospital course . a six - year - old boy was referred to our hospital after a traffic accident . he presented with decreased mentality ( glasgow coma scale score of 6 ) , with an endotracheal tube and mechanical ventilation . computed tomography ( ct ) scans showed bilateral tbgh , about 30 cc in the right side and 20 cc in the left side ( figure 1a ) . we decided to remove bilateral tbgh to reduce increased intracranial pressure ( icp ) ; this was done by bilateral stereotactic hemorrhage aspiration ( figure 1b ) . postoperatively , he was transferred to the intensive care unit where he was sedated and ventilated . immediate postoperative brain ct confirmed the appropriate location of both draining catheters and the persistence of hemorrhage , with more hemorrhage on the right side ( figure 1b ) . we started irrigation via a draining catheter with 8,000 iu of urokinase dissolved in normal saline every 8 hours over 2 days on the right side . after the administration of urokinase , 3 cc normal saline was injected into the clot . at total of 5 cc of diluted urokinase and normal saline were administered . the amount of drain was about 110 cc dark - colored blood mixed with cerebrospinal fluid on the right side and less than 5 cc on the left side during the first 24 hours postoperatively . on the second day after operation , brain ct follow - up demonstrated diffuse low density around the previous hemorrhage and severe brain swelling ( figure 2a ) . shortly after brain ct , the patient 's right pupil size suddenly became dilated and unresponsive to light . ( pod ) 11 , brain ct showed further reduction in bilateral tbgh and ivh and enlargement of ventricle size associated with scalp bulging at the operation site ( figure 3a ) . at pod 39 , ventriculoperitoneal shunting and cranioplasty using autologous bone tbgh is uncommon and bilateral tbgh is extremely rare.36 ) we were unable to find any case of bilateral tbgh in a child in the literature and could not obtain any information about the hospital course and treatment . the child 's brain is resilient and able to compensate for acutely increased icp due to intracerebral hematoma because the skull has expansibility.2 ) anatomical aspects of younger child to head injuries are large head to body ratio , relatively weak neck , thinner skull , and larger subarachnoid space in which the brain can move freely.13 ) for this reason , a child 's brain has the ability to expand and buffer against impact but vulnerable to damages . a small amount of tbgh ( < 2 cm in diameter ) can be considered as a hemorrhagic contusion.4 ) it can be related to diffuse axonal injury when it is associated with contusions and/or small hemorrhage in the corpus callosum , basal ganglia , tegmentum of pons , ivh , and acute brain swelling.11 ) the pathophysiologic mechanism of unilateral tbgh is unclear , but is believed to occur from shear strain in ganglionic lesion.12 ) mosberg and lindenberg4 ) demonstrated a traumatic tear of a pallidal branch of anterior choroidal artery as the origin of pallidal hematoma in an autopsy case . head injuries including traffic accidents associated with acceleration and deceleration forces with rotational movement traumatic dissection of perforating arteries , mainly the anterior choroidal artery or lenticulostriate artery , can cause basal ganglia hemorrhage.61012 ) still , the exact explanation for bilateral tbgh is elusive in the literature . we think this phenomenon could develop by similar mechanism , but do not know whether the hemorrhage developed simultaneously in both sides or separately over time . in this case , initial ct scans showed a difference in hemorrhage volume on both sides of the brain , with the larger diameter of 3.6 cm on the right side and 3.1 cm on the left side . this finding did not provide any clues about the mechanism of bilateral hemorrhage development , especially the time sequence . whether to treat this patient or not depended on his clinical condition . our patient showed poor neurological condition at admission and we decided to remove both hemorrhage areas using stereotactic aspiration and periodic urokinase irrigation . six hours after admission the operation was performed and urokinase irrigation was done every 8 hours . no literature references concerning urokinase irrigation for children are available ; we decided to use 8,000 iu of urokinase , which is the amount that we usually use to treat adult patients . initially , 5 cc of regimen would be tolerable for a child . during the first 24 hours postoperatively , 110 cc was drained from the right side indicating cerebrospinal fluid mixture , with < 5 cc drained from the left side . routine brain ct at pod2 demonstrated markedly decreased hemorrhage at both basal ganglia but diffuse low density lesions around the previous hemorrhage . these findings are not typical in adult basal ganglia hemorrhage and we presumed the cause of this finding the possibility of the urokinase overdosage and toxicity . brain edema caused by thrombin might be greatly amplified by the presence of plasminogen activators , perhaps because the latter compete for naturally occurring thrombin inhibitors.1 ) the authors concluded that in the context of intracerebral hemorrhage the use of tissue plasminogen activator or urokinase ( upa ) to lyse clotted blood in brain parenchyma may promote edema formation in surrounding tissue.7 ) a case featuring protracted perihematomal edema after hematoma evacuation and fibrinolysis therapy with upa was reported.8 ) recent studies indicate that no differences in permeability could be detected between newborn and adult blood - brain barrier ( bbb ) capillaries and the newborn bbb has restrictive properties similar to that of the adult . in our case under the condition of bbb disruption due to initial hemorrhage injection of adult dose of urokinase into the hemorrhage site may aggravate cerebral edema around cerebral tissue.579 ) also , the total of 110 cc drainage through the right draining catheter may have masked this edema formation during the first postoperative 24 hours . thus we presumed his neurological condition was poor and that a second operation was needed . bilateral tbgh is very rare in children and there are limited information how to treat child patients . further investigations into the use of urokinase , especially in children , are needed .

traumatic basal ganglia hemorrhage ( tbgh ) is a rare presentation of head injuries . bilateral lesions are extremely rare . the pathophysiologic mechanism of bilateral tbgh seems to be the same as diffuse axonal injury . however , limited information about childhood bilateral tbgh is available in the literature . we report the case of a child with bilateral tbgh treated with stereotactic aspiration of hemorrhage and periodic urokinase irrigation .

pseudomonas aeruginosa is a gram - negative , aerobic bacterium found in water and soil . it is a normal flora of the skin and gastrointestinal tract of human beings ( 1 , 2 ) . this bacterium as an opportunistic pathogen is one of the most important microorganisms in nosocomial infections in immune - compromised patients including patients with malignancies , cystic fibrosis and burns with multiple pathogenic factors and high rate of resistance to most of the antibiotics . the presence of glycocalyx in cellular membrane is responsible for easy binding of the bacterium to the host cell , biofilm formation and protection of bacteria against penetration of antimicrobial agents and phagocytic system ( 3 ) . in a previous study , p. aeruginosa has been isolated from nosocomial pneumonia ( 16% ) , nosocomial urinary tract infections ( 12% ) , post - operative wound infections ( 85% ) and hospital blood infections ( 10% ) which included 23% of total isolated bacteria from admitted patients ( 4 ) . selection of the appropriate treatment approach against p. aeruginosa is limited due to its resistance to common recommended antibiotics ( 5 , 6 ) . bacterial resistance to antibiotics is increasing which makes humans to apply effective antimicrobial agents with fewer side effects such as medicinal plants instead of medicines with less efficacy and greater side effects ( 7 ) . plants have different chemical compounds like secondary metabolites ( 8 , 9 ) with many biochemical and bioactivity properties showing applications in various industries such as pharmaceutical , chemical , cosmetic and food industry ( 1013 ) . the aim of this study was to introduce the most important native medicinal plants of iran being effective on p. aeruginosa . all required information was obtained by literature review using keywords including p. aeruginosa , medicinal plant extracts or essential oils of published articles in authentic scientific databases such as science direct , wiley - blackwell , springer , google scholar , scientific information database ( sid ) and magiran . according to literature review , our results showed 12 different native medicinal plants were effective against p. aeruginosa in iran including eucalyptus camadulensis , marticaria chamomilla , ferula gummosa boiss , lawsonia inermis , ocimumgra tissimum , allium sativum , satureja hortensis l , satureja bachtiarica bunge , satureja khuzestanica ( jamzad ) , thymus daenensis celak , thymus carmanicus jalals and camellia sinensis . medicinal plants are good alternatives for synthetic preservatives in food and drug industry due to their antimicrobial compounds . e. camadulensis ( eucalyptus ) leaves are rich in polyphenols and terpenoids and eucalyptol or cineole ( 26 ) . phytochemicals results showed that alfa and beta - pinenes are the main ingredients of ferula gummosa boiss ( galbanum ) ( 27 ) and lawsoniainermis ( henna ) containsmanitol , tanic acid , mucilage and galic acid but its most important ingredient is 2-hydroxy-1,4-naphoquinone ( lawson ) recognized as bioactive agent . ocimumgra tissimum ( basil ) contains essential oils , tannins , glycosides , saponin , anthocyanin , eugenol , linalool , methyl cinnamate , camphor and thymol . different species of satureja ( savory ) contain monoterpenes , phenolic compounds especially carvacrol , thymol and eugenol as well as some of the sesquiterpenes . the main phytochemical essential oils of aromatic plants are hydrocarbons , aldehydes , ketones , alcohols , phenols , ethers and esters with phenolic and terpenic sources . the presence of linalool , alpha - pinene , beta - pinene , borneol , carvone , limonene , carvacrol , p - cymene and terpinenein essential oils of understudy plants showed antimicrobial properties particularly ( 28 ) . these compounds with high hydrophobic properties can separate lipids from bacterial cell wall and thereby increase the permeability of the membrane which leads to ion expelling and electron imbalance and eventually cell death . the researchers demonstrated that plant species used in popular medicine are promising resources for antimicrobial treatments ( 13 , 14 , 29 , 30 ) . phytochemical analysis has shown that bioactive compounds of medicinal plants with their antioxidant and antimicrobial properties are good substitutions for synthetic drugs in food and drug industry .

background and objectives : pseudomonas aeruginosa is a gram - negative , aerobic bacterium found in water and soil . it is a normal flora in skin and gastrointestinal tract of human beings . p. aeruginosa as an opportunistic pathogen involved in nosocomial infections having multiple pathogenic factors and shows high rate of resistance to different antibiotics . the aim of this study was to identify the most important native medicinal plants of iran effective on p. aeruginosa.materials and methods : all required information was obtained by searching keywords such as p. aeruginosa , medicinal plant extracts or essential oils in published articles in authentic scientific databases such as science direct , wiley - blackwell , springer , google scholar , scientific information database ( sid ) and magiran.results:according to the literature review , our results showed 12 different native medicinal plants were effective against p. aeruginosa in iran including eucalyptus camadulensis , marticaria chamomilla , ferula gummosa boiss , lawsonia inermis , ocimumgra tissimum , allium sativum , satureja hortensis l , satureja bachtiarica bunge , satureja khuzestanica ( jamzad ) , thymus daenensis celak , thymus carmanicus jalals and camellia sinensis.conclusion:phytochemical analysis has shown that bioactive compounds of medicinal plants with their antioxidant and antimicrobial properties can be good alternatives for the synthetic medicines in food and drug industry .

infantile hemangioma ( ih ) is the most common benign tumor of infancy,1 affecting nearly 10% of children under 1 year old and 30% of premature babies . prematurity , older maternal age , preeclampsia , and multiple gestations have been suggested to be risk factors of the development of ih.2 approximately 60% of hemangiomas are located at the head and neck regions,3 and they present with a 2.4:1 ratio of females to males.4 their large size , facial location , and/or segmental morphology are the major risk factors associated with the development of complications including ulceration , functional impairment , and permanent disfigurement.5 as most ihs can involute spontaneously , there is still great controversy over the management of ih . however , consensus was achieved in that when the tumor gives rise to infection , ulceration , necrosis and bleeding resulting in serious disfigurement , dysfunctions and even threatening life , treatment is urgently required . the lesions that potentially impair vital function or cause life - threatening complications are described as alarming hemangiomas.6 there is no gold standard for alarming hemangioma . recombinant interferon alpha ( ifn- ) , an inhibitor of angiogenesis , has been used successfully in treating complicated ih , particularly in hemangiomas that have failed to respond to oral propranolol.7,8 however , concerns of irreversible neurotoxicity , especially spastic diplegia , handicap the application of ifn-.911 here , we present a study where we treated eleven chinese cases of alarming hemangioma with ifn-2a . the study was approved by the ethics committee at the ninth people s hospital , shanghai jiao tong university ( shanghai , people s republic of china ) . eleven consecutive infants ( nine girls and two boys ) with alarming hemangiomas in the head and neck region who failed to respond to a 2-week course of propranolol or corticosteroid therapy , and who received a subcutaneous injection of ifn- in our institution between january 2009 and december 2010 were enrolled in this study . all patients had large ( > 5 cm in diameter ) or multiple hemangiomas ( 2 sites ) in the head and neck region ; in three patients , the hemangioma caused airway obstruction . the demographic data regarding each patient s age , sex , site of lesion , and duration of treatment are shown in table 1 . the diagnosis of hemangiomas was established mainly by obtaining the patient s history , noting clinical manifestations , and performing a physical examination . all patients underwent ultrasonography , and four patients had a magnetic resonance imaging ( mri ) examination to obtain more details of the lesion ( when the diagnosis was uncertain , mri was performed ) . after informed consent had been obtained from the parents according to institutional guidelines , the patients were treated with ifn-2a for a period of 24.5 months . ifn-2a was administrated subcutaneously once daily at a dose of 310 units / m per day . periodical baseline electrocardiogram , neurologic examination , and laboratory evaluations of hepatic transaminases were performed . the size and extent of the deep - seated lesions were monitored by serial color doppler ultrasonography ; the percent change of the superficial lesions compared the pre- and posttreatment tumor size using photographs . the patients were observed at an interval of 3 weeks during the therapy course ; follow - up visits were continued for up to 2 years . the final results were assessed by two other physicians from the department of oral oncology , depending on the clinical examinations , photographs , and doppler ultrasonography taken before and after treatment ; the response to ifn-2a therapy was evaluated according to the following scale ( that was modified following achauer et al12 ) : scale 1 , poor response ( shrinkage 0%25% ) ; scale 2 , fair response ( shrinkage 26%50% ) ; scale 3 , good response ( shrinkage 51%75% ) ; scale 4 , excellent response ( shrinkage 76%100% ) . eleven consecutive infants ( nine girls and two boys ) with alarming hemangiomas in the head and neck region who failed to respond to a 2-week course of propranolol or corticosteroid therapy , and who received a subcutaneous injection of ifn- in our institution between january 2009 and december 2010 were enrolled in this study . all patients had large ( > 5 cm in diameter ) or multiple hemangiomas ( 2 sites ) in the head and neck region ; in three patients , the hemangioma caused airway obstruction . the demographic data regarding each patient s age , sex , site of lesion , and duration of treatment are shown in table 1 . the diagnosis of hemangiomas was established mainly by obtaining the patient s history , noting clinical manifestations , and performing a physical examination . all patients underwent ultrasonography , and four patients had a magnetic resonance imaging ( mri ) examination to obtain more details of the lesion ( when the diagnosis was uncertain , mri was performed ) . after informed consent had been obtained from the parents according to institutional guidelines , the patients were treated with ifn-2a for a period of 24.5 months . ifn-2a was administrated subcutaneously once daily at a dose of 310 units / m per day . periodical baseline electrocardiogram , neurologic examination , and laboratory evaluations of hepatic transaminases were performed . the size and extent of the deep - seated lesions were monitored by serial color doppler ultrasonography ; the percent change of the superficial lesions compared the pre- and posttreatment tumor size using photographs . the patients were observed at an interval of 3 weeks during the therapy course ; follow - up visits were continued for up to 2 years . the final results were assessed by two other physicians from the department of oral oncology , depending on the clinical examinations , photographs , and doppler ultrasonography taken before and after treatment ; the response to ifn-2a therapy was evaluated according to the following scale ( that was modified following achauer et al12 ) : scale 1 , poor response ( shrinkage 0%25% ) ; scale 2 , fair response ( shrinkage 26%50% ) ; scale 3 , good response ( shrinkage 51%75% ) ; scale 4 , excellent response ( shrinkage 76%100% ) . all eleven patients received the treatment for a duration of 24.5 months ( median : 3 months ) . eight patients had received medication for 3 months , one for 4.5 months , and two for 2 months . the age at initiation of ifn-2a therapy ranged from 3 days to 8 months ( median : 4 months ) . it was observed that the most apparent regression of tumors happened at 1 month after medication administration ; the tumor shrank further with the red color fading . nine patients ( 82% ) achieved scale 4 ( figures 1a , b , 2a , and b ) and two patients ( 18% ) achieved scale 3 . the adverse effects included low fever ( six cases ; 54.5% ) , diarrhea ( two cases ; 18.2% ) , and anorexia ( one case ; 9.1% ) , as well as neutropenia and high levels of aminotransferases to varying degrees , which resolved after stopping the medication . neurotoxicity such as spastic diplegia and other motor developmental disturbances were not found in this series . no patients experienced the rebound phenomenon , and no patients required the restarting of ifn or another therapy in the following 2 years . in this series of eleven infants with alarming hemangiomas treated with ifn-2a , rapid and good response to treatment was obtained with few reversible adverse effects . in addition to its antiviral effect , ifn- was also used as an inhibitor of angiogenesis given its antiangiogenic properties.13 since its efficacy in pulmonary hemangiomatosis was first reported by white et al14 in 1989 , ifn- was chosen as a therapeutic modality for hemangiomas , especially for life - threatening cases or steroids - insensitive patients . according to other reports,1517 the rate of response to ifn in hemangiomas varies from 80%100% , which is very similar to our overall response rate of 100% ; our result was as good as those found in these studies ( p>0.05 ) , and the duration time was shorter ( p<0.05 ) . the common adverse effects of ifn include influenza - like symptoms of fever , somnolence , anorexia , diarrhea or constipation , and a high level of aminotransferases ; these symptoms are always slight and they can be reversed following the discontinuation of ifn . although exceptional , neurotoxicity is still the main concern in the treatment of ih with ifn . epilepsy , spastic diplegia , and lower limb disability had been reported after ifn injection . chang et al16 first reported in 1997 that one patient who received treatment with ifn-2b developed mild gross motor delay , which improved 2 months after the cessation of therapy . the pathogenesis of ifn - related neurotoxic effects is unclear , but given its potential seriousness , many experts have limited the use of ifn- for alarming hemangiomas . according to a meta - analysis of a large sample , which was carried out by michaud et al9 in 2004 , eleven of 441 children ( 2.5% ) receiving ifn therapy for the treatment of vascular lesions developed spastic diplegia ; perhaps there were not enough patients in our study to see this outcome , or it is also possible that the short duration of therapy decreased the risk for these children . considering that the durations we used were only 24.5 months ( median : 3 months ) , we suggest that the short - term use of ifn- should be safe . the current treatments of ihs include drug therapy , cryosurgery , laser therapy , and surgical excision . oral corticosteroids ( for example , prednisolone , prednisone ) used to be the mainstay of therapy for hemangiomas , but their clinical application was limited by the adverse effects such as cushing s syndrome and growth retardation . since the impressive effect of propranolol in treating hemangioma was reported by laut - labrze et al18 in 2008 , many studies ( including our own experiences ) have confirmed its effectiveness and have reported few side effects in hemangiomas.1922 nowadays , propranolol has been our first - line medicine for treating ih , but there are still some patients with alarming hemangiomas who may be concomitant with a contraindication for propranolol such as asthma , cardiac failure , or failure to respond to this medicine . for these cases , the rapid and impressive responses , as well as the few side effects observed in this series without relapse after treatment with ifn-2a prompts us to suggest that the short - term ( < 4.5 months ) use of ifn-2a can be chosen as an alternative option for alarming hemangiomas in the head and neck region , which are resistant to corticosteroid or propranolol treatment .

objectiveto evaluate the efficacy and adverse effects of interferon-2a in the treatment of alarming infantile hemangiomas in the head and neck region.patients and methodsfrom january 2009december 2010 , a subcutaneous injection of interferon-2a was applied to eleven infants with giant multifocal or segmental hemangiomas at a dose of 3 million units / m2 per day . all patients did not respond to propranolol or corticosteroids . the age at initiation of interferon-2a therapy ranged from 3 days to 8 months ( median : 4 months ) . the duration of therapy ranged from 24.5 months ( median : 3 months ) . eight patients received medication for 3 months , one patient for 4.5 months , and two patients for 2 months.resultsnine patients had a reduction in tumor mass of 95% ; two patients tumors decreased in size by 75% . the overall response rate was 100% . the main adverse effects included fever , diarrhea , and anorexia , which resolved after stopping the medication . no serious adverse effect was observed.conclusionshort-term treatment with interferon-2a can be used as a safe and effective treatment for alarming infantile hemangiomas that are resistant to propranolol or corticosteroids , and that endanger the proper functioning of the affected organ or the patient s life .

we present the results of the first external quality assurance study on sars - cov molecular detection . ninety - three institutions involved in laboratory diagnostics of sars were invited to participate in the study . invitees were members of the international who sars reference and verification laboratory network ( 9 ) or national and regional sars reference laboratories . the study was announced as an external quality assurance study on diagnostic proficiency , which included certifying and publishing the results in a comparative and anonymous manner . fifty - eight laboratories from 38 countries ( 21 european , 9 austral - asian , 7 north and south american , and 1 african ) eventually enrolled in the study . four companies that produced commercial diagnostic test systems also participated but were evaluated separately because they do not fulfill public health duties . virus material was obtained from supernatants of vero cell cultures collected one day after infection with sars - cov strains frankfurt 1 and hku-1 . the supernatants were heated to 56c for 1 h and irradiated with 30 kgy . aliquots of the inactivated virus stock solutions were lyophilized and redissolved , and the virus rna was quantified by two different noncommercial real - time rt - pcr assays ( 2,6 ) . test samples for the study were generated by diluting the inactivated virus stock solutions in human fresh - frozen plasma testing negative for hiv-1 , hepatitis b virus , hepatitis c virus , and sars - cov by rt - pcr . aliquots of 100 l each were then lyophilized and shipped at ambient temperature to the participating laboratories . virus - positive samples contained 94940,000 rna copies per milliliter after resuspending in 100 l of water . the participants were asked to analyze the material with the molecular methods they routinely use in suspected cases in humans . details about the methods were requested , such as the sources of rt - pcr primers and protocols , the type of extraction method used , and suppliers and types of commercial kits , if used . first , laboratories had to correctly detect the four samples containing > 9,400 copies of viral rna per milliliter , a concentration well above the detection limit of published and commercial nucleic acid amplification tests ( nat ) for sars - cov ( 6,7,1012 ) . indeterminate results in positive samples were treated as negative and in negative samples were treated as positive since the application of nat usually does not involve indeterminate endpoints , and laboratories should be able to resolve unclear results by double testing with another amplification assay ( 13 ) . before evaluating the performance of individual laboratories , we determined how many participants managed to detect virus in each sample ( table 1 ) . the concentration - dependent , cumulative positivity rates per sample corresponded exactly with the response rates calculated by a probit regression analysis , which is equivalent to a dose - response model ( figure , p < 0.0001 ) . the model could predict for the average laboratory that 50% of all test results could be expected to be correctly positive when 158 ( 95% confidence interval [ ci ] 76.55269.15 ) copies of virus rna per milliliter of sample were present , and 95% with more than 11,220 ( 95% ci 5,67531,988 ) copies per milliliter . good compliance with the model furthermore confirmed that all samples contained the expected concentration of rna upon reception by the participants and that no rna degradation had occurred even in samples containing low amounts of virus . probit analysis of the fractions of laboratories achieving a positive result ( y - axis ) in relation to the virus rna concentration in a given positive sample ( x - axis ) . the thick line is the regression line calculated on the basis of a probit model ( dose - response curve ) ; the thin lines are 95% confidence intervals . the proficiency criteria , 51 ( 88% ) of 58 laboratories passed the minimum requirements for successful participation . failure in three laboratories was due to lack of sensitivity , in three due to false - positive results , and in one due to both . thirteen of 51 successful laboratories ( 22.4% of all 58 participants ) could also detect the virus in all three weakly positive samples ( < 2,350 copies / ml ) , and another 17 missed only one positive sample . ten of the 58 laboratories issued indeterminate results in one or more samples . whether common technical factors would influence the performance of laboratories was also assessed . we subjected cumulative results from low concentration samples ( < 2,300 copies / ml ) to analysis of variance ( anova ) analysis . seven technical factors ( table 2 ) were used to characterize the test procedures each laboratory was using . only use of commercial rt - pcr test kits made a significant difference with regard to total sensitivity . this finding was in concordance with results of the four participating companies who manufacture these kits : all were 100% correct . for noncommercial tests , whether laboratories developed primers themselves or adapted from other researchers did not make a difference . this finding might be due to availability of well - evaluated primers through a who internet resource during the outbreak ( 14 ) . forty - two of the 58 participants used at least one procedure listed on this site . analysis of variance ( anova ) by factor , eliminating the influence of other factors ; pcr , polymerase chain reaction . we finally assessed whether laboratories belonging to the international who sars reference and verification network ( 9 ) were more proficient in sars molecular detection than others . in the three samples containing < 2,350 copies of sars - cov rna per milliliter , the network laboratories achieved a cumulative fraction of correct positive results of 79.5% ( 95% ci 60.2%98.9% ) as opposed to 61.5% ( 95% ci 50.6%72.4% ) in the other labs participating in the study . this difference was not significant ( p value = 0.11 , t - test ) . the results of this first external quality assurance study on sars - cov molecular detection are assuring . compared to an earlier study on molecular testing for filoviruses , lassa virus , and orthopoxviruses , using very similar proficiency criteria ( 15 ) , almost double the portion of participating laboratories completed the study successfully ( 88% vs. 45.8% ) . on the other hand , this study only examined paramount issues like sensitivity and control of contamination . validation of other aspects , like cross - reactivity of primers or control of pcr inhibition , is the responsibility of each diagnostic laboratory . commercial tests clearly were the preferred way of achieving good diagnostic performance , possibly because sars - cov is a pathogen with which relatively few laboratories have had experience . however , developing and approving commercial tests is a lengthy process and high costs limit their application . other approaches have to be adopted for efficiently providing good diagnostic tools in immediate response to an infectious disease outbreak . who 's strategy of disseminating essential information through a public internet resource before laboratories have willingly shared protocols and positive control material with other institutions , enabling qualified diagnostics within weeks after the primary description of the new virus . international strain collections should be complemented with noninfectious reference material of rare pathogens . until now , such material has been available only for highly prevalent agents like hiv-1 , herpes viruses , or hepatitis viruses . for sars - cov , all samples described can be obtained for a nonprofit charge through the who sars reference and verification laboratory network .

inactivated severe acute respiratory syndrome associated coronavirus samples were used for an external quality assurance study within the world health organization sars reference and verification network and other reference institutions . of 58 participants , 51 correctly detected virus in all samples > 9,400 rna copies per milliliter and none in negative samples . commercial test kits significantly improved the outcome .

the treatment of bipolar disorder is complex and full of caveats for the clinician [ 1 - 4 ] . an important problem in the gathering of scientific evidence lies in the low reliability and validity of diagnosis . another problem is that specific and different treatments need to be considered separately for manic , hypomanic , mixed and bipolar depression episodes , as well as for unipolar depression . this article will comment on the available hard data ( randomized trials ) for the treatment of bipolar depression and suggest future directions for research . older studies conducted throughout the 1970s and 1980s on treatment of bipolar disorder reported positive effects for lithium , carbamazepine , amitriptiline , imipramine and fluoxetine [ 9 - 11 ] , however , the studies were small and suffered from a number of methodological drawbacks . results from add - on studies with imipramine as an adjunctive therapy to lithium were negative . within the last 10 years , several phase iii clinical studies of lamotrigine ( sca100223 , sca30924 , sca40910 , scaa2010 and scab2001 ) have demonstrated a lack of efficacy for this agent in the treatment of bipolar disorder . there were only two small studies reporting a positive effect of valproate in bipolar i patients , while on the contrary , the efficacy of the olanzapine - fluoxetine combination ( ofc ) against bipolar i depression has been well documented . there has been concern about the effect of olanzapine monotherapy on the depressive core of symptoms , however , it is certain that patients receiving this treatment manifest a significant improvement in symptoms peripheral to those of depression , such as insomnia , anxiety and loss of appetite . it has been reported that the ofc is more effective than olanzapine monotherapy and also improves many secondary indices . one study without a placebo arm suggested both paroxetine and venlafaxine could be effective for the treatment of bipolar depressed patients . another compared imipramine and paroxetine with placebo as an add - on to an ongoing lithim regimen and reported that these antidepressants were beneficial for patients with low ( but not high ) serum levels of lithium . other reports suggest that adding venlafaxine , sertraline or buproprion to a mood stabilizer increases the response rate [ 23 - 25 ] . adding inositol or modafinil to a mood stabilizer could also be useful in the treatment of bipolar depression . during the last 3 years , there have been some important insights from newly available data . for example , recent negative data has emerged for drugs that had previously shown efficacy in older studies , such as monotherapy with lithium , paroxetine and aripiprazole , and there have been equivocal results for valproate : two randomized controlled trials ( rcts ) on the extended - release form of valproate reported one positive and one negative result ; neither study was published ( for reviews , see ) . quetiapine was , however , reported to be effective at dosages of both 600 mg / day and 300 mg / day , and produced response rates of 58.2% and 57.6% , respectively ( versus 36.1% for placebo ) , and remission rates of 52.9% in both the treated groups ( versus 28.4% for placebo ) . it is important to note that quetiapine significantly improved all the montgomery - sberg depression rating scale ( madrs ) items corresponding to the core symptoms of depression . post - hoc analysis suggests 300 mg and 600 mg are equally effective ; despite there being a small difference in the effect size , they both improved secondary measures including quality of life indices . another study reported that an extended - release form of quetiapine at 300 mg daily was significantly more effective than placebo for bipolar i depression throughout the 8-week study , with significance observed as early as day 7 . in a recent double - blind , placebo - controlled study , adding an antidepressant ( either buproprion or paroxetine ) to a mood stabilizer in 179 bipolar depressed patients was not significantly more beneficial than placebo after 26 weeks of treatment , and the recovery rates ( 23.5% in the antidepressant group versus 27.3% in the placebo group ) and switch rates to mania were similar . however , these data should be read with caution because although paroxetine played a significant role in the design , it has since been shown to be no more effective than placebo . a more recent study reported that adding lamotrigine to lithium was more effective than placebo in patients with bipolar depression . another recent 8-week trial studied 52 incomplete responders treated with carbamazepine or oxcarbazepine ( 600 - 1200 mg daily ) during maintenance treatment with lithium . maintenance phase , the design and the results are more relevant to the acute depressive phase because the study sample included depressed patients . both groups improved with the addition of either drug but those receiving oxcarbazepine improved significantly more in terms of their madrs and hamilton depression rating scale ( hdrs)-21 scores . another study reported that adding venlafaxine , sertraline or buproprion to a mood stabilizer increases the response rate . several reviews and meta - analytic studies of the literature are currently available . some suggest that only quetiapine - and to a lesser extent , olanzapine - show efficacy as a monotherapy for bipolar depression [ 42 - 44 ] . however , two meta - analyses of four randomized placebo - controlled trials ( of 6 and 8 week duration ) with a total sample size of 142 patients suggested that divalproex could also be efficacious in acute bipolar depression , with response rates of 39.3% for divalproex versus 17.5% for placebo . remission rates were 40.6% versus 24.3% , respectively , with an effect size d equal to 0.35 . negative trials of lamotrigine monotherapy ( 1072 patients ) reported that lamotrigine was superior to placebo in people with an hdrs score of greater than 24 but not in people with an hdrs score of less than or equal to 24 . the meta - analysis of data on paroxetine and monoamine oxidase inhibitors ( maois ) in 52 patients confirmed that the effectiveness of paroxetine was unacceptably low , but rates of recovery with maois were significantly higher than the recovery rate with paroxetine . classically , the treatment of bipolar illness includes the use of the so - called mood stabilizers ( lithium and specific anticonvulsants ) , antipsychotics , and antidepressants . recent data dispute the efficacy of some of these agents against bipolar depression . only quetiapine and the ofc are currently considered to be effective and thus have been approved for the treatment of acute bipolar depression . typical antipsychotics ( haloperidol , chlorpromazine and perphenazine ) seem to have some efficacy against acute mania but they also seem to predispose patients to manifest dysphoria or depression . the dispute concerning the usefulness of antidepressants continues ; clinicians should be cautious in their use and avoid prescribing them as monotherapy . it is important to bear in mind that the only positive data available for the use of antidepressants in treating bipolar disorder are for fluoxetine ; strong negative data still exist for paroxetine . since , in real life , the majority of bipolar patients do not do well on monotherapy , several combination therapies and add - on agents have been tested that the clinician should become familiar with . some of the recommendations above are in relative contrast to everyday clinical practice where clinicians do not tailor their choice of antidepressant to a specific type of depression and tend to use typical antipsychotics against mania . the chronicity of bipolar depression and its relative refractoriness to treatment might be the cause of this discrepancy . class effect for drugs might iatrogenically worsen the long - term course of the illness in some patients . when the clinician is treating a depressed bipolar patient , it is clear that the first step should be the use of agents with proven efficacy ( from placebo - controlled double - blind studies ) against this condition . however , it is likely that most patients will fail with such a treatment and the clinician will be left with no hard data to rely on . in this case , the clinician should avoid treatments with a proven worsening effect on the long - term outcome of the disease . additionally , psychoeducation could constitute a useful tool to treat bipolar depression , along with family - focused psychoeducation and cognitive - behavioral therapy . the author has received support comprising travel and accommodation expenses from various pharmaceutical companies in order to participate in medical congresses . he has also received honoraria for lectures from astrazeneca , janssen - cilag , eli lilly and a research grant from the pfizer foundation . he is member of the board of wyeth for desvenlafaxine and bristol - myers squibb for aripiprazole in bipolar disorder .

the treatment of bipolar depression is one of the most challenging fields in contemporary psychiatry . the best data concern the antipsychotics quetiapine and the olanzapine - fluoxetine combination . however , the usefulness of antidepressants in bipolar depression remains controversial ; positive data are available for fluoxetine but negative results have been published for paroxetine . accumulated knowledge so far suggests that bipolar patients need continuous administration of an antimanic agent even during the acute depressive phase . although our knowledge is indeed limited , the development of guidelines for polypharmacy is necessary and should be done as soon as possible .

primary hyperparathyroidism is most commonly caused by a single parathyroid adenoma ( 8590% ) and multi - gland disease in approximately 10% of patients . the size of abnormal parathyroid glands in patients with primary hyperparathyroidism is highly variable , those weighing more than 23 g are classified as we report a rare case of giant parathyroid adenoma presenting with recurrent episodes of pancreatitis and discuss its management with an emphasis on the role of preoperative localization . a 50-year - old male without any comorbid illnesses was being evaluated and conservatively managed for recurrent attacks of acute pancreatitis at an outside canter for 9 months . his biochemical evaluation incidentally showed hypercalcemia ( 11.2 mg / dl ) and further investigations revealed elevated levels of serum paratharmone ( 669 pg / ml ) . a computed tomography ( ct ) neck and chest done at the referring center revealed a 6 cm 4 cm mass in the left paratracheal region with an extension to the superior mediastinum . an f - fluorodeoxyglucose ( f - fdg ) positron emission tomography / ct ( pet / ct ) scan was additionally done which confirmed the isolated uptake standard uptake value : 4.3 in the left paratracheal region [ figure 1a and b ] . clinical evaluation at our center was unremarkable except for a vague fullness in the left paratracheal region . the left paratracheal mass lesion was localized to the left inferior parathyroid gland using tc99 m sestamibi scintigraphy , which demonstrated a persistent retention of the sestamibi tracer in the left inferior parathyroid gland [ figure 2 ] . an ultrasound guided fine - needle aspiration cytology from the lesion revealed a benign epithelial lesion that could not be further characterized . a provisional diagnosis of primary hyperparathyroidism due to a giant parathyroid adenoma was made and the patient was planned for a definitive surgery . ( a and b ) 18f - fluorodeoxyglucose positron emission tomography / computed tomography revealed tracer uptake in a 6 cm 4 cm mass in the left paratracheal region with an extension to the superior mediastinum . ( standard uptake value 4.3 ) no other significant uptakes were seen 25 mci of 99mtc - sestamibi was given intravenously followed by the acquisition of early and delayed images of the neck and upper thorax and/or mediastinum . the initial early image is obtained at 15 min after the injection , and delayed imaging is obtained at 1 , 2 and 4 h after the injection . the scan demonstrated a persistent retention of the sestamibi tracer in the left inferior parathyroid gland at 4 h the patient underwent an uneventful resection of the tumor - bearing left inferior parathyroid gland through a focused trans - cervical approach after carefully safeguarding the left recurrent laryngeal nerve [ figure 3a d ] . the patient made an uneventful recovery and was discharged on oral calcium supplementation for biochemical hypocalcemia that normalized in a couple of weeks . the final histopathology confirmed the diagnosis of a giant parathyroid adenoma [ figure 4 ] and the patient is on regular follow - up . ( a ) the left recurrent laryngeal nerve splayed over the left giant parathyroid adenoma . ( b ) the left parathyroid adenoma dissected off the nerve and delivered in the neck . ( d ) specimen photograph of the giant parathyroid adenoma ( a and b ) h and e , 20 section shows tumor cells which are large with moderate eosinophilic granular cytoplasm , fine nuclei and tiny nucleoli , oncocytic type of cell clusters are seen , with areas of hemorrhage , no capsular or vascular invasion are seen , the findings are suggestive of a diagnosis of parathyroid adenoma they are believed to have distinct clinical and biochemical features related to specific genomic alterations . parathyroid adenomas are usually located on the posterior capsule of the thyroid but may be found in other ectopic locations . an enlarged parathyroid gland , as seen in our patient generally descends into the mediastinum because of its weight and as a result of the negative intra - thoracic pressure . the clinical presentation of primary hyperparathyroidism has changed over the years from a severe , debilitating disease to a disease with subtle symptoms and physiologic derangements . the diagnosis of primary hyperparathyroidism rests on the laboratory confirmation of increased serum calcium levels and inappropriately elevated levels of serum parathormone . some authors have suggested that the weight of the parathyroid adenoma has a direct correlation with the functional status of the gland and the severity of biochemical abnormalities , but this was not true in our patient . although the actual causal relationship between hypercalcemia and pancreatitis has been a topic of debate , detection of hypercalcemia points to a differential diagnosis of primary hyperparathyroidism as was encountered in our patient due to a giant parathyroid adenoma . preoperative localization of the hyper - functioning parathyroid gland / glands is considered vitally important prior to definitive surgical management . several diagnostic localization methods , both invasive and noninvasive exists , which range from ultrasound , ct scans , magnetic resonance imaging , tc99 m sestamibi scintigraphy and pet scanning in the preoperative setting and gamma probe and intraoperative parathyroid hormone assays in the intraoperative setting . preoperative localization studies with two concurrent imaging techniques ( combined ultrasound and tc99 m sestamibi scintigraphy ) are increasingly becoming increasingly popular as they enable minimally invasive surgical approaches . nuclear imaging with parathyroid scintigraphy the sensitivity of tc99 m sestamibi scintigraphy in detecting parathyroid adenomas has been reported to range from 70% to 100% . the use of this single - isotope dual - phase scintigraphic technique , is based on their observation that 99 m tc - sestamibi washes out more rapidly from the thyroid gland than from hyper functioning parathyroid glands hybrid tc99 m sestamibi single - photon emission ct / ct imaging is in fact superior to ct and tc99 m sestamibi scintigraphy alone in the preoperative localization of the hyper - functioning pathologic glands , especially in patients suffering from multiglandular disease with primary hyperparathyroidism . although the role of f - fdg pet / ct scans in identifying parathyroid carcinomas is well established , its use in the localization of parathyroid adenomas has yet to be widely utilized . a recent study reported that clinicians should possibly consider pet - ct as a second line modality when conventional imaging fails to localize the hyper functioning parathyroid gland . there have been a few reports for the use of c - methionine pet as a promising imaging modality for localizing parathyroid adenomas . surgical excision of the hyper functioning gland is the treatment of choice for parathyroid adenomas . the surgical approach for an inferior giant parathyroid adenomas extending on to the mediastinum can be cumbersome requiring a full collar incision or occasionally a median sternotomy . our case further demonstrates that a focused trans - cervical excision of giant inferior parathyroid adenoma is a viable approach for resection and should be considered prior to a formal neck exploration or sternotomy . further it is believed that following aggressive medical management of acute pancreatitis , parathyroidectomy can improve the clinical outcome and prevent further recurrences of pancreatitis . clinicians should have a high level of suspicion of primary hyperparathyroidism in patients presenting with recurrent episodes of pancreatitis . timely diagnosis , appropriate preoperative localization techniques that would include a parathyroid scintigraphy and a focused surgical intervention are important to resolve complications and improve outcomes .

parathyroid adenomas are usually small in size ; ( weighing 70 mg1 g ) those weighing more than 23 g are classified as giant parathyroid adenomas . giant parathyroid adenomas are in fact rarely encountered among patients with primary hyperparathyroidism . they are believed to have distinct clinical and biochemical features related to specific genomic alterations . we chanced to manage a unique and possibly the first case of giant parathyroid adenoma ( 6 cm diameter and weighing 20 g ) presenting with recurrent episodes of pancreatitis and discuss its surgical management with an added emphasis on the role of nuclear imaging in its preoperative localization . our case demonstrates that clinicians should have a high index of suspicion of primary hyperparathyroidism in patients presenting with recurrent episodes of pancreatitis . timely diagnosis , appropriate preoperative localization techniques , which would include a parathyroid scintigraphy and a focused surgical intervention are crucial to resolve complications and improve outcomes .

dipeptidyl peptidase-4 ( dpp-4 ) inhibitors and glucagon - like peptide-1 ( glp-1 ) analogs are incretin - based drugs ; these drugs have found widespread use as a new class of anti - hyperglycemic agents effective for treating diabetes mellitus . glp-1 is reported to slow food absorption , improve insulin production by the pancreas , and increase beta cell mass , whereas dpp-4 inhibitors act by delaying the breakdown of glp-1 . both types of agents lower glucose levels without weight gain and with a reduced risk of hypoglycemia , representing clear advantages over other glucose - lowering agents.1 these beneficial aspects in addition to ease of use , particularly in the case of the dpp-4 inhibitors , has accelerated their worldwide use . as these are newly developed drugs , their long - term side effects are still unknown . however , concerns regarding the association between the use of these drugs and pancreatitis and pancreatic or thyroid cancers have increased , and need to be investigated . a 55-year - old japanese man with type 2 diabetes mellitus was admitted to our hospital with a 24 hour history of upper abdominal pain . at a previous visit to another hospital , he had been diagnosed with gastric ulcer and prescribed a histamine h2 blocker . however , his symptoms worsened , with increased back pain and frequent vomiting . at the time of the diagnosis , his type 2 diabetes mellitus had been controlled with 0.6 mg of voglibose and 500 mg of metformin per day , both initiated 3 years before . in addition with that , 50 mg of sitagliptin per day had been added to his treatment regimen 8 months earlier , and diabetes mellitus was in good control with hba1c below 6.5% . his latest fasting glucose and glycosylated hemoglobin levels were 111 mg / dl and 6.2% , respectively . he had no history of chronic pancreatitis , pancreatic tumor , hypercalcemia , or habitual alcohol use . hyperlipidemia had also been diagnosed at the same time of the diabetes mellitus diagnosis , however was well controlled with 10 mg of atorvastatin . on physical examination , his height , weight , and body mass index were found to be 175 cm , 77.2 kg , and 25.2 kg / m , respectively . his body temperature , blood pressure , and heart rate were 38.1c , 172/88 mmhg , and 98 beats / min , respectively . upper abdominal tenderness was observed without mass or rigidity . c - reactive protein level was 0.1 mg / dl , and white blood cell count was 21800/l . his pancreatic and liver enzyme level were elevated at the hospitalization ( amylase level , 3581 iu / l ; pancreatic amylase level , 3435 iu / l ; elastase-1 level , 6749 ng / dl , aspartate aminotransferase level , 266 iu / l ; and ala - nine aminotransferase level , 137 iu / l ) . abdominal computed tomography ( ct ) ascites was present on the liver surface , abdominopelvic cavity , peripancreatic area , and posterior pararenal extraperitoneal space ; furthermore , a gallstone was detected ( fig . 1a ) . the acute physiology , age , and chronic health evaluation ( apache ) score was 6 points , systemic inflammatory response syndrome ( sirs ) score was 3 , and ct scan severity index was grade 3 . his condition was complicated by severe systemic inflammation , disseminated intravascular coagulation , and respiratory insufficiency , which required treatment comprising intravenous fluid therapy , administration of antibiotics and pancreatic enzyme inhibitors systemically and via an arterial catheter , use of a respirator , and continuous hemodiafiltration in the intensive care unit . however , ct revealed no signs of common bile duct dilatation , choledocholithiasis , or gallstone incarceration . hyperbilirubinemia improved a few days after treatment for pancreatitis , and there was no recurrence of pancreatitis or hyperbilirubinemia during hospitalization ; therefore , we eliminated pancreatitis by gallstone . extensive inflammation and necrosis were observed , and the pancreatic cyst was resistant to therapy , requiring nearly 3 months of daily drainage and weekly necrectomy ( fig . an oral diet was started . in spite of the improvement in pancreatitis , his insulin levels gradually decreased , with serum and urine c - peptide concentrations of 0.52 ng / ml and 38.6 g / day , respectively . the delta c - peptide level after glucagon loading was 0.31 ng / ml ( serum c - peptide levels before and 6 min after glucagon stimulation were 0.38 and 0.69 mg / dl , respectively ) . at that time , a diagnosis of pancreatic diabetes was made . his diabetes mellitus was well controlled with a total insulin injection of 28 units per day . acute pancreatitis is known to be fatal , with a mortality rate of nearly 10% if severe disease is not diagnosed and if appropriate treatments are not initiated immediately.2 even in cases in which diagnosis and treatment are rapid , severe pancreatitis can prove life threatening . various causes for pancreatitis include alcohol consumption , gallstones , idiopathic chronic pancreatitis , endoscopic retrograde cholangiopancreatography or endoscopic sphincterotomy , trauma , malignancy , autoimmune hypercalcemia , hyperlipidemia , or certain drugs , of which alcohol and gallstone are the 2 primary causes in japan.3 our patient did not have a history of alcohol intake within the few months prior to hospitalization . in addition , he had no history of a medical condition that could cause acute pancreatitis , except hyperlipidemia , which was well controlled with atorvastatin for the past 3 years . because abdominal ct revealed gallstones and bilirubin was elevated after hospitalization , we first suspected gallstone pancreatitis . however , neither ct nor ultrasound imaging indicated biliary ductal dilatation involving the common bile duct . hyperbilirubinemia improved only a few days after treatment for pancreatitis had begun , suggesting that bilirubinemia might have developed as a result of the spread of inflammation from pancreatitis . in addition , there was no recurrence of pancreatitis for 14 months without gall stone treatment . medications are also known to cause pancreatitis , with a frequency of 1.4% to 2.0%.4 there are several reports describing pancreatitis associated with metformin and atorvastatin . in the japanese guidelines for pancreatitis published in 2010 , metformin and atorvastatin are not included . however , as one of the hmg - coa reductase inhibitors group , pravastatin is classified within class i ( medications in which at least 1 case report described a recurrence of acute pancreatitis with a rechallenge with the drug).5 an exhaustive search of the literature revealed only 6 and 5 cases of pancreatitis associated with atorvastatin611 and metformin , respectively.1216 in most of these cases , drugs were administered for less than a year . with the increased use of incretin - related drugs , a few cases of acute pancreatitis that had been suspected to be related with dpp-4 inhibitors or glp-1 agonists have been reported . to the best of our knowledge , only 4 cases of pancreatitis related to sitagliptin and vildagliptin have been reported ( table 1 ) . one patient was treated with sitagliptin for 8 weeks;17 2 other patients were switched from sitagliptin to vildagliptin 2 weeks or 6 months before;18,19 and 1 patient received combined therapy of sitagliptin and exenatide for a few weeks.20 raschi et al reported a significant correlation between glp-1 , dpp-4 inhibitors , and pancreatitis , on the basis of the information in the fda database.21 among these drugs , sitagliptin and exenatide are reported to have a strong correlation with pancreatitis . the average duration from administration of sitagliptin and exenatide to onset of pancreatitis was 444 days and 515 days , respectively , which was similar to that in our case in which pancreatitis was diagnosed 8 months after the administration of sitagliptin . animal studies showed that glp-1-based treatments induced pancreatitis in a rat model of type 2 diabetes , with medications such as sitagliptin increasing pancreatic ductal replication and acinar - to - ductal metaplasia.2224 exenatide has also been found to induce pancreatic acinar inflammation , with abnormal acinar cells and a high frequency of cell death.25 further , in type 2 diabetes patients , pancreatitis is 6-fold more likely to be reported in association with sitagliptin or exenatide than with other therapies.23 these drugs are also suggested to be correlated to pancreatitis and increased risks for pancreatic and thyroid cancers . however , dore et al . reported that no evidence was found for an increased incidence of pancreatitis in a large cohort of patients treated with either exenatide or sitagliptin , compared to those treated with metformin or glyburide.26 there are many case reports and studies suggesting that glp-1 agonists and dpp-4 inhibitors , which are widely used and promoted for the treatment of type 2 diabetes , could have serious accidental and unexpected side effects . we reported a case of acute necrotic pancreatitis in which a dpp-4 inhibitor had been administered 8 months before . while the dpp-4 inhibitor was suspected to be the cause of pancreatitis , the correlation between incretin - based drugs and pancreatitis remains controversial .

a 55-year - old japanese man with a 3-year history of type 2 diabetes mellitus was admitted to our hospital for upper abdominal pain . control of diabetes mellitus was good with voglibose and metformin , with sitagliptin added to this regimen 8 months prior . his pancreatic enzyme levels were elevated , and abdominal computed tomography ( ct ) showed diffuse pancreatic swelling with fluid accumulation and ascites of ct grade 3 . the patient was diagnosed with severe acute pancreatitis . there were no obvious causes for pancreatitis except the recently administered sitagliptin . since incretin - related drugs entered the market , the number of incretin - related drugs prescriptions rapidly increased and so did the incidence of pancreatitis . there are several reports suggesting the correlation between incretin - related drugs and pancreatitis , such as a report based on data obtained from the united states food and drug administration ( fda ) which revealed a significant correlation between the administration of exenatide or sitagliptin and pancreatitis . however , there also is a report that denied the evidence for such in a large cohort study . the relation between incretin based drugs and pancreatitis is still controversial .

after informed consent was given and under the institutional review board approval , human hcc and paired normal liver tissues were obtained immediately after surgery at the johns hopkins hospital ( baltimore , us ) , the 3rd affiliated hospital of sun yat - sen university ( guangzhou , china ) , fundeni clinical institute ( bucharest , romania ) , and ion chiricuta comprehensive cancer center ( clui nanoca , romania ) . tissues were snap frozen upon acquisition and stored in a 80 c freezer until use . the arraystar human lncrna array v2.0 was used to profile both lncrnas and messenger rnas ( mrnas ) in human genome of 3 pairs of human hcc and the matched normal tissues . 33,045 lncrnas were collected from the authoritative data sources including refseq , ucsc knowngenes , ensembl and many related literatures . sample labeling and array hybridization were performed according to the agilent one - color microarray - based gene expression analysis protocol ( agilent technology ) with minor modifications . briefly , mrna was purified from 1 g total rna after the removal of rrna ( mrna - only eukaryotic mrna isolation kit , epicentre ) . then , each sample was amplified and transcribed into fluorescent crna along the entire length of the transcripts without 3 bias utilizing a random priming method . the concentration and specific activity of the labeled crnas ( pmol cy3/g crna ) were measured by using nanodrop nd-1000 . 1 g of each labeled crna is fragmented by adding 11 l 10 blocking agent and 2.2 l of 25 fragmentation buffer , and then heated the mixture at 60 c for 30 min ; finally 55 l 2 ge hybridization buffer is added to dilute the labeled crna . 100 l of hybridization solution was dispensed into the gasket slide and assembled to the lncrna expression microarray slide . the slides were incubated for 17 h at 65 c in an agilent hybridization oven . the hybridized arrays were washed , fixed and scanned by using the agilent dna microarray scanner ( part number g2505b ) . mircury hy3/hy5 power labeling kit ( exiqon ) was used according to the manufacturer 's guideline for mir labeling of the same 3 pairs of hcc and matched normal liver tissues . 1.0 mg of each sample was 3-end - labeled with hy3 fluorescent label using t4 rna ligase by the following procedure : rna in 2.0 l of water was combined with 1.0 l of cip buffer and cip ( exiqon ) . the mixture was incubated for 30 min at 37 c , and was terminated by incubation for 5 min at 95 c . then 3.0 l of labeling buffer , 1.5 l of fluorescent label ( hy3 ) , 2.0 l of dmso , and 2.0 l of labeling enzyme were added into the mixture . the labeling reaction was incubated for 1 h at 16 c , and terminated by incubation for 15 min at 65 c . after stopping the labeling procedure , the hy3-labeled samples were hybridized on the mircury lna array ( v.18.0 ) ( exiqon ) according to the array manual . the total 25 l mixture from hy3-labeled samples with 25 l hybridization buffer was first denatured for 2 min at 95 c , incubated on ice for 2 min and then hybridized to the microarray for 1620 h at 56 c in a 12-bay hybridization systems ( hybridization system nimblegen systems ) , which provides an active mixing action and constant incubation temperature to improve hybridization uniformity and enhance signal . following hybridization , the slides were achieved , washed several times using wash buffer kit ( exiqon ) , and finally dried by centrifugation for 5 min at 400 rpm . then the slides were scanned using the axon genepix 4000b microarray scanner ( axon instruments ) . agilent feature extraction software ( version 10.7.3.1 ) was used to analyze lncrna and mrna array images . quantile normalization and subsequent data processing were performed by using the genespring gx v11.5.1 software package ( agilent technologies ) . after quantile normalization of the raw data , lncrnas and mrnas that at least 1 out of 6 samples have flags in present or marginal were chosen for further data analysis . for microrna array analysis , the scanned images were then imported into genepix pro 6.0 software ( axon ) for grid alignment and data extraction . replicated mirnas were averaged and mirnas that intensities 50 in all samples were chosen for calculating normalization factor . after informed consent was given and under the institutional review board approval , human hcc and paired normal liver tissues were obtained immediately after surgery at the johns hopkins hospital ( baltimore , us ) , the 3rd affiliated hospital of sun yat - sen university ( guangzhou , china ) , fundeni clinical institute ( bucharest , romania ) , and ion chiricuta comprehensive cancer center ( clui nanoca , romania ) . tissues were snap frozen upon acquisition and stored in a 80 c freezer until use . the arraystar human lncrna array v2.0 was used to profile both lncrnas and messenger rnas ( mrnas ) in human genome of 3 pairs of human hcc and the matched normal tissues . 33,045 lncrnas were collected from the authoritative data sources including refseq , ucsc knowngenes , ensembl and many related literatures . sample labeling and array hybridization were performed according to the agilent one - color microarray - based gene expression analysis protocol ( agilent technology ) with minor modifications . briefly , mrna was purified from 1 g total rna after the removal of rrna ( mrna - only eukaryotic mrna isolation kit , epicentre ) . then , each sample was amplified and transcribed into fluorescent crna along the entire length of the transcripts without 3 bias utilizing a random priming method . the concentration and specific activity of the labeled crnas ( pmol cy3/g crna ) were measured by using nanodrop nd-1000 . 1 g of each labeled crna is fragmented by adding 11 l 10 blocking agent and 2.2 l of 25 fragmentation buffer , and then heated the mixture at 60 c for 30 min ; finally 55 l 2 ge hybridization buffer is added to dilute the labeled crna . 100 l of hybridization solution was dispensed into the gasket slide and assembled to the lncrna expression microarray slide . the slides were incubated for 17 h at 65 c in an agilent hybridization oven . the hybridized arrays were washed , fixed and scanned by using the agilent dna microarray scanner ( part number g2505b ) . mircury hy3/hy5 power labeling kit ( exiqon ) was used according to the manufacturer 's guideline for mir labeling of the same 3 pairs of hcc and matched normal liver tissues . 1.0 mg of each sample was 3-end - labeled with hy3 fluorescent label using t4 rna ligase by the following procedure : rna in 2.0 l of water was combined with 1.0 l of cip buffer and cip ( exiqon ) . the mixture was incubated for 30 min at 37 c , and was terminated by incubation for 5 min at 95 c . then 3.0 l of labeling buffer , 1.5 l of fluorescent label ( hy3 ) , 2.0 l of dmso , and 2.0 l of labeling enzyme were added into the mixture . the labeling reaction was incubated for 1 h at 16 c , and terminated by incubation for 15 min at 65 c . after stopping the labeling procedure , the hy3-labeled samples were hybridized on the mircury lna array ( v.18.0 ) ( exiqon ) according to the array manual . the total 25 l mixture from hy3-labeled samples with 25 l hybridization buffer was first denatured for 2 min at 95 c , incubated on ice for 2 min and then hybridized to the microarray for 1620 h at 56 c in a 12-bay hybridization systems ( hybridization system nimblegen systems ) , which provides an active mixing action and constant incubation temperature to improve hybridization uniformity and enhance signal . following hybridization , the slides were achieved , washed several times using wash buffer kit ( exiqon ) , and finally dried by centrifugation for 5 min at 400 rpm . then the slides were scanned using the axon genepix 4000b microarray scanner ( axon instruments ) . agilent feature extraction software ( version 10.7.3.1 ) was used to analyze lncrna and mrna array images . quantile normalization and subsequent data processing were performed by using the genespring gx v11.5.1 software package ( agilent technologies ) . after quantile normalization of the raw data , lncrnas and mrnas that at least 1 out of 6 samples have flags in present or marginal were chosen for further data analysis . differentially expressed lncrnas and mrnas with statistical significance were identified through volcano plot filtering . go analysis and pathway analysis were performed by using the standard enrichment computation method . for microrna array analysis , the scanned images were then imported into genepix pro 6.0 software ( axon ) for grid alignment and data extraction . replicated mirnas were averaged and mirnas that intensities 50 in all samples were chosen for calculating normalization factor . expressed data were normalized using the median normalization . according to the cerna paradigm , long non - coding transcripts share mir responsive elements ( mres ) with protein - coding genes , and compete with these protein - coding genes for the pool of shared mirs . thus , cerna would play a crucial role in the regulation of their cognate genes , , . here , we described a dataset composed of lncrna , mrna and microrna microarray gene expression profiling for hcc and normal liver tissue . with this dataset we believe that this dataset would be particularly valuable for investigating the interplay among lncrna , mrna , and microrna in hcc . for example , we have found that ints6p1 and ints6 are part of the same competitive tumor suppressor network that includes oncomir-17 - 5p ( fig . 1 ) . this finding provides a new insight in understanding the underlying mechanisms of hepatocarcinogenesis and uncovers the potential therapeutic targets .

to assess the potential competitive endogenous rna ( cerna ) network in hepatocellular cancer ( hcc ) , the lncrna , mrna , and microrna microarrays were conducted on 3 pairs of hcc and paired normal liver tissue . after that , the arrays were normalized and analyzed with gene oncology ( go ) and pathway analysis . next , we screened out the pseudogenes and their cognate protein coding genes which are both down - regulated in hcc . finally , the up - regulated microrna binding sites were predicted on the most down - regulated pseudogene and its cognate protein - coding gene . all the array data were uploaded to gene expression omnibus ( accession number gse64633 ) .