text
stringlengths 897
19.4k
| summary
stringlengths 210
2.46k
|
|---|---|
it has been considered to be an inflammatory autoimmune disease of central nervous system , which is often associated with varying degree of disability and impaired quality of life . despite the etiology of ms is not determined yet , it is believed that both genetic and environmental factors play role in it 's pathogenesis . it is believed that ms is an autoimmune disease and mediate by cd4 type 1 t helper cells , but a variety of other immune cells including , b cells , cd8 t cells may involve in pathogenesis of disease too . it is postulated that an antigen begin the immunologic process in ms disease but these target are still uncertain . viral infections , emotional stress , heat exposure , and allergic reactions to foods were suggested as factors that can trigger exacerbation in ms patients . food allergens were supposed as one of offending substances which may trigger the allergic process and cause immunoglobin e ( ige)-mediated reactions , therefore , since many years ago allergenic reaction as a causative factor in ms was suggested . one study showed improvement of ms patients , after avoiding foods to which they have allergic and recurrence of symptoms after reuse of such foods . in spite of more than 170 foods identified to induce allergic reactions , a few are the most common offending substances and fish and eggs are between these agents . egg is noticed as one of the most allergenic foods and fish is another one that its allergic reactions via ingestion begin in the 1 24 months of life . the effect of nutrition and dietary supplements on the course of ms is a topic of great interest for both patients and clinicians . usually ms patients ask regard the role of change the diet habits and effect of different foods in the course of their disease . indeed , avoid the food that induce immunity in body may have a role in prevention of autoimmune disease , so , avoiding use of food allergens such as fish and egg may be effect on ms course . furthermore , some studies indicated usefulness of omega-3 fatty acids in the management of autoimmune disease due to anti - inflammatory properties and immunomodulatory activities . among omega-3 polyunsaturated fatty acids ( pufa ) those from fish oil is more potent . omega-3 fatty acid have supposed to have potential therapeutic role in relapsing - remitting multiple sclerosis ( rrms ) patients , and the efficacy of omega-3 fatty acid supplements from fish oil in reduction ms exacerbation was suggested by a small clinical with no control patient group . one study was reported improvement of motor performance in healthy rat pups after consumption of fish oil . however , there are some controversies in effect of fish meal ; it can trigger specific ige antibodies production by plasma cells , additionally , omega-3 pufa from fish oil may have immunomodulatory property . such controversies along with the hope to find all of the way that improve course of disease moved us to design this study . we evaluated the specific ige antibody against egg and fish as a part of major food allergens in patients with ms compared to healthy control group . the present study is conducted on patients with ms referring to kashani ms clinic affiliated to isfahan university of medical sciences , during november 2011 to november 2012 . patients with clinically definite ms according to the mcdonald criteria and age between 20 years and 40 years were eligible , if they had not received corticosteroids during last month and immunosuppressive drug over last 3 months . this study was approved by the ethics committee of isfahan university of medical sciences ( approval code : 189035 ) and all subjects were explained about the aims and the purposes of the study . written informed consent was obtained from all of them . a total of 48 ms patients were randomly selected from registered patients of kashani ms clinic by using a table of random values . then 48 healthy individuals without positive history of ms disease who were matched with the ms patients regarding to age and gender were selected as control group . after collecting demographic data by a pretested questionnaire , allergen - specific ige against fish was measured by immuno cap technique ( phadia , uppsala , sweden ) . data were presented as means sd or number ( % ) based on the variables . chi - square test was used to assess results of positivity frequency of specific ige antibody against wheat , soy and nuts between groups . statistical significance was accepted at p < 0.05 . the present study is conducted on patients with ms referring to kashani ms clinic affiliated to isfahan university of medical sciences , during november 2011 to november 2012 . patients with clinically definite ms according to the mcdonald criteria and age between 20 years and 40 years were eligible , if they had not received corticosteroids during last month and immunosuppressive drug over last 3 months . this study was approved by the ethics committee of isfahan university of medical sciences ( approval code : 189035 ) and all subjects were explained about the aims and the purposes of the study . written informed consent was obtained from all of them . a total of 48 ms patients were randomly selected from registered patients of kashani ms clinic by using a table of random values . then 48 healthy individuals without positive history of ms disease who were matched with the ms patients regarding to age and gender were selected as control group . after collecting demographic data by a pretested questionnaire , allergen - specific ige against fish was measured by immuno cap technique ( phadia , uppsala , sweden ) . data were presented as means sd or number ( % ) based on the variables . chi - square test was used to assess results of positivity frequency of specific ige antibody against wheat , soy and nuts between groups . the mean age of the subjects was 30.8 6.6 years in ms group and 30.9 6.3 years in control group . in both groups 11 subjects ( 22% ) were males and 37 ( 78% ) subjects were females . ige antibody against fish was negative in all of ms patients and controls ( p = 1 ) and ige antibody against egg was negative in all of ms patients and controls ( p = 1 ) [ table 1 ] . comparison of subjects characteristics and results of egg and fish specific immunoglobin e between study groups in present study no subjects in both ms group and control has ige against egg and fish . our finding is accordance with result of one study that showed low prevalence of ige - mediated allergic disease in ms patients . and is comparative with the results of oro as that showed low number of positive allergen - specific ige test in ms patients . indeed , bergamaschi et al . was showed less probability to allergic respiratory diseases ( ards ) and allergic rhinitis in ms patients . moreover , it is showed patients with atopic diseases should be less prone to autoimmune diseases such as ms . one research showed less severity of ms disease when associated with ards and less prevalence of ms in subjects affected by atopic diseases . these studies should support the hypothesis that suggested protective effects of genetic factors that make susceptibility to t helper type 1 ( th1)-mediated immunity in ms patients against the development of t helper type 2 ( th2)-mediated disease such as allergic disease . in the other hand , association between ms and diseases that mediated by both th1 and generally , excess production of th1 cytokines ( il-2 and interferon - gamma ) in myelin - reactive t cells and cell mediated immunity plays major role in pathogenesis of disease such as ms , experimental autoimmune encephalitis and insulin - dependent diabetes mellitus , whereas , the base of pathogenesis of systemic autoimmune diseases with a strong humoral component such as allergy is t cells that produce th2 cytokines ( il-4 , il-5 , and il-10 ) . infections specially , epstein - barr virus ( ebv ) is one of the factors that is postulated have a role on ms development , indeed , it is now suspected that it should have a promoting role in ige - mediated egg food allergy . according to these suggestions , ebv may trigger both ms and food allergy and it may show association of diseases mediated by both th1 and th2 . focusing on the association of different foods with immune system and demyelination process , different allergens such as fish and egg may have a possible effect on ms . indeed , ige - mediated mast cell in pathogenesis of ms as an autoimmune disease has suggested by calenof . therefore , assessing the role of ige against foods might be also important in the determinants of ms and elucidating the protective or detrimental effect of mast cells . the role of different food and some allergens in beginning and progression of ms was reviewed by researcher . furthermore , protective effect was also reported with fish among women that suffer from ms . although , all of disease that caused by food allergens are not mediated by ige , assessment of ige may help in detection of some allergenicity . however , fish is one of the sources of omega 3 fatty acid and there are some controversies about consumption of omega 3 in ms patients . , in the other hand , no beneficial effects were reported by using omega 3 fatty acid in ms patients in other studies . with respect to the results of our study , we conclude egg and food ige were not high in ms patients and ige allergy against fish and egg may be very unlikely to affect ms development and intake egg and fish are not inhibited . however , more studies with larger sample size are needed to confirm this finding . | background : the effect of nutrition in the course of multiple sclerosis ( ms ) is a topic of great interest . the present study was aimed to evaluate the immunoglobin e ( ige ) against egg and fish in ms patients compared to healthy controls.methods:between march 2012 and july 2012 , 48 ms patients were selected and compared with 48 healthy subjects to assess the frequency of ige against egg and fish in ms patients compared to healthy control .
fish and egg specific ige was determined by immuno cap .
sex and the frequency of specific ige were compared between study groups by chi - square test.results:total of 96 subjects was assessed ( 22% male and 78% female ) .
the mean age of the study subjects was 30.8 6.6 years .
mean age of case and control groups was 30.7 ( 6.9 ) versus 30.9 6.3 , respectively ( p = 0.83 ) .
there were no detection of egg and fish specific ige in serum of ms patients and healthy subjects.conclusions:ige allergy against fish and egg may be very unlikely to affect ms course . |
molecularly imprinted polymers ( mips ) have received much
attention recently as new materials capable of molecular recognition . they
have been extensively utilized in solid - phase extraction [ 25 ] , chromatography
[ 68 ] , sensing [ 9 , 10 ] , and catalysis [ 1113 ] . during molecular imprinting ,
crosslinked polymers are formed by free - radical copolymerization of functional
monomers with an excess of crosslinker around an analyte that acts as a
template . after polymerization , the template is removed leaving in this way selective
binding sites in the polymer network that are complementary in form and
functionality to the analyte molecules . the main advantages of mips , over conventional polymers
used as separation material , are the high selectivity and affinity for the target
analytes used in the imprinting procedure . furthermore , mips are characterized
by superior mechanical and thermal stability , as well as better inertness
towards acids , bases , metal ions , and organic solvents compared to enzymes . in
addition , imprinting polymerization is a very inexpensive procedure for the
development of artificial receptors . in the majority of the cases , the price of
an mip depends entirely on the price of the template used . moreover , if the
template is expensive , it is possible to recover the template and use it again .
alternatively , inexpensive template analogues can be used for the preparation
of mips . in most studies , methacrylic acid ( maa ) was used as
functional monomer to synthesize mips making the polymer preparation a simple
and facile process [ 1416 ] . maa can form hydrogen bonds with the template
molecule in porogen prior to polymerization . a more deliberate approach using
synthetically designed functional monomers could enable a better control in the
formation of high - affinity binding sites for each corresponding template minimizing ,
at the same time , the inherent nonspecific binding properties common in noncovalent
imprinted polymers . in this paper , we report for the first time the
preparation of mips as nucleoside receptors using both methacrylic acid and a
zinc - phthalocyanine peripherally substituted with methacrylic groups ( compound 1 , scheme 1 )
as functional monomers . the receptor site is a three - dimensional cavity
around the phthalocyanine plane in crosslinked polymers to which the analyte
molecule could be specifically bound via coordination through the metal of the
phthalocyanine and hydrogen bonding / electrostatic interaction with maa and the modifiers
linked to the phthalocyanine ( scheme 1 ) . such cooperative interaction approach
in mip formation , already proposed for porphyrin derivatives [ 1821 ] , was
applied here for the first time to phthalocyanine compounds . an organic soluble nucleoside derivative , tri - o - acetyladenosine ( toaa ) , was utilized
in this work as template in the preparation of phthalocyanine - based mips . the
development of synthetic receptors that recognize nucleotide bases and their
derivatives is an important area in chemistry today . the literature provides
many examples of artificial receptors for each of the common nucleoside bases [ 15,16,2225 ] . recently , these receptors have provided insights into dna - dna and
protein - dna interactions , and applications are envisioned in the fields of biosensors ,
drug therapy , separation science , and genetic engineering . toaa was selected as
model template in a previous work where the binding affinity and
selectivity of the zinc - phthalocyanine 1 towards different nucleosides were
evaluated by uv - vis titration experiments . binding experiments showed that zinc - phthalocyanine 1
bounds toaa most strongly , giving a
binding constant ka of 1.35104 , 500 times that
of 1 to tri - o - acetyluridine ( toau ) , showing in this way a high
selectivity . the presence of the 2-aminopyridine moiety in the structure
of toaa could be probably responsible for the good binding characteristics of
this nucleoside derivative with compounds functionalized with methacrylic
groups . an imprinted polymer receptor for toaa , namely , ppm(toaa ) ,
was prepared using both 1 and maa as functional monomers . imprinted polymers
were also prepared using either maa or 1 , called pm(toaa ) and pp(toaa ) ,
respectively , and used as references . corresponding unimprinted blank polymers ,
ppm(bl ) , pm(bl ) , and pp(bl ) , were prepared using the same monomers in the
absence of toaa . batch rebinding studies were conducted by uv - vis spectroscopy
and the binding characteristics of the mips were examined by scatchard analysis . in order to verify the selectivity
of the mips , the binding of toaa and its structurally related compound , toau ,
on the all prepared polymers was investigated . ethylene glycol dimethacrylate ( egdma ) , 2,3,5-tri - o - acetyladenosine
( toaa ) , 2,3,5-tri - o - acetyluridine
( toau ) , and acetic acid were purchased from sigma - aldrich ( steinheim , germany ) . --azoisobutyronitrile ( aibn ) and
methacrylic acid ( maa ) were supplied from fluka ( steinheim , germany ) . analytical grade dichloromethane and methanol were purchased from j. t. baker
( deventer , holland ) . zn(ii ) tetra(4-methacryloyloxyphenoxy)phthalocyanine ( 1 )
was prepared on the basis of a published method . uv - vis spectra were
obtained with a cary 100 scan uv - vis spectrophotometer . the preparation of ppm(toaa ) was carried out as follows :
to a solution of toaa ( 0,0468 mmol , as template ) in dichloromethane ( 262 l )
were added phthalocyanine 1 ( 0.0117 mmol , as the first functional monomer ) and
maa ( 0.1758 mmol , as the second functional monomer ) in a glass tube . after
adding of egdma ( 0.9360 mmol , as cross - linker ) and aibn ( 0.0112 mmol , as
initiator ) , the mixture was sonicated for 5 minutes flushing with nitrogen gas and
then polymerized by heating at 60c for 16 hours . the template molecules were removed by washing the polymer first
with methanol / acetic acid ( 7/3 v / v ) and then with methanol until no template
molecules were detected from the recovered solutions with a uv - vis
spectrophotometer . pm(toaa ) and pp(toaa ) were identically prepared using either
maa ( 0.1758 mmol ) or 1 ( 0.0117 mmol ) as functional monomer , respectively . the
corresponding blank polymers , ppm(bl ) , pm(bl ) , and pp(bl ) , were prepared in the
same manner in the absence of toaa . the polymer ( 20 mg ) was added to a dichloromethane
solution ( 3.5 ml ) of toaa of known concentrations ( 2.08.0105 m ) in vials . the resulting suspension was shaken
for 16 hours at room temperature , then the polymer was rapidly removed by
filtration and the resulting solution was analyzed by uv - vis spectrophotometer
at 258 nm . the amount of toaa bound to the polymer , b , was calculated by
subtraction of the concentration of free toaa , [ toaa ] , from the initial toaa
concentration . scatchard analysis was provided by the scatchard equation , b/[toaa ] =
( bmaxb ) ka , where ka is the association constant and bmax is the
apparent maximum number of binding sites . therefore , ka and bmax
of the polymer were determined from the slope and the intercept , respectively ,
by plotting of b/[toaa ] versus b. batch rebinding experiments and
scatchard analysis were performed in a similar manner for ppm(toaa ) , pm(toaa ) ,
pp(toaa ) , and the corresponding blank polymers . the rebinding tests were also
carried out incubating the polymers with toau in order to verify their binding
selectivity . the binding behavior of the prepared mips was evaluated by
batch rebinding tests and the binding data were processed with scatchard
equation in order to estimate the binding properties of the polymers . figure 1
shows the scatchard plot for ppm(toaa ) . as can be seen , it is a single straight
line , which indicates that there exists one kind of binding sites populated in
the mip . similar
scatchard plots were obtained in a study of yan et al . with malachite
green - imprinted polymers . this fact is very interesting since a nonlinear
profile was commonly observed in the scatchard assessment of mips indicating
the presence of binding sites that exhibit various affinities to the ligand
[ 18 , 20 , 21 ] . table 1 shows the values of
ka and bmax for ppm(toaa ) and pm(toaa ) . as shown , the mip prepared with both functional monomers 1 and maa ,
ppm(toaa ) , exhibited higher binding affinities for toaa compared to pm(toaa ) ,
prepared solely with maa . pp(toaa ) , prepared only with 1 , did not show any
binding capacity for toaa . this means that phthalocyanine 1 contributes to
higher binding affinities , although 1 itself barely interacts with toaa . the
effects of the use of both functional monomers strongly suggest that the
imprint that allows the simultaneous multipoint interactions of the template with
the carboxylic residues of maa and the zn(ii ) ion of 1 shows a higher binding
ability for toaa than that allowing only the individual template / functional
monomer interactions . the corresponding blank polymers , ppm(bl ) , pm(bl ) , and pp(bl ) ,
showed no binding affinities for toaa confirming that the selectivity was due
to the imprinting of the polymer matrix and not to the intrinsic affinity of
the template to the functional monomers alone . as for the selectivity ( figure 2 ) , both ppm(toaa ) and
pm(toaa ) exhibited binding affinities for toaa while they did not show any
binding capacity for toau . as expected , also pp(toaa ) did not show any binding
capacity for toau . if we examine the chemical structure of toaa and toau , it is
clear that toaa has more chances than toau to form hydrogen bonds with the mips
because of more functional groups that could form hydrogen bonds with the polymers . consequently , the polymers ppm(toaa ) and pm(toaa ) showed a good binding affinity
for toaa and no binding capacity for toau . this is not surprising since the
inability of carboxylic acid receptors to bind uracil derivatives appears to be
rather general as evidenced in the literature [ 15 , 27 , 28 ] . the higher binding affinity of ppm(toaa ) for toaa in
comparison with pm(toaa ) could be explained considering the possibility of coordination
of the zn(ii ) ion of 1 with the nitrogen atoms of the 2-amonopyridine moiety of
toaa . similar multipoint interactions have already been proposed by takeuchi et
al . in a study on the preparation of mips for cinchonidine by the combined
use of maa and a vinyl - substituted zinc(ii ) porphyrin as functional monomers . the coordination of the zn(ii ) ion with the nitrogen atoms of toaa could be explained
considering that the zinc(ii ) ion is the acid with moderate hardness and the
nitrogen atom of the 2-aminopyridine moiety is the base with moderate softness
. the absence of this kind of nitrogen atom in the chemical structure of
toau could explain the inability of ppm(toaa ) to bind toau . on the other hand ,
the inability of pp(toaa ) to bind toaa suggests that the coordination of the zn(ii )
ion of the phthalocyanine with the nucleoside is not sufficient alone to assure
the recognition and subsequent complementary binding between the receptor and
the nucleoside molecule , confirming in this way that the analyte molecule is
specifically bound to the polymer through multipoint interactions . a highly specific and selective toaa - imprinted polymer
was prepared by the combination of maa and a zinc - phthalocyanine substituted
with methacrylic groups as functional monomers . the effects of the simultaneous
use of the two functional monomers suggest the effective cooperation of the
phthalocyanine - based and carboxylic residues rather than independent operation
for retaining of toaa . considering these promising results for easily constructed and highly selective mips for nucleosides , new investigations are
now being directed towards the development of mip - based sensors arrays for
nucleoside discriminations . | a molecularly imprinted polymer ( mip ) for
tri - o - acetyladenosine ( toaa ) , ppm(toaa ) , was
prepared by the combined use of methacrylic acid ( maa ) and
zn(ii)tetra(4-methacryloxyphenoxy ) phthalocyanine as functional
monomers .
this mip exhibited a higher binding ability for toaa
compared to the mip prepared using only maa , pm(toaa ) , in batch
rebinding tests .
scatchard analysis gave a higher association
constant of ppm(toaa ) for toaa ( 2.96104 m1 ) than that of
pm(toaa ) ( 1.48104 m1 ) .
the mip
prepared using only the zinc - phthalocyanine , pp(toaa ) , did
not show any binding capacity for toaa .
this means that the
phthalocyanine in the mip contributes to higher affinities ,
although it barely interacts with toaa .
since selectivity
for this kind of mips is more important than binding
affinity , the binding of toaa and a structurally related
compound ,
tri - o - acetyluridine ( toau ) , on the polymers was
investigated . both ppm(toaa ) and pm(toaa ) exhibited binding
affinities for toaa while they did not show any binding capacity
for toau . |
although i was born in princeton , new jersey , i grew up half a world away in melbourne , australia . this was the direct result of the peculiarities of the academic job market , even in the mid-1970s . my father was a mathematician at princeton 's institute for advanced studies and was lured to the antipodes by an attractive offer from the university of melbourne . i 'm sure my parents expected to come back to the united states in due course , but the relaxed australian life - style suited our family , and we settled permanently in melbourne . because i was only three years old when we moved , i developed a deceptive australian accent that belies my new jersey heritage ! at high school and university ( both publicly funded ) , i followed a meandering path from biology to mathematics to psychology and back to biology . the broad education that i received as an undergraduate at the university of melbourne , with an emphasis on systematics and evolution , built a solid foundation that frames the more molecular and mechanistic questions i ask today . like many others , my laboratory experience was limited to prescribed classes , so my first summer of real research at the end of my third year was a revelation . i became fascinated by the elegant beauty of the single - celled algae that were the focus of study in rick wetherbee 's lab in the botany school . i worked with a postdoctoral fellow , jan lind , to characterize the extracellular glycoproteins these organisms use as cellular glues ( ludwig et al . , 1996 ) . student , which in the australian system is an optional fourth year of university that allows a full year of dedicated bench research . by the end of my honors office of naval research to investigate the marine diatoms that are the primary drivers of biofouling on ship hulls . this allowed me to work as a research assistant for a year , while i considered what i wanted to do next with my life , thinking for the first time that one could actually make a living doing this fun research thing . during my time in rick 's lab i started to appreciate the problem of how cells move macromolecules ( like those secreted glycoproteins ) around in very precise ways . with this interest in intracellular protein traffic in mind , i went looking for a lab that would further my training and afford some scientific independence . i was fortunate to join marilyn anderson in 1995 as she moved from the university of melbourne to la trobe university ( located in a suburb of melbourne ) . i joined her small group to initiate a new project investigating the delivery of a plant defense protein , napi , to the vacuole in tobacco cells . we had n't been at la trobe long when trevor lithgow joined the department , introducing me to the benefits of yeast as a model organism . under the joint supervision of marilyn and trevor , i defined the vacuolar sorting signal of napi and identified a candidate receptor that likely diverts the protein from the default pathway of secretion to an endosome - like prevacuolar compartment ( miller et al . , 1999 ) . aside from the superb scientific training i received from my advisors , graduate school was formative in other ways . most importantly , i forged lasting friendships with my peers , including my now - husband , marcus lee ( a fellow graduate student in marilyn 's lab ) , that enriched my life both at the bench and beyond . after four years in marilyn 's lab , it was time to move on and find the next step in my own path . inspired by both of my mentors fulfilling overseas postdocs ( marilyn at cold spring harbor and trevor at the biozentrum in basel ) , i sought out postdoctoral opportunities with those whose work i admired . in retrospect , my approach was very naive , and i am fortunate that i was even invited to interview with so many great labs , coming as i did from a somewhat obscure university in a distant land with ( as yet ) no publications to my name . nonetheless , both marcus and i managed to find excellent opportunities not only in the same city , but in the same lab , this time working with randy schekman . so , we gave away our furniture , packed our suitcases , and headed to berkeley , california . i was suddenly surrounded by a sizable cadre of smart , driven colleagues , both postdoctoral fellows and graduate students , all of whom focused on intellectual problems that fascinated me . the lab was well - funded , and we all had enormous freedom to pursue our own questions , guided always by randy 's own powerful and creative intellect . after a false start on a project to develop a new in vitro reconstitution assay , randy suggested i look into the molecular function of one of the coat proteins that drives vesicle formation from the endoplasmic reticulum ( barlowe et al . , 1994 ) . characterization of the copii coat was pioneered in randy 's lab , and we had in hand many genetic tools and in vitro assays that facilitated this new project . i used a combination of yeast genetics and biochemistry to delineate the copii subunit sec24 as the primary cargo - binding component of the coat ( miller et al . , 2002 ) . my findings dovetailed nicely with x - ray crystal structures that elena mossessova solved in jonathan goldberg 's lab , and we ended up publishing our findings in back - to - back papers ( miller et al . , 2003 ; mossessova et al . , 2003 ) . the panel of mutants that i generated in randy 's lab still provides interesting new leads ( kung et al . , 2012 ) , and we continue to use the powerful approaches of yeast genetics and biochemical assays that mutually inform each other . in retrospect , my postdoctoral years seem like glorious , carefree days when i had the time , resources , and stimulating environment to simply do the very best research i could . again , a group of like - minded colleagues , especially david madden , per malkus , and raphael valdivia , greatly enriched both my bench and leisure lives . yet , once again , it all too soon became time to move on . although the obvious next step after a postdoctoral fellowship is an independent faculty position ( at least here in the united states ) , i have to confess that i did n't necessarily see myself in that role at the end of my postdoc . i did n't have a long - term career plan , having instead simply been driven by the joy that i derived from doing research and the desire to keep having fun . nonetheless , i had to find a new position after several years in randy 's lab . so i went on the job market , looking mainly in larger cities that would also afford opportunities for marcus , who wanted to change fields and explore protein trafficking in the malarial parasite . our two - body problem was solved in new york city , with marcus joining a malaria lab on a second postdoctoral fellowship , while i joined the department of biological sciences at columbia university . fortunately for me , it turns out that running a lab is also a lot of fun , even if i do n't get to do as much bench work as i 'd like . my lab continues to explore the molecular mechanisms of vesicle formation from the endoplasmic reticulum , focusing on how protein folding influences this process . it has long been known that misfolded or improperly assembled proteins are not captured into copii vesicles , but the mechanism by which this quality - control checkpoint works remains unclear . this problem is central to a variety of human diseases , most notably cystic fibrosis , which is often caused by mutations in a chloride channel that cause the protein to misfold . we aimed to use yeast as a model system to probe the cellular pathways that contribute to biogenesis of a related yeast protein , yor1 ( pagant et al . , 2007 ) . i was fortunate to receive pilot funding and a subsequent full grant from the cystic fibrosis foundation , who were persuaded that we could successfully model a human disease in a genetically tractable system . my association with the cystic fibrosis foundation led directly to a fruitful collaboration with john hartman , an expert in quantitative genomics , who introduced us to the art of high - throughput screening ( louie et al . , 2012 ) . this approach has yielded a jackpot of mutants that we continue to characterize mechanistically using our biochemical assays . it goes without saying that the success of my lab is entirely the result of the fantastic students and postdocs with whom i have worked . i am grateful to my first crop of graduate students , ray louie , leslie kung , and mariana dorrington , who took a chance on a green principal investigator and joined my lab when we were still unpacking boxes . one of my great mentors at columbia , marty chalfie , advised me that initially i would be my own best postdoc . happily for me , this was not entirely true , as i managed to recruit a former colleague from the schekman lab , silvere pagant , who remains in the lab to this day as a senior research associate , leading our efforts on quality control of yor1 . the work of two talented postdocs , alenka copic and cath latham , opened up a new view of the problem of quality control , turning our focus to the physical properties of the vesicles themselves ( copic et al . , 2012 ) . another dedicated student , jenn d'arcangelo , is well underway with her efforts to follow up on our new model , which proposes that the protein quality - control checkpoint is in fact a stochastic product of cargo occupancy and vesicle architecture . there are clearly many exciting discoveries for us to make in the coming years . along with the debt of gratitude i owe my lab members , i am also extremely thankful for the support and encouragement of many mentors over the years . in addition to my research advisors , i deeply appreciate the support of my former department chairs and perennial cheerleaders : carol prives , mike sheetz , marty chalfie , and stuart firestein . respected colleagues bill wickner , frances brodsky , lois weisman , and susan michaelis are scientific supporters whose enthusiasm for my work is truly gratifying . indeed , i am grateful to the many talented colleagues who study intracellular membrane traffic and contribute to the supportive nature of the field as a whole . my impression is that this collegial community is , like i am , driven by a passion for science and excited by new discoveries , whatever their sources . finally , whatever success i have achieved professionally would not be possible without the support both intellectually and personally of my husband , who is an equal partner in raising our son and has made career sacrifices of his own to afford me the opportunities i 've had . | i am honored to be the first recipient of the women in cell biology sustained excellence in research award . since my graduate school days , i have enjoyed being part of a stimulating scientific community the american society for cell biology embodies .
having found myself largely by accident in a career that i find deeply enjoyable and fulfilling , i hope here to convey a sense that one need not have a grand plan to have a successful life in science
. simply following one 's interests and passions can sustain a career , even though it may involve some migration . |
osteosarcoma is a common malignant bone tumor in children that involves the metaphysis of the distal femur and proximal tibia . after surgery , the normal growth of the uninvolved , contralateral extremity can result in limb length discrepancy ( lld ) . a discrepancy of < 1 cm is acceptable because it is not noticeable and has no risk of complications . if the discrepancy is > 2 cm , complications such as limping , scoliosis , osteoarthritis of the knee and hip , low back pain , and lower extremity stress fractures can develop . if the expected lld at skeletal maturity is <3 cm , a discrepancy can be prevented by lengthening the limb 12 cm during reconstruction ; otherwise , alternative reconstructions , for example , expandable prostheses , should be used . prediction of the discrepancy before surgery is important for planning the reconstruction . however , there is no accepted , reliable method to predict discrepancies for children who undergo limb salvage surgery and chemotherapy . for healthy children , anderson 's growth remaining method , moseley 's straight line graph , and paley 's multiplier method have been the standards for predicting limb length and lld . among these , the multiplier method is simple and reliable . the length of limb or bone at maturity ( lm ) can be predicted by using the formula lm = l m , where l is the current length and m is the current age multiplier . the degree of discrepancy after epiphyseal plate injury equals the growth remaining on the physis ( gphysis ) , which is predicted using the formula gphysis = ( lm l ) , where is a constant ( 0.71 for the distal femur and 0.57 for the proximal tibia ) . thus , the accuracy of the coefficients ( m , the current age ) is the key to using the multiplier method . recently , gilg et al . reported a decreased adult height in patients after chemotherapy and therefore paley 's multiplier method overestimated the height of patients with bone tumors ( range : 17 to 8 cm , mean 2.3 cm , median absolute error 5 cm ) . the purpose of this study was to adjust the coefficients of the multiplier method to more accurately predict the length of the limb at maturity based on the lower limb length of chinese children with osteosarcoma . this retrospective study was approved by the medical ethics committee of beijing jishuitan hospital . to calculate the coefficients of the multiplier , patients were selected according to these inclusion criteria : osteosarcoma diagnosis , treated with adjuvant and neoadjuvant chemotherapy ( high - dose methotrexate , doxorubicin , ifosfamide , and cisplatin ) before skeletal maturity , and available standing full - length radiographs of the lower limb before 18-year - old . to assess the accuracy of prediction methods , patients were selected according to these inclusion criteria : osteosarcoma diagnosis , treated with adjuvant and neoadjuvant chemotherapy before skeletal maturity , and available pre - maturity and post - maturity standing full - length radiographs of the lower limb . patients whose lower limb length data were included to calculate the coefficients of multiplier were excluded . standing full - length radiographs of the lower extremity were taken using sonialvision safire ii equipment and slot - scanning technology ( shimadzu corporation , kyoto , japan ) . longitudinal length of the healthy ( without a tumor , tumor - like lesion , deformity , or trauma ) femur , tibia , and lower limb were measured from the proximal end of the femoral head to the intercondylar notch , the tibial crest to the center of the tibial plafond , and the proximal end of the femoral head to the center of the tibial plafond , respectively . statistical analyses were performed using the r project for statistical computing ( version 3.2.0 ; r foundation for statistical computing , vienna , austria ) . for constructing the length - for - age curves , the lms method ( package gamlss ) was used . then , the lower limb multiplier value for a specific age and gender was calculated using the formula m = lm / l , where m is the gender- and age - specific multiplier and l is the age - specific bone length . the maximal value under the curve was taken as the bone length at maturity ( lm ) . the lengths of the femur and tibia at maturity were predicted as anderson et al . or paley et al . this retrospective study was approved by the medical ethics committee of beijing jishuitan hospital . to calculate the coefficients of the multiplier , patients were selected according to these inclusion criteria : osteosarcoma diagnosis , treated with adjuvant and neoadjuvant chemotherapy ( high - dose methotrexate , doxorubicin , ifosfamide , and cisplatin ) before skeletal maturity , and available standing full - length radiographs of the lower limb before 18-year - old . to assess the accuracy of prediction methods , patients were selected according to these inclusion criteria : osteosarcoma diagnosis , treated with adjuvant and neoadjuvant chemotherapy before skeletal maturity , and available pre - maturity and post - maturity standing full - length radiographs of the lower limb . patients whose lower limb length data were included to calculate the coefficients of multiplier were excluded . standing full - length radiographs of the lower extremity were taken using sonialvision safire ii equipment and slot - scanning technology ( shimadzu corporation , kyoto , japan ) . longitudinal length of the healthy ( without a tumor , tumor - like lesion , deformity , or trauma ) femur , tibia , and lower limb were measured from the proximal end of the femoral head to the intercondylar notch , the tibial crest to the center of the tibial plafond , and the proximal end of the femoral head to the center of the tibial plafond , respectively . statistical analyses were performed using the r project for statistical computing ( version 3.2.0 ; r foundation for statistical computing , vienna , austria ) . for constructing the length - for - age curves , the lms method ( package gamlss ) was used . then , the lower limb multiplier value for a specific age and gender was calculated using the formula m = lm / l , where m is the gender- and age - specific multiplier and l is the age - specific bone length . the maximal value under the curve was taken as the bone length at maturity ( lm ) . the lengths of the femur and tibia at maturity were predicted as anderson et al . or paley et al . from january 2008 to september 2014 , 217 patients met the inclusion criteria and 827 radiographs ( 513 radiographs of 131 boys and 314 radiographs of 86 girls ) were used to construct the length - for - age curves and to calculate the coefficients of the multiplier method . the median length of the femur , tibia , and lower limbs for specific ages and gender and the length - for - age curves are shown in table 1 and figure 1 , respectively . the overall lower - limb multipliers for boys and girls are shown in table 2 and figure 2 . because the multipliers for the tibia and femur are nearly identical , we took the mean multipliers for both bones to obtain one , similar to what paley et al . did . median length and interquartile range of femur , tibia and lower limb of chinese boys and girls with osteosarcoma ( cm ) data are shown as median ( interquartile range ) . lower limb , femoral , and tibial length - for - age curves of chinese children with osteosarcoma , boys ( n = 131 ) , girls ( n = 86 ) . lower limb multipliers for chinese children with osteosarcoma femoral and tibial multipliers for chinese children with osteosarcoma . prematurity and postmaturity radiographs of 21 patients ( 15 boys and 6 girls ) were used to assess the accuracy of the prediction methods . the mean error of our predictions was lower than that of the error from paley 's and anderson 's predictions , and the difference was statistically significant [ table 3 ] . when compared with actual measurements , our coefficients had a correlation of 0.98 , whereas paley 's and anderson 's predictions had a correlation of 0.96 and 0.76 , respectively [ figure 3 ] . comparison of errors between different methods of predicting lengths of the femur and tibia at maturity ( n = 21 ) compared with mean error of our predictions by paired t - test : * t = 7.072 , p<0.001 ; t = 4.872 , p<0.001 . correlation between actual measurements and predicted the length of the femur and tibia using anderson 's method ( a ) , the multiplier method with paley 's coefficients ( b ) , and the multiplier method with our coefficients ( c ) , n=21 . for healthy children , there are three main methods to predict limb length and lld ; they are anderson 's growth remaining method , moseley 's straight line graph , and paley 's multiplier method . anderson 's method was designed only for caucasian children and is less accurate than other methods , consistent with our results . moseley 's method uses limb lengths measured at two or three ages ( interval 1 year ) as parameters for prediction ; therefore , it is not practical for a child who will soon undergo an operation . the multiplier method just uses current age and limb length measurements as parameters for prediction and has been proven to be more reliable than other methods . therefore , the multiplier method is the best choice to predict limb length and lld for chinese children with osteosarcoma . however , our results showed the mean femoral and tibial length of chinese children with osteosarcoma was overestimated by the multiplier method by 0.8 cm ( range : 1.2 to 3.4 cm ) . in 38.1% of cases , the error was more than 1 cm and in 11.9% more than 2 cm . gilg et al . reported similar findings of overestimation by the multiplier method using paley 's coefficients ( range : 17 to 8 cm , mean : 2.3 cm , median absolute error : 5 cm ) after chemotherapy . because an lld of more than 1 cm can lead to many complications , we need to be careful in predicting limb length and lld using paley 's coefficients for young sarcoma patients . all of the predicted femoral and tibial length errors using our coefficients were < 1.6 cm , which means the predicted lld errors were also very small . because few complications occur if lld is < 1 cm , we believe our coefficients are able to accurately predict limb length and lld of chinese children undergoing limb - salvage surgery for osteosarcoma . paley 's calculation was based on data from caucasian children . after reviewing two studies of chinese children and a study of black children , paley et al . this implies the modified coefficients in our study could be applicable for all children with osteosarcoma receiving chemotherapy , regardless of ethnicity . first , we could not calculate the mean length and standard deviation ( sd ) for a specific age and gender as anderson et al . did because the radiographs of our patients were not all performed at the same age . instead , we used the median length stratified by the lms method to calculate the coefficients rather than the average of the multiplier for each percentile group as paley et al . did . however , the multipliers for the mean group and average of each percentile group of 8- to 18-year - old children were approximately the same ; the median and mean length of the femur , tibia , and lower limb for a specific age and gender follow the same normal distribution . therefore , no essential differences between our statistical method and that of paley 's study exist . another limitation could be the lms method used in this study to construct the growth curve because children with osteosarcoma have a decline in growth velocity during chemotherapy and a catchup phase after cessation of antineoplastic treatment . however , the influence of antineoplastic agents on the growing bone is very complex , and there is a lack of reported statistical methods to analyze this type of data . considering the prediction error of our coefficients is acceptable , this limitation might be negligible in our study . we might be able to clarify this problem when more data are collected in the future . finally , using the constant ( 0.71 for the distal femur , 0.57 for the proximal tibia ) to predict lld is acceptable for a child who has undergone epiphysiodesis , but whether these values are equally applicable in predicting lld of a child who has undergone limb salvage surgery is questionable . the collapse of the implant and growth of remaining bone might vary according to the reconstruction method . therefore , the accuracy of the multiplier method in predicting lld might need further research for these children the adjusted coefficients of the multiplier method are reliable in predicting the lower limb length of chinese children with osteosarcoma . | background : for a child with osteosarcoma , prediction of the limb length discrepancy at maturity is important when planning for limb salvage surgery .
the purpose of this study was to provide a reliable prediction method.methods:a retrospective review of chinese children receiving chemotherapy for osteosarcoma before skeletal maturity was conducted . standing full - length radiographs of the lower extremity were used for length measurements .
length - for - age curves were constructed using the lms method .
the lower limb multiplier for a specific age and gender was calculated using the formula m = lm / l , where m was the gender- and age - specific multiplier , lm was the bone length at maturity , and l was the age - specific bone length .
prematurity and postmaturity radiographs were used to assess the accuracy of the prediction methods.results:a total of 513 radiographs of 131 boys and 314 radiographs of 86 girls were used to calculate the coefficients of the multiplier .
the multipliers of 8- , 9- , 10- , 11- , 12- , 13- , 14- , 15- , 16- , 17- , and 18-year - old boys after chemotherapy for osteosarcoma were 1.394 , 1.306 , 1.231 , 1.170 , 1.119 , 1.071 , 1.032 , 1.010 , 1.004 , 1.001 , and 1.000 , respectively ; while for girls at the same ages , the multipliers were 1.311 , 1.221 , 1.146 , 1.092 , 1.049 , 1.021 , 1.006 , 1.001 , 1.000 , 1.000 , and 1.000 , respectively .
prematurity and postmaturity femoral and tibial lengths of 21 patients were used to assess the prediction accuracy .
the mean prediction error was 0 cm , 0.8 cm , and 1.6 cm for the multiplier method using our coefficients , paley 's coefficients , and anderson 's method , respectively.conclusions:our coefficients for the multiplier method are reliable in predicting lower limb length growth of chinese children with osteosarcoma . |
during a severe financial crisis , it is a priority to use scientific evidence to identify factors that enable therapeutic compliance , based on the following main drivers : information to the patients about their illness , motivation , and behavioral skills . among the latter is the ability to comply with a medical prescription when prescribed medicines are purchased by the patients . economic factors can be a threat to medicines accessibility , the reimbursement systems being part of the solution . it considers a possible association between the number of patients who attended a medical appointment , and had medicine prescribed , and the number of these same patients who purchased the prescribed medicine and whether reimbursement level was a deciding compliance - related factor . several studies have shown that therapeutic compliance increases health benefits , following which a decrease in health care - related expenditure is expected . in order to support medication compliance , health care systems monitoring programs can be implemented . patients , medical doctors , and pharmacists to ensure that health outcomes actually follow prescribed therapeutic regimens , as pointed out by the world health organization .
on an individual basis , adherence to medical therapy ( the extent to which recommendations are followed as defined ) is a complex and dynamic behavioural process that is strongly influenced by the patient , his or her support environment , practices of healthcare providers , and the characteristics of care delivery systems , pp.47 . reimbursement systems can alleviate patients from the financial burden of diseases and promote therapeutic compliance . however , adverse side effects should be avoided , mainly for lower income individuals , patients requiring polytherapy , and those with chronic diseases and sustained medical expenditures . indeed , healthcare expenditure is a very important factor for patients with chronic diseases because the treatment could be life - long so the cost of therapy would constitute a large portion of their disposable income , pp.282 . therefore , it is critical to define copayment according to the expected therapeutic benefits in specific groups of patients , by decreasing therapeutical costs and fostering health outcomes . the reimbursement system in portugal is established according to disease severity , and the acute or chronic condition of diseases . the lower levels of copayment are applied to mild severity and acute diseases , being the highest ones related to severe and chronic conditions . there are 4 levels of reimbursement : level d , at15% , is the lowest one and includes medicines in a transitory situation in which the price evaluation is still ongoing in terms of reimbursement ; level c , at 37% , is for transitory and mild conditions ; level b , at 69% , includes medicines for moderate chronic diseases ; and level a , at 95% , is for medicines prescribed for severe chronic diseases . the prescription of medicines at public health care centers relies on national therapeutic guidelines published by the department of quality in health ( departamento da qualidade na sade ) of the health directorate ( direo geral de sade ) . a review of the literature shows 50% therapeutic compliance in patients having chronic diseases in developed countries . however , these generic data do not identify the specific variations in different pharmacotherapeutic groups and their associated health outcomes . when there is full compliance for hypertension , the risk of cardiac ischemic disease decreases by 3 or 4-fold . regarding patients who experience a first myocardial infarction , those who had statin compliance lower than 80% had a more than 4-fold increase in risk of recurrent myocardial infarction and a more than 2-fold higher risk of all cause mortality when compared to those who experienced an adherence equaled or higher than 80% . for antidyslipidemic drugs 12 months after therapy initiation , a study reported adherence of 84% to 89% , but another study reported only 50% . for diabetes , it was found that only 28% of the patients in europe achieved adequate glycemic control . similar results were found in patients with asthma using prophylactic therapy , while for patients using maintenance therapy , the number reaches 30% to 70% . financial factors are the most important reason for these results , followed by the number of different medicines prescribed for the patient . low levels of compliance reinforce the economic burden related to the most common diseases . in portugal , a study aimed at identifying the determinants for therapeutic compliance showed that the main reason for nonadherence was forgetfulness followed by lack of economic resources / being more expensive , with the latter being the second most stated reason . the third reason was not wanting to take the medicines or not liking the medication . this study also showed that about 33% of patients with chronic conditions ceased taking the prescribed medication for economic reasons . further studies have shown a decrease in the intake of prescribed medication as the cost of that medication increases . in these cases , discontinuation of either the ongoing or the beginning of therapeutic medication negatively affected health outcomes . on an individual basis , adherence to medical therapy ( the extent to which recommendations are followed as defined ) is a complex and dynamic behavioural process that is strongly influenced by the patient , his or her support environment , practices of healthcare providers , and the characteristics of care delivery systems , pp.47 . reimbursement systems can alleviate patients from the financial burden of diseases and promote therapeutic compliance . however , adverse side effects should be avoided , mainly for lower income individuals , patients requiring polytherapy , and those with chronic diseases and sustained medical expenditures . indeed , healthcare expenditure is a very important factor for patients with chronic diseases because the treatment could be life - long so the cost of therapy would constitute a large portion of their disposable income , pp.282 .
therefore , it is critical to define copayment according to the expected therapeutic benefits in specific groups of patients , by decreasing therapeutical costs and fostering health outcomes . the reimbursement system in portugal is established according to disease severity , and the acute or chronic condition of diseases . the lower levels of copayment are applied to mild severity and acute diseases , being the highest ones related to severe and chronic conditions . there are 4 levels of reimbursement : level d , at15% , is the lowest one and includes medicines in a transitory situation in which the price evaluation is still ongoing in terms of reimbursement ; level c , at 37% , is for transitory and mild conditions ; level b , at 69% , includes medicines for moderate chronic diseases ; and level a , at 95% , is for medicines prescribed for severe chronic diseases . the prescription of medicines at public health care centers relies on national therapeutic guidelines published by the department of quality in health ( departamento da qualidade na sade ) of the health directorate ( direo geral de sade ) . a review of the literature shows 50% therapeutic compliance in patients having chronic diseases in developed countries . however , these generic data do not identify the specific variations in different pharmacotherapeutic groups and their associated health outcomes . when there is full compliance for hypertension , the risk of cardiac ischemic disease decreases by 3 or 4-fold . regarding patients who experience a first myocardial infarction , those who had statin compliance lower than 80% had a more than 4-fold increase in risk of recurrent myocardial infarction and a more than 2-fold higher risk of all cause mortality when compared to those who experienced an adherence equaled or higher than 80% . for antidyslipidemic drugs 12 months after therapy initiation , a study reported adherence of 84% to 89% , but another study reported only 50% . for diabetes , it was found that only 28% of the patients in europe achieved adequate glycemic control . similar results were found in patients with asthma using prophylactic therapy , while for patients using maintenance therapy , the number reaches 30% to 70% . financial factors are the most important reason for these results , followed by the number of different medicines prescribed for the patient . low levels of compliance reinforce the economic burden related to the most common diseases . in portugal , a study aimed at identifying the determinants for therapeutic compliance showed that the main reason for nonadherence was forgetfulness followed by lack of economic resources / being more expensive , with the latter being the second most stated reason . the third reason was not wanting to take the medicines or not liking the medication . this study also showed that about 33% of patients with chronic conditions ceased taking the prescribed medication for economic reasons . further studies have shown a decrease in the intake of prescribed medication as the cost of that medication increases . in these cases , discontinuation of either the ongoing or the beginning of therapeutic medication negatively affected health outcomes . portuguese patients attending a medical appointment between 2010 and the first half of 2012 at 64 public health care centers ( continental portugal aces ) were identified . the sample includes patients with diagnosis related to the most prevailing diseases in portugal , which represent the highest percentage of public health costs : diabetes , hypertension , cerebrovascular diseases , asthma , and ulcer disease , as displayed at table 1 . norms issued by health directorate , code icpc , pharmacoterapeutic group ( ptg ) , and associated reimbursement levels . the number of patients with prescriptions has been collected from the health system central office ( administrao central do sistema de sade ) . data concerning the number of patients with purchased prescribed medicines were obtained from the invoice checking centre ( central de conferncia de faturas ) . the percentage of variation between the number of patients with prescriptions and the number who actually had their medicines dispensed provides a measure of therapeutic compliance in terms of prescribed medicines purchased . a conservative approach was taken with respect to the missing data of patients who had had prescriptions and medicine dispensed during the second semester of 2012 . the annual data came to a total of 96 observations , a total of 32 observations collected per year during the 3 years . they concern each one of the disease segments related to the 16 international classification of primary care codes of diseases . following a descriptive longitudinal and retrospective analysis , we pursue with an estimation of the normality presuppositions in order to conduct a correlation analysis . a major asymmetry was observed concerning the number of patients in each of the identified segments , with patients having arterial hypertension being the most numerous . average numbers of 3 475 016 ( standard deviation [ sd ] = 323,481 ) patients with medical prescriptions and 3 191 672 ( sd = 186,209 ) patients with prescribed medicines dispensed by pharmacies were observed . between 2010 and 2012 , the average number of patients in the diabetes segment of the pharmacotherapeutic groups with medical prescriptions was 831 410 ( sd = 315 413 ) , which decreased to an average of 749 078 ( sd = 264 796 ) patients who purchased their prescribed medicines in the pharmacy . for those taking antiplatelet , antiulcer , and antiasthmatic therapies , the average number of patients with medical prescriptions was 73 418 ( sd = 79,563 ) , 174 396 ( sd = 90,730 ) , and 100 660 ( sd = 73,055 ) , respectively . for the same segments , the average number of patients with prescriptions who purchased the prescribed medicines from a pharmacy was 76 990 ( sd = 92 135 ) , 127 024 ( sd = 66 510 ) , and 86 386 ( sd = 65 429 ) , respectively ( table 2 ) . descriptive statistics concerning the number of patients with medicine prescription and dispensing for the segments associated according to the pharmacotherapeutical groups , for the period between 2010 and 2012 .
abbreviation : sd , standard deviation . calculation by the authors , based on data at health system central office and invoice checking centre . the percentage of variation observed between the average number of patients with a medical prescription and the average number of the same patients who effectively purchased the prescribed medicines between 2010 and 2012 decreased by 32% for the antiulcer and by 16% , 9% , 5% , and 7% for the antiasthmatic , antiplatelet , antihypertensive , and antidiabetic segments , respectively . we found a positive correlation between the percentage of variation in the number of the same patients with prescriptions and with medicines dispensed belonging to the various pharmacotherapeutic groups and the reimbursement level associated with the pharmacotherapeutic groups ( table 3 ) . the positive association between these 2 variables decreased from a high correlation coefficient of .629 in 2010 to a moderate correlation coefficient of .498 in 2012 , being statistically significant for the 3 correlations ( p < .01 ) . spearman correlation coefficient between the percentage variation observed between the number of patients with prescription and dispensing of medicines belonging to 5 pharmacoterapeutic groups and the associated reimbursement level , between 2010 and 2012 .
calculation based on data from health system central office and invoice checking centre . therapy nonadherence by diabetic patients and those with cardiovascular diseases is a major concern considering the increase in morbidity and mortality in portugal . this study has identified a shortcoming in the health service that leads to a medical appointment that eventually requires additional diagnostic examinations to identify the most suitable therapy and adequate regimen for the patient . the most appropriate treatment therapy could be concluded with the patient purchasing from a pharmacy and taking the medicine . this was the weakness in the health service that was observed in the study , in which purchasing of the medicine by the patient was not fully ensured . the results showed that compliance was greater when the reimbursement level was higher , as the correlation coefficient showed a statistically significant moderate to high positive association . it is possible that these observations may be related to the diseases included in each reimbursement level that are defined according to their severity and chronicity . the higher levels of reimbursement include the pharmacotherapeutic groups associated with more severe and chronic diseases that demand long - term therapies , while the lower levels can be long - term or intermittent conditions , but the drug therapy is for mild and acute diseases . this may be the reason why chronic patients with diseases demanding more frequent medical surveillance are more aware of the need to comply with the prescribed therapeutic regimen compared to the others who are not subject to such frequent clinical surveillance . this study has several limitations , as neither the number of competitors nor their respective prices were identified in each market segment . another aspect is related to patients socioeconomic status , which defines their ability to pay and is therefore directly related to medicine purchase in line with other basic and essential goods , potentially influencing medicine compliance . it is essential to ensure that medical appointment resources are efficiently used to promote public health . the reimbursement level is a potentially modifying factor in patients behavior in relation to the prescribed medicine purchases . contributing to providing holistic medicine reimbursement systems will optimize the use of public resources in the health sector . | during a severe financial crisis , it is a priority to use scientific evidence to identify factors that enable therapeutic compliance by patients .
this study aimed to evaluate a possible association between the number of patients who attended a medical appointment and had medicine prescribed and the number of these same patients who purchased the prescribed medicine and whether the level of reimbursement was a deciding factor .
we perform a correlation analysis at primary care centers in portugal , between 2010 and 2012 ( n = 96 ) .
we found a moderate to high positive association , which is statistical significant , between the number of the patients with medicines dispensing and medicines reimbursement levels .
the correlation coefficient varies from .5 to .63 ( p < .01 ) .
the compliance increases along with the increase in the reimbursement levels . |
japan already has a super - aging society , where 1 in every 5 people is aged 65 years or older . in such an aging population , the issue of pelvic organ prolapse ( pop ) is an increasing concern . japanese gynecologists have traditionally performed curative surgical procedures such as vaginal hysterectomy ( vh ) , anterior and posterior colpoplasty , and circumferential suture of the levator ani muscles for pop and especially for uterine prolapse . however , following reports by a french group of gynecologists of a tension - free vaginal mesh ( tvm ) surgery for the repair of pop using mesh without hysterectomy that has a favorable cure rate and low frequency of complications [ 1 , 2 ] , many japanese gynecologists have switched to using this technique . in certain hospitals , this surgical procedure has replaced vh as the first - line surgical option for pop . pop is attributed to vulnerability of the pelvic floor and often adversely affects quality of life and sexual function [ 3 , 4 ] . it can also distort the lower urinary tract , resulting in stress urinary incontinence ( sui ) and other voiding dysfunctions . the aim of treatment for pop should , therefore , not only aim at anatomical restoration but also at maintaining or improving patients ' quality of life . as many pop patients present with lower urinary symptoms , it is vital that voiding function is evaluated preoperatively . it should also be evaluated postoperatively on followup because several studies have demonstrated that applying transvaginal mesh for anterior vaginal prolapse increases the risk of de novo sui [ 6 , 7 ] . in addition , other complications such as mesh erosion , de novo dyspareunia , and recurrent prolapse have been reported in women who have undergone tvm . at the department of obstetrics and gynecology , shimane university school of medicine , we have employed tvm surgery as the first - line surgical treatment for pop . we report here the clinical outcome of 105 patients with pop who underwent tvm surgery , focusing on the occurrence of pre- and postoperative sui and examining the correlation between pelvic organ prolapse quantification ( pop - q ) stage , predominant prolapsed organ , and residual urine volume . between september 2009 and september 2012 , 105 women with pop underwent the tvm procedure at our department . mean age at surgery was 69.4 8.20 years ; 15 women were 59 years , 37 were 6069 years , 41 were 7079 years , and 12 were 80 years . those women with pop - q stage 2 who provided written informed consent were scheduled for tvm surgery . the presence of preoperative sui was confirmed at the time of surgery and patients were designated into two groups : with and without preoperative sui . in 48 patients , briefly , a monofilament polypropylene mesh ( 25 25 cm , gynemesh ps ; ethicon , somerville , nj ) is cut into a similar shape as that used in the prolift system ( ethicon , somerville , nj ) . a full - thickness incision of the vaginal wall is made following sufficient fluid separation with epinephrine diluted 4 10-fold . the mesh arm on each side is passed into the paravesical region using a modified emmet needle . the anterior subvesical strap into the arcus tendineus fasciae pelvis and the posterior subvesical strap is inserted into the arcus tendineus 1 cm from the sciatic spine . for the p - tvm to correct rectocele and/or uterine prolapse , a posterior colpotomy is performed longitudinally , and the mesh is placed under the vaginal wall . on each side , the mesh strap is passed into the pararectal space through the sacrosciatic ligament to become exteriorized in incisions located outside and below the anus . for total tvm ( t - tvm ) in patients with vaginal stump prolapse following hysterectomy , a one - piece prosthetic mesh consisting of two parts connected to each other is inserted into the anterior and posterior walls . after cystoscopy and digital examination of the rectum , the colpotomy is closed with a 2 - 0 pds running suture without additional colpectomy . patients were discharged 3 days after surgery and monitored for postoperative complications on an outpatient basis at 1 , 3 , 6 , and 12 months postoperatively . postoperative sui was defined as even one episode of a period of increased intra - abdominal pressure that sui patients reported at the 1- and 3-month followups . those patients without preoperative sui who reported experiencing an episode of sui after tvm for the first time were designated as having de novo postoperative sui . for analysis of pop - q stage by age distribution , patients were divided into 4 groups : < 60 years , 6069 years , 7079 years , and 80 years . for the analysis of predominant prolapsed organ by age distribution , we divided the predominant prolapsed organ into cystocele , uterine prolapse , rectocele , and vaginal vault prolapse . statistical analysis was performed using the chi - square test with p < 0.05 taken to indicate statistical significance . the characteristics of the 105 patients who underwent tvm surgery between september 2009 and september 2012 are shown in table 1 . stage iii was most commonly diagnosed pop - q stage ( n = 73 ) , followed by stage ii ( n = 23 ) and stage iv ( n = 9 ) . no significant difference in the degree of pop progression was found for age distribution . in regard to the predominant prolapsed organ , the most common was cystocele in 63 patients ( 60% ) , uterine prolapse in 29 ( 27.6% ) , vault prolapse in 7 ( 6.7% ) , and rectocele in 6 ( 5.7% ) . no significant difference was found between the pop primary lesion and age distribution , as shown in table 2 . almost half of the 105 patients who underwent tvm surgery had preoperative sui ( n = 50 ) . no significant difference in the frequency of preoperative sui was seen between the age groups . in addition , irrespectively of pop - q stage or predominant prolapsed organ , there was no significant relationship observed with the presence of preoperative sui ( table 3 ) . analysis of the occurrence of postoperative sui revealed that from the 55 patients who did not have preoperative sui , 28 ( 50.9% ) did not have sui postoperatively ; the remaining 26 ( 47.3% ) had de novo postoperative sui . no differences were observed in the postoperative sui incidence rate due to differences in the predominant prolapsed organ or when investigated by pop - q classification ( data not shown ) . of the 50 patients with preoperative sui , 14 ( 28.0% ) reported no postoperative sui and the remaining 35 ( 70% ) observed the same degree of sui as they had preoperatively ( table 4 ) . from among the 26 patients with de novo postoperative sui , of these 23 patients , 5 ( 21.7% ) reported the resolution of sui and 8 ( 34.7% ) reported that symptoms were milder despite still being present . these 13 patients who experienced resolution or alleviation comprised half of those in whom de novo sui appeared postoperatively following tvm . anticholinergics were prescribed for the 4 patients whose symptoms did not improve , and of these , 1 patient underwent incontinence surgery using tension - free vaginal tape ( tvt surgery ) ( table 5 ) . when the 35 patients with preoperative sui and in whom sui persisted after tvm were asked about the course of their symptoms at the 3-month followup , 25 ( 71.4% ) reported that sui was the same as preoperatively and 10 patients ( 28.6% ) reported that it had worsened . of these , 4 patients ( 11.4% ) were prescribed medication ( table 6 ) . residual urine volume measurements taken in 48 patients prior to tvm surgery were investigated with relation to sui . when the number of patients with a preoperative residual urine volume 50 ml and those with volume < 50 ml was compared according to pop - q stage , no relationship was observed between them . there was also no relationship observed between the presence of preoperative sui and preoperative residual urine volume ( table 7 ) or between preoperative residual urine volume and the presence of postoperative sui ( table 8) . de novo sui is one of the complications of pop surgery in patients without preoperative sui [ 10 , 11 ] . in the present study , patients who underwent pop surgery at shimane university hospital in the past 3 years were studied retrospectively to investigate the relationship between sui and pop . firstly , the pop - q stages of 105 patients who underwent tvm surgery were classified by age , but there were no significant differences in terms of the degree of pop progression and age distribution . in addition , even when pop was classified according to a report by delancey , where injury at stage i leads to uterine and vault prolapse , and injury at stage ii leads to cystocele and rectocele formation , no difference was observed between the age groups when predominant prolapsed organ was compared . these results do not show that pop itself progresses as age increases but rather that there are no differences between the age groups when the main site of injury is compared . pelvic organ prolapse not only consists of the symptoms of organ descent but also causes a high rate of lower urinary tract symptoms , including difficulty in voiding , dysuria , and incontinence . in the present study , the presence of preoperative sui in 105 patients who underwent mesh surgery was investigated . there was no difference in the presence of sui between patients with and without preoperative sui , regardless of whether the presence of sui was investigated by age , pop - q stage , or by predominant prolapsed organ . this is consistent with a report by araki et al . stating that the detrusor muscle function is widely distributed in pop patients . postoperative sui is a well - known complication of pop surgery , but even in our study , 47.3% of the 55 patients without preoperative sui experienced de novo postoperative sui . this implies that de novo sui is a result of the resolution of urethral obstruction by anatomical reconstruction . therefore , the fact that approximately half of the patients without preoperative sui will develop it postoperatively needs to be the subject of informed consent . meanwhile , although a third of the 50 patients with preoperative sui reported resolution postoperatively , 70% still had symptoms of sui . tvm surgery did improve sui in some cases , but even still , we suggest it would be better for patients if their expectations regarding sui improvement by tvm surgery are not too high . after tvm surgery , approximately half of the patients developed de novo sui , but of those approximately half reported that sui was resolved within 6 months or it had subsided to the extent that did no longer bothered them . conversely , for 17% , it became a problem that affected their everyday lives and medication was prescribed ; incontinence surgery was performed for only one patient ( 4.3% ) . even if postoperative sui appears only transiently , a small number of serious cases may require surgery . thus , even if postoperative sui appeared only transiently in our patients , we considered whether or not surgical treatment should be expedited , keeping in mind the possibility of relieving the symptoms . no association was observed between the preoperative residual urine volume and presence of preoperative sui , so predicting the onset of sui postoperatively is considered difficult . as stated earlier , gynecologists should routinely make a detailed evaluation of voiding function as a basic minimum when pop surgery is scheduled . it has previously been suggested that preoperative evaluation of detrusor function or urethral function might help predict urinary outcome in patients with pop [ 14 , 15 ] . since tvm is associated with the risk of inducing sui , a condition not usually treated by obstetricians and gynecologists , such professionals should improve their understanding of the pathogenesis of various types of urinary incontinence and specific tests , such as urodynamic study , as well as cooperating with urologists in treating pop . as the number of obstetricians and gynecologists adopting tvm for the treatment of pop is expected to increase , surgeons should know that sufficient informed consent with regards to the onset of postoperative sui is required . tvm surgery is a useful surgical method that can replace traditional methods for treating pop , but sufficient informed consent with regards to the onset of postoperative sui is required . | objective . to examine retrospectively the occurrence of stress urinary incontinence ( sui ) in patients who underwent transvaginal mesh repair ( tvm ) for pelvic organ prolapse ( pop )
. methods .
the presence of preoperative sui and postoperative changes in sui was retrospectively analyzed for 105 patients who underwent tvm for pop between september 2009 and september 2012 .
results .
preoperative sui was observed in almost half of the patients ( n = 50 ) who underwent tvm surgery .
no significant differences were seen in patient age , pelvic organ prolapse quantification ( pop - q ) stage , or primary pop complaint between those with and without preoperative sui . of the 50 patients with preoperative sui , sui was resolved in 14 ( 28% ) following tvm surgery .
of the 55 patients without preoperative sui , de novo postoperative sui appeared in 26 ( 47.3% ) , of whom approximately half experienced resolution or improvement of sui within 6 months postoperatively .
there was no relationship between preoperative residual urine volume and occurrence of postoperative sui .
conclusion .
tvm surgery is a useful surgical method that can replace traditional methods for treating pop , but sufficient informed consent with regards to the onset of postoperative sui is required . |
the disease is named after victor babes , the hungarian pathologist and microbiologist who identified intraerythrocytic microorganisms as a cause of febrile hemoglobinuria in cattle in 1888 . then in 1893 , theobald smith and frederick l. killborne identified a tick as a vector for transmission of babesia bigemina in texas cattle . this observation demonstrated the first time that an arthropod could transmit an infectious agent to a vertebrate host . the first documented human case was about half century later in a splenectomized croatian herdsman by babesia divergens . the first case in an immunocompetent person was in nantucket island in masachusetts , in 1969 , by babesia microti ; the vector was ixodes dammini tick ( now known as ixodes scapularis ) . b. microti is the main etiologic agents in northern and midwestern regions of the united states . most clinically evident disease occurs primarily in those patients with advanced age or those with underlying immunosuppression . , there is no characteristic rash and the symptoms are often mild in immunocompetent person . symptoms include a gradual onset of malaise , fever , fatigue , and headache , along with myalgias , arthralgias , and nausea . b. microti can multiply to levels sufficient enough to cause hemolytic anemia , thrombocytopenia , and atypical lymphocytosis . more severe disease can cause organ dysfunction , including mental status change , pulmonary edema , renal failure , hepatosplenomegaly , and jaundice . in the us , 56.5% of all patients who develop symptomatic infection with b. microti die from the infection . exacerbation of babesiosis has also been demonstrated experimentally in animals following splenectomy or administration of antisplenic cell serum . we describe a healthy man , with no history of trauma , presenting with spontaneous splenic rupture on day 1 of hospitalization , later discovered to have babesiosis . successful non - surgical management is discussed , including using polymerase chain reaction ( pcr ) dna , a more sensitive test to make the diagnosis of babesiosis . a 54 year old male with no significant past medical history presented to our institution with complaints of dull left upper quadrant abdominal pain for one week along with abdominal distention and subjective fevers and headache . he had seen a holistic doctor in chinatown where who had performed bedside ultrasound and had told him that he had fluid in his stomach . patient denied nausea , vomiting , diarrhea , chest pain , dyspnea , cough , rash , joint pain , trauma , or any weight loss . temperature on presentation was 98.6 f with a blood pressure of 106/64 and oxygen saturation of 98% on room air . laboratory results included total leukocyte count of 4.4 k / cumm , hemoglobin level of 10.6 g / dl , hematocrit of 31.3% , and a platelet count of 123 k / cumm . total bilirubin of 0.9 mg / dl , aspirate aminotransferase of 67 u / l , alanine aminotransferase 92 u / l , and alkaline phosphatase 107 u / l . ct scan of the abdomen and pelvis showed mildly enlarged spleen with moderate sized hemoperitoneum ( perihepatic and perisplenic ) , extending into the pelvis ( fig . a linear hypodensity was present in the inferomedial aspect of spleen , suspicious for splenic laceration . the initial clinical impression was infectious mononucleosis with spontaneous splenic bleed , and/or spontaneous hemoperitoneum with no clear inciting event with normal coagulation profile . repeat liver function test was elevated with total bilirubin of 2.1 mg / dl , direct bilirubin of 0.3 mg / dl , alkaline phosphatase level of 168 u / l , aspartate aminotransferase level of 100 u / l , and alanine aminotransferase level of 118 patient was hydrated for the blood loss , being treated for the pain , and tolerating a surgical liquid diet . panel of tests were ran including : ebv , cmv , babesia , malaria , ldh , and hiv . the elevated ldh , indirect bilirubin , along with splenomegaly was suggestive of hemolytic anemia . cmv dna pcr , cmv igg , hiv , mono test , and ebv were all negative . patient experienced 2 transient episodes of hypotension where his systolic pressure decreased to 80s ; patient was asymptomatic . he was managed conservatively for the splenic rupture ; he remained hemodynamically stable with continued intravenous fluids and 2 units of prbc transfusions . he was to complete a total of 10 days of antimicrobial therapy and a follow up with the infectious disease specialist as outpatient . human babesiosis is a malaria - like infection documented since biblical times in cattle but only recently as a zoonotic pathogen of humans . this may be due to the increased white - tailed deer population and the white - footed mouse or simply because of increased awareness and reporting . besides tick transmission , babesiosis can spread transplacentally and through blood transfusions . fever is present ( intermittent or sustained ) ; less common symptoms include headache , myalgia , arthralgia , and anorexia . patients experiencing severe babesiosis present with the above along with thrombocytopenia and elevated liver enzymes . spontaneous splenic rupture is a rare complication as a result of infection with babesia species ; and few reports exist in literature . it may be secondary to phagocytosis of babesia - infected erythrocytes by splenic histiocytes in addition to sequestration of platelets causing thrombocytopenia . the first documented case of splenic rupture from babesiosis was reported in the lay press from 2005 , where it described a man in minnesota who underwent emergent splenectomy for spontaneous rupture secondary to babesiosis . however , this case was never reported in a medical journal , . in the absence of trauma , splenic rupture can occur in infectious mononucleosis , malaria , typhoid fever , leukemia , cmv , plasmodium species , coxiella species , bartonella species , staphylococcus species , and streptococcus species , . diagnosis is generally determined upon microscopic examination of thin blood smears , polymerase chain reaction ( pcr ) , small animal inoculation , and identification of babesia antibody titer . the method used to diagnose babesiosis in our patient was light cycler real time pcr . detection of b. microti was based on the sequence of 252-bp fragment of the highly conserved 16s - like ribosomal rna gene and was carried out through a light cycler probe utilizing the roche light cycler . to control for substances that may interfere with pcr amplification , a molecular ( pcr - based ) screening strategy - either as a stand - alone or as a means to complement serology - would enable detection of acute parasitemia , independent of phase of infection . pcr assay can rapidly detect and quantify genotype of small subunit ribosomal rna gene ( ssurdna ) of b. microti . the genotype - specific pairs of primers targeted on internal transcribed spacer ( its ) 1 or 2 sequences is used and amplicons by pairs of primers displayed the high specificity for homologous genotype dna . dna is amplified using the following primers : bab 2 ( 5-gttatagtttatttgatgttcgttt-3/bab 3 ( 5-aagccatgcgattcgctaat-3 and bab1 ( 5-gttagtataagcttttatacagc-3)/bab 4 ( 5-ataggtcagaaacttgaatgataca-3 ) to generate 154-bp amplicons . bab 2 and bab 3 are b. microti - specific fragments from a gene encoding the small subunit r rna at decreasing inoculum of 445 , 44.5 and 4.45 copies / ml , the assay has positive rates of 100 , 97.5 and 81% , respectively . a blinded probit analysis demonstrates a detection rate of 95 and 50% at 12.92 and 1.52 parasites/2 ml of whole blood , respectively , which proves that quantitative real - time pcr - based assay for detection of b. microti is a highly sensitive and specific test , , . patients with active babesiosis require treatment , which includes those with viral infection - like symptoms and identification of babesial parasites in blood smear by pcr . symptomatic patients with positive antibody to babesia but absent babesial parasites on smear or babesial dna by pcr should not receive treatment . treatment is also not suggested for asymptomatic patients regardless of the results of the serologic tests , blood smears , or pcr . if parasitemia persists after repeat testing in a 3 month period , then treatment should be considered . treatment usually involves a two - drug regimen ; clindamycin plus quinine , or atovaquone plus azithromycin ( as in the case of our patient ) for 710 days . if patients are persistently symptomatic , longer duration of antimicrobial therapy may be employed . partial or complete red blood cell exchange transfusion is indicated for those with severe babesiosis with high grade parasitemia ( > 10% ) , significant hemolysis ( hemoglobin < 10 ) , or renal , hepatic , or pulmonary compromise . frequently splenic rupture develops into an extensive intraperitoneal hemorrhage leading to hemodynamic instability requiring urgent splenectomy to prevent death . interventional radiology is another option for patients who continue to require blood transfusion while maintaining hemodynamic stability . in case of sudden deterioration . however , to best optimize patient outcomes , there should be low threshold for urgent laparatomy and splenectomy . | this article describes the case of spontaneous splenic rupture as a rare complication of infection with babesia species .
we will discuss the symptomatology that this disease could present along with both surgical and non - surgical management approaches .
babesia infection often presents with mild to moderate symptoms , but can rapidly progress to significant injury including splenic rupture .
the first case reported in a medical journal was in 2007 .
treatment usually involves a two - drug regimen ; clindamycin plus quinine , or atovaquone plus azithromycin ( as in our patient ) .
if hemodynamic stability is present , a primary non - surgical treatment may be especially beneficial since splenectomy may worsen optimal immunologic function and the infection itself . |
cardiac involvement in hypereosinophilia is rare ; when present , its various manifestations range from heart failure to thromboembolic events and/or atrial fibrillation , which are caused by fibrous thickening of the endocardium of one or both ventricles and mural thrombosis.1)2 ) toxocara canis ( t. canis ) is a common roundworm in dogs . toxocariasis with concomitant eosinophilia is an often asymptomatic and self - resolving condition ; however , clinical forms of toxocariasis may be present.3 ) myocarditis occurs in 10 - 15% of cases of visceral larva migrans , and in those cases , myocarditis is accompanied by an increased level of circulating eosinophils.3 ) here , we report a patient who presented with right heart failure , a thickened right ventricular apex with thrombus , and peripheral eosinophilia for 8 months , which was associated with toxocariasis . a 57-year - old male presented to the hospital with generalized edema and recently progressive dyspnea . he had been treated at an outside hospital after presenting with a pericardial effusion , right atrium ( ra ) thrombus , and ascites for 2 months . when he visited the hospital , his vital signs were stable with blood pressure , 130/80 mm hg ; pulse rate , 98 beat / min ; respiratory rate , 20 breaths / min ; and body temperature , 36.4. physical examination revealed jugular venous distension in the sitting position , decreased breaths sound in the bilateral lower lung fields , a severely distended abdomen with shifting dullness on percussion , and pretibial pitting edema . cardiac auscultation revealed a grade 2/6 systolic heart murmur , and electrocardiography demonstrated atrial flutter with a ventricular rate of 77 bpm ( fig . ng / l ( normal range , 0 - 40 ng / l ) , mildly elevated liver enzymes ( direct bilirubin 0.71 mg / dl , alkaline phosphatase 223 iu / l ) , and a high - sensitivity c - reactive protein of 7.12 mg / dl ( normal level 0 - 0.75 ) . complete blood count showed a white blood count of 9.4 10/l with 15% eosinophils ( 1410/mm ) , and eosinophilia was persistent since 8 months ago from the past medical records . transthoracic echocardiography showed an enlarged ra with spontaneous echo contrast , no definite thrombus , and a normal left ventricular ejection fraction ( fig . 3a , supplementary movie 1 ) and moderate tricuspid regurgitation with an elevated right ventricle ( rv ) systolic pressure ( 49 mm hg ) . interestingly , dense rv apical trabeculations with a large hypoechogenic mass occupied the apex ( fig . after review of previous echocardiography at the outside hospital , we identified that this rv apical mass was present for at least 3 months ( fig . pericardiotomy was performed , and biopsy revealed non - specific pericarditis without evidence of tuberculosis . 5a ) without alteration of the dense rv apical mass ( fig . 5b , supplementary movie 3 ) . chest computerized tomography showed no pulmonary thromboembolism , a normal endobronchial lesion , and normal coronary arteries with a relatively hypodense thickened rv apical endomyocardium , suggesting rv apical fibrosis with thrombus ( fig . a cardiac manifestation associated with hypereosinophilia was suspected based on echocardiographic findings with a suspicious rv apical thrombus and peripheral eosinophilia.4 ) further work - up the following day with cardiac magnetic resonance imaging ( mri ) showed thickening of the hypodense rv apex ( fig . we performed an endomyocardial biopsy and serological studies in order to define the cause of the patient 's eosinophilia and symptoms ; however , endomyocardial biopsy showed no evidence of eosinophilic infiltration . there was elevation of ig g ( 2000 mg / dl ; normal range , 650 - 1500 mg / dl ) and a greater elevation of total ig e ( 5000 iu / ml ; normal range , 0 - 380 iu / ml ) . through further work - up , we excluded secondary hypereosinophilia ( due to malignant diseases , allergy , vasculitis , parasitic infection ) . since the initial tests were inconclusive and the patient had a history of occupational canine exposure , serological tests for parasites were done . the diagnosis of toxocariasis was confirmed by serological exams [ elisa for t. canis positive ; 2.306 ( cut off : 0.848 ) ] . he was treated with anticoagulation by intravenous infusion of unfractionated heparin , which was later bridged to warfarin . in addition , intravenous furosemide ( 20 - 40 mg / day ) was administered to control ascites and edema . since the patient 's symptoms were relieved by management of his heart failure , immunosuppressive treatment was not initiated . in addition , due to clinical and laboratory improvement , he was not treated with albendazole . hypereosinophilic syndrome is a rare condition , consisting of an elevated persistent eosinophil blood count ( > 1500 cells / mm for at least 6 months ) and evidence of organ dysfunction related to eosinophil infiltration.5 ) cardiac involvement , generally affecting the myocardium , is noted in more than 50% of patients . presentations include either right or left ventricular effects , pericardial or global myocardial manifestations , heart failure , intracardiac thrombi , myocardial ischemia , arrhythmias , or pericarditis.2)5 ) during the early necrotic stage , eosinophil infiltration produces endocardial microabscesses , and subsequently a thrombus is formed on the surfaces of the myocardium of both ventricles . finally , endomyocardial fibrosis occurs with congestive heart failure;6 ) loeffler 's endocarditis is thought to be a late cardiac manifestation that is characterized by fibrous thickening of the ventricular endocardium with extensive eosinophilic infiltration leading to apical thrombotic obliteration.4)7)8 ) endomyocardial biopsy is currently the gold standard for diagnosis , although typical findings from noninvasive methods such as cardiac mri may suggest the diagnosis . in the present study , toxocariasis associated eosinophilia is often asymptomatic , but the various clinical forms of toxocariasis may be present.3 ) when infectious eggs of t. canis reach the human gastrointestinal tract , they enter the portal system and the liver . following this , some visceral larva migrate from the liver to various organ systems such as the skin , lungs , and on rare occasions , the heart and central nervous system through the systemic circulation . loeffler 's endomyocarditis and pericardial tamponade are the unusual manifestations described in the literature.9)10 ) although there was no evidence of eosinophilic infiltration in the endomyocardial biopsy , considering possibility of inadequate tissue due to thrombus or fibrosis , we hypothesized that the cardiac manifestations in our patient were due to eosinophilic infiltration and that the myocardial damage increased troponin levels . our patient had a diagnosis of toxocariasis with myocardial manifestations , along with generalized symptoms and eosinophilia for 8 months . the diagnosis was confirmed with serological tests ( elisa ) for t. canis . the combination of serological tests , clinical manifestations , laboratory findings , and the patient 's occupational history supported the diagnosis . the patient remains on drug therapy , and serial follow - up echocardiography is also planned . until now , we have not been able to find any reports of rv involvement from hypereosinophilia caused by t. canis . our case suggests that when a patient who has myocarditis with eosinophilia presents , toxocara infection should be considered as a possible cause of eosinophilia , especially when there is a history of exposure to dogs and when the patient is a professional dog trainer . there were dense right ventricular apical trabeculations with a large hypoechogenic mass occupying the apex . | cardiac involvement in hypereosinophilia is rare ; when present , it manifests as ventricular thickening , usually with fibrous tissue and mural thrombosis .
we present a case of a 57-year - old man with an abnormal right ventricular apex with eosinophilia , which was caused by toxocara canis infection . |
patients with burns often present to the operation theatre with different painful conditions that require immediate surgical interventions and anaesthetic agents are needed to provide necessary deep sedation , along with analgesia . ketamine has been a safe and effective anaesthetic agent for burns dressings with a few limitations such as delayed recovery , emergence phenomenon , and nausea and vomiting . propofol is also used due to its favourable pharmacokinetics but it lacks the analgesic property intrinsic to ketamine . dexmedetomidine ( dex ) , a highly selective 2-adrenoreceptor agonist , is used for sedation in various clinical settings and shows an anaesthetic - sparing effect . studies have shown that concomitant dexmedetomidine use may reduce the requirement of propofol and ketamine , with faster postoperative recovery and more stable intraoperative haemodynamics . hence , we evaluated whether dex affects the requirement for propofol , ketamine and intraoperative haemodynamics during burns debridement and dressing changes , and compared its effectiveness and safety with conventional combination ketamine plus propofol . this prospective , open label study was conducted to assess whether dex affects the requirement of propofol and ketamine in 60 consenting patients aged between 18 - 60 years , posted for burns dressing and debridement . patients were excluded from study with known allergy or contraindications to study drugs , head injury , seizure disorder , and psychological disorders . monitors ( electrocardiography , noninvasive blood pressure ( nibp ) and pulse oximeter ) were attached and the baseline values were noted . in both dex and control groups , patients were premedicated with intravenous glycopyrrolate 0.2 mg , ramosetron 0.3 mg , and fentanyl , 2 g / kg . all patients were administered bolus dose of ketamine 0.5 mg / kg and propofol 1 mg / kg i.v . in separate syringes . then the patients received an infusion of 1 mg / kg / h of ketamine and 100 g / kg / min of propofol for maintenance in separate i.v lines . the propofol plus ketamine infusion was adjusted to achieve a ramsay sedation scale score ( rss ) of 6 . as soon as the desired level of sedation was achieved , an appropriate size of laryngeal mask airway ( lma ) was inserted and patients were maintained on spontaneous respiration . if patients showed increase in the heart rate , blood pressure , respiratory rate , or body movement on initiation of the surgical procedure was considered as inadequate anaesthesia / analgesia and managed by administering bolus dose of ketamine , 0.25 mg / kg or propofol 0.25 mg / kg through an infusion pump . blood pressure and heart rate were measured just after placing lma and at a regular interval of 5 , 15 , 30 , 45 , and 60 min . the study drug infusion was discontinued at the end of the surgical procedure , and total drug consumption was noted . the recovery time ( i.e. the time from discontinuation of infusion of the study drug and achievement of rss score of 3 ) patients were discharged from the recovery room after attaining an aldrete recovery scale score of 9/ [ as the aldrete score is cosidered to be standard for discharge from recovery room ] . the categorical data were expressed as frequencies and percentages and continuous variables were expressed as mean , median and standard deviation . the mean data between the groups was compared by unpaired t test and medians by mann - whitney u test . within group analysis a sample of 30 patients per group was required to demonstrate an estimated reduction in dose of ketamine and propofol in both the groups , with 99% power to detect the difference and two - sided alpha error of 0.05 . there was no statistically significant difference in the demographic and clinical characteristics among the two groups [ table 1 ] . the mean dose of ketamine used in dex group was significantly less ( 100.5 17.58 mg ) whereas it was 231.5 60.39 mg in the control group ( p < 0.0001 ) . similarly , mean dose of propofol in dex and control groups were 127.7 15.47 mg and 254 59.22 mg respectively ( p < 0.0001 ) [ figure 1 ] . time to recovery was 9.57 1.50 min in the dex group which was significantly lower than in the control group 11.53 2.56 min ( p = 0.0006 ) [ figure 2 ] . demographic and clinical characteristics comparison of dose requirement of ketamine and propofol with and without dexmedetomidine comparison of recovery time with or without dexmedetomidine in can be noticed from table 2 that in dexmedetomidine group hr , sbp , and dbp varied from 74.23 6.76 to 80.47 9.54 beats / min , 114.8 12.6 to 118.9 5.9 mm hg and 80.17 8.02 to 76.90 7.16 mm hg , respectively , whereas in control group hr , sbp , and dbp varied from 97.80 17.70 to 85.60 19.87 beats / min , 137.60 14.33 to 129.37 9.98 mm hg and 93.60 9.68 to 85.67 9.46 mm hg [ figures 3 and 4 ] starting from 0 min to 60 min . haemodynamic variables between dex group and control group comparison of changes in blood pressure between two groups comparison of changes in pulse rate between two groups dexmedetomidine , by activating pre and postsynaptic 2-receptors of sympathetic system produces vasodilatation . by acting on postsynaptic 2-receptors of vascular smooth muscle cells it produces vasoconstriction . it thereby , shows a biphasic , dose - dependent response on blood pressure and heart rate , characterized by an initial short - term increase in bp followed by a longer lasting reduction in bp and hr . most previous investigations have proven the cardiovascular depressive effects of i m dex at a dose of 2.5 g / kg , which increases the incidence of hypotension and bradycardia . however , virkkila et al . showed that i m dex 1 g / kg produced sedation and a reduction of intraocular pressure with minimal haemodynamic side effects when given as premedication before cataract surgery under regional anaesthesia . according to markku et al . i m dex provides complete bioavailability and needs less preoperative monitoring as compared to iv dex . also , scheinin et al . showed that the intramuscular doses resulted in linearly dose - related plasma concentrations of dexmedetomidine ; henceforth , clearance and half - life remains constant irrespective of its plasma concentration . for all these reasons we evaluated the effect of 1.0 g / kg i m dex on the requirement for supplemental propofol and ketamine during anaesthesia for burns debridement and dressing changes . despite the limited data , the advantage of adding dexmedetomidine with ketamine is that both balance the haemodynamic and adverse effects of each other . dexmedetomidine may decrease the incidence of tachycardia , hypertension , salivation , and emergence phenomena from ketamine , while ketamine may prevent the bradycardia and hypotension of dexmedetomidine . additionally , ketamine as part of the sedation induction may speed the onset of sedation and eliminate the slow onset time of i m dex . in our study , i m dex reduced the amount of adjuvant propofol and ketamine needed to maintain a rss score of 6 and provided more stable haemodynamics without compromising postoperative recovery . these results are consistent with previous investigations showing a 30 - 50% reduction in the propofol requirement with concomitant use of dex in adolescent patients and healthy volunteers . the sedative effect of dex is mediated through the locus ceruleus in the brain stem , where dex decreases sympathetic outflow and increases parasympathetic outflow . though dex , propofol . and ketamine act at different centres of the brain , they show synergism with respect to their sedative effects . previous studies showed a possible delay in recovery from propofol anaesthesia with the concomitant use of dex , probably due to its quite long duration of action . however , such findings of prolongation of extubation or recovery time profiles were not observed in the present study . dex , by its propofol sparing effect , may be beneficial for reducing the propofol dosage and avoiding adverse effects such as myocardial depression , metabolic acidosis , impaired platelet aggregation , and extended recovery caused by prolonged and large - dose administration of propofol . according to our study , i m dexmedetomidine use does not cause any significant haemodynamic changes . however , we observed a transient increase in bp immediately after shifting the patient inside the operation theatre may be due to patients anxiety and it came down to normal level after giving fentanyl and midazolam premedication . a more constant stable haemodynamics observed during anesthesia induction , surgical incision and throughout the procedure . there is decreased consumption of propofol and ketamine because of sedo - analgesic , anaesthetic - sparing effect of dexmedetomidine . bispectral index could have been a better monitor for assessing awareness and sedation but could not be used due to non - availability . clinical changes in the heart rate and blood pressure that are nonspecific were used as signs of increased nociception during our study . dexmedetomidine ( 1 g / kg i m dose ) is a good anaesthetic adjuvant that decreases the requirement of propofol and ketamine during burns debridement and dressings , attenuates sympathoadrenal response , maintains stable intraoperative haemodynamics and adequate duration of analgesia , and also has an excellent recovery profile . | background and aims : dexmedetomidine ( dex ) , a highly selective 2-adrenoreceptor agonist , is used for sedation management in various clinical settings and shows anaesthetic - sparing effect .
our aim was to study the effects of dex on requirements of propofol , ketamine , and intraoperative haemodynamic variations during burns debridement and dressing changes , and compare its effectiveness and safety with combination of ketamine and propofol.methods:sixty adult patients posted for elective debridement and dressing were included in the study .
thirty patients received dex ( intramuscular)(im ) 1 g / kg , 1 h before shifting to the operation theatre while the other thirty did not .
anaesthesia was induced with propofol and ketamine followed by adjusted infusion to achieve a ramsay sedation scale score ( rss ) of six in all patients .
intraoperatively haemodynamic parameters were recorded at regular intervals of 5 , 15 , 30 , 45 , and 60 min .
the mean data between the groups were compared by unpaired t test and medians by mann - whitney u test . within group analysis
was performed by using repeated measures anova .
p < 0.05 was considered significant.results:the dose requirement of ketamine and propofol in dex group was significantly lower when compared to control group ( 100.5 17.58 mg vs. 231.5 60.39 mg ( p < 0.0001 ) and 127.7 15.47 mg vs. 254 59.22 mg ( p < 0.0001 ) respectively ) . additionally , recovery time was lower in the dex group as compared to the control group , 9.57 1.50 min vs. 11.53 2.56 min ( p = 0.0006 ) .
haemodynamic variations were also significantly lower in the dex group as compared to the control group.conclusion:dexmedetomidine ( 1 g / kg i m ) reduced the requirement of propofol and ketamine , with more stable intraoperative haemodynamics . |
to date , there are no guidelines for a rational and more favourable sequence of treatment after docetaxel . two drugs ( cabazitaxel and abiraterone ) have recently been approved as second - line treatment after docetaxel failure in metastatic castration - resistant prostate cancer ( mcrpc ) , but there are no studies comparing abiraterone versus cabazitaxel . the most suitable drug is chosen based on the physician 's opinion and the patient 's characteristics . in patients with a good performance status who are able to receive either treatment , it would be convenient to begin with cabazitaxel and to reserve abiraterone in case there is a worsening of the general status , in consideration of abiraterone 's more favourable toxicity profile . we describe the case of a 74-year - old male with mcrpc who presented with an interesting and uncommon tumour dissemination ( pleuropulmonary ) occurring after the first standard treatment with docetaxel . intravenous treatment with cabazitaxel 25 a reduction of mediastinal adenopathies and infrarenal para - aortic stable bone involvement and an absence of pleural effusion were observed . no relevant toxicity was noted . since february 2012 , a progressive psa increase without clinical deterioration has been noted . the selection criteria for second- and third - line systemic treatment and the excellent response obtained with cabazitaxel in an unusual disease setting are described . metastatic castration - resistant prostate cancer ( mcrpc ) has been considered an aggressive and incurable disease with poor prognosis . in the last 10 years , the standard first - line mcrpc treatment has been docetaxel every 3 weeks combined with prednisone [ 1 , 2 ] . the tropic phase iii clinical trial confirmed the effectiveness of cabazitaxel versus mitoxantrone in terms of disease survival ( 15.1 vs. 12.1 months ) in patients who had progressed after docetaxel , also conferring an improvement in quality of life . results from this study led to cabazitaxel approval as second - line treatment in mcrpc . more recently , in 2010 , another chemotherapeutic agent , abiraterone , demonstrated improved survival versus placebo ( 14.8 vs. 10.9 months , respectively ) in mcrpc after docetaxel failure ( cou - aa-301 phase iii study ) [ 4 , 5 ] ; abiraterone was also approved for use as second - line treatment after docetaxel failure . to date , there are no guidelines for a rational and more favourable sequence of treatment after docetaxel , nor are there studies comparing abiraterone versus cabazitaxel . thus , the most suitable drug is chosen based on the physician 's opinion and the patient 's characteristics . in case of patients with a good performance status who are able to receive either treatment with cabazitaxel or abiraterone , it would be convenient to begin with the former and to reserve the latter drug in case there is a worsening of the general status , in consideration of the more favourable toxicity profile of abiraterone . a 74-year - old male with performance status 0 presented with a prostate specific antigen ( psa ) level of 51.2 ng / ml in august 2001 . after biopsy , computed axial tomography ( ct ) and bone scan , prostate adenocarcinoma t2bn0m0 , gleason 6 ( 2 + 4 ) , was diagnosed and considered an intermediate risk . the patient was treated with radical prostate - bed radiotherapy and full androgenic block with oral ( po ) bicalutamide 50 mg/24 h and subcutaneous goserelin 10.8 mg quarterly until march 2002 , when it was decided to remove the blockade after reaching an almost undetectable psa level . he was asymptomatic with a stable psa level less than 0.07 ng / ml until march 2003 , when the psa level started increasing until reaching its highest level ( 7.27 ng / ml ) in may 2005 . because of this biochemical relapse , antiandrogenic treatment was initiated with po tamoxifen 10 mg/12 h and po bicalutamide 50 mg/24 h , progressively reducing the psa level ( reaching its nadir of 0.66 ng / ml in september 2006 ) . the blockade was suspended and a quarterly subcutaneous treatment with leuprorelin acetate was initiated . in september 2009 , the psa level rose to 47.53 ng / ml along with a clinical picture of weakness of the lower limbs , ambulatory difficulty and mechanical lumbar pain . a thoracic - abdominal - pelvic ct scan was requested ; it focused on adenopathies between 1 and 2 cm in the upper and middle mediastinum and the left infrarenal para - aortics , as well as diffuse bone lesions in the lumbar vertebral bodies . magnetic resonance imaging showed a mass of soft tissue at the spinal level causing a spinal stenosis , maximum t7 level , without compromising the spinal cord , so it was treated with palliative intent radiotherapy ( fig . , first - line chemotherapy treatment was started with intravenous docetaxel 75 mg / m and po prednisone 5 mg/12 h. the first cycle was given on october 21 , 2009 . the patient 's psa level at this time was 47.53 ng / ml . he completed 9 cycles of treatment ( the last in april 2010 ) with excellent tolerance . a further evaluation in may 2010 gave a partial response , continuing only with luteinizing hormone - releasing hormone analogues . in april 2011 , pulmonary progression with right pleural effusion and pathological size increase in paratracheal adenopathies and the aortopulmonary window were observed on a ct scan and histologically confirmed . due to this situation and the good overall condition of the patient , it was decided to initiate intravenous treatment with cabazitaxel 25 mg / m and po prednisone 10 mg continuously . at the beginning of the treatment , his psa level was 120.62 ng / ml , reaching 64 ng / ml after the third cycle in june 2011 . after 6 cycles of chemotherapy , a reduction of mediastinal adenopathies and infrarenal para - aortic stable bone involvement and an absence of pleural effusion were observed . the patient 's psa level was 48.58 ng / ml . given the good response and the absence of toxicity , it was decided to continue with 2 more cycles . after 8 cycles , the last of which was in september 2011 , treatment was discontinued as it was considered that the therapeutic plan had been fulfilled without having relevant toxicity at any time . in february 2012 , a thoracic - abdominal - pelvic ct scan was requested , which showed stability of the infradiaphragmatic and supradiaphragmatic gland injuries , as well as diffuse bone metastasis . to date since february 2012 , a progressive psa increase without clinical deterioration has been noted . in january 2013 , the reintroduction of cabazitaxel treatment would be our first choice given the clinical benefit and the important targeted radiological and biochemical responses . currently , there is a treatment - free interval following the end of the 16-month cabazitaxel treatment and a 6-month period free of biological progression . mcrpc has historically been considered an aggressive and ultimately incurable disease with a poor prognosis , although its treatment has progressed significantly in recent decades . currently , docetaxel every 3 weeks alongside prednisone is the reference first - line treatment of mcrpc [ 1 , 2 ] . the use of bisphosphonates , in particular zoledronic acid , in patients with prostate cancer and metastatic bone disease has not proven to be superior to the best support treatment in terms of a decrease in bone events such as pathological fractures or spinal cord compressions [ 6 , 7 , 8 ] . in our case , we did not use bisphosphonates , considering the good pain control achieved with nonsteroidal anti - inflammatory medicines and transdermal fentanyl . the evidence from cases in which there is progress after first - line treatment with taxanes has promoted the study and emergence of various agents directed against other therapeutic targets . in this regard , chemotherapy with cabazitaxel , a semisynthetic antimicrotubule agent derived from taxanes , as well as treatment with the inhibitor of cytochrome p , abiraterone acetate , has offered an increase in survival while maintaining a good quality of life . for the first time in the tropic phase iii clinical trial , the effectiveness of cabazitaxel versus mitoxantrone was proven in terms of survival , also conferring an improvement in the quality of life . however , as with other taxanes , it is worth noting that there is haematological toxicity , in particular neutropenia ; therefore , administering cabazitaxel in combination with granulocyte colony - stimulating factor is recommended . moreover , its safety in elderly patients was proven in an interim analysis in 20 countries of the european union . in our 74-year - old patient , granulocyte colony - stimulating factor was prophylactically administered from the second cycle of cabazitaxel , maintaining optimal levels of the three haematological series during the treatment and showing an excellent tolerance towards cabazitaxel treatment . this case was atypical due to the presence of pleuropulmonary metastases secondary to prostate cancer , and because of the good subjective and objective response to the cabazitaxel treatment , supporting the results of the tropic phase iii clinical trial . the presence of visceral metastasis , which defined the disease as aggressive , along with haemoglobin levels and performance status among other aspects were studied in this trial as forecast factors , with the psa level being unequivocally the most important [ 3 , 7 , 10 ] . one of the biggest controversies focuses on determining the ideal time and best results of post - docetaxel castration - resistant prostate cancer treatment . currently , there are no guidelines or protocols indicating which are the most beneficial and logical sequences ; there are also no studies which directly compare abiraterone and cabazitaxel . the most suitable drug must be chosen based on the treating physician 's judgment and the personal characteristics of the patient . it seems logical that , in the case of patients with a good performance status capable of receiving treatment both with cabazitaxel and abiraterone , it would be convenient to start with the former , keeping the latter in case of an eventual overall deterioration , acting consistently with the most favourable toxicity profile of abiraterone . for those who have progressed to docetaxel during mcrpc treatment , a reintroduction of treatment could also be considered if there was a good initial response to first - line treatment ( lasting over 4 months ) , if relapse occurred after 6 or more months after the last cycle , if docetaxel was interrupted because of toxicity , or if a tenth cycle had been reached . currently , there are no randomized studies that prove a benefit from treatment reintroduction . in addition , there is recent data about a probable lower efficacy in the reintroduction of treatment with docetaxel following abiraterone , suggesting some mechanism of cross - resistance . all of the above , along with the existence of drugs such as abiraterone and cabazitaxel which have a favourable response rate and toxicity profile , means that reintroduction of treatment with docetaxel is unusual in everyday medical practice . emphasis in the handling of mcrpc should focus on the chronology of the metastatic disease , with first - line treatment with docetaxel and a long - term vision to maximize the opportunity for patients to receive all or most of the treatments available today , with continuous treatment and the discovery of new agents being as important as their rational and sequential use . in this regard , after progressing to taxanes , treatment with cabazitaxel has shown benefits in overall survival in terms of elderly patients and aggressive disease , along with an acceptable toxicity profile , turning it into the standard mcrpc therapy after progressing to docetaxel . | introductionto date , there are no guidelines for a rational and more favourable sequence of treatment after docetaxel . two drugs ( cabazitaxel and abiraterone ) have recently been approved as second - line treatment after docetaxel failure in metastatic castration - resistant prostate cancer ( mcrpc ) , but there are no studies comparing abiraterone versus cabazitaxel .
the most suitable drug is chosen based on the physician 's opinion and the patient 's characteristics . in patients with a good performance status who are able to receive either treatment
, it would be convenient to begin with cabazitaxel and to reserve abiraterone in case there is a worsening of the general status , in consideration of abiraterone 's more favourable toxicity profile.case reportwe describe the case of a 74-year - old male with mcrpc who presented with an interesting and uncommon tumour dissemination ( pleuropulmonary ) occurring after the first standard treatment with docetaxel .
intravenous treatment with cabazitaxel 25 mg / m2 and oral prednisone 10 mg continuously was initiated .
the patient received a total of 8 cycles of chemotherapy .
a reduction of mediastinal adenopathies and infrarenal para - aortic stable bone involvement and an absence of pleural effusion were observed .
no relevant toxicity was noted . since february 2012 , a progressive psa increase without clinical deterioration
has been noted.conclusionsthe selection criteria for second- and third - line systemic treatment and the excellent response obtained with cabazitaxel in an unusual disease setting are described .
the results confirm the long duration and quality of response of cabazitaxel treatment .
further therapeutic options in this group of patients are suggested . |
kumar1 claimed that people have
difficulty using the hamstrings , muscles that are prone to shortening . ayala2 argued that the hamstrings play a
significant role in effective walking and running , and that short hamstrings have often been
observed in people , especially athletes . in addition , extended hamstring muscle contraction
prevents complete extension and reduces flexibility . as stated by kim3 , stretching is one of the most popular methods to increase
muscular flexibility ; thus , self - myofascial release with a foam roller has gradually become
preferred to improve muscular flexibility , particularly since it is a low - cost intervention . faulkner4 also asserted that
self - myofascial stretching improves one s sense of physical awareness and joint sensitivity ,
and improves the function of the proprioceptors , which function in balance and motor skills . muscular flexibility of the hamstrings can be examined using the sit and reach test ,
passive toe touch test , and straight leg raise ( slr test ) . the sit and reach test is highly
reliable ; thus , it is used as a valid testing method5 ,
6 . ultrasound delivers heat deep into
the muscles , resulting in better flexibility of the collagen fibers and muscles7 , 8 . the therapeutic effects of ultrasound include relaxed joint contracture , better adhesion ,
and reduced joint stiffness , pain , and muscular rigidity7 , 9 . therefore , this study explored the positive effects of self - myofascial release on hamstring
muscular flexibility and proprioception and investigated the comparative effectiveness of
the stretch combined with therapeutic ultrasound . this study involved 30 university students ( mean age , 21.8 0.81 years ; 1:1 male : female
ratio ; mean height , 167.6 8.49 cm ; mean weight , 62.5 8.13 kg ) with no history of pain in
the achilles tendon or hamstrings within the most recent 6 months . written informed consent
was obtained from each subject . this study was approved by the ethics committee of the kaya
university ( kaya irb-78 ) . the subjects participated in two experiments . in the first experiment ( ms ) , they performed
self - myofascial stretching using a foam roller daily for 1 week . in the second experiment
( msu ) , the same participants performed the self - myofascial stretching after the 15-minute
application of ultrasound . ultrasound therapy were applied to the biceps femoris ,
semitendinosus , and semimembranosus muscles for 5 minutes each ( frequency , 1 hz ; strength ,
3 w / cm ; velocity : 2 cm / sec ) . this study included pre- and post - tests of
hamstring muscle flexibility and hip joint proprioception . this study used the sit and reach test to
evaluate hamstring flexibility , while dual inclinometers were used to test hip joint
proprioception . a paired t - test was used to test differences between the pre- and post - test
results , while an independent t - test was used to test differences between the two
experiments . the use of self - myofascial stretching in the ms experiment had a significant effect on
hamstring flexibility and hip joint proprioception . however , the addition of ultrasound to
self - myofascial stretching in the msu experiment had no additive effect ( table 1table 1.comparison of hamstring flexibility and hip joint proprioception before versus
after the ms and msu interventionsbeforeafterdifferencesmssrt ( cm)7.42 10.2110.92 9.84 * 9.58 10.12jps ( degrees)3.57 2.491.41 1.30 * 0.40 1.02msusrt ( cm)5.42 11.3310.67 9.73 * 9.36 10.48jps ( degrees)7.45 4.281.37 2.12 * 0.79 1.82ms : self - myofascial stretching ; msu : self - myofascial stretching with ultrasound ; srt :
sit and reach test ; jps : joint position sense ( * p<0.05 , mean sd ) ) . ms : self - myofascial stretching ; msu : self - myofascial stretching with ultrasound ; srt :
sit and reach test ; jps : joint position sense ( * p<0.05 , mean sd ) as suggested by sherer11 ,
self - myofascial stretching had a significant effect on increased hamstring flexibility and
improving hip joint proprioception . longo12 also investigated the muscle and tendon stiffness after stretching
with feet lifted 20 degrees toward the shin , that is , in dorsi - flexion , using an
electromyogram and an ultrasound . as shown in the aforementioned research , this study also
presented the same result that self - myofascial stretching using a foam roller immediately
increased hamstring flexibility and enhanced hip joint proprioception . however , the results of this study showed that the use of therapeutic ultrasound for 15
minutes prior to the self - myofascial stretching had no additional effect on hamstring
flexibility or hip joint proprioception . therapeutic ultrasound delivers heat to the soft
tissues , which helps increase blood circulation and induce relaxation . as suggested by
kondo13 , the application of heat on leg
contractures in mice did not increase muscular flexibility . however , further research should
be performed since lounsberry14 presented
the contradictory result that therapeutic ultrasound treatment applied to the hamstrings can
increase muscular flexibility . the current study concluded that self - myofascial stretching immediately increased hamstring
flexibility and improved hip joint proprioception but that the addition of therapeutic
ultrasound offered no further benefit . | [ purpose ] this research explored the positive effects of self - myofascial release on
hamstring muscular flexibility and proprioception and investigated the effectiveness of
the stretch combined with therapeutic ultrasound . [ subjects and methods ] this study
included 30 healthy university students with no history of pain in the achilles tendon or
hamstring within the recent 6 months .
each participant completed two experiments . in the
first experiment ( ms ) , they completed self - myofascial stretching using a foam roller for 7
days . in the second experiment ( msu ) , the same participants performed the self - myofascial
stretching after the 15-minute application of ultrasound .
this study involved a pre- and
post - test on hamstring muscle flexibility and hip joint proprioception .
[ results ] the use
of self - myofascial stretching in the ms experiment had a significant effect on hamstring
muscle flexibility and hip joint proprioception .
however , the addition of ultrasound in
the msu experiment had no additive effect . [ conclusion ] self - myofascial stretching
immediately increased hamstring muscle flexibility and improved hip joint proprioception ,
but the addition of pre - stretch ultra sound provided no further benefit . |
in recent years , the incidence of obesity - related glomerulopathy has been steadily
increasing in patients with chronic kidney disease ( ckd ) . according to one report , the
relative risks for ckd in overweight ( body mass index [ bmi ] of 25 kg / m or
higher ) and obese individuals ( bmi of 30 kg / m or higher ) , as compared to
individuals with a normal bmi ( 1825 kg / m ) , are 1.40 and 1.83 respectively1 . another study reported the independent risk
ratio for ckd as 1.86 in patients with metabolic syndrome2 . therefore , we believe that education on obesity prevention is important for patients with
renal failure , especially during the early stages of the renal disease . moreover , once
dialysis is initiated in such patients , there is a simultaneous need to address
cardiovascular risk factors in these patients in order to reduce the overall risk of
mortality . currently , various anti - obesity measures are being initiated , and some of these
involve estimation of body fat . numerous methods are available for estimating body fat ,
including dual - energy x - ray absorptiometry , computed tomography , magnetic resonance imaging ,
underwater weighing method , and body impedance analysis ( bia ) . body composition analyzers ,
used in bia , are low - priced and allow measurement of body fat without any assistance from a
medical specialist . in bia lean tissue with high water
content offers low resistance , while fat tissue with low water content offers high
resistance to electric current ; therefore , electrical current can pass more easily through
lean tissue than fat tissue . impedance is the frequency - subordinate resistance of a
conductor to exchange a current . xc is the amount of accumulation of
electricity of the electric charge produced by capacitors , such as a cell membrane and an
interface section between organizations . bioelectric impedance ( z ) , measured in ohms , is the
square root of the sum of the squares of r and xc3 . as bia involves estimation using a low electrical current , the amount of body water plays
an important role in this analysis if the instrument is precise , data measured after bath ,
voiding , drinking , etc . notably , patients with ckd remove excess
body water through dialysis , as their kidneys are unable to effectively filter body fluids
and waste products . therefore , the amount of body water changes significantly before and
after dialysis in these patients . the amount of percent body fat ( % bf ) estimated by bia in
patients with renal failure undergoing dialysis might differ from the true values on account
of retention of atypical amounts of water in these patients . thus , the question arises which
body composition parameters , whether those measured before dialysis or after dialysis ,
should preferably be used in health assessment of dialysis patients . to the best of our knowledge , there are some studies that report the relationship between
body composition and effect of exercise in dialysis patients or in patients with other
arteriosclerotic diseases , such as stroke4 , 5 ; however , thus far , no study has
specifically investigated the validity of body composition parameters , before and after
dialysis , in health assessment of dialysis patients . with this in mind , the purpose of the
present study was to assess the changes in body composition parameters before and after
dialysis in chronic hemodialysis patients and to determine the strengths of linear
relationships between various body composition parameters and blood lipid levels in these
patients . the participants in this study were 19 japanese outpatients ( 17 men and 2 women ; mean sd
age , 54 12 years ; range , 3582 years ) attending a dialysis center in june 2013 . the research protocol was
explained to the participants , who subsequently provided their informed consent , prior to
the commencement of the study . moreover , additional prior information was provided to the
participants , including explanations about freedom of research participation , protection of
personal data , and freedom to withdraw from the study even after providing the informed
consent . patients unable to stand during measurements were
excluded , as this was a basic requirement of the study . in addition , patients having serious
dementia , patients on pacemakers , and cancer patients were excluded from the study . in two
subjects , we performed a cross - sectional experimental study , which compared body composition
parameters before and after dialysis , and determined the strengths of linear relationships
among body composition parameters , blood lipid levels , and physical activity ( pa ) . we
measured body composition parameters , including body weight ( bw ) , bmi , % bf , and percent
skeletal muscle ( % sm ) , using an hbf-362 body composition monitor ( omron healthcare , kyoto ,
japan ) . physical therapists interviewed the subjects to record their physical activities
during the last 24 hours . based on the type and intensity of these activities , levels of pa
were calculated for each of the participants6 , 7 . pa was assessed in all the participants on
the day of dialysis as well as on a non - dialysis day . the blood lipid profile included total
cholesterol ( tc ) , high - density lipoprotein cholesterol ( hdl - c ) , low - density lipoprotein
cholesterol ( ldl - c ) , and triglyceride ( tg ) levels obtained from the patients clinical
records . the body composition analyzer used in the study was located near the entrance of the
dialysis room . the body composition parameters in each of the participants were measured
before the dialysis , and again after the dialysis session , which lasted for 34 hours . the
blood lipid levels were measured every month , and we adopted the latest available data for
evaluating their relationships with the body composition parameters . therefore , body composition before and
after dialysis was compared using parametric tests , and the rest of the statistical analyses
were conducted using non - parametric tests . the body composition parameters before and after
dialysis were compared by using paired t - tests . spearman s rank correlation coefficients
were calculated to determine relationships among body composition parameters , blood lipid
levels , and pa . all statistical analyses were performed using spss version 19.0 software
( ibm , armonk , ny , usa ) . the changes in body composition parameters before and after dialysis are shown in table 1table 1.changes in body composition parameters before and after dialysis in chronic
hemodialysis patients ( n = 19 ) as assessed by body impedance analysispre - dialysispost - dialysisbw ( kg)63.6 9.261.8 8.9**bmi ( kg / m)23.4 3.322.7 3.2**%bf ( % ) 18.4 8.422.0 8.5**%sm ( % ) 32.3 4.330.5 bw : body weight ; bmi : body mass index ; % bf :
percent body fat ; % sm : percent skeletal muscle . * * p < 0.01 . all body composition parameters differed significantly before and after
dialysis ( p < 0.01 ) . bw , bmi , and % sm were found to be significantly lower , and % bf was
found to be significantly higher after dialysis than those before dialysis . bw : body weight ; bmi : body mass index ; % bf :
percent body fat ; % sm : percent skeletal muscle . * * p < 0.01 the relationships ( in terms of spearman s rank correlation coefficients ) between various
body composition parameters and blood lipid levels before and after dialysis are shown in
table 2table 2.the relationships ( in terms of spearman s rank correlation coefficients ) between
various body composition parameters and blood lipid levels in chronic hemodialysis
patients ( n = 19)tchdl - cldl - ctgpre - dialysisbw0.3200.532 * 0.4320.479*bmi0.3090.598**0.505 * 0.377%bf0.582**0.711**0.788**0.551*%sm0.498 * 0.582**0.685**0.373post - dialysisbw0.3180.681**0.4150.494*bmi0.3190.593**0.501 * 0.386%bf0.620**0.681**0.789**0.651**%sm0.539 * 0.571*0.709**0.429tc : total cholesterol ; hdl - c : high - density lipoprotein cholesterol ; ldl - c :
low - density lipoprotein cholesterol ; tg : triglyceride ; bw : body weight ; bmi : body mass
index ; % bf : percent body fat ; % sm : percent skeletal muscle . * p < 0.05 , * * p <
0.01 . hdl - c , bmi , % bf , and % sm before dialysis were found to be strongly correlated
with blood lipid levels . strong correlations were also observed in case of body composition
parameters measured after dialysis . tc : total cholesterol ; hdl - c : high - density lipoprotein cholesterol ; ldl - c :
low - density lipoprotein cholesterol ; tg : triglyceride ; bw : body weight ; bmi : body mass
index ; % bf : percent body fat ; % sm : percent skeletal muscle . * p < 0.05 , * * p <
0.01 the mean pa on the day of dialysis was found to be significantly lower than the pa on a
non - dialysis day ; however , the correlation coefficients were not significant among body
composition parameters , blood lipid levels , and pa . dialysis involves filtration , performed by the kidneys in normal
individuals , by an external dialyzer . dialysis is performed 2 or 3 times a week . as patients under
dialysis can not remove the accumulated body water for about 2 days , they tend to have excess
body water before dialysis . conversely , after dialysis , the amount of body water is
drastically reduced . in this study , we found a higher % bf and a lower % sm after dialysis than before dialysis . this suggests that the observed differences in % bf and % sm before and after dialysis
resulted from changes in the amount of body water . measurements using the body composition
analyzer are made after information regarding age , sex , and height of a subject is entered
into the apparatus . first , the weight of the subject is measured using the body composition
analyzer . thereafter , a small current is sent through the subject s body impedance is
measured and % bf is calculated . because age , sex , and height remain constant before and
after dialysis , the changes in bw and impedance solely influence the estimated % bf . these
changes , in turn , can be directly attributed to the changes in the amount of body water . increases in fat mass , especially visceral fat , result in increased free fatty acid
secretion from the adipose tissue . as a result , large quantities of free fatty acids
accumulate in the liver , causing hepatic lipogenesis . simultaneously , free fatty acids in
the blood also increase8 , 9 . kobayashi and colleagues reported that the % bf estimated by
bia is useful for the prediction of tc , ldl - c , and tg levels in japanese men10 . consequently , increases in % bf have been
related to worsening of blood lipid parameters . in this study , we examined the validity of
these relationships . thus , our study supports the view that there are strong correlations between
% bf and blood lipid levels in dialysis patients , and that the measurement of % bf has
relevance in the context of health assessment in dialysis patients . in fact , we originally
hypothesized that post - dialysis data would be more useful for this health assessment as the
amount of body water would have been regulated by dialysis . however , no major differences
were observed in the strengths of the relationships between the body composition parameters ,
before and after dialysis , and the blood lipid levels . this was corroborated by strong
correlation between these variables both before and after dialysis . we conclude that body
composition parameters including % bf , whether measured before or after dialysis , might be
useful in health assessment of dialysis patients . we examined the relationships
between the body composition parameters and the blood lipid levels to verify the usefulness
of body composition parameters in health assessment of dialysis patients . however , body fat
distribution was reported to be strongly correlated with other data . therefore , further
studies need to investigate the relevance of data on coronary artery disease risk factors ,
such as the arteriosclerosis index and blood glucose levels , along with that of body
composition data in the context of usefulness in health assessment of patients , thus
probably contributing towards better health outcomes . moreover , we need to focus attention
on fat distribution and to evaluate the accumulation of visceral fat by modalities such as
magnetic resonance imaging or computed tomography . in this study , out of the various body
composition parameters , we paid particular attention to the % bf , and tried to verify the
body composition of dialysis patients by studying the relationship with the blood lipid
levels . however , the reliability of body composition parameters after dialysis , and the
reliability of bia in dialysis patients need to be further studied . an additional limitation
of the present study was that the subjects included only two women . therefore , the influence
of gender can not be ruled out . in general , women tend to have higher levels of body fat and
fewer skeletal muscle cells than men . besides , the subjects in our study ranged widely in
age . however , we consider the overall effects of gender and age to be minimal . thus , all the
subjects were included in the final analysis . nevertheless , to get a better insight into
this issue , studies focused on only one gender or specific age groups need to be conducted
in the future . lastly , this study was a cross - sectional study ; although our results suggest
that the body composition parameters before and after dialysis might have applications in
health assessment of chronic hemodialysis patients , further large - scale longitudinal studies
should be performed to confirm our findings . | [ purpose ] this study assessed changes in body composition before and after dialysis in
chronic hemodialysis patients and determined the relationships between various body
composition parameters and blood lipid levels in these patients . [ subjects ] the
cross - sectional study included 19 dialysis outpatients ( 17 men and 2 women , aged
3582 years ) . [ methods ] body mass index , body weight , percent body fat , and percent
skeletal muscle were measured before and after dialysis by using body impedance analysis .
blood lipid levels were obtained from patients clinical records .
the body composition
parameters before and after dialysis were compared using paired t - tests .
spearman s
rank
correlation coefficients were calculated to determine relationships between the body
composition parameters , before and after dialysis , and the blood lipid levels .
[ results ]
all body composition parameters differed significantly before and after dialysis .
high - density lipoprotein cholesterol level significantly correlated with all the body
composition parameters , whereas total cholesterol , low - density lipoprotein cholesterol ,
and triglyceride levels significantly correlated with some of these parameters .
the
correlation coefficients revealed no major differences in the relationships between blood
lipid parameters and body compositions before and after dialysis .
[ conclusion ] our
findings suggest that body composition parameters , whether measured before or after
dialysis , can be used to evaluate obesity in longitudinal studies . |
a 38-year - old g1p0 primigravida was admitted to our hospital at 40 weeks gestation for a normal vaginal delivery . the initial fetal heart rate ( hr ) was 120 - 150 beats / min and showed good reactivity and variability . when the diameter of the cervical opening was approximately 4 cm , lumbar epidural analgesia was planned , and an intravenous ( iv ) infusion of lactated ringer 's solution ( 1,000 ml ) was administered . an 18-gauge tuohy needle ( portex regional anaesthesia tray , smiths medical , uk ) was blindly inserted into the lumbar epidural space at the l3 - 4 level in the left decubitus position . a tuohy needle was advanced to 5 cm , at which point the epidural space was identified on the first attempt using the loss of resistance ( lor ) technique . after ensuring that there was no cerebrospinal fluid ( csf ) or blood leak , we slowly injected a test dose , i.e. , 4 ml of 1% lidocaine with 15 g of epinephrine . an epidural catheter ( portex regional anaesthesia tray , smiths medical , uk ) was inserted without any resistance . the catheter tip was threaded 4 cm in the cephalad direction beyond the tuohy needle , after catheter placement . then , we mixed 20 ml of 0.75% ropivacaine and 100 g of fentanyl with normal saline ( total volume , 100 ml ) , and subsequently injected 12 ml of the mixture , the rest of the mixture was injected into the epidural space with a patient controlled epidural analgesia ( pcea ) pump ( pain management provider , abbott , usa ) with a basal flow rate of 5 ml / h plus a 5 ml bolus with a 5 min lockout . at 5 minutes after the initial dose administration , her blood pressure ( bp ) , hr , and respiratory rate ( rr ) were 120/70 mmhg , 72 beats / min , and 20 breaths / min , respectively . we subsequently assessed the extent of bilateral sensory blockade by observing the loss of cold sensation to alcohol sponges and the loss of sensation to pinpricks . at that time , the sensory level was located at the tenth thoracic dermatome , and the motor function was intact . at 15 minutes after the initial dose administration , the patient complained of a pulling sensation and tightness at the back of her neck . at 20 minutes after the initial dose administration , the patient showed drowsiness and a depressed mental status ; therefore , we encouraged her to take deep breaths and stopped the pcea pump . the total injected volume of the drug mixture was 1.5 ml . at that time , her vital signs were as follows : bp , 90/60 mmhg ; hr , 60 beats / min ; and rr , 8 breaths / min . the sensory level was at the eighth thoracic dermatome ; however , no change in motor function was observed . because of the reduced rr and depressed mental status , the patient was placed in the trendelenburg position and was administered 100% o2 via a facial mask at a flow rate of 5 l / min . at 3 min after position change , her vital signs were as follows : bp , 76/49 mmhg ; hr , 55 beats / min ; rr , 8 breaths / min ; and spo2 , 95% . the sensory level was the third thoracic dermatome , but her motor functions were not affected . after the patient was injected with 10 mg of ephedrine , an obstetrician examined the fetal status via ultrasonography . the fetus showed severe bradycardia , ( hr , 70 beats / min ) ; despite being in the normal range ( hr , 100 - 150 beats / min ) before this event . therefore , we decided to perform an emergency cesarean section , which was planned to occur within 30 min , followed by prompt intrauterine fetal resuscitation . at that time , the patient 's vital signs were as follows : bp , 80/51 mmhg ; hr , 52 beats / min ; rr , 8 breaths / min ; and spo2 , 92% . we moved the patient to the left lateral recumbent position , injected 0.5 mg of atropine via the maternal iv line , started rapid fluid replacement , and continuously monitored the fetal hr . at 5 min after intrauterine fetal resuscitation , the fetal hr was 100 beats / min , but the patient still showed a depressed mental status and complained of dyspnea . artificial respiration was performed immediately by using ambu bag because the patient 's spo2 decreased to 82% . consequently , her spo2 recovered to 95% , while the fetal hr increased to 120 beats / min and showed good variability . fifteen minutes after recovery of the spo2 level , the patient was transferred to the operating room on artificial ventilation . the arterial blood gas analysis performed immediately before the operation revealed the following : ph , 7.086 ; paco2 , 66.6 mmhg ; pao2 , 218.6 mmhg ; hco3 , 19.6 the patient 's preoperative vital signs were as follows : bp , 94/62 mmhg ; hr , 90 beats / min ; and rr , 8 breaths / min . anesthesia was induced by the administration of 4 mg / kg of iv thiopental , while tracheal intubation was facilitated by the administration of 1 mg / kg of iv succinylcholine . after tracheal intubation , anesthesia was maintained with o2 , air , and 1.5 - 2.0 vol% sevoflurane . after 40 minutes , the patient was transferred to a recovery room after extubation , because she showed complete recovery during the emergence period . after that point , her vital signs were stable , tidal volume > 400 ml , rr was 12 breaths / min , and spo2 was 99% in room air . a neurological examination performed in the recovery room , showed that the patient had an alert mental status , and that her orientation - related mental functions were normal . the sensory and motor functions of the patient recovered completely , but she complained of mild numbness in her thighs and calves . arterial blood gas analysis performed in the recovery room revealed the following : ph , 7.350 ; paco2 , 30.7 mmhg ; pao2 , 156.3 mmhg ; hco3 , 16.6 after 1 hour in the recovery room , the patient was transferred to the general ward . after 2 days , no post - dural puncture headache or other neurological complications were observed , therefore , she was discharged along with the infant , who did not show complications , or neurological abnormalities . critical complications during the administration of the obstetric epidural anesthetic agents include intravascular injection ( 1 in every 5,000 epidural cases ) , intrathecal injection ( 1 in every 2,900 epidural cases ) , subdural injection ( 1 in every 4,200 epidurals cases ) , and considerable or total spinal block ( 1 in every 16,200 epidural cases ) . our patient showed progressive changes in mental status , respiratory depression , bradycardia , and hypotension during lumbar epidural analgesia , however , her motor functions were relatively unaffected . we could not perform any additional radiological tests to determine the location of the epidural catheter tip since the epidural catheter was accidently removed when the patient was transferred to the operating room . however , on the basis of the patient 's symptoms and signs , subdural injection was inferred as the cause of these complications . many case reports have shown that subdural injection results in distinct effects in patients , such as moderate hypotension , slow symptoms onset , progressive respiratory depression , lack of coordination , and complete recovery after almost 2 hours . in fact , the needle or catheter can be accurately located during epidural anesthesia by using many methods . lor is one of the traditional techniques for locating the epidural space , while intravascular and subarachnoid injection can be avoided by the aspiration of csf or blood via a needle or catheter . administration of a test dose , i.e. , a small amount of a local anesthetic and epinephrine mixture , aids in accurate location of the epidural space . if possible , the epidural anesthetic agent should be administered under guidance such as , that of c - arm imaging . however , the results of many studies have indicated that subdural injection is a negative finding as in the current case . because c - arm guidance for anesthesia is contraindicated in pregnant women because of the required radiation exposure , the possibility of subdural injection during obstetric epidural anesthesia can not yet be completely negated . one study that used radiographs and contrast agents to monitor the needle showed partially inaccurate placement of the tuohy needle in 17% of the cases and partial subdural placement in 7% of the cases despite the procedures being performed by experienced personnel using conventional methods to identify the dural space . first , anesthesiologists must be careful when handling tuohy needles in the epidural space ; second , difficult blocks and previous back surgery are predisposing factors of accidental subdural injection ; third , a repetitive neuroaxial block on the same intervertebral space can cause accidental subdural injection ; and fourth , continuous epidural catheter techniques should be conducted in a fractioned manner . temporary hypotension during neuraxial epidural anesthesia may not affect the mother and fetus , but it can be fatal to both if it persists . several measures are considered for the treatment of hypotension : intravenous administration of fluids with 500 ml of colloid or 1,000 ml of crystalloid , avoidance of uterine aortocaval compression , vigilant monitoring of blood pressure , and iv vasopressors , such as 5 - 10 mg of ephedrine or 40 - 100 g of phenylephrine are helpful . anesthesiologists generally use ephedrine in gradually increasing doses and continuously monitor blood pressure . according to some studies , atropine is known to rapidly cross the placenta and directly cause fetal tachycardia . in instrumented studies on sheep , glycopyrrolate does not cross the placenta ; therefore , it does not cause fetal tachycardia . in healthy parturients , the plasma , placental artery , and vein concentrations of atropine were determined after iv or intramuscular administration of 0.01 mg / kg atropine , showing faster distribution and elimination of atropine and higher mean peak maternal plasma levels for iv administration than those observed for intramuscular administration . the first is change in position ; use of the left lateral recumbent position or , if required , the right lateral or knee - elbow position can help the fetus . the second is rapid fluid replacement and supplementation with 100% o2 . the third is suppression of uterine contractions and an intra - amniotic infusion of warmed crystalloid solution . if fetal distress dose not alleviate , emergency cesarean section can be considered . in the case of our patient , although the fetal heart rate returned to the normal range after appropriate management , the mother 's symptoms were likely to aggravate the condition . complications like injecting an anesthetic agent into the subdural space during epidural labor analgesia can be fatal for both the mother and the fetus . therefore , anesthesiologists should have thorough knowledge about the complications involved in epidural anesthesia administration and their characteristic symptoms as well as be prepared for maternal and intrauterine fetal resuscitation before proceeding with an epidural analgesia block at locations other than the operating room . furthermore , the patient and fetus should be closely monitored for a sufficient amount of time owing to the possibility of delayed onset of epidural anesthesia - related complications . | subdural injection of epidural anesthesia is rare and is usually undiagnosed during epidural anesthesia causing severely delayed maternal hypotension , hypoxia , and fetal distress .
a 38-year - old primiparous woman was administered epidural labor analgesia at 40 + 6 weeks ' gestation , and developed progressive maternal respiratory depression , bradycardia , and hypotension after accidental subdural administration of the anesthetic agent .
furthermore , fetal distress occurred soon after administration .
the patient was managed with oxygen , position changes , fluid resuscitation , and ephedrine .
intrauterine fetal resuscitation was successfully performed with atropine before cesarean section , and a healthy baby was delivered . although subdural injection is uncommon , this case emphasizes the importance of anesthesiologists monitoring patients for a sufficient period after epidural labor analgesia , and being prepared to perform maternal or fetal resuscitation . |
a 39-year - old canadian man flew to fiji on october 28 , 2003 , and returned to canada on november 10 , 2003 . immediately on arrival in canada , he started experiencing generalized body aches , which lasted until november 17 . on november 15 , he noticed an erythematous maculopapular rash over his whole body , as well as inguinal lymphadenopathy . the rash and swollen nodes subsided on november 18 and were replaced with the sudden onset of pain and swelling in his right ankle joint and pain without swelling in his right knee and right elbow . two days later , barely able to walk , the patient sought medical attention at the mcgill centre for tropical diseases . an examination found substantial periarticular tenderness , warmth , erythema , and swelling of his right ankle with essentially full range of motion ( figure ) . his travel history included an uneventful 4-day trip to melbourne , australia , in 1999 , involving a trip to the countryside , followed by a week in bali . in view of his clinical symptoms and recent travel history , a preliminary diagnosis of ross river virus disease laboratory investigations included a complete blood count ( cbc ) ; urinalysis ; and measurement of levels of liver enzymes , serum creatinine , uric acid , rheumatoid factor , antistreptolysin o , and anti - dnase b , all of which were normal . the erythrocyte sedimentation rate ( esr ) was 23 mm / h , and the antinuclear antibody ( ana ) test was positive with a speckled pattern . serum specimens were collected from the patient on days 10 , 21 , and 141 after the onset of illness ; they were screened for elevated immunoglobulin ( ig ) m antibody against geographically relevant arboviral antigens by enzyme immunoassays ( eia ) , when eia was available for a particular arbovirus . all serologic tests were performed at the arboviral diseases laboratory of the centers for disease control and prevention ( cdc ) in fort collins , colorado , as previously described ( 10,11 ) . serologic evidence of a dengue infection was absent in both this patient and the patient described in the next section . patient 1 : ankle swelling , pain , tenderness , erythema , and warmth on day 10 of illness . on march 5 , 2004 , a 44-year - old canadian woman returned to canada after visiting new zealand for 2 months and fiji for 1 month ; she did not travel through australia or another known ross river virus she had previously visited fiji uneventfully in 1995 . on march 14 , she experienced the abrupt onset of fatigue ; the next day she was feverish , nauseated , and anorexic and had severe arthralgia in her ankles and feet . for several days , she experienced extreme hypersensitivity to touch , particularly of her soles , severe enough to prevent weight bearing , and had mild ankle swelling . her joint pains worsened over several days and spread to her knees , hips , and upper extremities . on march 16 , she noticed a nonpruritic , erythematous , maculopapular rash , with small vesicular lesions on the palms , which involved the extremities and face but not the trunk ; the rash resolved after 4 days . on march 17 , she had normal cbc results and serum creatinine kinase level , mildly elevated liver enzymes , and an esr of 62 mm / h . by day 10 of illness , she was able to resume limited sedentary work . one month after illness onset , fatigue and joint pain persisted , but physical examination results were normal , apart from difficulties in ambulation due to pain ; tests for ana and rheumatoid factor were negative , c - reactive protein level was normal , and esr was 30 mm / h . four months after illness onset , she continued to have gradually resolving arthralgia and fatigue that limited daily activities . at cdc , serologic tests were performed on serum specimens obtained on days 16 and 33 of illness ( table ) . * ig , immunoglobulin ; prnt , plaque - reduction neutralization test ; rrv , ross river virus ; bfv , barmah forest virus ; sinv , sindbis virus ; nd , not done . igm - capture enzyme immunoassay ; samples tested at 1:400 dilution ; positive samples had a positive - to - negative ( p / n ) absorbance ratio > 3.0 ; equivocal samples had a p / n ratio 2.03.0 ( 10 ) ; no test for anti - sinv igm was available . 90% plaque - reduction endpoints ; > 10 is considered positive ( 11 ) . from onset of illness to serum collection . the clinical features and serologic results in these 2 cases provide strong circumstantial evidence for ross river virus transmission in fiji during late 2003 and early 2004 , which suggests that heightened surveillance is needed as well as epidemiologic and ecologic studies in that region . while both cases were highly clinically compatible with epidemic polyarthritis , and tests for ross river virus specific serum igm antibody were positive in both , the first case is the most convincing serologically because seroconversion ( i.e. , a 4-fold titer change ) in neutralization tests was also observed . the subsequent decrease in this patient 's ross river virus specific igm reactivity and neutralizing antibody titer within a few months also argues for a recent ross river virus infection . in the second case , the high but stable anti - ross river virus neutralizing antibody titer may reflect the fact that the earliest sample available for testing was obtained > 2 weeks after illness onset when the patient 's anti if ross river virus was circulating in fiji in 2003 and 2004 , at least 2 basic hypotheses may explain its reemergence there . the first of these , which seems the most plausible , involves occasional reintroduction of this virus from the known disease - endemic region ( e.g. , by viremic persons arriving from australia ) , sometimes resulting in local transmission , ultimately followed by local extinction . circumstantial evidence to support this hypothesis includes the fact that , during the same period that the 2 patients described here traveled to fiji , australia was experiencing its usual summer surge in ross river virus incidence ( 3 ) . the second hypothesis , considered unlikely ( 7 ) , is that ross river virus became established in fiji after the 19791980 epidemic but remained undetected while causing sporadic and largely unrecognized human cases . the ability of arboviruses to be moved from one region to another , even from one continent or hemisphere to another , has long been appreciated ( 12 ) . fortunately , the conditions for local transmission and long - term survival of an arbovirus in a new area are often highly complex , so that most such introductions are probably abortive . the recent introduction of west nile virus to north america and its permanent establishment there , however , is a sobering demonstration that newly introduced arboviruses sometimes achieve long - term survival in new areas where preadapted vectors and suitable vertebrate amplifying hosts are available ( 13 ) . ross river virus is almost certainly imported into north america fairly frequently because this virus is endemic and often epidemic in australia , human travel between australia and north america is frequent , high levels of viremia lasting several days often develop in ross river virus infected persons , and cases of ross river virus disease among visitors to australia are commonly reported ( 14,15 ) . notably , 100 viremic travelers enter new zealand every year from queensland alone ( 16 ) . fortunately , however , to date all such importations into north america evidently have been abortive , and if an introduction of ross river virus to north america should ever result in local amplification and transmission by preadapted vectors ( e.g. , ae . aegypti or ae . albopictus , activity would probably be short - lived and remain localized , and a lack of optimal vertebrate reservoirs would probably keep the virus from becoming established . the recent north american experience with west nile virus , however , emphasizes how uncertain such predictions can be . therefore , travel medicine specialists and other healthcare providers in north america ( and other disease - nonendemic areas ) should be familiar with the clinical features of ross river virus disease , as well as its potential public health importance , and realize that diagnostic tests for this infection currently are available at only a few public health reference laboratories ( e.g. , cdc ) . | we report 2 clinically characteristic and serologically positive cases of ross river virus infection in canadian tourists who visited fiji in late 2003 and early 2004 .
this report suggests that ross river virus is once again circulating in fiji , where it apparently disappeared after causing an epidemic in 1979 to 1980 . |
lymphocytic plasmacytic enteritis ( lpe ) , a chronic enteropathie , is the most frequently described type of inflammatory bowel disease in dogs . lpe is recognized as one of the most common causes of chronic vomiting and diarrhoea . the name of this disorder refers to the population of inflammatory cells present in the lamina propria of the small bowel . despite being an important disease , the exact aetiology remains unclear but appears to involve an exaggerated reaction of the mucosal immune system against the environment ( bacteria and food antigens ) in a susceptible host . some investigators have recently focused on the effect disturbing the homeostasis between the immune system and luminal antigens in the intestinal microenvironment . similarly , several reports have evaluated the role of cytokines , subpopulations of leukocytes , lymphocyte apoptosis , toll - like receptors , nuclear factor kappa - beta or intestinal microbial communities . diagnosing inflammatory bowel disease is based on ruling out diseases that may cause intestinal inflammation along with histological evidence of inflammatory infiltration into the intestinal mucosa . marked advances in endoscopic equipment combined with the advantages of flexible endoscopy make upper gastrointestinal endoscopy the procedure of choice for obtaining intestinal biopsies to diagnose enteropathies in dogs and cats . information about macroscopic parameters of gastric and duodenal mucosa evaluated during endoscopy can vary depending on who performs the technique . recently , the gastrointestinal standardization group sponsored by world small animal veterinary association ( wsava ) proposed a set of guidelines for endoscopic examinations in order to obtain information about gastrointestinal endoscopic findings that could be universally used . moreover , the following should also be evaluated in the duodenum : distensibility of the lumen , hyperemia / vascularity , edema , discoloration , friability , texture , haemorrhage , erosion / ulcer , lacteal dilation , and contents ( mucus , bile , or food ) . distended lacteals , defined as many expanded white villi in the duodenum , is an endoscopic finding strongly indicative of intestinal lymphangiectasia ( il ) . these scattered white spots have been described as having a snowflake - like or rice grain - like appearance . information about the presence of these white spots and their significance is limited . as far as we know , this finding has been reported in one dog with il and lpe and in eight dogs with ultrasonographic intestinal hyperechoic mucosal striations . the aim of this retrospective study was to evaluate the significance of white spots in the duodenal mucosa of dogs with lpe . we analysed endoscopy examination data that were compiled between january 2000 and december 2008 at the complutense university of madrid veterinary medical teaching hospital ( spain ) . all the dogs were cared for according to protocols approved by the animal experimentation committee of the complutense university of madrid ( spain ) . the dogs in our study were diagnosed with lpe with white spots in the mucosa of the duodenum found by endoscopy ( n = 22 ) . control dogs consisted of animals randomly selected during the review of the endoscopic data that had lpe but no white spots ( n = 28 ) . the following information was obtained from the medical records of all dogs : signalment , clinical signs , and physical examination findings and laboratory results at the time of presentation . the severity of the clinical signs was assessed using two previously described activity indexes : the canine inflammatory bowel disease activity index ( cibdai ) and canine chronic enteropathy clinical activity index ( ccecai ) . the cibdai is the sum of the score of six different clinical signs including attitude / activity , appetite , vomiting , stool consistency , stool frequency , and weight loss . the recently introduced ccecai , which is based on the previously established cibdai , also includes the scoring of serum - albumin concentration , peripheral edema and ascites , and severity of pruritus . the minimum information obtained for each dog included a complete anamnesis , complete blood count and serum biochemical profile ; fecal examination for three consecutive days for cestodes , nematodes , and protozoa ( direct smear with saline solution , direct smear with methiolate iodine formaldehyde solution and zinc - sulfate flotation , or the telemann technique ) ; fecal chymotrypsin , and serum trypsin - like immunoreactivity . persistent gastrointestinal signs ( > 3 weeks in duration ) in combination with normal results from a thorough diagnostic evaluation and absence of a response to diet modification ( prescription dry diets for gastrointestinal disease with low concentration of lipid ) were noted in these dogs . gastroduodenoscopy was performed in all dogs in order to obtain gastric and duodenal mucosal biopsy specimens . videoendoscopes of variable lengths and diameters were used according to the size of the dog for endoscopic exploration . dogs were denied access to food 24 h prior to endoscopy and to water 12 h before the examination . an average of five to six images showing representative findings ( through the descending duodenum ) were routinely captured by a video printer . for all animals , photographs of the duodenum with gross white spots were reviewed in order to assess the density of the spots ( 1 = mild , 2 = moderate , 3 = severe ) . this evaluation method was chosen by the authors after taking into account the scores for other endoscopic parameters proposed by the wsava gastrointestinal standardization group . the density of the white spots was graded by one of the authors ( fr ) . information regarding the animals ' medical history , clinical signs , laboratory results , or histopathologic descriptions was not available to the clinician when evaluating the spots . all duodenal mucosal biopsy specimens were taken using flexible , through - the - endoscope , pinch biopsy forceps with smooth - edged oval cups . biopsy specimens were fixed by immersion in neutral - buffered 10% formalin , embedded in paraffin wax , cut into 5 m - thick sections , and stained with hematoxylin and eosin , masson trichromic , and periodic acid - schiff reagent . lpe was diagnosed in each dog based on information from the diagnostic evaluation combined with a histopathologic finding of lymphocyte and plasma cell infiltration into the lamina propria of the duodenum . a complete histopathological evaluation of all biopsies was performed according to the histopathologic criteria recently proposed by the wsava gastrointestinal standardization group for diagnosing gastrointestinal inflammation in dogs and cats . specifically , the findings for cases of lacteal dilation were scored from 0 to 3 as follows : 0 = normal , when the central lacteal represented up to 25% of the villous lamina propria width on the longitudinal section ; 1 = mild dilation , when this width represents up to approximately 50% ; 2 = moderate dilation , when this width represented up to 75% ; and 3 = marked dilation , when central lacteal represented up to 100% of the villous lamina propria . statistical analysis was performed using commercially available software ( ibm spss statistics 19 ; spss , usa ) . the clinical and histological findings of the two lpe groups ( with and without white spots ) were compared . data were analysed using student 's t - tests or willcoxon signed - rank tests depending on the distribution of the variables . correlations between the density of the white spots in the duodenum , serum proteins , serum albumin , activity index , and histological grading were analysed in lpe group with white spots using spearman 's test . a chi - square test was used to compare percentages ; a fisher exact test was used when needed . the lpe group with white spots in the duodenum included 22 animals : 17 males and 5 females . the median age at the time of endoscopy was 5.2 years ( range , 2~10 years ) . six animals were mixed breeds along with 16 dogs that were 11 different pure breeds . the lpe group without white spots in the duodenum included 28 animals with 18 males and 10 females . the median age at the time of endoscopy was 5 years ( range , 2~9 years ) . statistical significant differences were not found between both groups regarding age , sex and breed distribution . decreased serum protein concentrations ( 5.6 g / dl ) were found in 31.8% ( 7/22 ) of the lpe dogs with white spots and in 7.1% ( 2/28 ) of the lpe dogs without white spots . hypoproteinemia was significantly more frequent in dogs with white spots compared to ones without ( p = 0.02 ) . mean serum protein concentrations were 5.68 g / dl ( range , 2.4~8.4 g / dl ) in lpe dogs with white spots and 6.58 g / dl ( range , 4.6~7.6 g / dl ) in lpe dogs without . serum protein concentration was significantly lower in white spots lpe dogs related to the other group ( p = 0.038 ) . mean serum albumin concentrations were 2.84 g / dl ( range , 1.0~4.3 g / dl ) in lpe dogs with white spots and 3.29 g / dl ( range , 2.3~4 g / dl ) in ones without . serum albumin concentrations were significantly lower in the lpe dogs with spots compared to the dogs without ( p = 0.039 ) . no significant differences in activity indices were observed between the two groups according to ccecai ( white spots group : mean , 4.54 ; range , 0~15 ; group without spots : mean 5.53 ; range , 2~14 ) . cibdai scores were significantly lower ( p = 0.016 ) in the white spots group ( mean , 3.77 ; range , 0~11 ) compared to the group without white spots ( mean , 5.21 ; range , 2~9 ) . lacteal dilation histological scores were significantly higher ( p = 0.027 ) in lpe dogs with white spots ( mean , 0.45 ; range , 0~2 ) compared to dogs without white spots ( mean , 0.12 ; range , 0~1 ) . no statistically significant differences were found between the two groups when analyzing the other histological parameters . the density of the white spots in the duodenal mucosa was graded as mild in 14 dogs ( 64% ; fig . hypoproteinemia was found in 21% of the dogs ( 3/14 ) with mild white spot density , in 25% ( 1/4 ) with moderate density , and in 75% ( 3/4 ) with severe density . no statistically significant correlation was found between density of white spots and serum protein or albumin concentrations . likewise , no statistically significant correlation was found between the density of the white spots and either disease activity indices ( cibdai , p = 0.894 ; ccecai , p = 0.076 ) . however , the results showed a statistically significant correlation between density of the white spots and lymphatic dilatation histological scores ( p = 0.023 ; = 0.481 ; fig . to date , the present study is the first that compares two populations of lpe dogs , with or without white spots in the duodenal mucosa . the characteristics of both populations were similar in terms of age , gender , and breed distribution . until now , the appearance of many white spots on endoscopy strongly suggested intestinal il . to our knowledge , this feature has not been routinely described in dogs with lpe . according to our results , the presence of hypoproteinemia in lpe dogs is significantly higher when white spots are present in the duodenal mucosa than when they are not . previous studies reported a higher prevalence of hypoproteniemia in these lpe dogs compared to our study , ranging from 24~63% . it is unclear why the lpe dogs in the present study had a lower prevalence of hypoproteinemia compared to previous studies . although not statistically significant , correlation between serum protein or albumin levels and the density of the white spots was found . significant lower serum protein and albumin concentrations in lpe dogs with white spots was probably related to the presence of these spots in the duodenal mucosa . a recent study was the first to describe a significant association between lacteal dilation and hypoalbuminemia . an increase in plasma proteins leakage from the intestine can be the result of several causes via one of two main mechanisms : 1 ) mucosal injury with or without erosions or ulcerations , and 2 ) increased lymphatic pressure in the gut due to different factors . in our dogs , both mechanisms could be implicated . rupture of intestinal villous lacteals that appeared as " rice - grain " spots in duodenum in our study indicated lymph leakage into the intestinal lumen with other components such as chylomicrons , lymphocytes , and proteins . although some lymph constituents can be digested and reabsorbed at more distal sites in the intestine , the presence of lacteals dilation , inflammation , or oedema in the mucosa can limit intestinal absorptive capacity , resulting in a net loss of lymph . it was surprising that cibdai scores was significantly lower in the group with white spots compared to the group without . in this study , hypoalbuminemia has been reported to be a sign of poor prognosis which is why this group of dogs was expected to be in a poor clinical condition . after reviewing the activity indices of this group , we hypothesised that a possible reason for the relatively low cibdai scores might be that these animals presented only one clinical sign like vomiting or severe abdominal pain that is not noted in this activity index . up to now , the presence of scattered white spots in the duodenal mucosa seems to correspond to lacteals that are dilated and filled with chyle . the results from our study support this hypothesis based on the significant correlation found between the histological grade of lacteals distension and density of the white spots observed during endoscopy exploration . in cases of il ( congenital or acquired ) , the intestinal villous lacteals can dilate , become more fragile , and rupture easily when pressure in the mesenteric or intestinal lymph vessels increases independently of the disease . this explanation could also explain the presence of white spots in cases of lpe because distended lacteals are frequently found in the presence of this disease . in animals with intestinal diseases such as inflammatory lpe the results obtained from this study suggest that the appearance of white spots in the duodenal mucosa of dogs is not a finding exclusive to il . low serum protein and albumin concentrations are probably a result of these white spots . in our study , the density of the white spots in the duodenum significantly correlated with the histological lacteal dilation scores . further studies are needed in order to evaluate the clinical significance of these white spots in dogs with lpe , especially in terms of prognosis . | distended lacteals , described as expanded white villi in duodenum , are strongly indicative of primary intestinal lymphangiectasia . in the present study , we evaluated the significance of white spots present in the duodenal mucosa of dogs with lymphocytic plasmacytic enteritis ( lpe ) .
fifty dogs with lpe were included in this study , and white spots were detected in the duodenal mucosa in 22 dogs during endoscopy .
hypoproteinemia was more frequent in dogs with white spots than in dogs without spots ( p = 0.02 ) .
serum protein and albumin concentration were significantly lower in lpe dogs with white spots ( p = 0.038 ) compared to lpe dogs without white spots ( p = 0.039 ) .
there was a significant correlation between white spots density and lymphatic dilatation histological scores ( p = 0.023 ; = 0.481 ) .
these results suggest that the presence of white spots in the duodenal mucosa of dogs is not a finding exclusive for intestinal lymphangiectasia .
low serum protein and albumin concentrations together with lymphatic dilatation seem to be related to the presence of white spots in the duodenal mucosa of lpe dogs . |
integrated ehr systems have the potential to significantly improve patient safety and quality of care within the hospital ; however , there are many significant barriers to implementation that must be addressed by leadership before committing to hospital - wide adoption . before transitioning to an ehr system , organizations must identify and dedicate appropriate administrative and medical personnel to work on implementation , which includes a dedicated liaison between the organization and ehr vendor ( 5 ) . identifying a team champion , along with practicing appropriate change management techniques , is more likely to lead to a positive transition phase ( 6 ) . communication with the ehr vendor about specific needs and workflow design should be prioritized to ensure that the system is ready for full implementation when it is scheduled to go - live. success depends on a seamless conversion from one charting system to another , and there is no guarantee of data integrity during the transition phase ; however , a well - planned and executed implementation can minimize some of these risks ( 7 ) . if implementation is done poorly it can increase the risk of error , in turn exposing physicians and hospitals to potential medical malpractice lawsuits and other legal complications . some studies have shown that medical error , adverse patient events , and even mortality can increase when a new ehr system is introduced ( 1 ) . this can be explained through an increase in user error while entering information into an unfamiliar it system and ehr system - wide crashes that create problems in care processes or limit access to important patient information ( 1 ) . a more recent study published in the british medical journal found that in the immediate 30-day period before and after a single day ehr roll - out at 17 u.s . hospitals , there were no adverse short - term effects on patient safety , suggesting that accounts of negative experiences at a single hospital can be problematic when evaluating success of implementation ( 8) . legal precedent suggests that providers are responsible for reducing risk during the transition phase , with one federal court ruling that the hospital had a duty to ensure that physicians had timely access to lab results while an electronic system was installed and operationalized ( 1 ) . the hospital had the responsibility to maintain effective workaround solutions to minimize disruption to patient care and clinical decision - making , in effect requiring duplication of work during the transition phase . if the implementation is short lived , this requirement is a nuisance that disappears relatively quickly . should ehr system installation take longer than anticipated or the project meet with unexpected delays , processes are slowed , decision - making is impacted , and patient care potentially jeopardized . furthermore , the health insurance portability and accountability act ( hipaa ) clearly states that hospitals are solely responsible for their ehr system , including how it is used ( 9 ) . this requirement places significant burden on hospitals to ensure appropriate policy and technical support are readily available , all at significant cost to the organization . ehr systems also increase the amount of data and documentation available for review in the event of a medical error or adverse event . in one case where a patient was left as a quadriplegic after surgery , the competency of the surgeon was originally called into question , but when ehr metadata was further analyzed it was discovered that a time stamp raised question as to whether the anesthesiologist was present for the entire surgery ( 7 ) . this level of detail available to prosecutors may heighten the risk of malpractice allegations among an entire team of providers ( 7 ) . integrated ehr systems have the potential to significantly improve patient safety and quality of care within the hospital ; however , there are many significant barriers to implementation that must be addressed by leadership before committing to hospital - wide adoption . before transitioning to an ehr system , organizations must identify and dedicate appropriate administrative and medical personnel to work on implementation , which includes a dedicated liaison between the organization and ehr vendor ( 5 ) . identifying a team champion , along with practicing appropriate change management techniques , is more likely to lead to a positive transition phase ( 6 ) . communication with the ehr vendor about specific needs and workflow design should be prioritized to ensure that the system is ready for full implementation when it is scheduled to go - live. success depends on a seamless conversion from one charting system to another , and there is no guarantee of data integrity during the transition phase ; however , a well - planned and executed implementation can minimize some of these risks ( 7 ) . if implementation is done poorly it can increase the risk of error , in turn exposing physicians and hospitals to potential medical malpractice lawsuits and other legal complications . some studies have shown that medical error , adverse patient events , and even mortality can increase when a new ehr system is introduced ( 1 ) . this can be explained through an increase in user error while entering information into an unfamiliar it system and ehr system - wide crashes that create problems in care processes or limit access to important patient information ( 1 ) . a more recent study published in the british medical journal found that in the immediate 30-day period before and after a single day ehr roll - out at 17 u.s . hospitals , there were no adverse short - term effects on patient safety , suggesting that accounts of negative experiences at a single hospital can be problematic when evaluating success of implementation ( 8) . legal precedent suggests that providers are responsible for reducing risk during the transition phase , with one federal court ruling that the hospital had a duty to ensure that physicians had timely access to lab results while an electronic system was installed and operationalized ( 1 ) . the hospital had the responsibility to maintain effective workaround solutions to minimize disruption to patient care and clinical decision - making , in effect requiring duplication of work during the transition phase . if the implementation is short lived , this requirement is a nuisance that disappears relatively quickly . should ehr system installation take longer than anticipated or the project meet with unexpected delays , processes are slowed , decision - making is impacted , and patient care potentially jeopardized . furthermore , the health insurance portability and accountability act ( hipaa ) clearly states that hospitals are solely responsible for their ehr system , including how it is used ( 9 ) . this requirement places significant burden on hospitals to ensure appropriate policy and technical support are readily available , all at significant cost to the organization . ehr systems also increase the amount of data and documentation available for review in the event of a medical error or adverse event . in one case where a patient was left as a quadriplegic after surgery , the competency of the surgeon was originally called into question , but when ehr metadata was further analyzed it was discovered that a time stamp raised question as to whether the anesthesiologist was present for the entire surgery ( 7 ) . this level of detail available to prosecutors may heighten the risk of malpractice allegations among an entire team of providers ( 7 ) . as providers become more comfortable with an ehr system , learned dependence on built - in clinical decision - making tools may risk critical human decision - making , leading to medical error ( 7 ) . simple actions made possible through computerized record keeping , like copy and paste , may cause a typing error to be copied over and over again , leaving a long trail of mistakes that could potentially lead to medical error ( 7 ) . a 2005 study showed that a widely - used computerized physician order entry system facilitated 22 different types of medication error risks , including inventory displays being mistaken for dosage guidelines , fixed ordering formats that generated wrong orders , and display screens that prevented a coherent view of the patient 's medications ( 7 ) . the legalities and risk associated with ehr adoption may be further amplified by the tendency of physicians to practice independently and to not ask for help when they may not fully understand a practice or protocol ( 7 ) . responsibility for content entered into the system is that of the physician , and without appropriate training and ongoing review of electronic charting practices , the risk of medical error increases ( 10 ) . hospital leadership must address the need for training and commit to regular , ongoing skill upgrading for all ehr system users in order to maintain competency and catch user mistakes before they lead to an adverse event . furthermore , physician responsibility to review an entire database of notes collected by a community of care providers for each patient , and to base their decision - making on the previous observations and actions of others is a threat to physician autonomy and individual practice preferences ( 11 ) . legal and ethical implications aside , the cost of ehr systems is one of the largest contributory factors of failed widespread adoption ( 11 ) . one of the primary issues that is still unresolved is who pays for the implementation of an ehr system , as it is currently health care payers that see the most benefit ( 11 ) . approximately 89% of the monetary benefits gained from ehr systems benefit health care payers rather than those who finance implementation ( 11 ) . additional costs are incurred through regular system upgrades , and ongoing maintenance creates an environment where physicians and hospitals are disincentivized to add an ehr system to operations . costs for a five - person practice to implement an ehr system are approximately $ 162,000 in the first year and $ 85,000 a year in maintenance costs , and these expenses can easily reach far into the millions for an individual hospital ( 4 ) . federal investment in ehr implementation across the country as part of the health information technology for economic and clinical health act has already reached $ 25 billion ( 4 ) , and without addressing the barriers to successful implementation , this venture threatens to be an ongoing waste of public tax dollars with limited benefit to patients and physicians alike . as ehr implementation continues in hospitals , administrative and physician leadership must actively investigate all of the potential risks for medical error , system failure , and legal responsibility before moving forward . ensuring that physicians are aware of their responsibilities in relation to their charting practices and the depth of information available within an ehr system is crucial for minimizing the risk of malpractice and lawsuit . hospitals must commit to regular system upgrading and corresponding training for all users to reduce the risk of error and adverse events . | electronic health records ( ehr ) are not a new idea in the u.s . medical system , but surprisingly there has been very slow adoption of fully integrated ehr systems in practice in both primary care settings and within hospitals . for those who have invested in ehr ,
physicians report high levels of satisfaction and confidence in the reliability of their system .
there is also consensus that ehr can improve patient care , promote safe practice , and enhance communication between patients and multiple providers , reducing the risk of error .
as ehr implementation continues in hospitals , administrative and physician leadership must actively investigate all of the potential risks for medical error , system failure , and legal responsibility before moving forward .
ensuring that physicians are aware of their responsibilities in relation to their charting practices and the depth of information available within an ehr system is crucial for minimizing the risk of malpractice and lawsuit .
hospitals must commit to regular system upgrading and corresponding training for all users to reduce the risk of error and adverse events . |
epidermal growth factor receptor ( egfr ) inhibitors may have a role in this setting . a 53-year - old woman with stage ib2 squamous cell carcinoma of the cervix was initially treated with chemoradiation . six months after completing treatment , she developed a recurrence in the common iliac and para - aortic lymph nodes above the previous radiation field and was treated with additional radiation therapy . two years later , she developed recurrent disease in the left supraclavicular lymph nodes and was treated with chemoradiation followed by 3 cycles of adjuvant cisplatin and topotecan . she had a complete response and was placed on maintenance therapy with topotecan and erlotinib , which was well tolerated and produced minimal side effects . after 20 months of maintenance therapy , it was discontinued given the long interval without evidence of disease . the patient is currently without evidence of disease 5 years after completing the topotecan - erlotinib treatment . we noted a sustained response in a patient with recurrent metastatic cervical cancer treated with radiotherapy , cisplatin , and topotecan followed by maintenance therapy with topotecan and erlotinib . further evaluation of the role of egfr inhibitors in this setting should be considered given their favorable toxicity profile and biological relevance . cervical cancer is the third most commonly diagnosed cancer and the fourth leading cause of cancer death among women worldwide . many women with cervical cancer present with advanced - stage or recurrent disease due to a lack of screening . in addition , approximately 30% of women who undergo definitive treatment for localized cervical cancer subsequently develop metastatic disease . when metastatic cervical cancer is limited , management includes local treatment such as radiation therapy and/or surgery . if disseminated disease is present , palliative chemotherapy is recommended . several agents have shown activity in cervical cancer as single agents or in combination therapy . cisplatin is the preferred single agent , and improved response rates have been shown when cisplatin is used in combination with other agents including paclitaxel and topotecan . recent data indicate that bevacizumab may improve overall survival , particularly in combination with platinum - based chemotherapy . however , despite these advances , most responses in patients with metastatic cervical cancer are partial and of short duration . therefore , the development of new agents and new combinations of previously studied drugs is vital to improve outcomes for patients with advanced disease . erlotinib is an oral selective inhibitor of the epidermal growth factor receptor ( egfr ) tyrosine kinase . erlotinib has approval by the food and drug administration for the treatment of lung and pancreatic cancer [ 5 , 6 , 7 , 8 , 9 ] . it is the recommended first - line therapy for non - small cell lung cancer ( nsclc ) in patients with an egfr mutation . in addition , erlotinib is used for refractory disease in patients with advanced nsclc after failure of at least 1 prior chemotherapy regimen . furthermore , erlotinib is also recommended as maintenance therapy in patients with advanced nsclc following a complete response to first - line chemotherapy , regardless of egfr mutation status [ 7 , 8 ] . erlotinib is also approved for first - line therapy in combination with gemcitabine in patients with advanced - stage pancreatic cancer . previous studies have shown that egfr is overexpressed in squamous cell carcinomas of the cervix and have indicated that egfr overexpression may be associated with a poor prognosis . it has been reported that human papillomavirus 16 , the primary causative agent of cervical cancer , stimulates egfr expression on epithelial cells . on the basis of these data , erlotinib has been evaluated in the treatment of cervical carcinoma [ 12 , 13 ] . in this report , we describe a case of sustained complete response in a patient with distant recurrent cervical cancer treated successfully with local radiation therapy followed by adjuvant chemotherapy and erlotinib - based maintenance therapy . a 53-year - old woman was diagnosed with stage ib2 poorly differentiated squamous cell carcinoma of the cervix with lymphovascular invasion . six months after completion of treatment , positron emission tomography - computed tomography ( pet - ct ) showed recurrent disease to the common iliac and para - aortic lymph nodes above the previous radiation field . the patient was treated with additional radiation therapy to the common iliac and para - aortic lymph nodes . two years later , pet - ct showed a hypermetabolic left supraclavicular lymph node , and fine - needle aspiration showed poorly differentiated carcinoma consistent with cervical cancer recurrence . the patient received additional chemoradiation with cisplatin encompassing the left supraclavicular area , cervical regions , and upper mediastinum . given the patient 's high likelihood of recurrence , she was offered maintenance therapy with erlotinib based on previous study findings in nsclc . she received therapy with low - dose topotecan ( 2 mg / m intravenous every 14 days ) combined with erlotinib ( 100 mg orally daily ) . pet - ct scans were performed every 34 months during maintenance therapy and were negative for disease . maintenance therapy was well tolerated and produced minimal side effects including mild fatigue and nausea . after 20 months of maintenance therapy , the treatment was discontinued given the long interval without any evidence of disease . the patient is currently without evidence of disease 5 years after completing the topotecan - erlotinib maintenance therapy . of note , a copy of the written consent form is available for review by the editor - in - chief of this journal on request . this report describes the case of a woman with recurrent metastatic cervical cancer who developed a sustained complete response following treatment with radiation therapy and adjuvant chemotherapy with cisplatin and topotecan , followed by maintenance therapy with a combination of topotecan and the egfr inhibitor erlotinib . erlotinib has been studied in 2 previous phase ii studies in women with cervical cancer [ 12 , 13 ] . the first study was an open - label single - arm trial that enrolled 25 patients with recurrent or metastatic disease who had all previously received chemotherapy . the study failed to show significant activity of erlotinib as monotherapy : no patient had an objective response , and 4 patients ( 16% ) had stable disease . a second study evaluated erlotinib in combination with cisplatin in 36 patients undergoing definitive radiation therapy for locally advanced disease . thirty - four patients ( 94% ) had a complete response , and 2 patients ( 6% ) had a partial response . in both studies , erlotinib was well tolerated , and the most common side effects were skin rash , fatigue , and gastrointestinal toxic effects . erlotinib has also been approved for treatment of nsclc on the basis of results of randomized trials . a large study compared first - line treatment with erlotinib ( n = 86 ) to platinum - based doublet chemotherapy ( n = 87 ) in patients with metastatic nsclc whose tumors had egfr exon 19 deletions or exon 21 substitution mutations . the median progression - free survival ( pfs ) time was 9.7 months in the erlotinib group and 5.2 months in the platinum - based chemotherapy group ( hazard ratio [ hr ] , 0.37 ; 95% ci , 0.250.54 ; p < 0.0001 ) . however , overall survival did not differ significantly between the treatment groups : median overall survival time was 19.3 months in the erlotinib group and 19.5 months in the platinum - based chemotherapy group ( hr , 1.04 ; 95% ci , 0.651.68 ; p = 0.87 ) . in another study , patients with advanced nsclc who previously received 1 or 2 chemotherapy regimens were treated with erlotinib or placebo . the median overall survival time was 6.7 months for the erlotinib group and 4.7 months for the placebo group ( hr , 0.70 ; 95% ci , 0.580.85 ; p < 0.001 ) . erlotinib has also been evaluated for maintenance therapy for nsclc . in a trial for patients with nonprogressive nsclc following first - line platinum - doublet chemotherapy , the median pfs time was better with erlotinib than with placebo : 12.3 versus 11.1 weeks , respectively ( hr , 0.71 ; 95% ci , 0.620.82 ; p < 0.0001 ) . in a more recent clinical trial , patients with advanced nsclc without tumor progression after 4 cycles of cisplatin - gemcitabine treatment median pfs time was significantly longer with gemcitabine than with observation ( 3.8 vs. 1.9 months , respectively ; hr , 0.56 ; 95% ci , 0.440.72 ; p < 0.001 ) and with erlotinib than with observation ( 2.9 vs. 1.9 months , respectively ; hr , 0.69 ; 95% ci , 0.540.88 ; p < 0.003 ) . the patient in our reported case was treated with erlotinib and topotecan as maintenance therapy following treatment for recurrent cervical cancer . the treatment was based on the results of maintenance therapy with erlotinib in lung cancer where it was shown to be well tolerated and associated with prolonged pfs [ 7 , 8 ] . however , the only trial with erlotinib for recurrent cervical cancer failed to show benefit of erlotinib as a single agent . in our case , erlotinib was therefore combined with topotecan , a cytotoxic drug known to be active against cervical cancer . the goal of the treatment plan was to provide a regimen that would be well tolerated and effective . because the patient did not experience any evidence of disease progression or unacceptable toxic effects , she was kept on treatment . after almost 2 years on this regimen without evidence of disease , both the patient and her medical team felt it was safe to stop the drugs , and she remains without evidence of disease 5 years later . this erlotinib and topotecan regimen was shown to be safe and potentially effective as maintenance therapy following the treatment of recurrent squamous cell carcinoma of the cervix . prolonged survival can potentially be achieved with a more aggressive approach such as the one described in this report . maintenance therapy which includes an egfr inhibitor should be further studied in women with recurrent cervical cancer given the favorable toxicity profile and biological relevance of this class of drugs . | introductionrecurrent cervical cancer is associated with a poor prognosis .
most treatment responses are partial and of short duration .
the development of new therapies is vital to improve treatment for recurrent disease .
epidermal growth factor receptor ( egfr ) inhibitors may have a role in this setting.case descriptiona 53-year - old woman with stage ib2 squamous cell carcinoma of the cervix was initially treated with chemoradiation .
six months after completing treatment , she developed a recurrence in the common iliac and para - aortic lymph nodes above the previous radiation field and was treated with additional radiation therapy .
two years later , she developed recurrent disease in the left supraclavicular lymph nodes and was treated with chemoradiation followed by 3 cycles of adjuvant cisplatin and topotecan .
she had a complete response and was placed on maintenance therapy with topotecan and erlotinib , which was well tolerated and produced minimal side effects .
after 20 months of maintenance therapy , it was discontinued given the long interval without evidence of disease .
the patient is currently without evidence of disease 5 years after completing the topotecan - erlotinib treatment.conclusionwe noted a sustained response in a patient with recurrent metastatic cervical cancer treated with radiotherapy , cisplatin , and topotecan followed by maintenance therapy with topotecan and erlotinib .
further evaluation of the role of egfr inhibitors in this setting should be considered given their favorable toxicity profile and biological relevance . |
anaplastic large cell lymphoma ( alcl ) is an uncommon non - hodgkin lymphoma with both systemic and cutaneous forms . primary cutaneous anaplastic cd 30 + large cell lymphoma is a rare anaplastic large t - cell cd 30 + lymphoma originating in and confined to skin . there are case reports on primary cutaneous lymphoma on histopathology but only few case reports are available on cytopathology . they can be easily misdiagnosed as carcinoma or melanoma by observers who are not familiar with this type of lymphoma . the authors present an unusual case of an ulcerofungative mass in the left iliac fossa clinically masquerading as squamous cell carcinoma which was diagnosed as primary cutaneous anaplastic large cell lymphoma on imprint cytology . subsequent biopsy findings and immunohistochemical studies correlated well with imprint cytology , highlighting its importance in the primary diagnosis . a 59-year - old man presented in skin department with large beefy red ulcerofungative mass in the left iliac fossa measuring 641 cm which was a small nodule 2 months back . computed tomography ( ct ) scan showed the presence of soft tissue mass with irregular outlines arising from the skin . there was no nodal or any other organ involvement in the body . with high clinical suspicion of squamous cell carcinoma , biopsy of the mass and imprint smears the tumor cells were predominantly round in shape having moderate to abundant cytoplasm with a well - defined cytoplasmic membrane and accentuated cell borders . at places , the nuclei were central to eccentric showing variation in size and shape , had irregular nuclear membranes with fine chromatin and variably prominent nucleoli [ figure 1a ] . the smears also showed characteristic hallmark cells with horseshoe shape / reniform nuclei [ figure 1b ] , plasmacytoid cells , occasional hand mirror cells with eccentric nucleus and elongated cytoplasm [ figure 1c ] and occasional doughnut cells [ figure 1d ] . background showed neutrophils , macrophages , lymphocytes , apoptotic cells , mitosis , and sparse lymphoglandular bodies . keeping in view the above findings cytological diagnosis of non - hodgkin lymphoma with high possibility of alcl was made . ( a ) round tumor cells with well defined cell borders , cytoplasmic blebs at places , pleomorphic nuclei , plasmacytoid cells and a mitotic figure ( giemsa , 400 ) ; ( b ) hallmark tumor cell ( giemsa , 400 ) ; ( c ) hand mirror cell ( giemsa , x400 ) ; ( d ) doughnut cell ( giemsa , 400 ) histologically , the sections showed ulcerated squamous epithelium . individual tumor cell showed round to pleomorphic nuclei with an irregular nuclear membrane and conspicuous nucleoli . many reniform / horseshoe shaped nuclei , mitotic figures and apoptotic bodies were also seen . on immunohistochemistry ( ihc ) , the tumor cells were positive for cd 45 and cd 30 [ figure 2 , inset ] which favored the diagnosis of cd 30 + primary cutaneous anaplastic large cell lymphoma . diffuse population of tumor cells with round to pleomorphic nuclei , horse shoe shaped nuclei , mitotic figures , apoptotic bodies and part of overlying epidermis can be seen ( h and e , 400 ) , inset showing cd 30 positivity ( ihc , 400 ) alcl is a nodal t - cell malignancy that is characterized by homogenous proliferation of large atypical lymphocytes that express cd 30 antigen . first group includes a spectrum of cd30 + t - cell lymphoproliferative disorders that include lymphomatoid papulosis and primary cutaneous anaplastic large cell lymphoma . systemic alcl(s - alcl ) is further subdivided into anaplastic lymphoma kinase(alk ) positive and alk negative subtypes based upon the expression of alk . anaplastic lymphoma kinase expression is due to t ( 2;5 ) ( p23q35 ) translocation activating npm - alk protein that acts like an oncogene . cutaneous alcl is confined to skin and usually does not express alk while systemic alcl usually presents as advanced stage disease with nodal involvement and b- symptoms ( mediastinal mass , spleen , liver or lung involvement ) . the alk+ group of s - alcl generally involve children and young adults having good prognosis , while alk- s - alcl mainly affects elderly population with bad prognosis . as an adjunct to tissue base diagnosis imprint cytology plays important role in the evaluation of lymphoid neoplasm . the diagnosis of alcl relies on recognition of various morphological features , most important is the presence of hallmark cells. the nuclei of hallmark cells is reniform , embryo like and horse shoe like with distinct nucleoli and having high mitotic activity . hand mirror cells , doughnut cells , cells with multilobated nuclei , and multinucleated tumor giant cells with wreath like arrangement of nuclei . neutrophil rich variant have large number of neutrophils admixed with tumor cells . in the present case , the presence of characteristic hallmark cells , plamacytoid cells , cytoplasmic blebbing , doughnut cell , hand mirror cell , sparse lymphoglandular bodies , and apoptotic cells were helpful in the diagnosis on imprint cytology . the differential diagnosis on imprint smears includes carcinoma , malignant melanoma , diffuse large b cell lymphoma and hodgkin lymphoma . however , the presence of characteristic hallmark cells , lymphoglandular bodies , and cytoplasmic budding favors a diagnosis of cutaneous anaplastic large cell lymphoma . distinguishing malignant melanoma from c - alcl may be difficult in case of amelanotic melanoma where brown colored melanin pigment is absent . however , melanoma cells have uniform hyperchromatic nuclei , intranuclear inclusions , large prominent nucleoli , and infrequently display significant apoptosis / necrosis . melanoma cells demonstrate nuclear positivity for s-100 protein and are negative for cd 30 and other lymphoid markers . diffuse large b - cell lymphoma is included in the differential diagnosis but cytological hallmark cells or cell variants have not been reported . hodgkin lymphoma rarely involves skin . the reed sternberg cells ( r - s cells ) the r - s cells are binucleate and contain solitary inclusion like eosinophilic macronucleoli surrounded by clear chromatin . background has lymphocytes , eosinophils , plasma cells and histiocytes . , we think that primary cutaneous anaplastic large cell lymphoma can be diagnosed on imprint smears due to its characteristic morphological features . the method is rapid , easily done and a preliminary report can be given as the treatment is different for lymphoma and carcinoma . | primary cutaneous anaplastic large cell lymphoma ( c - alcl ) is a form of cutaneous t - cell lymphoma that is characterized by solitary nodules and plaques . in this report
, the authors present an unusual case of a 59-year - old male with a solitary ulcerofungative mass in the left iliac fossa clinically masquerading as sqaumous cell carcinoma .
the imprint smears of the lesion had characterstic morphological features which helped in the diagnosis .
subsequently , the imprint cytology correlated well with the histopathology and immunohistochemical studies highlighting its utility as simple , rapid , and easy test . |
atrial tachycardia ( at ) resulting in cardiogenic shock requiring circulatory support is a rare entity . at originating from the right atrial appendage ( raa ) a 26-year - old woman in the 19th week of her first pregnancy presented with a chief complaint of palpitations . electrocardiogram ( ecg ) showed sustained at with heart rate ( hr ) of 180 bpm . the p wave morphology was positive in the inferior leads , and exhibited a negative to positive transition in leads v1 to v6 . transthoracic echocardiography revealed a structurally normal heart with global mild hypokinesis ; the left ventricular ejection fraction ( lvef ) was 50% . the at was resistant to beta - blockers , verapamil , and cardioversions . because the patient felt exertional dyspnea , we performed radiation - free catheter ablation at the 26th week of pregnancy . using the electroanatomical mapping system ( carto ) , the origin of at was identified in the apex of the raa where the local electrogram preceded the p wave onset by 32 ms . repeated ablation around the focus with both 4 mm tip and irrigated tip ablation catheters ( navi - star and navi - star thermocool , biosense webster , ca , usa ) prolonged the at cycle length , but failed to terminate the tachycardia . after the ablation , the patient remained hemodynamically stable despite at with hr of 140150 bpm . she continued her pregnancy and delivered a healthy baby at 39 weeks of pregnancy . at 1a ) . brain natriuretic peptide ( bnp ) was markedly elevated at 1839 pg / ml , and chest x - rays showed cardiomegaly ( cardiothoracic ratio=64% ) with pulmonary congestion . amiodarone and landiolol were carefully administered ; however , the patient experienced circulatory collapse unresponsive to catecholamines . with her circulation supported by percutaneous cardiopulmonary bypass ( pcpb ) and intraaortic balloon pump ( iabp ) , we attempted emergent repeat catheter ablation . 1b ) . the local electrogram at the earliest site of activation preceded the p wave onset by 34 ms and had a qs pattern in the unipolar electrogram ( fig . multiple rf applications with an 8 mm - tip catheter ( ablase , life line , japan ) with a power of 3040 w and target temperature of 55 c , and an open irrigation catheter ( navi - star thermocool , biosense webster , ca , usa ) with a power of 2540 w and target temperature of 43 c transiently accelerated the tachycardia without termination . contrast injection to the raa revealed a diverticulum around the site of earliest activation at the apex of raa ( fig . attempts to isolate the raa with encircling lesions also failed ; emergent surgery was performed with median sternotomy . pathologic examination of the resected raa revealed trabeculation of the pectinate muscles with heterogeneous fibrous scar formation from the first ablation ( fig . 2c ) . transmural lesions were rare , and the tip of the diverticulum was intact , explaining the difficulty of rf delivery in the raa and failure of endocardial ablation . with termination of at her circulation stabilized , allowing withdrawal of pcpb and iabp as her cardiac function gradually normalized . plasma bnp value decreased to < 2 pg / ml and lvef on transthoracic echocardiography improved to 67% at 3 months . atrial tachycardia originating from the raa is relatively rare with reported incidence of 3.88% of all focal ats , . an incessant form of tachycardia that may lead to tachycardia - induced cardiomyopathy is common . trabeculation of the pectinate muscles and low blood flow within the raa can cause the temperature and impedance of the ablation catheters to rise , which may prevent effective formation of ablation lesions . irrigated tip ablation catheters are reportedly more effective than non - irrigated tip ablation catheters . however , especially when the focus of at is located at the apex or the diverticulum of the raa , surgery or raa isolation with cryoballoon is sometimes necessary , . in the present case , at was refractory to ablation even using irrigated tip catheters , and surgical resection of raa was needed to terminate the at . pathological findings of the resected raa clearly explained the difficulty of delivering rf energy to the apex and the diverticulum of the raa . pregnancy may induce arrhythmias due to myocardial stretch from increased blood volume , increased sympathetic tone due to increased sensitivity of adrenergic receptors , and the effect of hormones such as estrogen and progesterone . in most cases of pregnancy - induced arrhythmia the main cause of decreased cardiac function in this case was thought to be tachycardia - induced cardiomyopathy considering the full recovery of cardiac function with termination of at and her uncomplicated subsequent pregnancy . however , requirement of circulatory support with tachycardia - induced cardiomyopathy is rare ; pathophysiology similar to that of peripartum cardiomyopathy may have coexisted and affected the clinical course . close follow - up after delivery and early aggressive intervention to the arrhythmia could have prevented the circulatory collapse in this patient . recent advances in ablation technologies and techniques such as epicardial ablation and cryoablation may improve the outcome of catheter treatment of ats originating in the raa . we report a case of failed catheter ablation for focal atrial tachycardia originating from the raa in a post - partum woman who developed cardiogenic shock requiring circulatory support . the anatomical features of the raa likely contributed to our inability to achieve effective ablation . the post - partum state of the patient might have affected her severe clinical course . | a 26-year - old woman in her first pregnancy presented with persistent atrial tachycardia ( at ) . at was resistant to medications , cardioversions , and the first attempt of catheter ablation .
two months after delivery she developed severe systolic dysfunction and circulatory collapse .
emergent catheter ablation was performed with the support of percutaneous cardiopulmonary bypass and intraaortic balloon pump .
the at originated in the apex of the right atrial appendage ( raa ) . repeated attempts at ablation were unsuccessful , prompting surgical raa resection , which terminated the tachycardia and improved the cardiac function .
histological examination of resected raa provided insights into mechanism of resistance to catheter ablation . |
gaps in margin render the tooth susceptible to caries , pulpitis and periodontal disease [ 13 ] . all - ceramic restorations are in fast progression in properties and usage . in situations with high esthetic demands , these materials may be the material of choice . although adhesive resin cements are recommended for most of all - ceramics , and these luting agents have very low solubility , fitness is still important . the incidence of gingival inflammation increases around clinically deficient restorations , particularly those with rough surfaces , subgingival finish lines or poor marginal adaptation . factors affecting adaptation in all - ceramic restorations may be categorized into those influencing before cementation [ 57 ] and those influencing after cementation [ 812 ] and changes in marginal fitness after thermal or mechanical loading in the mouth [ 1317 ] these factors have influence before cementation : ceramic system ( polycrystalline based ceramics , glass - ceramics , glass infiltrated ceramics and feldspathics ) the manufacturing technique ( sintering , slip - casting , heat pressing , casting , cad / cam ) , fabrication stages,[1921 ] finish lines [ 6 , 7 , 22 ] core and veneering layer thermal mismatch . in techniques that a strong core is veneered by a layer ceramic , thermal mismatch between two materials can cause deflections during the fabrication process . in the study of castellani , thermal distortion of all - ceramic crowns the metal ceramic crowns stabilized after an initial loss of marginal precision , and the all - ceramic crowns continued to distort with each firing cycle . reported that the addition of porcelain to the copings caused a significant change in the marginal fit of the crowns made from conventional in - ceram , copy - milled in - ceram and copy - milled feldspathic crowns . both studies found significantly larger marginal discrepancies in the facial and lingual surfaces than mesial and distal . greater bulk of porcelain was explained as the probable reason for higher discrepancy in these surfaces . komine et al . reported , ceramic firing did not significantly affect either marginal or internal adaptation of the cercon , a zro2 ceramic . the difference between studies is possibly a result of the greater strength of zro2 core . the purpose of the present study was to investigate the influence of core and veneer thickness on marginal adaptation of ips e.max press ( ivoclar vivadent , schaan , liechtenstein ) crowns , during different stages of core fabrication , veneering and glazing . ips e.max press is a heat pressed lithium disilicate glass - ceramic , which is veneered by ips e.max ceram , a nano - fluorapatite glass - ceramic . this material is the last generation of pressed ceramics from ivoclar vivadent company , with improved strength and optical properties . it is indicated for anterior and posterior single crowns , for bridges anterior to second premolars and implant superstructures . the null hypothesis was that increasing the core thickness has no effect on marginal accuracy of this ceramic . three stainless steel dies were machined simulating a premolar , prepared for full coverage , with 7.5 mm height , 7 mm diameter , and 6 convergence angle ( fig 1 ) . the minimum framework thickness recommended by ivoclar vivadent was 0.8 mm and the maximum thickness for the veneering layer was 0.7 mm . so cores were fabricated on 0.8 mm ( group a ) and 1 mm shoulder dies ( group b ) , ten specimens for each group . special metal templates were machined to insure similar thickness for cores in each group and final crowns ( fig 1 ) . a groove , 4 mm long and 0.5 mm deep was inserted on dies for repeatable seating of samples and preventing their rotation . depressions were made on four sides of dies 0.5 mm below margins , pointing identical positions for measurements . , templates were placed on related dies and wax was injected in between . during removing wax patterns from metal dies , wax patterns were removed , sprued and invested in ips pressvest speed investment material ( ivoclar vivadent , schaan , liechtenstein ) . then rings were transferred to ivoclar ep600 press furnace ( ivoclar vivadent , schaan , liechtenstein ) and press filled with ips e.max press , [ k20768 ( ivoclar vivadent , schaan , liechtenstein ) ] ho ingots at 920 . then the cores were divested , sandblasted with glass polishing beads at 2 bar ( 30 psi ) pressure and cleaned by invex ( ivoclar vivadent , schaan , liechtenstein ) in ultrasonic bath to remove the reaction layer formed on them . each core was seated on the main die ( 1.5 shoulder ) and the assembly was placed in a device designed to keep them together and prevent their movement ( fig 2 ) . one end of the device was not fixed and could apply pressure on the core , to insure close adaptation of core to die . marginal fit was examined at 120 magnification by a stereomicroscope ( szx12 olympus , japan ) at four predetermined points . according to holmes definition for marginal gap , the distance between crown margin and the edge of die was measured . after this stage , all cores were reinserted on the 1.5 mm shoulder die and ips e.max ceram [ k3116 powder , k43221 liquid ( ivoclar vivadent , schaan , liechtenstein ) ] as the veneering layer was applied on them using a template to insure uniform thickness . each veneered crown was inserted on the main die and again the assembly was placed in the device and the fitness was examined under the stereomicroscope . all laboratory procedures were done by one technician and all examinations were done by one of the investigators . mean marginal gaps measured after core fabrication , veneer firing and glaze were 13.5 ( 1.4 ) m , 33.9 ( 2.3 ) m and 40.5 ( 1.7 ) m , respectively for group a and 14.9 ( 2.0 ) m , 35.5 ( 2.2 ) m and 41.3 ( 2.0 ) m , respectively for group b. there were no significant differences in marginal gap values between the two groups ( p>0.1 ) . significant increase in gap was observed after veneering stage in both groups ( p<0.05 ) , but no significant increase was detected after glazing in either of the two groups . this study was designed to evaluate the influence of core and veneer thicknesses on marginal adaptation of ips e.max press crowns during different stages of fabrication . the results showed 0.2 mm increase in core thickness had no effect on the marginal accuracy of crowns and the null hypothesis was confirmed . addition of the veneering layer significantly decreased marginal adaptation of the crowns ( p<0.05 ) . in this study , finish line was rounded shoulder that is suggested for all - ceramic full coverage crowns . core thicknesses were 0.8 and 1 mm , because the least thickness recommended by the manufacturer was 0.8 mm . die spacer was not used because crowns were not cemented ; further more , die spacer application might complicate uniform thickness of the samples and may affect crown fitness . the marginal 0.5 mm of cores was not veneered , because veneer material on the margin could lead to misleading results . the methods used for measurement of the marginal fit include : 1 ) direct view of the crown on a die , 2 ) cross - sectional view , 3 ) impression replica technique , and 4 ) clinical examination . the last three methods are suitable for measuring gaps after cementation and after loading in the mouth . in this study , uncemented , nonsectioned specimens were examined by direct view under the stereomicroscope . to reposition them repeatedly , grooves and depressions helped all examinations to be done in identical points . because of symmetrical contour in the specimens , only four measurement points per specimen were considered . the sample size of ten for each test group was for compensating minor variations in the fabrication process . in the present study , studied marginal adaptation of different types of all - ceramic partial coverage restorations after exposure to an artificial mouth . the result of the present study is in agreement with values reported for four cusps reduced group ( 50m ) before cementation . conrad et al . reviewed current literature for in vivo and in vitro marginal discrepancy evaluations . reported that the labial and palatal surfaces of the conventional and copy milled in - ceram crowns exhibited significantly larger marginal discrepancies than the other surfaces . the results are consistent with the findings of sulaiman et al . for procera , ips empress and in - ceram . their specimens were made on dies simulating prepared maxillary central incisor , with a wider shoulder and as a result , a greater mass of porcelain at the labial and palatal surfaces compared to the mesial and distal [ 19 , 20 ] . in the present study , there was no variation in shoulder width and veneer thickness inside one group . changing core and veneering layer thickness in different groups did not influence the fitness either . in this study , they indicated that addition of porcelain to the copings caused a significant change in the marginal fit of the crowns , but sulaiman et al . found no significant differences among the various stages of crown fabrication . low shrinkage of heat pressed cores may explain the difference . for heat pressed ceramics that use lost wax technique , 0.4% shrinkage of wax pattern and 0.2% shrinkage of ceramic coping can be compensated by 0.3% setting and 0.2% thermal expansion of investment material . because of inherent properties , large gaps are not expected in pressed copings . in the present study , their comparison between zro2 copings and crowns demonstrated that ceramic firing did not significantly affect marginal adaptation . they explained that the strength of zro2 copings prevent them from being affected by porcelain firing procedure . lithium disilicate glass - ceramics are not as strong as zro2 copings ( 400mpa compared with 900mpa ) . glaze had no significant effect on gap , similar to what balkaya et al . reported . the values for marginal gaps in both groups were in a clinically accepted range proposed by christensen , mclean and fraunhofer . ips e.max press crowns have an acceptable marginal fit . the comparison between the present study and previous studies indicate that variation in veneer thickness of one crown is more influential on marginal accuracy than uniform change in veneer or core thickness . | objective : to evaluate the influence of core thickness and fabrication stages on the marginal accuracy of ips e.max press crowns.materials and methods : twenty ips e.max press crowns , 1.5 mm thick , were fabricated on metal dies .
the crowns had two different core thicknesses , 0.8 mm for group a and 1 mm for group b , ten for each group .
marginal gap was measured after each stage of core fabrication , veneering and glaze firing .
the specimens were not cemented and the measurements were made at four points on metal dies using a stereomicroscope ( 120 ) .
data were analyzed by spss software and independent t-test.results:mean marginal gaps measured after each stage for group a were 13.5 ( 1.4 ) m , 33.9 ( 2.3 ) m and 40.5(1.7 ) m , and for group b these figures were 14.9(2.0 ) m ,
35.5(2.2 ) m and 41.3(2.0 ) m . there were no statistically significant differences in marginal gap values between the two groups ( p>0.1 ) .
significant increase in gap was observed after the veneering stage in both groups ( p<0.05 ) .
after glazing , no significant increase in gap was detected.conclusion:ips e.max press crowns have an acceptable marginal fit .
increasing thickness of core does not increase marginal fitness . |
infection with hepatitis b ( hbv ) and hepatitis c ( hcv ) are the serious worldwide public health problems ( 1 , 2 ) . it is estimated that about 350 to 400 million people suffer from hepatitis infection throughout the world and each year one million people die due to complications of this infection , including cirrhosis and hepatocellular carcinoma ( 1 ) . the prevalence of hepatitis infection varies markedly according to geographical areas . in the united states , canada , western europe , australia , and new zealand , the prevalence of hepatitis b is 0.1% to 2% ; and are known as low prevalence areas ( 35 ) . mediterranean countries , japan , central asia , the middle east , and latin and south america ( 2 - 8% ) , and southern asia , china , and sub - saharan africa ( 8 - 20% ) are considered as intermediate and high prevalence area , respectively ( 5 ) . the prevalence of hepatitis c infection has been reported from different regions ( 2 ) . while hcv prevalence in western europe has been reported from 0.4 to 3% of populations , a prevalence of up to 15% has been reported in mediterranean and east european countries ( 3 ) . in developing countries , there is no access to adequate and reliable information on the prevalence , risk factors and burden of viral hepatitis ( 6 , 7 ) . ( 8) estimated that the prevalence of hbv infection varies 2.1% - 2.6% and 2.1% among iranian males and females , respectively . some studies show that the prevalence of hbv is rising in iran ( 9 ) . but despite this , the majority of studies ( 1015 ) that conducted in iran focused on specific groups such as blood donors , drug abusers and is not based on population . screening program for hepatitis infection in high risk group was implemented since 1984 in iran . according to instruction of ministry of health of iran , hepatitis screening tests are mandatory in the following groups : blood donors , health care provider , patients with history of hemodialysis , pregnant women , infants born to hbsag+ mothers , patients with jaundice or other symptoms of acute hepatitis , first degree relatives of chronic hbv patients , cirrhosis patients , illicit intravenous ( iv ) drug users , hiv patients , prisoners and immigrants from countries with high prevalence of hepatitis . but for this reason , the current study was designed to report the epidemiologic features of hbv and hcv in iranian peoples with positive hepatitis screening test . the present study was designed as cross - sectional study that conducted from march 2010 to march 2012 . in this study , we investigated the epidemiological features of all patients were diagnosed with hepatitis during screening programs in shahid beheshti university of medical sciences coverage area ( more than 80% of tehran 's population ) . demographic information such as age , gender and occupational status , and also medical histories including history of vaccination against hbv , having high risk exposure and laboratory findings were gathered for each patient . patients were categorized into six groups according to their occupation : work without pay ( including householders , students , disable persons and unemployed ) , militaries , government servants , self - employed and high risk occupations ( including health care provider , barbers , prisoners and sweepers ) , other jobs that were not in mentioned categories were classified as other occupations . the high - risk exposures in this study were accidental needle pricks , blood transfusion , blood donation , hemodialysis , iv drug use , high risk sexual practice and intra - family transmission . patients , who did not report any risk factors , were categorized as unknown group . after obtaining necessary information , continuous variables are presented as mean standard deviation , and other parameters as frequency and percentage . differences between groups were determined by chi- square test and differences between means of groups were compared by independent samples t test . a p - value of 0.05 or less was considered statistically significant and all reported p - values were two sided . the mean age of male patients at diagnosis was significantly higher than female ( 47.216.9 vs. 42.816.7 , p < 0.0001 ) . 42% of patients had no income - jobs and only one percent of them were employed in high risk occupations . icterus was most common symptom in patients under study ( n=145 , 3.2% ) followed by nausea and vomiting ( n=115 , 2.5% ) , abdominal pain ( n=93 , 2% ) and fever ( n=78 , 1.8% ) . 30.5% of cases reported other symptoms and 60% of patients had no symptoms at diagnosis that 11% of whom were diagnosed during routine pregnancy tests . demographic and clinical characteristics of patient under study in more than three - quarters of the cases , transmission of the disease was unknown . 87 cases ( 2.0% ) had at least one hbv infected in first degree relatives that 7 of whom were infants born from infected mother . mean age of hcv patients was lower than hbv infected patients ( 43.815.7 vs. 46.417.9 , p < 0.0001 ) . the sex ratio ( male : female ) in hcv infection was significantly different from hbv infection ( 5.26:1 vs. 1.23:1 , p < 0.0001 ) . table 2 demonstrates some of the observed differences between patients with hbv and hcv infection . in this cross - sectional study we have investigated the epidemiological and clinical profile of hepatitis infection in patients diagnosed by a screening program . a total of 4455 new patients during two past years were reviewed that about two - third of whom were infected with hbv . history of iv drug use was most common high risk exposure and in 95% of cases there were no history of hbv vaccination . this result confirmed a finding reported in similar previous studies ( 1 , 9 ) . the causes may be due to higher exposure of men to risk factors for hepatitis infection . despite the availability of an effective hbv vaccine the lowest prevalence of hbv infection was observed in patients less than 20 years old . this may indicate a successful vaccination program in infants that have been implemented since 1993 in iran . if correct , this observation confirms reveals the importance and success of hbv vaccination in high risk groups . as mentioned in various studies , in intermediate prevalence rate areas such as iran but in this study iv drug use was the most common high risk exposure , similar to the pattern observed in low prevalence areas . the rate of iv drug use in hcv patients was significantly higher than hbv patients , comparable to the results of similar studies ( 16 , 17 ) . it should be mentioned that because of this fact that iv drug use and unsafe sex is taboo in iran , there is an underestimation in the reported rate of these high risk exposures by patients . in the interpretation of findings of this study first , we did not know the total number of people screened and only we had access to information of individuals with positive screening test . this means that we did not have population denominator for calculation of the rate of disease . second , design of study was as a cross sectional and there was a lack of healthy control group , for this reason , causal inference is not possible . in conclusion , findings of present study indicates that iv drug use , contact with infected family member and unsafe sex are the most common high risk exposures in iranian infected with hepatitis . for this reason , these groups should be considered as priority in health education , vaccination and screening programs . also , the results of this study showed that most of patients had no symptoms at diagnosis therefore periodic screening tests in high risk groups seem to be necessary . further studies are suggested for evaluation of trend of disease and changes in mode of transmission after implementation of vaccination programs . | aimthe aim of this study was to report the epidemiological features of hbv & hcv infection in an iranian high risk population.backgroundhepatitis b and hepatitis c infections are worldwide serious public health problems .
iran has an intermediate prevalence of infection and a screening program was started in 2010 among high risk individuals.patients and methodsthis cross - sectional study was conducted on 4455 new patients during two past years .
demographic information , age , gender , occupational status , medical history , history of vaccination against hbv , high risk exposure and laboratory findings were collected for each patient
. then distribution of demographic and risk factors was evaluated in each type of hepatitis.resultsthe mean age of patients was 45.617.3 years . more than two - thirds of the diagnosed cases were infected with hbv .
74% of patients were carriers of hepatitis virus .
60% of patients had no symptoms at diagnosis .
illicit intravenous drug use was most common high risk exposure in patients under study ( n=366 , 8.2% ) .
high risk behaviors including illicit intravenous drug use and unprotected sex were relatively higher in patients infected with hepatitis c compared to patients with hepatitis b infection.conclusionfindings of this study suggest that illicit intravenous drug use , contact with an infected household member and unprotected sex are the most common high risk exposure in iranian patients infected with viral hepatitis .
therefore , preventive strategies such as health education , vaccination and screening programs should be directed to these groups .
the results also show that a majority of patients have no symptoms at the time of diagnosis , therefore periodic screening tests in high risk groups is required . |
postpneumonectomy syndrome ( pps ) is an ominous complication , with prevalence in children ranging from 1 in 6 to 1 in 5 pneumonectomies . it is caused by mediastinal shift following massive lung resection that results in compression and stretching of the great vessels and airways . it usually occurs after right pneumonectomy , performed for infections , congenital malformations , or metastatic tumours . we report on a patient with oesophageal atresia ( oa ) who developed a pps following oa repair . a 1-day - old girl was referred to our department for the suspect of oa . she was born by caesarean section at 37 weeks of gestation after an uneventful pregnancy . her birth weight was 2.1 kg and the apgar score was 7/7 at 1/5 min . on admission she was well , with normal oxygen saturation during spontaneous breathing . chest x - rays showed the nasogastric tube folding at the level of the first thoracic vertebra and a distended stomach ( fig . echocardiography demonstrated normal left sided aortic arch , a large patent ductus arteriosus and hypoplastic right pulmonary artery . preoperative fiberoptic tracheoscopy was performed to exclude the presence of a tracheo - oesophageal cleft , and to measure the oesophageal gap . the tip of the bronchoscope was placed at the level of the fistula and a contrasted naso - gastric tube was inserted in the upper pouch . she underwent uneventful surgical ligation and section of the tof and primary oesophageal anastomosis . on post - operative day one , she had progressive clinical worsening with marked hypoxia despite mechanical ventilation . chest x - rays showed total collapse of the right lung and right mediastinal shift ( fig . a fiberoptic tracheobronchoscopy performed by an experienced otolaryngologist revealed a long malacic trachea , extending to the left main bronchus . the suspect of a right oesophageal bronchus associated with the oa was confirmed by oesophagogram showing the origin of the right main bronchus from the oesophagus , caudal to the patent anastomosis ( fig . the right lung collapse caused massive mediastinal shift and rotation , clinically mimicking a pps . a high resolution ct scan with 3d images reconstruction showed a collapsed hypoplastic right lung with a single , small , right pulmonary artery and an associated left pulmonary artery sling ( fig . 2a ) , not visible during the pre - operative echocardiography focused to the side of the aortic arch . to push the mediastinum in the correct position , a 12 ch foley catheter was inserted in the right hemithorax and sterile normal saline ( 50 ml ) was infused ( fig . d ) , and serial saline infusions were performed in the next days . in the occasion of surgical correction of the left pulmonary artery sling ( day 22 of life ) a tissue expander was inserted in the right hemithorax to stabilize the mediastinum . on post - operative day 25 , a right pneumonectomy was performed and the tissue expander was replaced with a larger one . post - operative course was uneventful ; she was extubated on post - operative day 2 , and discharged home on post - operative day 24 . she is alive and well at 24 months of follow - up with moderate thoracic asymmetry and good respiratory function . we present a case of acute pps following oa repair in a patient with associated right oesophageal lung . the association of oa with an abnormal bronchial implantation on the oesophagus is extremely rare and falls in the so - called communicating bronchopulmonary foregut malformations ( cbpfm ) . in our series of 256 patients with oa / tof consecutively treated from 1995 we found only one such patient and gou et al . first used the term bronchopulmonary foregut malformations in 1968 to describe a spectrum of congenital malformations including pulmonary sequestration with or without connections to the alimentary tract . srikanth et al . later suggested the term cbpfm to describe a segment of lung tissue connected to the foregut , and introduced a classification . the first group of this classification is represented by sequestered lung tissue associated with oa / tof and connected to the distal oesophagus . in our patient , surgical repair of ea suddenly impeded the ventilation to the lung fed by the oesophageal bronchus , thereby leading to total right lung collapse and contralateral single lung ventilation . the pathogenetic cascade is confirmed by the only reported case that did not have surgical ligation of the fistula after detection of the anomaly . that patient s respiratory conditions remained stable because the fistula allowed airflow to the right lung . in our patient , the limitation of the preoperative endoscopic study to exclude a tracheo - oesophageal cleft and to define the oesophageal gap misled our intraoperative management and delayed the diagnosis of cbpfm . a detailed tracheobronchoscopy would probably have allowed the diagnosis of cbpfm before oa repair , as suggested by the subsequent tracheobronchoscopy that showed the absence of the right main bronchus . in any case , in the event of acute worsening of clinical conditions during oa / tof repair or shortly thereafter , with unilateral total lung collapse , the presence of an associated cbpfm should always be born in mind and actively investigated . oesophagogram is the gold - standard diagnostic test as it shows the aberrant origin of the oesophageal bronchus . the study should be performed in lateral decubitus as the bronchus originates from the side of the oesophagus , usually the right one . oesophagoscopy should be avoided in the acute setting as it can cause disruption of the fresh anastomosis . in our patient , lung resection is generally well tolerated , with good long - term outcomes . however , there are anatomic characteristics specific to children that are thought to predispose them to specific post - operative complications . moreover , during childhood , lungs are more compliant due to the higher content of elastic tissue . this relative flexibility of the mediastinal structures could lead to contralateral pulmonary distension after a pneumonectomy . mediastinal shift and rotation causes compression and stretching of the great vessels and airways that in association with overdistension of the remaining lung can result in critical worsening of pulmonary function leading to major respiratory failure , the so called pps . this condition is most frequently encountered in children than in adults for the anatomical characteristics mentioned above . pps can occur almost immediately after pneumonectomy but is more common in the progressive and delayed form . in our patient , oa / tof repair was followed by acute complete right lung collapse , simulating a right pneumonectomy , with massive right - sided mediastinal shift , clinically mimicking a pps . the left pulmonary artery sling that caused left main bronchus stenosis further worsened the clinical picture . as a consequence , both air and blood flow in the remaining left lung was acutely reduced by the mediastinal shift . when such a clinical picture occurs in patients with group 1 cbpfm , the term pseudo - pps seems more appropriate as they do not undergo lung resection surgery . classically , treatment of cbpfm is to resect the aberrant lung tissue with lobectomy or pneumonectomy and mediastinal repositioning using rigid prostheses ( e.g. breast prostheses ) or tissue expanders in the empty hemithorax . reimplantation of the anomalous bronchus is the ideal management but was attempted in only one patient with cbpfm associated with oa , which was successful . this option should be considered in patients with normal pulmonary vasculature and without lung tissue damage due to aspiration or prolonged consolidation . however , in some cases pps may be life - threatening , and its treatment requires emergency repositioning of the mediastinum in axis . in our patient , we performed an iatrogenic hydrothorax by infusing sterile normal saline in the right hemithorax , which was followed by immediate improvement of her clinical conditions . serial infusions were performed to maintain the mediastinum in axis , which allowed the patient to sustain clinical stability and to undergo cardiac surgery . in our patient , bronchial reconstruction was not possible as definitive treatment because the right bronchus was too short , not allowing a good anastomosis with the trachea , and the lung remained collapsed too long to allow its re - expansion . the association of oa with an abnormal bronchial implantation on the oesophagus is extremely rare and falls in the so - called communicating bronchopulmonary foregut malformations ( cbpfm ) . in our series of 256 patients with oa / tof consecutively treated from 1995 we found only one such patient and gou et al . first used the term bronchopulmonary foregut malformations in 1968 to describe a spectrum of congenital malformations including pulmonary sequestration with or without connections to the alimentary tract . srikanth et al . later suggested the term cbpfm to describe a segment of lung tissue connected to the foregut , and introduced a classification . the first group of this classification is represented by sequestered lung tissue associated with oa / tof and connected to the distal oesophagus . surgical repair of ea suddenly impeded the ventilation to the lung fed by the oesophageal bronchus , thereby leading to total right lung collapse and contralateral single lung ventilation . the pathogenetic cascade is confirmed by the only reported case that did not have surgical ligation of the fistula after detection of the anomaly . that patient s respiratory conditions remained stable because the fistula allowed airflow to the right lung . in our patient , the limitation of the preoperative endoscopic study to exclude a tracheo - oesophageal cleft and to define the oesophageal gap misled our intraoperative management and delayed the diagnosis of cbpfm . a detailed tracheobronchoscopy would probably have allowed the diagnosis of cbpfm before oa repair , as suggested by the subsequent tracheobronchoscopy that showed the absence of the right main bronchus . in any case , in the event of acute worsening of clinical conditions during oa / tof repair or shortly thereafter , with unilateral total lung collapse , the presence of an associated cbpfm should always be born in mind and actively investigated . oesophagogram is the gold - standard diagnostic test as it shows the aberrant origin of the oesophageal bronchus . the study should be performed in lateral decubitus as the bronchus originates from the side of the oesophagus , usually the right one . oesophagoscopy should be avoided in the acute setting as it can cause disruption of the fresh anastomosis . in our patient , lung resection is generally well tolerated , with good long - term outcomes . however , there are anatomic characteristics specific to children that are thought to predispose them to specific post - operative complications . moreover , during childhood , lungs are more compliant due to the higher content of elastic tissue . this relative flexibility of the mediastinal structures could lead to contralateral pulmonary distension after a pneumonectomy . mediastinal shift and rotation causes compression and stretching of the great vessels and airways that in association with overdistension of the remaining lung can result in critical worsening of pulmonary function leading to major respiratory failure , the so called pps . this condition is most frequently encountered in children than in adults for the anatomical characteristics mentioned above . pps can occur almost immediately after pneumonectomy but is more common in the progressive and delayed form . in our patient , oa / tof repair was followed by acute complete right lung collapse , simulating a right pneumonectomy , with massive right - sided mediastinal shift , clinically mimicking a pps . the left pulmonary artery sling that caused left main bronchus stenosis further worsened the clinical picture . as a consequence , both air and blood flow in the remaining left lung was acutely reduced by the mediastinal shift . when such a clinical picture occurs in patients with group 1 cbpfm , the term pseudo - pps seems more appropriate as they do not undergo lung resection surgery . classically , treatment of cbpfm is to resect the aberrant lung tissue with lobectomy or pneumonectomy and mediastinal repositioning using rigid prostheses ( e.g. breast prostheses ) or tissue expanders in the empty hemithorax . reimplantation of the anomalous bronchus is the ideal management but was attempted in only one patient with cbpfm associated with oa , which was successful . this option should be considered in patients with normal pulmonary vasculature and without lung tissue damage due to aspiration or prolonged consolidation . however , in some cases pps may be life - threatening , and its treatment requires emergency repositioning of the mediastinum in axis . in our patient , we performed an iatrogenic hydrothorax by infusing sterile normal saline in the right hemithorax , which was followed by immediate improvement of her clinical conditions . serial infusions were performed to maintain the mediastinum in axis , which allowed the patient to sustain clinical stability and to undergo cardiac surgery . in our patient , bronchial reconstruction was not possible as definitive treatment because the right bronchus was too short , not allowing a good anastomosis with the trachea , and the lung remained collapsed too long to allow its re - expansion . in patients with oa , the development of post - operative severe respiratory distress and unilateral lung collapse must lead to the suspect of an associated cbpfm . neonatologists and paediatric surgeons should be aware of this rare association that may cause acute life threatening worsening of patient s clinical conditions . in the case of pps development , infusion of sterile normal saline in the affected hemithorax is a simple , fast and effective method that allows pushing the mediastinum in the correct position , thereby leading to dramatic improvement of the clinical conditions . although no identifying details are reported , parents of the patient have given their informed consent . | highlightsafter esophageal atresia repair , if postpneumonectomy syndrome develops , an associated esophageal lung must be considered.contrast esophagography , with the patient lying on the side of collapsed lung , is the optimal diagnostic study.in infants with postpneumonectomy syndrome , infusion of normal saline in the hemithorax on the side of collapsed lung is a simple , rapid , and effective method to obtain mediastinum realignment in emergency with immediate improvement of clinical conditions . |
differential lipid composition between the apical and basolateral membrane domains of epithelial cell plasma membranes made it clear that membrane lipids are not laterally distributed in a homogeneous fashion . the lipid raft hypothesis was developed to explain lateral separation of bilayer lipids , and this idea quickly found applications in viral budding , endocytosis , and signal transduction ( reviewed in ) . in model membranes , lipids can separate into microscopically resolvable raft - like domains . plasma membrane surrogates formed by chemical membrane blebbing or cell swelling procedures also show phase behaviour [ 5 - 8 ] . similar domains are not evident upon direct observation of unperturbed plasma membranes in living cells , but the non - equilibrium nature of cell membranes , including endocytosis , exocytosis , and other motile processes , may prevent overt phase separation . likewise , quantitative analysis of lipid - anchored protein and lipid diffusion in cell membranes by fluorescence recovery after photobleaching ( frap ) , frster resonance energy transfer ( fret ) , and fluorescence correlation spectroscopy ( fcs ) [ 9 - 11 ] indicated that rafts in the plasma membrane of resting cells must be very small or ephemeral ( or both ) , forcing an evolution of the lipid raft hypothesis . these tiny clusters do not represent lipid phase separations but are probably short - range ordering imposed upon lipids by transmembrane proteins and cortical actin structures . thus , the current challenge for the field is to understand the interplay between protein and lipid that converts the exceedingly small , unstable clusters of components into larger , more stable membrane microdomains required for function . the recent development of sensitive quantitative microscopy methods has advanced our knowledge of lipid dynamics in resting cells . the diffusion of raft lipids ( e.g. , sphingomyelin ) and non - raft lipids ( e.g. , phosphatidylethanolamine ) was measured by an elegant fcs technique within regions as small as 30 nm in diameter using stimulation emission depletion fluorescence microscopy . the results indicate that raft lipids , but not non - raft lipids , are indeed preferentially trapped , albeit for short distances ( < 20 nm ) and for short periods ( 10 - 20 ms ) . homofret measurements , combining frap , emission anisotropy , and theoretical model fitting to test models of lateral organization in the membrane , were used determine the degree of clustering of glycosylphosphatidylinositol ( gpi)-anchored proteins in the plasma membrane . the formation of gpi - anchored protein nanoclusters ( of ~4 molecules or even less ) is an active process involving both actin and myosin , and these nanoclusters are nonrandomly distributed into larger domains of < 450 nm . additionally , high - speed single - particle tracking ( 50 khz ) revealed that gpi - anchored proteins , along with other membrane proteins , undergo rapid hop diffusion between 40 nm actin - regulated compartments , with a compartment dwell time of 1 - 3 ms on average . however , when gpi - anchored proteins were deliberately cross - linked by gold or quantum dot particles , they underwent transient confinement or stall ( stimulation - induced temporary arrest of lateral diffusion ) from a cholesterol - dependent nanodomain in a src family kinase mediated manner [ 17 - 19 ] . a recent study identified a transmembrane protein ( carboxyl - terminal src kinase [ csk]-binding protein ) involved in the linkage between the particle - cross - linked gpi - anchored protein , thy1 , and the cytoskeleton ( figure 1 ) . thy-1 crosslinking by streptavidin - coated quantum dots aggregates gpi lipid tails in the outer leaflet of the plasma membrane in a cholesterol - dependent manner . carboxyl - terminal src kinase ( csk)-binding protein ( cbp ) , a transmembrane protein , is recruited to or captured by thy-1 clusters along with src - family kinase substrates ( ks ) . cbp or ks ( or both ) are phosphorylated by src - family kinases ( sfk ) , enabling cbp to bind to actin filaments via an ebp50-erm ( ezrin / radixin / moesin - binding phosphoprotein 50-ezrin / radixin / moesin ) adaptor linkage resulting in a transient anchorage . when either cbp or the adaptors are dephosphorylated by an unspecified protein tyrosine phosphatase ( ptp ) the anchorage is terminated . the lipid envelope of influenza and hiv virions , but not those of the vesicular stomatitis virus ( vsv ) or semliki forest virus ( sfv ) , is enriched in raft - like lipids , leading to the notion that these viruses bud from lipid microdomains in the plasma membrane [ 21 - 25 ] . by contrast , the lipidomes of vsv and sfv are very similar to each other and to that of the plasma membrane suggesting that these viruses do not select or generate lipid raft domains for budding . the protein and lipid environment of the budding domains of hemagglutinin ( ha ) and hiv has been the source of several recent papers examining the process of viral budding using quantitative live - cell imaging techniques . influenza buds from ha clusters ( ranging up to micrometers in diameter ) regulated by ha transmembrane region length and palmitoylation . recent fluorescence lifetime imaging microscopy ( flim)-fret experiments in living cells indicate that ha colocalizes with lipid microdomain markers , further supporting the role of lipid - protein interactions in influenza virus budding . proton magic angle spinning nuclear magnetic resonance was used to detect a minor fraction ( ~10 - 15% ) of liquid - ordered membrane phospholipids in ha virions and virion lipid extracts at 37c . while lipid ordering increased at lower temperatures , it was not required for virion fusion with target membranes . progressive recruitment of cytoplasmic hiv-1 gag to the membrane , via post - translational acyl lipid modification and pip2/basic residue interactions , forms membrane domains that culminate in virion budding [ 31 - 33 ] . while the hiv-1 lipid envelope composition indicates enrichment in lipids and proteins associated with rafts , paradoxically , one report has failed to observe an enrichment of enhanced green fluorescent protein ( egfp)-gpi at gag domains in living cells , suggesting that the local lipid microenvironment may not exactly parallel the classic raft lipid composition . recent work has implicated the tetraspanin family of proteins in gag domain formation and function . tetraspanins , a widely expressed and highly conserved class of transmembrane proteins ( reviewed in ) , form tetraspanin - enriched microdomains ( tems ) through lateral tetraspanin - tetraspanin interactions and binding to non - tetraspanin membrane proteins . tetraspanins can be palmitoylated and the lipid environment within tems contains cholesterol , but gpi - anchored proteins and caveolin are not enriched in tems ( reviewed in ) . recently , cholesterol and tetraspanin palmitoylation were implicated in the confined diffusion and co - diffusion ( of two tetraspanin molecules ) of the tetraspanin cd9 . tetraspanins appear to induce order in the plasma membrane by virtue of protein clustering , but they likely also stabilize lipid microenvironments in the plasma membrane allowing for lateral organization of hiv-1 gag and virion budding . some lectin - based membrane domains form in the absence of post - translational lipid modifications or known lipid binding activity . dendritic cell - specific intracellular adhesion molecule-3-grabbing non - integrin ( dc - sign ) , a tetrameric c - type lectin with affinity for high - mannose glycans , forms microdomains on the plasma membrane [ 40 - 42 ] that serve as high - avidity binding sites for numerous pathogens . a previous report suggested that dc - sign interacts with lipid rafts , but this was based on detergent insolubility and cholera toxin colocalization assays , which generally do not faithfully report on intrinsic membrane lateral heterogeneity . also , dc - sign domains do not depend on cholesterol ( unpublished data ) . this result implies that dc - sign within domains does not exchange with the surrounding membrane . the source of this stability remains a mystery , and its cause may not reside in the membrane - apposed cytoskeleton but in extracellular cross - linking factors such as galectins ( reviewed in ) . dc - sign membrane domains that are multiplexed with another c - type lectin , cd206 ( unpublished data ) , appear to mediate the formation of fungipods , novel cellular protrusive structures involved in fungal recognition by dendritic cells ( figure 2 ) . thus , the lateral heterogeneity in membranes provided by rafts and other microdomains continues to provide surprising functional consequences . c - type lectins ( clrs ) form a type of plasma membrane domain that is not dependent on cholesterol . ( a ) plasma membrane domains containing mixtures ( yellow ) of dendritic cell - specific intracellular adhesion molecule-3-grabbing non - integrin ( dc - sign ) ( green ) and cd206 ( red ) are observed on a monocyte - derived dendritic cell ( dc ) by immunofluorescence . dc - sign domains are known sites of binding and entry for a range of pathogens including hiv-1 . ( b ) yeast cell wall material is sensed by these clr membrane domains , triggering a unique protrusive response , the fungipod . the image shows an example of a dc fungipod formed via cd206 ligation by a fixed saccharomyces cerevisiae particle ( zymosan ) , visualized by scanning electron microscopy ( 9500 ) . a variety of membrane domain forming systems have a wide gamut of lipid and protein constituents and possess a correspondingly broad range of functions . recent advances have shown that preferential lipid trapping or confinement in the resting plasma membrane occurs only on very small spatiotemporal scales . critical attention must be paid when determining if and when such confinement becomes biologically meaningful for processes such as endocytosis and signal transduction . while lipid ordering can be stabilized by oligomerization of membrane - associated proteins ( i.e. , gm1 crosslinking , influenza ha clustering ) , the lipids in these domains may still exchange between domain and surrounding membranes , making even these stabilized raft - like domains dynamic environments . at what point does a membrane domain become stable enough to be biologically relevant ? what is the range of protein and lipid turnover rates seen in membrane domains and are there different turnover rates for each constituent ? it is likely that a spectrum of membrane microdomains exists with different compositions and physical characteristics suited to their diverse purposes . the lipid species and their ordering within raft - like complexes appear to be key factors in determining intradomain cohesiveness and resultant domain size and lifetime . | evidence in support of the classical lipid raft hypothesis has remained elusive .
data suggests that transmembrane proteins and the actin - containing cortical cytoskeleton can organize lipids into short - lived nanoscale assemblies that can be assembled into larger domains under certain conditions .
this supports an evolving view in which interactions between lipids , cholesterol , and proteins create and maintain lateral heterogeneity in the cell membrane . |
in the post - genomic era , much attention has been paid to understanding the dynamics of the proteome , transcriptional regulation and post - translational modification of proteins ( ptms ) . numerous ptms supply the proteome with structural and functional diversity , and govern cellular plasticity and dynamics . types of ptms include phosphorylation ( 1,2 ) , sumoylation ( 3 ) , ubiquitination and methylation . compared to well - known and extensively studied protein phosphorylation ( 1,2 ) , protein methylation attracts much less attention , despite the fact that it was discovered nearly half a century ago ( 4 ) . protein methylation can modify the nitrogen atoms of either the backbone or side - chain ( n - methylation ) in several types of amino acids , such as lysine , arginine , histidine , alainine and asparagine , etc ( 511 ) . also , methylation occurs at cysteine residues as s - methylation ( 12 ) . in this field , lysine residues can be mono- , di- or tri - methylated by histone lysine methyltransferases ( hkmts ) ( 5,8,10,11 ) . the methylation of lysine has been mostly studied in h3 and h4 histone proteins , which play essential roles in many biological processes , such as heterochromatin compaction , x - chromosome inactivation and transcriptional silencing or activation ( 5,10,11 ) . furthermore , the hkmts also modify a variety of non - histone proteins with diverse functions ( 5,8,10,11 ) . for example , set9 methylates a transcription factor taf10 to increase its interacting affinity for rna polymerase ii , which is implicated in transcriptional regulation of taf10 target genes ( 13 ) . in addition , methylation of p53 by set9 in vivo increases its stability and regulates the expression of p53-dependent genes ( 14 ) . furthermore , the activity of lysine methylation of cytosolic ezh2-containing methyltransferase complex is essential for receptor - induced actin organization and proliferation ( 15 ) . protein methylation can also occur on the guanidino nitrogen atoms of arginine ( 6,7,9,10,16 ) . histone code together with lysine methylation ( 5,11 ) , the substrates of prmts are much more diverse than hkmts ( 6,7,10 ) . indeed , arginine methylation plays important roles in numerous cellular processes , including rna processing , transcriptional regulation , signal transduction and dna repair ( 6,7,10 ) . for example , arginine methylation of spt5 regulates its binding with rna polymerase ii to modulate the transcriptional elongation ( 17 ) . and pmrt1 methylates nip45 , the nuclear factor of activated t cell ( nfat ) cofactor protein , to play an essential role in cytokine gene transcription ( 18 ) . in addition , as a potential role arginine protection , prmts may modify and protect the arginines against endogenous reactive methylglyoxal ( 9 ) . recent study shows that lsd1 ( lysine - specific demethylase 1 ) is responsible for the demethylation of histone h3 lysine 4 ( 5 ) . very recently , it has been verified that jhdm1 ( jmjc domain - containing histone demethylase 1 ) is responsible for the demethylation of lysine 36 ( 19 ) . furthermore , peptidyl - arginine deiminase pad4 is able to deiminate both unmodified arginine and monomethylarginine residues in histones into citrullines ( 6 ) . identification of methylated proteins with their sites will be a foundation of understanding the molecular mechanism of protein methylation . besides the conventional experimental methods , such as mutagenesis of potential methylated residues , methylation - specific antibodies ( 20 ) and mass - spectrometry ( 2123 ) have also been deployed . therefore computational prediction of methylation sites is much more desirable for its convenience and fast speed . unfortunately , although many methods with satisfying accuracies have been developed to predict phosphorylated protein sites ( 2,24 ) , only one work , which focuses on only disordered regions of considered proteins , has been published on prediction of methylation sites ( 25 ) . in this work , we provide a novel online tool for protein methylation site prediction of memo , protein methylation modification prediction , employing the algorithm of support vector machines ( svms ) ( 26 ) ( ) . we have collected all annotated methylated residues in swiss - prot version 48 ( 27 ) . then we have combined the two datasets into an integrated positive ( + ) dataset for training after homology reducing . limited by the available data , only methylated lysines and arginines , we have implemented the prediction system in a web server , which is now available at : . first , we obtained the dataset of methylation sites from the feature table of swiss - prot ( version 48 ) ( 27 ) . we obtained 328 positive ( + ) sites , including lysines ( 148 items ) , arginines ( 76 items ) , histidines , asparagines and other kinds of residues ( supplementary table 1 ) . methylation lysine and methylation arginine for information on lysine and arginine methylation , respectively . from 1700 scientific articles , we collected 107 and 264 experimentally verified methylation sites for lysine and arginine , respectively . in addition , we combined the manually curated data and the data from swiss - prot into an integrated positive ( + ) dataset . as a result , only lysines ( 227 items ) and arginines ( 273 items ) had enough data entries to train and test the svm models . in the present work we focused on methylated lysine and arginine residues , and did not take other amino acids into consideration . the positive ( + ) dataset for training might contain some homologous sites from homologous proteins . if the testing data were highly homologous to the training data , the prediction accuracy would be overestimated . to avoid the overestimation , we clustered the protein sequences from positive(+ ) dataset with a threshold of 30% identity by blastclust , one program in the blast package ( 28 ) . if two proteins were similar with 30% identity , we re - aligned the proteins with bl2seq , another program in the blast package ( 28 ) , and checked the results manually . if two methylation sites from the two proteins were at the same position in alignment , only one item was kept while the other one was discarded . thus , we obtained positive ( + ) data of high quality with 156 lysine and 250 arginine - methylated sites . as described previously ( 2,24 ) , the negative ( ) sites were taken from non - annotated lysine / arginine sites in the same proteins from which ( + ) sites were chosen . finally , memo was implemented in perl and hosted by apache running on a debian linux system . the web server of memo ( version beta 1.0 ) has been available since jan , 2005 . to mimic queries from biologist users , we have randomly submitted to memo three proteins , pbx4 ( q9byu1 ) , syntaxin 10 ( o60499 ) and sorting nexin ( snx)-17 ( q15036 ) from a large - scale experiment to identify the potential methylated proteins ( 20 ) , as examples to demonstrate the simplicity and accuracy of memo ( table 1 ) . with methyl - specific antibodies , there have been 200 putatively arginine - methylated proteins to be identified ( 20 ) . however , the precise arginine methylation sites on these substrates still remain to be verified . from the list we have blindly taken three proteins , which have not been included in our training dataset , and predicted the potential arginine methylation sites in these proteins . transcription factor pbx4 is a member of the pbx family that is implicated in a variety of developmental processes including axial patterning , hindbrain development and organogenesis ( 29,30 ) . syntaxin 10 is a snare ( soluble n - ethylmaleimide sensitive factor attachment protein receptor ) protein . as a member of the syntaxin family , syntaxin 10 localizes to the trans - golgi network ( tgn ) and play a potential role in regulating the expression profile of transferrin receptor ( tfr ) ( 31 ) . snx17 is a member of the snx family that is involved in the sorting of transmembrane proteins ( 32 ) . snx17 associates with ldl receptor - related protein ( lrp ) to modulate its cell surface levels ( 33 ) . in all three cases , we have employed the memo web tool to predict the arginine methylation sites on these proteins . we have retrieved the protein sequences of the three proteins in fasta format , and pasted them in the input form of memo . memo predicts r55 , r57 and r63 of pbx4 , r11 and r22 of syntaxin 10 and r339 , r341 , r399 and r442 of sorting nexin-17 as potentially positive hits ( table 2 ) . interestingly , six of nine predicted sites are consistent with the methyl - specific antibody epitopes ( 20 ) . the examples used here also shows that memo could be an important and useful computational tool for further experimental work . our approach can be comparable with previous method ( 25 ) . more details about performance comparison the known methylated protein residues ( supplementary table 1 ) are still far fewer than known phosphorylated residues ( 1,2 ) . in addition , the accuracies may also be affected by a lack of training data . however , as proteomic techniques improve , more and more methylation sites will be identified . we can expect that the prediction systems could be expanded to other kinds of methylated residues besides arginine and lysine . in addition , a powerful predictor of methylation sites in a methyltransferase family - specific fashion is also desirable . moreover , some other machine learning methods could be applied , i.e. group - based prediction and scoring algorithm ( gps ) ( 2 ) , artificial neural networks and hidden markov models . furthermore , evolutionary information , e.g. phylogenetic conservation between human and mouse ( 3 ) , could be integrated into the prediction system to improve its accuracy . finally , the sequence patterns and structural specificities , which facilitate the binding between methylation sites and methyltransferases , remain to be dissected . here we have developed a high - performance protein methylation predictor using the svms . due to the data limitation we have implemented our method in an accessible web server , and expect that the memo may serve as a useful tool to experimentalists , who study protein methylation function and dynamics . the predicted arginine methylation sites of pbx4 ( q9byu1 ) , syntaxin 10 ( o60499 ) and sorting nexin-17 ( q15036 ) with the methyl - specific antibody epitopes in these protein sequences memo predicts r55 , r57 and r63 of pbx4 , r11 and r22 of syntaxin 10 and r339 , r341 , r399 and r442 of sorting nexin-17 as potentially positive hits . | protein methylation is an important and reversible post - translational modification of proteins ( ptms ) , which governs cellular dynamics and plasticity .
experimental identification of the methylation site is labor - intensive and often limited by the availability of reagents , such as methyl - specific antibodies and optimization of enzymatic reaction .
computational analysis may facilitate the identification of potential methylation sites with ease and provide insight for further experimentation . here
we present a novel protein methylation prediction web server named memo , protein methylation modification prediction , implemented in support vector machines ( svms ) .
our present analysis is primarily focused on methylation on lysine and arginine , two major protein methylation sites .
however , our computational platform can be easily extended into the analyses of other amino acids .
the accuracies for prediction of protein methylation on lysine and arginine have reached 67.1 and 86.7% , respectively .
thus , the memo system is a novel tool for predicting protein methylation and may prove useful in the study of protein methylation function and dynamics .
the memo web server is available at : . |
supratentorial metastasis is found in 14.6% of cases , intraspinal mets in 12.5% , and systemic metastasis in 9.7% . the management of patients who present with diffuse leptomeningeal spread preoperatively has not been clearly defined . an 11year - old boy presented with progressive headache and gait ataxia for 1 year . on examination he was found to have only cerebellar ataxia with no signs suggestive of spinal cord involvement . he was investigated with cranio - spinal contrast mri , which showed three lesions , one in the region of the vermis and the other in the suprasellar region and long segment cervico - dorsal region [ figures 1 , 2a b and 3a b ] . the lesions were hypointense on t1w , and hyperintense on t2 with heterogenous contrast enhancement . the right ventriculo peritoneal shunt was inserted as the patient had features of raised icp with hydrocephalus . he was operated in prone position with flexion at atlanto - occipital joint , thereby opening up the operative site , taking care not to overflex to avoid blocking the venous drainage or airway . there was minimal improvement in sensory loss but none in motor power in 1 week . in view of his repeat mri spine showed no hemorrhage in the spinal lesion or in the tumor bed . there was minimal improvement in sensory loss but none in motor power in 1 week . in view of his lower cranial nerve palsies mid - sagittal mri showing fourth ventricular mass and sellar mass ( a ) mid - sagittal mri of cervico - dorsal showing dorsally placed lesion extending from c3 below . ( b ) mid - sagittal mri of cervico - dorsal showing dorsally placed lesion , expanding the spinal subarachnoid space above and below the lesion ( a ) axial t2 mri showing mass in dorsal posterior aspect of the cord . ( b ) another axial t2 mri showing mass in dorsal posterior aspect of the cord drop metastasis from the primary location to anatomically lower sites including whole - spinal cord is known as a potential way for tumors like medulloblastoma to spread and are seen in approximately 40% of patients . the high incidence of involvement of the lumbosacral region shows the effect of gravity on csf borne metastases . disseminated plaques and nodules are also more common in the dorsal region , supporting the theory of spread along the csf pathways as the normal caudal flow of csf is along the dorsal aspect of the cord . by far the most common presentation is that of the intradural , extramedullary type though intramedullary metastases are also reported . the presence of leptomeningeal metastasis in medulloblastoma is used for clinical staging and is already demonstrated as an independent prognostic factor . early drop metastasis is used to describe the group of patients with positive preoperative or immediate postoperative ( less than 1 month ) mri findings . late drop metastasis has been defined by new image evidence of leptomeningeal enhancement found after the primary surgical procedure with at least one negative prior whole - spine mri examination . leptomeningeal metastases found at presentation seem not to be a prognostic factor though late drop metastasis reflects the relative resistance of adjuvant therapy and may be viewed as a possible poor prognostic factor in this small patient group . the uniqueness of this case lies in the fact that the spinal drop metastases were sheetlike extending from the c3 to d8 region . the causes of postoperative paraplegia following posterior fossa surgery could be the following : intraoperative patient position , overflexion of neck and/or imbalance of the subarachnoid pressure between rostral and caudal thoracic spine , and by removing csf at the operative site . another possibility was that the contamination of csf with blood after posterior fossa surgery could lead to the development of a symptomatic spinal hematoma being explained by the movement of blood from the tumor bed into the spinal canal under the effect of gravity , during or after the surgery . meticulous homeostasis and isolation of the surgical area from the spinal space with avoidance of over drainage of csf have been stressed upon . the hydrodynamic changes that occur following a shunt placement can be speculated as another cause of paraplegia following surgery for nonspinal lesions . the current staging stratifies patients harboring these tumors in two groups , a high risk and a low risk group , with the mainstay of treatment being surgery , craniospinal irradiation , and chemotherapy . however , the exact management for patients presenting with disseminated leptomeningeal spread prior to surgery ( high risk ) , like in our case , is not clear . we would like to discuss two new options regarding the management of medulloblastoma with disseminated metastases . the first option is the administration of neoadjuvant chemotherapy in order to downstage the tumor , followed by surgery and radiotherapy . reported on three cases of presumed medulloblastomas who were preoperatively treated with chemotherapy consisting of high doses of carboplatin alone . the treatment improved the clinical condition prior to surgery and facilitated tumor removal , resulting in partial regression of tumor . the preoperative single - drug therapy did not affect the histological diagnosis or prevent the presence of an effective degree of tumor sensitivity to the drug and all the three children were disease - free for a mean period of 42 months . multidrug chemotherapy after a endoscopic / small biopsy has shown to reduce the tumor bulk significantly , downstaging the tumor and making total excision feasible . another option would be to operate on the drop metastases , especially those with long segment involvement , in the same sitting . the literature search did not reveal any studies which had dealt with this kind of management . besides , it may not be feasible in cases with long segment involvement like in our case . the possibility of neoadjuvant chemotherapy and/or single sitting surgical intervention for drop metastases needs to be explored in order to improve the outcome for such lesions . | management of patients with medulloblastoma presenting with multiple metastasis in subarachnoid space preoperatively is unclear . an 11year - old boy presented with vermian medulloblastoma with an unusually long segment cervico - dorsal lesion and suprasellar lesion .
the child underwent a posterior fossa craniotomy ( prone position ) and excision of vermian mass .
he developed paraplegia in the immediate postoperative period , the possible causes for which are being discussed .
besides , treatment options for patients presenting with disseminated disease preoperatively have been highlighted .
preoperative chemotherapy to downstage such lesions may be tried and such complications could be avoided . |
pediatric lower urinary tract scoring system ( plutss ) is a standard questionnaire that applies for screening of the children with bladder dysfunction ( 1,2,3 ) . application of this simple instrument has been evaluated in other studies ( 1 - 5 ) . the items of the questionnaire were first used by the international reflux study in children ( 1 ) and then were modified by farhat and akbal ( 2,3 ) . a 24 -month follow up of children with vesicourteral reflux ( vur ) showed that the final score dropped significantly and it was associated with improvement of vur ( 4 ) . this scoring system has been suggested as a tool for follow up of response to treatment . the aim of this study was to evaluate the validity of persian translated version of the plutss . between march 2008 and march 2011 , 197 children ( 141 female and 56 male ) aged 5 - 15 years with history of voiding symptoms for at least three months , enuresis , urinary tract infection , and 33 healthy children ( 12 female and 21 male ) were entered into the study after taking consent from the parents . the study was approved by ethical committee of iran university of medical sciences ( iums ) and followed by the institution s review board for human subjects guidelines . it was performed in accordance with the ethical standards laid down in the 1964 declaration of helsinki and revised in tokyo 2008 . inclusion criteria were the history of recurrent urinary tract infection , enuresis or incontinency , and age of more than five years . children with neurogenic bladder or history of pelvic and urogenital surgery were excluded from the study . recurrent urinary tract infections ( uti ) were defined as the history of at least two episodes of upper urinary tract infection or more than two episodes of lower urinary tract infection ( 6 ) . enuresis was defined as bedwetting in the absence of day time incontinence ( 7 ) . control group was selected from those who brought to the general outpatient clinic for routine check up and they had no history of renal disease , uti or incontinency . questionnaires :
plutss ( 2 - 4 ) is a standard questionnaire contains 14 items about wetting episodes , urinary frequency , voiding pattern , and one question about quality of life . plutss was translated to persian language by a persian speaking pediatric nephrologist who was familiar with medical terms and english language . the translated version was read by two epidemiologist and community medicine specialist and then re - checked with its original english scoring system and the accuracy of translation was approved . in order to confirm that the translated phrases can be understood , the questionnaire was distributed among twenty families form different levels of education and socio - economic background . the questionnaire was filled - out twice in two separate days , once by a physician and then by a parent . then the questionnaire was filled out for the second time with one week apart for twenty - four children . evaluation of feasibility was assessed by answer rate , and missing / non - unique response rate . to assess test - retest reliability , 24 families filled out the questionnaire twice at an interval of one week . for evaluating the validity of discrimination between subjects , we used five groups of children with history of uti ( single and recurrent ) , enuresis , voiding dysfunction , and healthy children ( 8) . a ziemens sonoline g40 sonography system was used for all patients with two 7.5 - 10 mhz linear and 5 mhz convex probes ( 9 - 11 ) . a conventional kidney bladder sonography was performed in all children in order to rule out any urological abnormalities . statistical analysis :
considering type one error of 0.05 , power of 0.8 , number of items equal to14 , cronbach s alpha required equal to 0.5 , testing null hypothesis against alpha of 0 , delta of 2 , sample size was estimated 40 in each group . intra - class correlation coefficients were calculated to analysis test - retest analysis reliability ( 11 ) . chi - square and odd ratio ( or ) was used for 2x2 tables , and likelihood ratios for any row by any column table . a total of 197 children ( 62 recurrent uti , 49 single uti , 33 voiding dysfunctions , and 53 enuresis ) who came to the outpatient clinic were enrolled in the study , and 33 age and sex - matched healthy children who were brought to the clinic for routine check - up were selected as controls . from 228 filled - out plutss questionnaires by parents , six questionnaires were not returned by the parents and were excluded . we found that the questions related to incontinency were misunderstood by parents of children with diurnal enuresis . awake to questions number 1 and 2 and sleep to questions number 3 and 4 . for children with enuresis , some iranian parents awake the child during the night and take him / her to the toilet . for this reason , we added this item to the question number 4 and scored it as the soaked sheet . regarding voiding frequency , some parents said that it was depend on the intake of fluid ; so we added the word in average . cross leg and asked for more explanation ; therefore , we changed the word to the holding pee or use pressure to hold pee . to the question number 13 about the everyday defecation we added the term of hard stool and painful defecation as well . the mean scores were 6.8 ( 5.4sd ) in voiding dysfunction , 14.4(5sd ) in enuresis , 10.5 ( 7.8sd ) in ruti , 8.9(6sd ) in suti , and 1.9 ( 1.8 ) in controls ( one - way anova ; p<0.001 ) . q= question ; ruti= recurrent urinary tract infection , suti= single urinary tract infection
cronbach s alpha for the 14 items of questionnaire was 0.74 . the mean plutss for the first round was 9.66 ( 7.3 ) and the second round was 10.66 ( 7.4 ) ( p>0.05 ) . the intraclass coefficient correlation for assessing test - retest reliability of the plutss was 0.82 ( p<0.001 ) . : 89.5 - 97.6 ) , and negative predictive value of 95.6 ( 95% c.i . : 91.1 - 100 ) for cut - point of five by receiver operative characteristic curve for discrimination between cases and controls ( fig . auc= area under the curve , scc= spearman s rho correlation coefficient , roc curve analysis of whole of cases . farhat et al validated it for discriminating normal children from those with voiding dysfunction and found cut point of 6 for girls and 9 for boys ( 2 ) . it has been used as an instrument for predicting the improvement of vesicoureteral reflux ( 5 ) . mota et al used this questionnaire as an instrument for screening voiding dysfunction in brazilian population and found 20 - 22% of children suffered of enuresis or voiding dysfunction while half of them sought medical consult ( 13 ) . dogan et al used plutss as a non - invasive tool for screening asymptomatic children in primary school . using cut point of less than nine , they found ninety percent had normal plutss . comparing to uroflowmetry and bladder wall thickness they found higher sensitivity and specificity for plutss ( 14 ) . another questionnaire has been suggested for dysfunctional elimination syndrome contained 15 items ( 15 ) . we evaluated the persian translated version of plutss among children with voiding symptoms and healthy children ( 9 - 11 ) . the filled - out questionnaires revealed that some items regarding daytime incontinence and enuresis needed to be more clarified because the patients with daytime enuresis without incontinency responded positively to the first two questions . additionally , the children with holding maneuver could not respond to the translated question regarding cross leg correctly . roc curve showed high area under the curve for discrimination of normal children from those with voiding symptoms . the optimum cut point for iranian children , both girls and boys , were five that was a little lower than those suggested by farhat earlier ( 2 ) . it was interesting that many normal children did not evacuate bowel everyday but it did not mean constipation ; even though some children with elimination syndrome evacuate bowel everyday but had hard stool with painful defecation . therefore , the question number 12 regarding the bowel movement had low auc ( 0.55 ) .
despite that akbal et al suggested voiding frequency of less or more than 7 time per day , we found a higher auc(0.62 ) by grouping the cases to less than 4 , 5 to 7 , and higher than seven times per day ( 3 ) . the concepts of straining and feeling pain during voiding were two other questions that some parents respond with uncertainty ; therefore , it seems more reasonable to ask children to fill - out the questionnaire by the assistance of their parents . there is still no consensus regarding which questionnaire to be used for as a screening tool for evaluation of symptoms and to monitor the response to therapy . in our country , other studies in order to evaluate validity of the questionnaire in larger population and different cultures are recommended . persian translated plutss has a proper validity and reliability as an instrument for screening children with urinary tract symptoms but some questions need to be changed in some way in order to be understood in our language . | background pediatric lower urinary tract scoring system ( plutss ) is a questionnaire contains items for assessmentof wetting episodes , voiding frequency and pattern .
it is used for screening and evaluation of the responseof children with lower urinary tract symptoms to therapy .
we studied the validity and reliability of persiantranslated version of this questionnaire among iranian children.methods one hundred and ninety - seven children aged 5 - 15 years with urinary tract infection , voiding dysfunction , enuresis were enrolled in this study .
thirty - three healthy age - matched children without urinary complaintwere considered as controls .
plutss questionnaire was filled out for all children .
sonography was performedto rule out urogenital abnormalities .
internal consistency , test - retest reliability , and validity of the questionnairewere assessed using cronbach s alpha , intra - class correlation coefficient , and anova test respectively.roc curve was used to define cut - point and its validity in discrimination between groups .
p - value < 0.05was considered significant.results the means for plutss items were 6.8 ( 5.4 ) for voiding dysfunction , 14.4(5 ) for enuresis,10.5(7.8 ) for recurrent and 8.9(6 ) for single urinary tract infection , and 1.9(1.8 ) for controls ( p<0.001).cronbach s alpha for the 14 items of questionnaire was 0.74 . the intraclass coefficient correlation for assessingtest - retest reliability was 0.82 ( p<0.001 ) .
roc curve showed cut point of 5 for differing case from controls withsensitivity of 97.0 and specificity of 74.9(p<0.001).conclusions persian translated plutss has a proper validity and reliability as an instrument for screeningchildren with urinary tract symptoms but some questions need to be changed in some way to be understandableby our culture . |
immune checkpoint inhibition with the anti - ctla-4 antibody ipilimumab or the pd-1 antibodies pembrolizumab and nivolumab has become a valuable and effective treatment in metastatic melanoma . all substances have demonstrated significant and durable tumor responses with significant prolonged progress - free and overall survival . side effects of a therapy with ipilimumab are mainly related to the mode of action of the drug resulting in activation of the immune system against autoantigens . immune - mediated adverse events have been reported in 10 - 15% of the patients and primarily manifest as skin rash , diarrhea and colitis , hepatitis and endocrinopathies . however , side effects , particularly endocrinopathies are often difficult to diagnose in early stages because of their lack of specific symptoms . we present the case of a 34-year old female patient with metastatic malignant melanoma undergoing treatment with the anti - ctla-4 antibody ipilimumab . six days after the third infusion , the patient reported a persistent headache since 2 d. she interpreted this symptom as a symptom of premenstrual syndrome as she was waiting for her menstrual period and had already experienced similar headaches . laboratory testing was inconspicuous and showed normal values for routine parameters and for thyroid - stimulating hormone ( tsh ) . a prescription for ibuprofen ( administered 2 times daily in a dosage of 400 mg ) was given which helped to manage the pain at first . two days later , as the headache did not subside , the patient was examined again . she then presented a light periorbital swelling and was examined from a neurologist and an ophthalmologist who both could not find any cause for the symptoms . a ct scan of the head and brain , a cerebrospinal fluid puncture and a measurement of the intraocular pressure were performed and did not show any abnormalities . pain medication was adapted and the patient left with the requirement to contact us if the headache would get worse . almost a week later , the patient was emergently seen . laboratory results showed thyroid malfunction and a mri scan of the brain confirmed the diagnosis of hypophysitis ( fig . 1 ) . in addition , a cellulitis of the periorbital subcutaneous fat tissue was observed ( fig . 1 ) . the patient was treated with dexamethasone in a dosage of 4 mg every 6 hours . one day later , the symptoms and swelling declined almost completely , but vitiligo began to develop on the face of the patient . a mri scan of the brain performed 2 d later showed a decrease of inflammation in the periorbital region whereas the signs of hypophysitis had improved only slighly . the vitiligo continued to spread over the next weeks and finally involved more than half of the body surface area . a tumor staging showed progressive disease and treatment with the anti - pd1 antibody nivolumab was initiated . figure 1.gadolinium-enhanced t1-weighted mr images of the brain show increased contrast uptake ( red arrows ) and enlargement of the right lateral orbital region and pituitary gland on the day of diagnosis ( a ) and 2 d after the beginning of high dose steroid therapy ( b ) . table 1.course of disease from diagnosis of the primary tumor in 08/2006 until death of the patient due to metastatic disease . 08/2006excision of primary melanoma ( amelanotic , tumor thickness > 1,7 mm , clark level iv ) right thigh09/2006sentinel lymph node biopsy and lymph node dissection right groin ( 2/8 nodes positive)10/2006 - 08/2007adjuvant therapy with interferon- ( high - dose)2008first pregnancy03/2009birth of a healthy baby girl02/2015second pregnancy , detection of intraabdominal lymph node metastases during ultrasound examination at 19 week of gestation03/2015surgical resection of lymph node metastases ( r2)histological examination of tumor tissue : melanoma metastasis . mutation analysis of tumor tissue : wildtype for braf , nras and c - kit03/2015termination of pregnancy04/2015surgical resection of abdominal lymph node metastases ( r2)04/2015 - 06/2015therapy with ipilimumab ( 3 cycles ) , termination due to side effects07/2015 - 09/2015therapy with nivolumab ( 3 cycles ) , termination due to progression of disease10/2015tumordebulking of abdominal metastases12/2015progressive disease with development of multiple brain metastases and pulmonary metastases12/2015whole brain radiation ( 36 gy)02/2016death of the patient due to further tumor progression
gadolinium - enhanced t1-weighted mr images of the brain show increased contrast uptake ( red arrows ) and enlargement of the right lateral orbital region and pituitary gland on the day of diagnosis ( a ) and 2 d after the beginning of high dose steroid therapy ( b ) . course of disease from diagnosis of the primary tumor in 08/2006 until death of the patient due to metastatic disease . the onset of these side - effects is often difficult to recognize because of the lack of specific symptoms . in the case presented here , the diagnosis of headache as a sign of hypophysitis was blurred because the patient was waiting for her menstrual period and had already experienced similar headaches as signs of a premenstrual syndrome . other symptoms suspicious for hypophysitis such as nausea or fever were not present at first . furthermore , laboratory testing initially did not show any abnormalities such as disbalanced thyroid hormones . as the periorbital swelling occurred , the clinical presentation mimed a slight case of angioedema . it must remain unclear if the swelling should be interpreted as an independent event of immune - mediated infiltration and inflammation or if it represents a per continuitatem effect due to the inflammation of the pituitary gland . the former scenario seems to be more likely as there are more than 10 similar cases published in the literature so far reporting that ipilimumab therapy may induce orbital myositis and orbital inflammation . in our patient , application of corticosteroids was performed delayed , because brain mri scans had been inconspicuous first . we therefore recommend that every patient should be sensitized to report any symptoms that develop during or after treatment with immunostimulating drugs and that mri of the head and brain should be performed immediately in every patient who presents with an unusual headache . to our knowledge this is the first case in which this combination of common und uncommon immune - mediated adverse reactions occurred in the same patient . whether autoimmunity in patients with melanoma undergoing immunotherapies with i.e. interferon- , interleukin-2 , ipilimumab , nivolumab or pembrolizumab is associated with increased response rates and prolonged survival is still discussed controversially . there are reports that the development of leukoderma or vitiligo was associated with a better prognosis . and that immune - related adverse events such as vitiligo and autoimmune thyreoiditis were associated with responses to ipilimumab , at the cost of considerable toxicity . however , there are other studies that report that development of autoimmune diseases whether they were tumor - associated or drug - induced was not associated with a better prognosis . this regrettably applies to our patient who showed no tumor response , neither under ipiliumab nor under nivolumab treatment . | abstractipilimumab is an anti - ctla-4 antibody that is approved for the treatment of metastatic malignant melanoma .
side - effects are mostly immune - mediated and in many cases the lack of specific symptoms leads to delayed diagnosis and treatment of adverse events .
we present the case of a female patient who experienced an uncommon combination of adverse reactions while undergoing therapy with ipilimumab and where the absence of specificity of the symptoms led to late diagnosis and treatment of side effects .
autoimmune disease was neither associated with tumor response nor with prolonged survival . |
decision - making strategies for optimal treatment of recurrent ovarian cancer ( roc ) are complex as new cytotoxic drugs and an increasing number of biological agents become available . this presents challenges in defining the optimal timing and sequencing of the drugs or treatment regimen . a controversial issue of roc treatment concerns the lack of an os advantage observed with a number of investigational compounds and regimens , and they can be often associated with increased toxicity and no improvements in patients ' qol . therefore , current treatment options for patients with roc are frequently guided by safety considerations and convenience . a sub - analysis of the ova-301 study showed that for platinum - sensitive patients ( pfi > 6 months ) , median progression - free survival was 9.2 months with the trabectedin + pld combination vs 7.5 months with pld monotherapy ( hazard ratio , 0.73 ; 95% ci , 0.56 to 0.95 ; p=0.0170 ) . in fact , the median overall survival in the patient subgroup with a platinum - free interval in excess of 12 months ( considered to have very ps disease ) was 36.5 months with the combination , which was in the range of that obtained with platinum combinations . although therapeutic regimens that combine platinum - based therapy with other cytotoxic agents are the current standard of care for advanced ovarian cancer patients , the cumulative toxicities of cisplatin and carboplatin can present barriers for the long - term use of these agents [ 2 , 3 ] . as previously discussed , there are women with relapsing disease ( particularly the pps subgroup ) who would benefit from a delay in platinum retreatment to possibly enhance their response to platinum in a future application , or who are not ideal candidates for platinum - based therapy due to the toxicity profile of platinum or due to platinum - induced toxicity . there appear to be three main limitations to using carboplatin combinations , including allergy to carboplatin ( hypersensitivity ) , renal toxicity , and ototoxicity . hypersensitivity reactions ( hsrs ) to carboplatin are a particular concern , and have been reported in approximately 15 - 20% of women . symptoms of carboplatin hsrs are highly variable and can be mistakenly attributed to other agents , particularly when they are used in combination . they include itching , rash , chest tightness , emesis , blood pressure changes and facial swelling . the onset of the carboplatin - associated hsr is also highly variable , occurring either as soon as the infusion starts or after it is completed . when expectations for a positive outcome with platinum are good , then desensitisation protocols may be useful to continue platinum - based therapy , and success rates in excess of 50% have been reported . however , for example a 12-step desensitization protocol that administers the total dosage of carboplatin at increasing doses and faster rates over an extended period of time , requires adequate support in an intensive care unit or allergy department . all with the attendant burden on staffing and resources , and of course patient preference [ 1 , 2 ] . other clinically significant sequelae such as neurotoxicity , severe cumulative myelosuppression , renal toxicity and ototoxicity are commonly caused by platinum - based chemotherapy . indeed neurotoxicity , which influences patient 's quality of life , is a dose - limiting adverse effect for all platinum compounds , and there is a high probability of persistent neurotoxicity including residual neuropathy ( ~20% of oc patients ) associated with carboplatin plus paclitaxel treatment . carboplatin causes dose - limiting and cumulative myelosuppression , characterised by frequent and severe thrombocytopenia , granulocytopenia and anaemia . likewise , cisplatin is associated with several cumulative and irreversible toxicities , including dose - dependent renal tubule toxicity and neurotoxicity . cumulative doxorubicin and paclitaxel exposure must also be monitored to minimize the risk of patient morbidity due to cardiotoxicity and neuropathy . gemcitabine has many overlapping toxicities with other agents , and care must be taken with combination regimens to avoid synergy of these adverse effects . toxicity issues should be carefully taken into account before considering platinum re - treatment , as the platinum - associated cumulative and irreversible toxicities may jeopardise its long - term intervention on subsequent relapses . consideration of platinum - induced cumulative toxicity takes on greater significance as the number of salvage regimens increase , as it can be given only to those patients for whom the toxicities would be acceptable . this underscores the need for alternative therapeutic options , including an efficacious non - platinum regimen with an acceptable toxicity profile . other factors that influence treatment decisions in this heavily - treated patient population have to be taken into account . for example , efficacy ( clinical or symptom benefit ) , safety ( specifically limitations with carboplatin due to hypersensitivity or residual toxicities ) and qol need to be considered . this could include health - related qol , patient - reported outcomes regarding symptoms , and time without symptoms or toxicity . for example , although temporary in nature , alopecia is a visible reminder of cancer treatment and is extremely upsetting for many women . a recent pan - european survey into the qol of 1743 patients with ovarian cancer by oskay - ozcelik et al . reported that alopecia was the single most troublesome side effect , with 42% patients reporting being bothered by alopecia . furthermore , there is now an increasing body of evidence which shows that extending the platinum - free interval in relapsing patients with partially platinum sensitive ovarian cancer , also improves their response rate to platinum re - treatment at a later time point . clinical evidence from ova-301 shows that the toxicity related to the trabectedin + pld combination was acceptable . the most common adverse events with the trabectedin + pld combination were neutropenia and transient increased transaminase levels ( box 1 and table 1 ) . the results show that neutropenia followed a predictable pattern of rapid onset and reversibility and , similarly , transaminase increases appear early after administration ( during treatment cycles one and two ) , then generally decrease in incidence and severity with subsequent treatment cycles ( fig . 1 ) . hence the clinician can assess the impact of the combination therapy on the patient from the first 2 cycles . the impact of the trabectedin + pld combination was also assessed on patients ' qol via qlq - c30 , a standardised qol instrument developed by the eortc to assess the quality of life of cancer patients . results from ova-301 showed no difference in patients ' qol between the 2 study arms ( fig . during the course of their illness , patients with ovarian cancer may undergo multiple cycles of treatment , with alternating multiple episodes of remission and relapse . therefore roc patients are treated over a continuum in which therapeutic choices and strategies may impact the efficacy and safety of future therapies . platinum rechallenge in combination or monotherapy regimes are often limited by hypersensitivity reactions and cumulative long - term toxicities , regardless of the regimen . desensitisation protocols may be useful so as to allow treatment to continue , albeit with significant burden on staffing and resources and with varying outcomes . the safety data from ova-301 show that trabectedin + pld can be considered as a treatment option at any relapse of ovarian cancer , including fully platinum - sensitive patients unsuited to receive subsequent platinum , with a manageable safety profile and equivalent efficacy . therefore , trabectedin + pld is a non - platinum alternative that is well tolerated . furthermore , increasing evidence indicates that by extending the platinum - free interval with effective non - platinum agents such as trabectedin + pld , patients are given some extra time to recover from any of the adverse effects of their prior platinum - based therapy with no detriment in qol ; and with even potential induction of their response to any subsequent platinum application , hence preserving their future treatment options . professor fotopoulou received speaker fees from pharmamar for her participation at the bgcs 2014 symposium . | most patients with recurrent ovarian cancer ( roc ) undergo a series of remissions and recurrences , therefore the additive or cumulative toxicity of chemotherapy must be factored into their treatment plan .
there are challenges in defining tailored therapeutic approaches , including optimal timing and drug sequencing management strategies to treat patients with roc .
this is particularly relevant as new cytotoxic drugs and biological agents become available .
many of these drugs are associated with increased toxicity and with no observable survival advantage .
therefore current treatment options for the heavily - pretreated relapsing oc patient population are frequently guided by safety considerations and convenience .
rechallenge with platinum - based combination regimes is commonly limited by the risk of cumulative long - term toxicities .
not all patients can continue with platinum at second - line or , indeed , further relapses due to loss of activity or toxicity - related issues including hypersensitivity , neurotoxicity , alopecia and ototoxicity
. in particular , hypersensitivity reactions are a concern and have been reported in approximately 15 - 20% of women receiving the drug .
trabectedin + pld is a non - platinum combination that is well tolerated , with a manageable safety profile , which is independent of age . |
mantle cell lymphoma ( mcl ) is a rare type of b - cell lymphoma that represents 3%-10% of all non - hodgkin 's lymphoma subtypes . most frequently , the skin lesions are accompanied by systemic symptoms , but several cases have been described with only cutaneous lesions without systemic involvement . skin lesions may evolve before the clinical symptoms of internal organ lymphoma appear , representing the first sign of the disease . due to the variability of its presentation that includes nonspecific papules that appear benign herein we present two cases of the less common blastoid variant of mcl , one with aberrant expression of bcl2 and bcl6 involving the skin , highlighting the aggressive course that this disease may have , despite an inconspicuous clinical presentation . a 77-year - old man presented for routine skin exam and was noted to have slightly elevated pink papules on both his cheeks [ figure 1 ] . the differential diagnoses included acneiform papules , but because these arose on sun - damaged skin , a biopsy for suspected basal cell carcinoma was performed . a shave biopsy after revealed a dense nodular and diffuse infiltrate of atypical medium - sized lymphocytes [ figure 2a and b ] . cd5 stained a few reactive t cells , but the tumor cells were negative [ figure 3 ] . cd23 , cd10 , tdt , and cd21 immunohistochemical stains and in situ hybridization for epstein the diagnosis of blastoid variant of mcl , aberrant type was established and a workup for systemic lymphoma was recommended . the patient declined the offer of chemotherapy and died of lymphoma one year after the diagnosis was established . multiple pink papules and sun - damaged skin of the right cheek ( a ) dense diffuse lymphocytic infiltrate with a grenz zone . hematoxylin and eosin ( h and e ) stained sections , 40 ; ( b ) monomorphic medium - sized atypical lymphocytes , with blast - like nuclei . h and e stained sections , 400 immunohistochemical profile of the mantle cell lymphoma , case 1 100 a 76-year - old woman with an 8-year history of systemic mcl presented with the multiple indurated papules on the abdomen and thighs . a punch biopsy showed a diffuse lymphocytic infiltrate in the dermis [ figure 4 ] . the atypical lymphocytes expressed cyclin d-1 , cd5 , cd45 , cd79a , pax5 , and cd20 [ figure 5 ] . no expression of tia1 , cd138 , cd123 , cd56 , cd21 , eber , cd10 , cd23 , and tdt was seen . ( b ) atypical medium - sized to large lymphocytes with multiple mitotic figures , h and e stained sections , 600 immunohistochemical profile of the mantle cell lymphoma , case 2 . a 77-year - old man presented for routine skin exam and was noted to have slightly elevated pink papules on both his cheeks [ figure 1 ] . the differential diagnoses included acneiform papules , but because these arose on sun - damaged skin , a biopsy for suspected basal cell carcinoma was performed . a shave biopsy after revealed a dense nodular and diffuse infiltrate of atypical medium - sized lymphocytes [ figure 2a and b ] . cd5 stained a few reactive t cells , but the tumor cells were negative [ figure 3 ] . cd23 , cd10 , tdt , and cd21 immunohistochemical stains and in situ hybridization for epstein the diagnosis of blastoid variant of mcl , aberrant type was established and a workup for systemic lymphoma was recommended . the patient declined the offer of chemotherapy and died of lymphoma one year after the diagnosis was established . multiple pink papules and sun - damaged skin of the right cheek ( a ) dense diffuse lymphocytic infiltrate with a grenz zone . hematoxylin and eosin ( h and e ) stained sections , 40 ; ( b ) monomorphic medium - sized atypical lymphocytes , with blast - like nuclei . h and e stained sections , 400 immunohistochemical profile of the mantle cell lymphoma , case 1 100 a 76-year - old woman with an 8-year history of systemic mcl presented with the multiple indurated papules on the abdomen and thighs . a punch biopsy showed a diffuse lymphocytic infiltrate in the dermis [ figure 4 ] . the atypical lymphocytes expressed cyclin d-1 , cd5 , cd45 , cd79a , pax5 , and cd20 [ figure 5 ] . no expression of tia1 , cd138 , cd123 , cd56 , cd21 , eber , cd10 , cd23 , and tdt was seen . ( b ) atypical medium - sized to large lymphocytes with multiple mitotic figures , h and e stained sections , 600 immunohistochemical profile of the mantle cell lymphoma , case 2 . skin involvement in mcl is seen predominantly in the elderly , with a median age of 65 years and a male to female ratio of 2.3:1 . cutaneous involvement is rare in mcl and usually presents in the late stages of the disease . it usually indicates a poor prognostic sign , with death due to disease in the majority of patients 12 years after the cutaneous presentation . skin lesions usually present as nodules or plaques , but the clinical picture may be diverse . such presentations , as well as the acneiform lesions present in our first patient may delay the diagnosis due to low suspicion for a biopsy . in many cases and as in our first patient , skin lesions are the first visible signs of the disease . after the diagnosis is established in the skin , a thorough workup of the patient uncovers systemic involvement in the majority of cases . several cases with isolated cutaneous involvement were reported and thought to have a more benign course , although the period of observation in the reported articles did not exceed three years . this presentation should be differentiated from lymphoma with similar features , such as cutaneous involvement by chronic lymphocytic leukemia / small cell lymphoma ( cll / sll ) . mcl has characteristic immunophenotypic and molecular genetic features that allow a diagnosis to be made in most cases . the infiltrate usually consists of small b cells ( cd19 , cd20 , and cd22 ) , co - expressing cd5 and cd43 , and in most cases lacking cd23 and cd10 . typically , cd23 is positive in cll / sll and sometimes in follicle center lymphoma , and cd10 positivity is seen in follicle center lymphoma , helping to differentiate these from classic mcl . other b cell markers , such as cd79a seen in case 1 , will also be positive . expression of cd5 , although characteristic , is seen only in 85% cases of systemic mcl . the most important immunohistochemical marker required in the evaluation of mcl is cyclin - d1 . the overexpression of the prad / cyclind1 gene is the result of a chromosomal translocation t(11;14)(q13;q32 ) , a classic feature in this subtype of non - hodgkin 's lymphoma . expression of cyclin d1 positivity by immunohistochemistry correlates with higher mitotic index and worse prognosis . blastoid mcl , a rare cytomorphologic variant of mcl , that is characterized by sheets of monotonous , medium - sized cells , with irregular nuclei , scant cytoplasm , and a high mitotic rate , has a more aggressive clinical course . two cytomorphologic subtypes of blastoid mcl include classic type , which is characterized by medium - sized blast - like nuclei with dispersed chromatin , and a large cell and pleomorphic variant with variable nucleoli , similar to cells of large b - cell lymphoma . a combination of both blastoid changes and classic - type mcl may be seen . cll / sll and mcl are usually both cd5 positive , but cll / sll is cd23+/cyclin - d1 , whereas mcl is cd23/cyclin - d1 + . however , cd23 cll / sll and cd23 + mcl may occur , requiring cyclin d1 to confirm mcl . moreover , co - expression of cd10 and bcl-6 , as seen in case 1 , is more typical of follicle center lymphoma , but has been reported in skin manifestations of mcl . the prognostic significance of aberrant expression in cutaneous mcl is unknown , but such cases , especially the pleomorphic blastoid variant , should be distinguished from diffuse large b - cell lymphoma , leg type ( dlbcllt ) , which rarely may express cyclin - d1 . these tumors are also very aggressive , but present with an immunophenotype that is bcl2+/mum-1 + , foxp1+/igm+ and usually bcl6 negative or weak . sox11 was recently found to be helpful in differentiating dlbcl with cyclin d1 expression and mcl . these two cases present additional examples of blastoid mcl in the skin , and highlight clinical and immunophenotypic features that may make the diagnosis challenging . more investigations and larger patient case series are needed to study the clinical and immunohistopathological features of cutaneous mcl , to determine the significance of aberrant immunophenotypic staining . a thorough workup is essential if the patient has no known history of lymphoma , followed by long - term observation for signs of systemic disease in cases of presumed primary cutaneous mcl , because appearance of the systemic involvement may be delayed . | mantle cell lymphoma ( mcl ) is a form of non - hodgkin lymphoma that rarely affects skin .
cutaneous involvement is non - specific but usually indicates widespread disease .
herein we present two cases of mcl with secondary skin involvement .
one case presented as an acneiform eruption on the face and had aberrant expression of bcl-2 and bcl-6 with weak cd5 expression .
the second presented with multiple tumors on the abdomen and thighs . in both cases expression of cyclin - d1 by the tumor cells
was seen .
both patients died shortly after the diagnosis was established . |
on april 13 , 2000 , the pennsylvania state department of health notified the centers for disease control and prevention ( cdc ) of an increase in salmonella
enterica subspecies enterica serotype typhimurium . active surveillance for salmonella group b and serotype typhimurium was initiated , and health officials in maryland , delaware , new jersey , and new york were notified . isolates were sent to public health laboratories for confirmation and serotyping and to new jersey and cdc for antimicrobial susceptibility testing by mic with broth microdilution and molecular subtyping by pulsed - field gel electrophoresis ( pfge ) and phage typing ( 4,5 ) . to identify and compare isolates from cows during the time of the outbreak , we contacted personnel at the salmonella reference center at the university of pennsylvania . stool samples from 93 persons yielded s. typhimurium ( 76 in pennsylvania and 17 in new jersey ) . the median age of patients was 9 years ( range 3 months88 years ) , and 51 ( 55% ) were male . of the 44 isolates , 26 were pattern a , 1 pattern b , 5 pattern c , 7 pattern d , and 1 each for pattern e , f , g , h , and i. the three dominant patterns ( a , c , and d ) formed a complex of highly related strains ( 1 band difference , 1 band shift , or both ) . we defined the 38 isolates with patterns a , c , and d as outbreak - related strains . the outbreak - related strains were unique when compared to the other 3,469 s. typhimurium pfge patterns in the pulsenet database ( cdc , atlanta , ga ) . of the 16 isolates tested for antimicrobial resistance , 12 ( 7a , 1b , 1c , 3d ) were resistant to ampicillin , kanamycin , streptomycin , sulfamethoxazole , and tetracycline ( akssut ) , 3 ( 1a , 2c ) were akssu , and 1 ( a ) was assu resistant . two of the three s. typhimurium isolates obtained from dairy cows during the same time period were also outbreak - related strains . dates of illness onset among persons with salmonella enterica subspecies enterica serotype typhimurium infection , pennsylvania and new jersey , march - april , 2000 we conducted 11 interviews with patients who had recent onset of disease ; during these interviews , infection through milk consumption became a leading hypothesis . in the case - control study , a case was defined as an outbreak - related isolate of s. typhimurium in a resident of pennsylvania or new jersey with illness onset between march 1 and april 21 . if more than one person in a household met the case definition , we interviewed the person with earliest onset . two controls per case were selected by random digit dialing and matched to patients by area code and three - digit telephone prefix and age group . using a questionnaire administered over the telephone we interviewed 23 ( 61% ) of the 38 eligible case - patients and 37 controls ; they did not differ with respect to age or sex ( median age 5 years vs. 5 years , p = 0.8 ; percent male : 70% vs. 54% , p = 0.2 ) twenty - two ( 96% ) patients reported diarrhea , 17 ( 74% ) bloody diarrhea , 20 ( 87% ) abdominal cramping , 16 ( 70% ) fever , and 8 ( 35% ) vomiting . in addition , 6 patients ( 26% ) were hospitalized , and 9 ( 39% ) were treated with antimicrobial drugs ( amoxicillin [ 2 patients ] , ciprofloxacin [ 2 patients ] , sulfamethoxazole [ 1 patient ] , unknown agent [ 4 patients ] ) . ill persons were 22 times more likely to drink milk from dairy plant x than controls ( 20 of 23 patients vs. 13 of 37 controls , matched odds ratio = 23 , 95% confidence interval = 2.7 to 184.5 ) . odds of infection increased with drinking larger amounts of milk from dairy plant x ( p = 0.0008 ) . other risk factors , including handing reptiles or consuming chicken , undercooked eggs , sprouts , or unpasteurized milk or juice were not associated with illness . although philadelphia patients were excluded from the case - control study for logistic reasons , seven were residents or employees of an independent living facility where more than 80% of the milk received was from dairy plant x. during the last 2 weeks of april , state and federal agencies visited dairy plant x. the plant purchased raw milk from over 59 different farms . finished product was distributed in seven counties in eastern pennsylvania as well as to delaware and new jersey . dairy plant x was regularly inspected every 3 months by the pennsylvania department of agriculture . the most recent inspection before the outbreak was in january 2000 ; no problems were reported . according to our review of time and temperature pasteurization charts , pasteurization was adequate during the time of the outbreak . our review of in - house microbial testing results from january 3 and april 17 identified 13 instances where the standard plate count was elevated and 9 instances where coliforms were elevated . the highest standard plate count was 120,000/ml on april 4 , and the highest total coliform count was reported as > 100/ml on april 14 and 17 ; both occurred in skim milk . according to the pasteurized milk ordinance , the standard plate count should not exceed 20,000/ml , and the coliform count should not exceed 10/ml . inspectors from the food and drug administration ( fda ) found violations of sanitary standards that could have resulted in contamination of products after pasteurization . in addition , several machines leaked raw milk onto the floor , and raw skim milk was held in a silo at > 10c ( standard : 7.2c ) . sixty - six milk samples with production dates from april 3 to 20 were collected and tested by the pennsylvania department of agriculture . all 172 finished milk samples collected in may and july were negative for salmonella and had < 1 g / ml phosphatase , indicating all were adequately pasteurized . a review of records at dairy plant x identified 14 employees who were absent between march 20 and april 20 . three ( 21% ) had a gastrointestinal illness with onset march 20 , march 26 , and one unknown ; a stool sample from one yielded the outbreak - related strain of s. typhimurium . all reported drinking finished products produced at the plant in the 5 days before their illness onset . we describe a large , multistate outbreak of multidrug resistant s. typhimurium infections linked to pasteurized milk . salmonella likely contaminated the containers or milk contact surfaces after pasteurization because of environmental conditions in the plant , likely originating in salmonella - contaminated raw milk . two dairy cow isolates of s. typhimurium obtained during the outbreak period were outbreak - related strains , which suggests that these strains were circulating in pennsylvania dairy herds . although federal agencies asked for access to the farms that provided the milk to the plant , these farms were not identified , which prevented further preplant investigation . s. typhimurium resistance type akssut that caused this outbreak appears to be emerging and raises similar concerns to those that surround s. typhimurium definitive type 104 ( dt104 ) ( 6 ) . antimicrobial drugs are commonly used to treat persons with salmonellosis and can be life saving in severe infections . antimicrobial resistance can limit treatment options , can contribute to treatment failure , and is associated with increased deaths ( 7 ) . we reviewed the published literature and identified 12 outbreaks in the united states between 1960 and 2000 that were associated with pasteurized milk ( table ) . of the 12 outbreaks , seven were caused by contamination after pasteurization , and five were caused by salmonella . although published reports are relatively rare , outbreaks may not be recognized for several reasons . milk is an extremely common exposure , which makes reporting exposure to milk likely , obscuring an association . typhimurium is one of the most common serotypes of salmonella , which make detecting outbreaks more difficult in the absence of subtyping . several factors may enhance detection of pasteurized milk - associated outbreaks : a very focal illness event , illness caused by an unusual strain , a method for subtyping surveillance strains , heavy contamination of the product , and a local brand of milk . the outbreak we report led to immediate changes in dairy plant x. the plant hired an outside consultant and addressed fda s immediate concerns . in addition , the pennsylvania department of agriculture began to integrate plant employee training with routine inspections . and finally , as routine inspection regimens did not prevent the outbreak , the findings from this investigation prompted fda to move up its scheduled review of the state milk regulatory program . although the results of this review are not available to federal authorities or the public , pennsylvania s milk control program now satisfies all of the fda criteria for certification . current milk standards are designed largely to safeguard against a failure or breakdown in the process of pasteurization . our review of milk - borne outbreaks suggests that inadequate pasteurization is a relatively uncommon event compared to contamination after pasteurization . additional regulatory emphasis on post pasteurization monitoring , such as coliform and standard plate count , may be needed for adequate protection . | an outbreak of multidrug - resistant salmonella
enterica serotype typhimurium infections occurred in pennsylvania and new jersey . a case - control study implicated pasteurized milk from a dairy , and
an inspection indicated the potential for contamination after pasteurization .
dairy cattle are the likely reservoir , and milk may be an important vehicle of salmonella transmission to humans . |
gastrointestinal cancers remain the most common and important cancer worldwide 1 . early diagnosis of gastrointestinal cancers will lead to improvement in clinical outcomes and survival . for early gastrointestinal cancers with minimal risk of lymph node metastasis , endoscopic resection with the technique of endoscopic submucosal dissection ( esd ) achieved a high rate of en bloc resection . retrospective cohort studies showed that esd reduced the rate of local recurrence when compared to endoscopic mucosal resection ( emr ) 3
4 . despite the advantages in oncological clearance , esd is technically challenging . a study on the learning curve for esd showed that the en bloc resection rate increased from 45 % to 85 % after the first 40 cases , while the perforation rate decreased after the initial 20 cases 5 . we conducted a study of the preclinical training for experienced endoscopists to perform esd in a porcine model 6 . despite their vast experience in esophagogastroduodenoscopy ( egd ) , colonoscopy , and endoscopic retrograde cholangiopancreatoscopy ( ercp ) , the development of master and slave transluminal endoscopic robot ( master ) aimed to improve the performance of complex endoluminal procedures by mounting two robotic arms onto an ordinary double channel endoscope 7 . a multicenter prospective cohort study had confirmed the feasibility and safety in performing esd using master to treat early gastric cancer in five patients 8 . the current study aimed to investigate the enhancement of proficiency in performing esd using master through a comparison of esd experts , esd non - experts , and novices in an ex vivo porcine stomach model . this is a prospective preclinical study investigating the effects of use of a prototype robotic endoscope on the proficiency of performing esd in an ex vivo porcine stomach model . three groups of participants were invited to perform esd using the master and slave transluminal endoscopic robot ( master ) . the first group consisted of esd expert endoscopists who had performed more than 100 cases of esd . the second group consisted of esd non - expert endoscopists with vast experience in performing esophagogastroduodenoscopy ( egd ) , colonoscopy as well as endoscopic retrograde cholangiopancreatoscopy ( ercp ) . they either had experience with less than 10 cases of esd or had never performed the procedure . all of the procedures were performed using the master endoscopic robot which was held by a single endoscopist ( kyh ) experienced in handling the master robot ( fig . 1 ) . in order to standardize the size of the lesion for the trial , we created a standard 20 mm circular cardboard disc which was then used to create standard 20 mm circular lesions with diathermy markings ( erbe 300 d , erbe , germany ) in an ex vivo porcine stomach . after submucosal injection of normal saline mixed with indigo carmine , a circumferential mucosal incision was made using an it2 knife ( olympus co ltd , japan ) ( fig . 1 ) . all participants completed the esd procedure using the master robot ( fig . 2 ) . the steps for performance of esd were standardized as : 1 . submucosal dissection using the left arm with the diathermy hook ; and 4 . repeating the procedure until complete dissection of the gastric lesion had been achieved .
setting for conduction of the preclinical ex vivo porcine stomach esd using the master robotic endoscope . b standardized gastric lesions for performing esd using the robotic endoscopic platform .
external view demonstrating submucosal dissection using the master robotic endoscope . b endoscopic view showing lifting of mucosa and submucosal dissection using the master robotic endoscope . each of the participants performed three esd procedures , and all procedures were video - recorded and timed . the outcomes included the time for first successful grasp of the mucosa , time to achieve adequate elevation and exposure of the submucosa , time for performance of submucosal dissection , and total time for the procedure . this study was approved by national university of singapore institutional animal care and use committee ( iacuc protocol no : 024/12 ) . the analysis of continuous data was performed using the student 's t test , while the categorical data were analyzed with the chi - squared test . a total of nine participants completed the esd procedures for resection of the standardized 20 mm lesion using the master endoscopic robot . the non - clinician novice group consisted of three engineers focusing on material design and development without experience in performing endoscopy . table 1 illustrates that the endoscopists in the esd expert group were more experienced and had performed many more endoscopic procedures than the esd non - expert group of endoscopists . esd expert group consisted of one surgeon and two gastroenterologists ; esd non - expert group consisted of two surgeons and one gastroenterologist ; novice group consisted of engineers without experience in performing endoscopy . all participants were able to complete the esd procedures and there were no perforations during the procedure . when the operative times were compared between the three groups , there was no difference in the time for first grasping of mucosa , time to expose the submucosa , time for submucosal dissection , and total time for the procedure ( fig . there was a trend towards longer operative time for the non - clinician novice to complete the submucosal dissection though the difference was not statistically significant . the average operative time for master esd was 121.7 57.7 s for the esd expert group , 202.7 149.5 s for the esd non - expert group , and 561.0 495.6 s for the novice group ( p = 0.242 ) ( fig . 4 ) . when all the clinicians were grouped to compare with the non - clinicians , we found that there was a trend towards a longer total dissection time ( p = 0.085 ; 95 % ci = 70.8 to 868.5 ) and submucosal dissection time ( p = 0.078 ; 95 % ci = 48.5 to 705.8 ) for the non - clinician group as compared to clinician group , however these differences were not significant . comparison of the operative time ( s ) for master esd among esd experts , non - experts , and novice study groups . comparison of the operative time ( s ) for master esd between endoscopist and non - endoscopist study groups . colorectal , gastric , and esophageal cancers ranked the second , fourth , and fifth most common cancers in asia 9 . the majority of gastrointestinal cancers are diagnosed at late stage with grave prognosis despite major surgery and oncological therapies . on the other hand , early stage gastrointestinal cancers carry excellent prognosis with 5-year survival of over 85 % if treated appropriately 10 . intramucosal early gastrointestinal cancers can be treated by endoscopic resection with adequate oncological clearance due to minimal risk of lymph node metastasis 11 . esd has emerged as a safe and effective method of endoscopic resection with a high rate of en bloc resection . a european series reported 82 cases of epithelial or submucosal lesions treated with esd 12 . the en bloc resection rate was 77.1 % , while the local recurrence was 0 % after r0 resection compared to 38.5 % after piecemeal resection . although the procedural time per specimen size was significantly shorter in the second half of the study , the authors commented that esd was difficult , time consuming , and required a prolonged learning curve . one of the reasons for the difficulties in esd is the lack of appropriate endoscopic instruments and platform for performing the dissection . unlike minimally invasive surgery where surgeons performed dissection using two instruments under the laparoscope in a triangulation manner , esd is performed in a single handed manner with the instrument co - axially aligned with the endoscope . the advantages of the da vinci robotic surgical system was clearly demonstrated in performing complex surgical tasks within a confined space during radical prostatectomy 13 . the development of the master aimed to improved surgical dissection within the gastrointestinal lumen through a flexible endoscopic platform mounted with two robotic arms 7
14 . the current study employed the first generation of master robotic endoscope which has two robotic arms , one with a dissection hook and the other with a forceps attached to an ordinary dual channel endoscope . our results demonstrate that the techniques and outcomes of esd can be standardized using the master . standardization of esd technique using devices such as the master raises hope for a large number of endoscopists worldwide to practice esd , who may find the procedure to be technically challenging , requiring prolonged procedural times , and associated with a high complication rate . it is well known that this can be very long especially in centers with a small case load and few experts . in our study , the non - clinician group with no experience in endoscopy managed to grasp the concept of esd and complete the procedure within 20 min . this may suggest that devices such as the master can significantly shorten the learning curve for esd . the procedure for esd was greatly enhanced by using the two end effectors for dissection , one of the aims being to attain adequate exposure of the submucosal plane with the other aim being safe dissection . as participants in the novice group were engineers with no previous experience in performing endoscopy or esd , robotic technology is one of the methods used to overcome inadequate experience and learning curve . this is important evidence to demonstrate that flexible robotic technologies will enhance the performance of complex dissection within the gastrointestinal lumen . the model employed was an ex vivo porcine stomach , hence bleeding during esd could not be simulated . moreover , the size of the lesion was small , which might not be representative of a true gastric esd , especially from the viewpoint of risk of perforation . the number of participants and the number of master esd procedures performed were limited . as it was an ex vivo model study this led to the need for twisting and torque of the endoscope to facilitate dissection . , we have demonstrated that the procedure for esd and its outcomes can be standardized and enhanced using the master robot , and produced comparable results between esd experts and non - experts . we also demonstrated that master enabled novices to learn and perform simple esd procedures to acceptable standards after a short training period . | background and study aims : one of the challenges in performing endoscopic submucosal dissection ( esd ) is the lack of counter traction during submucosal dissection .
master ( master and slave transluminal endoscopic robot ) was designed to allow performance of complex endoluminal procedures using two arms with excellent control .
this study aimed to compare the performance of esd between endoscopists and novices using master .
methods : this is a prospective study comparing the differences in performing esd using master in an ex vivo porcine stomach model among individuals with or without experience in surgery and endoscopy
. multiple standardized lesions of 20 mm2 were pre - marked on an ex vivo porcine stomach .
each participant received basic training in controlling master before the esd procedure . the operative time and size of specimen obtained by each participant were noted .
results : nine individuals ( three esd expert endoscopists , three esd non - expert endoscopists , and three non - clinician novices ) participated in the experiment .
all participants completed the esd procedure for en bloc resection of standardized lesions using endomaster without perforation .
the mean times ( mean sd ) taken by esd expert endoscopists , esd non - expert endoscopists , and novices to complete robotic esd were 122 58 s , 203 150 s , and 561 496 s , respectively .
there was no statistically significant difference in the mean operative time to complete the esd between the three groups ( p = 0.242 ) . when the performance of the six endoscopists was compared to that of the three novices
, the endoscopists took an average of 162 111 s to complete the esd , while the non - clinicians required an average of 561 496 s ( p = 0.085 ) .
conclusions : there was a trend to shorter operative time when comparing endoscopists to non - endoscopists in performing esd using master .
the use of master enabled the novice without endoscopy experience to complete the esd procedure . |
a 30-year - old woman was referred to our clinic for evaluation of an intraocular mass lesion in her right eye . her best corrected visual acuity was 30/50 in the right eye and 20/20 in the left eye . although the anterior segment showed no pathologic findings , including the absence of an afferent pupillary defect , ophthalmoscopy revealed a 311 cm - sized nonpigmented choroidal mass with subretinal fluid in the superonasal quadrant of the fundus , extending from the equator to the ora serrata ( fig . the mass showed relatively medium internal reflectivity and contained a cystic portion on ultrasonography ( fig . 1 ) . magnetic resonance imaging ( mri ) showed high signal intensity in t1-weighted images with enhancement and low signal intensity in t2-weighted images ( fig . 1 ) . a pet ( 18-fdg ) whole body scan was performed to rule out a metastatic lesion ; the scan showed no remarkable fdg uptake . we subsequently decided to perform a fine needle aspiration biopsy of the lesion with a 25 g pars plana vitrectomy . approximately 20% of cytological biopsy results can be errorneous due to inadequate selection of the aspiration site ; therefore , we did not exclusively rule out choroidal melanoma . however , because of several atypical characteristics , including the presence of cystic portions and amelanotic nonpigmented lesions , and the relatively infrequent occurrence of malignant melanoma in korea , our differential diagnosis contained benign masses such as schwannomas and leiomyomas . although the patient 's central vision was only mildly affected , the extent of subretinal fluid could have eventually involved the macula . we decided to surgically excise the lesion to obtain a definitive diagnosis and to prevent further visual deterioration . the gross specimen was approximately 311 cm in size and contained a cystic portion ( fig . interrupted sutures were places at the scleral flaps and cryotherapy was performed at the margins of excision . light microscopy revealed that the tumor was composed of spindle cells with bland palisading nuclei in an antoni a pattern . intraocular schwannomas are very rare , benign , peripheral nerve neoplasms that usually appear as solitary , amelanotic lesions of the ciliary body or choroid . although schwannomas are cytologically benign , they may progressively enlarge at a rate similar to or greater than that of choroidal melanomas.1 ophthalmoscopic , mri , and ultrasonographic findings are not helpful in differentiating schwannomas from uveal melanomas.2 in two reported cases of anterior uveal schwannomas , the tumors were noted to transilluminate brightly.3,4 this may be a helpful clinical finding because it is unusual for anterior uveal melanomas to transilluminate in this way . most previously reported schwannoma cases have been diagnosed after enucleations performed because of the possibility of malignant melanoma.5,6 in some reported cases , early diagnosis was made using anterior chamber biopsy techniques for ciliary body masses.7 other cases have utilized local block excision of ciliary body tumors to confirm the diagnosis of a schwannoma.8 however , it is not known if this can always be done to confirm the presence of a schwannoma . as was illustrated in our case , it is difficult to differentiate between an amelanotic melanoma , metastatic carcinoma , a choroidal schwannoma , or a medulloepithelioma using ancillary techniques . immunohistochemical staining techniques were not utilized in this case . when clinical features exist that are not typical of melanoma , such as the presence of cystic components or amelanotic nonpigmented lesions ( amelanotic melanoma is very rare in korea ) , we recommend performing an aspiration biopsy or even surgical excision to first rule out the presence of a benign neoplasm before performing enucleation . | schwannomas rarely present as intraocular tumors and are often misdiagnosed as malignant melanoma .
we describe a choroidal schwannoma confirmed by sclerouvectomy.a 30-year - old woman presented with a large nonpigmented intraocular mass of the choroid in the right eye and underwent surgical excision by sclerouvectomy .
histologically , the tumor was composed of a mixture of cellular solid components ( antoni a ) and loose myxoid components ( antoni b ) .
the tumor was eventually diagnosed as a schwannoma .
currently available ancillary studies are still of little value in definitively differentiating schwannomas from other choroidal tumors . in the case of atypical findings for a malignant melanoma , a benign neoplasm
should be included in the differential diagnosis .
this patient avoided enucleation by first having the mass excised .
we are unaware of previous reports in which a choroidal schwannoma was diagnosed by surgical excision . |
schwannomas are infrequent tumors originating from the neural crest cells and usually interpreted as slow - growing benign nerve sheath tumors [ 1 , 2 ] . visceral sites of this tumor include the gastrointestinal tract , liver , pancreas , kidney , brain , heart and retroperitoneum . retroperitoneal schwannomas account for only 13% of all schwannomas and for only 1% of all retroperitoneal tumors . the literature reports schwannomas detected using computed tomography ( ct ) and magnetic resonance imaging ( mri ) , but we could not find any case of schwannoma detected using positron emission tomography ( pet)-ct imaging . herein , we report a case of large adrenal schwannoma which was diagnosed incidentally and review the cases previously reported in an attempt to clarify the inconsistent features of this rare disease . a 32-year - old female presented with new onset of intermittent right flank pain . during examination , a left adrenal mass was found incidentally on abdominal ultrasonography and she was referred to our institution for additional evaluation . her medical and family histories were unremarkable . on physical examination the abdomen was soft , blood pressure was 130/85 mm hg and pulse rate was 72 beats / min ; sinus rhythm was normal . a heterogeneously enhancing soft tissue mass on the medial aspect of the left adrenal gland measuring 65 95 mm was visualized and no additional mesenteric or retroperitoneal lymphadenopathy was identified on the abdominal ct scans . as the mass was approximately 10 cm in size , [ f ] fluorodeoxyglucose ( fdg ) pet - ct was also performed . it showed intense uptake within the left adrenal nodule with a standardized uptake value ( suvmax ) of 9.5 , indicative of malignancy ( fig . 1 ) . endocrinological examinations including serum electrolytes , cortisol , urinary metanephrine , normetanephrine , adrenalin , noradrenalin and vanillyl mandelic acid , as well as plasma renin and aldosterone were within normal range . also , a dexamethasone suppression test showed values within the normal range at onset and at 30 min . due to the large size of the tumor , standard transperitoneal adrenalectomy postoperative pathological evaluation revealed schwannoma in the adrenal gland , a hard , well - circumscribed , encapsulated mass 4 8 10 cm in overall dimensions that was grossly compressing the adrenal parenchyma . histologically , the tumor consisted of spindle cells with alternating areas of compact hypercellularity with irregular streams and without atypia or mitosis . immunohistochemical analysis demonstrated rare ki67-positive cells ( < 5% ) while sma , desmin , cd34 and cd117 staining was negative in tumor cells . in contrast to these results , s-100 and vimentin staining were diffusely positive across the tumor . thus , the evidences corresponded to a benign adrenal schwannoma type antoni a ( fig . schwannomas are slow - growing benign nerve sheath tumors whose principal components originate from crest cells , the vestibulocochlear nerve being the most frequent site [ 1 , 4 ] . they are most often found within the head , the neck as well as the upper and lower extremities , and with a lesser frequency on the trunk , in the gastrointestinal tract , liver , pancreas , kidney , brain , heart and retroperitoneum . these rare tumors account for only 15% of retroperitoneal masses and comprise only 13% of all schwannomas [ 6 , 7 , 8 ] . these tumors are usually characterized by a benign course , are encapsulated and vary from firm solitary masses to fluctuant cysts . schwannomas were initially described by verocay in 1908 ; after this description antoni had performed histological subclassification into two patterns . histologically , these tumors consist of compact hypercellularity with irregular streams ( antoni type a ) and loose hypocellularity with cystic spaces ( antoni type b ) . investigators believe that schwann cells of nerve fibers innervating the medulla are the source of these adrenal lesions [ 11 , 12 , 13 ] . functional adrenocortical tumors can be easily revealed by characteristic hormone - related symptoms , blood chemistry or urinary tests . however , non - functional adrenocortical tumors present no characteristic lesions . due to their non - secreting and asymptomatic properties , adrenal schwannomas are often diagnosed incidentally . moreover , increasing medical examination health screening and advances in imaging modalities give rise to an increased incidental detection of retroperitoneal tumors . ct scan shows a well - circumscribed , homogeneous , round - oval mass with cystic degeneration or calcification . mri findings are usually non - specific , but helpful in the differential diagnosis of solid non - functional tumors . solid tumors with a low signal intensity on t1wi and heterogeneously high intensity on t2wi are revealed on mri . fdg pet has previously been suggested as valuable in discriminating benign from malignant adrenal masses . the concept of fdg pet is based on an increased glucose uptake by malignant lesions . the quantitative analysis of fdg uptake is performed using standardized suvs or by qualitative visual evaluation with respect to liver uptake . the sensitivity of fdg - pet in identifying malignant lesions varied between 93 and 100% with a specificity between 80 and 100% [ 16 , 17 , 18 , 19 , 20 ] . the sensitivity of fdg pet imaging is only moderate , however , for the diagnosis of small lesions , and false - positive results have to be considered . in our case , the huge size of the tumor and the location and also the characteristics of the lesion on imaging were strongly suspicious of a malignant adrenal neoplasm . whereas some of the characteristics of retroperitoneal schwannomas , including heterogeneity and degeneration , may mimic malignancy on radiological interpretation , a preoperative diagnosis of adrenal schwannoma is almost impossible and usually should be confirmed by histopathological examination as seen in our patient . it should not be forgotten that the malignant form is frequently associated with von recklinghausen disease and neurofibromatosis . in consequence of significant risks , fine needle aspiration should be performed only in patients with a history of carcinoma or suspected metastasis . furthermore , physicians should consider the possibility of local recurrence and malignant formation in benign schwannomas despite a prior benign diagnosis . a non - secreting adrenal mass larger than 4 cm should be removed surgically with the added benefit of a definitive diagnosis . in cases of huge tumors as our case , the conventional approach can be preferred to laparoscopic resection . histologically , neoplastic cells that simulate the appearance of differentiated schwann cells organized as cellular areas with nuclear palisading ( antoni a ) and loose , hypocellular , myxoid lesions with microcystic spaces ( antoni b ) are seen . in our case the specimen consisted of spindle cells with alternating areas of compact hypercellularity with irregular streams and without atypia or mitosis . immunohistochemically , these lesions stain positively for s-100 antigen , vimentin , collagen iv and laminin and negatively for keratin , desmin , actin , cd34 and cd117 [ 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 23 ] . fine et al . demonstrated that a positive stain for calretinin , the same protein family as s-100 , which expressed for schwannoma but not for neurofibroma , can be used for the discrimination of these two diseases . we report the case of an incidentally discovered schwannoma difficult to diagnose in preoperative evaluation . because of the lack of definitive non - histological diagnostic modalities in this rare tumor , surgical excision can provide the benefit of a definitive diagnosis . | adrenal schwannoma is an extremely uncommon cause of incidentaloma .
it originates from neural sheath schwann cells of the adrenal gland .
we report the case of a left adrenal schwannoma incidentally discovered in a 32-year - old woman during examination of bloated feeling and stomach ache .
the patient was incidentally found to have a left adrenal mass of 9 cm on abdominal ultrasonography .
computed tomography ( ct ) of the abdomen and [ 18f ] fluorodeoxyglucose positron emission tomography ( pet ) were also performed .
metabolic evaluation was unremarkable .
due to the large size of the tumor , left adrenalectomy was performed .
the postoperative course was uneventful .
histological examination established the diagnosis of schwannoma .
this diagnosis was supported by immunohistochemistry of s-100 and vimentin positivity . in conclusion ,
adrenal schwannoma is an extremely rare entity and can grow considerably in size .
the present case report emphasizes that clinicians should be aware of the possibility of retroperitoneal schwannoma .
total excision of benign schwannoma is associated with a favorable outcome . to our knowledge , there are case reports of schwannoma with ct and magnetic resonance imaging findings in the literature , although this is the first schwannoma case with pet - ct imaging . |
follow - up series of the copeland shoulder resurfacing arthroplasty have reported few postoperative fractures around the prosthesis . with advancing population age we report three cases of periprosthetic fracture around a copeland resurfacing arthroplasty and subsequent management with an anatomic or reverse total shoulder replacement . in 2013 , three patients presented to our hospital with periprosthetic fractures around a copeland surface - replacement hemiarthroplasty . the fractures occurred around the stem of the prosthesis and in all cases the mechanism was a simple fall onto the affected shoulder . , there was significant comminution of the greater tuberosity and also an ipsilateral intra - articular fracture of the distal humerus [ figures 13 ] . demographics and outcomes of the cases ( tsr = anatomic shoulder arthroplasty , rsr = reverse shoulder arthroplasty ) patient 1 ( a ) preoperatively and ( b ) postoperatively patient 2 ( a ) preoperatively and ( b ) postoperatively patient 3 ( a ) preoperatively and ( b ) postoperatively in all cases , the initial decision was made to manage these injuries nonoperatively . in two patients at follow - up , there was further evidence of prosthetic loosening , and in one patient , tuberosity comminution with displacement . as a result , in all cases , it was deemed that open reduction and internal fixation would have unfavorable results . patients 1 and 2 underwent revision to anatomic shoulder replacement ( epoca , depuy synthes , leeds , uk ) while patient 3 had a reverse polarity shoulder arthroplasty and a total elbow replacement at the same sitting . all patients had undergone a previous deltopectoral approach to the shoulder , and the same approach was used at revision surgery . the copeland implant was found to be loose in two cases and easily removed in the third case . in patients 1 and 2 , a metal - backed glenoid was used and an uncemented humeral stem ( epoca , depuy synthes , leeds , uk ) . in patient 3 , who underwent a reverse shoulder replacement , the humeral stem was cemented ( delta international ltd . , leeds , england , uk ) . in all cases , the tuberosities were repaired using fiber wire ( arthrex , fl , usa ) or cerclage cable . we were conscious of the need for the commencement of tuberosity healing before allowing a full active range of movement . for the first 2 weeks we allowed pendulum movements . at 2 weeks , we allowed full passive and active - assisted movements . at 6 weeks , we allowed a full range of active movement as tolerated . the two patients who were revised to an anatomic total shoulder replacement reported their shoulder to be better than prior to their periprosthetic fracture with the copeland hemiarthroplasty in - situ . the most recent modification of the oxford score was used , which uses a score of 0 - 48 with 48 being the best outcome . demographics and functional outcome of the patients are shown in table 1 . all postoperative radiographs were satisfactory , with the prosthesis well - seated and no signs of loosening . all patients had a minimum range of abduction and forward flexion of 150 with a minimum range of internal and external rotation of 40. before the introduction of the humeral surface - replacement , several problems had been identified with stemmed designs . loosening could lead to significant osteolysis on the humeral side , making revision difficult or impossible . there was an increased risk of fracture using stemmed designs both on insertion and due to the increased stress riser postoperatively . the prosthesis was designed to reconstruct natural anatomy , minimize bone loss , and preserve the tuberosities and rotator cuff in contrast to previous shoulder arthroplasty designs . in more recent years , due to the risk of glenoid loosening from polyethylene wear , many surgeons when performing copeland resurfacing , prefer to resurface the humeral head only and perform multiple drilling of the glenoid , using microfracture technique , to encourage secondary fibrocartilage . we do not , however , know of any proven evidence that this technique works or is of benefit in shoulder resurfacing . designer series report encouraging results with the prosthesis for osteoarthritis , rheumatoid arthritis , and avascular necrosis at medium - term . more recently , independent series have also shown a low rate of revision and good functional outcome . all the original copeland resurfacings in our series had been implanted in other departments , and we were unable to objectively assess function prior to fracture . it is encouraging , however , that two out of three patients reported their shoulders to be better than the pre injury state . we could not find any literature reporting the outcome of revision of copeland resurfacings for periprosthetic fracture . we believe that undisplaced fractures in this scenario should have a trial of conservative management , as long as the implant is not loose . however , late displacement or a loose prosthesis warrants operative intervention . we acknowledge that these are only early clinical results . in our practice , through rehabilitation , we would expect continued improvement throughout the 1 year to 18 months following revision arthroplasty . we plan to follow this cohort up to report medium - term results in the future . satisfactory overall , and in fact better than her pre injury state . the copeland surface replacement arthroplasty has been one of the most common shoulder replacements used in the uk since it was introduced over 20 years ago . periprosthetic fractures around these implants will potentially become an increasing problem with an aging population . revision of these periprosthetic fractures to an anatomic total or reverse shoulder arthroplasty is an option that can produce good results as indicated by our small number of cases . | follow - up series of the copeland resurfacing hemiarthroplasty have reported few postoperative fractures around the prosthesis .
we report three cases of periprosthetic fracture around a copeland resurfacing arthroplasty . due to prosthetic loosening and tuberosity comminution ,
all cases were managed with revision shoulder arthroplasty .
all patients had good functional outcome and range of movement on early follow - up . |
kikuchi fujimoto disease ( kfd ) , or histiocytic necrotizing lymphadenitis , is an infrequent idiopathic disorder.1 it is usually a self - limited condition with a good prognosis because it has a low complication rate.2 it mainly affects young women.3 the most common clinical symptoms are fever and laboratory finding of cervical lymphadenopathy associated with leukopenia.3 cases of kfd associated with autoimmune disorders , such as systemic lupus erythematosus ( sle ) , have been reported.4 herein , we describe a female patient who presented with cervical necrotizing lymphadenitis and febrile syndrome and subsequently met the diagnostic criteria for sle.5 a 27-year - old female patient , without any relevant past medical history , presented to the clinic with a 30-day history of voluminous and tender enlargement of cervical and nuchal lymph nodes . five days after the onset of the symptoms , the patient developed asthenia and fever of 3839c that responded poorly to antipyretics . a week before visiting us , the patient had symmetric arthralgias , mainly of proximal and distal interphalangeal joints of hands and elbows . on physical examination , multiple indurated , fixed , and tender lymphadenopathies were evident in the cervical and nuchal areas . a recent occurrence of an erythematous , indolent node of diameter 5 mm was detected in the right cheek . laboratory test results showed hypochromic normocytic anemia and elevated lactate dehydrogenase , erythrocyte sedimentation rate , glutamic oxaloacetic transaminase , and glutamic pyruvic transaminase . institutional approval by the hospital privado ethics committee and written informed consent from the patient was obtained to report the findings of this case . serology test results for human immunodeficiency virus ( hiv ) , hepatitis b and c , epstein an ultrasonography of the neck revealed bilaterally enlarged submandibular and jugular chain lymph nodes ( the largest was 2 cm in diameter ) , with some showing signs of necrosis . cervical and chest computed tomography scans only showed lymph node enlargements as previously described . an abdominal computed tomography scan evidenced infracentimetric inguinal , intercavoaortic , and left lateroaortic lymph nodes of measuring up to 9 mm in diameter . the histopathological report disclosed more than ninety percent of the lymph node sample showed necrosis with distortion of the normal architecture ; periodic acid the polymerase chain reaction analysis of the biopsy material was negative for histoplasma , aspergillus , mycobacteria , and cytomegalovirus . twelve days after the onset of the symptoms , the patient developed arthritis of the proximal and distal interphalangeal joints of the hands , malar rash , photosensitive erythema in the chest , and painful oral ulcers . the patient then developed generalized erytroderma in the chest , abdomen , and upper and lower limbs , as well as diffuse alopecia . pending autoimmune screen test results were received , which revealed positive antinuclear antibodies ( hep2 ) with a titer of 1:320 and a speckled pattern ; negative anti - double - stranded - dna antibodies ; positive anti - ro antibodies ; and negative anti - la , anti - smith , anti - ribonucleic protein , lupus anticoagulant , and anticardiolipin antibodies . owing to the nonspecific findings of the first lymph node sampling , it was decided to perform a second biopsy guided by ultrasound to select tissue with less necrosis ( figure 1 ) . the histopathological examination of the specimen revealed scarce lymphoid tissue due to extensive geographic necrosis and numerous histiocytes diffusely laid out surrounding the necrotic foci . immunohistochemical panels evidenced residual lymphoid tissue that expressed positive cd20 , cd3 , and bcl-2 . a diagnosis of associated sle was made because the patient presented malar rash , photosensitivity , oral ulcers , alopecia , arthritis , and positive antinuclear antibody ( 2012 systemic lupus international collaborating clinics classification criteria).5 the patient has begun treatment with hydroxychloroquine ( 200 mg / d ) and prednisone ( 20 mg / d ) , with a marked improvement in the symptoms 1 week after the treatment was started and a progressive reduction in the lymphadenopathies until complete resolution after 1 month of treatment initiation . histiocytic necrotizing lymphadenitis was described by kikuchi and fujimoto in 1972.3 it was mainly described in young adults < 40 years of age.6 this disease is more prevalent in asia , but some cases have been reported in other continents also . its etiology is unknown , although the most accepted hypothesis is its viral autoimmune origin.7 three patterns of presentation of this association were found by medline / pubmed search until 2015 : kfd before the onset of sle ( 30% ) , simultaneous occurrence of both disorders ( 47% ) , and kfd after sle ( 23% ) . some cases of familial occurrence of kfd were observed in japan within a short period of time and in a similar setting.8 only one human leukocyte antigen ( hla)-typing study was found.9 also , few reports of kfd proposed the possibility of familial clustering . one of them described two nontwin sisters with hla - identical phenotype who lived contemporarily in the same environment.10 other report showed two nontwin sisters with hla - identical phenotype who developed the disease in different locations and 10 years apart from each other.8 a current publication described the development of kfd in four members of the same family ( three confirmed cases and one possible case ) at different periods of time . its onset may be acute or subacute and may last 2 or 3 weeks.11 no studies have shown if familial cluster of kfd is present when it links with sle . cervical lymphadenopathy , which is usually tender to palpation , is the main clinical feature . other lymph node regions can also be involved.12 the common presenting symptoms are fever , sweating , chills , tender lymph nodes , malaise , weight loss , and cough.1214 the laboratory and radiologic tests available for the diagnosis are nonspecific . the common laboratory abnormalities are leukopenia , usually neutropenia ; anemia ; thrombocytopenia ; elevated c - reactive protein and erythrocyte sedimentation rate ; impaired liver function ; and atypical lymphocytes on peripheral blood smear.7,12 the diagnosis is mainly made by histopathological assessment of the lymph node . clinical and histological differential diagnoses of kfd should take into account the following diseases : non - hodgkin lymphomas and other lymphoid malignancies ; lymphadenopathies associated with connective disorders such as sle , rheumatoid arthritis , and still s disease ; and bacterial or viral infections such as cat scratch disease , infectious mononucleosis , herpes simplex , hiv , toxoplasmosis , tuberculosis , and atypical mycobacterial lymphadenitis.6 because of the clinical and pathological correlation between kfd and sle , some authors have postulated that kfd may be a clinical feature or an incomplete phase of lupus lymphadenitis.1518 however , there are several case reports of kfd without sle,1 which may support the fact that they are two independent entities that may commonly coexist , as it happens with most of the autoimmune diseases in susceptible subjects . in kfd , the most common histologic finding is lymph node showing geographic necrosis with foci of apoptotic cells with abundant karyorrhectic fragments surrounded by histiocytes.6 characteristically , neutrophils and eosinophils are absent.6 only in those cases in which the pathologist notes hematoxyphilic bodies ( clusters of basophilic material within lymph node sinuses ) , dna deposits in the wall of the vessels , or areas of vasculitis surrounding the necrotic foci , he or she would suggest the diagnosis of lupus lymphadenitis and not kfd.2 immunohistochemical analysis has great value and is generally used to exclude hematologic malignancies . cd8 also , positive immunostaining appeared for cd68 and cd4 in histiocytes . from a clinical approach , usually , kfd takes a monophasic and benign course that limits itself in 16 months.1518 however , if it coexists with sle , it can have a more aggressive course and should be treated to prevent sequelae . a long - term follow - up is necessary to monitor for recurrence.19 in addition , there have been reports of death in patients with kfd and sle due to severe infections and development of hemophagocytic syndrome.19 our patient did not have this complication . in our case , a new ultrasonographically guided biopsy was repeated to select the lymph nodes with less necrotic tissue . we propose this strategy to reach a histological diagnosis . in order to do that , the abovementioned ancillary studies were requested and the lymph node biopsy was repeated to ultrasonographically select the lymph nodes with less necrotic tissue to reach a histological diagnosis . kfd is one of the differential diagnoses of cervical necrotizing lymphadenitis , and when it is present , it would be wise to suspect , during its clinical course , a possible association with other autoimmune conditions , such as sle . | kikuchi fujimoto disease , or histiocytic necrotizing lymphadenitis , is an infrequent idiopathic disorder .
it has been associated with autoimmune disorders , of which systemic lupus erythematosus is the most outstanding .
the basis of its diagnosis relies on the histological examination of lymph nodes , which typically reveals necrosis surrounded by histiocytes with crescentic nucleus , immunoblasts and plasma cells , and absence of neutrophils .
we report the case of a 27-year - old argentinian female patient without any relevant past medical history to demonstrate the correlation between kikuchi fujimoto disease and systemic lupus erythematosus . |
the levonorgestrel intrauterine system ( lng - ius ) , originally developed for long - term contraceptive use , has shown to have a profound effect on the endometrium . the system has been used extensively for the treatment of heavy menstrual bleeding and for the conservative treatment of non - atypical as well as atypical endometrial hyperplasia ( wildemeersch et al . , 2003 , 2007 ; buttini et al . , 2009 ; 2014 ) and even for early endometrial adenocarcinoma ( wildemeersch et al . , 2010 ) . during the years 2001 - 2013 we performed a pilot study on 120 patients with a particular type of lng - ius fibroplant ( apcor research , belgium ) for the conservative management of benign and/or premalignant uterine conditions . part of that study concerned the clinical results of 13 patients where endometrial hyperplasia was found after investigative hysteroscopy and d&c , eleven among them showing atypical hyperplasia / endometrioid intraepithelial neoplasia. benign endometrial polyps were found in another 23 patients ( janssens , 2013 ) . all 36 patients were treated by the insertion of the lng - ius , aiming at preventing recurrence or worsening of the endometrial pathology . informed consent before entering the study had been obtained before receiving the experimental device . patients were regularly followed - up as appropriate , while avoiding hysterectomy as much as possible . in this report , we describe a patient who presented with the patient is a 44-year old premenopausal woman who consulted with heavy menstrual bleeding and dysmenorrhea . pelvic ultrasound revealed a thick irregular endometrium ( maximum thickness 22 mm ) presumably polypoid , in an otherwise normal uterus . the histological diagnosis of the specimen was atypical hyperplasia / endometrioid intraepithelial neoplasia , with architectural atypia grade 3 and cellular atypia grade 1 . informed consent was obtained and a fibroplant lng - ius was inserted and anchored in the uterus in november 2001 . meticulous follow - up was conducted , i. e. including at least a yearly pelvic ultrasound and an endometrial pipelle ( endometrial suctionapparatus ) biopsy . march 2004 new pipelle samples were taken , showing again arrested secretion , areas of indifferent aspect , suggesting complete regression of atypical hyperplasia . pelvic ultrasound prior to the biopsy showed a normal uterus with a quasi - atrophic aspect of the endometrium , endometrial thickness less than 3 mm and a correctly positioned lng - ius . colordoppler flow study of the uterine artery showed a ri ( resistance index ) of 0.77 , as seen normally in the postmenopausal period . eight months later our patient was referred to a tertiary centre for extensive ultrasound investigation , which confirmed our findings . in september 2006 , a new d&c was performed . hysteroscopy revealed only a discrete irregular aspect at the posterior wall of the uterine cavity . the fibroplant lng - ius was still correctly anchored in the uterine fundus , and easily removed with simple traction . endometrial sample showing glandular complexity with stratification , loss of polarity , more eosinophilic cytoplasm , nuclear enlargement and atypia ( h&e 100 ) . a new fibroplant lng - ius was inserted in october 2006 . in september 2009 , histological examination showed important decidual transformation , probably hormonally induced and the lng - ius was replaced for the second time . a last endometrial sample was taken in october 2010 , showing chronic non - specific endometritis. from 2011 until now the patient was followed regularly , showing an atrophic uterus with a lng - ius inside . the woman is in amenorrhea since about 10 years and apparently very happy with this treatment and follow - up schedule . atypical endometrial hyperplasia , also called adenocarcinoma in situ , is a well - known precursor of overt endometrial carcinoma . a rate of 45.9% of endometrial carcinoma was found in hysterectomy specimen in women with this particular subtype of endometrial hyperplasia ( pennant et al . , 2008 ) . as was experienced in the observational study we conducted , meta - analysis on the oncogenic potential of polyps reveals a malignancy rate between 0.8 and 8% ( lee et al . , 2010 ) . in a recently published prospective belgian study of 1220 pre- , peri- and postmenopausal women with abnormal uterine bleeding atypical hyperplasia was found in one single patient , i.e. 0.1 % of the total cohort studied , belonging to the post - menopausal group of 454 women ( van den bosch et al . , 2015 ) . endometrial hyperplasia without atypia was found in 48 patients , about 40 times more frequently . in this perspective , the pre - menopausal patient with atypical endometrial hyperplasia we presented seems a rather exceptional case . conservative treatment of atypical endometrial hyperplasia with lng - ius can be considered in selected cases , such as in women who wish to preserve their fertility . however , conservative treatment carries an inherent oncologic risk as no correct staging is possible and the risk of missing a concurrent ovarian cancer can not be neglected . therefore , patients opting for conservative treatment should have a strict gynaecological follow - up with regular endometrial biopsy and pelvic ultrasound . endometrial hyperplasia has been treated before in other centres with lng - ius . in an australian systematic review a 96% regression rate for nonatypical endometrial hyperplasia treated with lngius was found ( buttini et al . , there was ( also only ) one patient with atypical endometrial hyperplasia , treated with a lng - ius for more than seven weeks . the patient had normal endometrial histology on subsequent assessment . in a korean study ( lee et al . , 2010 ) complete regression of endometrial hyperplasia was achieved in all 12 cases . in the ( also single ) case of atypical hyperplasia , the regression was attained at the 9th month after insertion of the lng - ius . a norwegian research group found lng - ius to be effective at reducing the occurrence of
hyperplastic endometrial polyps , with effectiveness superior to that of oral progestin and observationonly ( arnes et al . , 2014 ) . furthermore , in the first prospective comparative trial of its kind conducted by the same group , a study was performed to examine the results of the treatment of 170 patients with endometrial hyperplasia which were treated either by an oral progestogen or by lng - ius : all 53 women treated with an lng - ius showed histologically normal endometrium after 6 months of therapy ( rbo et al . , 2014 ) . in this study nineteen patients were diagnosed with atypical hyperplasia and six of them were successfully treated with lng - ius . the authors concluded that cyclical progestogens are found to be less effective compared with continuous oral therapy and lng - ius , and should not be used any more for this indication . we present a case of a 44-year old premenopausal woman with a premalignant uterine polyp opting for conservative therapy . today , 14 years after the start of her treatment , the patient is in good health and very happy with this therapeutic option . considering the rather limited value of a case - report the positive experience should encourage further studies , especially since recent literature data indicate that conservative treatment of premalignant endometrial pathology is a real option with high success rate in selected women such as patients who want to preserve their fertility , have contraindications for surgery or refuse hysterectomy | prevention of progression to invasive carcinoma in patients with a premalignant endometrial lesion using longterm treatment with levonorgestrel ( lng ) releasing intrauterine systems ( ius ) remains controversial , especially when manifest cellular atypia has been found in the endometrial biopsy specimen .
we present a case of a 44-year old premenopausal woman with a premalignant uterine polyp who declined hysterectomy and was followed - up for more than 12 years after the first lng - ius was inserted .
endometrial atrophy installed , no pathology was detected and hysterectomy was thereby successfully avoided .
the positive experience in this case should encourage further studies as literature data indicate that conservative treatment of premalignant endometrial pathology is a real option with a high success rate for women who have a contra - indication for surgery , refuse the classical approach for personal reasons or want to preserve their fertility . |
one - lung ventilation ( olv ) is commonly used in thoracic surgeries . by ventilating the contralateral lung and collapsing the ipsilateral lung , olv avoids pollution of the contralateral lung by the excretions and blood from the ipsilateral lung , and provides a clear surgical field vision . however , intraoperative hypoxemia is a common complication of olv [ 15 ] . olv is also an important reason for postoperative acute lung injuries in patients receiving thoracic surgeries [ 610 ] . ventilator - induced lung injury during olv is further supported by the association between tidal volume exceeding 78 ml / kg predicted body weight and the release of systemic and pulmonary inflammatory mediators . various lung - protective strategies have been tried , such as lower tidal volume combined with positive end - expiratory pressure ( peep ) , preconditioning , dexmedetomidine , therapeutic hypercapnia , and protective ventilation modes . in this study , we investigated the lung protective effect of additional ipsilateral ventilation of low tidal volume and high frequency in patients receiving lung lobectomy . a consecutive 60 patients receiving lung lobectomy from october 2012 to may 2014 at our hospital were included in this study . there were 48 males and 12 females with a mean age of 52.9 years ( range , 3950 years ) . patients were excluded from the study if they had smoking history , intraoperative transfusion , olv < 1 hour , operation time > 4 hour , or conversion to total lung resection . patients were randomly assigned into the conventional olv ( cv ) group ( n=30 ) and the ipsilateral ventilation of low tidal volume and high frequency ( lv ) group ( n=30 ) . at 30 min before anesthesia , general anesthesia was induced with intravenous injection of midazolam ( 0.050.1 mg / kg ) , sufentanil ( 0.3 g / kg ) , and vecuronium bromide ( 0.1 mg / kg ) . the patient was intubated with a double - lumen tube ( sheridan , mexico ) connected to a ventilator ( aestiva/5 7900 , ge healthcare , usa ) . the fraction of inspired oxygen ( fio2 ) was 100% with a flow rate of 1.5 l / min . the end - tidal carbon dioxide partial pressure ( petco2 ) tow - lung ventilation was performed using the following parameters , tidal volume 10 ml / kg , ventilation frequency 12 times / min , and inspiratory - to - expiratory time ( i / e ) ratio 1:1.5 . for olv in the cv group , the following parameters were used , tidal volume 8 ml / kg , ventilation frequency 14 times / min , i / e ratio 1:1.5 , and peep 5 cm of water . for olv in the lv group , the contralateral lung ventilation was performed with tidal volume 6 ml / kg , ventilation frequency 12 times / min , and i / e ratio 1:1.5 . meanwhile , the ipsilateral lung was ventilated using the same type of ventilator with tidal volume 12 ml / kg , ventilation frequency 40 times / min , and i / e ratio 1:1.5 . ephedrine 10 mg was administered if the systolic blood pressure dropped below 20% of the baseline value . atropine 0.20.5 mg was administered if the heart rate was less than 50 beats / min . arterial blood samples were collected from the femoral artery before olv ( t0 ) , at 30 min ( t1 ) and 60 min ( t2 ) after the initiation of olv , and after the surgery ( t3 ) . partial pressure of arterial carbon dioxide ( paco2 ) , partial pressure of arterial oxygen ( pao2 ) , and fio2 were measured . normal lung tissues were harvested 5 cm away from the lesions at a mean time of 102.4 min ( range , 73123 min ) . lung injury was assessed using a previously reported score system : 0 point , no pathological changes ; 1 point , mild pathological changes ; 2 points , intermediate pathological changes ; 3 points , severe pathological changes ; 4 points , extremely severe pathological changes . comparison was made using student s t - test or chi - square test when appropriate . all statistical analyses were performed using spss 17.0 ( spss , chicago , il , usa ) . a consecutive 60 patients receiving lung lobectomy from october 2012 to may 2014 at our hospital were included in this study . there were 48 males and 12 females with a mean age of 52.9 years ( range , 3950 years ) . patients were excluded from the study if they had smoking history , intraoperative transfusion , olv < 1 hour , operation time > 4 hour , or conversion to total lung resection . patients were randomly assigned into the conventional olv ( cv ) group ( n=30 ) and the ipsilateral ventilation of low tidal volume and high frequency ( lv ) group ( n=30 ) . at 30 min before anesthesia , general anesthesia was induced with intravenous injection of midazolam ( 0.050.1 mg / kg ) , sufentanil ( 0.3 g / kg ) , and vecuronium bromide ( 0.1 mg / kg ) . the patient was intubated with a double - lumen tube ( sheridan , mexico ) connected to a ventilator ( aestiva/5 7900 , ge healthcare , usa ) . the fraction of inspired oxygen ( fio2 ) was 100% with a flow rate of 1.5 l / min . the end - tidal carbon dioxide partial pressure ( petco2 ) tow - lung ventilation was performed using the following parameters , tidal volume 10 ml / kg , ventilation frequency 12 times / min , and inspiratory - to - expiratory time ( i / e ) ratio 1:1.5 . for olv in the cv group , the following parameters were used , tidal volume 8 ml / kg , ventilation frequency 14 times / min , i / e ratio 1:1.5 , and peep 5 cm of water . for olv in the lv group , the contralateral lung ventilation was performed with tidal volume 6 ml / kg , ventilation frequency 12 times / min , and i / e ratio 1:1.5 . meanwhile , the ipsilateral lung was ventilated using the same type of ventilator with tidal volume 12 ml / kg , ventilation frequency 40 times / min , and i / e ratio 1:1.5 . ephedrine 10 mg was administered if the systolic blood pressure dropped below 20% of the baseline value . atropine 0.20.5 mg was administered if the heart rate was less than 50 beats / min . arterial blood samples were collected from the femoral artery before olv ( t0 ) , at 30 min ( t1 ) and 60 min ( t2 ) after the initiation of olv , and after the surgery ( t3 ) . partial pressure of arterial carbon dioxide ( paco2 ) , partial pressure of arterial oxygen ( pao2 ) , and fio2 were measured . normal lung tissues were harvested 5 cm away from the lesions at a mean time of 102.4 min ( range , 73123 min ) . lung injury was assessed using a previously reported score system : 0 point , no pathological changes ; 1 point , mild pathological changes ; 2 points , intermediate pathological changes ; 3 points , severe pathological changes ; 4 points , extremely severe pathological changes . comparison was made using student s t - test or chi - square test when appropriate . all statistical analyses were performed using spss 17.0 ( spss , chicago , il , usa ) . the cv and lv groups were similar in general information , surgical side , olv time , operation time , intraoperative fluid infusion , and urine volume ( table 1 ) . at time point t0 , the two groups showed no significant difference in ratio of the partial pressure of arterial oxygen to the fraction of inspired oxygen ( pao2/fio2 ) ( p=0.860 , table 2 ) . however , at time points t1 through t3 , patients in the lv group showed significantly higher pao2/fio2 than those in the cv group ( pt1<0.001 , pt2<0.001 , pt3=0.012 ) . the normal lung tissue of the cv group showed significantly more severe pathological changes of interstitial edema , alveolar edema , neutrophil infiltration , and alveolar congestion than the lv group ( figure 1 ) . in addition , the lung injury score was 2.70.7 in the lv group , which was significantly lower than 3.10.7 in the cv group ( p=0.006 ) . it was suggested that patients in the lv group had significantly less severe lung injury than those in the cv group . in this randomized study , we compared the lung protective effects of two ventilation modes in patients receiving lobectomy . in the cv group , patients received only contralateral olv . in the lv group , patients received contralateral ventilation and ipsilateral ventilation of low tidal volume and high frequency . we found that patients in the lv group had significantly higher pao2/fio2 and significantly less severe lung injury than those in the cv group . in our study , the ipsilateral ventilation was started with a tidal volume of 1 ml / kg and gradually increased to 2 ml / kg , with a ventilation frequency of 40 times / min . this technique can minimize the effects on surgical procedures , and in the meanwhile , moderately inflate the collapsed lung and improve ventilation and oxygenation . after the initiation of olv , the pao2 at time points t1 and t2 was lower than that at t0 in both groups . however , the lv group showed significantly lower reduction in pao2 than the cv group ( p<0.001 ) . lower pao2/fio2 indicates more severe lung injury and is a commonly used diagnostic criterion for acute lung injury . we found that at time points t1 through t3 , patients in the lv group showed significantly higher pao2/fio2 than those in the cv group ( pt1<0.001 , pt2<0.001 , pt3=0.012 ) . to exclude any possible disturbing factors , we chose patients without smoking history , and no inhalation anesthetics were used for maintaining anesthesia . the pathological changes of interstitial edema , alveolar edema , neutrophil infiltration , and alveolar congestion were significantly less severe in the lv group than in the cv group . we speculate that the ipsilateral ventilation of low tidal volume might avoid excessive collapse of the alveoli and decrease the surface tension . this may result in reduced sucking effect of the surface tension in the alveoli and less fluid effusion from the capillaries , leading to alleviated lung injury . in addition , the ipsilateral ventilation might help to alleviate lung injury by reducing the release of oxygen radical and attenuating the neutrophil infiltration during restoration of two - lung ventilation [ 12,2022 ] . the use of ipsilateral low tidal volume ventilation and contralateral conventional ventilation can successfully isolate the bilateral lungs in lobectomy . the use of additional ipsilateral ventilation also decreases the risk of hypoxemia and alleviates postoperative lung injury . | backgroundto investigate the protective effects of additional ipsilateral ventilation of low tidal volume and high frequency on lung functions in the patients receiving lobectomy.material/methodssixty patients receiving lung lobectomy were randomized into the conventional one - lung ventilation ( cv ) group ( n=30 ) and the ipsilateral low tidal volume high frequency ventilation ( lv ) group ( n=30 ) . in the cv group
, patients received only contralateral olv . in the lv group , patients received contralateral ventilation and additional ipsilateral ventilation of low tidal volume of 12 ml / kg and high frequency of 40 times / min .
normal lung tissues were biopsied for the analysis of lung injury .
lung injury was scored by evaluating interstitial edema , alveolar edema , neutrophil infiltration , and alveolar congestion.resultsat 30 min and 60 min after the initiation of one - lung ventilation and after surgery , patients in the lv group showed significantly higher ratio of the partial pressure of arterial oxygen to the fraction of inspired oxygen than those in the cv group ( p<0.001 ) .
lung injury was significantly less severe ( 2.70.7 ) in the lv group than in the cv group ( 3.10.7 ) ( p=0.006).conclusionsadditional ipsilateral ventilation of low tidal volume and high frequency can decrease the risk of hypoxemia and alleviate lung injury in patients receiving lobectomy . |
all strategies ( immediate antibiotics , culture , or rapid testing ) will prevent most non - suppurative complications ( acute rheumatic fever ) . given the imperfect sensitivity of both culture and rapid testing , these strategies may fail to prevent a low percentage of acute rheumatic fever cases , but given the low rate of this complication in the united states , acute rheumatic fever risk should not influence our decision making . we know of no evidence that the non - group a streptococci cause non - suppurative complications . preventing suppurative complications is more challenging.18 one could argue that prompt antibiotics ( either with empiric therapy or rapid testing ) will decrease the risk of peritonsillar abscess compared to a 2-day delay in antibiotics experienced from the culture strategy . a recent review of the microbiology of peritonsillar abscess included group a and group c streptococci and anaerobic bacteria.19 most patients with positive cultures ( aspiration of the abscess ) have negative throat swabs.20 empiric antibiotics would likely prevent some suppurative complications above those prevented when treating only rapid test positive patients . f. necrophorum infections can cause lemierre s disease , peritonsillar abscess and persistent sore throat symptoms.2124 while we do not yet know the probability of progression to these complications , certainly empiric antibiotic treatment would likely decrease their incidence . a recent pediatric paper has documented the increasing incidence of f. necrophorum infections ( including lemierre s syndrome ) over a recent 6-year period . the authors speculate that decreased empiric antibiotic use may be contributing to the resurgence of this infection.25 zwart and colleagues showed that immediate penicillin v , given for 7 days , decreased group a streptococcal symptoms in 2.5 days , and non - group a streptococcal symptoms , in 1 day in adult patients.26 previous analyses suggested that antibiotics decrease symptom duration by only 1 day . his study focused on patients at the heart of the controversy : those with pharyngitis scores of 3 or 4 . no previous study of symptom benefit either restricted enrollment to adults or just those patients having severe pharyngitis . as the centor score increases , we suspect that symptom severity also increases . because prompt antibiotics speed recovery from this discomfort , symptom relief may dominate the treatment decision for many patients with severe adult pharyngitis . however , adult patients clearly develop significant pharyngitis because of non - group a beta - hemolytic streptococci , especially from groups c and g.2,2729 randomized trial data also suggest a symptomatic benefit for treating these patients.26 , immediate antibiotics convey an advantage to household contacts ( important to many patients with children ) . because non - group a streptococci can cause epidemic pharyngitis,27 we assume that immediate treatment will decrease communicability of those infections also . immediate treatment does give penicillin to more patients , putting a few additional patients at risk for allergic reactions . penicillin allergic reactions did not have a significant influence on the treatment decision when tested in previous decision and cost - effectiveness models.6,9 we can not quantify the contribution that oral penicillin for severe pharyngitis makes to the antibiotic resistance problem . despite over 50 years of penicillin use as most other bacteria already have penicillin resistance , we consider this risk less significant . linder and colleagues have shown in two articles that the use of broad - spectrum antibiotics for pharyngitis is a major problem.16,17 all experts agree that we should join in correcting these inappropriate antibiotic prescriptions . summarizing the strategy differences in table 2 , we present percentage estimates from zwart s prospective study of adult severe pharyngitis patients . in zwart s study , the prevalence of group a streptococci is 50% and non - group a strep , 25% . the treat all severe pharyngitis patients strategy provides antibiotic prescriptions to all adult patients having group a and non - group a streptococcal pharyngitis . test - and - treat strategy misses 10% of group a streptococcal pharyngitis and all the non - group a pharyngitis . these cases are missed because the rapid antigen test has a sensitivity of approximately 90% for group a streptococci30 and does not test for either group c or group g streptococci . we favor treating all severe pharyngitis to benefit this approximately 30% of severe pharyngitis patients that the testing strategy would omit . our analysis is certainly sensitive to both the prevalence of group a and non - group a streptococci and the sensitivity of the rapid antigen test utilized . although zwart s prevalence estimates are higher than previously reported in the literature , we use these data from the only randomized controlled trial that focused solely on patients with severe pharyngitis .
table 2treatment appropriateness for 300 hypothetical patients ( from fig . 1 ) with severe pharyngitis : test and treat when positive versus treat allpatient number ( % ) pharyngitis etiologyrapid antigen testappropriatenessresultsclassificationtest - and - treat if positivetreat all135 ( 45%)gas+true positiveaa15 ( 5%)gasfalse negativeia75 ( 25%)ngastrue negativeia75 ( 25%)othertrue negativeaigas group a streptococcus , ngas non - group a streptococcus , a appropriate , i inappropriate . 1 ) with severe pharyngitis : test and treat when positive versus treat all gas group a streptococcus , ngas non - group a streptococcus , a appropriate , i inappropriate . our strategy does result in prescribing antibiotics to 25% of the severe pharyngitis patients having no streptococcal infection . adult group a and non - group a streptococcal pharyngitis causes severe , albeit limited , symptoms , which improve more rapidly with narrow spectrum antibiotics . using narrow spectrum antibiotics ( penicillin v or erythromycin for those who are penicillin allergic ) and limiting antibiotics to severe pharyngitis will minimize new antibiotic resistance while affording ill patients a faster recovery . in summary , we believe the differences between the two guidelines result from a difference in the perceived importance of antibiotic over versus under use.10 we do not believe that the acp - asim algorithm - based guideline results in an unacceptably large amount of unnecessary antibiotic use . on the contrary , we accept over treating a minority of adult pharyngitis patients with the most severe presentations in an effort to reduce suffering in an approximate equal number of patients who will be under treated with the test and the problem of antibiotic overuse for sore throat is not a result of the algorithm - based approach outlined in the acp - asim guideline , but instead , reflect poor adherence to the guideline as written.16 furthermore , we believe strict adherence to the idsa guideline will only marginally reduce antibiotic overuse , and quite possibly , increase undue suffering . | despite numerous controlled trials , clinical practice guidelines and cost - effective analyses , controversy persists regarding the appropriate management strategy for adult pharyngitis . in this perspective
, we explore this controversy by comparing two competing clinical guidelines .
although the guidelines appear to make widely diverging recommendations , we show that the controversy centers on only a small proportion of patients : those presenting with severe pharyngitis .
we examine recently published data to illustrate that this seemingly simple problem of strep throat remains a philosophical issue : should we give primacy to relieving acute time - limited symptoms , or should we emphasize the potential societal risk of antibiotic resistance ?
we accept potentially over treating a minority of adult pharyngitis patients with the most severe presentations to reduce suffering in an approximately equal number of patients who will have false negative test results if the test - and - treat strategy were used . |
mammary gland disorders were first described by an ancient surgeon , imhotep , in a papyrus dated to the 17 century bc . the author described 45 cases of this type , with a final conclusion of no cure presented along with the last case in the series . for more than 3000 years , breast cancer was a mysterious , abashing and incurable disease detected at a very advanced stage . it consisted in extensive procedures of dissecting the mammary gland along with pectoral muscles and axillary , supraclavicular , and often also mediastinal lymph nodes . currently , halsted 's radical mastectomy is performed only in cases of infiltration of pectoral muscles and the range of surgical treatment is decided on the basis of tnm disease staging . ultrasonography ( us ) is one of the basic methods used in detection of focal lesions , including breast cancer staging . first examinations employing ultrasonographic techniques were performed in a - mode using instrument probes immersed in water in the 1950s . in the 1960s , holmes , wright , and meyerdirk developed an ultrasound scanner facilitating two - dimensional b - mode imaging with the use of gel as a contact substance between the probe and the examined structures . recent years have witnessed a continuous , dynamic growth in breast and breast pathologies imaging methods [ ultrasonography , ultrasonography and sonoelastography , mammography ( mmg ) , magnetic resonance imaging ( mri ) , including contrast - enhanced imaging and positron emission tomography ( pet ) ] . thanks to the wide accessibility of mmg and us screening , breast cancer is increasingly often detected and successfully treated at earlier stages . a challenge related to the diagnostic imaging of breasts is the increase in the precision of the anatomical assessment of the gland for early detection of subclinical lesions , performance of ultrasound - guided biopsy procedures with subsequent preoperative location of lesions to optimize the surgical treatment . ultrasound imaging is a primary and baseline diagnostic procedure the patient with suspected pathological lesions within breast is referred to by the surgeon . the scan should be performed in compliance with the standards set forth by the polish ultrasound society . the results of ultrasound scans are subsequently correlated with the results of other imaging tests and , above all , with the clinical evaluation . following visualization of pathological lesions in a ultrasound scan , the lesions should be assigned a category according to the bi - rads us classification . according to the classification , category bi - rads us 2 includes focal lesions presenting with features of lesions that are unambiguously benign , requiring no further examinations or biopsy verification ; follow - up ultrasound scan is recommended in 12 months.in this category , surgical consultation may be required by clinically enlarging inflammatory lesions , including complex cysts , abscesses or damages to breast implants ( fig . 1).category bi - rads us 3 includes lesions of a probably benign , with probability of malignancy amounting to < 2% . category bi - rads us 2 includes focal lesions presenting with features of lesions that are unambiguously benign , requiring no further examinations or biopsy verification ; follow - up ultrasound scan is recommended in 12 months . category bi - rads us 3 includes lesions of a probably benign , with probability of malignancy amounting to < 2% . a , b. damaged saline chamber in a patient with a dual - chamber implant lesions classified into this category include fibroadenomas ( the most common solid lesions within the breasts ) , thickwalled cysts , dilated milk ducts with thick contents or small cyst aggregates . lesions classified into this category may be subject to fineneedle aspiration biopsy ( fnab ) , follow - up examination in 6 months , or sonoelastographic examination . results of surgical evaluation taking into account the patient 's age , family history and preferences are decisive for the choice of therapeutic management . they are characterized by high structural diversity as shown in ultrasound scans , reflecting their complex structure , including histopathological structure . according to stavros , only 4050% of fibroadenomas present with features typical of bi - rads us category 3 ; presentation of the remaining ones is considered suspicious , resulting in their being classified as bi - rads us category 4 ( fig . hypoechogenic , oval solid focal lesions with segmentally rough edges ; bi - rads us category 4 . histopathological verification : complex fibroadenomas asymptomatic fibroadenomas , do not become enlarged usually remain monitored and do not require surgical treatment . patients referred to surgical treatment are usually patients with rapidly - growing fibroadenomas or fibroadenomas larger than 45 cm in size , causing pain , presenting with features of atypia , or suspected of malignant growth . the incidence of malignancies in fibroadenomas is very low and accounts for 0.002% to 0.125% of cases . in situ carcinomas : ductal ( dcis ) and lobular ( lcis ) are diagnosed most commonly . usually , they consist in small foci of malignant growth within large adenofibromas and the prognosis is better compared to the overall prognosis in breast cancer . in these cases , ultrasound monitoring of lesion size , echogenicity , echostructure , shape and vascular pattern is particularly important . due to the large diversity and potentially benign character of lesions falling within this category , the therapeutic decisions , usually conservative in nature , are made mainly on the basis of ultrasound scans . precise determination of lesion morphology ensures appropriate therapeutic decision , increases emotional comfort of the patient as well as facilitates planning further follow - up without more invasive diagnostics.lesions classified as bi - rads us category 4 and bi - rads us category 5 are referred to as suspicious lesions characterized by the probability of malignancy being larger than 2% and requiring microscopic verification . thick needle biopsy is preferred in case of lesions falling within these categories ( fig . 3 a ) . in exceptional cases , following negative microscopic verification , vacuum- assisted biopsy ( vab ) or surgical biopsy may be considered . lesions classified as bi - rads us category 4 and bi - rads us category 5 are referred to as suspicious lesions characterized by the probability of malignancy being larger than 2% and requiring microscopic verification . thick needle biopsy is preferred in case of lesions falling within these categories ( fig . 3 a ) . in exceptional cases , following negative microscopic verification , vacuum- assisted biopsy ( vab ) or surgical biopsy may be considered . a 28-year - old female , using contraceptives , with clinically palpable tender tumor within the supramamillary region in the right breast . family history of breast or ovarian cancer negative . ultrasound scan reveals a hypoechogenic , solid lesion with not circumscribed margin , ap dimension > ll dimension . histopathological verification : hamartomas in case of benign lesions classified as bi - rads us category 4 , including complex fibroadenoma , hamartoma ( fig . determination of cancer cells implies therapeutic management appropriate for the cancer type and stage . in case of an invasive or an in situ carcinoma being diagnosed in these categories , there are two basic methods of surgical treatment : breast conserving therapy ( bct ) , consisting in resection of the breast tumor including a healthy margin , placement of radiopaque clips within the tumor bed followed by axillary lymphadenectomy ( al ) or sentinel lymph node biopsy ( slnb ) and subsequent radiation therapy;mastectomy involving resection of the mammary gland including the fascia of the major pectoral muscle and axillary lymph nodes ( lymphadenectomy of slnb , as in the case of cn0 ) . breast conserving therapy ( bct ) , consisting in resection of the breast tumor including a healthy margin , placement of radiopaque clips within the tumor bed followed by axillary lymphadenectomy ( al ) or sentinel lymph node biopsy ( slnb ) and subsequent radiation therapy ; mastectomy involving resection of the mammary gland including the fascia of the major pectoral muscle and axillary lymph nodes ( lymphadenectomy of slnb , as in the case of cn0 ) . radical mastectomy following halsted 's procedure performed only in case of infiltration of pectoral muscles . surgeons expectations regarding ultrasound scans performed in patients with lesions suspected of malignant growth and patients diagnosed with breast cancer and referred to ultrasound imaging examinations before planned surgery include the precise assessment of the focal lesion with : the size and location , echo pattern , shape , orientation , margin , vascularity , potential calcifications , evaluation of location relative to the surrounding structures such as skin , nipple , pectoral muscles of ribs , surrounding breast tissues and the axillary fossa . the size of the tumor is one of the factors taken into consideration in treatment planning . malignant lesions less than 3 cm in size and absence of secondary lesions in other organs or regions ( m0 ) are an indication for breast conserving therapy ( fig.s 4 and 5 ) . contraindications for breast conserving therapy include : multifocal carcinomahistory of radiation therapy delivered to the breastextensive microcalcifications reported in mmg summarycertain collagenoseslack of patient 's consent
history of radiation therapy delivered to the breast extensive microcalcifications reported in mmg summary lack of patient 's consent types of the surgical treatment of breast cancer
hypoechogenic lymph node without visible hilum , with indistinct capsular margin . patient diagnosed with breast cancer was qualified for axillary lymphadenectomy relative contraindications include retromamillar location of the tumor and pregnancy . breast conserving therapy is also possible in patients with tumors > 3 cm in size , particularly at specialist oncology centers . this pertains to patients with large breasts in whom the cosmetic effect will be maintained and in cases when the tumor size had regressed secondary to systemic treatment as evidenced by imaging studies . precise ultrasound assessment of the lymph nodes within the axillary fossa as well as in the supraclavicular and subclavicular lesions , often combined with fnab , is essential for the surgeon in order to properly plan the surgical procedure within the fossa . currently , patients with no palpable lymph node enlargement in the clinical evaluation of axillary fossa ( n0 ) are qualified for sentinel lymph node biopsy ( slnb ) . this allows to avoid axillary lymphadenectomy which is known to be associated with numerous adverse effects . however , it should be stressed that in case of a macrometastasis ( as detected in histopathological examination ) into the sentinel node , patients are usually qualified for another surgical procedure . as demonstrated by numerous publications , sensitivity of ultrasound assessment combined with fnab verification of lymph nodes presenting with suspicious image in the ultrasound scan allows for more accurate disqualification of patient from the slnb procedure as compared to clinical examination , thus allowing to avoid a double instead of a single surgical procedure . ultrasonographic examinations by choi et al . showed that the thickness of the lymph node cortical layer of more than 3 mm is a sensitive marker of metastases into the lymph nodes within the axillary fossa . determination of the number of visible lymph nodes , their size , shape , echogenicity or morphological abnormalities such as the image of the nodular hilum , capsule and outline , is also important . assessment of vascularity by color doppler scan and comparison with contralateral axillary fossa lymph nodes is also helpful . the potential importance of ultrasound scans is supported by the results of a recent study acosog z0011 , suggesting a possibility of abandoning lymphadenectomy in case metastatic involvement of 12 sentinel nodes in n0 patients subjected to a breast conserving procedure and adjuvant tangential fields radiotherapy covering the entire breast including the axillary fossa . in addition , ultrasound scan detection of abnormal lymph nodes within the supraclavicular region and cytology - confirmed presence of cancer cells within the fnab ( cn3 ) disqualifies patients from surgical treatment and is an indication for systemic induction treatment ( stage iiic ) . in case of finding benign neoplastic tumors ( including fibrocystic breast disease ) in this category of lesions , the recommended treatment involves tumorectomy without adjuvant treatment . besides preoperative assessment and monitoring of changes , ultrasound scans are also basic tools for the monitoring of postoperative lesions such as intraglandular hematomas or mastitis as well as for assessment of complications of subsequent radiotherapy . in addition , ultrasound scans are often primary examinations used in the assessment of palpable lesions , nearly half of which corresponds to variants of normal mammary gland structure . ultrasound scan of mammary glands is often the primary examination in the diagnostics of mammary disorders . it allows for precise estimation of malignancy of the detected focal lesions , monitoring of biopsy procedures and localization of lesions prior to surgical treatment . current worldwid e recommendations include the establishment of centers where surgery , oncology , radiotherapy and diagnostics specialists can make joint decisions regarding the treatment of breast cancer patients . this is obviously the optimum approach , similar as in the case of any other clinical and procedural discipline . | recent years have witnessed a dynamic development of mammary gland imaging techniques , particularly ultrasonography and magnetic resonance imaging .
a challenge related to these studies is the increase in the precision of the anatomical assessment of breast , particularly for early detection of subclinical lesions , performance of ultrasound - guided biopsy procedures , and accurate preoperative location of pathological lesions so as to optimize the surgical treatment .
ultrasound imaging is a primary and baseline diagnostic procedure the patient with suspected pathological lesions within breast is referred to by the surgeon .
lesions visualized in ultrasound scans are classified according to the bi - rads us assessment categories .
the successive categories ( 2 through 6 ) encompass individual pathological lesions , estimating the risk of malignancy and provide guidelines for further diagnostic and therapeutic management .
this article described the important aspects of ultrasonographic imaging of focal lesions within the breasts as significant from the standpoint of surgical treatment of patients falling within bi - rads us categories 3 , 4 , 5 , and 6 .
attention is drawn to the importance of ultrasound scans in the assessment of axillary fossa lymph nodes before the decision regarding the surgical treatment . |
the attainment of peak bone mass in women typically takes place in the early 30s but pregnancy and lactation occur mostly during or before this period of life . it is considered that pregnancy could affect peak bone mass and increase the risk of developing osteoporosis later in life . bone loss during pregnancy may result in pregnancy - associated osteoporosis and vertebral fractures . during pregnancy , approximately 80% of calcium accumulates during the third trimester , when the fetal skeleton is rapidly mineralizing . although maternal adaptations designed to meet the calcium needs of the fetus might begin early in pregnancy , they are most needed in the third trimester [ 5 - 6 ] . calcium homeostasis appears to be attained by increased dietary intake with or without increased efficiency of absorption , decreased urinary excretion as a result of increased tubular calcium resorption and by elevated bone turnover with bone loss . thus , there seems to be a good evidence that during pregnancy calcium is mobilized from the maternal skeleton to that of developing fetus . development of biochemical markers enabled to asses bone turnover during normal pregnancy , when radiography or densitometry can not be used [ 8 - 10 ] . rank - a cellular receptor activator of nf - kappab , rank - ligand and osteoprotegerin ( opg ) constitute a novel cytokine system that regulate activity of bone cells . osteoprotegerin , is a soluble decoy receptor that inhibits bone resorption by binding to receptor activator of nuclear factor nf - kappab ligand ( rankl ) and in consequence inhibits osteoclast s maturation and activation . rankl produced by osteoblastic lineage cells and activated t lymphocytes is the essential factor for osteoclastogenesis , fusion , activation and survival of osteoclasts , thus effecting on bone resorption and bone loss . rankl activates its specific receptor - rank , located on osteoclasts and its signalling cascade involves stimulation of osteoclasts action . the effects of rankl are counteracted by opg which acts as a soluble neutralizing receptor . rankl and opg are regulated by various hormones ( glucocorticoids , vitamin d , estrogens ) , cytokines ( tumour necrosis factor alpha , interleukins 1,4,6,11 and 17 ) and various mesenchymal transcription factors . rankl and opg are also important regulators of vascular biology and calcification and of the development of a lactating mammary gland during pregnancy . the discovery and characterization of rankl , rank , opg and subsequent studies have changed the concept of bone and calcium metabolism . the objective of the study was to assess bone turnover in pregnancy by measuring biochemical bone markers in the serum in relation to osteoprotegerin level . thirty healthy , pregnant women during their first visit for prenatal care participated in our study . exclusion criteria included assisted conception or any diseases or use of medication known to affect bone metabolism . all pregnant women were primiparas of mean age 24.53.8 yrs ( 20 - 36 yrs ) and body mass index ( bmi ) before pregnancy 20.32.8 kg / m2 ( 16.7 - 30.9 ) . 27 healthy , non pregnant women , before first pregnancy , ( mean age , 253.4 yrs ; range 21 - 33 yrs , mean bmi 20.92.9 ; range 17.6 - 29.8 ) served as controls . in this group 5 the average calcium intake was on the level of 50 - 75% of daily requirement . the study protocol was approved by the local bioethical committee of collegium medicum , n.c . fasting blood samples from pregnant women were collected , between 8 - 9 am , at 1 trimester ( 6 - 14 wks ) and at 3 trimester ( 31 - 37 wks ) of pregnancy . in control group osteoprotegerin and vitamin 25 oh d3 were assayed by elisa ( biomedica , austria ) . reference value for opg at age 20 - 36 yrs was 44.5 21.2 pg / ml , reference range vitamin 25 oh d3 in winter and summer were 14 - 42 ng / ml and 15 - 80 ng / ml , respectively . n - mid osteocalcin ( oc ) , a bone formation marker and beta - crosslaps ( ctx ) , a bone resorption marker were determined by eclia ( roche diagnostics ) . reference values for oc in premenopausal women were 4 - 35 ng / ml and for ctx 0.299 0.137 ng / ml . intact pth was assayed by eclia ( roche diagnostics ) , expected values were 15 - 65 pg / ml . serum calcium was measured by colorimetric method ( roche diagnostics ) and accepted reference values were 2.15 - 2.55 mmol / l . the data collected at 1 trimester and during 3 trimester were compared by wilcoxon test . the average concentrations of ctx , opg and calcium were elevated in pregnant women comparing to expected reference values ( table 1 ) . at 3 trimester serum ctx and calcium levels were significantly higher than in age - adjusted non pregnant women ( p<0,004 ; p<0,001 respectively ) . mean oc values were only slightly increased during pregnancy and comparable with these in non - pregnant women . serum vitamin d3 ( 1 trimester 71,0 28,0 ; 3 trimester 87,038,0 ng / ml ) in pregnant women were found to be in the upper reference range whereas pth ( 16,0 8,0 and 19,0 8,8 pg / ml ; respectively ) was in the lower . a strong relationship between both markers of bone turnover oc and ctx ( r=0,76 ; p<0,00001 ) and positive but weak correlations between opg and oc ( r=0,54 ; p<0,04 ) , opg and ca ( r=0,55 ; p<0,03 ) were found at 1 trimester . serum ctx and opg significantly increased during pregnancy ( p<0,002 ; p<0,004 ) whereas calcium slightly decreased . the average concentration of measured parameters , except calcium , were higher in 8 women in which blood was collected at the very end of pregnancy ( 36 - 37 weeks ) ( table 1 ) . at 3 trimester no correlation between opg and oc or ca was found , but there was still a strong positive relationship between oc and ctx ( r=0,69 ; p<0,00002 ) . both , serum ctx and opg seemed to be the parameters that allowed to differentiate between elevated and normal bone turnover among pregnant women ( table 2 ) . when cluster analysis was applied , with ctx and opg as dimensions , two subgroups were obtained . at 1 trimester 14 out of 30 women could be included into the subgroup with increased bone resorption according to ctx values . the average opg concentration in this subgroup was highly elevated , calcium was slightly increased while osteocalcin was still within the reference range . in the second subgroup the values of biochemical parameters were found to be within the accepted reference range . at 3 trimester bone resorption was highly elevated in 10 ( 7 at 31 - 35 wks and 3 at 36 - 37 wks ) out of 30 pregnant women ( table 2 ) . in these women the average opg concentration was also elevated , whereas osteocalcin was found to be in the upper reference range and calcium was normal . in the second subgroup with ctx in the upper reference the bone markers were also analyzed in relation to serum calcium level ( table 3 ) . in pregnant women at 1 and 3 trimester the mean values of bone markers , except opg , were lower in the lowest quartile of calcium concentrations and higher in q3 . the relationship of opg and calcium has changed between 1 and 3 trimester . at the end of pregnancy during pregnancy dynamic changes occur in maternal bone and calcium metabolism , but the effect of pregnancy upon the bone mass is not fully understood . two mechanisms : intestinal calcium absorption and urinary calcium excretion help to satisfy the increased demand for calcium during pregnancy . but they are not sufficient enough , because there is evidence that pregnancy affects also bone mass . many authors infer that pregnancy is followed by loss in bone mass up to 5% . it is not known whether osteoprotegerin is involved in the regulation of bone turnover during pregnancy . in earlier study uemura et al have found that circulating opg levels increased with gestational age and especially before the delivery , after 36weeks . the tissue source of opg in pregnancy is unknown , but the placental source was suggested . the breast is also a potential source of maternal serum opg and the rank - rankl signalling pathway appears to be involved in the development of lactating mammary tissue . however , the rapid postpartum decline in maternal opg toward preconception values in both breastfeeding and non - breast - feeding women suggests that the breast is not the primary contributor to maternal serum opg during pregnancy . in our study serum opg concentration in non pregnant women and those at 1 trimester of pregnancy was similar , what suggests that opg levels gradually increased as gestational age progressed . this may be related with the increasing level of estradiol found during pregnancy . in postmenopausal women a significant , positive relationship between opg and estradiol was found , but such a correlation was not confirmed in pregnant women . contrary to the others we found a weak positive correlation between opg and oc but only at the 1 trimester . similarly to earlier findings , we observed much higher rise in opg at the end of 3 trimester with concomitant decline of serum calcium . the association of serum calcium and osteoprotegerin level changed during pregnancy . at the 3 trimester , when the calcium demands of the fetus are the greatest , opg was higher in the lowest quartile of calcium whereas in q3 osteoprotegerin was lower . bone alkaline phosphatase was shown to rise with gestational age whereas osteocalcin did not change or similarly to n - terminal propeptide of collagen type i showed a biphasic pattern with decrease from 1 to second trimester , followed by increase in the 3 . we have measured biochemical markers in fasting morning samples only twice , at 1 and 3 trimester and observed the elevation in oc during pregnancy , especially at 36 - 37 wks . bone resorption , reflected by serum ctx , increased significantly during pregnancy with peak levels at the end of 3 trimester that confirms data by other authors . this was accompanied by a decrease in serum calcium , especially before the delivery ( 36 - 37wks ) . serum ctx and opg seemed to be the only parameters to differentiate between elevated and normal bone turnover . according to the nomogram proposed for the polish premenopausal women serum ctx value over 0,490 ng / ml and oc > 34 ng / ml ( > 95 percentile ) reflect the elevated bone turnover . from our study we may conclude that , at least , abnormal ctx during 1 trimester may be a good predictor for faster bone loss during pregnancy . our results confirm that serum opg and bone turnover markers levels increase during pregnancy and clearly show that bone resorption precedes bone formation . in pregnancy many factors known to influence on the bone mass undergo changes : increased calcium demand , change in nutritional habits , changes in body weight and fat content , changed levels of physical activity and hormones with potential to affect bone metabolism . this may be the main reason for difficulties in finding the exact role of opg in relation to bone turnover during pregnancy . while the determination of osteocalcin at the beginning of pregnancy , seems to be of limited clinical use , measuring opg as a factor related to bone turnover or a bone resorption marker , such as ctx , may have a good predictive value for later pregnancy - associated bone loss or osteoporosis . in pregnancy bone turnover increases mainly due to enhanced bone resorption . the determination of ctx and/or osteoprotegerin at the beginning of pregnancy may have a good predictive value for later pregnancy - associated bone loss . this work was supported by grant bw 17/2002 from the nicolaus copernicus university in torun . | although calcium metabolism during pregnancy is well described the mechanisms involved in bone metabolism are not quite clear .
increase of osteoprotegerin ( opg ) with elevated bone turnover is supposed to be a homeostatic mechanism limiting bone loss .
the aim of the study was to assess bone turnover in pregnancy in relation to serum osteoprotegerin level .
osteocalcin ( oc ) , beta - crosslaps ( ctx ) , opg , vitamin 25 oh d3 , parathormone ( pth ) , and calcium ( ca ) were determined in 30 healthy women at 1st and at 3rd trimester of pregnancy and 27 healthy age - matched non pregnant women.in pregnant women average opg , ctx and serum calcium concentrations were found to be highly elevated . during pregnancy opg and bone resorption significantly rised whereas only slight increase in oc level was found with concomitant decrease in serum calcium .
opg correlated positively with oc and ca only at 1st trimester .
serum ctx and opg at 1st trimester seemed to be the only parameters to differentiate between elevated and normal bone turnover among pregnant women.in pregnancy bone turnover increases mainly due to enhanced bone resorption .
the determination of osteocalcin at the beginning of pregnancy seems to be of limited clinical use , whereas measuring bone resorption markers such as ctx and/or osteoprotegerin may have a good predictive value for later pregnancy - associated bone loss . |
the incidence of recurrence for dukes ' b and c colorectal carcinomas is approximately 50% . similar to this approach , extensive lymph node resection has been questioned for colon cancer . so far , numerous adjuvant treatments have been used to prevent the development of recurrence and improve survival . preoperative irradiation in rectal cancer has been shown to significantly reduce the incidence of locoregional recurrences , but only one study showed improvement of survival . both irradiation and systemic chemotherapy are followed by significant toxicity in contrast to intraperitoneal chemotherapy [ 8 , 9 ] . intraperitoneal chemotherapy integrated in cytoreductive surgery is the standard treatment of peritoneal malignancy that which survival by eradicating the microscopic residual tumor . locoregional recurrence in locally advanced gastrointestinal carcinomas is the result either of tumor involving the serosa and perforation of the bowel wall or of iatrogenic dissemination of cancer emboli which give rise to locoregional tumor within 2 - 3 years . if chemotherapy is used by the intraperitoneal route , microscopic residual tumor resulting from surgical manipulations in locally advanced colorectal cancer surgery may possibly be eradicated . the purpose of the study is to investigate the effect of adjuvant perioperative intraperitoneal chemotherapy after resection of locally advanced colorectal carcinomas . hyperthermic intraoperative intraperitoneal chemotherapy ( hipec ) is compared with early postoperative intraperitoneal chemotherapy ( epic ) . the end point of the study is the investigation of overall survival , recurrence rate , and sites of recurrence . from 1999 to 2004 patients with locally advanced ( t3 , t4 ) colorectal carcinomas were prospectively assigned to undergo r0 resection and receive epic as an adjuvant . from 2005 until today patients with the same tumor characteristics were prospectively assigned to undergo r0 resection and receive hipec as an adjuvant . patients meeting the following criteria were eligible for treatment : ( 1 ) age over 18 years that could undergo major surgery , ( 2 ) satisfactory cardiopulmonary function with no evidence of myocardial infarction during the previous 6 months , ( 3 ) normal liver function , ( 4 ) normal renal function ( blood urea < 50 mg / dl and creatinine level < 1.5 mg / dl ) , ( 5 ) normal white blood cell count ( > 4000 ) and platelets ( > 150.000 ) , and ( 6 ) performance status > 50% according to karnofsky performance scale . the exclusion criteria were the following : ( 1 ) age under 18 years , ( 2 ) the presence of irresectable metastatic disease , ( 3 ) previous treatment for cancer , ( 4 ) the presence of a second malignant tumor at high risk for recurrence ( except for skin basal cell carcinoma or in situ cervix carcinoma radically treated ) , ( 5 ) karnofsky performance status < 50% , ( 6 ) psychosis , drug or alcohol addiction , ( 7 ) the presence of diffuse peritonitis , and ( 8) pregnancy . right colon was considered the segment of the large bowel , proximal to the left colic flexure . left colon was considered the segment of the large bowel from the left colic flexure distal to the peritoneal reflexion . the rectum was considered the segment of the large bowel , distal to the peritoneal reflexion . the diagnosis of carcinoma was established by physical examination , biochemical and hematological examinations , tumor markers ( cea , ca 19 - 9 , and ca-125 ) , abdominal and thoracic ct scan , whole - body bone scan , colonoscopy , and tumor biopsy . the protocols were approved by the ethical committee of the hospitals and the patients signed informed consent . the coliseum technique ( open abdomninal method ) was used during hipec which was administered before the reconstruction of the continuity of the alimentary tract for 90 min if mitomycin - c ( 15 mg / m ) was used and for 60 min if oxaliplatin ( 130 mg / m ) was used . the cytostatic drug was diluted in 2 liters of normal saline for hipec and in 11.5 liters of d1.5w if epic was used . epic was given through a tenckhoff catheter that was positioned at the tumor bed for the first 5 postoperative days . the chemotherapy regimen was instilled rapidly in the peritoneal cavity and dwelled for 23 hours . then the drains were opened for one hour , and instillation of the regimen began again . all the patients who were ptnm stage iii and iv received additional 6 cycles of systemic chemotherapy with 5-fu + leukovorine . right colon carcinomas were treated with right or transverse colectomy depending on tumor location . left colon carcinomas were treated with left colectomy and rectal tumors with low anterior resection or abdominoperineal resection . details about t , n , tnm stage , degree of differentiation , and circumferential margins of resection were recorded . followup was possible every 4 months during the first year and every 6 months later by physical examination , hematological and biochemical examinations , tumor markers ( cea , ca 19 - 9 , ca-125 ) , thoracic and abdominal ct scan , and whole - body bone scan whenever it was indicated . the proportions of patients with a given characteristic were compared by chi - square analysis or by pearson 's test . differences in the means of continuous measurement were tested by the student 's t - test . the survival curves were obtained using the kaplan - meier method , and the comparison of curves was calculated using the log - rank test . cox regression analysis made multiple analysis of survival possible . logistic regression analysis made multiple analysis of recurrence , morbidity , and mortality possible . the hipec - group consisted of 45 patients and the epic group of 63 patients . five patients from the hipec - group and 6 patients from the epic group were rejected from the analysis because they were found to have pt2n0m0 tumors or they had peritoneal malignancy . the groups were comparable for age , gender , t stage , nodal status , tnm stage , anatomic distribution of the tumor , type of surgical operation , morbidity , and sites of recurrence . they were different in performance status , degree of differentiation , and recurrence ( table 1 ) . in 2 patients of hipec - group , the lesions were completely resected , and the patients were included in the study protocol . epic was found to be related to hospital mortality ( p = .034 ) but it did not influence the survival independently . only one patient in hipec - group died in the immediate postoperative period ( table 1 ) . the 3-year survival rate for the hipec - group was 100% . for epic group mean survival was 100 6 months , and 3-year survival rate was 69% ( p = .011 ) ( figure 1 ) . nodal status was also found to be related to survival ( p = .0262 ) . multivariate analysis of survival showed that only nodal status was a prognostic indicator of survival ( hr = 5.221 , p = .022 , 95% ci = 1.1184.182 ) . the median followup time for hipec and epic group was 17 and 28 months , respectively . during followup , one patient ( 2.5% ) in the hipec - group was recorded with recurrence and 16 ( 28% ) patients in the epic group ( p = .009 ) . the patient in the hipec - group had colon cancer and developed liver metastasis . in the epic group 3 patients with rectal cancer developed recurrence and only one of them locoregional . perioperative intraperitoneal chemotherapy ( p = .001 ) and the degree of differentiation ( p = .024 ) were found to be related to recurrence . by multivariate analysis 95% ci = .006.516 ) and the use of intraperitoneal chemotherapy ( hr = 6.663 , p = .001 , 95% ci = .008.519 ) were found to be prognostic indicators for the development of recurrence . cancer emboli from traumatized interstitial tissues , severed lymphatic vessels , and venous blood loss implant adherently at the resection site and in abraded peritoneal surfaces . platelets , polymorphonuclear cells , and monocytes infiltrate the fibrinous exudate that accumulates during wound healing . cancer emboli grow rapidly and give rise to detectable tumors within 2 - 3 years after initial surgical operation . numerous publications for pseudomyxoma peritonei , colorectal cancer , gastric cancer , peritoneal mesothelioma , and ovarian cancer have shown that microscopic residual tumor after cytoreductive surgery combined with intraperitoneal chemotherapy in peritoneal malignancy may be completely eradicated . the success of the treatment mainly depends on the completeness of cytoreductive surgery and on the extent of the peritoneal malignancy . intraperitoneal chemotherapy is effective on tumor emboli that are less than 2 - 3 mm in their largest diameter . the peritoneal - plasma barrier has the property of delaying the absorption of macromolecular substances to the systemic circulation . the drugs instilled intraperitoneally act longer and intensely at the peritoneal surfaces where cancer emboli are entrapped . three of the most potent cytotoxic agents for gastrointestinal carcinomas are 5-fu , mitomycin - c and oxaliplatin . all have been successfully used in colorectal cancer with peritoneal carcinomatosis [ 9 , 10 , 13 ] . mitomycin - c , and oxaliplatin are non - cell - specific drugs and may be used during hipec . 5-fu is a chemotherapeutic drug that acts on g2 phase of the cell cycle and can be used only in epic . it is well known that patients receiving intraperitoneal chemotherapy are prone to infections , abscess formation , sepsis or wound dehiscence . although no wound dehiscence was observed , various infections were quite frequent , and as a consequence the high incidence of postoperative complications is easily explained . epic , but not hipec , was found to be related to the increased morbidity , but it was not shown to be a prognostic indicator . probably , the rapid infusion of the cytotoxic drugs into the peritoneal cavity has a negative effect on the recently performed anastomosis , which may be another explanation for the anastomotic failures and the enterocutaneous fistulas . another explanation about the high rate of anastomotic leaks after epic is that the sutures of the digestive track are bathed for 5 consecutive days in a liquid of chemotherapy that makes them vulnerable . the respiratory complications were also frequent ( 8.2% ) and this has been reported by others . toxicity of intraperitoneal chemotherapy is very rare and mild if one drug is used for perfusion [ 24 , 26 ] . the slowly absorbed cytotoxic drugs do not show high concentrations in the systemic circulation and can not easily produce systemic side effects . from this point of view only one patient in the epic group was recorded with mild neutropenia that did not require special treatment . with intraperitoneal chemotherapy renal toxicity a very rare complication attributed to intraperitoneal chemotherapy is mild pancreatitis which was recorded in only one patient . the most optimistic report about the overall 5-year survival rate recorded 60% and 56% for colon and rectal cancer , respectively . the difference in survival between the two groups is significant and may be due to either the difference in the degree of differentiation or the route of intraperitoneal chemotherapy ( intraoperative versus postoperative ) which has not been clarified . similar , but not statistically significant difference in overall survival has been reported for colorectal cancer with peritoneal carcinomatosis . in this paper although the 5-year followup has not been completed , no death related to cancer recurrence has been recorded in the hipec - group . intraperitoneal chemotherapy has been shown to be related to survival , but it has not been proved to influence survival independently . however , it appears to play a significant role in the development of recurrence , as has been shown by multivariate analysis . no patient in the hipec - group get 4 patients in the epic group developed locoregional recurrences . it is important to note that significant difference in the rate of recurrence has been documented for colorectal cancer with peritoneal carcinomatosis . although the number of included patients is small and further study is required , the use of intraperitoneal chemotherapy in the treatment of locally advanced colorectal cancer appears to play a significant role in reducing the incidence of recurrences . the survival is higher , and the number of recurrences is smaller with the use of hipec . | background and aims .
intraperitoneal chemotherapy is a basic tool in the treatment of peritoneal malignancy .
the purpose of the study is to investigate the effect of adjuvant perioperative intraperitoneal chemotherapy in the treatment of locally advanced colorectal cancer .
patients and methods . patients with t3 and t4 colorectal carcinomas that underwent r0 resection received either hyperthermic intraoperative intraperitoneal chemotherapy ( hipec group = 40 patients ) or early postoperative intraperitoneal chemotherapy ( epic group = 67 patients ) .
the survival , the recurrences and the sites of recurrence were assessed .
results .
the 3-year survival rate for hipec group was 100% and for epic group 69% ( p = .011 ) .
nodal infiltration was found to be the single prognostic indicator of survival .
the incidence of recurrence in epic group was higher than in hipec group ( p = .009 ) .
the independent indicators of recurrence were the use of hipec and the degree of differentiation ( p < .05 ) .
conclusions .
intraperitoneal chemotherapy , particularly hipec , as an adjuvant in locally advanced colorectal carcinomas appears to improve survival and decrease the incidence of recurrence . |
he used a cystoscope to peer into the abdomen of a dog after first insufflating the peritoneal cavity with air . since then , laparoscopic surgery has progressed in practically all branches of surgery with ever - increasing extensions of the boundaries to the most complex surgical procedures in select cases . laparoscopic appendectomy is one such procedure increasing in popularity since initially reported by semm in 1983 . several studies have shown the advantages of laparoscopic surgery in terms of shorter hospital stay , rapid postoperative recovery , and better pain control . however , there have been concerns about the risk of infectious complications , particularly the development of intraabdominal abscess and superficial wound infection the purpose of this study was to assess the comparative incidence of superficial wound infection and intraabdominal abscess in patients undergoing appendectomy by open or laparoscopic surgery for suspected acute appendicitis . all consecutive patients admitted with right iliac fossa pain who had an open or laparoscopic appendectomy as an emergency were included . the choice between open and laparoscopic approach was decided by the operating surgeon after discussion with the patient . data were collected in a specifically designed proforma , where the patient demographic details , operative findings , conversion to open surgery , and postoperative complications were recorded . the main emphasis was on the development of infectious complications , ie , wound infection and intraabdominal abscess formation . cdc definitions of nosocomial surgical site infections were used for the purpose of defining wound infection . intraabdominal abscesses were diagnosed with ultrasound scan , ct scan , or both of these , in patients with suspected symptoms and signs . patients were divided into 2 groups , laparoscopic ( la ) and open ( oa ) . criteria for superficial incisional surgical site infection infection occurs within 30 days after the procedure , and infection involves only skin or subcutaneous tissue of the incision . at least one of the following : purulent drainage , with or without laboratory confirmation , from the superficial incision . organisms isolated from an aseptically obtained culture of fluid or tissue from the superficial incision . at least one of the following signs or symptoms of infection diagnosis of superficial incisional ssi by the surgeon or attending physician a standard technique for laparoscopic appendectomy was used with a 10-mm optical trocar in the infra - umbilical position . two 5-mm ports were used , one in the left iliac fossa and the other in the suprapubic position . tripolar cutting forceps ( acmi corporation , southborough , ma , usa ) were routinely used for dissection , as they helped to speed up the procedure . the appendix base was tied and divided between 2 endo - loops ( ethicon , uk ) with laparoscopic scissors . the appendicular stump was not buried routinely . in the case of perforation , a careful washout was performed . open appendectomy was performed through a gridiron incision in the right iliac fossa by muscle splitting and peritoneal incision . the severity of appendicitis was graded perioperatively as :
catarrhal when the appendix was inflamed without necrosis or perforation , gangrenous when tissue necrosis was present , perforated when a visible perforation was in the appendix with free pus . catarrhal when the appendix was inflamed without necrosis or perforation , gangrenous when tissue necrosis was present , perforated when a visible perforation was in the appendix with free pus . all patients had prophylactic antibiotics at induction ( cefuroxime 1.5 g and metronidazole 500 mg ) . patients with catarrhal appendicitis had 3 further doses , and those with a gangrenous or perforated appendix had a 5-day course of antibiotics . there were 63 males and 71 females with a median age of 24 years ( range , 7 to 63 ) . of these 134 patients , 85 ( 63.4% ) had acute appendicitis , 27/134 ( 20.1% ) appendices were perforated , and 22/134(16.4% ) were normal on histological examination . there were 80 patients in the la group and 54 in the oa group ; however , 9 patients had a conversion to an open procedure . demographic details and main outcome measures for laparoscopic appendectomy and open appendectomy the median operating time was 51.3 minutes ( range , 35 to 100 ) for the laparoscopic group and 40.6 minutes ( range , 30 to 95 ) for the open group . figure 1 shows a comparative graph for the median operating times between the 2 groups . there were 5 wound infections ( 9.2% ) in the open group ( p=0.05 ) . comparison of operative time between the laparoscopic ( la ) and open appendectomy ( oa ) groups . grades of appendicitis were similar in the 2 groups though more perforated appendices occurred in the open surgery group . in the la group , there were 53 inflamed appendices , 12 perforated appendices , and 15 normal appendices . in the oa group , 32 inflamed , 15 perforated , and 7 normal appendices were removed . one patient in the open group and one in the la group developed an intraabdominal abscess ( p=;0.48 ) . conversion to an open procedure was necessary in 11% ( 9/80 ) of the patients in the laparoscopic group . open appendectomy has been the gold standard treatment for acute appendicitis since the description by mc burney in 1894 . although appendectomy is considered a safe operation , a potential for complications exists . most noticeable among them are wound infection , intraabdominal abscess , adhesions , bowel obstruction , and pulmonary complications from general anaesthesia . since its first description in 1983 , laparoscopic appendectomy has gained in popularity with accumulating evidence demonstrating the benefits of the laparoscopic approach in terms of shorter hospital stay , more rapid recovery , and better postoperative pain control . furthermore , laparoscopy allows a complete and thorough assessment of the abdominal cavity and increases diagnostic accuracy , particularly in females where the rates of appendectomy with normal histology have been very high . the development of a postoperative intraabdominal abscess ( iaa ) after appendectomy is a rare but serious complication and is associated with significant morbidity.some reports have suggested an increased risk of an intraabdominal abscess after laparoscopic appendectomy compared with open surgery , whilst others have reported the opposite . in this study , there was no difference , in that one patient in the open group and one in the la group developed an intraabdominal abscess . both were diagnosed by ultrasound scan at day 12 and 15 after their operation and were managed conservatively using broad - spectrum antibiotics initially . good surgical technique and proper use of antibiotics is crucial to reduce the incidence of postoperative intraabdominal abscess . surgeons experienced in the laparoscopic technique and beyond their learning curve report low rates of infectious complications . the conversion rate in this study was 11% , similar to conversion in other reports , though this decreases with increasing surgeon experience . tate reported an incidence of 1.4% for the development of intraabdominal abscess following appendectomy , though this includes an incidence of 7.5% after surgery for perforated appendicitis . the higher incidence in perforated appendicitis may be due to increased bacterial contamination with a risk of a loose fecalith acting as a nidus for infection . an advantage of laparoscopic appendectomy has been the reduced risk of wound infection , as the inflamed appendix is dissected and removed without direct contact with the wound , especially if an extraction bag for specimen retrieval is used . this introduces a bias in that the surgeons with experience and special interest in laparoscopic surgery were more likely to opt for the laparoscopic approach . surgery was performed by varying grades of surgeons including 3 consultants and 6 specialist registrars . the incidence of intraabdominal abscess formation was low , and to detect a significant difference between the 2 groups would require a large number of patients in a randomized controlled trial . due to other advantages of laparoscopic appendectomy , such a trial is unlikely . in this study , the risk of superficial wound infection is less in the la group and comparable to that in previous publications . a postoperative intraabdominal abscess is a rare , though potentially serious , complication of the procedure , and this study suggests that the risks after laparoscopic and open appendectomy are similar . the advantages of diagnostic laparoscopy in patients with abdominal pain , combined with the benefits of laparoscopic appendectomy , suggest that all patients with suspected appendicitis should be considered for laparoscopic appendectomy provided appropriately trained personnel and adequate equipment are available . | background : despite the reported advantages of laparoscopic appendectomy ( la ) , ongoing debate exists about a possible increase in postoperative infectious complication rates especially intraabdominal infections and wound infection , unless wound protection is utilized.methods:all consecutive appendicectomies ( open and laparoscopic ) performed over 4 months were included in this prospective study .
demographic details , operative time , time to conversion , infective postoperative complications , and delay in discharge were recorded .
the patients were divided into 2 groups , laparoscopic ( la ) and open appendectomy ( oa).results : a total of 134 appendicectomies were performed , 80 in the la group and 54 in the oa group .
twenty - six ( 19.4% ) appendices were perforated at the time of operation .
the median patient age was 24 years ( range , 7 to 63 ) .
patients included 71 females and 63 males .
operating time in the la group was longer with a median duration of 51.3 minutes ( range , 35 to 100 ) compared with 40.6 minutes ( range , 30 to 95 ) in the oa group .
an extraction bag was used in 59/71 ( 83% ) la patients .
wound infection was recorded in 6 patients ( 5/54 in oa and 1/80 in la ) .
the site of wound infection was the port of specimen extraction in the laparoscopic group , and an extraction bag was not used . wound infection delayed hospital discharge by an average of 2 days .
intraabdominal abscess formation complicated the outcome in 2 patients ( 1 in the la group and 1 in the oa group).conclusion : wound infection is less common in la than in oa , and an extraction bag is recommended .
intraabdominal infection rates do not appear to be increased , though the numbers in this study are relatively small .
the longer operating time is minimal given the better results , and la is the optimal approach to the diagnosis and management of acute appendicitis . |
the performance of dental restorations is influenced by several factors , including the restorative materials used , the clinician 's level of experience , the type of tooth , the tooth 's position in the dental arch , the restoration 's design , the restoration 's size , the number of restored surfaces , and the patient 's age . amalgam was the material of choice worldwide for class i and class ii restorations for more than a century . however , rising demand for the use of esthetic materials in posterior teeth has increased dramatically over the past two decades , surpassing amalgam . composites are gaining popularity over amalgam as posterior esthetic restorative material because of the following reasons : scientific advances in the development of superior alternative restorative materials , esthetic reasons , cavity preparation is both less invasive and less extensive , placing amalgam restorations without a dentine - bonding agent fails to seal the margins , and last but not the least is mercury toxicity . however , the main problem faced by composites is polymerization shrinkage and stresses which depends on multiple factors such as the configuration factor , composition of resin composites , material properties , various incremental placement techniques , and different modes of curing . the various incremental techniques used are faciolingual layering ( vertical ) , gingiva - occlusal layering ( horizontal ) , three site technique , wedge - shaped layering ( oblique ) , successive cusp build - up technique , bulk technique , and centripetal build - up . however , this technique has many disadvantages : it is difficult to place the multiple increments leading to an increase in the arduousness of the task and the time it takes to complete it . if not performed properly , placing multiple layers can result in polymerization shrinkage and marginal leakage . in light of this , a group of new products were recently introduced , known as bulk - fill composites . these materials are recommended for insertion in a maximum 4-mm bulk due to their high reactivity to light curing . the rationale of the bulk - fill resins is to reduce clinical steps by filling the cavity in single increment , leading to a reduced porosity and a uniform consistency for the restoration , further reducing the clinical time taken and cost factor for the patient . at present , three types of bulk - fill resins are available , distinguished primarily by their viscosity , which is low , for example , smart dentin replacement sdr ( dentsply , detrey , konstaz , germany ) , venus bulk fill ( heraeus kulzer , u.s.a ) , medium for eg , tetric evoceram bulk fill ( ivoclar vivadent , amherst , ny ) , quixfil ( dentsply , uk ) , x - tra fil ( voco , u.s.a ) , or fluctuating , for example , sonicfill ( kerr , sybron endo , u.s.a ) and fiber- reinforced bulk - fill composite , for example , ever x flow ( gc , europe ) . the null hypothesis of the study was that the adaptability and subsequent gap formation at the pulpal floor do not depend upon the bulk fill or incremental technique used to fill the prepared cavities . this study was performed at the institute of dental studies and technologies in the department of conservative dentistry and endodontics . class i cavity to the depth of 4 mm was prepared in each tooth , with a shallow depression in the center of the pulpal floor using a standardized round bur ( mani inc . , utsunomiya , tochigi , japan ) of size and 0.5 mm diameter under profuse water cooling . the depth of class i cavity prepared was 4 mm as per manufacturer 's claim that bulk - fill composites can be filled beyond 4 mm . the teeth were etched using 3 m espe scotch bond multi - purpose etchant for 20 s following which the specimens were washed with distilled water for 15 - 20 s and further blot dried for 20 s. adper single bond adhesive ( 3 m espe , st . paul , mn , usa ) was applied to and scrubbed on the surface for 20 s to create a good hybridization of the etched area . it was then light - cured ( bluephase c8 ivoclar vivadent , amherst , ny ) for 20 s. all the cavities prepared were then restored to a depth of 4 mm using different materials :
group i : sdr ( dentsply , detrey , konstanz , germany),group ii : sonicfill ( kerr , sybron endo , usa),group iii : ever x flow ( gc , europe ) , andgroup iv : z350 xt ( 3 m , latin america ) .
group i : sdr ( dentsply , detrey , konstanz , germany ) , group ii : sonicfill ( kerr , sybron endo , usa ) , group iii : ever x flow ( gc , europe ) , and group iv : z350 xt ( 3 m , latin america ) . groups i - iii are bulk - fill composites and group iv includes incrementally filled composite . each group was light - cured for 20 s with light emitting diode light curing unit . specimens were then subjected to a thermocycling regimen of 2500 thermal cycles by alternating immersion in water at + 5 8c and + 55 8c with a dwell time of 2 min and transfer time of 5 s in each bath . all the samples were sectioned buccolingually and examined under the stereomicroscope at 25 magnification for evaluation of their adapting capacity at the pulpal floor . seven samples from each group were coated with two layers of nail varnish except the area of approximately 1 mm around the tooth and restoration junction . finally , these sections were stained with 2% buffered methylene blue dye for 24 h and examined under the stereomicroscope for dye penetration . the remaining eight samples from each group were taken to vacuum desiccators and sputter coated with gold - palladium . each specimen was then examined under a scanning electron microscope ( sem ) for gap formation at the pulpal floor . the obtained results were statistically analyzed using spss version 18.0 ( spss inc , ibm corp , chicago , usa ) with one - way anova and post - hoc bonferroni test for multiple comparisons to compare means of different groups . the results of the study showed that the bulk - fill composites demonstrated better results than incrementally filled composites . table 1 summarizes the results ( mean , standard deviation , median , minimum , and maximum values ) for gap formation observed under sem [ figure 1a d ] for all the groups . mean , sd , median , minimum , and maximum values of gap formation ( m ) observed under sem in different groups scanning electron microscope images for all the groups showing gap formation are as follows : ( a ) smart dentine replacement . ( d ) z350 xt ( 3 m ) table 2 represents the multiple comparisons between different pair of groups for gap formation ( m ) by post - hoc bonferroni test . the significant difference at 0.05 level of significance in gap formation , i.e. , p < 0.05 was obtained between all the groups . comparison between different pair of groups for gap formation ( m ) observed under sem in different groups ( by post - hoc bonferroni test for multiple comparisons ) the stereomicroscopic images [ figure 2a h ] showed that sdr has the best adaptability . ( h ) z350 xt ( 3 m ) after dye penetration out of the bulk - fill composites , sdr ( 2.1824 m ) showed statistically significant least gap formation followed by sonicfill ( 2.5178 m ) and ever x flow ( 3.3379 m ) , which in turn showed statistically comparable results . z350 xt ( 6.1059 m ) , on the other hand , also demonstrated significantly more gap formation and the less adaptability as compared to sdr . traditional composites were self - cured and prepared as two components to be mixed just before use , resulting in inadvertent air incorporation leaving pores as mechanical defects that were extremely deleterious to strength . then came the incrementally placed composite resins , but the big challenge faced by them was the incorporation of voids or contamination between composite layers , bond failures between increments , difficulty in placement because of limited access in conservative preparations , and the increased time required to place and polymerize each layer . compared to the incremental build - up technique of the restoration , today 's bulk - fill composites require less chair side time and are more predictable , making the restorative process comfortable for the patient . in our study , it could be claimed that bulk - fill composites demonstrated enhanced flowability leading to good adaptation ; elasticity and low polymerization shrinkage stress which reduces microleakage , reduced postoperative sensitivity and secondary caries ; improved depth of cure of at least 4 mm eliminating the need for layering , and can be cured in bulk as they are highly translucent which in turn allow the curing light to sufficiently penetrate to the bottom of single increment layer . according to chuang et al . , sdr , is designed to be used as a posterior restorative material as it can be placed up to 4 mm single increment , shows 60% less polymerization shrinkage and 30 - 50% reduction in procedure time compared with conventional composites . it has a self - leveling consistency for optimum adaptation to the cavity and is compatible with current adhesive systems . in accordance with the results , a study conducted by van ende et al . showed that sdr provided satisfactory bond strengths regardless of the filling technique and cavity depth . however , adhesion failed when conventional composites were used in bulk . in which class ii cavities were restored with four bulk - fill type composites and the highest rating of no dye penetration was achieved with the restorations made of the sdr as compared to the restorations made of sonicfill system . rheine suggested that sdr is the flowable composite which can be used as a bulk - fill base material in increments of up to 4 mm , as also recommended by the manufacturer . the main difference lies in a modulator ( on the activated photoactive group ) that is incorporated into a urethane - based dimethacrylate which reduces polymerization stress by slowing the radical polymerization rate . conducted an in vitro study in which high microleakage values were recorded for sdr as compared to sonicfill when deep class ii cavities were prepared and restored with gingival cavosurface margin below the cementoenamel junction . another bulk - fill composite resin used in this study was sonicfill , a sonic activated bulk - fill system with single increment bulk - fill having a bulk - cure up to 5 mm for expediency , has a high wear resistance for durability , and a reduced translucency for acceptable esthetics . in this study , sonicfill showed significantly comparable results to ever x flow , but lesser adaptability and increased gap formation as compared to sdr . the sonicfill system overcomes the difficulty by applying external sonic vibrations and temperature by lowering its viscosity at the point of delivery by applying internal vibrations to the resin , without the need for heat or external handheld sonic devices . it , thus , has adaptability of a flowable and the sculpt ability of a universal composite , obviating the need of an initial lining or a capping occlusal layer . these results are supported by sabbagh j. who stated that sonicfill is a fast and reliable new technique for posterior restorations which does not require any additional capping layer . the manufacturer stated that as sonic energy is applied through the handpiece , the modifier causes the viscosity to drop ( up to 87% ) , increasing the flowability of the composite , enabling quick placement , and precise adaptation to the cavity walls . however , munoz - viveros et al . who evaluated the sealing ability of sonicfill composite in a class ii restoration in comparison with surefil sdr and filtek supreme ultra , concluded that sonicfill has equivalent margin adaptation of filtek supreme ultra filled in 2 mm increments and surefil sdr which requires an additional overlay material ( ceram x ) . a fiber - reinforced composite , ever x posterior , specially designed to be used as dentine replacement , in conjunction with a conventional composite was also used in this study showing comparable results to sonicfill , but less than sdr . it consists of a combination of a resin - matrix , randomly orientated short e - glass fibers , and inorganic particulate fillers . the resin matrix contains bisphenol a - glycidyl methacrylate , triethylene glycol dimethacrylate , and polymethyl methacrylate forming a matrix called semi - interpenetrating polymer network ( net - poly(methylmethacrylate)-inter - net - poly(bis - glycidyl - a - dimethacrylate ) ) which provides good bonding properties and improves toughness of the polymer matrix . the short fibers prevent and arrest crack propagation through the restoration and tooth structure , which is considered to be the main cause of composite failures . these results suggest that sdr showed the best adaptive capacity and the least gap formation as compared to the other bulk - fill composites used because of its self - leveling property allowing optimal adaptation to the cavity walls . within the limitation of this study , it was concluded that the new bulk - fill composites provided better results than the incrementally filled conventional composites . it can , thus , be suggested that sdr because of its self - leveling property can be used as a base layer and can be overlaid by sonicfill having adaptability of a flowable and the sculpt ability of a universal composite . | aim : to compare newer bulk - fill composites with an incrementally filled composite for adaptability and subsequent gap formation at the pulpal floor.materials and methods : class i cavities were prepared in 60 intact molars , with a shallow depression in the center of the pulpal floor .
the samples were divided into four groups ( n = 15 ) , according to the material used ; smart dentine replacement ( sdr ) , sonicfill , ever x flow and z350 xt , restored to a depth of 4 mm .
following thermocycling , samples were sectioned buccolingually and examined under a stereomicroscope .
seven samples from each group were coated with nail varnish except for approximately 1 mm around the tooth restoration junction .
these samples were examined under stereomicroscope after staining with 2% buffered methylene blue dye .
the remaining samples were examined under a scanning electron microscope for gap formation .
the data were statistically analyzed using one - way anova and post - hoc bonferroni test.results:sdr showed the significantly best adaptability as compared to both sonicfill and ever x flow ( comparable ) .
however , significantly least adaptive capacity was seen in the incrementally filled group ( z350 xt).conclusion : bulk - fill composites performed better than incremental composites , demonstrating better adaptability and less gap formation at the pulpal floor . |
the host - microbiota symbiosis is maintained in the healthy state . however , any dysbiosis due to either microbiota composition alteration or host genetic susceptibility could result in intestinal or extraintestinal pathogenesis . the mechanism by which unhealthy microbiota of the patient with the healthy microbiota of a pre - screened healthy donor . patient attitude has generally been positive towards fmt . in a survey of patients and accompanying family members in the usa , people were presented with two cases of clostridium difficile infection ( cdi ) and were offered antibiotic with or without fmt ( with 90% vs. 65% success rate , respectively ) . 85% of responders chose to undergo fmt in the scenario where the exact nature of fmt was not described and 81% when fmt was completely explained ( not significantly different ) . importantly , if the physician recommended fmt , patients were more willing to accept it in a statistically significant manner . in a survey of patients with ulcerative colitis in an outpatient setting in the usa , patients with more severe disease or history of hospitalisation were more willing to choose fmt . physicians attitude towards fmt has only been assessed for cdi . it is argued that physicians are generally less willing to accept fmt than patients . moreover , the attitude of iranian physicians towards fmt is not known . since , the gut microbiota is a major contributor to many diseases ; it is conceivable that fmt will become part of the integrative therapeutic strategies in the future . therefore , the objective of this study was to investigate the iranian physician s knowledge and attitude towards fmt . the target population of this study was physicians who attended the iranian gastroenterology and hepatology conference 2014 . a questionnaire was devised to firstly assess the general knowledge of individuals on the importance of gut microbiota in health and disease ; and secondly , to estimate the awareness of and attitude towards fmt . participants were considered familiar with fmt if they self - reported familiarity with the method ; who , subsequently , were asked to complete the rest of the questionnaire . to assess the physician s knowledge , we asked general questions on familiarity with the indications ; knowledge of the us food and drug administration ( fda ) stance ; previous encounter with clinical trials of fmt ; and knowledge of diseases which might benefit from fmt . the questionnaires were distributed at the beginning of each session and participants were requested to fill in and return the questionnaires during the breaks . face - to - face interaction during the breaks was also conducted to encourage participants to complete the questionnaires . data analysis was performed with spss ( version 22 ; spss , chicago , il , usa ) . participants characteristics and their general knowledge of gut microbiota
in total 217 physicians completed the questionnaire ; four of which were excluded because the question on familiarity with fmt was left unanswered . of the remaining 213 physicians who completed the questionnaires , 122 ( 57.3% ) the mean age of participants was 45.50 9.04 and 38.00 7.85 for men and women , respectively . overall , 200 ( 93.9% ) knew that gut microbiota was required for the normal homeostatic state and 172 ( 80.8% ) knew that gut microbiota contributes to pathogenesis of disease . one hundred eighty three ( 86.4% ) physicians thought it to be possible to therapeutically manipulate the composition of gut microbiota . overall , 146 ( 68.5% ) were familiar with fmt ; of whom 132 ( 94.28% ) were willing to accept fmt if scientifically and ethically approved and 115 ( 88.46% ) were willing to refer their patients for fmt if indicated . the main reason for not referring the patient despite the overall agreement with the method was the uncertainty about the patient acceptance . not surprisingly , the doctors who had an overall positive opinion towards fmt were significantly more willing to refer their patients if indicated , compared to those who did not agree with fmt [ 110 ( 91.7% ) vs. 4 ( 50% ) , p<0.001 ] .
of those who were familiar with fmt , 73 ( 54.1% ) reported a negative first attitude towards fmt . next , we aimed to identify the most unpleasant aspect of fmt for the physicians . in total , 42 ( 30.7% ) had identified stool preparation as the most unappealing aspect of fmt while 17 ( 11.6% ) reported the therapeutic use of fecal material as the most unappealing and 39 ( 28.5% ) indicated that both are equally unappealing . the doctors who had an overall positive opinion towards fmt reported less negative feelings towards fmt compared to those who did not agree with it because of the unpleasant nature of it [ 66 ( 52.38% ) vs. 4 ( 80.0% ) ] . when we offered a choice between fecal and synthetic microbiota , physicians preferred synthetic microbiota to fecal microbiota [ 51 ( 34.9% ) vs. 30 ( 20.5% ) ] . the missing data are omitted for final per cent calculation
the missing data are omitted for final per cent calculation overall , 146 ( 68.5% ) were familiar with fmt ; of whom 132 ( 94.28% ) were willing to accept fmt if scientifically and ethically approved and 115 ( 88.46% ) were willing to refer their patients for fmt if indicated . the main reason for not referring the patient despite the overall agreement with the method was the uncertainty about the patient acceptance . not surprisingly , the doctors who had an overall positive opinion towards fmt were significantly more willing to refer their patients if indicated , compared to those who did not agree with fmt [ 110 ( 91.7% ) vs. 4 ( 50% ) , p<0.001 ] .
of those who were familiar with fmt , 73 ( 54.1% ) reported a negative first attitude towards fmt . next , we aimed to identify the most unpleasant aspect of fmt for the physicians . in total , 42 ( 30.7% ) had identified stool preparation as the most unappealing aspect of fmt while 17 ( 11.6% ) reported the therapeutic use of fecal material as the most unappealing and 39 ( 28.5% ) indicated that both are equally unappealing . the doctors who had an overall positive opinion towards fmt reported less negative feelings towards fmt compared to those who did not agree with it because of the unpleasant nature of it [ 66 ( 52.38% ) vs. 4 ( 80.0% ) ] . when we offered a choice between fecal and synthetic microbiota , physicians preferred synthetic microbiota to fecal microbiota [ 51 ( 34.9% ) vs. 30 ( 20.5% ) ] . the missing data are omitted for final per cent calculation
the missing data are omitted for final per cent calculation it is argued that physicians are generally less willing to accept fmt than patients . in a survey of american physicians in 2010 , only 40% were willing to refer patents for fmt . however , we identified that most of the iranian physicians are familiar with fmt and generally hold a positive attitude towards it . the majority of the participants said that they accept fmt as a therapeutic modality providing that it is scientifically as well as ethically approved . this is in accordance with other reports on physicians attitude towards fmt . in a report from the usa , gastroenterologists and infectious disease specialists were asked if they would refer cdi patients for fmt . the highly positive attitude of iranian physicians towards fmt can be in part attributed to the growing understanding of the role of gut microbiota in intestinal and extra - intestinal disease among gastroenterologists and internists via educational monthly seminars of the iranian association of gastroenterologists and hepatologists . stool preparation was reported to be the most unappealing aspect of fmt for physicians in our study . there are currently commercial companies , which have built a biobank of pre - screened stool material , which are shipped frozen upon request . it is debatable whether the fecal material is a drug or human tissue , and as such not amenable to commercialisation . nevertheless , it appears that physicians would prefer to skip the stool preparation phase ; as they are more in favour of synthetic microbiota as opposed to fecal microbiota . furthermore , the current guidelines for determination of a healthy donor disregard the importance of assessing the composition of the gut microbiota prior to transplant ; which is arguably the reason why fmt trials in diseases other than cdi have had controversial results so far . in addition , only 8.5% of volunteers were found to be eligible for stool donation . therefore , it is advisable to establish centralised stool biobanks , which can screen , prepare , and deliver the fecal material to the physicians upon request . therefore , the participants are not representative of all internal medicine subspecialties . nevertheless , this is the first report of physicians attitude towards fmt in iran . we identified that the majority of physicians are willing to accept fmt as a therapeutic option if it is scientifically justified and ethically approved . | backgroundfecal microbiota transplant ( fmt ) is employed to replace the
unhealthy microbiota of the patient with the healthy microbiota of a pre - screened healthy donor .
given the growing importance of gut microbiota dysbiosis in the pathogenesis of intestinal or extraintestinal diseases ; it is conceivable that fmt becomes integrated in the routine clinical practice .
our objective was to assess the knowledge and attitude of the iranian physicians towards fmt .
methods
we surveyed the participants of iranian gastroenterology and hepatology 2014 conference .
results
overall , 146 ( 68.5% ) were familiar with fmt ; of whom 132 ( 94.28% ) were willing to accept fmt if scientifically and ethically approved and 115 ( 88.46% ) were willing to refer their patients for fmt if indicated . in total , 42 ( 30.7% ) had identified stool preparation as the most unappealing aspect of fmt , while 17 ( 11.6% ) reported the therapeutic use of fecal material as the most unappealing and 39 ( 28.5% ) indicated that both are equally unappealing .
the doctors who had an overall positive opinion toward fmt reported less negative feelings towards fmt .
conclusion
iranian physicians are willing to accept fmt as a therapeutic option if it is scientifically justified and ethically approved .
nevertheless , physicians prefer to skip the stool preparation phase ; as they are more in favour of synthetic microbiota as opposed to fecal microbiota . |
endoscopic ultrasound - guided fine needle aspiration ( eus - fna ) is a safe , accurate and inexpensive technique , and the interpretation is reliable when performed by trained cytopathologists . however , the diagnostic sensitivity is superior only when the specimen is assessed onsite for diagnostic adequacy and most institutions do not have skilled individuals to render onsite assessment . a fine needle biopsy ( fnb ) specimen contains core tissue with better preservation of cellular architecture than an fna specimen and therefore has greater diagnostic accuracy and provides more tissue for ancillary studies . it may be specifically requested by pathologists to establish a definitive diagnosis in challenging cases when fna is inconclusive or for identification of molecular markers that are specific for neoplasms such as pancreatic neuroendocrine tumors , malignant melanoma , and metastatic lung or breast cancer . to meet these expectations , a 19 gauge ( g ) trucut needle biopsy ( eus - tnb ; cook endoscopy , winston - salem , nc , usa ) was developed to procure larger amounts of tissue with conserved architecture that would enable histological analysis . the overall diagnostic accuracy of eus - tnb for evaluating suspicious lesions at various sites in the body is reported to be 75% to 84% and 61% to 67.5% for pancreatic masses.1,2 while the eus - tnb technique has some advantages over fna , the rigidity induced by the 19 g caliber needle and the mechanical friction of the firing mechanism produced by the torqued echoendoscope , limits its use for evaluating pancreatic head and duodenal lesions . to overcome this limitation , a new 19 g fnb device was recently developed with procore ( cook endoscopy ) reverse bevel technology to enable the acquisition of core specimens . in a recent study from europe , histologic samples were obtained successfully with this procore needle in a majority of patients with a diagnostic accuracy of more than 90%.3 however , some technical difficulties were still encountered when performing transduodenal passes . the same fnb device is also available in a 22 and 25 g platform to facilitate easy transduodenal sampling . in a recent randomized trial that compared the 22 g procore and the standard 22 g fna needle for sampling of pancreatic mass lesions , there was no significant difference in the rates of diagnostic sufficiency ( 100% vs. 89.3% ) , technical failure ( 0% vs. 3.6% ) , or complications ( 3.6% for both ) between the standard fna and procore needles , respectively.4 patients in whom diagnosis was established in passes 1 , 2 , and 3 were 64.3% versus 67.9% , 10.7% versus 17.9% , and 25% versus 3.6% , respectively , for the fna and procore cohorts . also , there was no significant difference in procurement of histologic core ( 100% vs. 83.3% ) or the presence of diagnostic histologic specimens ( 66.7% vs. 80% ) between the fna and procore cohorts , respectively . in a prospective study of 50 patients with solid pancreatic masses , eus - guided sampling was performed using the 25 g procore needle.5 malignancy was diagnosed in 38 patients on the first pass , with a cumulative sensitivity of 83% , 91% , and 96% on passes 1 , 2 , and 3 , respectively . although visible core was reported in 46 patients ( 92% ) , histologic core histologic analysis showed malignancy in 29 patients on the first pass , with a cumulative sensitivity of 63% and 87% on pass 1 and passes 1 to 4 , respectively . a summary of findings from key abstracts presented at digestive diseases week 2013 that compared the fna and procore needle is shown in table 1.6 - 13 as evident from the table , heterogeneity in clinical trials makes interpretation of results difficult . well designed randomized trials comparing the different gauge procore and standard fna needles in pancreatic masses and other solid organ lesions is required to establish conclusive results . the role of the standard 19 g fna needle for yielding histological samples was assessed prospectively in a recent study.14 of the 120 patients who underwent eus - guided tissue acquisition , the procedure was technically successful in 119 patients ( 98.9% ) and adequate histological sample was obtained in 116 ( 97.5% ) . a major limitation of the study was that patients with pancreatic head or uncinate masses were excluded . as the standard 19 g needle is too stiff to navigate the transduodenal route , a flexible 19 g needle made of nitinol has been recently introduced . in a pilot study of 50 patients , which included several patients that underwent eus - fna via the transduodenal route , tissue acquisition was successful and adequate for cytologic assessment in 100% of patients and satisfactory histologic specimens were procured in 94.7% of patients.15 needle dysfunction or procedural complications were not encountered in this study . while manufacturer guidelines must be followed when using specially designed biopsy needles , when using a 19 g needle , to minimize bloodiness , one must not use suction or a stylet and repeated jabbing at the same area should be avoided . it is usually not necessary to perform more than three fnb passes in a lesion as repeated biopsies are more likely to yield blood clots . while the eus - tnb technique has some advantages over fna , the rigidity induced by the 19 g caliber needle and the mechanical friction of the firing mechanism produced by the torqued echoendoscope , limits its use for evaluating pancreatic head and duodenal lesions . to overcome this limitation , a new 19 g fnb device was recently developed with procore ( cook endoscopy ) reverse bevel technology to enable the acquisition of core specimens . in a recent study from europe , histologic samples were obtained successfully with this procore needle in a majority of patients with a diagnostic accuracy of more than 90%.3 however , some technical difficulties were still encountered when performing transduodenal passes . the same fnb device is also available in a 22 and 25 g platform to facilitate easy transduodenal sampling . in a recent randomized trial that compared the 22 g procore and the standard 22 g fna needle for sampling of pancreatic mass lesions , there was no significant difference in the rates of diagnostic sufficiency ( 100% vs. 89.3% ) , technical failure ( 0% vs. 3.6% ) , or complications ( 3.6% for both ) between the standard fna and procore needles , respectively.4 patients in whom diagnosis was established in passes 1 , 2 , and 3 were 64.3% versus 67.9% , 10.7% versus 17.9% , and 25% versus 3.6% , respectively , for the fna and procore cohorts . also , there was no significant difference in procurement of histologic core ( 100% vs. 83.3% ) or the presence of diagnostic histologic specimens ( 66.7% vs. 80% ) between the fna and procore cohorts , respectively . in a prospective study of 50 patients with solid pancreatic masses , eus - guided sampling was performed using the 25 g procore needle.5 malignancy was diagnosed in 38 patients on the first pass , with a cumulative sensitivity of 83% , 91% , and 96% on passes 1 , 2 , and 3 , respectively . although visible core was reported in 46 patients ( 92% ) , histologic core was seen in only 16 patients ( 32% ) . histologic analysis showed malignancy in 29 patients on the first pass , with a cumulative sensitivity of 63% and 87% on pass 1 and passes 1 to 4 , respectively . a summary of findings from key abstracts presented at digestive diseases week 2013 that compared the fna and procore needle is shown in table 1.6 - 13 as evident from the table , heterogeneity in clinical trials makes interpretation of results difficult . well designed randomized trials comparing the different gauge procore and standard fna needles in pancreatic masses and other solid organ lesions is required to establish conclusive results . the role of the standard 19 g fna needle for yielding histological samples was assessed prospectively in a recent study.14 of the 120 patients who underwent eus - guided tissue acquisition , the procedure was technically successful in 119 patients ( 98.9% ) and adequate histological sample was obtained in 116 ( 97.5% ) . a major limitation of the study was that patients with pancreatic head or uncinate masses were excluded . as the standard 19 g needle is too stiff to navigate the transduodenal route , a flexible 19 g needle made of nitinol has been recently introduced . in a pilot study of 50 patients , which included several patients that underwent eus - fna via the transduodenal route , tissue acquisition was successful and adequate for cytologic assessment in 100% of patients and satisfactory histologic specimens were procured in 94.7% of patients.15 needle dysfunction or procedural complications were not encountered in this study . while manufacturer guidelines must be followed when using specially designed biopsy needles , when using a 19 g needle , to minimize bloodiness , one must not use suction or a stylet and repeated jabbing at the same area should be avoided . it is usually not necessary to perform more than three fnb passes in a lesion as repeated biopsies are more likely to yield blood clots . the currently available procore and flexible 19 g needles are a significant advancement in acquiring core tissue during eus - guided procedures . although there are no randomized trials comparing the performance of the procore and flexible 19 g needle , the decision to choose either needle should be based on operator preference and costs . however , eus - guided tissue acquisition is a multistep procedure and must be patient - centered . providing the correct type of sample based on clinical need , sampling the lesion using the best evidence - based techniques , procuring adequate tissue for ancillary studies and closely collaborating with cytopathologists and oncologists are all important in order to have good technical and clinical outcomes . | endoscopic ultrasound - guided fine needle aspiration ( eus - fna ) is routinely performed for establishing tissue diagnosis in patients with gastrointestinal tumors .
the concept of delivering chemotherapy based on molecular markers and the ability to establish a reliable diagnosis in lieu of an onsite cytopathologist has fuelled the recent trend in procuring core tissue by means of eus - guided fine needle biopsy . to overcome the technical limitations induced by the rigidity of the trucut biopsy needle
, a new procore needle with reverse bevel technology has been developed .
recent data suggests that the newly developed flexible 19 gauge needle can also procure core tissue and has easy maneuverability when navigating the transduodenal route .
irrespective of the needles being used , the best clinical outcomes can be attained only by practicing evidence - based techniques , procuring adequate quantity of sample for ancillary studies , and processing the specimens appropriately . |
neutrophilic eccrine hidradenitis ( neh ) is known as an inflammatory disease of the eccrine sweat glands and is histologically characterized by necrosis and vacuolar degeneration of eccrine coil cells and dense neutrophil accumulation around the secretory coils . previous reports suggest that neh normally develops in patients with malignancies following chemotherapy such as cytarabine , although hemodialysis , behet 's disease or infectious diseases , or nonchemotherapeutic drugs such as granulocyte colony - stimulating factor ( g - csf ) are also associated with neh [ 2 , 3 ] . however , generalized neh in healthy adults without any disorders is extremely rare and its precise pathogenesis is still under consideration . dermcidin is a dominant sweat antimicrobial peptide with broad - spectrum activity which is specifically and constitutively expressed in the sweat glands . minami et al . reported that , in normal skin , the secretory coils of the eccrine sweat glands were positive for dermcidin and that , in contrast , the eccrine ducts lacked expression of dermcidin . this peptide is reported to be secreted into eccrine sweat directly . therefore , to investigate the destruction of secretory coils of eccrine glands in neh , in this report , we demonstrate immunohistochemical staining for dermcidin and give a possible explanation for the downregulation of dermcidin in secretory coils of affected eccrine glands in a patient with neh . a 69-year - old japanese man visited our outpatient clinic with a 15-year history of disseminated pruritic papules on his trunk and extremities ; however , the eruptions were limited to the summer months . interestingly , the pruritic papules disappeared without any treatment after the outside temperature went below 20c in fall . physical examination showed numerous erythematous papules and plaques on the forearms and the back ( fig . the histopathological studies of the lesional skin revealed degeneration of the eccrine coils associated with dense accumulation of neutrophils ( fig . moreover , immunohistochemical staining demonstrated that the secretory portion of the eccrine glands in the affected lesion significantly decreased the reactivity with antidermcidin antibody , while that in the nonaffected lesion was strongly stained with the antibody ( fig . as previously reported , the expression of dermcidin was not recognized in eccrine ducts . taking these clinical , histological , and immunohistological findings into account , we diagnosed this patient with generalized neh . without any additional treatment , the pruritic papules disappeared in the middle of september . in this report , we present a case of therapy - resistant generalized neh in an otherwise healthy adult . any treatment , including topical very strong or even the strongest steroid ointments and systemic antihistamines , was not effective . of particular interest is that the eruptions spontaneously resolved in fall when the outside temperature went below 20c . actually , bachmeyer and aractingi suggested that 90% of the neh cases occur in patients with acute myeloid leukemia . other associations include nonchemotherapeutic drugs such as granulocyte g - csf , hemodialysis , behet 's disease and infectious diseases ( e.g. serratia marcescens , enterobacter cloacae , staphylococcus aureus , streptococcal endocarditis , nocardia , hiv-1 ) [ 2 , 3 , 6 , 7 , 8 , 9 ] . however , generalized neh without any disorder is extremely rare . in fact , there is no case of generalized neh in healthy adults in english literature . in healthy children , although 61 cases of idiopathic palmoplantar hidradenitis have been reported previously [ 10 , 11 , 12 ] , the eruptions usually occur mainly on the soles and palms , and only 4 cases of generalized neh in healthy children have been reported . one possible trigger for the outbreak of generalized neh is constantly high temperature . to sum up , our present case is the first report in english that describes generalized neh in a healthy adult ( table 1 ) . the first one postulates that neh is the consequence of a direct cytotoxicity of a drug secreted in the sweat in eccrine coils and duct cells , while the other one suggests that neh is one from the spectrum of neutrophilic dermatoses , as are sweet 's syndrome and hematological malignancies . dermcidin is constitutively secreted by the eccrine sweat glands and not induced by skin inflammation or injury . it appears to be the dominant sweat antimicrobial peptide with broad - spectrum activity not affected by low ph or increased salt concentrations , and is known to be secreted into eccrine sweat directly . in our case , interestingly , the staining for dermcidin in affected secretory coils of eccrine glands , which were surrounded by significant numbers of neutrophils , were almost negative . in contrast , secretory portions of eccrine ducts without neutrophil accumulation expressed dermcidin and the staining level of dermcidin in the area not affected by neh was almost similar to those in healthy adults . these results suggest that , in neh , the secretory coils of eccrine glands may be destroyed by neutrophils , resulting in the decrease of sweat in the affected skin , and this may cause the spontaneous regression of the disorder . in this report , we present a case of generalized neh in a healthy adult . the precise mechanisms of neh are still unknown . our present case gives a possible explanation for the mechanism of neh in a healthy adult but further evidence from more case reports is needed . | we describe a healthy 69-year - old japanese man with generalized neutrophilic eccrine hidradenitis ( neh ) .
he visited our outpatient clinic with a 15-year history of disseminated pruritic papules on his trunk and extremities ; the eruptions , however , were limited to the summer months .
histological findings reveal a dense accumulation of neutrophils around the sweat glands with degenerated secretary coils .
interestingly , immunohistochemical staining showed that the expression of dermcidin on the secretory portion of eccrine glands was significantly decreased in the affected lesion . to our knowledge , this is the first report in english of generalized neh in a healthy adult that shows the downregulation of the expression of dermcidin in affected eccrine glands . |
the occurrence of infective endocarditis during pregnancy is a very rare event with a reported incidence around 0.006% . most of the deaths are secondary to heart failure or the presence of embolic events that complicate clinical course . bacillus cereus is an extremely rare cause for endocarditis , and less than 20 cases reported so far . it is particularly seen in intravenous drug users ( ivdu ) , those with underlying valvular disease or intravascular devices such as pacemakers and prosthetic valves . we are reporting a case of b. cereus endocarditis in a young pregnant woman . to the best of our knowledge , as the most common tricuspid valve infective endocarditis in intravenous drug users is from staphylococcus aureus infection , this case illustrates an unusual outcome ( b. cereus ) on an uncommon valve ( tricuspid valve ) in a rare situation ( endocarditis in pregnancy ) . a 30-year - old , 25-week pregnant female presented to the emergency room ( er ) with right shoulder pain , which was progressively worse over a week with associated swelling and erythema on the lateral aspect of deltoid muscle . she has a long standing history of intravenous ( iv ) heroin and chronic methamphetamine use with tap water as diluents , as well as history of multiple hand abscesses . at presentation , she was afebrile , hypotensive to 85/62 mmhg , tachycardic to 120/min , mildly tachypneic to 26/min , with normal oxygen saturation . physical examination revealed poor oral dentition , and a large abscess over her deltoid muscle , from repeated intramuscular heroin injections . the abscess was incised and drained in the er , and 100 ml of purulent fluid was obtained . white cell count ( 14.6 g / dl ) , esr ( 55 mm / h ) and crp level ( 29 she was started on methadone for control of opioid withdrawal and the fetus was closely monitored . an extensive history about the technique of heroin use revealed that she often used her neck veins for access , disinfected the site of injection with alcohol swabs every time , used tap water as a diluent and denied using saliva or licking the needles at the time of use . the patient was initially started on iv hydration with normal saline and was empirically started on iv daptomycin due to the growth of drug resistant organisms on cultures in the case of previous abscesses . a transthoracic echocardiogram showed a 0.3 cm 0.4 cm vegetation on the native tricuspid valve along with mild tricuspid regurgitation . antibiotic susceptibility tests revealed an elevated mic for daptomycin and the patient was switched to iv vancomycin . a decision was made to keep the patient on 6 weeks of iv vancomycin but the patient left against medical advice after completing five full weeks of treatment . on a return visit to the hospital 4 weeks she was found to have elevated transaminases with an alt of 1048 iu / l and ast of 480 iu / l but a work up for hepatitis was negative and the right upper quadrant ultrasound was within normal limits . the transaminitis was attributed to the presence of hepatotoxic agents in the street drugs that she had resumed after discharge . the patient did not have any signs or symptoms concerning for infection and was cleared for discharge . bacillus infections have been recognized since the beginning of the 20th century and the nonanthrax species have increasingly been identified as pathogens , , , , . b. cereus is a gram - positive to gram - variable aerobic or facultative anaerobic spore - forming rod that is ubiquitous in nature . bacillus species have been demonstrated to be present in the hospital surroundings including equipment and mucous membranes of healthy individuals , . the b. cereus group consists of six closely linked species : b. cereus , b. mycoides , b. pseudomycoides , b. thuringiensis , b. weihenstephanensis , and b. anthracis . a majority of the human bacillus infections are caused by b. cereus
, , . clinical infections by b. cereus may be broadly classified as local infections , septicemia , central nervous system ( cns ) infections including meningitis , respiratory infections , endocarditis or pericarditis and food poisoning caused by the production of a heat stable emetic and diarrheagenic toxin , , , , , . majority of the significant illnesses are seen in populations at risk such as ivdus , patients on hemodialysis , neonates , immunocompromised patients and those with underlying malignancy , , , . b. cereus is an unusual cause of endocarditis , usually associated with ivdus , an underlying valvular disease or in association with implanted pacemakers and prosthetic valves ( table 1 ) . all together , to the best of our knowledge , there are less than 20 cases of b. cereus endocarditis in literature but none have been documented in pregnancy . the advancement in microbiological testing and increased awareness of its infectious potential allowed more cases of b. cereus endocarditis to be identified and reported . the first case of b. cereus endocarditis was reported in the 1970s in a patient with ivdu , . in most previous cases of b. cereus endocarditis of the native valves in iv drug abusers , worse outcomes , poor antibiotic response and surgical intervention are more common in patients with prosthetic valves according to literature , , . the commonest sources leading to bacteremia in those with iv heroin abuse are colonization of the skin , contamination of injection equipment or paraphernalia , and organisms present in the heroin itself . in a study published in 1974 , it was seen that 32% of street heroin samples and almost 50% of the injection drug paraphernalia grew bacillus spp . on culture . other studies have shown the presence of bacillus spp . in alcohol prep pads which may be used by these patients prior to injection . we were unable to acquire the actual heroin samples or her equipment for testing but at least one of the above mentioned sources may have been the source of origin for the infection . it is important to realize in clinical practice that b. cereus is a known blood culture contaminant and may be linked to contamination of ethanol solutions , hospital linen , culture media , hand gloves , and hospital construction material , , , , . grow easily on blood and chocolate agars at temperatures between 25 and 37 c . hence , a high suspicion should be maintained in the correct clinical setting especially in patients who continue to have multiple positive blood cultures . ivdus with b. cereus bacteremia are at a high risk for developing aggressive endophthalmitis , panophthalmitis or acute keratitis that can lead to blindness within hours requiring enucleation of the eye , . the choice of appropriate management of endocarditis in pregnancy can be challenging but prompt treatment is needed due to the high rates of maternal and fetal mortality associated with it , . b. cereus unlike most b. anthracis isolates , produces beta lactamases and is usually resistant to beta - lactam antimicrobials , including the third generation cephalosporins . alternative antimicrobials that can be used are aminoglycosides , vancomycin , clindamycin or erythromycin , , however , their safety in pregnancy is debatable . iv daptomycin is category b drug in pregnancy but since the organism had a high mic ( > 4 ) for daptomycin , vancomycin ( category c drug in pregnancy ) was used instead which is known to be efficacious against b. cereus . vancomycin may rarely be associated with sensorineural hearing loss or nephrotoxicity in the fetus after maternal use in the 2nd or 3rd trimester . our patient tolerated the antibiotic well without any maternal or infant related adverse events even on follow up at 2 weeks postpartum . a high suspicion for endocarditis must be maintained in patients with a history of ivdu and cultures growing unusual organisms , cases as such must be further investigated and early initiation of empiric antimicrobial therapy may improve outcomes . early diagnosis of endocarditis in pregnancy may decrease the need for surgery in most cases . pregnancy poses special challenges like optimal management of delivery and timing of surgery if indicated . | incidence of infective endocarditis during pregnancy is around 0.006% with high maternal and fetal mortality .
bacillus cereus is an extremely rare cause for endocarditis in intravenous drug abusers ( ivda ) or those with valvular disease or devices such as pacemakers .
we report a case of b. cereus endocarditis , which , to the best of our knowledge , has never been reported in pregnancy . a 30-year - old , 25-week pregnant female presented with right shoulder pain , swelling and erythema on the lateral aspect of deltoid muscle from large abscess over her deltoid muscle . she was found to have a vegetation on the native tricuspid valve .
cultures from abscess fluid and blood cultures grew b. cereus , she was appropriately treated with antimicrobials and had favorable outcomes .
there are < 20 cases of b. cereus endocarditis reported but none during pregnancy . when cultures grow unusual organisms the case must be thoroughly investigated . this case illustrates a rare situation ( endocarditis in pregnancy ) with an unusual outcome ( b. cereus ) on an uncommon valve ( tricuspid valve ) . |
all forms of mercury viz . , organic , elemental , and mercury salts are toxic and manifestations depend on nature , intensity and the chemical form of mercury . most human exposure results from fish consumption ( organic mercury ) or dental amalgam ( metallic mercury ) . kidneys are the prime target of mercury toxicity as it is primarily excreted through them . here , we describe a patient who consumed mercuric chloride with suicidal intent , and presented with typical manifestation such as acute kidney injury ( aki ) and gastrointestinal erosion . in addition , he had disseminated intravascular coagulation ( dic ) , a rare complication of mercury poisoning . a 36-year - old male was admitted with 2 days history of oliguria progressing to anuria , facial puffiness , edema legs , bleeding gums , hematochezia , and fever . he gave a history of consumption of unknown substance ( around 500 mg ) a week back used for folk remedies and rituals . his heart rate was 92/min , respiratory rate was 15/min , and blood pressure was 130/90 mm of hg . laboratory investigations showed hemoglobin 11.2 g / dl ; total count 6000/mm ; platelet count 100,000/mm ; blood urea 124 mg / dl ; serum creatinine 6.7 mg / dl ; sodium 135 meq / l ; and potassium 6.1 meq / l ; arterial blood gas analysis showed high anion gap metabolic acidosis . his coagulation profile showed prothrombin time 18 s , inr 1.6 ; activated partial thromboplastin time 60 s ; fibrin degradation products 10 mg / ml ; d - dimer levels 1 mg / ml ; and serum fibrinogen 250 mg / dl . diagnosis of overt dic was made as per criteria proposed by the international society of thrombosis and hemostasis with total score of five at admission . he received eight sessions of hemodialysis over 2 weeks after which his urine output started improving . renal biopsy done 2 weeks after admission showed markedly dilated tubules with sloughed off epithelium and cell debris within lumen [ figure 1 ] , interstitial edema , and mild inflammatory infiltrate in the interstitium consistent with acute tubular necrosis . consumed substance brought by the patient 3 weeks later was white colored powder , called . toxicological analysis of the compound revealed it to be mercuric chloride . at the end of 2 months , there are three classes of mercury : metallic elemental mercury , inorganic mercurial salts ( mercurous and mercuric salts ) , and organic mercurials . acute poisoning of this leads to corrosive bronchitis , pulmonary edema / fibrosis , diarrhea , renal dysfunction , visual and neuropsychiatric disturbances , and in severe cases , death due to respiratory failure . organic mercury compounds are absorbed completely from the intestine , converted to inorganic forms , and possess similar toxic properties . mercuric chloride is still used as wood preservative , photographic intensifier , disinfectants and also in indigenous drug formulation , and folk remedies in asian countries . once ingested , mechanism of mercury toxicity include ( a ) mercuric ions precipitate proteins that cause direct necrosis of tissues . about 8590% of mercury in the body accumulate in the kidneys causing acute renal failure due to necrosis of the proximal tubular epithelium . ( b ) inorganic mercury complexes sulfhydryl groups and causes metabolic acidosis , vasodilatation , and shock . though acute tubular necrosis is the most common lesion , tubulointerstitial nephritis and immune - mediated glomerular damage can also occur . rarely , it can present as hypertensive encephalopathy especially in children , nephrotic syndrome , chronic tubulointerstitial nephritis , or with isolated tubular dysfunction . our patient consumed mercuric chloride with suicidal intention and developed gastrointestinal erosion , anuric renal failure , and dic . franco et al . reported one patient with mercuric chloride poisoning who developed two consecutive episodes of acute renal failure by two different mechanisms , one toxic and the other immunological . renal biopsy done in that patient , showed acute tubular necrosis initially and granulomatous interstitial nephritis in the second biopsy . the international society of thrombosis and hemostasis criteria , which has 91% sensitivity and 97% specificity , was used for the diagnosis of overt dic . a score of five or higher is compatible with dic while a score below five is suggestive of dic . the possible explanation for dic was the lowered fibrinolytic activity due to inhibition of plasma plasminogen activator or the inhibition of plasminogen activation reaction catalyzed by this enzyme as demonstrated in experimental rat models . measurement of mercury levels in blood ( > 3.6 mg / dl ) and urine ( > 15 mg / dl ) may be helpful in diagnosis . chelation therapy should be considered for any symptomatic patient with a history of acute elemental mercury exposure . chelating agents include dimercaprol ( bal ) , 2,3-dimercaptopropane-1-sulfonate ( dmps ) , dimercaptosuccinic acid , and penicillamine . hemodialysis is not effective in removing mercury , but can enhance the removal of the dimercaprol - mercury complexes . the outcome depends on the form of the mercury compound and severity of the exposure . we did not do urine mercury levels , and the patient had not received any chelating agents as toxicological analysis was done much later . we conclude that mercury poisoning should be considered in case of aki and dic though it is a rare complication . prompt treatment with chelating agents guided by measurement of mercury levels will have an impact on the favorable clinical outcome . | mercury is a toxic heavy metal and occurs in organic and inorganic forms .
inorganic mercury includes elemental mercury and mercury salts .
mercury salts are usually white powder or crystals , and widely used in indigenous medicines and folk remedies in asia .
inorganic mercury poisoning causes acute kidney injury ( aki ) and gastrointestinal manifestations and can be life - threatening .
we describe a case with unknown substance poisoning who developed aki and disseminated intravascular coagulation ( dic ) .
renal biopsy showed acute tubular necrosis .
later , the consumed substance was proven to be mercuric chloride .
his renal failure improved over time , and his creatinine normalized after 2 months . |
blunt splenic trauma can result in life - threatening haemorrhage , and the majority can be managed conservatively . a 27-year - old passenger was ejected from a car following a high - speed collision . on arrival at the emergency department , she was normotensive , tachycardiac , complaining of abdominal pain . examination revealed tenderness along the left lower chest wall and upper abdomen , with multiple facial and anterior leg lacerations . she had a persistent tachycardia which responded to intravenous crystalloids and two units of packed red cells . an urgent contrast - enhanced computed tomography ( cect ) scan of head , neck , thorax , abdomen and pelvis was performed , demonstrating a grade 4/5 splenic laceration with several foci of active haemorrhage and a large volume of peri - splenic free fluid consistent with blood with no other intra - abdominal injuries ( fig . 1 ) . following review , a decision was taken to perform angiography with a view to selective angio - embolization as the patient remained haemodynamically stable . contrast angiography demonstrated multiple small pseudoaneurysms within the peripheral branches of the splenic artery with active contrast extravasation . the splenic artery was selectively catheterized and embolized at its mid - point with several coils ( fig . 2 ) . at the end of the procedure , collaterals were seen supplying the residual non - injured splenic tissue , with the absence of active contrast extravasation . the patient was transferred to the intensive care unit for continuous haemodynamic monitoring for 36 h. appropriate additional plain facial and long limb imaging was performed when stable , and no additional injuries were noted . an abdominal ultrasound scan , 6 weeks later , confirmed almost complete resolution of the peri - splenic haematoma . figure 1:cect demonstrating a grade 4 splenic injury with contrast extravasation suggesting active haemorrhage ( arrow ) . ( b ) post - embolization image demonstrating coils within the main splenic artery with early filling of collateral vessels . cect demonstrating a grade 4 splenic injury with contrast extravasation suggesting active haemorrhage ( arrow ) . ( b ) post - embolization image demonstrating coils within the main splenic artery with early filling of collateral vessels . in a haemodynamically unstable patient with blunt abdominal trauma , the goal is identification of the source and control of ongoing haemorrhage . focused assessment with sonography for trauma ( fast ) is available in major emergency departments to detect free fluid in the upper quadrants of the abdomen , pelvis and pericardial sac . although rapid , non - invasive and reproducible , assessment of the retroperitoneal cavity by fast is limited with reported false - negative rates of 2059% . whole - body cect scanning has become the gold standard diagnostic approach in blunt polytrauma , with resultant early intervention leading to greater survival rates . using cect solid intra - abdominal organ injury following blunt abdominal trauma is graded using the american association for the surgery of trauma ( aast ) scale ( table 1 ) . importantly , these grades do not account for ongoing haemorrhage or additional organ injury . in patients with active haemorrhage , recent advances in cect imaging facilitate a whole - body scan in < 20 s facilitating rapid assessment . the safe performance of a cect is determined by the availability , ease of access and proximity of the ct to the patient . table 1:aast splenic injury scale ( 1994 revision ) gradeinjurydescriptionilacerationcapsular tear , < 1 cm parenchymal depthiihaematomasubcapsular , 1050% , surface areaintraparenchymal , < 5 cm in diameterlaceration13 cm parenchymal depth , which does not involve a trabecular vesseliiihaematomasubcapsular , > 50% surface area or expanding ; ruptured subcapsular or parenchymal haematomaintraparenchymal haematoma > 5 cm or expandinglaceration>3 cm parenchymal depth or involving trabecular vesselsivlacerationlaceration involving segmental or hilar vessels producing major devascularization ( > 25% of spleen)vlacerationcompletely shattered spleenvascularhilar vascular injury which devascularizes spleen aast splenic injury scale ( 1994 revision ) the management of blunt splenic injury is determined by haemodynamic stability of the patient , and the presence or absence of other intra - abdominal injuries requiring surgical intervention . options include conservative non - operative management ( nom ) with frequent monitoring of clinical status . since the early 1980s , nom of haemodynamically stable patients with blunt splenic injury has become the standard of care in paediatric and adult populations . successful outcome following nom is reported as up to 97% of patients regardless of the grade of splenic injury . however , significant blunt splenic injury can be associated with other intra - abdominal and/or extra - abdominal injuries in 7.569% . haemodynamically stable patients with low - grade splenic injury and minimal haemoperitoneum managed conservatively have a reported delayed splenectomy rate of 10% . emergency splenectomy provides definitive treatment but carries a small lifelong risk of postsplenectomy sepsis syndrome . consequently , selective hepatic artery embolization is being increasingly employed in patients with confirmed active bleeding on cect and/or selective hepatic angiography . an on - call interventional radiological service is recommended in all level 1 trauma centres . at angiography arterial occlusion with an inflatable balloon is rapid and simple , and can halt life - threatening blood loss . stenting is indicated for disrupted vessels that may be difficult to gain access to at laparotomy or where vessels are tamponaded by surrounding haematoma when laparotomy may result in further haemorrhage and instability . in addition , angio - embolization can also be used to arrest haemorrhage after unsuccessful laparotomy or in a patient who rebleeds after a period of stability following blunt abdominal trauma . the choice of embolization agent depends on the durability of the occlusion required and the diameter of the affected blood vessel . in blunt abdominal trauma , haemorrhage arrest with transient occlusion is usually performed using a temporary occluding agent such as gel - foam . alternatively , permanent agents including coils or glue can be considered . in unstable patients , a large catheter can be threaded swiftly into the main splenic artery and angio - embolization achieved . however , the optimal approach is catheter placement in close proximity to the bleeding site to minimize de - vascularization of remnant normal tissue to preserve organ function [ 9 , 10 ] . a micro - catheter can be advanced creating a selective block even to a terminal arteriole . complications of angio - embolization are uncommon occurring in 5% usually related to arterial access , inserting and advancing the catheter , or rarely the contrast material including anaphylaxis and nephropathy . splenic necrosis can occur , causing pain and pyrexia with insufficient collateral vascular supply or following prolonged main vessel balloon occlusion . however , collateral supply through the short gastric or pancreatic vessels reduces the risk of organ ischaemia . post embolization syndrome , a triad of pain , pyrexia and nausea or vomiting is a rare complication . laparotomy and splenectomy are indicated in the haemodynamically unstable patient or those with other intra - abdominal injuries requiring laparotomy . increasingly selective splenic artery embolization is being employed in haemodynamically stable patients with evidence of ongoing haemorrhage on cect to avoid the need for surgery and to preserve splenic parenchyma . | splenic injury is a preventable cause of mortality following blunt trauma .
the majority of splenic injuries can be managed conservatively .
laparotomy is indicated in the haemodynamically unstable patient , or those with other intra - abdominal injuries requiring surgery .
angio - embolization can be used to achieve haemostasis and preserve splenic parenchyma .
the expertise and experience of the multidisciplinary trauma team and resources of the receiving facility are critical in determining the optimal management approach .
we present a patient with a successful outcome following selective angio - embolization for ongoing bleeding from a grade 4 splenic injury . |
physical activity has important to therapeutic effects , mainly preventive , and its absence
increases the risk of lifestyle diseases , such as obesity , osteoporosis , diabetes type 2 ,
ischemic heart disease , and certain types of cancers1 ,
2 . empirical studies indicate that
approximately 30% of the adult population in europe performs too little low - intensity
physical activity3 . as a consequence , they
run the risk of lifestyle diseases , which requires increased public spending for health
protection . this is especially significant for working - age people , as in addition to medical
expenses , the economic efficiency of enterprises decreases , and national finances are
impacted due to increased pay - outs of sickness allowances from reduced tax revenues4 . the level of physical activity varies among different social groups , which can be grouped
according to their educational attainment , and these relationships can be multidirectional . some study results have shown that as the education level increases , the participation in
various forms of physical activity also rises5 . this study attempted to define the relationship between physical activity and the
educational attainment of working - age inhabitants of wroclaw . this study was conducted in november 2013 and involved 2,174 people aged 1864 , 984 males
and 1,190 females . respondents with basic and vocational education attainment comprised 30%
( 383 males and 262 females ) those with secondary education comprised 49% ( 393 males and 676
females ) , while those with higher education comprised 21% ( 208 males and 252 females ) of the
sample . the representative sample was randomly selected , and its age - gender structure was
similar to the general population of wroclaw ( poland ) . for evaluation of physical activity the international physical activity questionnaire short
version7 was used , which contains six
questions on the physical activity of respondents in a typical week of their life . activity
covers physical efforts executed at work , home and in the surroundings , while moving from
place to place , including the time after work . due to the lack of conformity between the analysed variables and the normal distribution , the following characteristics were computed : medians , quartile deviations , minimum and
maximum values . the mann - whitney test for a sample of n > 20 and the kruskal - wallis test
( anova ) were used . statistical significance was accepted for p < 0.05 . the calculations
were carried out using ibm spss statistics 20 software . tables 1table 1.physical activity of the males according to their educational attainmentvariableeducationmeqminmaxdvpa ( min / week)basic and basic vocational240.0195.010.01260.0dmpa ( min / week)240.0150.040.01260.0dlpa ( min / week)420.0435.040.01260.0dtpa ( min / week)870.0540.060.03780.0dvpa ( min / week)secondary240.0210.010.01260.0dmpa ( min / week)300.0210.010.01260.0dlpa ( min / week)420.0410.030.01260.0dtpa ( min / week)960.0570.030.03780.0dvpa ( min / week)higher240.0190.010.01260.0dmpa ( min / week)240.0210.020.01260.0dlpa ( min / week)420.0345.020.01260.0dtpa ( min / week)950.0505.060.03600.0dvpa : weekly volume of physical activity with vigorous intensity , dmpa : weekly volume
of physical activity with moderate intensity , dlpa : weekly volume of physical activity
with low intensity , dtpa : weekly volume of physical activity and 2table 2.physical activity of the females according to their educational
attainmentvariableeducationmeqminmaxdvpa ( min / week)basic and basic vocational240.0142.530.01080.0dmpa ( min / week)180.0120.010.01080.0dlpa ( min / week)360.0375.020.01260.0dtpa ( min / week)775.0550.080.02880.0dvpa ( min / week)secondary240.0180.010.01260.0dmpa ( min / week)240.0210.010.01260.0dlpa ( min / week)420.0337.510.01260.0dtpa ( min / week)907.5525.040.03780.0dvpa ( min / week)higher240.0180.010.01260.0dmpa ( min / week)225.0120.030.01260.0dlpa ( min / week)420.0420.010.01260.0dtpa ( min / week)937.5575.050.03600.0dvpa : weekly volume of physical activity with vigorous intensity , dmpa : weekly volume
of physical activity with moderate intensity , dlpa : weekly volume of physical activity
with low intensity , dtpa : weekly volume of physical activity present the basic statistical characteristics of physical activity of the
female and male participants , according to their educational attainment . it is worth
noticing that in all groups , despite the level of educational attainment , male subjects
dominated the category of physical activity with low intensity . physical activity with
medium and vigorous intensity undertaken less frequently by female and male respondents . dvpa : weekly volume of physical activity with vigorous intensity , dmpa : weekly volume
of physical activity with moderate intensity , dlpa : weekly volume of physical activity
with low intensity , dtpa : weekly volume of physical activity dvpa : weekly volume of physical activity with vigorous intensity , dmpa : weekly volume
of physical activity with moderate intensity , dlpa : weekly volume of physical activity
with low intensity , dtpa : weekly volume of physical activity males were characterized by generally higher physical activity than females . the observed
differences were not statistically significant ( table
3table 3.differentiation of physical activities performed by adults with various
educational attainmentvariablebasic and basic vocationalsecondaryhigherzzzdvpa ( min/ week)1.410.310.35dmpa ( min/ week)0.911.421.10dlpa ( min/ week)0.761.160.35dtpa ( min/ week)0.750.770.23dvpa : weekly volume of physical activitywith vigorous intensity , dmpa : weekly volume
of physical activity with moderate intensity , dlpa : weekly volume of physical activity
with low intensity , dtpa : weekly volume of physical activity ) . dvpa : weekly volume of physical activitywith vigorous intensity , dmpa : weekly volume
of physical activity with moderate intensity , dlpa : weekly volume of physical activity
with low intensity , dtpa : weekly volume of physical activity among the working - age subjects from wroclaw , the level of education was not the biggest
differentiating factor influencing the volume of their physical activities . the exception
was the female group with secondary educational attainment , which performed the largest
volume of physical activity with moderate intensity , followed by the group of females with
higher education , and the smallest volume of physical activity was performed by the group
consisting of females with primary and vocational education . similarly concerning total
physical activity , the volume of physical activitiy being performed rose as the subjects
educational attainment increased . both differences were statistically significant ( table 4table 4.gender differentiation of physical activities performed by adults with various
educational attainmentvariablefemalesmaleshhdvpa ( min / week)0.940.96dmpa ( min / week)5.56 * 1.78dlpa ( min / week)2.351.77dtpa ( min / week)6.71 * 0.47dvpa : weekly volume of physical activitywith vigorous intensity , dmpa : weekly volume
of physical activity with moderate intensity , dlpa : weekly volume of physical activity
with low intensity , dtpa : weekly volume of physical activity , * p < 0.05 ) . dvpa : weekly volume of physical activitywith vigorous intensity , dmpa : weekly volume
of physical activity with moderate intensity , dlpa : weekly volume of physical activity
with low intensity , dtpa : weekly volume of physical activity , * p < 0.05 lack of physical activity is particularly hazardous for people of productive age , and due
to this situation , the therapeutic function of physical activity , mainly in the form of
prevention against lifestyle and occupational diseases , is insufficient . it also reduces the
chances of high quality life in retirement8 , 9 . in this study , no significant differences were found in the volumes of physical activity
between female and male subjects . whereas , findings made by other authors usually indicate
higher levels of physical activity among men10 . this is probably related to lifestyle changes occurring in
post - industrial societies , especially urban societies , mainly due to the progress of women s
empowerment , flexibility of social roles , or the active leisure trends . despite the fact that there are many studies indicating that correlations exist between the
level of educational attainment and the level of physical activity5 , 6 , 9 , in this study , this correlation was only found in the female group . the reason for this finding is probably
that the male subjects generally had lower levels of education than the female subjects and
the structure of the male group , according to the level of education being more uniform . in
addition , men , especially those with lower educational attainment , are more likely to
undertake physical activities at work5 ,
while those with higher levels of education are more like to perform physical activities in
their leisure time6 . this would lead to a
situation in which the total physical activity performed by male subjects would be similar
in volume , regardless of their education . this would further lead to the situation that the
total physical activity performed by the male subjects would be similar in volume ,
regardless of their education . higher volumes of physical activity performed in leisure time
by people with higher levels of education was also found for female subjects . it is
noteworthy that those with secondary education levels had increased awareness of the
positive health impact of physical activity . the study found statistically significant differences in the levels of physical activity of
females with basic and vocational attainment and females with secondary and higher
educational attainment , in favour of the last group . this referred only to physical activity
of moderate intensity , and to total physical activity . further study of the relationships between physical activity and
social and economic status should be performed . they should be continuous in nature and also
take into account other physical activity research methods and techniques ( for example the
ipaq questionnaire in long form , pedometry and accelerometry ) . | [ purpose ] this article attempts to define the relationship between physical activity and
educational attainment of working - age adults from wroclaw . [ subjects and methods ] the
study surveyed 2,174 participants aged 1864 years , 984 men and 1,190 women . to evaluate
their physical activity ,
the international physical activity questionnaire was used .
[ results ] most of the participants performed low - intensity levels of physical activity .
men were characterized by generally higher physical activity than women , but the
difference was not significant .
the level of educational attainment differentiated
physical activity only in women with secondary or higher education , who performed
significantly more physical activities than those with primary and vocational education .
[ conclusion ] further research in this subject area should be performed .
it should be
continuous and consider other methods and techniques . |
chronic tophaceous gout classically occurs after 10 years or more of recurrent polyarticular gout . however , tophi can also occur as first sign of the disorder . we report the case of a 60 year female with tophaceous involvement of the pubis bone which is an unusual location for this type of pathology without any prior manifestation of gouty arthritis . tophi can present in unexpected locations , even as the first sign of gout , often mimicking infection and neoplasia and vigilance is required when unusual symptoms or signs occur in a patient with gout . gout , a type of inflammatory arthritis that results from deposition of monosodium urate ( msu ) crystals in the synovial fluid and other tissues , typically follows a clinical course , first with years of asymptomatic hyperuricemia , followed by acute intermittent attacks , and eventually with chronic arthritis with the formation of tophi , or collections of msu crystals that have served as the nidus of a granulomatous reaction . although gouty tophi are seen in chronic disease , tophi may be first sign of the disorder . here , we report a sixty - year - old female with normal blood uric acid level who presented with tophus of the pubis bone as a cause of groin pain prior to any other manifestation of gout . a 60 year old female was admitted with a 5 day history of severe pain in the right groin and right hip and was unable to weight bear . on examination there was diffuse tenderness in the right groin and she was unable to lift the right leg due to pain . significant blood results included erythrocyte sedimentation rate 33mm / hr , leucocyte count 12800/cmm , serum creatinine 0.67mg / dl and serum uric acid 5.6 mg / dl . plain x - ray examination of the pelvis showed extensive osteolytic involvement of the right pubis bone . mri of the pelvis showed a lesion involving the right pubic bone which showed mild expansion and predominantly lytic in nature with associated lobulated soft tissue between pectineus and adductor muscles suggestive of a neoplastic etiology . subsequently a ct guided biopsy of the pubic soft tissue lesion the histopathological examination of the biopsy material showed fibrocollagenous soft tissue with multiple deposits of urate crystals surrounded by several multinucleated giant cells , histiocytes and lymphocytes . the above histopathological report confirmed the diagnosis of gouty tophus and ruled out other crystallopathy such as pseudogout . it is suggestive of extensive osteolytic involvement and cortical erosion of the right pubis bone coronal and axial t1 mri images of the pelvis shows the expansile oseolytic lesion of the right pubis with associated lobulated soft tissue involvement ( arrow shown ) . these are the coronal and axial t1 magnetic resonance images of the pelvis which shows a hypointense lesion of the right pubis bone . there is evidence of cortical break with associated lobulated soft tissue between pectineus and aductor muscles . these findings are most likely suggestive of a neoplastic etiology like metastases or multiple myeloma treatment was started with colchicine 0.6 mg twice daily , and morphine was required for adequate analgesia . after 48 hours , she was able to mobilise independently with a frame and was discharged home several days later . subsequently , low dose allopurinol was added under the colchicine cover and was slowly titrated to a maximum dose of 150 mg daily . gout is a metabolic disease , characterized by the deposition of monosodium urate crystals in the interior of the joints and peri - articular tissues . this condition occurs in patients with serum concentrations of uric acid greater than 7 mg / dl , either due to an increase in production or a decrease in excretion . gout is a disease more commonly found in men than in women ( i.e. , 9 male cases for each case in a woman ) and usually occurs during the 5th and 6th decades of life . the disease can manifest in four forms : asymptomatic hyperuricemia , gouty arthritis , intercritical gout , and chronic tophaceous gout . in the chronic phase of the tophaceous gout , these crystals are surrounded by cells that typically characterize an inflammatory response , including immature fibroblasts , lymphocytes , plasma cells , macrophages , and foreign body giant cells . the initial clinical presentation is often due to the involvement of the first metatarsophalangeal joint , followed by the ankles , knees , wrists , and the interphalangeal hand and shoulder . gouty tophi have been documented to occur after 5 years of the development of arthritis and are usually visible under the skin , joints , and limbs . they are commonly found in the olecranon bursa , the infrapatellar and achillestendons , in the subcutaneous tissue of the extensor surfaces of forearms , on the joints , and occasionally in the helix handset . gouty tophi have been reported in other unusual locations , such as the arytenoid cartilage , vocal cords , laryngeal tophi , myocardium , cardiac conduction system , mitral and aortic valves , eyes , and spinal cord . the primary medical treatment for chronic tophaceous gout includes alterations in lifestyle ( i.e. , weight reduction , low - purine diet , high fluid intake , reduced alcohol consumption , and withdrawal of diuretics ) . if the hyperuricemia can not be corrected by these methods , we will have to use drugs . probenecid is a uricosuric drug that can be used in patients with good kidney function , who excrete some uric acid . in patients with renal failure , and who are taking diuretics the use of uricosurics has permanently decreased tophaceous gout and the associated arthritic changes by almost 50% when compared with their disuse . in the present case , our patient was treated with allopurinol ; due to which the pain subsided and the tophi were moderately controlled . surgical treatment may be indicated depending on the extent of the patient s problem , the response to therapy and the functional impairment due to the compression of structures . tophaceous gout can be the first manifestation of gout and can exist even in the absence of arthritis . chronic tophaceous gout classically occurs after 10 years or more of recurrent polyarticular gout , and the development of tophi in the absence of prior episodes of gouty arthritis is unusual . tophaceous gout affecting the symphysis pubis is an extremely rare event , with only 2 reported cases in the literature [ 8 , 9 ] . radiographic findings along with the facts that this patient had no prior history of gout and considering the unusual location of the gouty tophus makes this case unique gouty tophus can be the first manifestation of gout and can exist even in the absence of arthritis . clinicians should be aware of both the above possibilities and investigate thoroughly in such cases . however tophus can be the first presentation of gout and it can occur in unusual locations . hence , physicians should be vigilant when unusual signs and symptoms occur in a patient with gout . | introduction : chronic tophaceous gout classically occurs after 10 years or more of recurrent polyarticular gout .
however , tophi can also occur as first sign of the disorder.case report : we report the case of a 60 year female with tophaceous involvement of the pubis bone which is an unusual location for this type of pathology without any prior manifestation of gouty arthritis.conclusion:tophi can present in unexpected locations , even as the first sign of gout , often mimicking infection and neoplasia and vigilance is required when unusual symptoms or signs occur in a patient with gout . |
differences in gene expression account for the majority of phenotypic differences between males and females of sexually dimorphic species 1 . thus , accurate identification of genes differentially expressed between males and females , i.e. sex - biased genes , is crucial for understanding the current state and evolution of the genomic architecture and mechanisms producing sexual dimorphism . the majority of sex - biased expression detected with microarrays in drosophila occurs in gonads ( e.g. 2 ) , suggesting that accurate identification of sex - biased genes should be based on gene expression measurements in these sex - specific organs . to take advantage of the increased sensitivity of whole - transcriptome sequencing ( rna - seq ) , to avoid the limitations of whole body ( wb ) samples for detecting sex - biased gene expression , and to better understand sex - biased gene evolution in drosophila , we sequenced testis and ovary mrnas from d. pseudoobscura , d. ananassae , and d. yakuba . flies were grown on cornmeal - molasses agar at 20c ( d. pseudoobscura 14011 - 0121.94 ) or 25c ( d. ananassae 14024 - 0371.13 and d. yakuba csn ) . virgin flies were collected and aged 6 - 10 days before dissecting 2 - 3 replicates of testes or ovaries . illumina truseq rna kits were then used to poly - a+ select mrna , reverse - transcribe mrna using random priming , shear cdna into 120 - 200 bp fragments , and produce libraries for 1x50 bp sequencing on an illumina gaiix or hiseq2000 ( table s1 ) . illumina 's real time analysis v1.13 module processed raw images , called bases , and provided base qualities . we downloaded d. pseudoobscura r3.1 and d. ananassae r1.3 reference genomes and annotations from flybase ( http://flybase.org ) , and modencode wb and reproductive tract rna - seq data 3 from ncbi ( table s1 ) . all reads were mapped to the appropriate reference genomes using bowtie v2.1.0 with default parameters 4 . other d. pseudoobscura datasets 5 and our d. yakuba samples currently consist of one replicate and are likely unsuitable for sex - biased gene identification . we identified sex - biased genes in wb , reproductive tract , or testis / ovary samples using cuffdiff v2.1.0 with default options , which include pooled sample dispersion estimates and geometric normalization of gene - level counts 6 , and edger v3.4.0 7 . we generated gene - level count data for edger with htseq v0.5.4p3 using uniquely - mapped reads and the intersection - nonempty method to assign reads to genes 8 . counts were full - quantile normalized within samples by gc - content and between samples using the edaseq r package 9 . in both cuffdiff and edger analyses genes were called sex - biased if the benjamini - hochberg 10 false discovery rate was < 0.01 . cuffdiff and edger results are shown in table 1 . in general , cuffdiff resulted in greater overlap than edger of the sex - biased genes found in both wb and testis / ovary analyses ( pearson 's , p < 1e-04 ) , while edger was more sensitive . first , testis / ovary analyses detect more ( d. ananassae : 3.3 - 5.0-fold ; d. pseudoobscura : 1 - 1.4-fold ) sex - biased genes than wb analyses ( pearson 's , all p<1e-04 ) . second , testis / ovary analyses significantly improve our power to detect the smallest class of sex - biased genes found in wb analyses . for example , 5.5 - 25.3-fold more female - biased genes are found in d. ananassae testis / ovary analyses than wb analyses ( pearson 's , p<1e-04 ; table 1 ) . we examined the magnitude of the log fold change of expression levels between testis and ovary or male and female whole body to better understand the difference between the two analyses ' results . male - biased genes ( mbgs ) and female - biased genes ( fbgs ) show larger magnitudes of log2 fold changes ( i.e. log2[expression level in male tissue/ expression level in female tissue ] ) in testis / ovary analyses than in wb analyses ( figure s1 ) . for mbgs , for example , higher log2 fold change in expression in testis / ovary relative to wb analyses could be caused by i ) lower expression in ovary than in female wb , ii ) higher expression in testis than in male wb , or iii ) both higher expression in testis and lower expression in ovaries relative to wbs . we examined genes called sex - biased in testis / ovary but not in wb cuffdiff analyses . consistent with scenario iii ) , mbgs have significantly lower expression in ovary and higher expression in testis relative to female and male wb , respectively , in both species ( t - tests , all p < 1e-05 ) . fbgs also follow scenario iii ) ( t - tests , p<1e-05 ) , except d. pseudoobscura female expression levels are not different between wb and ovary . similar d. pseudoobscura wb and ovary fbg expression levels may be expected if fbgs are enriched with broadly - expressed genes as they are in d. melanogaster 5,11 . except for the latter observation , these general results are consistent with the idea that gonad samples " concentrate " sex - biased expression relative to wb . in contrast to sex - biased genes , genes that were tested and unbiased in both testis / ovary and wb analyses do not have significantly different expression levels in whole male / testis or whole female / ovary in either species ( t - tests , all p>0.05 ) , except d. ananassae whole female expression levels are significantly higher than ovary levels ( t - test , p < 1e-05 ) . this could indicate that d. ananassae ovary rna contributes less to the wb rna pool relative to other species 2 , resulting in less detectable female bias in wb samples . these results also highlight the utility of this dataset for determining differences in sex - bias between drosophila species , and to assess fine - scale differences in expression across the genus . finally , more mb and fb genes were detected in d. pseudoobscura reproductive tract samples than testis / ovary analyses ( table 1 ) , which agrees with the hypothesis that the majority of sex - biased gene expression occurs in sex - specific organs . for instance , drosophila male reproductive tracts include seminal vesicles and accessory glands , which have additional sex - biased genes not expressed in testis . expression profiles of those particular sex - specific organs would also improve the assessment of sex - biased genes . | phenotypic differences between males and females of sexually dimorphic species are caused in large part by differences in gene expression between the sexes , most of which occurs in the gonads . to accurately identify genes differentially expressed between males and females in drosophila , we sequenced the testis and ovary transcriptomes of d. yakuba , d. pseudoobscura , and d. ananassae and used them to identify sex - biased genes in the latter two species .
we highlight the increased sensitivity and improved power of sex - biased gene detection methods when using our testis / ovary data versus male and female whole body transcriptome data .
we thus provide a resource specifically designed to accurately identify and characterize sex - biased genes across drosophila .
this dataset is available through ncbi geo accession gse52058 . |
recent progress in stem cell biology has opened up the possibility of new cell - based therapeutic approaches in regenerative medicine . to apply the cell - based therapies to patients with various diseases , including heart diseases , diabetes , and neural degenerative disorders , preparation of cells for tissue regeneration will be one of the highest hurdles to overcome . many different types of cells have been cultivated for this purpose , among which stem cells of various origins are the most promising materials because of their high propagation capability and diverse differentiation potentials . in general , cells that compose solid tissues in vivo thus , colony formation in three - dimensional culture matrices can be used as a selection tool for cells with a capacity of anchorage - independent growth . stem cells possess normal cell properties , form solid tissues in vivo , and grow with attachment to culture substrates in a monolayer culture . however , many types of stem cells , including neural stem cells and mammary gland cells , have been shown to grow in suspension . three - dimensional culture systems can support growth of stem cells without a niche . we previously reported the utility of a three - dimensional culture system using a thermo - reversible gelation polymer , mebiol gel , to isolate neural and skin stem cells . in this concise review , we focused on the application of mebiol gel for stem cell culture and regenerative medicine . a thermo - reversible gelation polymer , mebiol gel , is a copolymer composed of thermoresponsive polymer blocks [ poly(nisopropylacrylamide - co - n - butyl methacrylate ) poly(nipaam - co - bma ) ] and hydrophilic polymer blocks ( polyethylene glycol [ peg ] ) . the thermoresponsive blocks are hydrophilic at temperatures below the sol - gel transition temperature and are hydrophobic at temperatures above the sol - gel transition temperature . the hydrophobic interaction results in formation of a homogenous three - dimensional polymer network in water . the sol - gel transition temperature can be controlled by altering the chemical composition of nipaam - co - bma and peg . cells or tissues can be embedded in liquid mebiol gel solution at lower temperatures and cultured three - dimensionally in a hydrogel state at 37c . a number of new in vitro and in vivo applications of mebiol gel have been reported . for example , mebiol gel has been used for wound dressing , microcapsules for pancreatic islets , a drug delivery system , and three - dimensional culture matrices for various cells . extracellular matrices , including collagen and matrigel , have been used as scaffolds for clonal expansion of cells in three - dimensional culture . materials from biological sources , however , can not be absolutely free from contamination with unknown substances , including pathogens . these studies demonstrated that mebiol gel was not toxic to cells but suppressed the growth of fibroblasts , which usually grow in an anchorage - dependent manner in vitro . madhavan et al . reported that mebiol gel continuously supported the growth of animal cell lines without showing any toxicity . reported that collagen gel by itself altered the gene expression profile of mesenchymal stem cells but that mebiol gel did not . we compared the effect of mebiol gel with that of representative scaffolds , i.e. , type i collagen and matrigel . the neuroblastoma cell line sh - sy5y has been reported to differentiate into neuronal cells in vitro . in type i collagen gel or in matrigel , the cells showed an elongated shape and formed many processes ( figure 1c , 1d ) . in mebiol gel , however , the colonies that formed were completely round , and no interaction between cells and the matrix was indicated ( figure 1e , 1f ) . our data indicated that mebiol gel is a suitable scaffold for three - dimensional culture of certain types of cells without unexpected interaction . sh - sy5y neuroblastoma cells were cultured on an uncoated dish ( a ) , on a type i collagen - coated dish ( b ) , in a type i collagen gel at day 4 ( c ) , in matrigel at day 3 ( d ) , and in mebiol gel at day 4 ( e ) and at day 7 ( f ) . clonal expansion of stem cells from primary culture has great significance because it is the only way to determine the range of differentiation potential and self - renewing capacity of individual cells . in our previous study , we also succeeded in isolation of multipotent stem cells from mouse embryonic skin using mebiol . embryonic stem cells and induced pluripotent stem ( ips ) cells were also shown to form spheroids in mebiol gel in a clonal manner . when mouse ips cells ( ips - mef - ng-20d-17 ) were inoculated in mebiol gel , spheroids were formed from single cells ( figure 2a ) . the spheroid - forming ips cells stably expressed a stem cell marker , nanog ( figure 2b ) . a stem cell marker , nanog , was expressed in spheroid - forming cells ( b ) . these results indicate that mebiol gel is a potent tool for isolation and propagation of stem cells of a broad variety of origins . mebiol gel has been experimentally used as an artificial pancreas and wound dressing material in the treatment of skin defects and has been proved to be effective . nagaya et al . reported that liver regeneration was accelerated by mebiol gel treatment.28 when the surgical defect was covered with mebiol gel , fibrosis was suppressed and proliferation of hepatocytes was enhanced . in the process of regeneration , reported that human corneal limbal epithelial cells could be cultivated in mebiol gel and that the cells showed both limbal and corneal phenotype . sitalakshmi demonstrated that transplantation of limbal epithelial cells grown in mebiol gel could reconstruct the surgically damaged corneal epithelium in a rabbit model . since mebiol gel is a synthetic and biodegradable polymer , it rarely induces adverse immune response , contrary to future application of allogeneic biomaterials such as human amniotic membrane . these observations demonstrated that mebiol gel provides suitable environments for tissue regeneration without adverse inflammatory responses . in conclusion , three - dimensional culture of stem cells using mebiol gel has the following advantages : ( 1 ) it enables clonal expansion of stem cells from single cells , ( 2 ) it is simple and easy without the need for a sophisticated apparatus such as a cell sorter , and ( 3 ) s ince mebiol gel is a purely synthesized copolymer , it is free from biological contamination . thus , mebiol gel is suitable for preparation of cells for transplantation and is useful for direct application to promote regeneration of damaged tissues in vivo . | recent studies have revealed the possible utility of a three - dimensional culture system using a thermo - reversible gelation polymer , mebiol gel .
it is a purely synthesized biocompatible copolymer composed of thermoresponsive polymer blocks [ poly(n - isopropylacrylamide - co - n - butyl methacrylate ) poly(nipaam - co - bma ) ] and hydrophilic polymer blocks ( polyethylene glycol [ peg ] ) .
mebiol gel is characterized by its temperature - dependent dynamic visccoelastic properties .
mebiol gel is used as a biocompatible scaffold for three - dimensional culture without any toxicity .
representative biological scaffolds for three - dimensional culture , i.e. type i collagen and matrigel , interact with cells and affect cellular functions , but mebiol gel hardly showed such effects . because of its innertness , mebiol gel enables clonal expansion of single stem cells .
application of mebiol gel to tissue defects in animal models revealed that mebiol gel enhanced tissue regeneration with activation of stem cells and prevention of inflammation .
thus , mebiol gel is suitable for preparation of cells for transplantation and is useful for direct application to promote regeneration of damaged tissues in vivo . |
cataract surgery with intraocular lens ( iol ) implantation is the most common ophthalmic surgical operation . the mean annual incidence of postoperative endophthalmitis ( poe ) among cataract patients ranges from 0.05 to 0.14% [ 15 ] . in practice , ophthalmologists apply topical antibiotic drops to prevent this rare but potentially devastating complication . [ 3 , 68 ] . an american society of cataract and refractive surgery ( ascrs ) survey ( n = 1312 ) showed that fourth - generation fluoroquinolones were preferred by most surgeons ( 81% ) for infection prophylaxis after surgery . the topical fourth - generation fluoroquinolone moxifloxacin has proven advantageous over older fluoroquinolones as well as other topically available antimicrobials . it has a broader spectrum of action and excellent penetration into eye tissues and is able to deliver a concentration thousands of times the minimum inhibitory concentration [ 1013 ] . topical corticosteroids such as dexamethasone are applied with infection prophylaxis to minimize , if not eliminate , the inflammatory reaction expected after surgery . it has been reported that treatment with combined steroid - antibiotic eye drops was effective in preventing infection and controlling inflammation after phacoemulsification and iol implantation [ 1416 ] . in our setting , as well as in other developing nations , financial capabilities of patients and expenditure restrictions from health care organizations demand cost effectiveness . a fixed - combination eye preparation not only helps in cutting costs but also improves patient compliance due to convenience in dosing and application . its efficacy and tolerability in ophthalmic surgery has been evaluated [ 15 , 17 ] . however , its clinical use in asian patients with cataract has not been reported . the purpose of the present study was to evaluate the efficacy and tolerability of the combination formulation in the prevention of postoperative inflammation and infection following phacoemulsification in predominantly asian patients . this 15-day , open - label , and single - arm clinical trial was conducted at the american eye center , philippines . the center 's institutional review board approved the study protocol , which followed the principles set forth in the declaration of helsinki . adult patients ( 18 years ) with a diagnosis of cataract underwent clear cornea incision phacoemulsification with iol implantation . patients who presented with the following conditions were excluded : uncontrolled glaucoma , intraocular hypertension , diabetes mellitus , iris atrophy , chronic or recurrent ocular inflammatory disease ( i.e. , iritis , scleritis , uveitis , iridocyclitis , and rubeosis iridis ) , intraocular inflammation , or ocular pain in the study eye prior to the surgery . the use of any ocular antimicrobial drug within 30 days prior to enrollment in the study , nonsteroidal anti - inflammatory drugs or systemic or topical steroids within 14 days prior to enrollment , or a topical prostaglandin analogue four days prior to the surgery until the completion of the study also excluded patients from the study . patients were instructed to instill one drop from a labeled bottle of moxifloxacin 0.5%/dexamethasone 0.1% ( vigadexa ) 4 times a day in the conjunctival sac of the eye to be operated on beginning from day 1 ( 1 day before the surgery ) until day 15 ( 15 days after the surgery ) . on day 0 ( surgery day ) , the patient was dosed by the study nurse . the patients underwent phacoemulsification ( 2.2 mm clear cornea incision ) using the infiniti vision system ( alcon laboratories , inc . , fort worth , tex , usa ) followed by implantation of a single - piece aspheric hydrophobic acrylic iol ( acrysof iq , alcon laboratories , inc . , viscoelastics used were sodium chondroitin sulfate - sodium hyaluronate ( viscoat , alcon laboratories ) and sodium hyaluronate ( provisc , alcon laboratories ) and were removed using coaxial irrigation and aspiration with a vacuum level of 600 mm hg . all cases were done using the same surgical technique . preoperative and intraoperative medications included tropicamide / phenylephrine , povidone - iodine local antiseptic and topical proparacaine hcl , and intracameral lidocaine anesthesia . during the screening visit ( within 14 days prior to surgery ) , baseline values of both eyes were recorded for best - corrected visual acuity ( bcva ) in logmar , and intraocular pressure ( iop ) was measured by goldman applanation tonometry . patients were examined for the presence of anterior chamber ( ac ) cells and flare and any pathology of the eyelids , conjunctiva , and cornea through slit - lamp biomicroscopy . a dilated fundus examination was performed to examine the retina , macula , choroid , vitreous , and optic nerve . patients were seen postoperatively on days 1 , 3 , 8 , and 15 . at each visit , patients were examined for signs of infection , inflammation , and ocular pain . ac inflammation , a major criterion of effectiveness , was evaluated based on the number of cells per high - power field measured using the narrowest slit beam of the lamp ( 0.5 at a height of 8 mm ) and was recorded on a 04 point scale , where 0 indicates less than 5 cells , 1 = 510 cells ( mild ) , 2 = 1120 cells ( moderate ) , 3 = 2150 cells ( marked ) , and 4 indicates more than 50 cells ( hypopyon , severe ) . ocular pain was scored by patients subjectively ( 0 = none , 1 = minimum , 2 = mild , 3 = moderate , 4 = moderately severe , and 5 = severe ) . additionally , structural changes and signs of inflammation in the eyelids / conjunctiva and cornea were evaluated by slit lamp ( 0 = absence of active inflammation and 1 = presence of active inflammation ) . those with at least one follow - up visit after the surgery were included in the per - protocol ( pp ) analysis ( n = 60 ) . a fisher 's exact test of independence was employed to evaluate the differences in the percentage of patients with a score of zero for ac cells at each visit before and after treatment . the ocular signs score was analyzed using the cochran - mantel - haenszel ( cmh ) test with rank score . the replacement of missing values was adopted for the pp population according to the last value option carried forward technique . sixty - four patients ( 27 male and 37 female ) were enrolled in the study . the mean age was 68 years 11.4 years ( sd ) ( range from 34 to 86 years ) . two were lost to followup , and two were shifted to moxifloxacin ( vigamox ) and prednisolone acetate ( pred forte ) on day 1 due to severe ocular inflammation . an increased inflammatory response was observed for the first few days after surgery which gradually declined until day 15 ( table 1 ) . on day 1 , 85% of patients had ac cells grade 02 , while 15% had grade 3 . the number of patients with grade 3 ac cells decreased to 1.7% on day 3 . on day 15 , 91.7% had grade zero ac cells and only 1 patient had moderate inflammation . at the end of the study , 96.9% did not experience eye pain , while 3.1% rated their eye pain as minimum . signs of active inflammation in the eyelid / conjunctiva and cornea significantly decreased from day 1 postoperatively to day 15 . at day 1 , inflammation was documented in 9.4% ( n = 6 ) of eyes in the eyelid / conjunctiva , while the same was observed in the cornea in 23.4% ( n = 15 ) of eyes ( table 2 ) . at the end of the study , signs of inflammation in the eyelid / conjunctiva and in the cornea were seen in only 1 eye and in 2 eyes , respectively . the bcva improved from a mean of 0.5 logmar preoperatively to 0.0 logmar on day 15 ( p < the mean iop was recorded at 17 mm hg . the mean iop was maintained postoperatively in the range of 12 - 13 mm hg over the course of the 15-day treatment ( figure 2 ) . no abnormality was found in the fundus of the study eyes at exit from the study . our study assessed the efficacy of a fixed - combination moxifloxacin 0.5%/dexamethasone 0.1% formulation ( vigadexa ) in the prevention of postoperative inflammation and infection following phacoemulsification in mostly asian patients . at the completion of the study , a score of 0 for ac cells less than 5 was found in 91.7% ( 55/60 ) of eyes . patients with an ac reaction higher than grade 0 did not complain of any ocular discomfort or blurring of vision . they were , however , given topical fluorometholone four times daily dosing for one week after discontinuing vigadexa with resulting resolution of the inflammation . on the 1st postoperative day , more than half ( 55% ) had moderate to marked ac cell grading , which decreased to 21.7% by day 3 and to 3.3% by day 8 ( table 1 ) . this is consistent with the postoperative ac reaction pattern the investigators observed in cases where separate antibiotic and corticosteroid eye drops were given after cataract surgery . the postoperative inflammatory pattern in the eyelid / conjunctiva and cornea was judged by the investigators as consistent with previous observations . all these were reflective of the mild ocular changes expected to occur as a result of surgery . in this small population of 60 eyes , however , the rarity of the event and the size of the study population did not allow us to make statistically significant conclusions about the effectiveness of the medication in preventing poe . prior to our single - arm trial , the efficacy of the fixed combination had already been established in a study by freitas et al . in a brazilian population . in this randomized , parallel - group trial ( n = 139 ) , the combination moxifloxacin 0.5%/dexamethasone 1% was as effective in preventing infection and controlling inflammation postoperatively compared to when its individual components were administered concurrently . the current study also evaluated the safety and patient acceptance of the fixed - combination preparation of moxifloxacin 0.5% and dexamethasone 0.1% . the formulation was well tolerated by patients ; patients did not report any discomfort during or immediately after its application . no corneal or other ocular surface signs attributable to medication toxicity as well as drug - related adverse events were observed during the entire duration of the study . this can be attributed to the tolerability profile of the drug and ease of administration . patients will comply with instilling an eye drop that does not sting , burn , cause redness , or blur vision . furthermore , applying less number of drops makes it easier for patients to remember and adhere to the dosing regimen . with a combination preparation , patients no longer have to wait a minimum of five minutes to instill a drop from a separate medication to prevent a wash - out effect [ 16 , 18 , 19 ] . the formulations of netilmicin - dexamethasone , tobramycin - dexamethasone , and neomycin - polymyxin - dexamethasone effectively controlled postoperative inflammation and were well tolerated , as described in comparative trials with caucasian patients [ 16 , 18 , 20 ] . the fixed - combination moxifloxacin 0.5%/dexamethasone 0.1% formulation was found to be well tolerated and effective in minimizing inflammation following cataract surgery in asians . because vigadexa is a relatively new medication , further clinical trials with larger number of patients are warranted to further demonstrate and confirm its long - term safety and efficacy profile , particularly in the prevention of endophthalmitis . | background .
the use of a fixed - combination antibiotic corticosteroid for infection prophylaxis in asian patients undergoing phacoemulsification has not been reported .
methods . a 15-day , open - label ,
single - arm trial of 64 patients for phacoemulsification with intraocular lens ( iol ) implantation is described .
patients applied moxifloxacin 0.5%/dexamethasone 0.1% ( vigadexa ) eye drops four times daily before and until 15 days after surgery .
anterior chamber ( ac ) reaction , visual acuity , ocular pain and signs , and intraocular pressure ( iop ) were assessed at baseline and on postoperative days 1 , 3 , 8 , and 15 .
results . at day 15 ,
55 ( 91.7% ) patients scored 0 ( < 5 cells ) in ac reaction .
no surgery - related infection occurred .
mean best - corrected visual acuity improved 0.5 logmar from baseline to 0.0 logmar ( p < .0001 ) .
mean iop remained at 12 - 13 mm hg over the 15-day
treatment .
only 2 patients ( 3.1% ) reported minimum ocular
pain .
two ( 3.1% ) patients were shifted to prednisolone acetate
for severe inflammation . at the end of the study period ,
8.3%
were given fluorometholone for 1 week for ac reaction grade
> 0 .
no drug - related adverse event was reported .
conclusion .
following phacoemulsification and iol
implantation , the topical combination moxifloxacin
0.5%/dexamethasone 0.1% was effective in preventing
infection and controlling inflammation and was well
tolerated . |
abdominal aortic aneurysms ( aaa ) can be repaired with an aortic bifemoral bypass graft , which is considered an ideal procedure for aortic aneurysms , aorto - iliac disease or aortic atherosclerosis . though rare , infections involving the graft can happen , typically , two to five years following implantation . anaerobic , non - sporulating , gram - positive bacilli from the normal human gut flora can occasionally be implicated in invasive diseases . notably , eggerthella lenta , formerly known as eubacterium lentum , often causes clinically significant bacteremia with a significant mortality rate . herein we report a case of an aortobifemoral bypass graft with an aortoenteric fistula , giving rise to a very rare bacteremia caused by the species eggerthella lenta . a 75-year - old male with a past medical history significant for type 2diabetes mellitus , hypertension , chronic thrombocytopenia and chronic kidney injury underwent resection of a ruptured aaa and placement of an aortobifemoral bypass graft . his postoperative course was eventful for renal failure , which required four cycles of dialysis with improvement . twenty - nine months later , the patient was seen in the emergency department with a two - day history of rigors , dysuria , polyuria and burning micturition complicated by fever , weakness and lethargy observed by his family on the day of admission . blood pressure upon examination was 70/35 mmhg , rising to 90/48 mmhg after a fluid bolus ; temperature was 101 degrees fahrenheit ; heart rate 90/min ; and respiratory rate was 20/min . blood work was significant for a white blood cell count of 18,000 ; lactic acid of 4.1 , 20 percent bands and platelet count of 20,000.urinalysis was remarkable for white blood cells , red blood cells and moderate leukocyte esterase . physical examination revealed diffuse abdominal tenderness , and peri - umbilical tenderness with deep palpation without peritoneal signs.the patient was admitted to the intensive care unit with a diagnosis of severe sepsis secondary to urinary tract infection with high anion gap metabolic acidosis secondary to lactic acidosis . blood cultures and urine cultures were drawn , which demonstrated eggerthella lenta septicemia and escherichia coli extended spectrum beta - lactamase ( esbl)-positive urinary tract infection . a subsequent abdominal computed tomography ( ct ) with contrast demonstrated induration with inflammatory changes around the aortobifemoral bypass graft . furthermore , the graft showed stranding around the aorta near the iliac components with presence of an air bubble between these components [ figure 1 ] . this finding raised the possibility of gas producing infection or an aortoenteric fistula communicating with an adjacent loop of bowel , either of which could have feasibly contributed to the aortic graft harboring eggerthella lenta . the patient was recommended to have graft replacement surgery with repair of the fistula in order to remove the source of infection ; however , he refused , preferring to be treated with iv antibiotics instead , despite the considerable risk . repeated blood cultures after treatment with antibiotics were negative and the patient was discharged home on antibiotics as an outpatient with the possibility of requiring chronic suppression with antibiotics . ct scan of the abdomen and pelvis showing an induration with inflammatory changes around the aorto - iliac graft and an small air bubble ( yellow arrow ) between the two legs of the graft , possibly caused by a fistulous communication with the bowel aortoenteric fistulas can involve any part of the small or large bowel , but it is more common to find them in the third and fourth portions of the duodenum . mucosal bleeding can be one of the signs as erosions of the graft into the intestines can precede massive gastrointestinal bleeding from an established aortoenteric fistula . staphylococcus aureus and gram - negative bacilli , accompanied by fever , signs of infection and leukocytosis , typically cause early infections ( less than four months after repair ) . the presentation of late - onset infections can be subtle without any specific signs or symptoms with an absence of fever being common . in fact , in few studies , the absence of fever and stay in the intensive care unit ( icu ) , was associated with an increased risk of mortality . they can also present with complications of the graft infection , such as a pseudoaneursym , sepsis or bleeding . our patient did have fever , leukocytosis and hypotension , but thiscould have been caused by his concurrent urinary tract infection with e. coli . it is possible that had this patient not had symptoms from his urinary tract infection , his bacteremia may have been missed . the use of graft devices for repair of an aaamay require a complex , open - air procedure with exposure of the compromised vessel . this , of course , increases the risk of an infectionfrom the device as well as the wound . the incidence of aaa graft infection is low ( 0.4% to 3% ) , with one - third of those infections manifesting as aortoenteric erosions / fistula . the management of an aortoenteric fistula has typically required replacement of the affected graft and repair of the fistulae , a surgery with a mortality risk of 20 to 30 percent . bacteremia associated with the aortoenteric fistula has also been reported to have a high mortality risk . in our case , the ct scan of the patient raised the possibility of an aortoenteric fistula that was likely to be the source of the patient 's infection with eggerthella lenta . after being explained the risk of the surgery , as well as the possibility of not being able to resolve the infection without surgery , the patient declined to move forward with the procedure . although lactobacillus , clostridium and propionibacterium species are more commonly encountered , many other lesser known anaerobic gram - positive bacilli can be involved in clinical infections as well . members of this genus are anaerobic , non - sporulating , non - motile , gram - positive bacilli that grow singly , as pairs or in short chains . classification and identification of this bacterium is reliably achieved through specialized cultured blood samples identifying the gram - positive bacilli as eggerthella lenta with 94% and 99% probability and confirmed by 16srna pcr gene sequencing . eggerthella lenta can be found in many different parts of the body , most commonly in the colon and feces . bacteremia associated with this bacterium carries a high mortality rate ( 20 - 40% ) especially if it is found to be the only pathogen in the blood . eggerthella lenta has been linked with many conditions such as ulcerative colitis , crohn 's disease , sinusitis , abscesses , pelvic inflammatory disease , malignancy and pancreatic abscesses among others . nearly all infections with anaerobic bacteria originate from the patient 's own microflora ; therefore , we can conclude that this patient 's bacteremia was from his own flora , with the likely source to be the aortoenteric fistula . due to the fastidious nature of these organisms , it can be exceedingly difficult to isolate these anaerobes from the site of an infection and easy to miss . isolating them requires the appropriate method of collection , transportation and cultivation of specimens , which requires a laboratory capable of performing 16s rrna gene analysis . , it took three days in order to get a positive blood culture and another three days to identify the organism and get antibiotic susceptibility . treatment with etrapenem proved to be successful as repeat cultures were negative . though bacteremia caused by eggerthella lenta is rare , if it is present , it is almost always clinically significant and requires prompt diagnosis and treatment . we believe that patients , who have had repair of an aaa and present with abdominal pain with or without fever , should have their blood appropriately cultured for anaerobic bacteria . it should be noted that patients who undergo this procedure are recommended to have yearly ct scans performedto rule out infections or fistulas that can lead to dangerous bacteremia . | the presence of an aortoenteric fistula following aortobifemoral graft repair of an abdominal aortic aneurysm is associated with a high probability of infection leading to clinically significant bacteremia .
we report a case of an aortoenteric fistula that developed two years after initial aortic grafting resulting in colonization with the anaerobe , eggerthella lenta .
this dangerous bacterium is difficult to culture , associated with high mortality and the patient may have mild symptoms on presentation . |
a 61-year - old patient attended a consultation in a urology clinic due to complaints associated with the lower urinary tract . digital rectal examination ( dre ) revealed a slightly enlarged non - painful prostate gland with normal density and smooth contours . prostate - specific antigen ( psa ) level was 2.1 ng / ml . a urine test revealed 1015 red blood cells / hpf . the patient reported polyuria during the day and nocturia as well as persistent urgency with a normal urine stream . in an abdominal ultrasound scan no abnormalities were found in the upper urinary tract . due to the lack of effects of solifenacin therapy histopathological examination of samples from the tumor revealed : urothelial carcinoma high - grade pt1 , total resection of the lesion . in addition , carcinoma in situ was diagnosed in samples taken from the posterior wall of the urinary bladder . the patient was scheduled for intravesical immunotherapy . due to the size of the primary lesion ( 5 mm ) and the radicality of the original resection no repeated transurethral electroresection of the tumor of the bladder ( re - turt ) bacillus calmette - gurin ( bcg ) vaccine therapy was started 5 weeks after transurethral resection of the tumor ( turt ) . the vaccine was an attenuated strain of mycobacterium bovis ( onco bcg 100 formulation , biofarm , lublin , poland , containing at least 300 million live , attenuated mycobacteria of the brazilian moreau substrain dissolved in saline in 1 ampoule of 100 mg ) . after the first 2 doses the patient reported increases in body temperature of up to 37.5c as well as urgency episodes . after 6 weeks from the completion of the induction course cystoscopy and urine cytology were performed and no abnormalities were found . during a follow - up visit in a urology clinic dre revealed a very hard non - painful left prostatic lobe with an uneven surface , which was suspected of neoplastic hyperplasia . in line with the european association of urology guidelines , the patient was scheduled for a core biopsy of the prostate based on rectal examination results , despite a low psa level ( 2.1 ng / ml in the pre - operative period ) . in the group of patients with psa in the range of 2.13 ng / ml the risk of prostate cancer diagnosis is 23.9% ( european association of urology guidelines ) . twelve samples in total were collected under local anesthesia , including heterogeneously hypoechoic foci located in the peripheral zone on the left side . histopathological examination revealed multifocal low - grade prostatic intraepithelial neoplasia ( lg - pin ) in the right lobe of the prostate , while prostatitis chronica granulomatosa cum necrosi coagulativa telarum was found in samples from the right lobe , indicating a serious suspicion of tuberculosis origin of the lesions . the patient received consultation in a tuberculosis clinic ; however , no indications were found for anti - tuberculosis treatment . eight months after turt cystoscopy , dre and trus were conducted and samples were taken from lesions with suspected cancer relapse . rectal examination after 2 months from the biopsy revealed a non - painful , very hard left lobe of the prostate with an uneven surface . trus conducted in a reference center revealed an enlarged prostate of 45.6 ml in volume . the peripheral zone on the left , the apex of the prostate in the midline and the area of the membranous urethra on the left were hypoechoic ( fig . 1 , 2 , 3 , 4 , 5 ) . fine hyperechoic foci with the largest one characterized by reverberations ( probably gas ) were found ( fig . hypoechoic lesion ( 22 mm 20 mm ) located in the peripheral zone on the left corresponds with a hard nodule transrectal ultrasound of the prostate . bulky hypoechoic lesion originating from the peripheral zone of the left prostatic lobe transrectal ultrasound of the prostate . color doppler examination demonstrating blood flow within the suspicious lesion transrectal ultrasound of the prostate . hypoechoic lesion reaching beyond the midline part of the prostate transrectal ultrasound of the prostate . hypoechoic lesion in grayscale is heterogeneously hard in elastography mode transrectal ultrasound of the prostate . reverberation bands found within the nodule in line with the european association of urology guidelines , due to the presence of a high - grade neoplasm in the original turt the patient underwent cystoscopy every 3 months . liquid - based urine cytology was also regularly performed due to the original diagnosis of carcinoma in situ . in histopathological examination of samples taken during flexible cystoscopy low - grade intraurothelial neoplasia was found in a 1-millimeter sample taken from the neck / left wall and posterior wall . a relatively intense chronic inflammatory infiltration with epitheloid cell granuloma was observed in a sample from a polypous mucosa of the prostatic urethra . in rectal examination performed 9 months after turt the prostate was very hard on the left side . transrectal ultrasound scan revealed a peripheral zone on the left side filled with hypoechoic foci with signs of extraprostatic infiltration ( fig . 7 , 8) . a core biopsy of the prostate was conducted under neurovascular bundle block . three samples each were taken bilaterally from the base and four samples each were taken bilaterally from the apex ( fig . extraprostatic infiltration at the prostatic apex on the left side transrectal ultrasound of the prostate . biopsy of the suspicious lesion infiltrating periprostatic fatty tissue the histopathological report stated the following : inflammatione chronica partim granulomatosa et cum necrose focali in samples from the base of the left lobe . inflammatione chronica partim granulomatosa et cum necrose focali in the apex of the left lobe necrosis ( upper left ) and two multinucleated langhans - type giant cells ( arrows ) are visible during a follow - up visit in a clinic 14 months after turt rectal examination revealed a very hard , non - painful left lobe of the prostate . bcg therapy is currently the most effective immunotherapy method used for the treatment of non - muscle - invasive transitional cell carcinoma of the bladder . due to the common use of this type of therapy urologists are aware of the most frequent adverse reactions occurring during the therapy , both local and systemic ones . granulomatous prostatitis of tuberculosis origin is an exceptionally rare complication of intravesical therapy . in approximately 40% of cases symptomatic , mycobacterial prostatitis , which requires a 3-month antimycobacterial drug therapy , may be accompanied by symptoms of irritation in the lower urinary tract , pain in the perineum , episodes of hematuria towards the end of micturition , sterile purulent discharge from the urethra and compromised fertility . histopathological assessment of samples taken from the prostate is recommended if elevated psa levels persist for more than 3 months . however , no algorithm of optimal treatment has been determined for the cases in which granulomatous prostatitis with little or no symptoms is diagnosed . the patient was referred for a core biopsy of the prostate due to a justified suspicion of concomitant bladder and prostate cancer . in the early follow - up period the presence of a hard or even very hard , non - painful lesion was determined already after an induction course of bcg , while no signs of prostatitis were observed . gray - scale , doppler and elastography ultrasound scans showed a hypoechoic lesion with irregular contours , distinct blood flow and significantly increased density , which did not lose sonographic signs of malignant hyperplasia and even seemed to infiltrate the extraprostatic area despite the discontinuation of the intravesical therapy . an atypical finding for a prostate ultrasound image were fine hyperechoic foci with reverberation bands dispersed in the hypoechoic lesion , which could have corresponded to necrotic foci found in biopsy specimens . unfortunately , transrectal ultrasound imaging does not offer sufficient ability to differentiate between hypoechoic lesions of inflammatory and/or neoplastic nature . although rectal examination performed before the instillations demonstrated only enlargement of the prostate that suggested benign , adenomatous hyperplasia , unfortunately , a transrectal ultrasound scan was not performed at the time which could have been the point of reference for images of the prostate obtained after induction bcg therapy . therefore , in our opinion , not only thorough physical examination , but also imaging of the prostate is justified in patients referred for intravesical therapy , since it allows for comparison of the condition of the prostate with the image from before the therapy . | intravesical immunotherapy with attenuated strains of mycobacterium bovis is a widely used therapeutic option in patients with non - muscle - invasive transitional cell carcinoma of the bladder .
a rare complication of intravesical therapy with the bacillus calmette - gurin vaccine is granulomatous prostatitis , which due to increasing levels of prostate - specific antigen and abnormalities found in transrectal examination of the prostate may suggest concomitant prostate cancer . a case of extensive granulomatous prostatitis in a 61-year - old patient which occurred after the first course of a well - tolerated bacillus calmette - gurin therapy
is presented .
due to abnormalities found in rectal examination and an abnormal transrectal ultrasound image of the prostate with extensive infiltration mimicking neoplastic hyperplasia a core biopsy of the prostate was performed .
histopathological examination revealed inflammatory infiltration sites of tuberculosis origin . |
angiosarcoma ( as ) is an uncommon malignant neoplasm characterized by rapidly proliferating , extensively infiltrating anaplastic cells derived from blood vessels and lining irregular blood - filled spaces . as of the mediastinum . we present a case of as of mediastinum that was managed with recombinant activated factor vii ( rfviia ) during postoperative period . a 41 years old male presented with chief complaint of gradual onset breathlessness on exertion new york heart association ( nyha ) ii and pain in right lower chest . there was no history of haemoptysis , orthopnea or paroxysmal nocturnal dyspnea . pain in chest was dull in nature , non - radiating and relieved by taking medication . there was no history of hypertension , diabetes mellitus or any other prolonged illness . routine blood investigations including complete blood count ( cbc ) , renal and liver function tests were within normal limits . his coagulation profile including platelet count , prothrombin and activated partial thromboplastin time were also within normal limits . chest radiograph revealed bilateral pleural effusion that was later confirmed by ultrasonography of the chest . echocardiography revealed localized pericardial effusion adjacent to right atrium ( ra ) with multiple echodense nodular masses seen within pericardial cavity with constriction pathology . there was mild dilation of ra with no regional wall motion abnormality ( rwma ) . computerized tomography ( ct ) scan thorax revealed large eccentric sarcomatous mass lesion , aneurysmal dilatation of ra and bilateral pleural effusion . fine needle aspiration cytology ( fnac ) and pleural cytology revealed no active malignant or inflammatory cells . a provisional diagnosis of anterior mediastinal tumor was made and exploratory biopsy via midsternotomy was planned to confirm the diagnosis and informed consent was obtained for the same . patient was premedicated with lorazepam 2 mg and pantoprazole 40 mg a night before the surgery . on arrival in the operating room , pulse oximetry revealed oxygen saturation of 96% on air . after securing venous access , anaesthesia was induced with sodium thiopentone ( 3 mg / kg ) and fentanyl citrate ( 5 mcg / kg ) . vecuronium bromide ( 0.15 mg / kg ) was administered intravenously to facilitate tracheal intubation . anaesthesia was maintained with intermittent doses of fentanyl citrate ( 1 mcg / kg ) , vecuronium bromide ( 0.02 mg / kg ) , and isoflurane in 50% oxygen in air . intraoperative monitoring included ekg with st segment analysis , oxygen saturation , end tidal co2 , temperature and urine output , direct arterial blood pressure , central venous pressures , cardiac output and derived parameters , arterial blood gas analysis , and activated coagulation time ( act ) . transesophageal echocardiography ( tee ) revealed large cavity around ra with communication with it and there was homogenous opacity inside the cavity . heparin sulphate 4 mg / kg was administered to maintain act more than 450 seconds before initiating cardiopulmonary bypass ( cpb ) . a large necrotic vascular mass was seen in the anterior pericardium with invasion of ra and right ventricle . during dissection of the mass a rent in ra occurred which was repaired with bovine pericardial patch . weaning from cpb was uneventful . a total of three units of packed red blood cells ( prbc ) and four units of platelet concentrates ( pc ) and fresh frozen plasma ( ffp ) were transfused intraoperatively . tranexamic acid 10 mg / kg as bolus and 1 mg / kg / hr infusion was also started . patient was shifted to the postoperative recovery room for mechanical ventilation and monitoring of haemodynamics and bleeding from chest drains . in the recovery room patient was haemodynamically stable however constant bleeding was there from the mediastinum . he was planned for sternal closure on the second postoperative day after stabilisation of bleeding . however , during reopening significant oozing was still there from the surgical sites . mediastinum was again packed with only skin closure and patient was shifted to the recovery room . histopathology of the mediastinal sample gave impression of angiosracoma with microscopic findings of highly vascular mitotically active spindle cell neoplasm composed of freely anastomosing vascular channels lined up by atypical cells . he was haemodynamically stable in the postoperative period . however , constant bleeding from the chest drain was still there at 150 - 200 ml per day for next three days . therefore , he was planned for removal of pack and secondary closure of the chest . during secondary closure , significant bleeding was still there from the raw surgical surface that was not controlled even by adequate haemostasis and electrocautry . a total of nine packed red blood cells , four units of fresh frozen plasma and four units of platelet concentrate and apheresis were transfused in the recovery room . keeping in view of the intractable bleeding , massive transfusion and second reopening it was decided to administer rfviia ( novoseven , novo nordisk india ltd ) in the doses of 90 mcg / kg to this patient . after administering recombinant factor seven secondary closure of the chest was done and patient was shifted to the recovery room . after stabilization and discharge from the hospital patient was referred to oncology unit for further management and he is on a regular follow up for radiation therapy . primary angiosarcomas of the anterior mediastinum are rare tumors that need to be considered in the differential diagnosis of primary anterior mediastinal neoplasms . despite their histologic similarity to angiosarcomas at other sites , primary angiosarcomas of the anterior mediastinum appear to follow a more protracted clinical course than their counterparts in other organ systems . these tumors have a high local recurrence rate and metastasis because of their intrinsic biologic properties and because they are often misdiagnosed , leading to a poor prognosis and a high mortality rate . malignant vascular tumors are clinically aggressive , difficult to treat , and have a reported 5-year survival rate of around 20% . primary heart tumours are extremely rare in clinical practice , occurring at a frequency of 0.11 - 0.30% in surgical series and only 25% of them are malignant . as ( 75% ) is the most common primary cardiac malignant tumor and is an extremely rare , rapidly spreading vascular tumor . it is seen more commonly in males than in females , usually presenting between the third and fifth decade of life . clinical presentation is usually unspecific and can vary depending on the dimension and the site of the tumour . increasing dyspnoea , peripheral oedema , superior venacava syndrome , lung oedema , arrythmia , weakness , syncope and dizziness are the most common symptoms . potentially mortal complications are represented by pericardial effusion and thromboembolic events . as are commonly located in the ra with a high incidence of pericardial involvement . this predilection of the tumor affecting the right heart often produces right - sided congestive heart failure , superior vena cava obstruction and pericardial effusion . in this case ; the tumor was found arising from the ra presenting with pericardial effusion and symptoms of right heart failure . imaging studies like chest radiograph , computerized tomography ( ct ) and magnetic resonance imaging ( mri ) can reveal the extent and severity of tumor preoperatively . standard treatment includes extensive surgical resection followed by radio and chemotherapy to improve the survival as done in this case . perioperative management of these case warrant special care due to the presence of huge areas of necrosis and extensive loco - regional spread . anaesthetic considerations in patients with tumor involving ra include hypoxemia , low cardiac output , possible right to left shunt , and potential pulmonary emboli . optimal anaesthetic management depends on the judicious administration of anaesthetics , avoidance of cardiac depression and maintenance of preload . invasive haemodynamic monitoring and good venous access for rapid transfusion is necessary in these cases . the primary problem in this case was refractory bleeding which was controlled even by reopening and adequate haemostasis . rfviia ( eptacog alpha activated ) was introduced to clinical medicine in the 1980s as a prohemostatic agent . it is thought to act locally at the site of tissue injury and vascular wall disruption , by binding to exposed tissue factor and generating small amounts of thrombin that are sufficient to activate platelets . the activated platelet surface can then form a template on which rfviia can directly or indirectly mediate further activation of coagulation , resulting in the generation of much more thrombin and , ultimately , fibrinogen to fibrin conversion . clot formation is stabilized by inhibition of fibrinolysis , due to factor viia - mediated activation of thrombin - activatable fibrinolysis inhibitor . various authors have used rfviia safely as a rescue for refractory bleeding after cardiac surgery and found that it is associated with reduced blood loss , rapid improvement of coagulation variables , and decreased need for blood products . some authors reported use of rfviia in the setting of pulmonary haemorrhage secondary to chemotherapy for choriocarcinoma thereby preventing rapid deterioration in clinical condition and allowed salvage therapy . it has also been used as rescue in bleeding associated with obstetrics , hepatic resection , trauma , intracerebral bleed and even dental extractions apart from coagulation disorders . however , therapy with rfviia may lead to thromboembolic complications ( 10% ) and the patient may not respond . a meta - analysis showed that , in 73% of patients , rfviia achieved a reduction of bleeding and the probability of survival increased . however , data from 35 randomized controlled trials suggested that rate of arterial thromboembolic events is higher in patients who received rfviia than among those who received placebo ( 5.5% vs 3.2% , p=0.003 ) . in the present case we have found significant reduction in bleeding after administering rfviia and secondary closure of the chest was possible . , rfviia may be used as a rescue therapy in patients with malignant vascular tumors in the setting of intractable bleeding following surgical resection . | sarcomatous lesions of the mediastinum usually present as aggressive and multicentre masses often attached to adjoining structures including heart and lungs .
a forty one year male diagnosed with sarcomatous lesion in mediastinum presented for biopsy through midsternotomy later confirmed as angiosarcoma on histopathology .
patient bled excessively after surgery and required reopening of the chest .
however , bleeding could not be controlled with reopening , blood products and packing of the mediastinal cavity .
bleeding could only be controlled by using recombinant activated factor vii as rescue therapy without any adverse effects . |
a 42-year - old female visited our emergency room ( er ) with complaints of acute , diffuse abdominal pain . she had been treated for three days at a local clinic because of fever and right upper quadrant pain . the laboratory findings showed mild leukocytosis ( 11.210 cells/l ) and an elevated c - reactive protein level , and the hepatic parameters were markedly elevated . the serum hemoglobin level was 7.8 g / dl and she was transfused with whole blood . the ultrasound examination performed on an atl machine ( hdi 5000 , bothell , wa ) revealed a huge and heterogeneous lesion at the subcapsular area of the right hepatic lobe and also a perihepatic fluid collection ( fig . the differential diagnosis was hepatic subcapsular abscess or a hepatic mass such as a cavernous hemangioma draping over the liver . mdct was performed with a 4-channel scanner ( volume zoom ; siemens , erlangen , germany ) with using following parameters ; 120 kvp , 165 mas , 3 mm collimation and a 1.5 mm reconstruction interval for the arterial and portal venous phases , and 7 mm collimation and a 5 mm reconstruction interval for the unenhanced and equilibrium phase images . after injection of 120 ml of non - ionic contrast material , the arterial phase images were obtained with a 40 sec delay , and 80 sec and 3 min delays were used for the portal venous and delayed phases , respectively . coronal multiplanar reconstruction ( mpr ) was done at each phase . on the unenhanced images , about a 9 cm - sized , low density , irregular - shaped lesion was seen at the right hepatic dome . most of the lesion was not enhanced , but multiple , irregular and linear , septa - like densities were demonstrated which were of isoattenuation to the adjacent normal parenchyma on all phases ( fig . the unenhanced images also revealed a huge , heterogeneous and mainly hyperdense lesion occupying the entire right subcapsular area , and this was suggestive of acute hematoma ( fig . most of the lesion was not enhanced , except for multiple small enhancing foci that were gradually enlarged and isodense on all phases as compared with the liver parenchyma . the margin of the lesion at the junction with the normal parenchyma was shaggy and irregular . another 1 cm - sized lesion was seen at the right hepatic lobe , and the lesion was of low density on the arterial phase ; it showed peripheral isodense enhancement on the portal venous phase and it became totally isodense or slightly hyperdense on the delayed phase ( fig . the mpr images helped us view all the above - mentioned findings at a glance ( fig . angiography was performed for vascular embolization under the impression of rupture of hepatic tumor such as hepatic adenoma after the ct scan . the angiogram revealed a huge hypovascular area that conformed to the entire right subcapsular portion , which was compatible with hematoma , and an irregular parenchymal defect was seen in the hepatic dome without any feeding vessels , definite contrast accumulations or vascular malformations ( fig . so , interventional procedures were not done and the diagnosis was not changed even after angiography . the patient was given supportive care after angiography , but she suffered cardiac arrest that necessitated cardiopulmonary resuscitation . finally , emergency right lobectomy was performed about 24 hours after her er admission . at laparotomy , most of the portion of the right hepatic lobe was replaced by hematoma , and some inflammatory patches were present on the liver surface . a mass - like lesion was noted at segment 8 , which had ruptured , and this resulted in a large amount of blood and necrotic material in the peritoneal cavity . on microscopic examination , the lesion was diagnosed as peliosis hepatis which was a blood filled cavity lined by fibrinous material and hepatocytes ( fig . she was discharged about one month after surgery and has lived healthy without any symptoms or abnormal findings on follow - up ct examinations two years later . the etiology of peliosis hepatis is unknown ; however , a number of causes have been postulated and its pathogenesis remains uncertain ( 10 ) . peliosis hepatis has been considered as a rare , incidental autopsy finding that 's associated with chronic wasting diseases such as tuberculosis and malignancies . it has been associated with renal transplantation , hematologic disorders and infections such as pulmonary tuberculosis and human immunodeficiency virus . it has also been reported in patients treated with long - term with anabolic steroids , oral contraceptives , hormones or azathioprine ( 7 ) . in 25 - 50% of the cases , no associated condition has been identified , the same as in this case ( 9 ) . they range from asymptomatic to signs of acute infection and even to hepatic failure and intraabdominal hemorrhage . the patients with complicated fatal hemorrhage probably could have been successfully managed by surgical intervention such as partial hepatic resection or hepatic dearterialization , interventional selective hepatic arterial embolization or liver transplantation and adequate supportive care . although there were some cases in which the patients died after treatment , the other patients who had survived the disease became healthy without any symptoms ( 2 , 3 ) . two morphologic patterns of hepatic peliosis were described by yanoff and rawson ( 10 ) . in the phlebectatic type , the blood - filled spaces are lined with endothelium and they are based on by aneurismal dilatation of the central vein ; in the parenchymal type , the spaces have no endothelial lining and they usually are associated with hemorrhagic parenchymal necrosis . senf as reviewed by zak ( 1 ) considered the two morphological patterns as one process initiated by focal necrosis of the liver parenchyma , which transforms into an area of hemorrhage ( the parenchymal pattern ) . this pattern may progress to formation of fibrous walls and an endothelial lining around the hemorrhage ( the phlebectatic type ) , or heal by fibrin deposition , thrombosis and sclerosis of the vascular spaces . when reviewing the reports that have described the radiologic findings of peliosis hepatis with using various modalities , including angiography , us , ct and mri the imaging findings were so variable , depending on the histopathologic findings , including lesion size , the extent of communication with the sinusoids and the presence of thrombosis or hemorrhage within a lesion ( 8) . as for the angiographic appearances of peliosis hepatis , multiple small contrast accumulations or puddles have been described ( 2 - 4 ) . yet such findings were not shown in the present case because the major portion of the affected area was necrotized and replaced by hemorrhage , which attributed to delayed diagnosis and was the reason why radiologic intervention was not performed . hypoechoic or hyperechoic nodule or diffuse heterogeneous hepatic echotexture have been reported as us findings ( 5 , 6 ) . in our case , only a heterogeneous subcapsular mass - like lesion was noted and interpreted as abscess that correlated to the signs of clinical infection , but in retrospect , we could have found a hyperechoic nodule at segment 8 , which was considered to be a lesion that was demonstrated on ct scan . the mri findings for peliosis hepatis largely depend on the age or status of hemorrhage , with hypo- , iso- , or hyperintensities on t1-weighted images and hyperintensity on t2-weighted images . the contrast enhancement may be usually slow and late ( 7 - 9 ) . on the unenhanced ct , the lesions are usually of low density , but the attenuation will vary with regard to the age of the lesion , as well as the presence of hemorrhage . they have been reported to usually become isodense or slightly hyperdense at the late venous or equilibrium phase with or without a central unenhancing portion , although with the presence of hemorrhage they may show little enhancement ( 8) . ( 7 ) reported a unique pattern of the early and high enhancement with centrifugal progression on triphasic ct ; kleinig et al . ( 5 ) reported a small lesion of which density was high on the arterial and portal venous phases , respectively . in our case , a small lesion in the right lobe showed gradual and centripetal enhancement , and the attenuation was nearly the same as that of parenchyma . we suggest that this feature might be a more usual dynamic enhancement pattern on triphasic - enhanced ct , including the arterial , portal and delayed phases , in the lesions without necrotic change or other complications . until now , there has been no report describing the contrast - enhanced dynamic ct features in a case with peliosis hepatis with hemorrhagic necrosis , intrahepatic hemorrhage and rupture . here we demonstrated several features that can provide radiologists with clues suggesting that the cause of extensive subcapsular hemorrhage is a peliosis hepatis , or that a low density , mass - like lesion may be peliosis hepatis with hemorrhagic necrosis . the first clue is multiple small enhancing foci that are located at the boundary of the acute subcapsular hemorrhage and enlarge according to the passage of time . these densities are isodense to the parenchyma on all phase images , with the highest hounsfield number on the portal venous phase . this finding is considered to correspond to multiple small accumulations of contrast material on angiography , and this finding was first described by pliskin ( 4 ) . in our case , the densities were not visualized on us or angiography and it is now clear that visualization of these small foci is attributed to the excellent spatial resolution of mdct . the second clue is a shaggy border of parenchyma with hemorrhage , which may give an impression that the subcapsular high density is not just simple hemorrhage , but it is associated with peliosis hepatis . the last clue is multiple , irregular and linear , septa - like structures inside a low density mass , which show isoattenuation compared to the adjacent parenchyma on all phases . the structures may suggest uncomplicated peliotic parenchyma in contrast to the surrounding , hemorrhagic necrosis . the differential diagnosis of peliosis hepatis may be different according to the presented imaging findings . in the case of hypervascular , well - enhancing lesions , the differential diagnosis includes benign hepatic tumors such as hepatic hemangioma , adenoma , focal nodular hyperplasia , hemangiosarcoma , hypervascular metastasis or arteriovenous malformation . a hypovascular lesion must be differentiated from abscess , hypovascular metastasis or other necrotic masses . yet the addition of the delayed phase imaging can help rule out abscess or metastasis via the finding of disappearance or a decrease in size of the lesion , as compared to the arterial or portal phase images . in conclusion , familiarity with the imaging characteristics and the possible clinical manifestations of peliosis hepatis with or without complications can help radiologists make the early and correct diagnosis . thin - section , triphasic - enhanced mdct can provide quite useful and conclusive information for the diagnosis of peliosis hepatis . | we report here on an uncommon case of peliosis hepatis with hemorrhagic necrosis that was complicated by massive intrahepatic bleeding and rupture , and treated by emergent right lobectomy .
we demonstrate the imaging findings , with emphasis on the triphasic , contrast - enhanced multidetector ct findings , as well as reporting the clinical outcome in a case of peliosis hepatis with fatal hemorrhage . |
diseases that affect the teeth are as old as man himself , but epidemiological surveys of oral health conditions began in the 1960s . an experimental study on gingivitis in humans showed that the build - up of bacterial plaque led to the development of gingival inflammation ( gingivitis ) , and its removal eliminated the lesions . these systematic observations have become an important tool for determining the factors that cause disease in individuals with similar characteristics , and these observations have contributed to the prevention and treatment of different diseases . some common chronic diseases of the oral cavity and their consequences influence an individual 's general and collective well - being . periodontitis is the second largest oral health problem , affecting 1015% of the world 's population . the presence of dental calculus and bleeding tend to be more common in 12-year olds and adolescents . the most severe forms of periodontal disease significantly affect adults ( 3544 years old ) with a prevalence of 19% . gum problems in the elderly have a reduced impact at the population level due to the reduced number of present teeth . therefore , periodontal disease is highly prevalent and interferes with health - related quality of life in many ways , including the physical aspect , masticatory function , appearance , and interpersonal relationships . many quality of life indices to assess health in populations with chronic diseases , such as periodontal disease , allow the researcher to determine the impact of health care , especially in the absence of a cure . the oral health impact profile ( ohip-14 ) is a widely used index for the measurement of oral health on the quality of life in patients with oral diseases . this index is a good indicator of individual perceptions and feelings of their own oral health and their expectations regarding dental treatment and services . the present study assessed the impact and severity of periodontal disease on health - related quality of life in adult users of the brazilian unified health system ( sistema nico de sade sus ) . the study was a cross - sectional study of patients diagnosed and treated in the dental specialty centres ( centros de especialidades odontolgicas ceos ) of juiz de fora . the ethics committee on human research of propesq / ufjf approved this study ( opinion no . the study sample included adult users of the ceos who were treated in the periodontics section of the sistema nico de sade ( sus ) network , juiz de fora , state of minas gerais ( mg ) , brazil , who underwent basic clinical dental care and signed an informed consent form . the unified health system is the brazilian public healthcare system that was created in 1988 and provides universal , equal , full , and free care to approximately 75.5% of the population who has no other access to healthcare services . the ceos were created in 2004 and offer specialised care in periodontics , endodontics , minor oral surgery , and oral diagnosis , and care for patients with special needs . the following exclusion criteria were used : patients classified as code zero using periodontal screening and recording ( psr ) ; patients unable to interpret or answer the questions , such as patients with neurological or cognitive disorders ; users of complete dentures ; and patients with painful dental conditions . participants were interviewed to obtain identification , self - perceptions of general and oral health ( including the need to use or replace prosthesis ) and socioeconomic data . periodontal status was obtained from standardised dental records and data from the initial clinical examination . the examinations conducted by the four periodontists were periodically calibrated ( last interexaminer agreement of 0.81 and intraexaminer agreement of 0.88 for the psr ) . all patients answered the validated oral health impact profile ( ohip-14 ) adapted to brazilian portuguese . the portuguese version of the ohip-14 showed good psychometric properties similar to the original instrument . therefore , the present study did not validate the ohip because it has been validated in a population with similar sociodemographic and cultural characteristics . however , questionnaires were reapplied within seven days in 10 individuals in the pilot study to increase the reliability of results . the test - retest reliability was analysed using pearson 's correlation coefficient ( 0.83 ; p < 0.01 ) and cronbach 's alpha test ( 0.92 ) , and the results showed stability and internal consistency . the sample was estimated from the maximum number of first medical appointments in the three ceos during one month ( a total of five specialists x six individuals in the first appointment / week ) . the estimated sample size included 147 individuals assuming an average prevalence of 85% of periodontal disease in a total population of 360 available patients plus 20% for potential participation refusals . a total of 151 patients were approached during this period , and one patient refused to participate . therefore , the study included 150 patients diagnosed with periodontal disease . from this group , 38 patients were diagnosed with gingivitis , and 112 patients were diagnosed with periodontitis . the criterion adopted to differentiate individuals with periodontitis and gingivitis relied on the clinical diagnosis of periodontists from the sus network using the psr defined by the american dental association and american academy of periodontology . the answers often and always had an impact , but answers of sometimes rarely , and never had no impact . the maximum final score of the overall ohip-14 was 56 points ( two questions per domain with a maximum score of four points equals eight per domain for seven domains ) . therefore , a bivariate analysis was performed using the nonparametric mann - whitney and kruskal - wallis tests , which analyse the relationship between selected independent variables ( e.g. , oral morbidity , self - perception of general and oral health , self - reported skin colour , gender , socioeconomic status , professional occupation , marital status , education level , and age of the respondents ) and the dependent variable ( i.e. , impact of oral health on quality of life ) . multivariate analysis was conducted to identify predictors of the ohip-14 and control for possible confounding variables . multiple linear regression analysis was performed on the variables that were significantly associated with the overall ohip-14 in the bivariate analysis . the sample included 62% females with a mean age of 47 years ( sd = 13.5 ) . a total of 39% of the sample had less than eight years of education , and 33% had a median household income of 2,631.20 dollars . the dmft ( decayed , missing , and filled tooth ) index was 15.9 with a mean of 5% missing teeth and 11% restored teeth in the composition of the indicator . three cases received a psr code one ; 35 cases received a code two ; 104 cases received a code three ; and eight cases were classified as code four . the psychological discomfort and physical disability ohip-14 domains displayed the same frequency ( 82% ) ( table 1 ) . no association between gender and the overall ohip-14 was found ( p = 0.097 ) , but associations with physical pain ( p = 0.005 ) and psychological disability ( p = 0.007 ) were identified . age , marital status , education level , and professional occupation were not significantly associated with the overall ohip-14 ( p = 0.215 , p = 0.365 , p = 0.788 , and p = 0.200 , resp . ) or specific domains . self - reported skin colour was associated with psychological disability ( p = 0.043 ) ( table 2 ) . the association between self - perceived general health and functional disability ( p = 0.051 ) was statistically significant . individuals who perceived their general health as poor showed higher quality of life scores due to oral conditions . the association between self - perceived oral health and the overall ohip-14 and different domains was statistically significant ( p < 0.05 ) . individuals who perceived their oral health as poor showed higher quality of life scores due to oral conditions . the self - reported need to use complete or partial prosthesis or replace the prosthesis in use remained significantly associated with the overall ohip-14 ( p < 0.001 ) and all domains except functional limitation . dentition status was statistically associated with functional limitation ( p = 0.032 ) and disability ( p = 0.012 ) . periodontal disease was significantly associated with psychological discomfort ( p = 0.029 ) and physical disability ( p = 0.029 ) and the overall ohip-14 ( p = 0.017 ) ( table 3 ) . self - perception of oral health , the need to replace or use a prosthesis , and periodontal disease remained significant after fitting . these results indicate that the greatest impact of variables related to oral health on ohip-14 was socioeconomic conditions . moreover , the need for prosthetic rehabilitation and personal judgment were more significant than the periodontal status . the final model explains 27% of the variability of the final ohip-14 score in the sample , which indicates the existence of other explanatory variables that were not measured in this study . few brazilian studies associate periodontal disease with indicators of quality of life related to oral health , but this issue has been investigated in specific population groups , such as the elderly , pregnant women , or diabetics . this study extended the ability to generalise the data to the brazilian population who depends on the public healthcare system . sociodemographic factors , such as gender , income , education level , and age should be controlled in measurements of the impact of oral health on quality of life to obtain a sample as homogenous as possible [ 9 , 10 ] . the present study included a greater number of women in the sample . this observation is a common finding in institutional samples that may be explained by cultural moorings that hinder the adoption of self - care practices in males . men are seen as manly , strong , and invulnerable , and the search for preventive healthcare could be associated with weakness , fear , and insecurity . previous findings of gender in the studies that used the ohip-14 demonstrated a negative impact of being female on health - related quality of life [ 1113 ] , which is similar to the present study in which physical pain ( p = 0.005 ) and psychological disability ( p = 0.007 ) were significantly associated with being a female . among the potential variables that negatively influence the various measurements of oral health - related quality of life , socioeconomic factors , such as age and gender , may influence clinical characteristics because these factors determine lifestyle , housing , access to products , oral hygiene conditions , access to healthcare services , and education level . the results of this study exemplify this situation in which physical pain and physical disability showed an impact of 78.7% and 82% , respectively . the variables that were potentially associated with these domains , namely socioeconomic factors and gender , remained significant only in the bivariate analysis in the present study . the need for the use or replacement of prosthesis negatively impacted oral health - related quality of life ( p = 0.007 ) . this same result was found in a previous study in brazil and may be explained by the oral health condition of the brazilian population and public policies that prioritise children . the impact of prosthetic needs is not measured in studies in developed countries , which suggests that this age group requires more attention . the majority of previous studies concluded that periodontal diseases are associated with a worse health - related quality of life , and this impact increases with disease severity . this study confirmed the significant association between more severe periodontal disease ( periodontitis ) with worse scores in psychological discomfort ( p = 0.029 ) and physical disability ( p = 0.029 ) and the overall ohip-14 score ( p = 0.017 ) , which were controlled by sociodemographic variables . a strong correlation was observed between the single question on self - perceived oral health and the ohip-14 . therefore , this indicator captures the need reported by the individual and displays a scenario that is closer to the individual 's actual oral health status . self - perception of oral health and general health showed the greatest association with the overall ohip-14 ( p < 0.001 in the overall ohip-14 ) . self - perceived oral health remained associated with the overall ohip-14 after fitting for other variables in the multivariate regression . the present study exhibits some limitations , such as the classification of periodontal severity using only two levels and the inclusion of patients who were excluded in the psr analysis . the self - reported need for prosthetic rehabilitation and worse periodontal status are associated with oral health - related quality of life . these data confirm that subjective indicators are important in the analysis of individually reported needs . the results of the present study may be useful for planning other work involving the theme of quality of life in periodontal diseases and for the improvement and further development of public policies in the area , as well as improving actions aimed at promoting health and awareness of the importance of proper oral hygiene habits , to achieve better control of the disease . | objective . this study assessed the impact of periodontal diseases on health - related quality of life of adult users of the brazilian unified health system
. study design .
a cross - sectional study was conducted on an outpatient basis .
the sample included 151 adults treated in the periodontics section at dental specialty centres of juiz de fora ( minas gerais , brazil ) .
the oral health impact profile ( ohip-14 ) measured the impact of periodontal disease on quality of life .
participants were interviewed to obtain self - perception of general and oral health and socioeconomic data , and dental records were consulted to obtain periodontal status data .
the values of central tendency of the ohip-14 were compared with socioeconomic , demographic , and self - reported health predictors using nonparametric tests .
the final analysis was performed using multiple linear regressions .
results .
the results showed that psychological discomfort and physical disability exhibited a negative impact .
the following variables can explain approximately 27% of the impact of oral health conditions on health - related quality of life in this group : periodontal disease , self - perceived oral health , and the need to use or replace dental prosthesis .
conclusion .
the need for prosthetic rehabilitation and worse periodontal status are associated with health - related quality of life , which can be predicted by the self - perception of health . |
the treatment of edentulous areas with ridge defects poses a challenging task for the dentist . a variety of factors such as quality and quantity of existing contiguous hard and soft tissues , systemic condition and economic status of the patient play a significant role in treatment planning , clinical outcome and prognosis . management of such cases involves a wide range of treatment options comprising mainly of soft tissue augmentation ( employed mainly for siebert 's class i defects ) , bone augmentation techniques by inlay and onlay grafting ( mainly for siebert 's class ii and iii defects ) and combination technique incorporating soft tissue and bone augmentation . the clinical situations in which surgical augmentation can not be carried out on grounds of the systemic condition of the patients or their reluctance for the surgical procedure mandate the use of alternative treatment protocols . such alternate treatment protocols include removable partial dentures , fixed partial dentures with gingival colored porcelain and fixed - removable partial dentures known as andrews bridge . this case report presents the restoration of a seibert 's class iii ridge defect by modified andrews bridge in a 32-year - old patient . a 32-year - old male reported with a chief complaint of unesthetic appearance of the face due to depression in the lip region on the left side of the face . extra orally , two scars and a prominent depression in lower lip region were noticeable on the left side of the face . on intraoral examination , mandibular anterior and premolar teeth were missing and a bony defect ( 12 mm 19 mm ) with flabby tissue at the base was present at the respective region [ figure 1a ] . the complete case history of the patient was taken , which revealed that the patient had undergone treatment for comminuted mandibular fracture in symphseal - parasymphyseal region on the left side of face 3 years back . this segment of the mandible along with five teeth ( mandibular anteriors and premolars ) was removed during open reduction of the fracture followed by placement of titanium reconstruction plate . the intraoral closure of the defect was done by placing the temporal flap over the defect . the relative positions of the two mandibular segments and the reconstruction plate could be clearly appreciated on orthopantogram [ figure 1 ] . the tissues in the defect region were 12 mm below the cervical margins of the adjacent teeth , attributing it as a siebert 's class iii defect [ figure 1b ] . the various treatment modalities were thoroughly explained to the patient . considering the reluctance for the surgical procedure and economic status of the patient the modification planned was to replace the costlier prefabricated bar and sleeve attachment of conventional andrews system with two small disc shaped magnets . the advantages and disadvantages were clearly explained to the patient and informed consent was taken . the step by step procedure is as follows : ( a ) preoperative orthopantogram ( b ) preoperative interocclusal view showing siebert 's class iii defect
diagnostic impressions were made and casts were preparedthe selected abutment teeth ( 41 , 36 ) were prepared for metal ceramic restorations . the gingival retraction was done using gingival retraction cord ( ultrapak ) and putty wash impression ( express std putty 3 m , espe , usa and express light body std quick wash , 3 m espe , usa ) was made . provisional crowns ( protemp ii , 3 m espe , usa ) were cemented on both the prepared teeththe maxillary and mandibular casts were mounted , and the wax pattern was fabricated in blue inlay wax ( bego , usa ) comprising of a rectangular bar connecting copings on both the prepared teeth . the pattern was casted in nickel chrome alloy ( wiron 99 , bego , usa)the cast metal framework was tried in patient and checked for any impingement of the basal tissuesthe framework was again tried in after application of porcelain ( ceramco-3 , dentsply , usa ) . afterwards , the framework was reseated on the cast and a self - polymerizing clear acrylic ( dpi , india ) flange was fabricated from the bar in the framework till the soft tissues on the base of the defect . the tissue surface of the flange simulated the sanitary pontic design [ figure 2 ] . a magnet ( ndfeb magnet , ni - plated disc shaped magnet 2 mm 1.5 mm in size , techtone electronics , mumbai , india ) was placed in buccolingual and mesiodistal center of the lingual surface of this flange [ figure 3a]the framework was cemented in vivo with temporary cement ( rely - x temp , 3 m espe , usa ) . an impression of the mandibular arch after cementation of the framework was made using irreversible hydrocolloid ( algitex , dpi , india ) . the cast was poured ( kalstone , kalhabhai , india ) and undercuts were blocked . the cast thus obtained was used for the fabrication of removable component of the prosthesismounting of the casts was followed by teeth arrangement and esthetic try inacrylization of prosthesis was done with heat cure acrylic resin ( dpi , india)the undercuts in the prosthesis were removed before insertion . a counter magnet was placed on intaglio surface of lingual flange of the removable part of the prosthesis corresponding to the magnet on fixed part of the prosthesis [ figure 3a ] . the framework was cemented permanently , and the removable component was placed [ figure 3b]the technique of insertion and removal of the prosthesis was taught to the patient . oral hygiene instructions and recall schedule diagnostic impressions were made and casts were prepared the selected abutment teeth ( 41 , 36 ) were prepared for metal ceramic restorations . the gingival retraction was done using gingival retraction cord ( ultrapak ) and putty wash impression ( express std putty 3 m , espe , usa and express light body std quick wash , 3 m espe , usa ) was made . provisional crowns ( protemp ii , 3 m espe , usa ) were cemented on both the prepared teeth the maxillary and mandibular casts were mounted , and the wax pattern was fabricated in blue inlay wax ( bego , usa ) comprising of a rectangular bar connecting copings on both the prepared teeth . the pattern was casted in nickel chrome alloy ( wiron 99 , bego , usa ) the cast metal framework was tried in patient and checked for any impingement of the basal tissues the framework was again tried in after application of porcelain ( ceramco-3 , dentsply , usa ) . afterwards , the framework was reseated on the cast and a self - polymerizing clear acrylic ( dpi , india ) flange was fabricated from the bar in the framework till the soft tissues on the base of the defect . the tissue surface of the flange simulated the sanitary pontic design [ figure 2 ] . a magnet ( ndfeb magnet , ni - plated disc shaped magnet 2 mm 1.5 mm in size , techtone electronics , mumbai , india ) was placed in buccolingual and mesiodistal center of the lingual surface of this flange [ figure 3a ] the framework was cemented in vivo with temporary cement ( rely - x temp , 3 m espe , usa ) . an impression of the mandibular arch after cementation of the framework was made using irreversible hydrocolloid ( algitex , dpi , india ) . the cast was poured ( kalstone , kalhabhai , india ) and undercuts were blocked . the cast thus obtained was used for the fabrication of removable component of the prosthesis mounting of the casts was followed by teeth arrangement and esthetic try in acrylization of prosthesis was done with heat cure acrylic resin ( dpi , india ) the undercuts in the prosthesis were removed before insertion . a counter magnet was placed on intaglio surface of lingual flange of the removable part of the prosthesis corresponding to the magnet on fixed part of the prosthesis [ figure 3a ] . the framework was cemented permanently , and the removable component was placed [ figure 3b ] the technique of insertion and removal of the prosthesis was taught to the patient . oral hygiene instructions and recall schedule fixed component with acrylic flange fabricated and magnet placed in it ( a ) counter magnet placed in the removable component ( b ) postoperative view showing removable component placed over the cemented fixed component the management of extensive ridge defect ( siebert 's class iii ) by a fixed - removable partial denture in a mandibular fracture patient has been explained . the andrews system is basically composed of two components : fixed component ( retainers on abutments joined by bar ) and removable component . the conventional andrews system requires a castable bar ( incorporated in the fixed component ) and sleeve ( incorporated in the removable component ) attachment , which provides a precision while seating and retention . in this case , the bar and clip attachment of andrews bridge system was replaced with magnets . ni - plated , disc shaped , miniature ( 2 mm 1.5 mm ) , open field neodynium - iron - boron magnets were used . the magnetic attraction between the magnets this modification makes the appliance economical still maintaining all the basic requirements of andrews bridge system such as facilitating good oral hygiene maintenance in addition to providing good functional and esthetic results . moreover , these magnets do not exert any deleterious effects on the human tissues . the support in this system is mainly derived from the abutment teeth so no pressure was applied to the tissues at the base of the defect which were devoid of any bone support . the surfaces of magnets are exposed to oral fluids , which may lead to tarnish and corrosion . this may produce disruption of the protective coating of the magnets leading to some cytotoxic effects . it may result in the decreased retentive force upon usage . hence maintaining constant recalls and replacing the magnets as early as signs of corrosion develop may play a significant role in the durability and functioning of the appliance . the surgical grafting procedures still remain the best treatment options for the cases with unesthetic ridge defects . however , considering the treatment cost , invasiveness and treatment period in surgical procedures , the fixed removable system provides a rapid and economical substitute for achieving the desired treatment goals in cases with severe ridge defects . | prosthetic dentistry involves the replacement of missing and contiguous tissues with artificial substitutes to restore and maintain the oral functions , appearance , and health of the patient .
the treatment of edentulous areas with ridge defects poses a challenging task for the dentist .
management of such cases involves a wide range of treatment options comprising mainly of surgical interventions and non surgical techniques such as use of removable , fixed or fixed- removable partial dentures . but
each treatment plan undertaken should be customized according to patient needs . a variety of factors such as quality and quantity of existing contiguous hard and soft tissues , systemic condition and economic status of the patient play an important role in treatment planning , clinical outcome and prognosis .
this case report presents the restoration of a seibert 's class iii ridge defect by an economical modification of andrews bridge in a 32 year old patient . |
the main manifestations of the lipodystrophy ( ld ) syndrome in patients with normal serum cortisol levels are fat accumulation in the dorsocervical spine ( also known as buffalo hump ) , in the breasts , and in the abdomen or fat reduction in the face and in the limbs . these body changes are accompanied by dyslipidemia and hyperglycemia . however , there are only few reports of hyperlipidemia and lipodystrophy associated with haart without pi [ 2 , 3 ] . a recent study by smith et al . demonstrated an excess of cardiovascular risk factors in hiv patients receiving haart , and lipodystrophy syndrome has been considered a worrisome factor . this study was performed to analyze the body composition and metabolic variations in hiv-1 infected individuals during treatment with haart of different art regimen and without haart in the north - eastern part of india . a hospital based cross - sectional study conducted from october 2011 to september 2013 included random 101 seropositive hiv-1 male patients aged more than 15 years who are attending medicine out - patient department ( opd ) and art centre , centre of excellence , regional institute of medical sciences , for routine check - up on opd basis . these patients were categorised into the following groups : art nave patients ( n = 22 ) , hiv patients on zidovudine based regimen ( azt and 3tc and nvp or efv , n = 22 ) , stavudine based regimen ( d4 t and 3tc and nvp or efv , n = 18 ) , tenofovir based regimen ( tdf and 3tc and nvp or efv , n = 15 ) , and protease inhibitors based regimen ( atazanavir 300 mg boosted with low dose ritonavir 100 mg , n = 24 ) . the art was given to patients according to national aids control organization ( naco ) guidelines , india . patients who were known case of diabetes mellitus , chronic kidney disease , congestive cardiac failure , already on hypolipidemic drugs before starting art , and suffering from tuberculosis and other active opportunistic infections were excluded from the study . detailed history regarding clinicoepidemiological data including , facial dysmorphism ( lipoatrophy of face ) , exposure , hiv infection duration , duration of the present regimen , alcoholism ( > 80 gms / day ) , and cigarette smoking ( > 5 cigarettes / day ) were recorded in a preformed pro forma . anthropometric measurements , like body mass index ( bmi ) and waist - hip ratio , were measured . waist circumference was measured at midpoint between lowermost palpable rib and topmost point of iliac crest along midaxillary line , and hip circumference was measured at widest portion of buttocks . waist - hip ratio > 0.9 indicates truncal obesity and high risk for cardiovascular complications . total body water ( in percentage ) , bone mass ( in kgs ) , visceral fat ( in kgs ) , body fat ( in percentage ) , and muscle mass ( in kgs ) were analysed using tanita machine , a body composition guide for inner scan manufactured by tanita india private limited , mumbai . visceral fat ranging from 1 to 12 kgs was considered as healthy range and more than 12 as excess . blood biochemistry including lipid profile , kidney function test , and blood sugar levels ( random , fasting and postprandial ) was performed . anova and post hoc dunnet 's t3 test were used to determine significant difference among study population . the age range of study population was art nave patients , 24 to 51 years ; zidovudine based patients , 26 to 53 years ; stavudine based patients , 32 to 52 years ; tenofovir based patients , 37 to 60 years ; and protease inhibitors patients , 32 to 60 years . the mean duration of hiv infection and the present art regimen ( in months ) is shown in table 1 . lipoatrophy of face was most prevalent in hiv - positive population who are on stavudine based regimen ( 15 out of 18 patients , 83.3% ) and protease inhibitors based regimen ( 20 out of 24 patients , 83.3% ) . three patients ( 13.6% ) on zidovudine based regimen and 3 patients ( 20.0% ) on tenofovir based regimen had lipoatrophy of face ( refer table 2 ) . mean bmi of different categories of study population were in normal range , and there was no significant difference in mean bmi among different categories of study population ( p = 0.917 ) . among study population , excess visceral fat was most prevalent in protease inhibitors group ( 4 out of 24 patients , 16.7% ) . the mean total visceral fat among study population was in healthy range , and there was statistically insignificant difference among study population . though statistically insignificant , mean difference of total visceral fat between pis ( 6.21 4.79 ) and art nave ( 4.09 3.66 ) patients was about 2.11 . mean body fat percentage was in normal range among study population and did not vary significantly among different study groups ( p = 0.172 ) . the mean total body water percentage was relatively higher in zidovudine based regimen ( 61.98 7.86 ) and stavudine based regimen ( 61.4 6.63 ) than other groups ( art nave regimen was 59.80 9.73 , tenofovir based regimen was 58.90 4.9 , and protease inhibitors regimen was 57.64 6.99 ) , and there was no significant difference among study population ( p = 0.318 ) . there was no statistically significant difference among study population in terms of mean bone mass ( p = 0.200 ) and mean muscle mass ( p = 0.070 ) . waist - hip ratio ( mean ) in protease inhibitors group was 0.91 0.04 , indicating central obesity . the mean waist - hip ratio significantly varied among study population , being higher in hiv patients receiving protease inhibitors ( p = 0.001 ) . hypertriglyceridemia was found in stavudine ( 173.06 48.11 ) , tenofovir ( 164.07 77.40 ) , and protease inhibitors ( 249.83 125.3 ) based regimens . low hdl was found in zidovudine ( 32.75 7.19 ) , stavudine ( 26.72 7.12 ) , and protease inhibitors ( 32.79 11.0 ) based regimens . patients with protease inhibitors were found to have both fasting ( 118.04 46.03 ) and postprandial ( 205.38 105.26 ) hyperglycemia . there was a significant difference in total cholesterol ( p = 0.001 ) , triglycerides ( p = 0.000 ) , hdl ( p = 0.003 ) , ldl ( p = 0.009 ) , vldl ( p = 0.001 ) , rbs ( p = 0.000 ) , fbs ( p = 0.001 ) , and ppbs ( p = 0.000 ) among study population . the present study is a cross - sectional comparative data regarding body composition and metabolic parameters derangements among hiv patients receiving protease inhibitors and nrtis . 83.3% patients receiving protease inhibitors had facial dysmorphism in form of lipoatrophy and 16.7% patients had excess visceral fat with normal total body fat percentage . in addition to this , there was increased waist - hip ratio , more than 0.90 , indicating truncal obesity . there were also metabolic abnormalities in the form of hypertriglyceridemia , low hdl , high vldl , and fasting and postprandial hyperglycemia . these features indicate regional fat redistribution from periphery to visceral resulting in insulin resistance rather than mere fat loss or fat gain . similar finding was also described by previous study by dinges et al . and carr et al . . analysed the paired data in hiv infected patients before and after initiating pis ( n = 20 ) . they also found significant increase in glucose ( + 9 3 mg / dl , p = 0.0136 ) , insulin ( + 12 4.9 mg / dl , p = 0.023 ) , triglycerides ( + 53 17 mg / dl , p = 0.0069 ) , and total and ldl cholesterol ( + 32 11 mg / dl and + 18 5 mg / dl , p = 0.0082 and 0.0026 , resp . ) . in present study , there was no significant difference between the study groups in terms of bmi , total body water , bone mass and muscle mass , and visceral and body fat . 788 cohorts of hiv patients on haart noticed 14% prevalence of metabolic syndrome according to international diabetic federation criteria and 18% prevalence of the same , according to us national cholesterol education program adult treatment panel iii ( atp iii ) criteria , in patients receiving pis , the highest being in indinavir and the least in amprenavir . 49% of patients had at least 2 features of metabolic syndrome but did not meet the diagnostic criteria . in present study also , it is emphasising the same fact of insulin resistance in the form of truncal adiposity and hyperglycemia in patients receiving pis . studied 148 hiv-1 patients ( 116 patients were on protease inhibitors and 32 had never taken protease inhibitors ) and in 47 healthy men found that development of syndromic features like central adiposity along with hypertriglyceridemia , hypercholesterolemia , and insulin resistance with type 2 diabetes mellitus occurred mainly with the use of all potent protease inhibitors and hence concluded it to be a class effect . current data suggests that abnormal fat distribution occurs in hiv patients receiving non - pis based regimen . peripheral fat wasting was noticed in clinically stable asymptomatic hiv patients and may be due to long term use of nrtis especially stavudine . lipoatrophy of face ( buccal pad fat atrophy ) was observed in 83.3% of patients receiving stavudine based haart , 13.6% of patients in zidovudine group , 20.0% of patients on tenofovir group , and none in art nave group . along with this , stavudine subgroup also had hypertriglyceridemia , low hdl , and postprandial hyperglycemia , which were almost absent in other nrtis groups . on the contrary , hypertriglyceridemia was also found in the tenofovir group . saint - marc et al . in their cross - sectional data on 43 hiv patients on nrti found peripheral lipodystrophy ( bichat atrophy ) in 17 patients ( 63% ) receiving stavudine , 3 patients ( 18.75% ) receiving zidovudine and none in art nave . along with lipodystrophy , patients on stavudine had hypertriglyceridiemia which is similar to result of the present study . domingo et al . , in his study involving 150 hiv patients receiving haart , 75 stavudine based patients , and 75 zidovudine based patients noticed significant lower body fat in patients taking stavudine . analysed regional fat measured by dual energy x - ray absorptiometry ( dexa ) in 161 hiv patients and found progressive subcutaneous fat wasting occurring in stavudine - containing regimens compared with zidovudine - containing regimens ( relative risk was 1.085 per month ; p < 0.0001 ) and concluded that nrtis especially stavudine do have an independent contribution to fat wasting . other body composition parameters like total body water , muscle mass , and bone mass are not significantly affected among study population . hdl was significantly low in art nave and all nrti groups except for tenofovir group . though ldl was in normal range , it differed significantly ( p = 0.009 ) among study population , being high in stavudine based regimen ( 94.11 12.4 ) and protease inhibitors ( 98.3 27.8 ) . | background . hiv patients on highly active antiretroviral therapy ( haart ) containing protease inhibitors ( pis ) had been often associated with lipodystrophy
. however , there are only few studies on association of nucleoside and nonnucleoside reverse transcriptase inhibitors ( nrti and nnrti ) with lipodystrophy . study design .
one hundred and one hiv male patients were categorised into art nave ( n = 22 ) , zidovudine ( n = 22 ) , stavudine ( n = 18 ) , tenofovir ( n = 15 ) , and pis ( n = 24 ) based haart . their clinicoepidemiological data had been entered in preformed pro forma . the body composition , using tanita machine and metabolic parameters like lipid profile , blood sugars was analysed
. results .
clinically , lipoatrophy of face was most prevalent in hiv patients on stavudine ( 15 patients , 83.3% ) and pis ( 20 patients , 83.3% ) based haart .
the mean bmi among study population was in normal range .
excess visceral fat was most prevalent among patients on pis , 4 patients ( 16.7% ) .
the waist - hip ratio was significantly higher in pis ( p = 0.01 ) based haart .
there was no significant difference among different study populations in terms of bmi ( p = 0.917 ) , body water ( p = 0.318 ) , body fat ( p = 0.172 ) , bone mass ( p = 0.200 ) , and muscle mass ( p = 0.070 ) .
hypertriglyceridiemia was found in stavudine , tenofovir , and protease inhibitors regimens .
low levels of high density lipoprotein ( hdl ) was found zidovudine , stavudine , and pis regimens .
fasting and postprandial hyperglycaemia was found pis and impaired glucose tolerance in stavudine regimen . conclusion .
patients on pis were associated with truncal obesity and lipoatrophy of face , along with dyslipidemia and hyperglycaemia .
stavudine based regimen is associated with hypertriglyceridiemia and low hdl along with lipoatrophy of face . |
double balloon enteroscopy ( dbe ) consists of an enteroscope and an overtube with a balloon located at either distal end . with a success rate up to 89% and a low complication rate ranging from 0.8% to 4% , common therapeutic applications of dbe include biopsy and tattooing of small bowel lesions , hemostasis , polypectomy , balloon dilation , and foreign body retrieval . dbe can be used in patients in whom capsule endoscopy is contraindicated for suspected bowel strictures and obstruction . although dbe allows for deeper intubation of the small bowel , most complications arise following therapeutic procedure including electrocoagulation , polypectomy , and dilatation . air embolism into the mesenteric venous system following a small bowel transmural tattooing procedure has not been previously described in the literature . a 76-year - old female presented to the emergency department with acute abdominal pain and multiple episodes of melena . initial laboratory workup revealed a guaiac positive stool test and hemoglobin of 6 - 7 g / dl . a subsequent dbe showed a 3 cm ulcerated lesion in the mid - ileum and a mesenteric mass in the distal small bowel . the location of the small bowel mass was subsequently marked with mucosal clips and the bowel was enteroscopically tattooed up to the serosal surface with india ink for intraoperative localization for the laparoscopic surgical team . concern for bowel perforation was raised and a contrast - enhanced computed tomography ( ct ) scan of the abdomen and pelvis was ordered . the scan revealed a moderate amount of linear air tracking from the distal small bowel into the adjacent bowel venules and larger mesenteric veins . there was associated haziness surrounding the tumor location consistent with postprocedural edema [ figures 1a , b and 2 ] ( a and b ) contrast - enhanced coronal ct images ( lung window ) demonstrate linear pockets of air tracking within small mesenteric veins ( white arrow ) . note the enteroscopically placed clip in the patient 's distal ileal gist , which was tattooed for the surgeon ( curved arrow ) . contrast - enhanced axial ct image demonstrates linear branching pattern of air in the mesenteric veins due to air embolism ( white arrow ) . note the mild mesenteric stranding around the lesion , a common finding after enteroscopic procedure ( thick arrow ) . the presence of air in the mesenteric veins could not be attributed to disease pathology based on patient 's clinical status and imaging . ct findings were correlated with location of enteroscopic tattoo and this led to the conclusion that bowel alterations from the tattoo procedure ultimately allowed for embolism of intraluminal bowel air into the adjacent mesenteric venous system . due to this benign iatrogenic etiology of mesenteric venous gas , the patient subsequently underwent a successful laparoscopic small bowel resection for the mesenteric mass , which was confirmed by pathological examination to be a 4.5 2.5 2.5 cm gastrointestinal stromal tumor ( gist ) . since laparoscopic surgery plays a significant role in today 's surgical landscape , accurate lesion localization after port placement is paramount since the surgeon does not have the ability to palpate a tumor / lesion in this setting . the serosal surface of bowel lesions is marked on enteroscopy with india ink for preoperative localization or subsequent endoscopic identification of lesions , with an accuracy ranging from 70% to 100% . endoscopic mucosal clips typically fall of on an average of 10 days and may also spontaneously migrate , making this technique unreliable for lesion localization . optimal localization can be achieved with enteroscopic tattooing with india ink up to the serosal surface of the affected segment . when the lesion of interest is endoscopically located , the sclerotherapy needle deposits , approximately 0.2 - 0.5 ml of ink with each injection , through the bowel mucosa circumferentially around the lesion leaving a bluish - black marking visible from both the mucosal and serosal aspect [ figure 3 ] . note the bluish - black appearance of the deposited india ink according to a large review of enteroscopic tattoo cases by nizam et al . , the clinical complication risk was only 0.22% . case reports of adverse events following endoscopic tattoo include focal peritonitis , abscess / hematoma formation , idiopathic inflammatory bowel disease , dye spillage into peritoneal cavity , and tumor inoculation.[38 ] our case is unique in that it is the first description of enteroscopic tattoo complicated by mesenteric air embolism from the tattooed bowel into adjacent mesenteric veins , presenting as acute abdominal pain . mesenteric ischemia is the most common and serious cause of mesenteric air for which surgical management is necessary in the majority of cases . other causes of mesenteric venous air are associated with disease entities that cause ulceration of bowel mucosa and subsequent air embolism into the adjacent venous system . in iatrogenic cases of mesenteric air secondary to endoscopic procedures the patient 's history and presentation are incongruent with the common etiologies of mesenteric air and thus highlight the rarity of this case . gas in the great mesenteric veins is well visualized on contrast - enhanced ct scan and air in the small mesenteric veins appear as tubular or branched areas of low attenuation near the bowel margin . pneumoperitoneum does not have a tubular or branched appearance and can be found in the interface between the antimesenteric border of the bowel and the parietal peritoneum . to our knowledge , this is the first report in literature that describes mesenteric air embolism following an enteroscopic small bowel tattooing procedure , presenting as acute abdominal pain . although mesenteric air due to bowel ischemia is a common setting , other nonemergent etiologies such as mesenteric venous gas secondary to invasive procedures need to be considered . radiologists must recognize and differentiate iatrogenic causes of mesenteric air embolism to ensure appropriate clinical or surgical management . | double balloon enteroscopy ( dbe ) is a revolutionary procedure in which the entire small bowel can be visualized endoscopically .
dbe has the advantage of both diagnostic and therapeutic capabilities in the setting of small bowel neoplasms and vascular malformations .
we present a unique case of a 76-year - old female who underwent small bowel dbe tattoo marking of a distal small bowel tumor complicated by development of severe abdominal pain postprocedure secondary to bowel air embolism into the mesenteric veins .
mesenteric air can be seen after other endoscopic procedures such as biopsy , mucosal clip placement and polypectomy , or following a colonoscopy .
mesenteric air embolism following small bowel tattooing procedure has not been previously reported in the literature .
mesenteric air when present may be attributed to mesenteric ischemia and can subject the patient to unnecessary surgical intervention if misdiagnosed .
thus , this report holds significance for the radiologist as computed tomography ( ct ) findings of mesenteric air embolism must be evaluated in the context of appropriate clinical history before treatment decisions are made . |
management of infected total knee arthroplasty ( tka ) is a challenge to patient and surgeon alike . various spacer devices are available for the first stage surgery for local delivery of antibiotics . here , we report our experience with management of infected tka patients with our indigenously designed and produced knee spacer . between 2012 and 2013 , 28 patients with infected total knee replacement ( tkr ) have been managed by our indigenous knee spacer . minimal spacer - related complications and a stable knee joint with range of motion up to 100 were noted in these patients . after a mean period of 6 - 8 weeks , the spacer was removed and definitive tkr fixation done . at a mean follow - up of 4-months post second stage definitive surgery , patients were infection free with no evidence of recurrence of infection . our new innovative customized articulating knee spacer , which has intramedullary stem extension , has potential to significantly reduce spacer - related complications along with providing improved knee function . with the increasing incidence of total knee arthroplasty ( tka ) , the incidence of infected tka is also on the rise . the infection rate after primary tka ranges from 0.5% to 2% and is a serious problem despite modern technology and rigorous prophylaxis . however , considering the increasing number of patients with tka , infection is still a complication of major concern . a variety of techniques and devices have been developed to improve the management of the infected tka . antibiotic - loaded bone cement spacers in the two - stage reimplantation technique are the gold standard as they allow early joint and patient mobilization , a shorter hospital stay and potentially a reduced rate of reinfection . many off the shelf readymade spacers are available , but these are not very cost - effective and are associated with a variety of spacer - related complications . we describe our experience of managing infected total knee replacement ( tkr ) patients with our indigenous customized knee spacer in the initial stage of two - stage reimplantation complications . in the year 2012 - 2013 , 28 patients of infected tkr were managed by our new innovated customized articulating cement spacer in the first stage of two - stage exchange arthroplasty . the average age of the patients was 70 years ( range : 56 - 79 years ) . 20 were knees with advanced osteoarthritis , whereas the other 8 were post rheumatoid knees , all of these had been managed by primary tkr . after first stage implant removal and debridement and our indigenous spacer implantation , no evidence of spacer dislocation , mediolateral tilting , or spacer subluxation was noted while only 2 patients had spacer fracture . features such as pain , warmth , redness , severe restriction of movement with or without frank discharging sinuses are noted . neutrophilia persistently elevated erythrocyte sedimentation rate ( esr ) and c - reactive protein ( crp ) and radiographic loosening of implants are considered criteria of diagnosis of infected tkr . after epidural anesthesia in first stage surgery , total knee components are removed , cement and loose bodies being curetted out along with thorough cleaning of femoral and tibial canals with pulse lavage . during surgery itself , indigenous knee spacer is prepared on a clean trolley with 20 g ( two pacs ) and 40 g ( four pacs ) of high viscosity gentamicin - loaded bone cement . depending on preoperatively determined femoral or tibial canal size , 5 cc or 10 cc disposable syringes are selected . after thorough debridement and lavage , these stems are inserted in the femoral and tibial canals with 1 cm of their ends projecting into the joint . cement in doughy form is layered on femoral and tibial side to make femoral and tibial spacer components . for spacer construction 40 g ( four packets ) of gentamicin - loaded polymethylmethacrylate ( pmma ) , cement prepared for femoral side is layered on the femoral surface and the projected stem to shape it like femoral condyles of desired thickness . a groove on the anterior surface of the spacer is made with the femoral component for better alignment of the patella . for tibial tray , cement is placed on tibial surface in a doughy state and shaped into a spacer of desired thickness as determined preoperatively ( fig . flexion - extension matching is done to confirm an optimum spacer thickness and provide a smooth knee range of motion . 2 ) physiotherapy is started by knee range of motion and quadriceps strengthening exercises as soon as the pain permits and walker ambulation by second post - operative day . post - operative antibiotics are started as per culture , and sensitivity report of the fluid and tissue sent for culture preoperatively and continued for 6 weeks followed by 2 weeks antibiotic free period . normal skin condition over the operative site without any redness or sinuses and normal range of serial esr and crp markers make the patient eligible for the second stage of surgery which involves spacer removal and definitive tkr implant fixation . in our series , no evidence of dislocation , mediolateral tilting , or knee subluxation was noted except for two patients who had spacer fracture and were operated by spacer reimplantation . the mean range of knee motion with spacer in our series has been 100 flexion with complete eradication of infection and definitive surgery 6 - 8 weeks after spacer implantation . the cost of manufacturing these on table spacers is nominal when compared to off the shelf available articulating spacers , thus providing economic advantage to the patient ( table 1 ) . ( a ) infected total knee replacement , exposure and component removal , ( b ) intramedullary femoral and tibial stems , ( c ) our innovative knee spacer ( in situ ) . post - operative x - rays of the patient with knee spacer ( in situ ) . two - stage exchange arthroplasty with an antibiotic - impregnated cement spacer remains the standard treatment for patients with an infected tka . spacers not only help in maintaining knee joint space but also act as a source of local antibiotic delivery . nonarticulating block spacers can be easily made peroperatively by antibiotic - impregnated pmma and are fashioned to fit the existing bone defect . although useful in infected knees with the substantial bone loss , they present several disadvantages such as knee immobility and subsequent stiffness , spacer dislodgement , and bone erosion . scar formation , tissue adherence , and quadriceps shortening make subsequent surgery a difficult one . temporary prosthesis , prefabricated articulating spacers , and on table articulating spacers are some of the various options used to overcome problems faced with static block spacers . use of temporary prosthesis technique involves autoclaving removed femoral component and using a new tibial poly and fixing both these components with antibiotic cement to the parent bone , medullary canals being packed with antibiotic laden beads . however , there is possibility of bacterial adhesion to the surface of these components and increased the cost of management of patients with infected tka . commercially available prefabricated cemented articulating spacers have various disadvantages in the form of size mismatch , lack of modularity , unsatisfactory antibiotic impregnation , fixed antibiotic type , and dose , often allowing delivery of a single antibiotic . all these spacers have had their set of spacer - related complications which are largely due to their nonconformity to articulating surfaces , inadequate size and thickness and no or poor fixation to underlying bone . spacer fixation to bone and its stability in the joint is largely compromised because of lack of intramedullary purchase in femur and tibia . this problem has been successfully addressed by our innovation where we have used intramedullary antibiotic bone cement stems along with on table custom made spacers . stems not only provide sound anchorage to the overlying spacers but also act as a channel to deliver antibiotics deep inside the intramedullary canals . other factors like range of motion , patient satisfaction , and infection healing have been comparable to readymade contemporary devices available , but the cost - effectiveness of our spacers is an advantage to the patient . commercially available articulating knee spacers are very costly and most of the times out of reach of the patient already burdened by challenges of infection , multiple surgeries , and loss of livelihood . we have been able to achieve eradication of infection in all our patients of infected tkr with our indigenous cost - effective device . ours is a dynamic spacer , hence with knee flexion femoral component is removed first followed by tibial spacer removal . moreover , cement spacer is made in later setting stage of cement while stems are inserted in medullary canal only after cement has cured completely ; hence , there is no incorporation of cement in bone , making spacer removal into quite easy . our innovation provides specific advantage in the form of spacer stability inside the knee and capability of intramedullary local antibiotic delivery . however , a multicenter study and a long - term follow - up is required to confirm potential usefulness of this spacer device . the articulating antibiotic knee spacer as designed by us for the management of infected tkr is cost - effective , customized , easy to manufacture on the operation table and is associated with negligible spacer - related complications . our innovative knee spacer as a management option in the first stage of a two - stage exchange for infected tkr is easy to make on table in a customized fashion . moreover , it is biomechanically more stable and associated with negligible spacer - related complications . this spacer device can give a better outcome in patients with infected knee arthroplasty as compared to conventionally available spacers . | introduction : management of infected total knee arthroplasty ( tka ) is a challenge to patient and surgeon alike .
two - stage exchange is the universally acclaimed method to tackle this problem .
various spacer devices are available for the first stage surgery for local delivery of antibiotics . here
, we report our experience with management of infected tka patients with our indigenously designed and produced knee spacer.case report : between 2012 and 2013 , 28 patients with infected total knee replacement ( tkr ) have been managed by our indigenous knee spacer .
minimal spacer - related complications and a stable knee joint with range of motion up to 100 were noted in these patients .
after a mean period of 6 - 8 weeks , the spacer was removed and definitive tkr fixation done . at a mean follow - up of 4-months post second stage definitive surgery , patients were infection free with no evidence of recurrence of infection.conclusion:our new innovative customized articulating knee spacer , which has intramedullary stem extension , has potential to significantly reduce spacer - related complications along with providing improved knee function . |
in pediatric patients , though general anesthesia is the commonly used technique , regional anesthesia as analgesic adjunct is used for intraoperative as well as postoperative pain relief . for abdominal and lower limb surgeries , caudal epidural is commonly used as it is a safe , reliable , and easy to administer technique . caudal epidural is a simple technique allowing rapid recovery from anesthesia with effective postoperative analgesia . in comparison to bupivacaine , ropivacaine is known to have lesser cardiotoxicity[35 ] and motor blockade , with similar pain relief at equivalent analgesic doses . the duration of block is shorter even with longer acting local anesthetic agents like bupivacaine or ropivacaine because the local anesthetic spreads easily in children . the addition of an adjuvant not only increases the effectiveness of a local anesthetic by prolonging and intensifying the sensory blockade but also causes reduction in dose of local anesthetic agents . many adjuvants can be used to achieve prolongation of sensory blockade , e.g. , epinephrine , opioids ketamine , neostigmine . opioids can be given but they can cause confusion , itching , nausea , vomiting , and respiratory depression.[911 ] ketamine can cause neurotoxicity if accidentally injected in cerebrospinal fluid ( csf ) . clonidine was introduced in the market as an antihypertensive agent but in recent times it is also used for sedation , as premedication , and as an adjuvant analgesic . it has mild alpha-1 agonist activity ( alpha-2 : alpha-1.22:1 ) when given epidurally , clonidine exerts analgesic action by stimulating the descending noraderenergic medullospinal pathways and inhibiting the release of nociceptive neurotransmitters in the dorsal horn of spinal cord . neuraxial administration of clonidine is preferred as it has intense analgesic effect because of it 's spinal site of action . its main site of action is the substantia gelatinosa on the dorsal horn of spinal cord . we planned this randomized , prospective , double blind study to compare the analgesic properties of clonidine and fentanyl as analgesic additive in caudal epidural with ropivacaine in children . after obtaining approval from institutional ethical committee and written informed consent from parents , 90 asa i - ii patients aged 38 years , weighing 520 kg , scheduled to undergo infraumblical surgical procedures such as hernia repair , orchidopexy , hypospadias , and urethroplasty were enrolled in the study [ power of the study was 70% ( error = 10% ) calculated using ps power and sample size calculation version 2.1.30 softwarecheked ok ) . children with local infection of the caudal area , history of allergic reactions to local anesthetics , bleeding diasthesis , preexisting neurological or spinal diseases , mental retardation , neuromuscular disorders were excluded from the study . the study design of the trial was prospective , double blind , randomized , and clinically controlled . patients were premedicated with midazolam 0.4mg / kg orally 30 - 40 min before surgery . anesthesia was induced with oxygen , nitrous oxide 60% and halothane ( 2%-3% ) through jackson - ree 's modification of ayre 's t piece with appropriate size face mask and standard monitoring ( heart rate , non invasive blood pressure and pulse oximetry ) . after induction of anesthesia intravenous cannula was placed and laryngeal mask airway ( lma ) of appropriate size introduced . anesthesia was maintained with o2-n2o ( 1:2 ) and isoflurane ( 2%-3% ) with respiration assisted manually with fresh gas flow of 2 - 3 l / min . group i received ropivacaine 0.25% 1 ml / kg with clonidine 2 g / kg ; while group ii received ropivacaine 0.25% 1 ml / kg with fentanyl 1 g / kg . for each patient two different syringes were prepared by an anesthesiologist not involved in the study . one syringe contained ropivacaine and the other contained 0.1 ml / kg of either clonidine or fentanyl . normal saline was added to clonidine or fentanyl to achieve a total volume of 0.1 ml / kg . caudal block was given under full asepsis with 23 g short bevel hypodermic needle in left lateral position . the anesthetist in - charge of the patient was completely unaware of the content of syringes . after closure of skin incision , nitrous oxide and isoflurane were discontinued , the lma was removed and patients were shifted to the post anesthesia care unit ( pacu ) when fully awake , breathing room air . heart rate ( hr ) , mean arterial pressure ( map ) and oxygen saturation ( spo2 ) were recorded before induction of anaesthesia , after induction but before caudal anaesthesia , 5min after caudal anesthesia and every 5 min thereafter till the patient was shifted to pacu . during intraoperative period adequacy of analgesia was gauged by hemodynamic stability . an increase or decrease in the hr > 15% from the baseline values was considered as tachycardia or bradycardia . similarly , an increase or decrease in map > 15% was considered as hypertension or hypotension . absence of rise of hr or map of more than 15% compared with baseline values recorded just before surgical incision was considered as adequate analgesia . an increase in hr or map ( > 15% ) , 15 min after administration of caudal anesthesia was defined as failure of analgesia . if hr , map increased 45 min after surgical incision it was considered as inadequate analgesia . patients with failure of caudal analgesia or inadequate analgesia were given fentanyl 1 g / kg intravenously . patients , in whom caudal anesthesia failed or inadequate analgesia was present , were excluded from study . time from caudal block to skin incision , duration of surgery , duration of general anesthesia , and time to removal of lma after discontinuation of inhalational anesthetic agent was recorded . in pacu analgesia , sedation , hr , map , spo2 , and side effects were monitored by blinded observer every 30 min for 6 hours , and thereafter hourly till 12 hrs after caudal block . pain was assessed using hannallah pain scale [ table 1 ] . if patients had score of > 4 on at least 2 occasions or showed obvious signs of pain they were given oral paracetamol 10 mg/ kg . the duration of postoperative analgesia was defined as time interval between caudal anesthesia and first complaint of pain . assessment of sedation was done 30 min , 1 hour , 2hours , and 4 hours after surgery using 3 point sedation score [ table 2 ] . assessment of duration of motor blockade was done by noting the time from caudal block to spontaneous movements of leg by patient . time of micturition was defined as time from administration of caudal block to spontaneous voiding of urine . side effects like nausea , vomiting , respiratory depression , pruritus hypotension , and bradycardia were also noted . ninety pediatric patients , 45 in group i and 45 in group ii were studied . both the groups were comparable with regard to mean age , weight , gender , duration of general anesthesia , duration of surgery , time from caudal block to incision , and time to removal of lma after discontinuation of volatile anesthetic agent [ table 3 ] . demographic and clinical data ( mean sd or range ) the map , hr , and spo2 at induction , intraoperatively and postoperatively , when compared between the two groups using student t - test , yielded p values > 0.05 , which were not significant [ table 4 ] . map decreased in both groups by 1015% during anesthesia and increased by 515% during recovery but the changes were not significant ( p > 0.05 ) . hr also decreased during anesthesia followed by an increase in postop period in both the groups ( p > 0.05 ) . no patient in either group had a drop in hr to less than 80 beats per minute . intraoperative vitals ( mean value s.d ) mean duration of surgery was 46.22 5.22 in group i and 48.22 6.12 in group ii after 6 hours , however , pain score was significantly higher in group ii than group i ( p < 0.05 ) [ table 5 ] . the mean duration of analgesia was longer in group i than in group ii , but the difference was not statistically significant ( p > 0.05 ) . the dose of paracetamol required was higher in group ii than group i but this was also not statistically significant ( p > 0.05 ) [ table 6 ] . post operative pain scoring ( mean value s.d ) postoperative clinical data ( mean value s.d ) postoperative sedation score in both groups the complications / side effects seen in the two groups are shown as [ table 8 ] . residual motor blockade on arrival in pacu and time to complete regression of motor block were similar in both groups . eight patients of group ii suffered from vomiting and bradycardia occurred in 3 patients in group ii . these complications ( respiratory depression , vomiting , and bradycardia ) were not observed in group i and difference between two was statistically significant ( p < 0.05 ) . caudal epidural anesthesia is a simple , frequently used technique , which provides very effective analgesia intra- and postoperatively in pediatric patients undergoing infraumbilical surgeries . the search for the ideal combination of drugs for caudal anesthesia in pediatric patients is on . ropivacaine is a local anesthetic with better safety margin and reduced risk of cardiac toxicity.[36 ] separation of sensory and motor effects is more with ropivacaine than with bupivacaine . this study demonstrates that in a single shot caudal block with clonidine or fentanyl added to ropivacaine prolongs analgesia . bosenberg a et al . demonstrated that ropivacaine 0.2% provided satisfactory postoperative pain relief , while 0.1% was less effective and 0.3% was associated with higher incidence of motor block with minimal improvement in pain relief . previous reports[2224 ] demonstrated that ropivacaine produces vasoconstriction in contrast to vasodilatation produced by bupivacaine , so we hypothesized that using additive with ropivacaine will provide more analgesic advantage compared to bupivacaine . various drugs were tried to prolong the duration of analgesia with minimal side effects because the mean duration of analgesia provided with even longer acting local anesthesia is limited . fentanyl , a lipophillic opioid is very commonly used as an additive to local anesthetics in children . although there is no debate about its beneficial effects , side effects like respiratory depression , nausea , and vomiting are common . clonidine an 2 agonist has also been used as additive to local anesthetics , e.g. , bupivacaine , mepivacaine , lignocaine . its addition increases duration and improves quality of analgesia provided by single shot caudal anesthesia . clonidine is devoid of opioid side effects but may produce excessive sedation , hypotension , and bradycardia in adults . in the present study , addition of clonidine and fentanyl to ropivacaine was found to be effective in providing effective intraoperative and postoperative analgesia . the patients in group ii required analgesia supplementation slightly earlier in the postoperative period as compared to group i , but this difference was not statistically significant . respiratory depression is an expected but unwanted side effect of extradural opioid ; it has also been noticed in adult patients who received clonidine 300 g extradurally . many previous studies have however not reported respiratory depression after caudal administration of fentanyl or clonidine in pediatric patients . in our study , a transient decrease of oxygen saturation to 91% was observed in 5 cases of group ii , while no patient of group i suffered hemoglobin desaturation ( p = 0.0105 ) . a sedative effect was observed after epidural clonidine in adults and to a lesser degree in children . in our study , time taken to removal of lma and sedation score was not significantly different in both the groups ( p = 0.877 , p = 0.575 ) . in group i , 3 patients and 1 patient of group ii had sedation of 2 but this was not significant ( p = 0.575 ) hypotension and bradycardia are expected side effect of extradural clonidine in adults and depend on the dose administered , however in children the hemodynamic effects of extradural clonidine are less pronounced than in adults . in the present study , we observed a similar hemodynamic profile in both groups intraoperatively as well as postoperatively . no patient of groupi suffered from bradycardia , while 3 patients of group ii had bradycardia but this was not significant . no patient of either group had a fall in hr to less than 80 beats per minute . eight patients out of 45 had vomiting in group ii , but no patient of group i had vomiting in postoperative period . the extradural opioids are well known for their emetic effect while clonidine has anti - emetic properties when administered orally or intravenously . presence of lesser side effects may be an argument for the use of clonidine rather than fentanyl as an adjunct to local anesthetics when prolongation of analgesia is required . the addition of clonidine or fentanyl to ropivacaine prolongs the duration of analgesia after single shot caudal epidural anesthesia . clonidine offers some advantages over fentanyl as it does not produce clinically and statistically significant undesirable side effects like respiratory depression , vomiting and bradycardia . we recommend the use of clonidine as additive to ropivacaine in caudal anesthesia , in children , as it has a more favorable side effect profile than fentanyl . | background : the aim of the study was to compare the efficacy of clonidine and fentanyl as an additive to ropivacaine given via single shot caudal epidural in pediatric patients for postoperative pain relief.materials and methods : in the present double blind study , 90 children of asa - i - ii aged 3 - 8 years scheduled for infraumblical surgical procedures were randomly allocated to two groups to receive either ropivacaine 0.25% 1 ml / kg
+ clonidine 2 g / kg ( group i ) or ropivacaine 0.25% 1 l / kg + fentanyl 1 g / kg ( group ii ) .
caudal block was performed after the induction of general anesthesia .
postoperatively patients were observed for analgesia , sedation , hemodynamics , and side effects / complications.results : both the groups were similar with respect to patient and various block characteristics .
the analgesic properties and hemodynamics were also comparable in both groups ( p > 0.05 ) .
side effects such as respiratory depression , vomiting bradycardia were significantly less in group i than group ii ( p < 0.05 ) ensuing more patient comfort.conclusions:the analgesic properties of clonidine and fentanyl as additives to ropivacaine in single shot caudal epidural in children are comparable but clonidine offers a more favorable side effect profile . the use of clonidine as additive to ropivacaine in caudal epidural is superior choice to fentanyl because of lack of unwanted side effects and increased patient comfort . |
laparoscopy is now widely used in urology for both upper and lower urinary tract surgery . laparoscopic prostatectomy has been accepted as an appropriate treatment for prostate cancer at some institutions because of the shorter hospital stay and quicker recovery . pneumoperitoneum is a necessity in laparoscopy , and it has been associated with complications , such as retroperitoneal or preperitoneal insufflation , or both , and gas embolism . groin hernia following laparoscopy has been described , but it is a rare complication of pneumoperitoneum . clinically evident femoral hernias occur in 0.5% of the general population , but the prevalence of occult femoral hernias has not been well described . to our knowledge , our case represents the third reported occurrence of occult femoral hernia exacerbation after laparoscopy , and the first reported occurrence of groin hernia associated with laparoscopic prostatectomy . a 71-year - old man underwent laparoscopic prostatectomy as treatment for adenocarcinoma of the prostate . a pre - operative biopsy revealed a gleason grade 3 + 4 tumor , and his serum prostate specific antigen was 6.4 ng / ml ( normal < 4.10 ng / ml ) . no intraoperative complications occurred at the time of surgery ; however , it was noted that gas from the pneumoperitoneum had tracked to the scrotum and penis . visual inspection of the pelvis did not reveal the presence of an inguinal or femoral hernia . the patient did well until the third postoperative day when he complained of abdominal pain . he was treated conservatively but developed more abdominal distention with hypoactive bowel tones and tympany on examination . leukocytosis was noted , with an increase in the white blood cell count from 7000 to 14700 per cubic millimeter ( normal , 4400 to 11000 per cubic millimeter ) . a computed tomographic ( ct ) scan revealed a right femoral hernia with incarcerated small bowel ( figure 1 ) . the patient was taken to the operating room for an exploratory laparotomy and repair of a right femoral hernia . fifteen centimeters of perforated ischemic small bowel was resected , and a primary small bowel anastomosis was performed . the patient regained bowel function 7 days after repair of his hernia and partial small bowel resection and was discharged home . computed tomographic scan demonstrates right femoral hernia with incarcerated small bowel . our case represents what we believe to be the third reported occurrence of femoral hernia after laparoscopy . that this was a pelvic procedure occult hernias and small fascia defects may not always be apparent preoperatively , but extension of pneumoperitoneal insufflation to extraperitoneal compartments should alert the surgeon to the possible presence of such a defect . when this occurs , a high index of suspicion should be maintained for potential complications . in the future , we would strongly consider simultaneous hernia repair in similar situations . | laparoscopic prostatectomy has been accepted as an appropriate treatment for prostate cancer because of the shorter hospital stay and quicker recovery .
we present a rare complication of groin hernia with incarceration and necrosis of small bowel following laparoscopic prostatectomy .
occult hernias and small fascia defects may not always be apparent pre - operatively , but extension of pneumoperitoneal insufflation to extraperitoneal compartments should alert the surgeon to the possible presence of such a defect . |
clinical practice guidelines ( cpgs ) are propositions for health care providers about the care of patients with categorical conditions . they should be predicated upon the best feasible research evidence and practice experience.1 they are usually described as systematically developed statements to assist practitioners and patients decisions about appropriate health care for specific circumstances.2,3 the aim of cpg is to improve the safety and quality of patient care by providing clinicians with graded guidance predicated on evidence of best practice.4 health care providers might deviate from implementing cpgs due to barriers such as receptiveness of guidelines , incentives to adhere to guidelines , and perceived effect of guidelines on patient outcomes.3 the objective behind conducting this survey study was to explore the pediatricians perceptions towards clinical practice guidelines at hamad medical corporation ( hmc ) in qatar . a cross - sectional survey of physicians at hamad medical corporation , the only tertiary care , academic and teaching hospital in the state of qatar , was conducted between may 1 , 2013 and august 31 , 2013 . a total of 244 physicians were targeted . in all , 240 eligible physicians were included in the survey . a specialist will eventually be promoted to consultant if he or she meets the institution criteria for promotion . the pediatric physicians in our institution practice in the pediatric emergency center ( pec ) , general wards , subspecialty wards , neonatal intensive care unit ( nicu ) , or pediatric intensive care unit . a self - administered questionnaire was distributed in the different pediatric departments to different levels and positions . questionnaires were distributed on - site during working hours , and participants were asked to respond immediately . some of the participants returned the questionnaire to a specified box while others preferred to return them by hand . the questionnaire content was based on previous surveys2,3 but adapted to qatari s system and modified for the purposes of our study . these sections addressed physicians knowledge and attitudes regarding use of clinical practice guidelines ( cpgs ) in patient health care management . answers to questions of physicians awareness , knowledge , and attitudes regarding the significance of using cpgs were based on 5-point likert - style graded response options , ranging from strongly agreed to strongly disagreed and do nt know . verbal consent was obtained before administering the questionnaire , and participants were informed of why the information was being collected and how it would be used for effective patient care management . before the start of the interview , a statement was read to participants informing them that their participation was voluntary and confirmed that their answers are anonymous and confidential . approval for the study was obtained from hamad medical corporation - ethics committee ( ref # 13174/13 ) . qualitative and quantitative data values were expressed as frequencies along with percentages and mean sd and median and range . associations between two or more qualitative or categorical variables were assessed using chi - square test . for small cell frequencies , the chi - square test with continuity correction factor or fisher s exact test was applied . all statistical analyses were done using statistical package spss , version 19.0 ( ibm corporation , armonk , ny ) . a cross - sectional survey of physicians at hamad medical corporation , the only tertiary care , academic and teaching hospital in the state of qatar , was conducted between may 1 , 2013 and august 31 , 2013 . a total of 244 physicians were targeted . in all , 240 eligible physicians were included in the survey . a specialist will eventually be promoted to consultant if he or she meets the institution criteria for promotion . the pediatric physicians in our institution practice in the pediatric emergency center ( pec ) , general wards , subspecialty wards , neonatal intensive care unit ( nicu ) , or pediatric intensive care unit . a self - administered questionnaire was distributed in the different pediatric departments to different levels and positions . questionnaires were distributed on - site during working hours , and participants were asked to respond immediately . some of the participants returned the questionnaire to a specified box while others preferred to return them by hand . the questionnaire content was based on previous surveys2,3 but adapted to qatari s system and modified for the purposes of our study . these sections addressed physicians knowledge and attitudes regarding use of clinical practice guidelines ( cpgs ) in patient health care management . answers to questions of physicians awareness , knowledge , and attitudes regarding the significance of using cpgs were based on 5-point likert - style graded response options , ranging from strongly agreed to strongly disagreed and do nt know . verbal consent was obtained before administering the questionnaire , and participants were informed of why the information was being collected and how it would be used for effective patient care management . before the start of the interview , a statement was read to participants informing them that their participation was voluntary and confirmed that their answers are anonymous and confidential . approval for the study was obtained from hamad medical corporation - ethics committee ( ref # 13174/13 ) . qualitative and quantitative data values were expressed as frequencies along with percentages and mean sd and median and range . associations between two or more qualitative or categorical variables were assessed using chi - square test . for small cell frequencies , the chi - square test with continuity correction factor or fisher s exact test was applied . all statistical analyses were done using statistical package spss , version 19.0 ( ibm corporation , armonk , ny ) . out of the 240 questionnaires distributed , 169 ( 70.4% ) were returned by the end of the study . the ratio of male to female was 1.8:1 . among the participants were 68 consultants ( 40.2% ) , 47 specialists ( 27.8% ) , 20 clinical fellows ( 11.8% ) , and 34 residents ( 20.1% ) . in terms of years of experience , 43 ( 25.4% ) had < 5 years , 47 ( 27.8% ) had between 5 and 10 years , 33 ( 19.5% ) had between 11 and 16 years , and 46 ( 27.2% ) had more than 16 years . it was found that 94.6% of physicians were familiar with clinical practice guidelines ( cpg ) , and 80% of them used clinical practice guidelines in their clinical practice and patient care . details of participants current position , department , and year of experiences , familiarity and use of clinical practice guidelines are given in table 1 . physicians were asked to make an assessment of their familiarity and use of clinical practice guidelines in their own department and hospital . as measured by the questionnaire , physician perception and awareness of cpgs varied in view of the various aspects included and covered in standard cpgs ( table 1 ) ; 98.8% and 94.1% of physicians responded strongly agreed and agreed , respectively , that cpgs lead to good quality of care and have practical significance for patient care management . in all , 96.4% of physicians strongly agreed or agreed that cpgs provide more standardized patient care and should be implemented effectively throughout various pediatric disciplines . it is interesting to note that more than 80% of physicians agreed that cpgs provide recent advancement in the area and that use of cpgs will keep physicians more up - to - date about diagnosis and effective management of patient care . also , it is worth mentioning that more than 90% of physicians agreed that cpgs also reduce medicolegal responsibilities . in all , 62.9% of physicians agreed that use of cpgs might affect physicians clinical judgment . more than 75% of physicians disagreed that cpgs do not match with their practice style , restrict continuity of self - education , and are not evidence - based . familiarity with cpgs was observed to be higher among pediatric intensive care unit and nicu physicians ( 100% ) compared with physicians in other divisions , such as general pediatrics , pediatric subspecialty , and pec ( 91.1% to 95.6% ) ; however , the difference was not statistically significant ( p=0.845 ) . use of cpgs reported as very common was found to be higher in pec ( n=15 , 44.1% ) compared with other pediatric divisions such as nicu ( n=8 , 33.3% ) , pediatric subspecialty ( n=9 , 20% ) , general pediatrics ( n=9 , 16.4% ) , and pec ( n=1 , 12.5 ) , though the difference , again , was not statistically significant ( p=0.127 ) ( figure 1 ) . the association between physicians awareness and use of cpgs according to their respective positions are shown in figure 2 . among consultant and specialist physicians , the familiarity and use of cpgs were observed to be higher compared with fellow and resident physicians ; however , the difference was not statistically significant ( p=0.347 ) . we studied the association between years of experience and familiarity with and use of cpgs . among physicians who had more than 16 years of experience , the percentage of familiarity with cpgs was observed to be higher ( n=46 , 100% ) compared with those with < 5 years ( n=38 , 90.5% ) , 510 years ( n=44 , 93.6% ) , and 1116 years of experience ( n=31 , 93.9% ) ; however , the difference was not statistically significant ( p=0.488 ) . a similar association was observed between years of experience and whether use of cpgs was reported as very common or common ( figure 3 ) . the systematic review should include all relevant scientific studies.2 we desired to study the perceptions of pediatricians toward cpgs using an anonymous questionnaire . there are only very few studies in the literature that touch our area of study . our main finding is that , contrary to expectation , the pediatricians questioned in our study at all levels are familiar with cpgs and use them . our pediatricians have been trained in different countries , and they tend to apply what they learned during their residency years . pediatric residents in our institution noticed the difference in practice among attending physicians , which was the reason that the concept of cpgs was introduced . in addition , our department is particular about the necessity of involving almost every physician when developing guidelines . for instance , when the urinary tract infection guideline was developed , general pediatricians as well as pediatric nephrologists were involved in the discussion . our study showed that the urinary tract infection guideline is the most commonly used cpg , followed by guidelines concerning diabetic ketoacidosis , asthma exacerbation , and neonatal sepsis . in addition , our doctors believe that cpgs lead to good quality of care , are practical , provide standardized patient care , will keep them up - to - date , decrease the rate of litigation , are evidence - based , do not restrict continuity of self - education , do not alter physician esteem , are descriptive , lead to improvement of outcome , and are practical . however , the barriers that might impede the use of cpgs are that they affect clinical judgment , do not match with our pediatricians practice style , and do not reduce health care costs . preceding adoption of cpgs , attitudes of physicians should be determined.2 in addition , physicians feel more comfortable with cpgs if they participate in their development.1 the response rate of our study ( 70.4% ) was higher than 56.5% as reported by wahabi et al,2 and 49% as reported by heselmans et al.5 almost 95% of our pediatricians are familiar with clinical practice guidelines ( cpgs ) , and 80% of them use clinical practice guidelines in their clinical practice and patient care , compared with 35% of physicians in the study conducted by flores et al.6 the high rate of familiarity and use among our pediatricians , which is higher than other studies,2,5,6 might mean that physicians negative attitudes toward cpgs in general will not be a future obstacle to implementation of cpgs in our institution . junior physicians are known to have positive attitudes toward cpgs , and they report higher adherence rates.3 however , our study showed the opposite , which could be due to the fact that the majority of our senior physicians have prior experience in western countries where cpgs are commonly used . in the united states , cpgs apparently played a role in proving negligence from the part of the physician.7 however , that is not what our pediatricians perceive . the reason could possibly be due to our setting being an inpatient setting , and more time is allotted for communication with families . there is insufficient support in the literature that introducing cpgs reduces health care costs.8 our pediatricians responses reflect this in that only 43% believe that cpgs reduce health care costs . a study conducted by farquhar et al8 showed that 71% of clinicians consider cpgs to be good educational tools compared with 82% of our physicians , who consider that guidelines will keep them up - to - date . an australian study showed that 85% of physicians believe that cpgs are developed by experts who do nt understand general practice , and hence lack credibility.9 our study participants opposed that sentiment , and three quarters of the pediatricians stated that cpgs are evidence - based . cpgs are being described by many practitioners as oversimplified and biased and that they defy physicians autonomy and alter in a negative way doctor satisfaction.8 outcome expectancy is the prediction that a certain act will lead to a specific repercussion . health care providers will not adhere to certain guidelines if they believe that such guidance will not lead to outcome improvement.10 almost 80% of our pediatricians disagreed or strongly disagreed that cpgs will unlikely lead to improvement of outcome . clinicians are more likely to adhere to cpgs if they are derived from credible sources or organizations,8,11 if they are perceived as beneficial for patients,12 and if resources are available.13 the strength of our study is that 70% of potential respondents returned the survey and hence the results reflect the actual experiences of pediatricians within the organization . a limitation could be that private hospitals were not included in the study and hence the results can not be extrapolated to a state level . the strength of our study is that 70% of potential respondents returned the survey and hence the results reflect the actual experiences of pediatricians within the organization . a limitation could be that private hospitals were not included in the study and hence the results can not be extrapolated to a state level . pediatricians at hmc have positive perception toward cpgs in general , which could positively influence the future implementation of evidence - predicated cpgs . the results of our study suggest that cpgs are likely to be implemented if more counseling and education are provided to pediatricians regarding the usefulness of evidence - based guidelines . in addition , a program should be instigated to remove barriers while simultaneously addressing physicians concerns . | backgroundclinical practice guidelines ( cpgs ) are propositions for health care providers about the care of patients and are usually described as systematically developed statements to assist practitioners and patients decisions about appropriate health care for specific circumstances.objectivesthe purpose of this study was to investigate pediatricians perceptions of clinical practice guidelines at hamad medical corporation ( hmc ) in qatar.methodsa cross - sectional study was conducted at hmc between may 1 and august 31 , 2013 using a self - administered questionnaire that was distributed to 240 pediatricians.resultsa total of 169/240 questionnaires were completed for a response rate of 70.4% .
our main finding was that pediatricians at all levels are familiar with cpgs and use them .
in addition , our doctors believe that cpgs lead to good quality of care , are practical , provide standardized patient care , will keep them up - to - date , decrease the rate of litigation , are evidence - based , do not restrict continuity of self - education , do not alter physician esteem , lead to improvement of outcome , and are practical .
however , barriers that might impede pediatricians use of cpgs are that cpgs affect their clinical judgment , do not match with their practice style , and do not reduce health care costs.conclusionspediatricians at hmc have positive perceptions of cpgs . the results of our study suggest that cpgs are likely to be implemented if more counseling and education are provided to pediatricians regarding the usefulness of evidence - based guidelines . in addition , a program should be initialized to remove barriers while simultaneously addressing physicians concerns . |
three - dimensional ( 3d ) cultures of the colon cancer cell lines colo-205 ( cls cell lines service gmbh , heidelberg , germany ) and ht29 ( kind gift of prof . t. brabletz , erlangen , germany ) were set - up as described previously , . in brief , 4-well chamber slides ( bd biosciences ) were coated with a thin layer of ice - cold matrigel ( 75 l ) and incubated at 37 c for at least 30 min to allow solidification of the matrigel . subsequently , cells ( 35 10 cells / well ) were resuspended in culture medium containing 2% matrigel and seeded on top of the solidified matrigel . ht29 and colo-205 3d cultures were treated with dmso or with 3 m of the b - raf inhibitor plx4720 dissolved in dmso 4 days after seeding . cells were harvested at three different time points after starting the treatment : at 1 , 3 and 8 days for ht29 and at 1,3 and 10 days for colo-205 cells . the ht29 samples were measured in duplicates . to extract the cells the medium was aspirated and 500 l recovery solution ( bd biosciences ) were added to each well . the cell / gel mixture was scraped into a 15 ml tube using a pipette tip . following 1 h of incubation on ice the cells were washed twice with 15 ml ice - cold dpbs ( centrifugation : 10 min , 1200 rpm , 4 c ) and the cell pellet used for total rna isolation . rna quality and integrity were verified using the agilent 2100 bioanalyzer system ( agilent technologies ) . biotin - labeled crna samples for hybridization on illumina humanht-12 v4 expression beadchip ( illumina , inc . ) 250 ng total rna was used for complementary dna ( cdna ) synthesis , followed by an amplification / labeling step ( in vitro transcription ) to synthesize biotin - labeled crna according to the messageamp ii arna amplification kit ( ambion , inc . quality of crna was controlled using the rna nano chip assay on an agilent 2100 . microarray scanning was performed using a beadstation array scanner , setting adjusted to a scaling factor of 1 and pmt settings at 430 . data extraction was done for all beads individually , and outliers are removed when > 2.5 mad ( median absolute deviation ) . all remaining data points are used for the calculation of the mean average signal for a given probe , and standard deviation for each probe was calculated . the illumina probes were annotated with the custom mappings from the bioconductor r package illuminahumanv4.db . probes that were flagged as bad , i.e. matching repeat sequences , intergenic or intronic regions , or having no match , i.e. without match for any genomic region or transcript , according to the illuminahumanv4probequality mapping were discarded . findlargest function from the r bioconductor package genefilter resolved the problem , if multiple probes matched the same entrez gene . the function finds all replicates and selects the one with the largest interquartile rank ( iqr ) in expression across all samples , finally retaining 19,178 entrez genes in the colo-205 and the ht29 array samples . due to the unknown contributions of either technical or biological variability we restricted our analysis to comparisons of within cell line differences with respect to treatment and time . a principal component analysis ( pca ) on both cell line samples ( fig . 1b and c ) confirmed 3d culture growth as the largest influence on gene expression followed by the effect of plx4720 treatment , which showed in the separation along pc1 and pc2 , and is marked in the plots by culture and treatment , respectively . furthermore , the duplicates for the ht29 lie close to each other , which demonstrates the reproducibility of the 3d culture . due to the similar pca response patterns between colo-205 and ht29 we hypothesized that the culture conditions and treatment might elicit similar genes . as we did not have replicate samples for the colo-205 , we performed for both cell lines a moderated f - test using the r limma package on the treatment versus control samples to identify genes that responded differently over time . p - values from the f - statistic were corrected for false discovery rate estimation according to benjamini and hochberg . there was a significant pearson correlation of r = 0.71 for all differentially genes between plx4720 and control in both cell lines ( adjusted p - value < 0.001 ) , supporting our initial hypothesis . a hypergeometric test on the biological processes from the human gene ontology using the r gostats package showed a strong involvement of these genes in developmental and differentiation processes ( fig . the above findings led to the assumption that the effect of plx4720 reintroduced a differentiation phenotype from the otherwise more stem cell like cancer phenotype . to corroborate in detail the loss of stemness / pluripotency we used the plurinet gene set as marker for the stemness or inversely the differentiation status of the cells . the marker set consists of 299 genes that were derived from classifying human pluripotent , multipotent and differentiated cells . to assess the overall stemness / differentiation status of the colo-205 and ht29 cells , we compared the plurinet gene expression among all nci60 cell lines . gene expression had been measured using the affymetrix human genome u133 plus 2.0 arrays , which we normalized together using robust multichip averaging in conjunction with the custom definition file from brainarray in version 17.0 . a principal component analysis separated the samples along the pc1 according to their marker gene expression , predicting the acute lymphoblastic leukemia cell line molt-4 as least and the ovary adenocarcinoma derived sk - ov-3 as the most differentiated cells ( fig . relative to ht29 ( p - value < 10 , one - sided t - test ) likewise indicated a higher stemness of the former ( fig . 3b ) . to assess the loss of stemness we performed a gene set enrichment using the generally applicable gene - set enrichment ( gage ) . for analysis we performed an unpaired sample comparison of we tested for changes in a gene set in the same direction using the per gene fold change and summarizing individual p - values using stouffer 's method . 3c ) in both cell lines with a more significant effect in the colo-205 cells . three - dimensional ( 3d ) cultures of the colon cancer cell lines colo-205 ( cls cell lines service gmbh , heidelberg , germany ) and ht29 ( kind gift of prof . t. brabletz , erlangen , germany ) were set - up as described previously , . in brief , 4-well chamber slides ( bd biosciences ) were coated with a thin layer of ice - cold matrigel ( 75 l ) and incubated at 37 c for at least 30 min to allow solidification of the matrigel . subsequently , cells ( 35 10 cells / well ) were resuspended in culture medium containing 2% matrigel and seeded on top of the solidified matrigel . ht29 and colo-205 3d cultures were treated with dmso or with 3 m of the b - raf inhibitor plx4720 dissolved in dmso 4 days after seeding . cells were harvested at three different time points after starting the treatment : at 1 , 3 and 8 days for ht29 and at 1,3 and 10 days for colo-205 cells . the ht29 samples were measured in duplicates . to extract the cells the medium was aspirated and 500 l recovery solution ( bd biosciences ) were added to each well . the cell / gel mixture was scraped into a 15 ml tube using a pipette tip . following 1 h of incubation on ice the cells were washed twice with 15 ml ice - cold dpbs ( centrifugation : 10 min , 1200 rpm , 4 c ) and the cell pellet used for total rna isolation . rna quality and integrity were verified using the agilent 2100 bioanalyzer system ( agilent technologies ) . biotin - labeled crna samples for hybridization on illumina humanht-12 v4 expression beadchip ( illumina , inc . ) 250 ng total rna was used for complementary dna ( cdna ) synthesis , followed by an amplification / labeling step ( in vitro transcription ) to synthesize biotin - labeled crna according to the messageamp ii arna amplification kit ( ambion , inc . quality of crna was controlled using the rna nano chip assay on an agilent 2100 . microarray scanning was performed using a beadstation array scanner , setting adjusted to a scaling factor of 1 and pmt settings at 430 . data extraction was done for all beads individually , and outliers are removed when > 2.5 mad ( median absolute deviation ) . all remaining data points are used for the calculation of the mean average signal for a given probe , and standard deviation for each probe was calculated . the illumina probes were annotated with the custom mappings from the bioconductor r package illuminahumanv4.db . probes that were flagged as bad , i.e. matching repeat sequences , intergenic or intronic regions , or having no match , i.e. without match for any genomic region or transcript , according to the illuminahumanv4probequality mapping were discarded . findlargest function from the r bioconductor package genefilter resolved the problem , if multiple probes matched the same entrez gene . the function finds all replicates and selects the one with the largest interquartile rank ( iqr ) in expression across all samples , finally retaining 19,178 entrez genes in the colo-205 and the ht29 array samples . due to the unknown contributions of either technical or biological variability we restricted our analysis to comparisons of within cell line differences with respect to treatment and time . a principal component analysis ( pca ) on both cell line samples ( fig . 1b and c ) confirmed 3d culture growth as the largest influence on gene expression followed by the effect of plx4720 treatment , which showed in the separation along pc1 and pc2 , and is marked in the plots by culture and treatment , respectively . furthermore , the duplicates for the ht29 lie close to each other , which demonstrates the reproducibility of the 3d culture . due to the similar pca response patterns between colo-205 and ht29 we hypothesized that the culture conditions and treatment might elicit similar genes . as we did not have replicate samples for the colo-205 , we performed for both cell lines a moderated f - test using the r limma package on the treatment versus control samples to identify genes that responded differently over time . p - values from the f - statistic were corrected for false discovery rate estimation according to benjamini and hochberg . there was a significant pearson correlation of r = 0.71 for all differentially genes between plx4720 and control in both cell lines ( adjusted p - value < 0.001 ) , supporting our initial hypothesis . a hypergeometric test on the biological processes from the human gene ontology using the r gostats package showed a strong involvement of these genes in developmental and differentiation processes ( fig . the above findings led to the assumption that the effect of plx4720 reintroduced a differentiation phenotype from the otherwise more stem cell like cancer phenotype . to corroborate in detail the loss of stemness / pluripotency we used the plurinet gene set as marker for the stemness or inversely the differentiation status of the cells . the marker set consists of 299 genes that were derived from classifying human pluripotent , multipotent and differentiated cells . to assess the overall stemness / differentiation status of the colo-205 and ht29 cells , we compared the plurinet gene expression among all nci60 cell lines . gene expression had been measured using the affymetrix human genome u133 plus 2.0 arrays , which we normalized together using robust multichip averaging in conjunction with the custom definition file from brainarray in version 17.0 . a principal component analysis separated the samples along the pc1 according to their marker gene expression , predicting the acute lymphoblastic leukemia cell line molt-4 as least and the ovary adenocarcinoma derived sk - ov-3 as the most differentiated cells ( fig . the significant higher expression of the plurinet marker genes in colo-205 cells relative to ht29 ( p - value < 10 , one - sided t - test ) likewise indicated a higher stemness of the former ( fig . 3b ) . to assess the loss of stemness we performed a gene set enrichment using the generally applicable gene - set enrichment ( gage ) . for analysis we performed an unpaired sample comparison of plx4720 treated cells on days 3 and 8/10 relative to day 1 . we tested for changes in a gene set in the same direction using the per gene fold change and summarizing individual p - values using stouffer 's method . 3c ) in both cell lines with a more significant effect in the colo-205 cells . we described analysis on the two colon cancer cell lines that harbor braf mutations . to elucidate the effect of this mutation on carcinogenesis we compared the changes in gene expression of colo-205 and ht29 3d cultures under b - raf inhibition over time . while the cell culture data indicated a high reproducibility , technical and/or biological batch effects hindered us from direct comparison of the cell line data . therefore , we had to analyze each cell type individually . yet , functional enrichment of the gene expression clearly correlated with the treatment and cell culture phenotype and suggested the restoration of differentiated epithelia . the analysis predicted novel players involved in the differentiation process and inversely suggested stemness properties inherent in the cancer cell lines . including a broader data base from the nci60 cell line panel allowed quantifying the relative differentiation status of the cells . gene set enrichment then demonstrated the loss of stemness under b - raf inhibition in line with the observed differentiation phenotype . based on fig . 3c , it is even tempting to speculate that the colo-205 cells lose their stemness faster than ht29 , as the latter are more differentiated than the former according to fig . this is further supported by the stronger up - regulation over time of differentiation markers in colo-205 that are not part of the plurinet gene set , e.g. , the transcription factors caudal type homeobox 1 and 2 ( fig . 3d ) or the various gene products associated with epithelial differentiation and effector functions . in conclusion , we demonstrated the use of functional analysis in combination with public database data to elucidate the oncogenic mechanisms underlying braf mutations in colon cancer that led to the discovery of novel players and novel therapeutic rationales for using pathway inhibitors in the treatment of this disease . all authors acknowledge financial support by the dfg funded sfb 850 ( projects b4 and z1 ) . we thank the microarray unit of the dkfz genomics and proteomics core facility for providing the illumina whole - genome expression beadchips and related services . | cancer cell differentiation is an important field of discussion in the light of cancer stem cells . in a recent study by herr et al .
( 2015 ) b - raf inhibitors induce epithelial differentiation in braf - mutant colorectal cancer cells
we described how inhibition of mutant braf in colorectal cancer cell lines induces cell re - differentiation that is correlated with the loss of tumor growth in vitro and in vivo .
we used illumina humanht-12 v4 expression beadchip to characterize the gain of differentiation of plx4720-treated 3d cultures of ht29 and colo-205 cells . here , we describe the experimental design and statistical analysis that were performed on the data set leading to the above hypothesis .
the data are publicly available at the gene expression omnibus ( geo ) database under the accession number gse50791 . |
after meningitis , brain abscesses represent the second most common intracranial complication of chronic otitis media ( com)14 ) , with an associated mortality rate ranging between 7% and 61% in most large series11,14 ) . roughly 50% of brain abscesses in adults and 25% in children are believed to stem from otogenic infections8,18 ) , though the incidence has decreased due to the early treatment of chronic otitis media , the early diagnosis of associated complications , and the widespread use of antibiotics . nonetheless , the exact timing of abscess drainage and the optimal method for approach remain controversial . currently , most neurosurgery literature dictates that drainage via burr holes or complete lesion excision ( including the abscess capsule ) represent the gold - standard for surgical intervention16,17,18 ) . however , not only are these two procedures associated with significant morbidity , and but neither address the treatment of the origin of infection . herein , we describe the successful management of an otogenic brain abscess presenting as facial paralysis with concomitant headache and ipsilateral hearing loss using a transmastoid approach and subsequent facial nerve decompression and discuss the details of the technique and its specific advantages . a 50-year - old man presented to our clinic for evaluation of progressive left facial paralysis , otalgia , intermittent otorrhea , mild dizziness , headache and hearing impairment . on physical examination , facial paralysis was rated as grade iii ( per the house - brackmann grading system ) . a further endoscopic examination revealed total perforation of the tympanic membrane , edema of the middle ear mucosa , and foul - smelling , purulent discharge from the left ear ( fig . 1 ) , with left - sided caloric weakness of 71% found on subsequent electronystagmography . on further questioning , pure - tone audiometry was then performed , demonstrating near total deafness in the left ear . given these findings , a temporal bone computed tomography ( ct ) scan was performed , revealing a soft tissue density filling the middle ear cavity and mastoid , possible dehiscence of the mastoid segment of the facial nerve , and pneumocephalus above the tegmen of the left ear . magnetic resonance imaging ( mri ) was also performed , revealing inflammation of the temporal lobe and an epidural abscess . at that time , the decision was made to treat with intravenous antibiotics for 3 weeks to allow the abscess in the temporal lobe to mature . however , as severe headaches and fever developed on day 7 of the iv antibiotic course . emergent surgical intervention was then scheduled to resolve the ongoing severe headaches , dizziness , and facial nerve paralysis . specifically , the mastoid was removed via radical mastoidectomy , freeing a significant amount of cholesteatoma from the middle ear . during the operation , the dehiscence of the mastoid segment of the facial nerve was first identified ( fig . the tegmen was also found to be eroded , and , after removing many adherent granulations and burring out one portion , the abscess wall was exposed . next , a needle was advanced into the abscess cavity via a healthy portion of dura , though no pus was able to be aspirated . consequently , all further inteventions were deferred until the abscess was matured completely . after another 2-week course of iv antibiotics , a follow - up mri revealed more mature abscess formation in the temporal lobe ( fig . , an 18-gauge needle was advanced into the abscess , obtaining 12 ml of pus ( fig . the bony defect over the tegmen was closed using tragal and conchal cartilage , so that the free edges of the cartilage were hinged on the intracranial aspect . temporalis fascia and perichondrium grafts were also transplanted over this area to reinforce the eroded tegmen , and the middle ear and mastoid cavity were repaired via a temporalis muscle rotation flap . although the post - operative ct revealed a minimal residual abscess cavity , the facial paralysis and severe headache were completely resolved , and after an additional 8-week course of oral antibiotics , all evidence of the brain abscess had entirely disappeared ( fig . although intracranial complications of com are less common now than in years past , the associated incidence is estimated at between 0.13% and 1.97%12,13 ) . notably , cholesteatoma is an important risk factor for intracranial complications , as it is present in 78% to 100% com cases that go on to develop complications5,6,12,13 ) . the basic concepts in treating otogenic brain abscesses include immediate decompression of the abscess , prompt eradication of the primary otogenic nidus , and the active prevention of abscess recurrence . otogenic brain abscesses with intracranial complications are often located adjacent to the temporal lobe and cerebellum , with the middle segment of the temporal lobe and lateral lobe of the cerebellum most highly affected . the infection spreads intracranially through bony defects in the tegmen tympani or trautmann 's triangle or via spread of an infected clot within small emissary veins of the skull to the venous sinuses . given this location , such abscesses are often amenable to drainage via a transmastoid approach , thus avoiding an additional craniotomy13,14 ) . in the case described here , computed tomography facilitated the diagnosis of a brain abscess associated with underlying ear disease , while a subsequent mri provided additional information regarding the location of the abscess , the degree of mass effect , the presence of a midline shift , and disease stage18 ) . typically , treatment of otogenic brain abscesses first involves aspirating the pus or completely excising the abscess , after which parenteral antibiotic therapy is initiated to eradicate the primary nidus of infection1,3,7,9 ) . repeated abscess drainage via burr holes and complete excision ( including the abscess capsule ) are both major operations associated with a higher incidence of neurological deficits.18 ) conversely , the evidence shows that small abscesses can be treated with parenteral antibiotic therapy alone , and cases of multiple abscesses similarly respond best to parenteral antibiotic therapy after the largest lesion is aspirated2,9 ) . if aspiration is performed , the abscess size should be monitored using weekly or biweekly ct scans to determine whether repeat interventions are required9,15 ) . in all cases , the recommended course of parenteral antibiotic therapy is 6 to 8 weeks ( following aspiration)9 ) . in treating otogenic brain abscesses , the transmastoid approach has the advantage of eradicating the primary source of infection while additionally providing an easily accessible method for abscess aspiration in one or two stages4,10,18 ) . although otogenic brain abscesses are relatively rare , both the otologist and neurosurgeon should be vigilant for any concerning clinical signs including persistent fever , headache , or purulent ear discharge as these represent the most common symptoms and signs of intracranial complications of com . in conclusion , we contend that the transmastoid approach represents a good modality for otogenic brain abscesses with minimal neurologic sequelae . herein , the authors report a rare case of otogenic brain abscess with facial paralysis . compared to the other modalities for therapeutic intervention , the transmastoid approach has the advantage of eradicating the primary source of infection while additionally providing an easily accessible method for abscess aspiration that represents a novel , safe , and effective treatment strategy to decrease mortality and morbidity . as such , we contend that otogenic abscesses can be effectively managed through cooperation between the neurosurgeon and otologist . | despite significant advances in the treatment of all forms of chronic otitis media ( com ) , complications still can and do occur , with intracranial complications representing the most life - threatening cases , often requiring immediate therapeutic intervention . herein , we present a rare case of rapidly progressing facial paralysis with concomitant severe headache and ipsilateral hearing loss secondary to an otogenic brain abscess , treated with the transmastoid approach , drainage , and facial nerve decompression . |
arthroscopic techniques and instrumentation have developed rapidly and various techniques have been introduced for the treatment of rotator cuff tears . due to decreased short - term pain and a somewhat cosmetic effect , arthroscopic repair is more popular than open repair [ 13 ] . maintaining the integrity of the tendon is the primary goal of rotator cuff repair management strategies . most studies have also shown improved clinical outcomes after repair , and small and medium - sized rotator cuff tears have been commendably performed with any repair management strategy in most cases . recently , biomechanical studies have shown that the double - row repair procedure is superior for improving the pressurized contact area and the mean pressure between the tendon and footprint compared with the single - row repair procedure . however , there is still controversy regarding the optimal management of massive rotator cuff tears ( mrcts ) [ 68 ] . mrcts are those in which the length of the greatest diameter of the tear measures more than 5 cm or those that involve at least 2 tendons . charousset et al . reported better tendon healing rates with double - row repairs compared with single - row repairs but did not observe any significant difference in the clinical results . however , a recent comparative study showed significantly greater functional outcomes in patients with large - to - massive tears that were treated with double - row repair compared with single - row repair . the sample size and duration of follow - up were the limitations of these studies . due to these limitations , there may be a lack of strong evidence showing that either single- or double - row repair is superior . because of the controversy described above , we performed this study to address the question of whether double - row repair gives results that are superior to those obtained using single - row repair in terms of the integrity of the tendon and clinical outcomes for the treatment of mrcts with a large sample size . this study was approved by our institutional review board . from 2006 to 2012 , 1137 patients underwent arthroscopic repair of rotator cuff tears . single - row repair was performed in 146 patients , and double - row repair was used in 102 patients . the inclusion criteria were as follows : ( 1 ) a massive rotator cuff tear with preoperative magnetic resonance imaging ( mri ) and arthroscopic evidence ; ( 2 ) which persisted through non - operative treatment for more than 3 months with poor outcome ; and ( 3 ) no previous history of fractures or operations on the affected shoulder . patients were excluded if they had the following : ( 1 ) rotator cuff tears less than a diameter of 5 cm ; ( 2 ) ipsilateral shoulder pathology ; ( 3 ) glenohumeral osteoarthritis detected on radiographs ; ( 4 ) a follow - up of less than 24 months ; and ( 5 ) an inability to answer the questionnaires or undergo the rehabilitation treatment . the data were collected by an orthopaedic surgeon using the vas , range of motion ( rom ) , the constant score , the american shoulder and elbow surgeons ( ases ) score , and the university of california , los angeles ( ucla ) score . all patients underwent a radiographic evaluation consisting of anteroposterior ( ap ) views of the internal and external rotation and mri images . the postoperative images were used to divide the extent of rotator cuff injury into three classes : ( 1 ) full - thickness tear , ( 2 ) partial - thickness tear , and ( 3 ) cuff integrity . standard anterior and posterior portals were performed , and then a diagnostic arthroscopy was conducted to evaluate the quality of muscle tendon and arthrodial cartilage in shoulder . in the single - row repairs method , anchors ( bio - corkscrew , arthrex , naples , fl , usa ) were placed along the lateral edge of the greater tuberosity within the footprint of the rotator cuff through the superior portal region . sutures were then individually passed from the double - loaded anchors into the lateral edge of the tendon . if it was necessary to place a simple suture , a ten- to 15-mm bite of tissue was sutured using an antegrade suture passer or other instruments . after the sutures had been placed , they were sequentially tied with the help of a locking , sliding knot with backup half hitches . for double - row repairs , anchors for the medial row were set at the lateral margin of the articular surface . a lateral row of anchors was then inserted in the lateral aspect of the footprint , slightly distal to the greater tuberosity . both sutures were passed through the tendon and tied in a mattress fashion using a locking , sliding knot with back - up half - hitches . an immobilizing abduction brace was applied and passive range of motion stretching exercises were carried out . shortly thereafter , at postoperative week 6 , active - assisted range of motion exercises were started . the 2-tailed , unpaired t test was used to evaluate differences between two groups , and the 2-tailed , paired t test was used to detect changes in preoperative to postoperative outcome scores . student s t test was used to compare the differences for continuous data in terms of preoperative and postoperative vas , ucla score , constant score , ases index score , time of ability to activities , and rom in both groups . the single - row repair technique was performed in146 patients , and double - row repair was performed in 102 patients . in both groups , there were no significant differences in the pre - surgical values with regards to age , gender , affected shoulder , workers compensation , rom and scales ( vas , ucla , ases and constant ) . all of the results at the final follow - up in both groups showed a significant improvement compared with the patients preoperative status . there were no significant differences between the groups at the final follow - up evaluation in terms of vas ( p=0 . 082 ) , ases index ( p=0.779 ) , constant ( p=0.899 ) , and ucla ( p=0.895 ) ( table 2 ) . comparing the ability to participate in activities , the single - row repair procedure showed superior results compared with the double - row repair technique in both daily and sports activities ( p=0.019 ; p=0.006 ) ( table 2 ) . comparing the rom ( table 2 ) , there were no significant differences in forward flexion ( 162.58.6 in single - row group and 171.79.5 in double - row group ; p=0.093 ) and external rotation ( 48.812.6 in single - row group and 53.411.2 in double - row group ; p=0 . however , the double - row repair technique showed a tendency towards better results in rom compared with the single - row repair technique . the retear rate of a repaired rotator cuff was 29% ( 43/146 shoulders ) for single - row repair and 17% ( 17/102 shoulders ) for double - row repair , and this difference was statistically significant ( p<0.05 ) ( table 3 ) . the 43 retears in the single - row repair group involved 35 partial - thickness tears and 8 full - thickness tears . the 17 retears in the double - row repair group involved 12 partial - thickness tears and 5 full - thickness tears . the most important findings were the lower retear rate but later return to daily and sports activities in the double - row group compared with the single - row repair group , although no significant differences were found in the functional outcomes of the two groups . massive rotator cuff tears present a particularly complex and difficult challenge for the orthopaedic surgeon . several published studies on both open and arthroscopic approaches have reported improved results in shoulder function and pain relief with rotator cuff repair . arthroscopic rotator cuff repairs are becoming popular as a result of improvements in technology and the ability to achieve robust repairs in a minimally invasive fashion . compared with repairs of smaller tears , the operative repair of massive tears is technically more difficult and is associated with a higher recurrence rate [ 1620 ] . poor results for the treatment of the mrcts are primarily due to inelastic and poor tendon quality , scarring and adhesions to the retracted tendon , muscle atrophy , and fatty infiltration [ 2125 ] . however , so far , no articles have been published that definitely support the superior clinical outcomes of double - row fixation over single - row fixation . we conducted this study to confirm , in a large sample population , whether double - row repairs could yield better results compared with single - row repairs for the treatment of mrcts . biomechanical studies have emphasized that the double - row repair technique yields results that are superior to the single - row repair technique [ 2931 ] . the results of this study suggested that the functional outcomes both single- and double - row repairs are equal with respect to vas , ucla , ases and constant score . a previous study by sugaya et al . also showed no significant difference between the groups in terms of two postoperative scores . however , sugaya et al . thought that the dual - row repairs excelled in terms of structural outcome compared with the single - row technique . reported that a significant improvement with the double - row technique was demonstrated in clinical evaluation and that the improvements were more significant in tears greater than 30-mm than in ten- to 30-mm tears . performed a non - randomized comparative study including 31 patients in the double - row group and 35 in the single - row group . there were no significant differences between the groups in the clinical outcomes measured by the constant scale . however , in these studies , the limitation of the period of follow - up remains ; therefore , long - term follow - up is required in future studies . in the study by carbonel , the double - row technique showed superior results in rom compared with the single - row technique . franceschi et al . published a series of 60 patients who underwent single- or double - row repair . with a mean period of 24 months of follow - up , mri showed no significant difference in the postoperative rom between the groups . in this study , the rom results also exhibited no difference when comparing single - row repair with double - row repair . however , a tendency for a larger rom was shown in the double - row repair group . however , a standard rehabilitation protocol for tendon healing , though it prevents shoulder stiffness , has not been definitively established . this is an issue that requires careful judgment because overly conservative measures tend to aggravate stiffness , whereas overly aggressive measures can result in recurrent tears . a few studies have shown that the results are variable in massive tears , which have retear rates of 17% to 44% [ 4042 ] . several studies have reported superior tendon strength in patients who had undergone double - row repair . however , because these studies represent a heterogeneous series of operative techniques and tear sizes , it is not possible to reach a consistent conclusion . the failure rate on mri in this study was 24.4% , representing a total of 60 patients . compared with single - row repair , these findings were in line with the results comparing the biomechanical properties of the two techniques . therefore , we can conclude , with caution , that double - row repair could significantly decrease the retear rates compared with single - row repair . first , this study was not designed as a randomized trial because these techniques were applied at different time points . next , though we tried to include a large sample size , this study had low power for recognizing differences in the clinical scores between the repair procedures . finally , because the choice of surgical procedure was made according to the surgeon s preference at the time of surgery although single - row repair resulted in the ability of patients to take part in activities at a shorter time after the procedure , the results with regards to rom and the strength of tendon appeared superior following double - row repair . to better evaluate the outcomes of the two treatment strategies , | backgroundit is a challenge for orthopaedic surgeons to treat massive rotator cuff tears .
the optimal management of massive rotator cuff tears remains controversial .
therefore , the goal of this study was to compare arthroscopic single- versus double - row rotator cuff repair with a larger sample size.material/methodsof the subjects with massive rotator cuff tears , 146 were treated using single - row repair , and 102 were treated using double - row repair .
pre- and postoperative functional outcomes and radiographic images were collected .
the clinical outcomes were evaluated for a minimum of 2 years.resultsno significant differences were shown between the groups in terms of functional outcomes . regarding the integrity of the tendon , a lower rate of post - treatment retear was observed in patients who underwent double - row repair compared with single - row repair.conclusionsthe results suggest that double - row repair is relatively superior in shoulder rom and the strength of tendon compared with single - row repair .
future studies involving more patients in better - designed randomized controlled trials will be required . |
facial nerve paralysis in a patient with a parotid mass classically suggests a malignant process . the status of the seventh cranial nerve not only is considered a reliable indicator of malignancy but also correlates with the histologic grade and the postoperative prognosis.1
2 only a few reports in the literature have described facial nerve paralysis due to benign parotid tumors . we report the first case to our knowledge of facial nerve paralysis due to a benign primary parotid tumor with the imaging characteristics of an intraparotid facial nerve schwannoma . a 71-year - old woman was referred to our clinic with a 4-year history of facial nerve paralysis on the left side . her family first noted lower left facial asymmetry in 2008 , and the patient was initially diagnosed with a transient ischemic attack . the facial weakness progressively worsened and eventually resulted in complete paralysis of the left side of the face . at that point , on physical examination , grade 5/6 left facial paresis was noted with minimal movement at the oral commissure . no masses of the parotid gland or the neck were detected on palpation , and there was no bulge or displacement of the tonsillar pharyngeal wall . audiometry showed bilateral mild to moderately severe downsloping sensorineural hearing loss with excellent discrimination scores . high - resolution computed tomography demonstrated erosion of the stylomastoid foramen on the left side and showed that the stylomastoid foramen on the left side was filled with a mass on the left facial nerve that measured 8 mm in the greatest dimension ( fig . 1 ) . magnetic resonance imaging confirmed an 8 10-mm lesion at the stylomastoid foramen that was enhancing after infusion of contrast material ( fig . other disorders to be considered in the differential diagnosis included primary parotid gland tumors , either benign or malignant , perineural spread of cutaneous malignancy , or facial nerve hemangioma . the differential diagnosis is greatly limited considering the long - standing nature of her paralysis , the location of facial nerve enhancement , a normal ear examination , and overall good health . ( a ) axial and ( b ) coronal computed tomographic scans , in bone algorithm , illustrating enlargement and osseous erosion in the region of the stylomastoid foramen ( arrows ) . axial t1 , contrast - enhanced , fat - suppressed magnetic resonance image showing an enhancing mass at the stylomastoid foramen ( arrow ) . operative findings included fusiform enlargement of the stylomastoid portion of the facial nerve extending for 13 mm proximally . the vertical portion of the facial nerve was decompressed following a canal - intact mastoidectomy . the facial nerve was followed to the stylomastoid foramen , which was enlarged by the tumor . a superficial parotidectomy was performed , and the affected portion of the facial nerve was included in the specimen . a biopsy of soft tissue surrounding the facial nerve at the stylomastoid foramen was interpreted by the pathologist as suggestive of schwannoma on frozen section analysis . normal nerve was encountered proximally in the mastoid and at the level of the pes anserinus . final histologic examination revealed encasement of the facial nerve and its arborizing branches by salivary mixed tumor with chondroid and epithelial components compatible with pleomorphic adenoma without any evidence of schwannoma or malignancy ( fig . 3 ) .
encasement of large - caliber nerve and arborizing branches ( arrows ) by salivary mixed tumor with chondroid and epithelial components ( arrowheads ) , consistent with pleomorphic adenoma ( hematoxylin - eosin ; low - power view ) . inset : small nerve branch embedded in pleomorphic adenoma ( hematoxylin - eosin ; high - power view ) . the differential diagnosis of facial paralysis in a patient with a tumor commonly includes primary facial nerve tumor , malignant tumor of the parotid gland or metastatic skin cancer , and glomus jugulare or other temporal bone neoplasm ; pleomorphic adenomas are rarely included . in patients with salivary gland tumors , facial nerve paralysis , local invasion , and the presence of facial nerve palsy also seems to be associated with a poorer prognosis . a large multi - institutional study performed by eneroth et al in 1977 revealed that 14% of patients ( 145 of 1029 ) with salivary gland malignancies presented with facial nerve weakness . patients with facial nerve weakness had a poorer prognosis , with a 5-year survival rate of only 9%.3 in 2011 , wierzbicka et al reported an incidence of facial nerve weakness of 31% of patients ( 32 of 103 ) with parotid gland malignancies . in this series , patients with facial nerve weakness had a 3-year disease - free survival rate of 45% , compared with 88% in those without any facial nerve paresis.2
although strong evidence in the literature supports the association of facial nerve dysfunction with parotid gland malignancy , this clinical finding should not be considered pathognomonic for malignant disease . although several studies analyzing large series of patients with parotid tumors reported the occurrence of facial palsy only in patients with malignancy,4
5
6 facial palsy due to benign parotid gland tumors has also been reported . a comprehensive review of the literature revealed 17 such cases7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22 ( table 1 ) . the present case differs from the ones already discussed in the literature in two aspects . first , it was the smallest benign parotid tumor causing facial nerve palsy with the exception of a 0.5-cm tumor in a 9-year old boy reported by mamakos et al.10 second , the present case is the first in which a benign parotid tumor causing facial palsy was initially thought to originate from the facial nerve on the basis of preoperative imaging and frozen - section analysis . to our knowledge , the case that we describe here is the first reported case of facial palsy caused by a pleomorphic adenoma that had the imaging characteristics of an intraparotid schwannoma . the diagnosis of schwannoma was suggested by preoperative imaging findings and was initially thought to be confirmed on intraoperative frozen - section analysis . also , the progression of the facial weakness over a period of 4 years without other signs of malignancy did not suggest a cancerous etiology . however , as demonstrated by this case and discussed by other authors,23 imaging characteristics of intraparotid schwannomas are not specific , and an accurate preoperative diagnosis may be difficult . in the present case , the preoperative imaging showed a smooth mass centered on the facial nerve with erosion of the stylomastoid foramen with enhancement in the vertical segment of the intratemporal facial nerve , which led us initially to suspect a facial nerve schwannoma rather than a pleomorphic adenoma . on computed tomography , an intraparotid schwannoma can appear as a smooth , circumscribed intraparotid lesion , with possible dilatation of the stylomastoid foramen and fallopian canal in case of intratemporal extension . on gadolinium - enhanced magnetic resonance imaging , intraparotid schwannomas are isointense to hypointense on t1 and isointense to hyperintense on t2 , with strong contrast agent uptake.23 however , the imaging patterns of intraparotid schwannomas can be similar to those of other , more common benign parotid tumors , such as pleomorphic adenoma . indeed , pleomorphic adenomas also present on computed tomography as smooth , well - delineated masses . nodularity is sometimes found on the outer surface , and larger tumors may be more heterogeneous.24 on magnetic resonance imaging , pleomorphic adenomas present as well - circumscribed masses hypointense on t1 , hyperintense on t2 , and with heterogeneous enhancement with gadolinium.25
accurate preoperative diagnosis helps the surgeon determine the optimal therapeutic approach . however , as illustrated by this case , accurate preoperative diagnosis is not always possible . there are differences between the surgical treatment of pleomorphic adenomas and the surgical treatment of intraparotid facial nerve schwannomas . the recurrence rate after gross resection of intraparotid facial nerve schwannomas seems to be negligible if at all existent.23 however , when a pleomorphic adenoma is resected , a cuff of normal tissue must be included to avoid recurrence due to failure to remove the pseudopod - like extensions of tumor.26
27 in the present case , a portion of the facial nerve was resected along with the mass . this decision to resect the facial nerve was facilitated by the long - standing facial nerve paralysis . thus the surgical treatment would not have been different even if we had initially suspected a pleomorphic adenoma rather than a facial nerve schwannoma . the duration of facial paralysis was central to our diagnosis and treatment planning . if this patient had presented with an acute onset of facial weakness and imaging suggesting schwannoma , we would have considered facial nerve decompression . the decision to perform an intraoperative biopsy would then have depended on surgical findings at time of decompression with the decision to sacrifice the nerve and perform nerve grafting predicated on the pathologic findings and the degree of facial weakness . further , even though an incisional biopsy on a pleomorphic adenoma might have produced tumor spillage , the patient did not receive any postoperative radiation because we reserve this treatment modality for proven multifocal recurrence . this case also highlights the difficulty of accurate preoperative and even intraoperative diagnosis of salivary gland tumors . | background facial nerve paralysis in a patient with a salivary gland mass usually denotes malignancy .
however , facial paralysis can also be caused by benign salivary gland tumors .
methods we present a case of facial nerve paralysis due to a benign salivary gland tumor that had the imaging characteristics of an intraparotid facial nerve schwannoma .
results the patient presented to our clinic 4 years after the onset of facial nerve paralysis initially diagnosed as bell palsy . computed tomography demonstrated filling and erosion of the stylomastoid foramen with a mass on the facial nerve .
postoperative histopathology showed the presence of a pleomorphic adenoma .
facial paralysis was thought to be caused by extrinsic nerve compression .
conclusions this case illustrates the difficulty of accurate preoperative diagnosis of a parotid gland mass and reinforces the concept that facial nerve paralysis in the context of salivary gland tumors may not always indicate malignancy . |
malaria contributes the major disease burden and its control is hampered many operational and technical reasons and among the technical reason insecticidal resistance , namely , development of insecticide resistance in malaria vectors to the commonly used synthetic chemical insecticides in public health sprays has made the disease control more difficult . mosquito population has not been reduced significantly after continuous use of synthetic insecticides and anophelines retain their potential to support the outbreak and development of malaria in endemic areas . anopheles stephensi liston and anopheles culicifacies giles are two major vectors of malaria in india and later is a sibling species complex . there are five sibling species present named a , b , c , d , and e , of which species a , c , d , and e are vectors while b is a poor vector . culex quinquefasciatus say transmits filariasis while dengue fever and dhf are transmitted by the vector aedes aegypti linn . in contrast to vaccines and chemoprophylaxis as means of personal protection , repellents are convenient , inexpensive , and afford advantages in protection against a wide range of vector . they are also the primary means of mosquito - borne disease prevention available in areas where vector control is not practical [ 4 , 5 ] . the majority of commercial repellent products contain the deet ( diethyl 1 - 3 methyl benzamide , formerly known as diethyl 1-m toluamide ) , which was first synthesized in 1954 . although effective , deet is not the ideal product , as allergic and toxic effects have been documented [ 4 , 7 ] and its solvent characteristics can damage plastic and other synthetic materials . deet , in combination with certain other agents , is suspected of causing gulf war syndrome [ 8 , 9 ] , although this matter is still controversial . because of the undesirable effect of deet , research was actively carried out to find an alternative compound that is safer to use and equally or more effective ( robert et al . ) , [ 1113 ] . one promising new repellent is the piperidine compound , a13 - 37220 , which provides equal or better protection against certain mosquitoes than that obtained with deet [ 1315 ] . despite the significant repellency of a13 - 37220 the repellent potential of plant to mosquitoes and other pest insects has been well known both prior to and after the advent of synthetic chemicals , various botanical substances , cymbopogan spp . [ 18 , 19 ] , eucalyptus maculate citriodon , azadirachta indica , pelargonium citrosum , lantana camara , and mentha piperita have been reported as being repellent against adult mosquitoes . lemon eucalyptus , neem , and peppermint oils are derived from these plants and they are currently available in several commercially formulated repellents . however , their repellency is still lower in both efficacy and duration than that in currently used chemicals such as deet and a13 - 37220 . nevertheless , the possible health risks associated with use of these chemicals should be taken in to consideration . with this in mind , the present study was carried out to investigate the repellent activity of the indian medicinal plant , cyperus rotundus against the mosquito anopheles culicifacies giles species a ( diptera : culicidae ) , anopheles stephensi liston ( diptera : culicidae ) , and culex quinquefasciatus say ( diptera : culicidae ) . this may provide a new and promising repellent that can be used in the development of an economical and practical means to protect humans from the mosquito bites . several frequently used herbal drugs are derived from the cyperus rotundus species of the family cyperaceae . cyperus rotundus has been traditionally used in india for food and medicinal activity such as antibacterial , analgesic , antipyretic , and antiplasmodic , antibacterial , analgesic , antipyretic , antiplasmodic ( glossary of indian medicinal plant pid - chopra et al . ) presence of highly significant anti - inflammatory and antipyretic in cyperus rotundus suggests a very useful remedy for arthritic condition . the presence of tranquilizing , hypotensive , smooth muscle relaxant , antiemetic , anthistaminic anti - inflammatory and antipyretic activities show that the extract possesses significant pharmacological activity . for these studies plants were collected from rural area of district agra of utter pradesh and in delhi state of north india . the plant was identified by the national institute of science communication , the wealth of india division , council of scientific and industrial research , new delhi , india . fresh tuber was collected and washed with water , dried in shade , and powdered . the tuber of the root of cyoerus rotundus powdered material of this plant ( 1 kg ) was subjected to extract three times in a soxhlet apparatus using solvent of hexane in ratio of 1 : 3 ( w / v ) of 95% hexane at room temperature . the extract was made solvent free and the final residue of hexane extract of cyperus rotundus obtained , lyophilized , and then kept at 20c until testing for adult repellent activity . in preparing test concentrations , extract was volumetrically diluted in absolute hexane and tween 80 at an appropriate test concentration . mosquitoes were reared in a laboratory maintained at 27 2c temperatures and 70 5% relative humidity with a photoperiod of 12 : 12 hours ( light : dark ) with 90 minutes down and dusk simulation periods . one hundred-58 days old - sugar - fed female mosquitoes were introduced in to the cloth cages . these mosquitoes were starved for about 15 hours prior to their introduction in to the cages . needed standardization was made for experiments as to the determination of the suitable age of the mosquito for experiments and method of recording the data ( protocols for uniform evaluation of insecticides for use in vector control . sufficient quantity of bleached cotton was taken to be stacked in to a 460 ml styrofoam glass . 450 ml of the above sugar solution was poured into the glass and the cotton was soaked . to 40 ml of the sugar solution required quantity of the tuber hexane extract concentrate was mixed to arrive at the desired concentrations , namely , 2.5% , 5% , and 10% and was poured evenly on the sugar soaked cotton in the above styrofoam glass . 2.5% in 10% sugar soaked cotton was prepared for use as positive and only 10% sugar soaked cotton was used as negative controls , respectively . for tuber of root of cyperus rotundus hexane extract , known quantity of residue extract was redissolved in hexane to make a 10% ( w / v ) stock solution . various test concentrations ranging between 2.5% , 5% , and 10% were prepared in double distilled water using freshly made stock solution . the styrofoam glasses with cotton soaked with three different concentrations of tuber hexane extract of cyperus rutundus namely 2.5% , 5% , and 10% sugar solution , deet 2.5% ( positive control ) in 10% sugar solution and 10% sugar solution ( negative control ) were placed in four different corners and one in the centre of the cage . five - minute landing counts were made at 0 , 1 , 2 , 4 , 5 , and 6 hours . the cups were removed from the cage after the five minute observation at each interval of time . the cup was covered to avoid evaporation of the insecticide formulation and was placed in the refrigerator . for subsequent exposure the position of the cups were inter changed to different corners ( protocols for uniform evaluation of insecticides for use in vector control . observation is made in at least three replicates for the given species of the mosquito that landed and attempted to feed were recorded . no mosquito landing occurred in the initial 3 minutes the cups interchanged into the different corners . observations were made at 30 minutes intervals . if more than 1 mosquito landing was recorded during an observation , the test of repellency was terminated and the period of repellent protection calculated as the time between the extract application and multiple mosquito landing . the landing rates of the mosquitoes on different concentration of the formulation of hexane extract of tuber of root of cyperus rotundus ( 2.5 , 5 , and 10 % ( deet 2.5% and sugar ( 10% ) were recorded . result was expressed as average landing counts per exposure interval and as repellency compared to control means using as follows :
( 1)% repellency = ctc100 ,
where c : the mean number of landing on negative control ( 10% sugar solution ) ; t : landing on the repellents ( deet and tuber of root of cyperus rotundus ) . the consolidated data of the repellency observed in different species is given and it is evident that the overall repellency rates varied between 80100% for different repellents , concentrations of repellents and species . the hexane extract of cyperus rotundus was the candidate for subsequent field investigations repellent activity . a total of 100 adult mosquito comprising three species in two genera were rearing in laboratory nimr . table 1 summarizes the results of cyperus rotundus laboratory testing , these results showed a highly significant difference between the mean landing counting on the treated and control . the hexane extract of tuber of the root seed showed strong repellent activity against adult mosquitoes . percent protection obtained against anopheles culicifacies giles species a ( 100% in 4 hours , 6 hours ) anopheles stephensi ( 100% in 6 hours ) and culex quinquefasciatus were ( 100% in 6 hours ) at the 10% concentration . against deet-2.5% culicifacies a 100% repellency in 1 hour , 2 hours , 6 hours , an . stephensi have shown 100% repellency in 6 hours , and culex quinquefasciatus have shown 100% repellency in 1 hour , 2 hours , 6 hours . however , testing hexane extract of cyperus rotundus need to be carried out in the field . hexane extract of cyperus rotundus was found effective in repelling the three mosquito disease vectors , anopheles culicifacies species a , anopheles stephensi ( malaria vectors ) , and culex quinquefasciatus ( filaria vector ) though with minor variations . the percent repellency at different observation periods ( 0 hour , 1 hour , 2 hours , 4 hours , and 6 hours ranged from 80 to 100% against different concentrations , repellents , and species . against hexane extract of tuber of root of cyperus rotundus , culex quinquefasciatus has shown more than 90% repellency to all the concentrations ( except 2.5% in 0 hour , 1 hour , 2 hours ) that is , 2.5 , 5 , and 10% . anopheles culicifacies species a and anopheles stephensi have shown 90100% repellency against at 5% and 10% concentrations , while at 2.5% the repellency ranged between 7590% . in laboratory test , cyperus rotundus hexane extract possessed significant repellent activity against the three species tested which is similar compared to that reported for currently used synthetic compounds such as deet , a13 - 35765 , a13 - 37220 and cic-4 [ 14 , 27 ] . these chemical compounds provide better and longer protection against many biting insects and level = 0.3725.37 g / cm , 28 hours ) . repellent protection time in laboratory bioassays however can change depending on the biological characteristics of the mosquito test population . differences in species and body size , sugar water availability , adult density in test cages , and mosquito age can affect test results [ 18 , 2830 ] . tawatsin et al . demonstrated under laboratory conditions that volatile oils derived from turmeric ( curcuma longa ) , citronella grass ( cymbopogon winterianus ) , and hairy basil ( ocimum americanum ) with the addition of 5% vanillin were effective in repelling both diurnal and nocturnal mosquitoes for up to six hours . the hexane extract of cyperus rotundus was effective in reducing the vector species . when compared with the study of sharma et al . stephensi and culex quinquefasciatus , of hexane extracted of cyperus rotundus seem to be higher than that of neem oil ( 37.5% ) . selection of a repellent for further development can not be based on the results of any one test against a single insect because mosquito responses to repellents vary within and among species [ 18 , 33 ] . quinquefasciatus , the vectors of japanese b encephalitis [ 34 , 35 ] and filariasis [ 11 , 36 ] , respectively , is considered as satisfactory . the further studies should be investigated against as many different malaria vector as possible under both laboratory and field conditions . several methods enhancing the efficacy of repellent , such as purification of the active fraction , increase in persistence and duration of repellency need to be studied . from the observed data on the repellency against the three disease vectors , it can be concluded that dose of 10% could be used for achieving the desired level of protection against bites of these mosquitoes . however , these results pertain to the effectiveness in cage experiments using only sugar solution as attractant . thus , further confirmation by testing this repellent on human subjects to evaluate the repellency effect is needed . our repellent research is being continued to search for the development of new repellents from a natural original that not only offer effective anti - mosquito products but are also biorational alternatives to synthetic pesticides . | hexane extract of tuber of plant cyperus rotundus ( cyperaceae ) was screened under laboratory conditions for repellent activity against mosquito vector anopheles culicifacies giles species a ( diptera : culicidae ) , anopheles stephensi liston ( diptera : culicidae ) , and culex quinquefasciatus say ( diptera : culicidae ) .
the cyperus rotundus tuber extract was used to determine their effect on mosquito vector , and comparison with the deet ( nn diethyl 1 - 3 methyl benzamide , formerly known as diethyl 1-m - toluamide ) .
the tuber extracts showed more effective at all the dose .
result obtained from the laboratory experiment showed that the tuber extracts are more effective for repellency of allthe mosquito vector even at low dose .
clear dose response relationships were established with the highest dose of 10% tuber extract evoking 100% repellency . percent protection obtained against an .
culicifacies giles species a 100% repellency in 4 hours , 6 hours , an .
stephensi 100% repellency in 6 hours and cx .
quinquefasciatus was 100% repellency in 6 hours at the 10% concentration .
against deet- 2.5% an . culicifacies a 100% repellency in 1 hour , 2 hours , 6 hours , an .
stephensi have shown 100% repellency in 6 hours , and culex quinquefasciatus have shown 100% repellency in 1 hour , 2 hours , 6 hours .
the consolidated data of the repellency observed in different species is given and it is evident that the over all repellency rates varied between 80 and 100% for different repellents concentrations ( 2.5% , 5% , and 10% ) .
the extract can be applied as an effective personal protective measure against mosquito bites . |
pits and fissures of molar teeth represent the most caries - vulnerable sites because of their morphology . it has been reported that 70% of all occlusal surfaces of molars develop carious lesion within 10 years after the eruption , particularly in the first 3 years . therefore , many interventions such as fluoride application have been attempted to prevent occlusal decay ; however , pit and fissure sealants appear to be more effective than other measures . dental sealant is a term that describes a material applied to occlusal surfaces , which acts as a physical barrier between enamel surface and the biofilm to restrict bacterial overgrowth . fissure sealants should be used as part of caries prevention programs as their effectiveness in preventing pit and fissure caries has been well documented . interestingly , studies have correlated caries - free status among children of age 617 years to sealant application , although their effectiveness is dependent on the caries risk of individuals and national caries prevalence . another important point regarding sealant effectiveness is that it has also been shown to manage incipient occlusal carious lesions . although fissure sealant is strongly recommended in preventing occlusal caries , its use by dentists seems to be minimal . in 2010 , for example , only one - third of 8-year - old children in the united states and 14.1% of 14-year - old had a dental sealant . the reasons for underutilization of dental sealants seem to be multifactorial ; however , one of the reported main reasons beyond that was insufficient professionals ' knowledge . in a national survey in greece , for example , 61.9% of general dental practitioners reported inadequate knowledge on when and how to use dental sealant and only 35% practiced it routinely . in addition , studies in india spain and the us reported also a lack of current knowledge on dental sealants that consequently affected its practice . in yemen , data regarding the knowledge and utilization of fissure sealants by dental professionals is lacking , although the prevalence of dental caries in this country has been reported among the highest in the world . therefore , this study was conducted to evaluate fissure sealants knowledge and practices among practicing dental practitioners in sana'a , yemen . this descriptive , cross - sectional study was conducted using a self - administered questionnaire involving private dental practitioners , working in the different district of sana'a city , yemen . these questionnaires were sent to 500 yemeni dentists , selected randomly from the yemeni dental association register . the study was conducted in a full accordance with the declared ethical principles of the world medical association declaration of helsinki ( 2002 ) . the self - administered questionnaire was adapted from pretested questionnaires that have been applied in similar studies . before distributing the questionnaire , a pilot study was performed on a random sample of dentists ( n = 20 ) , and the questionnaire was modified according to the feedback obtained . the first section of the questionnaire sought demographic data of the participants including age , gender , qualification , and years of clinical experience . the second section included questions that focused on the dentists ' knowledge and practices regarding fissure sealants . ( armonk , ny : ibm corp . ) was used for data entry and analyses . qualitative data were presented as frequencies and percentages , and the outcomes were analyzed by chi - square test . the quantitative data were presented as means and standard deviations , and the outcomes were analyzed by nonparametric tests ( mann whitney and kruskal wallis ) . a total of 370 questionnaires were collected , giving a response rate of 74% . of these , most of the respondents were male ( 61.3% ) , general practitioners ( 84.2% ) , and had < 5 years of clinical experience ( 48.3% ) [ table 1 ] . demographic data of the subjects ( n=347 ) around , 8.4% of the respondents declared that they have never heard of fissure sealants . among the participants who reported having knowledge about fissure sealants , education at college ( 85.3% ) was the main source of information [ figure 1 ] . source of information regarding fissure sealants table 2 depicted that over 88% of the respondents believed that there is strong scientific evidence about fissure sealants use and approximately 90% showed well understanding of the instructions of sealant placement . some 84.6% of the dentists showed familiarity with the sealant placement technique , and 84% agreed of the importance of sealant use with fluoride . nearly , 57% of the respondents believed that sealant should only be used on newly erupted teeth and that the fissure sealants have adverse effects . proportion of subjects who answered correctly on knowledge questions by gender and experience years the total mean score of fissure sealants knowledge was 6.86 1.69 , with no significant differences according to gender ( p > 0.05 ) . similarly , there was no significant association between the level of knowledge and years of experience ( p > 0.05 ) [ table 3 ] . knowledge scores by gender and years of experience the respondents showed a poor level of clinical practice . some 41.4% reported that they always avoid dental sealant for the possibility of sealing over caries , and 68% would recommend reapplication in the case of partial or complete loss of sealant [ table 4 ] . this study was conducted in sana'a , the capital city of yemen , to assess dental practitioners ' knowledge , attitudes , and practice of dental sealants . to the best of our knowledge , the provision of dental service in yemen is primarily private ( 95% ) , and therefore , we restricted our survey to dental practitioners working in the private sector . in general , dental practitioners in this study showed a fairly acceptable level of knowledge about fissure sealants . however , their answers to practice questions were rather unsatisfactory , indicating a lack of current clinical knowledge of sealants usage . the most surprising result of the study was that around 8.4% of dentists reported that they never heard of fissure sealant , indicating that a considerable percentage of practicing dentists in yemen are completely unaware of fissure sealant . such alarming result can be attributed to inadequate university education or lack of continuing education after graduation . several studies have revealed insufficient or outdated fundamental knowledge of fissure sealant use , but a total lack of knowledge has not been reported previously . this emphasizes the urgent need for continuing education courses about indications and clinical practice of fissure sealants . furthermore , dental schools need to include and/or update their curriculum regarding fissure sealants to reflect modern dental education that concentrates on evidence - based practice ( ebp ) in pediatric dentistry and dental public health . in this era of modern dentistry , it is important to integrate the principles of evidence - based dental practice to the dental curriculum . in our findings , at least , 12% of dentists were concerned about insufficient evidence of fissure sealant effectiveness which further validates the importance of teaching ebp to dental students . similar opportunities for education focusing on evidence - based clinical guidelines should be made available to all practicing dental professionals through workshops , seminars , and continuing education courses . encouragingly , the majority of dentists in the present study believed that there is some scientific evidence of fissure sealants as a preventive measure , and they also showed a well understanding of the instructions of sealant placement . a large proportion of our respondents ( 84% ) preferred using sealant along with fluoride and strongly believed in their synergistic effects to reduce decay . a similar result was observed by asawa et al . who found that 85.3% of respondents believed that they get a better result in caries prevention when fluoride and sealant are used together . it has been recognized that using fluoride prior to sealant application could potentiate caries protection , without compromising properties of the sealant . furthermore , the addition of fluoride to a sealant has been reported to be cariostatic not only to areas close to sealant surface but also to the distant enamel area . in this study , we did not observe any significant association between the level of knowledge about dental sealants and the number of years since graduation . however , other authors have reported a negative association between knowledge and years of clinical experience as more recent graduates showed a better level of knowledge . an important finding in our study was that a very small proportion of our sample reported using rubber dam in isolation , whereas the vast majority reported using cotton rolls . this was in accordance with a previous study among greek dentists which reported a high preference of cotton rolls use over rubber dam for isolation . while some studies reported very low caries experience under sealants , others reported the opposite . in line with the findings among spanish dentists , a high percentage of our sample preferred reapplication of sealant in case of partial or complete loss . on the contrary , asawa et al . reported that 85.3% of indian dental practitioners did not reapply sealants regardless of retention status . such conflicting results among different studies could be attributed to lack of consensus in the literature about the procedure and also to the absence of universally accepted guidelines . the effectiveness of fissure sealants in the management of existing early noncavitated lesions has been proven under certain conditions in many studies . recent reviews have shown that when fissure sealants are retained on incipient noncavitated lesions , and thus access to the fermentable substrate is prevented , bacteria seem incapable of a cariogenic potential and therefore reduced caries progression is evident . the present study showed that a high proportion of dental practitioners had a reasonable level of knowledge about dental sealants . despite this , their levels of evidence - based clinical knowledge about the appropriate use of sealants were low . the findings suggest an urgent need for regular continuing education courses to improve the current knowledge of fissure sealants among dental professionals . | objectivesthis study was conducted to evaluate yemeni dental practitioners ' knowledge and practices concerning fissure sealants.materials and methods : a modified questionnaire consisted of 25-items was distributed to 500 dentists working in sana'a city .
descriptive statistics and chi - square / fisher 's exact tests were used for statistical analyses.results:the response rate was 74% .
most of the respondents were male ( 61.3% ) , general practitioners ( 84.2% ) , and had < 5 years of clinical experience ( 48.3% ) .
the respondents showed a reasonable level of knowledge about sealants , with the majority ( 88% ) believed that there is strong scientific evidence about fissure sealants effectiveness and around 90% showed a good understanding of sealant placement instructions . on the other hand
, respondents showed insufficient knowledge about sealants clinical practice.conclusion:although a high proportion of dental practitioners showed adequate knowledge about dental sealant , following guidelines and standardized procedures in clinical practice is lacking .
these emphasize the need for regular continuing education courses for dental professional . |
osteoporosis is a devastating disease characterized by low bone density , microarchitectural deterioration of bone tissue , and increased susceptibility to fracture . vertebral compression fracture ( vcf ) is a common manifestation of osteoporosis in the elderly with an incidence of 700,000 cases per year in the united states alone . vcfs can precipitate in a downward spiral of physical functioning characterized by chronic back pain , limited mobility , functional impairment , and kyphosis resulting in reduced pulmonary capacity , loss of stature , and greater risk of subsequent nonvertebral and additional vertebral fractures [ 2 , 3 ] . vertebral compression fractures also represent a significant economic burden in the united states , accounting for an estimated 17.5 billion dollars in annual medical costs . as the population continues to age conservative treatment of painful vcfs , such as bed rest , braces , and/or narcotic analgesic medication , has only modest short - term effectiveness and is associated with poor long - term outcomes , including exacerbation of bone loss , increased risk of subsequent fracture , decreased mobility , and increased mortality [ 57 ] . percutaneous techniques such as vertebroplasty and balloon kyphoplasty ( bk ) are minimally invasive treatments for acutely painful vcfs and have been used with increasing frequency over the last two decades . vertebroplasty involves injecting polymethylmethacrylate ( pmma ) into the collapsed vertebrae to reduce pain via vertebral stabilization . balloon kyphoplasty involves creation of a cavity before cement injection , which theoretically provides an advantage by correcting for sagittal alignment and reducing the risk of cement leakage . vertebroplasty and bk are both safe and effective procedures for treatment of osteoporotic vcf although bk may result in better clinical outcomes and fracture reduction compared to vertebroplasty in patients with significant vertebral body height loss . radiofrequency - targeted vertebral augmentation ( rf - tva ) is a novel percutaneous vertebral augmentation technique that was developed to address some of the limitations of bk while maintaining the benefit of vertebroplasty and bk . the purpose of this study was to assess the initial safety and effectiveness of rf - tva in osteoporotic patients with symptomatic vcf . all study procedures were conducted in accordance with the ethical principles stated in the declaration of helsinki , and this research was approved by the institutional review board at the investigative site . this prospective , single - site postmarket study was conducted to evaluate the safety and effectiveness of rf - tva in patients with single - level , symptomatic osteoporotic vcf . main inclusion criteria included age between 50 and 90 years , single - level osteoporotic vcf located between t10 and l5 , back pain severity > 4 on a 0-to-10 scale , oswestry disability index ( odi ) 21% , vertebral height loss between 20% and 90% compared to adjacent vertebral body , and fracture age < 6 months . main exclusion criteria included primary tumor or metastasis , neurologic deficit associated with the index level , pedicle fracture , significant kyphosis ( > 30 ) or translation ( > 4 mm ) , and active infection . patients underwent a physical examination , complete medical history , and radiographic imaging studies including thoracolumbar lateral and anteroposterior radiographs to confirm the presence and characteristics of the vcf . symptomatic levels were confirmed with radionuclide bone scan and computed tomography or magnetic resonance imaging . patient - reported back pain severity was quantified using an 11-point ( 0 to 10 ) numeric scale . back - specific functional disability was self - reported with the odi ( version 2 ) on a 0 to 100% scale . patients were first placed in the prone position and prepped and draped in the usual manner . rf - tva was performed via a unipedicular approach with site - specific cavity creation followed by remotely controlled delivery of ultrahigh viscosity pmma ( stabilit er bone cement ) using the stabilit vertebral augmentation system ( dfine , inc , san jose , ca , usa ) ( figure 1 ) . after placement of a working cannula , an initial cavity was created by inserting a straight coring osteotome ( vertecor straightline osteotome ) that permits biopsy . a navigational osteotome ( vertecor midline osteotome ) the midline osteotome was navigated through the vertebral body by rotating the handle to articulate the distal beveled tip as the osteotome was advanced through the vertebral body to the anterior third and across the midline in a controlled fashion ( figure 2(a ) ) . the midline osteotome was then reoriented , and additional passes were made to create site - specific cavities . this resulted in well - defined cavities with minimal disruption of adjacent trabeculae that served as preferential paths for cement delivery ( figures 2(b ) and 2(c ) ) . the pmma , which has an extended working time compared to standard pmma , was then converted to ultrahigh viscosity pmma as it passed through the activation element ( where it was heated by application of radiofrequency ) immediately prior to entering the delivery cannula , thus providing a constant viscosity throughout the procedure . the ultrahigh viscosity pmma was delivered at a continuous rate of 1.3 cc / min using a remotely controlled automated hydraulic delivery system . intermittently during pmma delivery , intravertebral filling was fluoroscopically monitored and terminated when the treating physician deemed that there was a risk of extravasation or that the fill was adequate ( figure 2(d ) ) . in cases where cement delivery was halted due to risk of extravasation but prior to optimal filling , the long working time allowed for cement delivery to be reinitiated after cement in the areas of potential extravasation had set . the remote control cement delivery feature of this device allows the physician user to perform the procedure at a safe distance from the fluoroscopic unit ( > 10 feet ) , providing a marked reduction in operator radiation exposure . final imaging was then obtained to confirm alignment and fill ( figures 2(e ) and 2(f ) ) . back pain severity was assessed at discharge and at 1 week , 1 month , and 3 months posttreatment . use of pain medications was reported according to the world health organization three - step analgesic pain ladder , a semiquantitative scale used to describe use of pain management drugs . current pain medication use is defined as 0 for no current pain medication use , 1 for current use of nonopioid pain medication ( e.g. , paracetamol ) , 2 for current use of weak opioid pain medication ( e.g. , codeine ) , and 3 for current use of strong opioid pain medication ( e.g. , morphine ) . adverse events were collected throughout the study and were defined as any reported complication , regardless of the relationship with the procedure or device . data were analyzed using predictive analytics software ( v. 18 , spss , inc . , all continuous data were verified to be normally distributed using the shapiro - wilk test . continuous data were reported as mean 95% confidence interval ( ci ) using exact methods , and categorical data were reported as frequencies and percentages . longitudinal changes in back pain severity and odi values were assessed with repeated measures analysis of variance . clinical success was defined as an improvement of 30% compared to pretreatment values for back pain severity and odi , respectively [ 12 , 13 ] . patients had severe back pain ( 7.9 , 95% ci : 7.1 to 8.6 ) and dysfunction ( odi : 74% , 95% ci : 69% to 79% ) at pretreatment . most patients also presented with associated diseases , most commonly hypertension ( n = 14 ) , coronary artery diseases ( n = 8) , and diabetes mellitus ( n = 5 ) ( table 1 ) . three patients were unable to receive treatment due to difficulty with placing a cannula in patients with a high body mass index . ultimately , 20 patients underwent treatment with the rf - tva system between june 2009 and february 2011 . the procedures were performed with deep sedation and local anesthetic in 19 of 20 cases . mean procedure time was 19 ( 95% ci : 14 to 23 ) minutes with average cement volume delivery of 4.0 ( 95% ci : 3.3 to 4.7 ) cc . hospital stay following the rf - tva procedure was minimal , with same day discharge in 70% of patients and next day discharge in 30% of patients . back pain severity rapidly improved from 7.9 ( 95% : 7.1 to 8.6 ) at pretreatment to 4.4 ( 95% ci : 3.1 to 5.6 ) at hospital discharge . over 3-month follow - up , back pain continued to improve with mean scores of 2.7 ( 95% ci : 1.5 to 4.0 ) at 3 months , representing a 66% ( p < 0.001 ) overall improvement ( figure 3 ) . back function similarly improved from 74% ( 95% ci : 69% to 79% ) at pretreatment to 60% ( 95% ci : 54% to 66% ) at 1 week and 40% ( 95% ci : 33% to 47% ) at 3 months , representing a 46% ( p < 0.001 ) overall improvement ( figure 4 ) . clinical success rates were 84% for back pain severity and 79% for odi at 3-month follow - up . patients were able to wean off pain medications over the 3-month follow - up period . at pretreatment , 70% of patients were routinely consuming pain medications , including 60% who regularly consumed opioids . at 3 months , only 21% of patients were regularly consuming pain medication with 16% consuming opioids ( table 2 ) . no adverse events related to the device or procedure were reported during the study ( 0 of 20 patients ) . one patient died from causes unrelated to the procedure before the 3-month follow - up visit . the rf - tva system is a novel , safe technique for percutaneous vertebral augmentation in osteoporotic patients with symptomatic vcfs . our early experience with this device demonstrates significant improvements in back pain severity and back function and reduced pain medication use with no observed complications . the results of this study are consistent with outcomes observed in an ex vivo biomechanical study of the rf - tva system . this study reported that rf - tva produced more discrete cavities and less native trabecular destruction compared to marked trabecular destruction observed with bk . additionally , rf - tva consistently showed a well - identified focal area of pmma with an extensive peripheral zone of pmma interdigitation , providing mechanical interlock into the adjacent intact trabecular matrix . additionally , several retrospective studies of rf - tva for treatment of vcfs have demonstrated consistent improvements in back pain severity and odi and no procedural complications [ 1517 ] . the results of these studies and of the current prospective study provide increasing evidence that treatment with rf - tva is optimized by the targeted delivery and interdigitation of ultrahigh viscosity rf - heated cement into the remaining trabeculae . in vertebral augmentation procedures , pmma cement may leak laterally to the soft tissues , superiorly or inferiorly into the adjacent disc space , or posteriorly , where it may involve the exiting nerve root or the spinal canal . the rf - tva system utilizes a fill control mechanism to ensure a controlled , constant rate of bone cement delivery , which encourages pmma interdigitation and may enhance fracture stability . additionally , the midline osteotome allows unipedicular access to the vertebra , enables targeted site- and size - specific cavity creation across the vertebral midline , and spares cancellous bone , thereby creating preferential pathways for the high - viscosity bone cement . our first experience in 20 patients performing the rf - tva procedure yielded no cement extravasation . these results compare favorably to cement leakage rates of 7% to 72% reported with kyphoplasty and vertebroplasty [ 1923 ] . the ultrahigh viscosity pmma also allows for an extended working time , which is particularly advantageous in patients with multiple levels requiring treatment or in vertebrae at risk of extravasation . the ability to discontinue cement delivery for extended periods of time ( due to the long working time cement and rf activation immediately prior to delivery ) , while that cement in the patient hardens serving as a barrier , enables more complete augmentation with decreased potential for extravasation . minimizing physician exposure to radiation during minimally invasive procedures for treatment of vcfs remains a concern . although the use of methods such as shielding and intermittent fluoroscopy has dramatically reduced physician users exposure to radiation during traditional vertebral augmentation procedures [ 24 , 25 ] , whole body radiation exposure rates of 0.31.1 microsieverts per minute during device positioning and 0.22.9 microsieverts during cement injection have been reported . for reference , a mammogram exposes a patient to a whole body radiation dose of 0.4 microsieverts . the use of a hand switch to remotely control cement delivery in stabilit system allows the operator to remain as far as 20 feet from the radiation source versus 0 to 2 feet for competitive devices [ 27 , 28 ] , thereby exponentially reducing user radiation exposure . this is a significant advantage to physicians who perform a high volume of vertebral augmentation cases . strengths of this study included the prospective design , use of validated measures of patient - reported outcomes , and strict inclusion / exclusion criteria . limitations of this study include lack of a control group , inclusion of only single - level fracture cases , and a relatively short follow - up period . the results from our initial clinical experience showed that rf - tva dramatically reduces back pain severity , improves back function , and reduces pain medication requirements with no observed complications in patients with osteoporotic vcf . overall , the initial clinical results of this prospective trial are promising and warrant further study in larger series with longer follow - up periods . | vertebral augmentation procedures are widely used to treat osteoporotic vertebral compression fractures ( vcfs ) .
we report our initial experience with radiofrequency - targeted vertebral augmentation ( rf - tva ) in 20 patients aged 50 to 90 years with single - level , symptomatic osteoporotic vcf between t10 and l5 , back pain severity > 4 on a 0 to 10 scale , oswestry disability index 21% , 20% to 90% vertebral height loss compared to adjacent vertebral body , and fracture age < 6 months . after treatment
, patients were followed through hospital discharge and returned for visits after 1 week , 1 month , and 3 months .
back pain severity improved 66% ( p
< 0.001 ) , from 7.9 ( 95% ci : 7.1 to 8.6 ) at pretreatment to 2.7 ( 95% ci : 1.5 to 4.0 ) at 3 months .
back function improved 46% ( p < 0.001 ) , from 74 ( 95% ci : 69% to 79% ) at pretreatment to 40 ( 95% ci : 33% to 47% ) at 3 months .
the percentage of patients regularly consuming pain medication was 70% at pretreatment and only 21% at 3 months .
no adverse events related to the device or procedure were reported .
rf - tva reduces back pain severity , improves back function , and reduces pain medication requirements with no observed complications in patients with osteoporotic vcf . |
the latter enters the cranium via the mastoid foramen to supply the dura of the posterior fossa . it also participates in anastomoses with other vessels , most important one being the vertebral artery and branches of anterior inferior cerebellar artery . the transmastoid artery is an important feeder to posterior fossa vascular malformations and tumors and can be the only prominent supply occasionally . superselective microcatheterization of this artery , however , can be difficult due to extreme tortuosity and the difficulty in navigating through the narrow mastoid foramen . a 45-year - old woman presented with headache since 2 years and gradually deteriorating vision since 3 months . she had bilateral papilledema ( left more than right ) with decreased visual acuity ; however , other neurological examinations were normal . a magnetic resonance imaging ( mri ) scan showed a large left petrous - based meningioma , bright on t2w images and enhancing brilliantly on post - gadolinium scans . considering these to be indicative of hypervascular nature of the tumor , a preoperative embolization was undertaken . during the procedure , the tumor was found to be hypervascular and with a single feeding artery , that being the transmastoid branch of the left oa [ figure 1a ] . however , this artery proved difficult to catheterize due to its tortuosity , small size , and a recurrent course of the ostial and proximal portions . various microcatheters ( including semi and true flow - guided catheters ) and microguidewire systems were used without benefit . an attempt was then made to induce spasm in the parent artery distal to the feeding vessel origin by repeated passages and torquing the wire . however , this also turned futile as the spasm inductions lasted short [ figure 1b ] . ( a ) left external carotid artery injection showing the hypervascular posterior fossa tumor fed primarily by the transmastoid foraminal branch of occipital artery . ( b ) microcatheter injection of the left occipital artery near the mastoid branch showing spasm of the occipital artery with no forward flow . ( c ) post coil - occlusion of the occipital artery ; the contrast flow is entirely via the artery of interest now . we then decided to sacrifice the parent artery and used a guglielmi detachable coil ( gdc ) for the same . the artery was sacrificed just distal to the origin of the mastoid branch [ figure 1c ] . after occlusion , embolization was done with polyvinyl alcohol ( pva ) particles , injections being made from the oa trunk but still outside the cranium . care was taken to inject slowly , allowing the pulsations carry forward the contrast - mixed particles , and not allow any reflux . post procedure angiogram showed near complete occlusion of the tumor bed [ figure 1d ] . the patient was operated on after 2 days , with complete excision of the tumor and minimal blood loss . the transmastoid artery ( 1 - 3 in number ) is a major and important branch of the oa ( with the stylomastoid branch ) passing through the mastoid emissary foramen and supplying the dura of the posterior fossa.[13 ] it is a prominent supply to vascular malformations and tumors of the posterior fossa . it enters the mastoid foramen soon after origin and may have a recurrent proximal course . the mastoid foramen is often small and often does not allow the passage of microcatheter of the available sizes . the narrow - caliber ( mean diameter 0.6 mm ) and the tortuosity of the artery does not make things any easier . the oa provides arterial supply to most of the muscles of the posterior and lateral upper portion of the neck , occipital muscles , posterior half of the scalp , and multiple neuronal branches to facial , spinal accessory , hypoglossal , occipital nerve of arnold and greater occipital nerve . its terminal branches form an anastomotic rete with branches of the contralateral oa , posterior auricular artery , and superficial temporal artery.[13 ] hence , knocking off the main trunk does not have any major side effects . in fact , for the same reason , it is a favored artery for bypass surgeries and can be ligated / occluded during surgeries or for treating aneurysms / pseudoaneurysms . however , unwanted embolization into the distal vascular bed can lead to scalp necrosis and neuronal ischemia , and hence we must prevent the same . in our case , we occluded the arterial trunk just after the mastoid branch had originated , so as to enable injection of pva particles without entering the mastoid foramen . another important point to be remembered is the common occurrence of occipital to vertebral artery anastomosis . hence , mixing of contrast agent with the pva is compulsory and so is a slow injection , with the surgeon and assistants on an active lookout for any reflux . here we describe a case of petrous meningioma with a single feeder from the mastoid branch of the oa , which could not be superselectively catheterized ; hence , the occipital trunk was sacrificed and pva particles injected without entering the cranial cavity . | the transmastoid branch of the occipital artery is an important supply to posterior fossa vascular malformations and tumors and is often difficult to catheterize due to tortuosity and a transforaminal course . in very difficult situations
, we can try to induce spasm of the occipital artery just beyond the origin of the mastoid branch by repeated passages of the microcatheter / wire .
this induces a temporary ligation like effect so that the microcatheter can then be manipulated into the mastoid branch via the mastoid foramen .
rarely , the occipital artery has to be sacrificed if spasm can not be induced or is short living , following which particles can be injected from a distance without entering the mastoid foramen . occluding the occipital artery proximally has no effect on distal perfusion , as collaterals and anastomoses from superficial temporal artery , posterior auricular artery , and opposite occipital artery
take over the supply . |
aortic regurgitation ( ar ) is characterized by the diastolic reflux of blood flow from the aorta to the left ventricle due to incomplete coaptation of the aortic valve . the overall prevalence of ar was 4.9% in the framingham heart study and 10% in the strong heart study . there are studies that have been performed to visualize the ar on the multi - detector computed tomography ( mdct ) scans [ 36 ] . in this study , we intend to mention a part of the aortic valve that becomes incompetent in aortic regurgitation and is visible on the mdct scans . normally , the aortic valve consists of three leaflets and three sinuses . the leaflets are mobile parts of the aortic valve whereas the sinuses are the cavities behind the leaflets . each leaflet is attached to the aortic wall and free margin of each leaflet coaptate with each other along the line of leaflet coaptation during diastole . during systole , the leaflets are open to allow blood flow across the aortic valve from the left ventricle to the aorta . during diastole , these leaflets close to hold the column of blood in the aorta while the left ventricle is being filled during diastole . normally , these valves are competent enough to withhold any blood flow from aorta to the left ventricle during diastole . but in aortic regurgitation , this mechanism fails and blood regurgitates across the aortic valve to the left ventricle . this is visualized as regurgitant jet on the echocardiography and as regurgitant orifice area ( roa ) on multidetector computed tomography ( mdct ) [ 37 ] . in normal tricuspid aortic valves , the leaflets coapt along the line of leaflet coaptation and become visible as hypodense area between aortic leaflets on mdct scans . the central part of this coaptation is due to coaptation of nodules of arantius present in middle of free margin of the aortic leaflets . central aortic valve coaptation area. normally , this area is competent and does not allow any regurgitation . in ar , incomplete coaptation of this area can be visualized on mdct scans as regurgitant orifice area ( roa ) . in this study , we looked at this central area of aortic valve coaptation , performing its planimetric measurements and also determining its hounsfield units to find its tissue properties . retrospective analysis of mdct scans of 400 symptomatic consecutive patients whose scans were performed at our outpatient cardiac computed tomography scanner for the evaluation of coronary artery disease ( los angeles biomedical research institute at harbor - ucla medical center ) were analyzed . patients with poor image quality ( columnation , streak artifacts , motion artifacts , and image noise ) , bicuspid aortic valves and heavy calcification of aortic valve leaflets that made the aortic valve region non - evaluable were excluded . sixteen mdct scans were excluded due to the above reason and 384 scans were included for evaluation of the aortic valve area . all mdct scans were performed with 64-detector row lightspeed vct scanner ( general electric healthcare , milwaukee , wisconsin ) . individuals presenting with baseline heart rates > 65 beats per minute ( bpm ) were administered oral beta - blocker therapy as the preferred method for slowing down the heart rate . iv administration was allowed in the protocol , using intravenous metoprolol at 5 mg increments to a total possible dose of 40 mg in order to achieve a resting heart rate < 65 bpm . following a scout radiograph of the chest ( anteroposterior and lateral ) , a timing bolus ( using 10 cc of contrast ) was performed to detect time to reach optimal contrast opacification in the axial image at a level immediately superior to the ostium of the left main artery . nitroglycerin 0.4 mg sublingual was administered immediately prior to contrast injection . during mdct image acquisition , 60 cc iodinated contrast was injected utilizing a triple - phase contrast protocol : 40 cc iodixanol , followed by 40 cc of a 50:50 mixture of iodixanol and saline , followed by a 50 cc saline flush . the scan parameters were 64 0.625 mm collimation , tube voltage 100120 kvp , and effective current 350780 ma . after scan completion , reconstruction of mdct scans was performed at 595% using 10% increment on retrospective scans and 7080% using 5% interval on prospective scans . for measurement purpose , this particular phase was utilized for measurement because this phase is available on both prospective and retrospective scans and it has been shown to be an optimum phase for coronary artery disease evaluation . central aortic valve coaptation area is identified as circular to triangular shape area present centrally in the aortic valve during diastolic phases . planimetric measurements of this area were performed on cross sectional images of the aortic valve ( as shown in fig . 1 ) . this central coaptation area is closed in normal persons , visualized as no contrast present in this area . in patients with aortic regurgitation , this area is incompetent and is visualized as regurgitant orifice area ( roa ) ( as shown in fig . 2 ) . planimetric measurement of the roa when observed was also performed in crosses sectional views of the aortic valve at 75% phase of the r - r interval ( fig . 2figure showing regurgitant orifice area ( roa ) in patient with aortic regurgitation central aortic valve coaptation area as seen on mdct scan figure showing regurgitant orifice area ( roa ) in patient with aortic regurgitation continuous variables were measured using student t test and categorical variables using chi square test . the data was summarized as mean standard deviation or numbers ( percentages ) . altman correlation was utilized for correlation between central aortic valve coaptation area and central roa . the data was analyzed using commercially available statistical software stata ( version 10 , college station , tx ) . retrospective analysis of mdct scans of 400 symptomatic consecutive patients whose scans were performed at our outpatient cardiac computed tomography scanner for the evaluation of coronary artery disease ( los angeles biomedical research institute at harbor - ucla medical center ) were analyzed . patients with poor image quality ( columnation , streak artifacts , motion artifacts , and image noise ) , bicuspid aortic valves and heavy calcification of aortic valve leaflets that made the aortic valve region non - evaluable were excluded . sixteen mdct scans were excluded due to the above reason and 384 scans were included for evaluation of the aortic valve area . all mdct scans were performed with 64-detector row lightspeed vct scanner ( general electric healthcare , milwaukee , wisconsin ) . individuals presenting with baseline heart rates > 65 beats per minute ( bpm ) were administered oral beta - blocker therapy as the preferred method for slowing down the heart rate . iv administration was allowed in the protocol , using intravenous metoprolol at 5 mg increments to a total possible dose of 40 mg in order to achieve a resting heart rate < 65 bpm . following a scout radiograph of the chest ( anteroposterior and lateral ) , a timing bolus ( using 10 cc of contrast ) was performed to detect time to reach optimal contrast opacification in the axial image at a level immediately superior to the ostium of the left main artery . nitroglycerin 0.4 mg sublingual was administered immediately prior to contrast injection . during mdct image acquisition , 60 cc iodinated contrast was injected utilizing a triple - phase contrast protocol : 40 cc iodixanol , followed by 40 cc of a 50:50 mixture of iodixanol and saline , followed by a 50 cc saline flush . the scan parameters were 64 0.625 mm collimation , tube voltage 100120 kvp , and effective current 350780 ma . after scan completion , reconstruction of mdct scans was performed at 595% using 10% increment on retrospective scans and 7080% using 5% interval on prospective scans . for measurement purpose , this particular phase was utilized for measurement because this phase is available on both prospective and retrospective scans and it has been shown to be an optimum phase for coronary artery disease evaluation . central aortic valve coaptation area is identified as circular to triangular shape area present centrally in the aortic valve during diastolic phases . planimetric measurements of this area were performed on cross sectional images of the aortic valve ( as shown in fig . 1 ) . this central coaptation area is closed in normal persons , visualized as no contrast present in this area . in patients with aortic regurgitation , this area is incompetent and is visualized as regurgitant orifice area ( roa ) ( as shown in fig . 2 ) . planimetric measurement of the roa when observed was also performed in crosses sectional views of the aortic valve at 75% phase of the r - r interval ( fig . 2figure showing regurgitant orifice area ( roa ) in patient with aortic regurgitation central aortic valve coaptation area as seen on mdct scan figure showing regurgitant orifice area ( roa ) in patient with aortic regurgitation continuous variables were measured using student t test and categorical variables using chi square test . the data was summarized as mean standard deviation or numbers ( percentages ) . altman correlation was utilized for correlation between central aortic valve coaptation area and central roa . the data was analyzed using commercially available statistical software stata ( version 10 , college station , tx ) . mean area of the central aortic valve coaptation area on planimetric measurement was 5.34 5.19 mm . incomplete co - aptation of the aortic valve cusps as roa was noticed on 29 patients . we followed trans - thoracic echocardiography ( tte ) reports on these 29 patients and all of them were found to have aortic regurgitation of various severities on tte . mean central aortic valve coaptation area ( mm ) in patients with aortic regurgitation was 10.53 0.26 and in patients without aortic regurgitation were 4.90 0.17 . there was correlation found between central aortic valve coaptation area and central roa using bland altman correlation which showed that with increase in roa area , the central aortic valve coaptation area also increases in size ( r = 0.80 , p = < 0.001 ) ( fig . 3 ) . the average aortic valve calcium score in the whole cohort was 8.49 64.45 au.table 1general characteristics of patient populationpopulation characteristics ( no . ( % ) age ( years)60.37 12.86males257 ( 67.3)hypertension108 ( 43.03%)diabetes mellitus48 ( 19.43%)hyperlipidemia88 ( 35.48%)family history of cad113 ( 49.78%)central aortic valve coaptation area ( mm)5.34 5.19aortic valve calcium score ( au)8.49 64.45hounsfield units of aortic pad area ( hu)123.69 31.31regurgitant orifice area ( roa ) mm6.33 8.13fig . 3bland altman correlation between central aortic valve coaptation area and aortic regurgitation orifice area general characteristics of patient population bland altman correlation between central aortic valve coaptation area and aortic regurgitation orifice area figure 1 shows central aortic valve coaptation area on cross - sectional views of the aortic valve as an area present in between the cusps . figure 2 shows a patient with aortic regurgitation showing the regurgitant orifice area on cross - sectional view of the aortic valve . in this study , we looked at an area of the aortic valve present in the central space between the aortic cusps , central aortic valve coaptation area seen during diastole . this is visualized as a circular to triangular area present centrally in between the aortic cusps during diastole . this area is widely open during systole to allow normal flow of blood from the left ventricle to the aorta . during diastole , this area is normally closed and competent enough to prevent any regurgitation of blood flow from the aorta to the ventricle . in ar , we can observe incomplete coaptation of this area in case of central aortic regurgitation jet . eccentric aortic regurgitation jets can be visualized as present in between the aortic cusps on the sides . there was a strong correlation found between increased central aortic valve coaptation area and the presence of increasing roa due to ar . this area may not be well demarcated in patients with bicuspid aortic valves . a significant difference in the hounsfield units was found between the contrast enhanced roa ( contrast usually 350500 hu ) and the surrounding aortic valve coaptation area ( 123.69 31.31 hu ) . this observation will be helpful for further studies looking at the diagnostic accuracy of mdct for ar , especially among scanners using low dose protocols , obtaining images in diastole [ 8 , 9 ] . this area may be difficult to be analyzed if there are motion artifacts , columnation artifacts , and heavy calcifications . the hounsfield measurement in this area may be helpful but it suffers from partial volume effect . it is critical to understand that the normal aortic valve cusps have a small but defined central area visible on current cardiac ct scanners that does not represent aortic regurgitation . it is the increase in this central area along with visible roa that represents aortic regurgitation . | as multiple new procedures now require better visualization of the aortic valve , we sought to better define the central aortic valve coaptation area seen during diastole on multi - detector row cardiac computed tomography ( mdct ) .
64-mdct images of 384 symptomatic consecutive patients referred for coronary artery disease evaluation were included in the study .
planimetric measurements of this area were performed on cross - sectional views of the aortic valve at 75% phase of the cardiac cycle .
planimetric measurement of central regurgitation orifice area ( roa ) seen in patients with aortic regurgitation and hounsfield units of the central aortic valve coaptation area were performed .
mean area of the central aortic valve coaptation area was 5.34 5.19 mm2 and hounsfield units in this area were 123.69 31.31 hu . the aortic valve coaptation area ( mm2 )
measurement in patients without ar was : 4.90 0.17 and in patients with ar : 10.53 0.26 ( p = < 0.05 ) . on bland
altman analysis a very good correlation between central aortic valve coaptation area and central roa was found ( r = 0.80 , p = < 0.001 ) .
central aortic valve coaptation area is a central area present at the coaptation of nodules of arantius of aortic cusps during diastole ; it is incompetent and increased in size in patients with aortic regurgitation . |
viral hepatitis due to hepatitis b virus ( hbv ) is a major worldwide public health concern leading to acute and chronic liver disease including cirrhosis and hepatocellular carcinoma ( hcc ) ( 14 ) . it is currently estimated that over 2.5 billion people are exposed and over 350 million people are chronically infected with the virus and that 1.2 million people die annually from hbv - related disease ( 57 ) . the prevalence of hbv is known to be higher through asia and the middle east , africa , south america and the mediterranean countries . in these regions , transmission occurs mainly through vertical and horizontal routes . in north america and northern europe , where hbv prevalence is lower , sexual and intravenous drug use are the major modes of transmission ( 8,9 ) . there are few reliable predicators for the risk of developing serious consequences of hbv infection such as host - related factors ( gender , age at infection , degree of liver damage at presentation and immune competence ) , environmental factors ( alcohol consumption , co - infection with other viruses such as hiv and hcv and drug therapy ) and hbv - related factors ( serological markers , viral load and persistence of viral replication ) . hbv is currently classified into eight genotypes ( a h ) based on sequence divergence over the entire genome exceeding 8% at the nucleotide level ( 1012 ) . additional variability in the genome has been shown to arise as a result of the natural emergence of strains which may have a selective advantage during the course of chronic hbv infection in a patient , e.g. precore mutants , deletions in the core gene , pres1 and pres2 regions [ for a review see ( 15 ) ] . it is speculated that these variants are driven by the immune system but it currently remains unknown which , if any are clinically significant . sequence evolution driven by external pressures such as the introduction of immunization programmes and more recently antiviral treatment has also given rise to a number of mutations within the viral polymerase and envelope regions [ for a review see ( 16 ) ] . although in vitro studies have provided significant information into understanding the clinical significance of sequence changes , these data remain limited to a few specific mutations ( 17,18 ) . the development of databases containing detailed genetic sequences of human pathogens provides a new point of departure for the investigation of host parasite relationships . using bioinformatics techniques it is possible to assess pathogen relatedness and likely evolutionary pathways , and to examine the pathways of sequence evolution of an agent in response to a particular selection pressure such as antiviral treatment . furthermore , building a repository for such data allows for the monitoring of the distribution and variability of hbv strains at regional , national and global levels , which is of importance in an increasingly mobile population . furthermore , such data provide a powerful tool in the public health setting when investigating hbv transmission events and outbreaks . owing to these considerations there is an urgent need to develop trusted databases to store reliable and curated data on the public health aspects of hbv infections and to develop appropriate methods and tools to extract and analyse the stored data and report the information . we present here hepseq ( ) , a freely accessible web resource on the public health aspects of hbv infection with specific focus on epidemiological , virological , clinical , nucleotide sequence and mutational aspects of hbv infection . hepseq is able to summarise and link large volumes of data and present those in a visually intuitive format . moreover hepseq provides a resource to support detection of variants in patients from different parts of the world , to help monitor the dynamic of hbv variants during therapy and potentially to contribute to re - design of diagnostic assays . a front - end apache web server serves content to the client browsers . a middle dynamic content processing and generation layer consists of php , cgi and perl scripts and specialized programs written in c ( e.g. for sequence alignment ) . finally a backend database has both datasets and relational database management system ( rdbms ) . during the design and development of hepseq , initially all the necessary requirements for a comprehensive public health database on epidemiological , clinical and molecular markers were identified through many discussions with the stakeholders ( clinicians and lab scientists ) and then data modelling was undertaken . after reviewing and improving the resultant model several times , a data schema capable of catering to diverse sources and formats of data was evolved and implemented as a relational database using postgresql open source database management system on a linux operating system server . this schema consists of patient , sample , gene and mutant tables , which have one to many relationships between them . this schema enables multiple mutations to be associated with a nucleotide sequence , multiple nucleotide sequences to be associated with a sample and multiple samples to be associated with a patient . the epidemiological , virological , clinical and nucleotide sequence data were mainly collated from the participating centres and manually checked before insertion to the database . caldicott standards are recommended by the department of health , england and govern the use and transfer of patient - identifiable information from national health service ( nhs ) organizations to other nhs and non - nhs organizations ( the caldicott report is available online at and confidentiality : nhs code of practice is available at ) . ambiguities in data were raised with the contributors and only stored in the database once these were resolved . the first of these sections contains the information pages accessed through the top navigational bar . these pages display a summary of the current contents in the repository , an overview of the hepseq system , and contact information . to facilitate the dissemination of news , events of interest to the public health community and latest publications on hepatitis , really simple syndication ( rss ) feeds from different sources are compiled and displayed on the news and events page . updates relating to hepseq are also rendered as rss feeds and are available for download and display with a rss newsreader from the overview page . information pages on clinical , epidemiological and sequence display real - time data from the current database records as pie and bar charts ( figure 1 ) . sequence matcher ( c ) matches a user input sequence and produces a tabular format results page ( d ) , from which detailed individual patient record ( e ) or the sequence record ( f ) can be obtained . users can either access all the records in a tabular form or access any detailed individual record by specifying a patient , sample , gene or mutant identifier . the search page provides all the fields available in the database and distinct entries of those . through this page any combination of the specific fields in the database can be searched by user - created unique queries and from the resultant tabular data , individual detailed records can be viewed . researchers interested in submitting data to hepseq can contact the curators by email detailing the nature , type and amount of data they wish to submit . after individually determining the best possible mechanism to submit data , the data will be bulk loaded into a temporary table and manually curated . after reconciling any inconsistencies in the data with the submitter the third section of the web interface provides graphical tools to dynamically generate pie and bar charts from any specified field or a pair of fields . this tool can easily find the associations between different factors ( e.g. outbreak and genotype ) and display those in a meaningful manner . another tool in this section integrates the google map api with the database and a specific parameter relating to the geographical area can be viewed . the sequence matcher tool allows a user to input a dna sequence and search it against all the sequences deposited in the hepseq . protocols for identical matching as well as for matching near - identical strain sequences are available . the identical matching is implemented through the string match functions of the programming language and is very fast . near - identical matching allows the user to pick a pairwise sequence matching algorithm from three available methods : smith waterman ( 19 ) , needleman the tabular format of the result is linked to individual records as well as alignments . the benefit of this tool is that a user - input sequence can be linked to related sequences and to potentially related cases . wunsch ( 20 ) algorithm against all the reference sequences and highly scoring matches ( > 98% sequence similarity ) with statistical significance are reported . if the input sequence is not a recombinant sequence then an unambiguous genotype can be predicted to the given sequence . in this tool genotyping the reference sequences were assembled from the sequences downloaded from genbank and the sequences in the hepseq system and validated using phylogenetic analysis . the mutation marker tool allows sequences grouped by different parameters ( e.g. genotype ) to be displayed as multiple alignments , allowing sequence differences and gaps to be visualized . this also annotates the alignment with clinically important specific mutations related to vaccine escape or antiviral resistance . the current release of hepseq is dedicated to be a comprehensive online resource for public health aspects of hbv infection and offers a platform for further multi - factorial analysis of hbv infection . in this current format the database system is useful as an extensive library of hbv sequences well annotated with clinical and epidemiological data . the first priority in future hepseq development is to increase the number of data contributors and users and trying to reach and receive data from almost all the centres and laboratories involved in hbv infection studies . this will make hepseq a truly global repository of hbv infection data and a public health portal for hbv infection studies . as the quality and consistency of the data availability is the best indicator of any database system , in future , increased focus will be towards data quality . in addition to the manual curation currently automatic scripts also report on the quality of the data . we would want to extend this to include the quality of the nucleotide sequences deposited in the system and to report on the sequencing errors that might have occurred . this has implications in assigning correct genotype to a sequence and also in the subsequent multi - factorial analysis of data . to achieve this although automated , web - based approaches can be used to a certain extent , manual curation remains the gold standard until the acceptable parameters for automated analysis are generally agreed . there is a need to explore approaches other than simple percentage sequence identities between strains for genotype assignment as these can be unreliable where partial ( rather than complete ) genomic sequences are available . approaches such as integrating position sensitive scoring matrices ( pssms ) , recently applied to hbv ( 22 ) with the current pairwise sequence comparisons will be explored . there is also a need to present the sequence analytical tools ( genotyping and sequence alignment tools ) as a webservice , so that other web - based systems could utilize these services without duplicating effort . | hepseq is a repository for an extensive library of public health and molecular data relating to hepatitis b virus ( hbv ) infection collected from international sources .
it is hosted by the centre for infections , health protection agency ( hpa ) , england , united kingdom .
this repository has been developed as a web - enabled , quality - controlled database to act as a tool for surveillance , hbv case management and for research .
the web front - end for the database system can be accessed from .
the format of the database system allows for comprehensive molecular , clinical and epidemiological data to be deposited into a functional database , to search and manipulate the stored data and to extract and visualize the information on epidemiological , virological , clinical , nucleotide sequence and mutational aspects of hbv infection through web front - end .
specific tools , built into the database , can be utilized to analyse deposited data and provide information on hbv genotype , identify mutations with known clinical significance ( e.g. vaccine escape , precore and antiviral - resistant mutations ) and carry out sequence homology searches against other deposited strains .
further mechanisms are also in place to allow specific tailored searches of the database to be undertaken . |
the causes of vitreous surgery failure have been a controversial issue for the century [ 13 ] . it was considered that anterior proliferative vitreoretinopathy ( apvr ) is the main reason of the initial or repeated vitreous surgeries [ 1 , 2 ] . however , apvr was significantly associated with residual basal vitreous and could be prevented effectively by its complete removal during ppv . furthermore , many pathological studies have demonstrated that apvr was related to vitreous incarceration of sclerotomy sites [ 46 ] . unfortunately , it is difficult to inspect the inner aspect of sclerotomy sites with conventional techniques , especially when there is massive residual vitreous , vitreous opacity , or hemorrhage . therefore , we developed a practical sclera depression method to examine the previous sclerotomy sites under surgical microscope before second 20-gauge ppv and defined a new method for classification of vitreous incarcerations in sclerotomy sites . then we investigated the relationship of severity of vitreous incarcerations and different 20-gauge sclera port in our study group . 82 consecutive hospitalized patients ( 82 eyes ) with recurrent retinal detachment , who were planned to receive second 20-gauge ppv from 7 provinces in southern china during january 2000 to december 2007 , were included in our study . a standard three - port ppv was performed on all the 82 patients by the same experienced surgeon . new sclerotomy sites were chosen beside the previous ones ( all were with 20-gauge sclerotomies ) . after sclerotomies , the inner aspects of the previous sclerotomy sites were carefully examined by our sclera depression method before vitrectomy . the ports for vitreous cutter and light pipe should be exchanged for observation of the previous sites near each other . in phakic eyes , when a 45 prismatic lens was placed and the slant was faced to the new sclerotomy site , the assistor should help indenting the sclera behind the site . then the surgeon inserted a illuminative lighter shallowly at another port to visualize the inner aspect around the new sclerotomy site . the surgeon just held a sclera depressor to indent the sclera behind the former sclerotomy site and inserted the illuminative pipe through another port to visualize the area of indented sclera around one former sclerotomy site under the surgical microscopy . the vitreous incarceration in the inner aspect of sclerotomy sites were classified as five grades by their severity . grade 0 was no vitreous incarceration ( figure 1 ) ; grade i had visible vitreous incarceration without traction on the retina ( figure 2 ) ; grade ii had vitreous incarceration with traction on the retina causing retinal detachment or trough ( figure 3 ) ; grade iii was vitreous incarceration leading to retinal breaks ( figure 4 ) ; grade iv had retinal incarceration in sclerotomy site ( figure 5 ) . the chi - square test was used to compare a possible difference in the frequencies of vitreous incarceration and different sclera port . there were 246 previous sclerotomy sites ( one eye with three different ports ) observed in the 82 included recurrent retinal detachment patients ( 82 eyes ) , of which 164 ( 66.7% ) previous sclerotomy sites were found with different degrees of vitreous incarceration . according to our classification and definition , there were 80 sites ( 32.5% ) with vitreous incarceration of grade iii and iv . grade ii of vitreous incarceration were found in 31 previous sclerotomy sites ( 12.6% ) . there were 135 sclerotomy sites ( 54.8% ) classified as grade 0 and i. the frequencies of vitreous incarcerations of the five defined grades at the three different ports of sclerotomy sites in the 82 included eyes are summarized in table 2 . to compare the frequencies of vitreous incarceration in different sclerotomy sites of standard three - port pars plana vitrectomy , only 12 patients ( 14.6% ) were found without vitreous incarceration in the vitreous cutter sites , and 14 patients ( 17.1% ) were without vitreous incarceration in the light pipe sites , but the infusion pipe sites in 56 patients ( 68.3% ) were free of vitreous incarceration . we could see that the least sclerotomy - related complications occurred in infusion port , but the retinal breaks caused by sclerotomy - related complications were the most frequency in vitreous cutter port . however , compared with two groups in light port and vitreous cutter port , their difference was no significant ( = 3.178 , p = 0.529 ) . the frequency of all grades of light port ( 82.9% ) or vitreous cutter port ( 85.4% ) was significant higher than that of infusion port ( 31.7% ; = 36.536 , p < 0.001 , and = 41.759 , p < 0.001 ) . many studied have shown that the vitreous incarceration in sclerotomy sites inducing apvr , were the main reason for recurrent retinal detachment after 20-gauge ppv [ 1115 ] . however , with conventional clinical methods such as indirect ophthalmoscope or three - mirror biomicroscopy with traditional sclera depression , it is extremely hard to observe the inner aspect of sclerotomy sites in detail , so the peripheral retina or the vitreous base is often ignored or only examined roughly [ 1618 ] . it would be much more difficult to observe these areas in case of vitreous hemorrhage , vitreous opacity , or opaque vitreous skirt . although ultrasound biomicroscopy ( ubm ) have been used for detecting the inner aspect of sclerotomy sites before surgery [ 12 , 13 ] , by which the degree of vitreous incarceration could be graded indirectly [ 13 , 14 ] . however , ubm could not identify different tissues incarcerated in sclerotomy sites due to the same echo of retina and vitreous . therefore , a practical method should be developed or vitreous incarceration would be continued to be ignored and apvr could not be effectively prevented . in our study , we examine and classify the vitreous incarceration in the inner aspect of previous 20-gauge ppv sclerotomy sites under the surgical microscopy with our sclera depression method intraoperatively . our study demonstrated that this new clinical method provides a simple and feasible procedure . on the basis of our definition and classification , we found that vitreous incarceration of grade iii and iv together involved 32.5% of previous 20-gauge sclerotomy sites , and vitreous incarceration of grade ii involved 12.6% of previous 20-gauge sclerotomy sites . what should deserve our greatest attention is that the frequency of all grades of light port ( 82.9% ) or vitreous cutter port ( 85.4% ) was significant higher than that of infusion port ( 31.7% ; = 36.536 , p < 0.001 and = 41.759 , p < 0.001 ) . it means that after 20-gauge ppv , vitreous incarceration in light port and vitreous cutter port is more common than in infusion port , and the ports for vitreous cutter and light pipe should be exchanged for observation of the previous sites around each other and completely vitrectomy surrounding the two ports . in conclusion , vitreous incarceration in previous sclerotomy sites can be observed and classified with our new method in patients undergoing second 20-gauge ppv for recurrent retinal detachment . vitreous incarceration in light port and vitreous cutter port is more common than in infusion port for the standard 20-gauge ppv . the most effective way to prevent the sclerotomy - related complications is to remove vitreous at basal and pars plana area completely during initial 20-gauge ppv , especially attention should be paid for the basal part surrounding light port and vitreous cutter port . | purpose . to observe and classify vitreous incarcerations in patients undergoing second 20-gauge pars plana vitrectomy ( ppv ) for recurrent retinal detachment
. methods .
retrospective noncomparative consecutive case series .
eighty - two consecutive patients with recurrent retinal detachment were included .
the previous sclerotomy sites were examined by our sclera depression method and the vitreous incarceration were classified into grade 0iv by their severity under surgical microscope before second surgery .
the relationship of vitreous incarceration and different ports was statistically investigated in our included patients .
results .
vitreous incarceration in the previous sclerotomy sites were found frequently .
vitreous cutter sites were most involved , but the infusion pipe sites were the least . according to our classification and definition ,
grade iii and iv of vitreous incarceration in all the three different sclerotomy sites accounted for 32.5% .
grade ii of vitreous incarceration consisted of 12.6% .
grade 0 and i in all the three different sclerotomy sites were 54.8% .
the frequency of all grades of vitreous incarceration in light port or vitreous cutter port was significant higher than that in infusion port .
conclusions .
vitreous incarceration in light port and vitreous cutter port are found more common than in infusion port for 20-gauge ppv with our new method . |
such clinicians should be reminded of the possibility of pbl when suspecting malignant bone tumors . therefore , laboratory findings that help differentiate pbl from other primary bone tumors can play an important role . serum soluble interleukin-2 receptor ( sil-2r ) levels in patients with common primary malignant bone tumors except pbl were reported not to be significantly elevated compared to those in healthy subjects in previous reports [ 1 , 2 ] . reported sil-2r levels being significantly higher in pbl than in other malignant bone tumors and benign bone tumors / tumor - like lesions and commented that the sil-2r level is a valuable marker for diagnosing pbl . however , we were not able to find reports discussing the changes in serum sil-2r levels during the clinical course in pbl . in this report , we present two pbl cases who had high serum levels of sil-2r on presentation and normalized serum levels after the treatments . we show the clinical course of the two pbl patients and discuss the possible clinical significance of sil-2r levels in pbl . in may 2007 a 52-year - old man visited the national hospital organization tokyo medical center ( ntmc ) with left buttock pain which had lasted for 6 months . the radiograph showed osteosclerotic and osteolytic changes in the wing of the ileum and the acetabulum ( fig . bone scintigraphy showed highly increased accumulation of 99mtc - hmdp in the left acetabulum and indicated sole bone lesion . a whole - body ct scan and gallium scan revealed no evidence of visceral or lymph node involvement . from these results , a 67-year - old man with a 1-month history of right hip pain visited the ntmc due to difficulty in walking . ct imaging showed moth - eaten pattern of destruction of the anterior part of the acetabulum and expanded soft tissue ( fig . a whole - body ct scan , and bone and gallium scans were carried out . thus , primary bone tumor of the right acetabular roof was suspected . in both cases , laboratory tests at hospitalization showed high levels of serum sil-2r [ case 1 : 2,880 u / ml , case 2 : 1,140 u / ml ( reference value : 188570 u / ml ) ] and slightly elevated levels of lactate dehydrogenase ( ldh ) [ case 1 : 263 u / l , case 2 : 241 u / l ( reference value : approx . immunohistochemistry revealed positive staining for cd20 and leukocyte common antigen , and was negative for cd3 . thus , both cases were diagnosed as pbl ( diffuse large b - cell lymphoma ) . according to the ann arbor staging system , both localized bone lesions were regarded as stage i. the chemotherapy [ r - chop ( rituximab , cyclophosphamide , doxorubicin , vincristine , prednisolone ) ; case 1 : 8 courses , case 2 : 6 courses ] was performed under the supervision of the hematology department . in case 1 , osteosclerotic changes increased and the pathological fracture line became unclear in radiographic images after the chemotherapy ( fig . 2a ) . new bone formation and increased osteosclerosis around the acetabulum as well as intrapelvic migration of the femur head were recognized in case 2 ( fig . 3a , b ) , and linked with radiological therapeutic response of the affected bones . in may 2007 a 52-year - old man visited the national hospital organization tokyo medical center ( ntmc ) with left buttock pain which had lasted for 6 months . the radiograph showed osteosclerotic and osteolytic changes in the wing of the ileum and the acetabulum ( fig . bone scintigraphy showed highly increased accumulation of 99mtc - hmdp in the left acetabulum and indicated sole bone lesion . a whole - body ct scan and gallium scan revealed no evidence of visceral or lymph node involvement . from these results , in august 2006 , a 67-year - old man with a 1-month history of right hip pain visited the ntmc due to difficulty in walking . ct imaging showed moth - eaten pattern of destruction of the anterior part of the acetabulum and expanded soft tissue ( fig . a whole - body ct scan , and bone and gallium scans were carried out . thus , primary bone tumor of the right acetabular roof was suspected . in both cases , laboratory tests at hospitalization showed high levels of serum sil-2r [ case 1 : 2,880 u / ml , case 2 : 1,140 u / ml ( reference value : 188570 u / ml ) ] and slightly elevated levels of lactate dehydrogenase ( ldh ) [ case 1 : 263 u / l , case 2 : 241 u / l ( reference value : approx . immunohistochemistry revealed positive staining for cd20 and leukocyte common antigen , and was negative for cd3 . thus , both cases were diagnosed as pbl ( diffuse large b - cell lymphoma ) . according to the ann arbor staging system , both localized bone lesions were regarded as stage i. the chemotherapy [ r - chop ( rituximab , cyclophosphamide , doxorubicin , vincristine , prednisolone ) ; case 1 : 8 courses , case 2 : 6 courses ] was performed under the supervision of the hematology department . in case 1 , osteosclerotic changes increased and the pathological fracture line became unclear in radiographic images after the chemotherapy ( fig . 2a ) . new bone formation and increased osteosclerosis around the acetabulum as well as intrapelvic migration of the femur head were recognized in case 2 ( fig . 3a , b ) , and linked with radiological therapeutic response of the affected bones . pbl is an extremely rare bone tumor ; its frequency is considered to be about 37% of all primary malignant bone tumors , approximately 3% of all extranodal lymphomas , and less than 1% of all malignant lymphomas [ 4 , 5 , 6 , 7 ] . according to who classification , pbl can be categorized into two groups as follows : group 1 , lymphoma involving a single skeletal site , with or without regional lymph - node involvement , and group 2 , lymphoma involving multiple bones , without visceral or lymph - node involvement . recently , several clinical reviews applying these criteria of pbl have been published [ 4 , 5 , 7 , 8 , 9 , 10 , 11 , 12 ] . there was a slight male predominance and a tendency for senior adults to be affected more often , although pbl can occur at any age . the pelvis or proximal part of the femur is the common site of the tumor . most cases of pbl are reported to be non - hodgkin 's diffuse large b - cell lymphomas . stage of disease , age , serum ldh levels , response to chemotherapy , and the use of combined modality therapy are considered to be prognostic factors in pbl . radiographs and ct images of pbl usually present non - specific findings , mostly various patterns of osteolysis and osteosclerosis coexisting in the bone . as a result , radiological differential diagnosis of pbl from other types of primary bone tumors such as ewing 's sarcoma , osteogenic sarcoma , and chondrosarcoma is often difficult . therefore , laboratory findings that help differentiate pbl from other common bone tumors are important . so far , the significance of measuring sil-2r levels has been rarely reported in clinical reviews of pbl [ 4 , 5 , 7 , 8 , 9 , 10 , 11 , 12 ] . in other primary malignant bone tumors including osteosarcoma , ewing 's sarcoma , chondrosarcoma , and malignant giant cell tumor , median serum levels of sil-2r are reported not to be significantly elevated compared with those of healthy controls [ 1 , 2 ] . recently , akahane et al . reported that the serum sil-2r level is valuable for differentiating pbl from other osteolytic malignancies or benign bone lesions that resemble malignant tumor radiographically . in our two pbl cases , the reduced sil-2r levels after r - chop therapy were linked with the reduction of the tumor size and the osteosclerotic changes in the bone lesions . moreover , the changes in sil-2r levels were similar to those in ldh levels known as a prognostic factor of pbl . the fact that sil-2r levels were associated with the clinical course of pbl means such measurements play an important role in the disease monitoring . adding to the recently reported results of the diagnostic significance of sil-2r in pbl , our case study tentatively indicates the clinical significance of sil-2r levels as a tumor marker in pbl cases . | in two patients with primary bone lymphoma ( pbl ) treated in our clinic , serum levels of soluble interleukin-2 receptor ( sil-2r ) reflected the clinical course . in both cases ,
sil-2r levels were high before treatment and normalized with the therapeutic effects of chemotherapy , coinciding with the changes in lactate dehydrogenase levels and radiographic findings .
adding to the recently reported results of the diagnostic ability of sil-2r in pbl , our case study highlights the clinical significance of serum sil-2r levels as a tumor marker in pbl cases . |
microsatellite loci were isolated from the recently published c. calcarata genome ( rehan et al . 2016 ) using the microsatellite identification tool ( misa ; thiel et al . 2003 ) interfaced with an executable version of primer 3 ( koressaar and remm 2007 ; untergasser et al . misa was used to trim genomic reads to lengths of 20 kb to facilitate scans . to ensure microsatellite quality , misa was configured to select loci based on strict minimum motif repeat requirements ( mononucleotides = 15 ; dinucleotides = 7 ; tri- through hexanucleotides = 5 ) . the resulting 2,010 putative microsatellite loci and flanking regions were sorted in descending order of motif length and motif repeat count . flanking regions were then visually inspected for self - complementarity to prevent hairpin or excessive primer dimer formation . putative primer pairs were also screened to ensure < 1 c difference in melting temperature between forward and reverse oligos . a top fifty candidate primers were then assessed for amplification performance and polymorphism in 16 females from across c.
calcarata s range ( c. calcarata is haplodiploid , thus primers must be screened in females to accurately assess heterozygosity ) . we followed the methodology of schuelke ( 2000 ) and designed forward primers modified with a partial m13 tail . a set of universal primers was labeled with three dyes from the ds-33 set ( fam , pet , and vic ) to allow for pcr product multiplexing downstream . pcr reactions were executed in an 11 l volume ( 5.45 l ddih20 ; 2.0 l 5 hf buffer ; 0.2 l [ 10 mm ] dntps ; 0.1l phusion hf taq polymerase ( thermo scientific , waltham , ma ) ; 0.25l [ 10 mm ] forward primer ; 0.5 l fluorescent m13 oligo [ 10 mm ] , 0.5 l [ 10 mm ] reverse primer ; 2.0 l dna template ) using an eppendorf mastercycler gradient thermocycler ( eppendorf north america , hauppauge , ny ) . pcr reactions involved five stages : 1 ) initial denaturing at 98 c for 40s , 2 ) a touchdown series of 10 cycles at 98 c for 10 s , 72 c for 15 s ( cooling incrementally to primer - specific ta ) , and 72 c for 15 s , 3 ) 20 cycles at 98 c for 10 s , primer ta for 15 s , and 72 c for 15 s , 4 ) 8 cycles at 98 c for 10 s , 62 c for 15 s , and 72 c for 15 s , 5 ) final extension at 72 c for 10 min . pcr products were mixed with hidi formamide ( applied biosystems , foster city , ca , usa ) before being sent to the dna analysis facility at yale university for fragment analysis on a 3730xl analyzer . alleles were manually scored using peak scanner 2 ( applied biosystems , foster city , ca , usa ) . after initial pcr , 21 loci were further screened for polymorphism and performance in an additional 23 females ( total screening panel n = 39 ) . loci were tested for hardy - weinberg and linkage disequilibrium using genepop 4.2 ( raymond and rousset 1995 ; rousset 2008 ) . each locus was then assessed for expected and observed heterozygosity ( he and ho respectively ) and total alleles ( k ) using genalex 6.502 ( peakall and smouse 2006 , 2012 ) . all 21 microsatellite loci were uploaded to genbank under accession numbers ku945359-ku945379 ( table 1 ) . table 1primer sequences and locus characteristics of twenty - one microsatellite loci developed for c. calcaratalocusprimer sequence 5-3genbankrepeat motifkallele size rangetanhohehwe pccal01f : acaaaacaaaagcgcggacaku945359ggtgac826331169380.6580.7520.011r : ggattgtcatgacgggggagccal02f : aaatcaaccctagccccagcku945360cagctc522628064390.3080.4090.259r : tacacacaggtcgtcacgtgccal03f : aatagacggagagcagcagcku945361aggcag715218864380.5260.6640.220r : ttgtttcatcttcgcacgcgccal04f : ggagaaccgagataccagaggku945362accga2919667360.0830.5790.367r : tcccactttttacggctcccccal08f : tcgattcacgcagacctgacku945363ctga1123528768380.5790.8540.004r : ggatatgcgcccgtcactaaccal11f : atagggagcgagctgtttcgku945364aggtt624327865370.6330.6980.004r : tcgtccgcagccataacaatccal14f : ggcgtagttccatctgtcgtku945365aacct316417466390.3080.4060.005r : ttgcaccgacgattctcgaaccal16f : cagggaaggcgggtatctttku945366aggtt325226267380.6580.5020.072r : ggcggtgaaattgcgactttccal17f : gtgcgcgtagaacaaccaagku945367ggcga519521567390.1790.2950.017r : agcctcgtgcagcttacaatccal18f : gtttcattcggttccgcaccku945368gttct223524066390.2560.261.000r : ctgagccgcgtatctgcataccal19f : tcattaattcgggcgcctgtku945369gaaca326127167380.3160.5080.020r : ctgcctttctcgtccctctgccal23f : aattcggccaagctcgtacaku945370gtgcg616318870390.7950.5850.157r : ggaaacttggttttcggcccccal25f : aaacggcggactgaaaaacgku945371ccgca718821866390.4360.6450.003r : acttcgagtgcggatttcgtccal29f : acgttggacgaacactgacaku945372aacct327028064390.3590.3311.000r : ccgtggctctccctaatcacccal30f : tactatgtgatgcgtgccgtku945373atcat526730263390.4360.6560.015r : cacgagtgggtcccgaatacccal37f : cgtctcgcagtaacggtacaku945374agaa1214819664390.7690.8680.056r : agaacagtcgtgtccggttcccal39f : caaagaaatggcggggaacaku945375ttat725327765380.5530.7650.010r : gcgacggtaatgacttacaacgccal44f : ttcccaacacgcttcgtacaku945376gtct620129767380.2890.3190.087r : tacgtggatgcattcgtcccccal48f : cgattccggtgaaacgcaagku945377ggaa510612667390.5130.5840.049r : cttccttccttcccatgcgtccal49f : ctgccgtatcctctctccctku945378gcac823426265390.7440.7870.571r : gagaggcacgcgggtaataaccal50f : ccgacctttctcgcaaaacgku945379tgta1422728367390.8210.8790.028r : tctctgtttcttcccaccgcinformation presented includes primer sequence ; genbank accession number ; repeat motif ; allele count ( k ) ; allele size range ; annealing temperature in c ( ta ) ; number of individuals successfully screened ( n ) ; observed ( ho ) and expected ( he ) heterozygosities ; and hardy - weinberg exact test p - values ( hwe p ) . primer sequences and locus characteristics of twenty - one microsatellite loci developed for c. calcarata information presented includes primer sequence ; genbank accession number ; repeat motif ; allele count ( k ) ; allele size range ; annealing temperature in c ( ta ) ; number of individuals successfully screened ( n ) ; observed ( ho ) and expected ( he ) heterozygosities ; and hardy - weinberg exact test p - values ( hwe p ) . this suite of 21 microsatellite loci are the first primers developed for a member of the new world ceratina , and the first set developed for the genus using a reference genome . no loci were found to be in linkage disequilibrium , nor did they diverge significantly from hardy - weinberg equilibrium following sequential bonferroni correction . observed and expected heterozygosities ranged from 0.08 to 0.82 ( mean 0.47 ) and 0.26 to 0.88 ( mean 0.56 ) , respectively ( table 1 ) . our results are thus very similar to those of other recent hymenopteran microsatellite development projects ( rabeling et al . 2014 ; chen et al . 2015 ; vickruck 2015 ) . these loci will be informative in exploring the population structure , patterns of parentage , and kinship dynamics in c. calcarata . as c. calcarata is closely related to four other native ceratina species ( rehan and sheffield 2011 ; shell and rehan 2016 ) , these loci may also cross - amplify ( as in ceratina flavipes , azuma et al . 2005 ; and halictus rubicundus ( christ ) , soro and paxton 2009 ) allowing for genus - wide research and conservation . additionally , these microsatellite loci can be powerful markers for understanding the evolution of social structure . microsatellite markers have been used to reveal variation in queen - worker dynamics by geography ( richards et al . 2005 ) , and deviations from expected worker kinship in a eusocial sweat bee ( lasioglossum malachurum ( kirby ) , soro et al . such markers have also been used to reveal mating structure in a communal bee ( andrena jacobi ( perkins ) , paxton et al . 1996 ) and polymorphism in reproductive strategy and sociality among populations of halictus scabiosae ( rossi ) ( ulrich et al . 2009 ) . as c.
calcarata is subsocial ( rehan and richards 2010 ) it likely represents an early stage in the evolution of eusociality ( rehan and toth 2015 ) . by employing even a subset of our 21 markers in a study of c. calcarata inter- and intracolony relatedness , we may be able to uncover similarly cryptic social dynamics in a bee putatively on the cusp of incipiently social reproductive behavior ( rehan et al . 2014 ) . protocols for the discovery and optimization of microsatellite loci are numerous and have evolved over decades of population genetics studies ( e.g. glenn and schable 2005 ; reviewed in zane et al . 2002 ) . to secure even one useful microsatellite was originally a laborious procedure with few guarantees : isolated loci were random , or limited to sites complimentary to specially designed probes ( ostrander et al . whole genome sequencing technologies have made great advancements in quality and accessibility of genetic resources over the past decade ( hudson 2008 ; ekblom and galindo 2011 ; vandijk et al . improved availability of such powerful resources has greatly expedited and improved the generation of microsatellite primers for many novel species ( e.g. copperhead snakes , castoe et al . the generation and analysis of whole genomes is still an expensive and bioinformatically exacting endeavor ( reviewed in lemmon and lemmon 2013 ) ; by contrast , microsatellite markers are affordable and adaptable tools , suited to a wide range of research . | the small carpenter bee , ceratina calcarata ( robertson ) , is a widespread native pollinator across eastern north america .
the behavioral ecology and nesting biology of c. calcarata has been relatively well - studied and the species is emerging as a model organism for both native pollinator and social evolution research . c. calcarata is subsocial :
reproductively mature females provide extended maternal care to their brood . as such
, studies of c. calcarata may also reveal patterns of relatedness and demography unique to primitively social hymenoptera . here , we present 21 microsatellite loci , isolated from the recently completed c. calcarata genome .
screening in 39 individuals across their distribution revealed that no loci were in linkage disequilibrium , nor did any deviate significantly from hardy - weinberg following sequential bonferroni correction .
allele count ranged from 2 to 14 , and observed and expected heterozygosities ranged from 0.08 to 0.82 ( mean 0.47 ) and 0.26 to 0.88 ( mean 0.56 ) , respectively .
these markers will enable studies of population - wide genetic structuring across c. calcarata s distribution .
such tools will also allow for exploration of between and within - colony relatedness in this subsocial native pollinator . |
hypoxia is suggested to play an important role in the pathogenesis of endocrine and metabolic dysregulation in obesity and the metabolic syndrome . we could previously demonstrate , based on an experimental human in vivo design established in our group , that 30 minutes of oxygen desaturation to 75% are sufficient to induce features of the metabolic syndrome such as glucose intolerance [ 2 , 3 ] and respective changes in sympathetic activation [ 2 , 3 ] , resting energy expenditure [ 2 , 3 ] , and vascular endothelial growth factor ( vegf ) levels , a hormone which has been assumed to play a role in the pathogenesis of the metabolic syndrome . another hormone centrally involved in body weight regulation and thereby the development of the metabolic syndrome is leptin . leptin is synthesized mainly , but not exclusively , by white adipose tissue sending a feedback signal to the brain about the amount of peripheral fat storages . recent literature indicates that circulating leptin concentrations are possibly increased by hypoxic conditions in humans , suggesting a link to the obstructive sleep apnea syndrome ( osas ) , a disease characterized by recurrent night apneic periods , which is strongly associated with obesity . indeed , as compared to healthy controls , osas patients show elevated leptin concentrations which return to normal after elimination of night apneas by continuous positive airway pressure ( cpap ) therapy . however , it remains unclear if high leptin levels in these patients are related to hypoxia , to hormonal interactions , or to the frequently increased body mass in osas . at high altitude ( 30004000 m ) , that is , under constant hypoxic conditions , increased [ 9 , 10 ] as well as decreased leptin concentrations have been reported in humans as compared to sea level . potential confounders of leptin secretion in this setting are physical strain , nutritional differences , or physical stress upon ascension . previous studies using cell cultures [ 1214 ] and animal models have provided a contradicting evidence for an impact of hypoxia on leptin concentrations . in order to clarify if hypoxia affects circulating leptin concentrations in humans , we experimentally induced a short hypoxic period as compared to normoxic condition in healthy normal weight participants according to our established study design which has been demonstrated to induce clinically relevant changes in energy and hormone metabolism [ 2 , 3 ] . oxygen saturation of 75% , as applied in our study , corresponds to a physiological state at approximately an altitude of 35004000 m. to control for common biases known to influence leptin metabolism , we performed our study at rest . moreover , our group has previously shown that the glucose metabolism is a main determinant of leptin secretion [ 16 , 17 ] . each subject , therefore , underwent an euglycemic glucose clamp procedure to ensure stable circulating glucose and insulin concentrations throughout the experiments to control for these influencing factors on plasma leptin levels . additionally , sympathetic activation as evaluated by circulating epinephrine and norepinephrine concentrations was monitored . exclusion criteria were overweight ( body mass index ( bmi ) > 25 kg / m ) , chronic or acute illness ( particularly respiratory diseases ) , alcohol or drug abuse , smoking , competitive sports , exceptional physical or mental stress , and current medication of any kind . each participant gave a written informed consent , and the study was approved by the local ethics committee . subjects participated in a hypoxic and a normoxic session separated by an interval of at least 4 weeks . on the days of experimental testing , subjects reported to the medical research unit at 11:00 h after an overnight fast of at least 12 hours . after 3 hours of clamping , hypoxia was induced for 30 minutes by decreasing oxygen saturation to 75% . on the normoxic control condition , we assessed the course of leptin concentrations at baseline and repeatedly 3 hours after induction of hypoxia according to leptin 's half life in normal weight men of about 3 hours by punctional determination . during induction of hypoxia and also during the normoxic control period , participants breathed at normobaric conditions through a tightly fitting face mask connected to a trajan 808 fresh gas supply ( draeger medical technology , luebeck , germany ) , using a valveless high - flow system between 14 and 17 l / min . inspired oxygen fraction ( fio2 ) was varied by adjusting oxygen and nitrogen . oxygen saturation was continuously measured by pulse oxymeter and was decreased to 75% within approximately 5 minutes . catecholamine levels were monitored at baseline and every 7.5 minutes during hypoxia ( versus control ) . all blood samples were immediately centrifuged and the supernatants stored at 24c until assay . leptin concentrations were measured by elisa ( diagnostic systems laboratories , sinsheim , germany ; interassay coefficient of variation ( cv ) 4.4% , intra - assay cv 3.8% ) . serum insulin was measured by radioimmunoassay ( pharmacia insulin ria 100 , pharmacia diagnostics , uppsala , sweden ; inter - assay coefficient of variation ( cv ) < 5.8% , intra - assay cv < 5.4% ) . blood glucose concentrations were monitored at 5-minute intervals throughout the experiment ( glucose analyser , beckman coulter , inc . high pressure liquid chromatography was applied to measure plasma epinephrine ( intra - assay cv < 2.9% ; inter - assay cv < 4.2% ) and norepinephrine levels ( intra - assay cv < 2.6% ; inter - assay cv < 3.9% , chromosystems , munich , germany ) . analyses of variance ( anova ) for repeated measurements , including the factors session ( time points of data collection ) were implemented and corrected according to the greenhouse - geisser procedure . the area under the curve ( auc ) was calculated from 6 hours leptin short - profiles to determine overall differences in leptin secretion between the two sessions . in addition , student 's paired t - tests were performed to compare hormone concentrations at single time points . upon induction of hypoxia , oxygen saturation decreased over a period of about 5 minutes and was held stable at a plateau of 74 2% . oxygen saturation ( corresponding to 3541 mmhg pao2 ) during the corresponding period under the normoxic condition remained at a mean level of 98 2% . determination of plasma glucose concentrations and serum insulin confirmed that respective blood levels remained constant after having reached the equilibrium and did not differ between hypoxic and normoxic conditions throughout the study ( figure 1 ) . also , as already published , norepinephrine concentrations did not differ significantly between the two sessions ( p = .3 ) whereas epinephrine levels were significantly higher under the hypoxic condition as compared with the control session ( p < .01 ) . the glucose infusion rates were significantly lower during the hypoxic as compared to the normoxic period . figure 2 shows the course of leptin concentrations during normoxic and hypoxic conditions under euglycemia . overall , leptin levels increased significantly during hypoxia ( p < .001 ) and normoxia ( p < .001 ) in the overall time course of 6 hours of measurements . there were no statistical differences in leptin levels between hypoxic and normoxic conditions as revealed by anova for repeated measurements for the session effect ( p = .269 ) and the interaction effect ( p = .638 ) . analyses of the aucs of leptin concentrations confirmed that there was no difference between the two conditions ( p = .180 ) . paired t - test comparison revealed that there were no differences between the groups at baseline ( p = .446 ) . similarly , after having reached the euglycemic equilibrium , plasma leptin concentrations showed no significant differences between conditions directly before the induction of hypoxia , during the hypoxic period , and during the 2.5 hours period after hypoxia in t - test comparison of single time points ( p = .137 for all ) . our results show that plasma leptin concentrations are not affected by acute hypoxia as compared to normoxic control in healthy subjects at rest . in contrast , previous studies showed an inverse correlation of serum leptin levels to altitude [ 11 , 19 , 20 ] , that is , when altitude increase serum leptin levels drop . however the effects of hypoxia on circulating leptin concentrations are contradicting as recently discussed in detail by sierra - johnson et al . [ the underlying cause why our results do not confirm previous data indicating an increasing effect of hypoxia on leptin levels deserves to be explained . norepinephrine and epinephrine have been shown to inhibit leptin secretion [ 2426 ] , whereas glucocorticoids , for example , dexamethasone , stimulate leptin secretion in humans [ 27 , 28 ] . so it may be speculated that in our study a potential increase in leptin concentrations upon hypoxia may be masked by suppressing effects of the risen epinephrine levels under this condition . this mechanism , however , can only remain speculation within the scope of an in vivo approach as applied here and requires some confirmation in further studies . our second finding was a significant increase in leptin concentrations in the course of the six hours of the experimental procedure . this is in line with the finding that circulating leptin concentrations display ultradian and circadian rhythmicity with a nadir about noon and the early afternoon , and peak levels during the night [ 29 , 30 ] . the increase in leptin concentrations starting prenoon and the following 6 hours as reported here may reflect this diurnal variation . moreover , the increased leptin concentrations may also be due to the standardized insulin infusion during the clamp [ 16 , 17 , 31 ] . since insulin has been shown to elevate leptin concentrations [ 17 , 32 ] , we intended to exclude this biasing factor by applying the hyperinsulinemic - euglycemic clamp technique which adjusts constant insulin concentrations during the experiments . notwithstanding , this method may have contributed to the overall rise in leptin levels even though in all conditions equally . one central question we intended to focus by our study was if alterations in leptin concentrations in osas patients could be assigned either to recurrent hypoxia or to the known high bmi which is a frequently found feature in this disease . generally , leptin is produced by white adipose tissue and downregulates food intake by inhibiting neuropeptide y synthesis and elevating alpha - melanocyte stimulating hormone synthesis in the hypothalamus , a feedback mechanism signalling increased peripheral fat reserves to cerebral appetite centers . indeed , it has been shown that serum leptin levels are positively correlated with the bmi [ 33 , 34 ] . remarkably , some studies could demonstrate that osas patients , however , display higher leptin levels than bmi - matched obese and normal weight subjects [ 34 , 35 ] . since leptin is a physiological feedback signal to reduce appetite and thereby should prevent the development of obesity , the occurrence of overweight and elevated circulating leptin concentrations , as seen in osas patients , deserves an explanation . one possible explanation is a congenital leptin deficiency , although this is a rarely seen defect . the second avowal could be a relative leptin resistance , due to the fact that leptin seems to downregulate its own receptors , so high leptin levels could possibly reduce the number of leptin receptors and generate a relative leptin resistance which in turn causes obesity . on the other hand , it was demonstrated that the apnea - hypopnea index ( ahi ) correlates positively with serum leptin concentrations in patients with osas but not in the bmi - matched control group and there was a significant decrease of serum leptin levels in osas patients upon treatment with cpap therapy over six months despite of stable bmi values [ 34 , 38 ] . therefore , we can speculate that recurrent oxygen desaturations in osas patients may play a major role in the regulation of leptin concentrations disregarding the influence of obesity . notwithstanding , our data do not confirm the hypothesis that elevated leptin concentrations in osas patients are caused by hypoxia either . this negative result , however , may be based on our study protocol which fundamentally differs from the approach of other investigations . this hypoxic pattern differs from previous studies according to length , frequency , and degree of oxygen desaturation [ 8 , 9 , 11 , 12 ] . zaccaria et al . , for example , studied male subjects at high altitude with an observation period of 20 days . therefore , it remains to be carefully considered to what extent our findings can be assigned to the hypoxic conditions as present in osas where severe hypoxic periods , displaying distinctly lower oxygen saturation values than 75% , can be observed . so eventually our negative findings may simply reflect an insufficient duration and the extent of hypoxia to affect leptin secretion . notwithstanding , our study design has been established to induce clinically relevant changes in other features of the metabolic syndrome [ 2 , 3 ] and is therefore an adequate approach to gain first insight into the effects of acute hypoxia in this context in humans . in addition , this is the first study investigating the effects of acute hypoxia on leptin concentrations controlling for fundamental influencing factors in healthy men . according to our data , plasma leptin levels seem to be unaffected by short hypoxic episodes of moderate degree . future studies are desirable to further clarify the relationship between hypoxia and leptin regulation in physiological and pathophysiological states . | leptin is involved in the endocrine control of energy expenditure and body weight regulation .
previous studies emphasize a relationship between hypoxic states and leptin concentrations .
the aim of this study was to investigate the effects of acute hypoxia on leptin concentrations in healthy subjects .
we examined 14 healthy men .
hypoxic conditions were induced by decreasing oxygen saturation to 75% for 30 minutes .
plasma leptin concentrations were determined at baseline , after 3 hours of euglycemic clamping , during hypoxia , and repeatedly the following 2.5 hours thereafter .
our results show an increase of plasma leptin concentrations in the course of 6 hours of hyperinsulinemic - euglycemic clamping which may reflect diurnal rhythmicity .
notwithstanding , there was no difference between levels of leptin in the hypoxic and the normoxic condition ( p = .2 ) . since we did not find any significant changes in leptin responses upon hypoxia
, plasma leptin levels do not seem to be affected by short hypoxic episodes of moderate degree . |
the prostate cancer is the most common malignant disease of men in western countries ( 1 ) . its incidence is continuously increasing korea and its age - standardized incidence rates per 100,000 men was 4.6 cases , which was the 8th - highest cause among the organ - specific malignant tumors in 2007 ( 2 ) . many pre - treatment prognostic factors have been proposed to be used to determine one of the treatment modalities and the gleason system was proved to be one of the most important prognostic factors . histological variation within each tumor brought two grades , the predominant , or primary grade and the less extensive , or secondary grade ( 3 ) . biopsy - derived gleason score ( bgs ) is used as one of the most important pretreatment prognostic factors ( 4 , 5 ) . though the overall accuracy of gleason grade on needle biopsies was found to be good in predicting prostatectomy specimen grade , upgrading and downgrading , large difference ( 2 points ) between biopsy - derived and post - prostatectomy gleason scores ( pgs ) may confuse the clinicians in consulting the patients . at 14 medical centers in korea , the medical records of 1,582 men who underwent radical prostatectomy for prostate cancer between 1995 and 2007 were reviewed retrospectively . prostate biopsy was recommended to the patients who had abnormal finding in digital rectal examination or whose serum prostate specific antigen ( psa ) level was above 3.0 or 4.0 ng / ml according to the policy for prostate biopsy of each medical center . all the pathologic slides of 18-gauge needle biopsy and the surgical prostate specimen from the involved medical centers were reevaluated by single expert uropathologist . according to the 2005 international society of urological pathology ( isup ) consensus on gleason grading of prostatic carcinoma ( 8) , bgs was defined as summation of primary gs and highest grade gs of all biopsy cores ; and pgs was defined as summation of primary and secondary gs in the prostate specimen . tumor volume was measured in the whole mount section of the resected prostate by the pathologist . the patients who took neoadjuvant therapy including androgen deprivation or radiation therapy and the patients whose pathological slides showed too poor quality to reevaluate were excluded . biochemical failure was defined as serum psa elevation above 0.2 ng / ml from nadir after radical prostatectomy . time to biochemical failure was measured by the time interval from radical prostatectomy to biochemical failure . needle biopsy specimen was taken from 6 ( 10.9% ) , 8 ( 8.4% ) , 10 ( 14.8% ) and 12 cores ( 65.8% ) and additional cores of suspicious nodules . clinical stage was classified into ct1 , ct2 , and ct3 based on digital rectal examination and mri findings . operation procedure was included 1,036 radical retropubic prostatectomies ( 71.6% ) , 220 radical perineal prostatectomies ( 15.2% ) , 125 laparoscopic radical prostatectomies ( 8.6% ) and 65 robot - assisted radical prostatectomies ( 4.5% ) . mean age was 64.9 ( 38 - 85 ) yr old and preoperative spsa was 11.8 ng / ml . the distribution of bgs was 46.7% , 39.5% and 13.8% in gs 6 , 7 , and 8 , respectively ( table 1 ) . according to the difference between bgs and pgs , the patients were divided into three groups : group a ( decreased in pgs by 2 or more ) , group b as a control group ( changed in pgs within 1 point ) , and group c ( increased in pgs by 2 or more ) . we evaluated various clinicopathological factors of prostate cancer , including age , preoperative spsa , the number of biopsy cores , the highest cancer % in biopsy cores , clinical and pathological stage , volume % and distribution of cancer cells in surgical specimen , and surgical margin status , univariately and multivariately . anova and chi - square test was used for analysis of the variables in three groups . scheffe 's method and dunnett 's c method were used for post - hoc test for identifying the groups which made difference . kaplan - meier method and log rank test and cox - regression hazard model this study was reviewed and approved by the institutional review board of the samsung medical center ( no . this study was reviewed and approved by the institutional review board of the samsung medical center ( no . each group included 30 ( 2.1% ) , 1,361 ( 94.1% ) and 55 ( 3.8% ) patients . group a included bgs 7 , 9 and 10 by 26.7% , 70.0% , and 3.3% , respectively , and group c , bgs 4 , 5 , 6 , 7 , and 8 by 5.5% , 7.3% , 21.8% , 63.6% , and 1.8% ( table 1 ) . in the comparison of the clinicopathological factors of the three groups , the number of biopsy cores , maximal cancer % in positive cores , clinical and pathological stage , cancer volume % , and surgical margin status were significantly different ( table 2 ) . in group a and c , maximal % of tumor in biopsy cores ( p < 0.001 and p = 0.032 , respectively ) and margin positivity ( p = 0.025 and p = 0.002 , respectively ) were higher than the control group b and pathological t stage was also worse in the group a and c than the control group b ( p = 0.006 and p < 0.001 , respectively ) . in group c , the number of biopsy core was significantly lower but tumor volume % in the pathology specimen was significantly higher and tumor was more widely distributed in the prostate specimen than the control group b ( p = 0.001 ) , which were different aspects from group a ( table 3 ) . of the patients in group a , 73.3% diagnosed as prostate cancer of bgs 9 or 10 and their pgs fell into pgs 7 or 8 . though pgs of 8 patients ( 26.7% ) who was diagnosed as bgs 7 was decreased to 5 , the pathological stage of 7 of them were pt2c or higher . hazard ratio ( hr ) for biochemical failure was significantly higher in both groups ( group a , hr 2.385 , 95% ci [ 1.222 - 4.656 ] p = 0.011 ; group c , hr 1.750 , 95% ci [ 1.147 - 2.672 ] , p = 0.009 ) ( fig . the median time to biochemical failure in group a and c were 46.0 and 62.6 months respectively but that of the control group did not reach median value within follow - up period . in multivariate analysis , however , this difference of bgs and pgs was not an independent prognostic factor of biochemical recurrence . well - known prognostic factors of prostate cancer such as pgs ( p = 0.045 ) , pt stage ( p < 0.001 ) , surgical margin ( p = 0.004 ) were significant in multivariate analysis ( table 4 ) . it has been noted that there is 20%-40% of discrepancy between bgs and pgs in the pathology of prostate cancer ( 6 , 7 , 9 ) . interestingly , in the univariate analysis , the result of current study demonstrated that the patients with this large difference between gs of pre- and post - prostatectomy showed worse clinicopathological findings and worse prognosis in biochemical failure than the control group irrespective of increase or decrease of the pgs compared with bgs . a similar study to this , in which the patients were classified into three groups , namely , upgraded , downgraded , and unchanged , proposed that gs upgrading was associated with adverse pathological outcome compared with downgraded and unchanged groups , which included higher rates of extraprostatic extension , lymph node metastasis , positive surgical margins , and seminal vesicle invasion ( 7 ) . of the patients who showed two or more points some of them were diagnosed as pgs 5 , however , pathological stage of most of them was pt2c or higher . one of the reasons of this discrepancy between bgs and pgs may be sampling error in biopsy of heterogenic and multicentric prostate cancer ( 10 ) . prostate cancer which showed uniform pattern histology was reported only 12%-33% in several studies ( 11 ) . needle biopsy specimen could be obtained mainly in high grade of tertiary component , which would be ignored in prostatectomy specimen . if the biopsy specimen contained small amount of high grade prostate cancer , the pathologists would be tend to diagnose needle biopsy specimen as more aggressive cancer . in a study , analyzing 101 completely sectioned whole - mounted radical prostatectomy samples , the average number of different grades was 2.7 ( range 1 - 5 ) ( 12 ) . in an extended study with 155 tumors from 61 whole - mounted radical prostatectomy samples , 15% of tumors included three or more histological grades ( 13 ) . a recent meta - analysis revealed that the presence of tertiary grade correlated with pathological stage , psa recurrence and clinical progression ( 14 ) . in several studies , samples characterized with pathological variables of poor outcome , such as extraprostatic extension and positive surgical margins contained a high grade tertiary component with consistently higher frequency ( 15 , 16 ) . therefore bgs of the patients in group a rather than pgs may reflect prognosis and should be considered as one of the important prognostic factors together with pathological stage . the patients who showed two or more points increase in pgs from bgs also demonstrated aggressive tumor burden and poor prognosis in biochemical failure . in these patients , a recent study of 301 patients with low - risk prostate cancer ( clinical stage t1c - t2a , psa 10 ng / ml , and bgs 6 ) who underwent an extended ( 10-core ) prostate needle biopsy , in men assessed with 10 - 12 cores , the rate of gs upgrading was 47.9% , which was significantly higher than 23.5% in 18 cores ( 17 ) . in another study , the authors proposed that prostate size and number of sampling was associated with gleason upgrading ( 18 ) . the mean prostate volume of the patients in group c was smaller than that of control group . on the other hand , tumor volume in whole - mount prostate was bigger . thus insufficient number of prostate sampling , especially in small prostate containing aggressive cancer might cause gleason upgrading . however , multivariate analysis showed clinical significance not in the difference of bgs and pgs but in well - known prognostic factors of prostate cancer such as spsa , bgs or pgs itself , pt stage and surgical margin . in the clinical settings , even if both of the clinicians and the patients would be confused with the somewhat large discrepancy in bgs and pgs , it can be ignored compared with other well - known prognostic clinicopathological factors . however , the clinicians had better kept in mind that many of these patients who showed large discrepancy in bgs and pgs might have other unfavorable clinicopathological factors of prostate cancer . bias related with interobserver variation in the pathologic result of gleason score or gleason sum would be one of major limitation of this kind of study . a considerable interobserver variation in the gleason scores of prostate cancer referred to several studies has been reported ( 19 , 20 ) . in addition , we did not review the tertiary component of prostate cancer specimen in group a , and survival analysis was not included due to the short follow - up period . practically , the large gleason score gap of 2 or more points in bgs and pgs rarely occurs . in the current study , the total number of reviewed patients was 1,582 , however , the number of focused patients was very small , which can be addressed as another limit point . in summary , clinical significance of a large difference ( 2 points ) between biopsy and post - prostatectomy pathological gleason scores in patients with prostate cancer changhee yoo , cheol young oh , jin seon cho , cheryn song , seong il seo , hanjong ahn , tae - kon hwang , jun cheon , kang hyun lee , tae gyun kwon , tae young jung , moon kee chung , sang eun lee , hyun moo lee , eun sik lee , young deuk choi , byung ha chung , hyung jin kim , wun - jae kim , seok - soo byun , and han yong choi large difference ( 2 points ) between biopsy - derived ( bgs ) and post - prostatectomy gleason scores ( pgs ) may confuse the clinicians in consulting the patients with prostate cancer . in the present study , we compared the prognosis of patients with the difference between pgs and bgs . when the pgs was changed from bgs by 2 points or above , such patients showed poor prognosis . strikingly , even in the decreased group ( pgs < bgs ) showed poor prognosis . however the large difference between bgs and pgs was not an independent prognostic factor , and one should be cautious in the interpretation of the scoring values . | we investigated the clinical significance of large difference ( 2 points ) between biopsy - derived ( bgs ) and post - prostatectomy gleason scores ( pgs ) .
at 14 medical centers in korea , 1,582 men who underwent radical prostatectomy for prostate cancer were included . according to the difference between bgs and pgs ,
the patients were divided into three groups : a ( decreased in pgs 2 , n = 30 ) , b ( changed in pgs 1 , n = 1,361 ; control group ) , and c ( increased in pgs 2 , n = 55 ) .
we evaluated various clinicopathological factors of prostate cancer and hazards for biochemical failure .
group a showed significantly higher mean maximal percentage of cancer in the positive cores ( max% ) and pathological t stage than control . in group c ,
the number of biopsy core was significantly smaller , however , tumor volume and max% were significantly higher and more positive biopsy cores were presented than control .
worse pathological stage and more margin - positive were observed in group a and c than in control .
hazard ratio for biochemical failure was also higher in group a and c ( p = 0.001 ) .
however , the groups were not independent factors in multivariate analysis . in conclusion ,
large difference between bgs and pgs shows poor prognosis even in the decreased group .
however it is not an independent prognostic factor for biochemical failure . |
we have previously found that multistep renal carcinogenesis occurs in eker rats8 and reported that erc , a rat renal carcinoma gene , is highly expressed in renal cancer.9 rat erc is a homolog of the human mesothelin gene10 , 11 that is localized to chromosome 16p13.3.12 mesothelin is expressed in normal mesothelial cells , mesotheliomas , nonmucinous ovarian carcinomas , and pancreatic ductal adenocarcinomas . although the human mesothelin gene encodes several proteins , its primary product is a 71kda precursor protein that is cleaved physiologically by a furinlike protease into a 40kda cterminal fragment that remains membrane bound and a 31kda nterminal fragment that is secreted into the blood.13 the resultant cterminal 40kda fragment is classified as a mesothelin , and its presence in the serum has been reported to be a useful tumor marker in patients with mesothelioma . we have since developed 22a31 , a cerc / mesothelinspecific mouse mab directed against tumors derived from the human mesothelioma cell line accmeso4 . to characterize this antibody , we carried out both in vitro and in vivo cell proliferation assays . interestingly , the antibody did not inhibit the proliferation of the accmeso4 cell line in vitro , but it dramatically inhibited cell linederived tumor growth in vivo.14 thus , the cerc / mesothelinspecific mouse mab 22a31 may be a potentially useful new tool for treating cerc / mesothelinexpressing cancers , including mesothelioma . in contrast , the secreted nterminal 31kda fragment , which has been cloned as a megakaryocytepotentiating factor , has not been reported to be a useful serum marker for mesothelioma . therefore , we developed an original sandwich elisa system using specific antibodies raised against the 31kda nterminal fragment of erc , nerc / mesothelin . to test this elisa system , we planned a 5year , largescale research screening program in collaboration with the tokyo doken national health insurance association ( tokyo , japan ) , which had worked in japan from 2007 to 2012 at construction sites with a risk of asbestos exposure . as of 2007 , approximately 220 000 blood samples were collected , and nerc / mesothelin levels were determined using the elisa kit . together with the participant 's medical history and related data , elisa analysis identified approximately 60 highrisk individuals from among 30 000 participants . based on the screening , we identified three participants with mesothelioma and 60 participants who were at high risk but had yet to develop mesothelioma . from these results , we predicted that nerc / mesothelin is a blood tumor marker that may be useful for largescale population screening and the early diagnosis of mesothelioma following mass examination.15 moreover , to more precisely measure nerc / mesothelin , we have developed a new 720 elisa system . this system is clinically useful for the precise diagnosis of pleural mesothelioma.16 over the next 4 years , we plan to carry out annual followup on all the participants in the highrisk population and to prospectively assess how many participants ultimately develop mesothelioma , while continuing to screen for any early signs of mesothelioma.17 the results from another study showed that members of a highrisk population who failed to undergo annual nerc / mesothelin screening were diagnosed with mesothelioma in the following year . therefore , we strongly recommended that participants who are identified as being at high risk for developing mesothelioma receive an additional health checkup and nerc / mesothelin test at least annually , even if they have no clinical symptoms . in addition , a new potential marker for mesothelioma was recently reported . in that study , a rat model of peritoneal mesothelioma transcriptome analysis of the rats with epithelioid and sarcomatoid types of mesothelioma defined connective tissue growth factor as a marker for malignant mesothelioma.18 in parallel , our research group has continued to seek a specific clinical marker for sarcomatoid , a rare form of mesothelioma with a particularly poor prognosis , and has already identified several specific markers for this tumor type . although additional research is needed , the results of our recent study and other published reports indicate the future direction for establishing new markers for the diagnosis and treatment of mesothelioma . asian countries , such as thailand , have experienced successful economic development in recent decades . with these advances , large populations have gradually begun to face many of the difficulties that large economies around the world have also faced in the past , such as air pollution and environmental issues . we now have to address these difficulties to protect our people 's lives and living environments . , the proportion of all illnesses represented by cancer has been increasing recently . a significant portion of this increase is assumed to be the result of environmental changes , such as urbanization and air pollution . it is an aggressiveand and a malignant tumor that is chiefly attributed to asbestos exposure . in several asian countries , including japan , rapid economic growth has brought many changes , but asbestos is still widely used . we previously reported that nerc / mesothelin might be a useful blood tumor marker for mesothelioma.6 , 19 , 20 furthermore , we developed and tested a unique diagnosis system in the largescale screening of construction workers in japan . we have also predicted that the incidence of mesothelioma will continue to increase in asia in the near future . we intend to share this diagnosis system and all knowledge gained pertaining to mesothelioma and to continue to establish early diagnosis and treatment systems . finally , our group will work to organize international seminars on environmental carcinogenesis once a year and an education program on the skills required for mesothelioma diagnosis . environmental carcinogenesis causes not only an asbestosrelated mesothelioma but also lung cancer resulting from air pollutants . throughout life , we are exposed to many environmental pollutants , and the environmental conditions of our surroundings vary between individuals . thus , epidemiology research is also needed to help solve the issue of environmental carcinogenesis in asia . through asian epidemiology research and advanced baseline studies in japan in 1775 , the british surgeon percival pott reported that the incidence of scrotal cancer was increasing among chimney sweeps and predicted that the cancer was caused by chimney soot . the industrialization that followed the industrial revolution in the latter half of the 18th century marked the largescale introduction of environmental pollutants . regarding asbestos , our preventative measures and practical responses are decades behind , despite the fact that there has been ample pathological and epidemiological evidence establishing the risks with exposure . future carcinogen research must include risk evaluation along with risk management and establish a good communication system for the people who have a relationship with the patient . in reality , almost everyone who has lived in an industrialized area has asbestos fibers in their lungs , and many can recall a specific incidence of incidental exposure ( e.g. , school teachers and students who handled asbestos samples , mats , or blankets and people in many other life situations ) . asbestos fibers are long and thin and can penetrate the lung , repeatedly scratching the mesothelium surface and causing prolonged cycles of damage , repair , and local inflammation . the length of exposure and the amount of asbestos are positively associated with the risk of mesothelioma . our recent largescale research study that screened for mesothelioma in japan was effective for early diagnosis . to confirm this screening method , we have begun an international largescale research screening program in japan and other asian countries . since we established the international environmental carcinogenesis research center last year at juntendo university ( tokyo , japan ) , japanese researchers have provided technical guidance on the use of this screening method as well as education on mesothelioma to asian doctors and researchers . in the near future , we will confirm that this method is effective in another country and gather reliable evidence for blood diagnosis of mesothelioma . from this center , we have established early diagnosis and treatment systems not only for mesothelioma but also for other diseases resulting from environmental carcinogenesis . moreover , the people living in asian countries , including japan , will understand and care about the risks of environmental carcinogenesis . dr . hino opened the asbestos mesothelioma clinic in 2005 at juntendo university and since then has continuously taken care of patients with mesothelioma and people who fear asbestos exposure . thus , we should establish holistic methods of caring for mesothelioma , including diagnosis , treatment , and endoflife counseling . | asbestos is an environmental carcinogen , and asbestosrelated diseases represent a globalscale environmental issue .
mesothelioma is an aggressive , malignant tumor that initially progresses along the surfaces of the pleura and peritoneum that is chiefly attributed to asbestos exposure .
xrays are commonly used for tumor screening in populations at risk for developing this cancer .
we previously reported that the nterminal of mesothelin may be a useful blood marker for early diagnosis method for mesothelioma and since then developed an nterminal of mesothelin elisa kit in collaboration with ibl co. , ltd . and confirmed its utility as a diagnostic system for mesothelioma .
recently , we performed a largescale research screening for mesothelioma and showed that it is a good model for early diagnosis in atrisk populations .
the year 2015 is the 100th anniversary of yamagiwa 's great work on coaltarinduced carcinogenesis by formative stimulation in 1915 and the 10th year since 2005 , kubota shock , people recognized that asbestos induces mesothelioma .
we dedicate this review to this memorial year for environmental carcinogenesis . |
heterotopic gastric mucosa ( hgm ) of the esophagus was first defined in 1805 by schmit during a postmortem examination . hgm of the esophagus is mostly localized in the upper esophagus and termed inlet patch . it usually can not be diagnosed easily . rarely , it can also be found in other parts of the esophagus . hgm is reported in up to 10% of the general population among numerous reports and epidemiologic studies which have been essentially performed in adult population . there are case reports showing that this injury may play a role in the development of stenosis , ulcer , perforation , or esophagotracheal fistula related to its capability of hydrochloric acid secretion . malignant progression of hgm occurs in a stepwise pattern , following the metaplasia dysplasia adenocarcinoma sequence . we present a case of esophageal gastric heterotopia that was located in the distal esophagus and needed differentiation from barrett 's esophagus . a caucasian teenage girl , 16 years old , followed up for the last 3 years , was initially admitted in the v - th pediatric gastroenterology clinic of st mary children 's emergency hospital , iasi , romania , for postprandial epigastric pain . over the 3 years , her physical examination revealed good generally status , abdominal pain localized in the left hypochondrium and/or in epigastrium , without any other pathological elements at examination . the upper gastrointestinal endoscopy revealed the presence of multiple pseudo - polypoid formations with slightly eroded tip , measuring approximately 0.5 cm , in the lower 1/3 of esophagus ( fig . 1a , b ) ; stomach with hypertrophic folds , with nodular purpuric congestion and erosions covered with hematic deposit in the antral region , sero - mucous fluid stasis of bile ( fig . 2 ) , duodenum with diffuse congestion without ulceration , friable mucosa . ( a ) gastric heterotopia in the distal part of esophagus ; ( b ) gastric heterotopia in the distal part of esophagus . histopathologic examination of the biopsy samples taken from the pseudo - polypoid formations showed acid - secreting , oxyntic - type , glandular , gastric epithelium , attached to the esophageal epithelium , without intestinal metaplasia or dysplasia . our histopathologic examination did not show intestinal metaplasia or goblet cells ( alcian blue stain ) , which are important for the diagnosis of barrett 's esophagus . five biopsy samples were taken , 3 from inlet patches which revealed gastric epithelium and 2 down ( distal ) from these injuries where squamous epithelium was found . histopathologic examination ( histopathologic examination [ he ] 100 ) : a gastric epithelium attached to the esophageal epithelium . the mucosa of rectum , sigmoid and descending colon appeared normal , without evidence of diverticulosis or polyps . the process is starting from the middle third of the esophagus and extending proximally and distally . the last esophageal segment reepithelialized is the most proximal . the persisting columnar cells at birth are usually proximally over the upper third of the esophagus or , much less frequently , distally over the esophagogastric junction . the preferential localization of hgm in the cervical esophagus is explained by the temporal difference in the stratified reepithelialization of both ends of the esophagus . it is generally accepted that barrett 's esophagus is an acquired metaplastic change because of chronic gastroesophageal reflux . another proposed theory on the development of hgm involves metaplastic transformation of the squamous lining to columnar from chronic acid injury as seen in barrett 's esophagus . these are based on similarities in the mucin and staining characteristics with ck7 and ck20 between barrett 's esophagus and hgm . it is postulated that chronic acid exposure results in inflammation that leads to reactivation or proliferation of remnant columnar mucosa . these remnants of columnar mucosa are present as microscopic foci in the esophageal lining or are covered by squamous mucosa . with chronic irritations , these foci develop into larger patch resulting in the formation of island of columnar mucosa , hgm . it was also proposed that the origins of hgm may be different , congenital in children and acquired in adult . the embryogenesis of esophagus can explain the profiles of hgm , proximal location or the distal part of the esophagus . the children do not have sufficient duration of acid exposure to induce changes suggested by the acquired theory . the origin of esophageal hgm has not been finally determined as yet , and further investigations are needed to resolve these questions . but from current available evidence , it seems more likely that hgm is congenital in origin . most inlet patches are solitary and extend longitudinally . in the patients with multiple patches , they tend to be small . in our case , we have described them as multiple pseudo - polypoid formations with slightly eroded tip . the underlying factor of the symptoms , clinical findings , and complications is the secretion of acid . only in 10% of cases they do produce clinical symptoms , such as chest and throat pain , dysphagia , globus sensation , shortness of breath , chronic cough and hoarseness . in our case , the hgm was grade i according to the proposed clinicopathologic classification ( table 1 ) . clinicopathologic classification of esophageal hgm ectopic gastric mucosa can occur anywhere along the gastrointestinal tract . barrett 's esophagus is characterized histologically by an admixture of 3 columnar epithelia : cardiac , oxyntocardiac , and intestinal metaplasia . histologically , hgm consists of oxyntic mucosa with mucus - secreting columnar cells , chief cells , and parietal cells . barrett 's esophagus is widely considered to be a consequence of longstanding acid induced injury commencing as an erosive esophagitis and progressing over years to columnar and intestinal metaplasia of the squamous epithelium . in our case , our histopathologic examination revealed just a discrete inflammatory infiltrate , without intestinal metaplasia or dysplasia . in barrett 's esophagus , columnar epithelium extends from the stomach up to the gastroesophageal junction into the esophagus . columnar epithelium was not the continuation of gastric mucosa ; it was clearly separated from the stomach by squamous epithelium . there were multiple pseudo - polypoid formations , which can indicate that all lesions are congenital and not reflux related as in barrett 's esophagus . furthermore , over the last 3 years as we have followed up the patient , the injuries have remained the same in number and pathology . based on studies from the literature , we reevaluated the findings in our patient as gastric heterotopia and not barrett 's esophagus . a strong affinity of h. pylori to colonize gastric type mucosa has been demonstrated . in our case , this type of gastric heterotopia can cause reflux - like symptoms , which resolved very well with proton pump inhibitor treatment . overexpression of cox-2 has numerous effects on cells : increased cell proliferation , decreased apoptosis rate , stimulation of angiogenesis , and increased invasive and metastatic potential . in contrast to barrett 's esophagus , gastric heterotopia has not been accepted as a premalignant lesion . cox-2 is overexpressed in barrett 's esophagus and is involved in the sequence of events that lead to malignant transformation . we are following the evolution by endoscopy every 6 months and multiple esophageal biopsies once a year in order to monitor any change in hgms . we are presenting a case with multiple pseudo - polypoid formations of gastric heterotopia that are located in the distal part of the esophagus . endoscopy combined with histopathologic and microbiological analysis of biopsies is definitely a mandatory method in clinical evaluation of metaplastic and nonmetaplastic changes within hgm of the esophagus . when , during superior digestive endoscopy , columnar - lined esophagus is observed in the distal esophagus , not being in continuity with gastric mucosa , the diagnosis of hgm must be thought and confirmed histologically by the presence of pure oxyntic mucosa . | abstractheterotopic gastric mucosa ( hgm ) of the esophagus is a congenital anomaly consisting of ectopic gastric mucosa .
it may be connected with disorders of the upper gastrointestinal tract , exacerbated by helicobacter pylori .
the diagnosis of hgm is confirmed via endoscopy with biopsy .
histopathology provides the definitive diagnosis by demonstrating gastric mucosa adjacent to normal esophageal mucosa .
hgm located in the distal esophagus needs differentiation from barrett 's esophagus .
barrett 's esophagus is a well - known premalignant injury for adenocarcinoma of the esophagus .
malignant progression of hgm occurs in a stepwise pattern , following the metaplasia dysplasia adenocarcinoma sequence.we present a rare case of a teenage girl with hgm located in the distal esophagus , associated with chronic gastritis and biliary duodenogastric reflux .
endoscopy combined with biopsies is a mandatory method in clinical evaluation of metaplastic and nonmetaplastic changes within hgm of the esophagus . |
gardner 's syndrome ( gs ) is an autosomal dominant disorder localized to a small region on the long arm of chromosome 5 ( 5q21 - 22).1,2,3 menzel first described adenomatosis of the colon in 1721 , and in 1863 , cripps discovered the heredity of colon polyposis and termed it familial adenomatosis.4 devic and bussy in 1912 described a triad of intestinal polyps , soft tissue tumors , and multiple osteomas of the skull.5 in 1943 fitzgerald described a case of intraosseous osteomas , abdominal desmoids , and multiple colon polyposis and defined the oral and facial aspects of the disease.6,7 in the early 1950s , the syndrome was defined by gardner . in 1962 , he also discovered the dental abnormalities and skeletal alterations of these patients.8 oral and facial anomalies are commonly observed in patients affected with this disease complex , and intestinal polyps predominantly cause malignancy . dentists should be aware that oral and facial anomalies may play an important role in the early diagnosis of gs . this article presents a case of gs and briefly reviews the oral and maxillofacial considerations of this disease . a 21-year - old patient was referred to the department of oral surgery at istanbul university , istanbul , turkey , for the management of craniofacial manifestations of gs . the patient came to our attention due to a primarily esthetic complaint about the right angle of the mandible . an initial clinical examination showed a nodular formation that was palpable along the mesial portion of the right mandibular angle ( figure 1 ) . a panoramic radiograph and an anteroposterior radiography showed the presence of multiple round radiopaque lesions in both the maxilla and mandible , multiple impacted teeth ( upper right first , second premolar , upper right third molar , upper left canine , upper left first and second premolar , upper third molar , lower left canine , first and second premolar , and lower right canine , first and second premolar ) , and multiple odontomas , each measuring approximately 0.5 to 2 cm in diameter ( figure 2 ) . on palpation , these lesions were hard , well limited , and non - adherent to the skin . no deviation of the mandible was observed , and no pain on mouth opening was evident . dental volumetric tomographic ( dvt ) images showed multiple osteomas of the buccal cortex of the right mandibular angle and left mandibular angle ( figure 3,4 ) . additionally , in the coronal and sagittal sections of the mandible condyle , a huge osteoma that limited mouth opening was diagnosed ( figure 5 ) . cephalometrically , he showed a slightly retrusive maxilla with an anb angle of 1and a relatively normal mandibula in anterioposterior direction . his mandibular plane angle ( s - n / go - me : 25 ) and articular angle ( s - ar - go : 133 ) were reduced ( table 1 ) . according to the steiner 's s line his lips were in normal position ( figure 6 ) . histopathologic examination revealed that the specimens displayed a normal - appearing dense compact lamellar bone with minimal marrow spaces and rare irregular haversian canals that did not show osteoclasts or osteoblasts ( h&e x100)(figure 7 ) . due to the dental anomalies , the osteomas in the mandible and the familial history of the patient , a 21-year - old patient was referred to the department of oral surgery at istanbul university , istanbul , turkey , for the management of craniofacial manifestations of gs . the patient came to our attention due to a primarily esthetic complaint about the right angle of the mandible . an initial clinical examination showed a nodular formation that was palpable along the mesial portion of the right mandibular angle ( figure 1 ) . a panoramic radiograph and an anteroposterior radiography showed the presence of multiple round radiopaque lesions in both the maxilla and mandible , multiple impacted teeth ( upper right first , second premolar , upper right third molar , upper left canine , upper left first and second premolar , upper third molar , lower left canine , first and second premolar , and lower right canine , first and second premolar ) , and multiple odontomas , each measuring approximately 0.5 to 2 cm in diameter ( figure 2 ) . on palpation , these lesions were hard , well limited , and non - adherent to the skin . no deviation of the mandible was observed , and no pain on mouth opening was evident . dental volumetric tomographic ( dvt ) images showed multiple osteomas of the buccal cortex of the right mandibular angle and left mandibular angle ( figure 3,4 ) . additionally , in the coronal and sagittal sections of the mandible condyle , a huge osteoma that limited mouth opening was diagnosed ( figure 5 ) . cephalometrically , he showed a slightly retrusive maxilla with an anb angle of 1and a relatively normal mandibula in anterioposterior direction . his mandibular plane angle ( s - n / go - me : 25 ) and articular angle ( s - ar - go : 133 ) were reduced ( table 1 ) . his profile was straight due to the slightly retruded maxilla position . according to the steiner 's s line histopathologic examination revealed that the specimens displayed a normal - appearing dense compact lamellar bone with minimal marrow spaces and rare irregular haversian canals that did not show osteoclasts or osteoblasts ( h&e x100)(figure 7 ) . due to the dental anomalies , the osteomas in the mandible and the familial history of the patient , the patient was diagnosed as gs . following resection of the osteomas that caused discomfort , gardner 's syndrome is inherited as an autosomal dominant disorder with an incidence ranging between 1 in 4,000 and 1 in 12,000 , depending on the region.5,9 gs is known to be caused by a gene mutation located at chromosome 5.10 the patient in this study displayed a familial history of the disease ; the mother and sister had both died due to gs . the intestinal polyps of the disease typically occur prior to puberty and become generalized in the 20 - 40-year age group . the polyps display the potential for malignant change.3,6 these multiple polyps can be observed at any location in the gastrointestinal tract , particularly in the distal colon , and must be completely removed due to the high rate of transformation to adenocarsinoma.6 gastric fundic polyps occur in 90% of affected individuals , but they are not malign lesions . they are premalignant lesions for periampullary carcinoma.2,6 an increased number of peptic ulcers have also been observed.8 soft - tissue lesions such as fibromas , neurofibromas , keloids , sebaceous cysts , leiomyomas , and lipomas are also observed.8 desmoid tumors are considered locally invasive , non - malignant , and non - encapsulated and may occur in the skin of the anterior abdominal wall or intra - abdominally . they display no malignant potential and have a slow growth pattern.2,3,6 these lesions occur in approximately 10% of patients and are three times more common in women.11 the majority of cutaneous lesions observed in gs present as multiple epidermoid cysts on the face , scalp , and extremities . they are benign lesions that occur at an early age , around puberty.3,6 other neoplasias such as papillary carcinoma , adrenal adenoma , adenocarcinoma , hepatocellular carcinoma , osteosarcoma , chondrosarcoma , osteochondroma , tiroid tumors , liver tumors , and less commonly , hypertrophy of the pigment layer of the retina have also been reported.12 dental abnormalities are present in 30 - 75% and osteomas in 68 - 82% of gs patients . the osteotomas are generally located in the paranasal sinuses and mandible , display slow growth , and vary from a slight thickening to a large mass.13 osteomas predominantly affect the mandible and maxilla5,12 but can additionally affect the skull and long bones . calvarium osteomas , maxillary osteomas , and hypercementosis also occur.14 osteomas are an essential component of gs , forming a slight thickening to a large mass that may affect all parts of the skeleton . the frontal bones are the most frequent osteoma site.6 exosteoses osteomas , also called peripheral osteomas , and enosteoses osteomas can be palpable , and enostoses may be detected by routine radiography.3,6 in the mandible , two types of osteomas occur : central or lobulated . centrally located osteomas are characteristically near the roots of the teeth , and lobulated types arise from the cortex and most commonly observed at the mandibular angle.6 we saw a huge lobulated osteoma at the right condyle and many central osteomas throught both maxilla and mandible . seventy percent of gs patients display dental anomalies such as impacted or unerupted teeth , congenitally missing teeth , supernumerary teeth , hypercementosis , dentigerous cysts , fused molar roots , long and tapered molar roots , hypodontia , compound odontomes , and multiple caries.3,5 difficulties in extraction due to ankylosis have also been reported.6 our patient presented several dental abnormalities including multiple impacted teeth in the mandible and maxilla and osteomas throughout the mandible , maxilla , and both condyle and coronoid processes . osteomas are predominantly detected by routine panoramic radiography.15 pain is rarely observed , and the disease is predominantly asymptomatic , but the lesions can cause facial asymmetry as a result of expansion.13 in addition to clinical palpation , dental panoramic radiography is an effective means of detecting multiple osteomas of the jaws that are characteristic of gs . radiologically , the lesions are radio - opaque . in our patient , radio - opacities on the angle of the mandible were observed , and several impacted teeth in all segments of the jaws were evident . increased difficulty of tooth extraction was present due to the high density of the alveolar bone , the limited mouth opening , and the loss of the periodontal space.our diagnosis was performed by ct radiographs to detect osteomas and dental anomalies . in conclusion this case demonstrated the characteristic oral and maxillofacial features of gs , but the patient displayed no signs of intestinal polyps or cutaneous lesions . we report this case due to the absence of intestinal polyps , a rare occurrence in gs patients . according to lew in contrast , the oral and maxillofacial manifestations of this syndrome appear many years prior to the intestinal lesions , meaning our patient may present intestinal polyps in the future . osteomas that limit mandibular movement or cause esthetic problems were removed , but the possibility of recurrence exists . in such situations , the maxillofacial surgeon must perform an early gs diagnosis . the patients should always be in contact with a gastroenterologist , an oncologist , and an oral surgeon | gardner 's syndrome is a variant of familial adenomatosis polyposis ( fap ) with a triad consisting of polyps of the colon , multiple osteomas and surface tumors of soft and hard tissue .
the intestinal polyps have a % 100 risk of undergoing malignant transformation , therefore early identification of this disease is very important .
there are several symptoms of gardner 's syndrome in the oral and maxillofacial surgery , which can be discovered during routine dental examination .
we report a case of a 25-year old male patient with gardner 's syndrome who has not any intestinal polyps but osteomas in the mandible and jaw deformalities . |
a 51-year - old , 55 kg , 155 cm tall female patient with halux valgus was admitted to undergo osteotomy and internal fixation . pre - operative serum electrolyte evaluation showed mild hypokalemia ( 3.3 mmol / l ) and electrocardiogram ( ecg ) showed sinus bradycardia and non - specific t wave change ( fig . for the treatment of hypertension , the patient did not take diuretics that can cause hypokalemia preoperatively . we explained to the patient spinal anesthesia before the operation and did not prescribe any premedication . in the operation room , the patient was monitored with non - invasive automated blood pressure , ecg with st segment analysis and pulse oximetry . her initial vital signs were as follow : blood pressure 150/90 mmhg , heart rate 60 per minute , respiratory rate 18 per minute , and peripheral oxygen saturation of 97% . to prevent perioperative hypotension , we infused ringer 's lactate solution ( 6 ml / kg ) for 15 minutes before spinal anesthesia . we approached between the l4/5 levels using a 25 g quinke needle via the midline approach in the lateral recumbent position . after dural puncture , 10.5 mg of 0.5% hyperbaric bupivacaine was injected slowly over 10 seconds . ten minutes after administering spinal anesthesia , sensory blockade was verified up to the t8 thoracic dermatome by the pinprick test . during surgery and anesthesia , there were no notable changes in vital sign and we neither supply oxygen nor sedatives . approximately 90 minutes into the operation , the patient suddenly complained of nausea , headache , tingling sensation around the mouth , paresthesia in both arms and stiffness in both hands . we started administering oxygen to the patient at 5 l / min via a nasal cannula and her vital signs , including blood pressure , oxygen saturation and respiratory rate were within the normal range , but she was bradycardic ( 48 per minutes ) . 2 ) . to determine the causes of the above symptoms and signs , we rechecked the anesthesia dermatome . the sensory blockade level slightly decreased to t10 but it was not considered as the main cause of her symptoms and signs . emergent arterial blood gas analysis ( abga ) by radial artery puncture was performed , which showed normal pao2 of 124 mmhg , but increased ph at 7.670 , decreased paco2 at 26 mmhg , and increased plasma hco3-concentration of 30.0 mmol / l . the patient was in a mixed state of severe respiratory alkalosis and mild metabolic acidosis . hvs was assumed the main cause of respiratory alkalosis secondary to excessive spontaneous breathing during surgery and spinal anesthesia , as evidenced by severe hypokalemia ( 2.1 mmol / l ) , ionized hypocalcema ( 0.72 mmol / l ) with somatic symptoms and signs of electrolyte imbalance . hyperventilation was controlled by closed mask ventilation with air / oxygen ( 1.5/1.5 l ) per minute for one minute . in order to correct electrolye imbalance , which was the main cause of hvs symptoms and signs , kcl 10 meq diluted in 50 ml normal saline solution was administered over 30 minutes , and 10% calcium gluconate in 10 ml was infused slowly over 5 minutes . after the patient 's hyperventilation subsided and at the time of completing intravenous electrolyte infusion , somatic symptoms , including perioral numbness , paresthesia of the both hands , fingers stiffness , nausea , and headache gradually improved . repeat abga after returning the patient to the recovery room showed ph 7.48 , paco2 48 mmhg and pao2 72 mmhg , which was considerded improved alkalosis , increased potassium concentration of 3.0 mmol / l , and slightly elevated ionized calcium of 0.96 mmol / l . second degree av block on ecg converted to sinus bradycardia and t wave inversion was also partially reversed . after discussing with the orthopedic surgeon and a cardiologist , the patient subsequently remained stable without symptoms and signs of hvs , and ecg on the ward ( fig . hvs is a syndrome induced by excessive hyperventilation during anxiety , fear , and stress situations , which causes hypocapnia and the associated systemic symptoms and signs . a wide range of hvs symptoms are known to exist , and the pattern of symptoms differ by patient . during and after hyperventilation , tingling sensation in the hand and numbness in the feet , sweating , and symptoms of the central nervous system can be manifested . anxiety and panic are thought to contribute to the cause of hvs but garssen et al . consider that the hyperventilation mechanism to be more complicated , because only some patients with panic disorder experience hvs . air hunger with rapid breathing due to anxiety can also be the main cause of psychological hvs . the list of respiratory and organic cause of hyperventilation includes asthma , chronic bronchitis , emphysema and chronic obstructive pulmonary disease ( copd ) and rarely , pulmonary embolism , encephalitis , brain tumors and hypoparathyroidism . in this case , the patient had no the history of copd , no abnormal findings in pulmonary function test and history of pulmonary embolism which are usually associated with increased carbon dioxide levels , hypoxia and chest pain . as such , we did not think that hvs in this patient was due to organic cause . physiologically , hyperventilaton can occur in women 's menstral cycle . during the second half of the menstral cycle , increasing progesterone stimulates the central nervous system and cervical carotid body , which induce physiological hyperventilation . other physiological causes of hvs include long speeches or lectures , hypoxic conditions ( for example in high altitudes ) , because hypoxia stimulates the respiratoy center to induce hyperventiltion . therefore , in this case , environmental changes , such as anxiety and psychological trauma occur during anesthesia and surgery were regarded as the main causes of hvs . before definitive symptoms and signs of hvs , we did not recognize breathing pattern change visually by oversight , because the surgical site was in the feet and heated mattress covered the patient 's trunk to prevent hypothermia . we suggest that in addition to vital sign monitoring , visual monitoring of the patient 's breathing patterns and respiratory status during regional anesthesia are equally important to prevent hvs . respiratory alkalosis occurs when the partial pressure of carbon dioxide is less than 36 mmhg , which results in reduction in hydrogen ( h+ ) ion in the intracellular fluid ( icf ) , and causes extracellular potassium ion shift into cells . as a result , serum potassium ion ( k+ ) serum k+ concentration during respiratory alkalosis decreases in proportion to reduction in carbon dioxide partial pressure . specifically , every 10 mmhg decrease in paco2 causes concomitant reduction in serum k+ by approximately 0.5 mmol / l . in this case , since the partial pressure of carbon dioxide had been reduced to 26 mmhg , calculation of the reduced blood k+ concentration ( 40 - 26 / 10 = 1.4 ) 0.5 = 0.7 mmol / l is determined as a result . if the quantity of total potassium inside and outside the cells is already deficient , hypokalemic symptoms may intensify in alkalosis . during anesthesia or surgery , administration of beta - stimulators , insulin or diuretics and hypothermia however , in this case , there was no history of drug administration ( beta agonists , diuretics ) or hypothermia , and preoperative seum k+ was mildly decreased to 3.3 mmol / l . we assumed the patient 's total potassium content was already low , which was thought a reason that caused hvs . therefore , preoperative mild hypokalemia without symptoms can rapidly deteriorate by spontaneous or iatrogenic hyperventilation during and after anesthesia . as such , adequate monitoring of k+ concentration and expeditious correction are mandatory for patient safety , even in very mild hypokalemic state . ecg abnormalities associated with severe hypokalemia include u waves greater than 1 mm , u waves larger than the t wave , t wave flattening or inversion ( inverted t wave ) , and qt waves . ecg changes during hypokalemia usually do not match the severity of hypokalemia , and hypokalemia associated with other arrhythmogenic factors , such as magnesium deficiency , digitalis intoxication may induce severe cardiac arrhythymia , including atrial fibrillation and premature ventricular contraction . in this case , besides second degree av block and t wave inversion , moderarte bradycardia ( 48 rate / min ) occurred during hvs . it was thought to be due to inhibition of sympathetic nervous system activity and reduction of venous drainage in spinal anesthesia in a patient who showed already preoperative bradycardia ( 60 rate / min ) . in this case we thought that the patient 's antihypertensive therapy had prohibit heart rate increase but this remained unconfirmed . in addition , we did not consider administration of parasympathetic blockers because blood pressure and vital signs were normal . instead , a decision was made to administer k+ supplement to prevent cardiac arrhythmia progression . whilst monitoring with ecg , we administered 10 mmol k+ diluted in 50 ml of normal saline over 30 minutes via peripheral vein , and we considered additional k+ replacement after evaluated for post - infusion k+ concentration ( the standard method of intravenous k+ replacement is to add 20 mmol of k+ to 100 ml of normal saline and infuse this k+ diluted solution over one hour ) . our patient 's symptoms and signs of hvs improved gradually , and we forfeited k+ replacement . serum total calcium ( normal : 8.0 - 10.2 mg% , or 2.2 - 2.5 mmol / l ) is present in three forms , as follows : approximately 50% of the calcium is binded with the plasma protein(albumin is responsible for 80% ) , unbounded ionized calcium , and 5 - 10% calcium bounded and chelated with plasma anions , such as phosphoric acid , sulfuric acid , and citric acid . about half of total calcium is ionized calcium ( normal : 4.0 - 4.6 mg% , or 1.0 - 1.5 disorders commonly associated with ionized hypocalcemia include massive transfusion , hypoparathyroidism , renal failure , sepsis , acute pancreatitis , rhabdomyolysis , hypomagnesemia , and medication such as aminoglycosides , cimetidine , and heparin . in this case , hypocalcemic symptoms manifested as perioral and bilateral hand numbness , limb stiffness , nausea , and headache towards the end of spinal anesthesia . even though preoperative calcium , phosphorus and magnesium were not measured and preoperative hypomagnesia and hypocalcemia symptoms could be excluded clinically . hvs was thought to be the main cause of hypocalcemia as intraoperative abga showed severe respiratory alkalosis . alkalosis promotes the binding of calcium to albumin and can reduce the fraction of ionized calcium in the blood , and ionized calcium may reduce without changes in total calcium . hypocalcemic symptoms are more common with respiratory alkalosis than with metabolic alkalosis . the clinical manifestation of hypocalcemic symptoms are associated with overexcitabilty of sensory and motor neurons , which causes stiffness and spasms of the facial nerve , masticatory muscle spasm symptom ( chevostek 's sign ) and wrist spasm secondary to upper extremity ischemia during measurement of systolic blood pressure ( trosseau 's sign ) . these hypocalcemic signs are neither specific nor sensitive and may not be manifested in hypocalcemia . severe hypocalcemia ( defined as ionized calcium < 0.65 mmol / l ) may be complicated with serious cardiovascular symptoms , such as ventricular tachycardia and refractory hypotension . adequate calcium replacement therapy is crucial for patient safety during anesthesia and in the perioperative period . in our patient , there was no wrist spasm during cuff inflation of non - invasive blood pressure intraoperatively , but wrist spasm occurred due to hvs at the end of surgery , and we confirmed hvs by decreased ionized calcium ( 0.72 mmol / l ) . intravenous calcium supplementation includes 10% calcium chloride ( 27 mg calcium / ml ) and 10% calcium gluconate ( 9.0 - 9.4 mg calcium / ml ) . because the potency of both drugs are relatively large in 10 ml and being hyperosmolar , and both forms of calcium are irritant and inflammatory to peripheral vessels , both agents need to be injected through the central vein via central venous catheter in order to prevent adverse effects . in this case , because the patient did not have central venous catheter , we chose and infused the less irritant calcium gluconate through the peripheral vein . in general , it is recommended that a bolus dose of 100 - 200 mg of calcium diluted in 100 ml isotonic saline , depending on the degree of hypocalcemia , should be infused over 10 minutes and continuous infusion of calcium 0.5 - 2 mg / kg / hr for maintenance . because the extent of hypocalcemia case was relatively mild in this case , we injected 10 ml of 10% calcium gluconate ( 90 mg calcium ) through the peripheral veins initially and resulted in we did not administer additional calcium replacement treatment as her musculoskeletal symptoms showed gradual improvement . known respiratory intervention to manage rapid progressing hypocapnia in hvs includes the use of closed mask ventilation ( rebreathing bag ) , but using performing closed mask ventilation in hypoxic patients or in patients with existing lung conditions may be dangerous , therefore special caution is required . drug therapy for hvs includes the use of beta - blockers for patients with palpitations , sweating , or trembling but caution must be exercised in copd patients at risk of brocho - obstructive disorders . to calm down anxiety or depression , sedative ( benzodiazepine ) use , we usually do not prescribe premedication and only when the patient or surgeon requests . if we had administered sedative premedication to our patient , it would have been useful to prevent hvs . in conclusion , we diagnosed and managed hvs following ecg changes , and manifestation of symptoms and signs of hypocalcemia and hypokalemia induced by hyperventilation during spinal anesthesia . anesthesiologists should always be aware of the possibility of electrolyte imbalance due to hvs during surgery or anesthesia , and in the perioperative period . | hyperventilation syndrome ( hvs ) often occurs under stressful conditions , and has been reported during or after anesthesia and operation .
hvs , characterized by multiple somatic symptoms and electrolyte imbalances induced by inappropriate hyperventilation , should be managed as an emergency .
we report a rare case of hvs during spinal anesthesia .
the patient was a previously healthy 51-year - old female without psychogenic conditions . during spinal anesthesia for lower extremity surgery ,
the patient complained of nausea , headache , paresthesia in the upper extremities and perioral numbness .
we found carpal spasm in both hands and flattening of t wave on electrocardiogram ( ecg ) .
emergent arterial blood gas analysis ( abga ) revealed markedly decreased paco2 , hypocalcemia and hypokalemia .
we managed the patient with verbal sedation , electrolytes replacement therapy and closed mask inhalation .
hvs subsided gradually .
we conclude that monitoring for possible hvs during anesthesia is very important for patient safety . |
glycogen synthase kinase-3 ( gsk-3 ) is a constitutively active and ubiquitously expressed serine / threonine kinase . in addition to playing a well - defined role in suppressing the canonical wnt/-catenin signalling pathway , it functions in hedgehog , notch , and several growth factor signalling pathways . large amounts of -catenin typically are associated with cadherin complexes at the plasma membrane of adherent cells . however , in the absence of wnt signalling , gsk-3 phosphorylates cytosolic -catenin within a complex that includes adenomatous polyposis coli , axin-1 , casein kinase-1 ( ck-1 ) , and other proteins and targets it for ubiquitin - mediated degradation ( figure 1a ) . in this manner , very low levels of non - cadherin - associated -catenin are maintained in the cell . upon wnt binding to frizzled receptors and low - density lipoprotein receptor - related protein ( lrp ) co - receptors and subsequent engagement of the intracellular protein dishevelled , the destruction complex is disrupted , gsk-3 and ck-1 activities are diverted to lrp co - receptors at the membrane , and cytoplasmic -catenin avoids phosphorylation . as a result , -catenin accumulates and enters the nucleus to regulate gene expression via binding to the tcf / lef ( t - cell factor / lymphoid enhancer - binding factor ) dna - binding proteins ( figure 1b ) . ( a ) in the absence of wnt signalling , the destruction complex comprised of apc , axin-1 , ck-1 , and gsk-3 promotes the phosphorylation and subsequent ubiquitin - mediated degradation of -catenin . ( b ) upon wnt stimulation , dishevelled is engaged , the destruction complex is disrupted , and ck-1 and gsk-3 activities are diverted to lrp at the cell membrane . unphosphorylated -catenin may accumulate and enter the nucleus to regulate gene expression upon binding to tcf / lef dna - binding proteins . ( c ) upon growth factor stimulation , activation of the pi3k signalling cascade leads to pkb - mediated phosphorylation of gsk-3 and inhibition of its kinase activity . apc , adenomatous polyposis coli ; ck-1 , casein kinase-1 ; gf , growth factor ; gsk-3 , glycogen synthase kinase-3 ; tcf / lef , t - cell factor / lymphoid enhancer - binding factor ; lrp , low - density lipoprotein receptor - related protein ; pi3k , phosphatidylinositol 3-kinase ; pkb , protein kinase b. physiological levels of gsk-3 do not limit the capacity of the destruction complex to mediate -catenin degradation ; only a small percentage ( < 10% ) of the total gsk-3 in the cell is associated with axin and engaged in canonical wnt signalling . other pools of gsk-3 are additionally used in several other pathways . upon insulin stimulation and consequent phosphatidylinositol 3-kinase ( pi3k ) activation , for example , the serine / threonine kinase protein kinase b ( pkb)/akt phosphorylates gsk-3 and negatively regulates its kinase activity ( figure 1c ) . a similar mechanism of negative regulation of gsk-3 has been demonstrated in other growth factor pathways [ 8 - 11 ] . regulation of -catenin has also been demonstrated in many of these pathways [ 8 - 12 ] . however , the direct convergence of wnt and growth factor pathways on -catenin regulation remains a controversial topic of discussion . if pi3k activation were sufficient to activate wnt signalling , why would additional mutations that lead to -catenin stabilization be needed ? several studies have also shown that growth factor stimulation that leads to gsk-3 inhibition through pi3k signalling does not result in stabilization of -catenin in the cell [ 14 - 16 ] . furthermore , gsk-3 molecules that have mutations in the pkb phosphorylation sites and thus that are insensitive to inhibition by pi3k signalling are still inhibited by wnt signalling [ 15 - 17 ] . it would appear that , although pi3k and wnt signalling pathways share a core regulatory protein , the insulation of these pathways is sufficient to prevent cross - talk . as demonstrated by ng and colleagues , axin may shield the associated gsk-3 within the destruction complex from protein kinases ( such as pkb ) that otherwise would phosphorylate and inactivate gsk-3 . although gsk-3 that is not directly associated with the complex may still be phosphorylated and inhibited , sufficient levels remain bound to the axin complex to suppress the accumulation of -catenin . it should be noted that chemical inhibitors of gsk-3 affect all gsk-3 molecules within a cell . hence , use of such reagents eliminates any selectivity gained by compartmentalization of the kinase . this is also true for genetic knockout or rnai ( rna interference ) suppression of each of the two isoforms ( gsk-3 and - ) , although suppression must exceed 75 - 80% to have an impact on -catenin . a recent report by maes and colleagues describes the effects of induction of vascular endothelial growth factor ( vegf ) overexpression in the osteo - chondroprogenitor cells of adult mice . vegf overexpression caused vascular defects , bone marrow fibrosis , hematological abnormalities , and increased bone mass , similar to the bone phenotype observed upon -catenin overexpression in the osteo - progenitor cells of mice . vegf overexpression correlated with increased pi3k signalling via vegfr-2 ( vegf receptor-2 ) , leading to enhanced gsk-3 phosphorylation , and the authors also observed -catenin stabilization . these results support the idea that receptor tyrosine kinase - mediated growth factor signals act through pi3k to induce -catenin . however , there are other explanations . accumulation of -catenin in the mouse tissues could be due to indirect activation of conventional wnt signalling through induction of wnt ligands or modulators . although the authors show that -catenin induction is sensitive to infusion of the pi3k antagonist wortmannin in the vegf - expressing mice , this does not exclude an indirect pathway . another possible mechanism is suggested by the known effect of vegf promotion of vascular permeability , a process that is preceded by vegf - dependent vascular endothelial - cadherin ( ve - cadherin ) phosphorylation and dissolution of the ve - cadherin complex comprised of adherens junction proteins p120 , -catenin , plakoglobin , and -catenin . thus , excess levels of cytosolic -catenin released from the membrane compartment , together with increased stress on the destruction complex , may contribute to vegf - mediated effects on -catenin stabilization . furthermore , nuclear localization of -catenin has been reported to be promoted by pkb phosphorylation of ser552 . clearly , it is not trivial to exclude alternative or indirect effects but it is somewhat easier to assume that the correlation between pi3k - induced inhibition of gsk-3 and accumulation of -catenin is actually a direct linkage . insulation mechanisms play critical roles in permitting shared signalling components between pathways yet maintain the integrity of these pathways and resultant biological processes . under normal circumstances , signalling specificity appears well insulated and can withstand precise experimental pressure . however , these mechanisms may be overwhelmed by unnatural genetic and chemical perturbation or by disease mutations . furthermore , the insulating mechanisms may not be relevant in all tissues or cell types . for example , both pkb and gsk-3 interact with the scaffold protein disc-1 ( disrupted - in - schizophrenia-1 ) in neurons and this protein , when overexpressed , has been shown to lead to accumulation of -catenin and subsequent signalling [ 23 - 25 ] . it remains to be seen whether disc-1 might mediate cross - talk between the pi3k and wnt pathways in a more biologically relevant context since disc-1 protein levels do not change significantly and the amount of gsk-3 bound by disc-1 is only a small fraction of the cellular total similar to the amount associated with axin and therefore is unlikely to be competitive . the small gtpase cdc42 ( cell division control protein-42 homolog ) , through its regulation of the par / apkc ( partitioning defective / atypical protein kinase c ) complex , has been proposed to inhibit gsk-3 and stabilize -catenin in the skin . activation of wnt signalling by apkc raises questions not unlike those associated with the effect of pkb on gsk-3 and -catenin but also raises the possibility that pi3k may activate cdc42 and impinge on wnt signalling in a pkb - independent manner . to definitively address the mechanisms and circumstances by which pi3k or other components of this pathway might impact -catenin regulation , future experiments will need to be conducted with cells or tissues that possess depleted levels of gsk-3 or -catenin and thus exhibit increased sensitivity to upstream manipulation of growth factor or wnt signalling . under these sensitized conditions , cross - talk may be more biologically relevant and detectable . likewise , if such experiments fail to demonstrate interplay , there may be greater appreciation of the compartmentalization of signalling events under physiological conditions . generation of cell lines in which elements of the pi3k pathway can be rapidly activated ( e.g. , pkb - estrogen receptor fusions ) should allow investigators to evaluate whether -catenin levels are induced within the expected time frame ( -catenin accumulation requires > 30 minutes ) . the potential for different pools of gsk-3 or -catenin to supplement each other in the cell must also be carefully evaluated in such experiments . importantly , the dynamics of any observed changes must be taken into consideration to exclude one pathway from leading to changes in the levels of agonists and antagonists of another pathway such as through transcriptional regulation or micro - rna expression . there are many examples of shared components in signalling pathways with little consideration of distinct pools or mechanisms to chaperone and isolate fractions of these molecules . often , the simplest and most direct path is not taken in biology , leading to erroneous assumptions and conclusions . indeed , understanding why a more convoluted route has been chosen | glycogen synthase kinase-3 ( gsk-3 ) is a well - established downstream component of the phosphatidylinositol 3-kinase ( pi3k ) signalling pathway but is also a key enzyme in negatively regulating the canonical wnt/-catenin signalling pathway .
several recent studies argue that pkb ( protein kinase b)-mediated inhibition of gsk-3 leads to -catenin accumulation , but whether cross - talk actually exists between these two pathways is controversial . to elucidate the mechanisms of shared signalling components , further studies taking into account different components of the pi3k signalling pathway and different pools of gsk-3 or -catenin are required . |
amyotrophic lateral sclerosis ( als ) is a devastating neurodegenerative disease which affects both motor function and extramotor systems . according to the revised el escorial criteria for the diagnosis of als , the presence of signs for the affection of both upper motor neurons ( umns ) in the primary motor cortex and lower motor neurons ( lmns ) in brainstem and spinal cord is mandatory , and the disease must be progressive . because of varied clinical phenotypes of als , it is difficult to differentiate it from other als - mimicking conditions . electromyography can be used for the detection of lmn involvement in addition to the clinical examination . on the other hand , umn signs must be visible at the clinical examination while electrophysiological transcranial motor stimulation abnormalities are not included in making the diagnosis of als according to the el escorial criteria . magnetic resonance imaging ( mri ) is the radiological investigation of choice with the recent advances of diffusion tensor imaging , presenting a promising technique for early detection of alterations in the motor cortex and pyramidal tracts . herein , we report a case of a 9-year - old male who presented to the department of neurology with complaints of progressive increase in weakness of bilateral lower limb , poor grip in bilateral upper limb , and difficulty in walking since last 2 years . there was no history of any muscle pain , trauma , fever , recent vaccination , dog bite , respiratory tract or gastrointestinal tract infection . physical examination demonstrated decreased power in the bilateral lower limb ( 3/5 in the right lower limb and 2/5 in the left lower limb ) and upper limb ( 4/5 in the right hand and 4/5 in the left hand ) , no signs of dermal rashes , or hypertrophy of muscles . mri of the brain was performed using 1.5 tesla scanner ( ge signa excite , usa ) . t2-weighted imaging and additional fluid attenuating inversion recovery sequence showed hyperintense signals in the posterior limb of internal capsule [ figure 1a and b ] involving corticospinal tract ( cst ) which was found to extending up to midbrain . ( a ) t1-weighted imaging , black arrow shows hyperintensity in the posterior limb of internal capsule ( b ) t2-weighted imaging , black arrow shows hyperintensity in the posterior limb of bilateral internal capsule ( c ) t2-weighted imaging , black arrow shows hyperintensity in the posterior bilateral internal capsule and midbrain ( corticospinal tract ) with classical wine glass appearance areas of abnormal signal intensity on t1- and t2-weighted images in the cst have been previously reported in patients with als . other diseases such as ischemic processes , demyelinating diseases , and infections may involve the pyramidal tracts . however , bilateral symmetrical involvement associated with the characteristic clinical findings clinches the diagnosis of als . the degeneration of motor neurons may result in a cellular loss and axonal edema as previously shown on electronic microscopy . so far , imaging methods had been of limited use because of their unsatisfactory results . approximately , 90% of als are sporadic with 10% having familial predisposition , but majority of the cases of juvenile als ( jals ) are familial . most of the jals are autosomal recessive , though autosomal dominant inheritance patterns have been described . recessive forms of jals have been mapped to chromosome regions 2q33 and 15q12 - 21 . no effective treatment for the disease have been found till date , though thyrotropin - releasing hormone , ganglioside therapy , and plasmapheresis have been tried in adults without much benefit . jals is a diagnosis that should be suspected in a child presenting with a combination of umn and lmn signs . mri facilitates reaching the correct diagnosis by showing the typical involvement of the cst and the wine glass appearance . mri plays as an important diagnostic tool for reaching up to a diagnosis and for prognosticating the disease . | amyotrophic lateral sclerosis ( als ) , also known as lou gehrig disease , is a chronic degenerative neurologic disease and is characterized by the selective involvement of the motor system .
usually , patients present with upper motor neuron ( umn ) and lower motor neuron compromise .
degeneration of the umn in the cerebral cortex is one of the main pathologic changes in als .
these changes usually affect corticospinal tracts leading to degeneration of the fibers which show characteristic hyperintensities along the tracts leading to the wine glass sign .
patients with als usually present in the sixth decade of life ; presentation in pediatric age in the form of juvenile als being rare . |
the jcb has long been a leader in providing free , public access to the science we publish . since january 2001 we have released our content six months after publication , and we also provide immediate free - access to colleagues in 143 developing nations . and , in this my first editorial in the journal , i am delighted to announce another enhancement to our commitment to public access . as of november 2007 we will deposit all jcb content in pubmed central ( pmc ) , where it will available to the public six months after publication . pmc , developed and managed by the nih 's national center for biotechnology information ( ncbi ) , in the national library of medicine ( nlm ) , is a free digital archive of literature from biomedical and life science journals . despite a previous reluctance on our side ( 2 ) , we are now happy to provide the nlm with all of our content in xml format . the process requires a certain amount of finessing to ensure accurate conversion ( hence the short delay until november ) . this change in our policy stems from the realization that xml content may have greater longevity than pdf files . we also recognize the necessity for multiple archives of our electronic content as print is phased out . additional placement of jcb content in the pmc archive ensures permanent and free access in a central repository alongside research from other leading journals . our routine deposit in pmc represents de facto compliance for authors with policies formulated by many funding agencies requiring access to research they have funded after a short delay . this service will be free of charge to authors ( although hhmi are welcome to pay us $ 1,000$1,500 a pop if they so choose ( 1 ) ) . deposit of our published content in pmc will also prevent the existence of multiple versions that might arise if authors had to independently upload their manuscripts . we continue to derive our revenue from journal subscriptions in addition to author billings , and we thus delay the public release of our content for six months . however , as has been the case since july 2000 , if authors want to make their papers available sooner , they may post the final , published , pdf version on their own websites immediately after publication . times are changing in the publishing world , and we want to move with them . we think pmc has demonstrated that it really has got legs ! and we hope other publishers will join the growing trend of establishing automatic deposit of all their content . in doing so , achieving the end goal to make this free archive of scientific literature as complete as possible becomes more likely . | the journal of cell biology has helped define the field of cell biology . since its establishment in 1955 by some of the founders of the discipline , the journal has attracted exciting , high quality science from leaders in the field .
this is thanks in large part to a committed and active editorial board , selected as some of the most respected and thoughtful cell biologists throughout the world .
it was therefore an honor , four months ago , to take the position of executive editor and work alongside current editor - in - chief ira mellman . |
a number of specific loci have been described as becoming hypermethylated during aging or carcinogenesis . transcriptional inactivation by cytokine methylation at promoter cpg islands of tumor suppressor genes is thought to be an important mechanism in human carcinogenesis . in half of all primary human cancer cells , moreover , p73 , a p53 homologue , has been shown to be hypermethylated in leukemia . using human cancer cells , herman and coworkers first described methylation - specific pcr ( msp ) , which can rapidly assess the methylation status of virtually any group of cpg sites . the msp primer sequences for the human p53 gene have been identified in medulloblastomas , human gliomas , and hepatocellular carcinoma . while there are many mouse experiments , the msp primer sequences for the mouse p53 gene have yet to be reported . it is thought that it helps a future study very much to establish msp technique . in this study , to establish msp for this gene , we analyzed a cpg site in the mouse p53 gene and designed the corresponding primer sequences . mice carrying a disrupted , nonfunctional p53 gene ( p53 ) were derived from homologous recombination in an embryonic stem cell line from 129/svj mice as described previously [ 9 , 10 ] . wild type mice of the parental inbred strain were used as controls for the p53 mice . the experimental protocols were approved by the ethics review committee for animal experimentation of the university of occupational and environmental health , japan ( kitakyushu , japan ) . a sr - y disk delivered a beta ray source of 1.85 gbq at 15 gy / min . the backs of seven - week - old mice ( p53 and p53 ) were irradiated with beta rays three times a week until the appearance of a tumor . genomic dna from the spleen , liver , kidney , and tumor was isolated using a quickgene dna ( fujifilm holdings corporation , tokyo , japan ) whole blood kit according to the manufacturer 's instructions . approximately , 1 g of dna was treated with sodium bisulfite using an epitect bisulfite kit ( qiagen , hilden , germany ) according to the manufacturer 's instructions . briefly , the dna , bisulfite mix , and dna protect buffer were mixed together . the bisulfite conversion thermal cycling conditions were as follows : 99c for 5 min , 60c for 25 min , 99c for 5 min , 60c for 85 min , 99c for 5 min , and 60c for 175 min . finally , the bisulfite - converted dna was purified on a spin column and eluted with 20 l of eb buffer . pcr primer sets included sense ( 5-atc gtt att cgg ttt gtt ttc-3 ) and antisense ( 5-cac gac ctc cgt cat ata ct-3 ) primers . thermal cycling conditions were as follows : 1 cycle at 95c for 10 min ; 30 cycles at 94c for 15 s , 55c for 30 s , and 72c for 30 s ; 1 cycle at 72c for 10 min . pcr products were inserted into a pcdna 3.1/v5-his - topo vector by topo cloning technology . two microliters of this reaction mixture were then added to a tube of top10 competent e. coli and mixed gently . after incubating on ice for 30 minutes , the cells were heat shocked for 30 seconds at 42c without shaking . tubes were immediately transferred back to the ice , and 250 l of room temperature medium was added . after incubation at 37c for 30 minutes , reaction mixtures were spread onto a prewarmed ampicillin plate and incubated overnight at 37c . colonies were picked and cultured overnight in lb medium containing 50 g / ml ampicillin . we isolated the plasmid dna using a miniprep kit ( qiagen ) , and its sequence was analyzed using both the t7 primer and reverse sequencing primers . dna sequencing was performed with a bigdye terminator v3.1 cycle sequencing kit ( applied biosystems inc . ) according to the manufacturer 's instructions using the t7 sequencing primer ( invitrogen , carlsbad , ca , usa ) and the sense primer 5-taa tac gac tca cta tag gg-3. thermal cycling conditions included 1 cycle at 96c for 1 min and 25 cycles at 96c for 10 s , 50c for 5 s , and 60c for 4 min . the dna sequencing reactions were purified using the bigdye xterminator purification kit ( applied biosystems inc . ) . the dna sequencing reactions in 96 well plates were run on a 3130/3130xl genetic analyzer ( applied biosystems inc . ) , and resulting sequences were analyzed with sequencing analysis software ( applied biosystems inc . ) . we searched for cpg islands in the p53 gene and designed pcr primer sets using methyl primer express software v1.0 ( applied biosystems inc . ) . thermal cycling conditions were as follows : 1 cycle at 95c for 10 min ; 35 cycles at 94c for 15 s , 50c for 1 min and 72c for 30 s ; 1 cycle at 72c for 10 min . we searched the mouse p53 gene from exon 4 to 9 for a cpg islands using methyl primer express software v1.0 ( figure 1(a ) ; applied biosystems inc . ) and found one located from intron 5 to intron 7 , spanning 619 base pairs . the cytosine ( c ) surrounded with a rectangle is the specific cpg site ( figure 1(a ) ) . this is the first description of a cpg island for the p53 gene in normal mouse tissues . using the same software , the cpg island the resulting sequences were the same as the sequences that were analyzed by the genetic analyzer in this study . several candidates for pcr primer sets were given by the software , and the suitable set , determined after many rounds of pcr , included a methylated base . the best sets for p53-unmethylation and p53-methylation are surrounded by a rectangle in figure 1(b ) and given in table 1 . cytosine ( c ) of gct ( alanine ) in exon 5 was converted to a thymidine ( t ) after bisulfite treatment in young mice , which did not occur in old mice after the same treatment ( figures 1(b ) , 1(c ) ) . in all organs ( i.e. , liver , kidney , and spleen ) of 8-week - old mice , we obtained a strong pcr product using the unmethylated primer and weaker band with the methylated primer . alternatively , in liver and spleen from 122-week - old mice , the dna was amplified to similar pcr products with both the unmethylated and methylated primers ( figure 2 ) . in radiation - induced tumors from p53 mice and p53 mice , amplified dna yielded similar bands with both the methylated and unmethylated primers ( figure 2 ) except in one tumor from a p53 mouse , which showed a strong band with the former and a weaker band with the latter . we have previously shown data for msp in the p53 gene where p53 methylation increased with age in the spleen after irradiation at a young age . after dna damage is induced by intra- and/or extracellular processes , dna methylation is known to increase with increasing age . in this study , we have shown how p53 methylation in the spleen and liver relates to age and that p53 methylation was found in all radiation - induced tumors in mice . finally , it is interesting to note that methylation increases in tumor suppressor genes in human tumors as well , including the p53 gene [ 68 ] . in this study , we established msp for the mouse p53 gene , and this is the first description . unfortunately , we were only able to find one base ( c ) that was methylated , observing bands of similar intensity using both unmethylated and methylated primers . it is thought that the width of the methylation study will progress in future by msp technique for the mouse p53 gene having been established . | methylation - specific pcr ( msp ) of the mouse p53 gene has not yet been reported .
we searched the cpg islands , sequenced the bisulfited dna , and designed pcr primers for methylation and unmethylation sites .
dna from a young mouse produced a strong pcr product with the unmethylated primer and a weaker band with the methylated primer .
dna from an old mouse produced bands of similar intensities with both primers . in radiation - induced tumors ,
dna from an old mouse yielded similar bands with both types of primers .
we suggest that msp is a valuable technique for the epigenetic study of the mouse p53 gene . |
the genus actinomyces belongs to the domain bacteria , phylum actinobacteria , class actinobacteria , order actinomycetales and family actinomycetaceae . the genus consists of a heterogeneous group of gram - positive bacteria that have a high g+c content . the genus actinomyces consists of a heterogeneous group of gram - positive bacilli , mainly facultatively anaerobic or microaerophilic rods with various degrees of branching . actinomyces species mainly belong to the human commensal flora of the oropharynx , gastrointestinal tract , and urogenital tract . actinomycosis is a very rare disease usually caused by one of a group of opportunistic but otherwise harmless commensals and may be complicated by one or more of another group of co - pathogens . actinomycetes are prominent among the normal flora of the oral cavity but less prominent in the lower gastrointestinal tract and female genital tract . as these microorganisms are not virulent , they require a break in the integrity of the mucous membranes and the presence of devitalized tissue to invade deeper body structures and cause human illness . many studies based on phenotypic identification of members of the genus actinomyces have been performed . however , during the past few years , actinomyces taxonomy has undergone much improvement , primarily driven by 16s rrna gene sequence analysis . ms2 is part of a project called culturomics , the comprehensive determination of the microbial composition of the gut microbiota and the relationships with health and disease , which are major challenges in the twenty - first century . ms2 was isolated from the stools of a healthy individual in raiatea island ( french polynesia , south pacific ) . actinomyces polynesiensis ms2 was isolated for the first time using inoculation in a blood culture bottle with coconut milk and then 5% sheep blood agar . growth was tested on columbia agar supplemented with 5% sheep blood and chocolate agar + polyvitex ( biomrieux , marcy - ltoile , france ) in aerobic and anaerobic condition using gaspak ez anaerobe container system sachets ( bd , franklin lakes , nj , usa ) at 37c and co2 gen ( thermoscientific , waltham , ma , usa ) . the ability of the strain to grow at different temperatures ( 25c , 37c and 45c ) was investigated . gram staining and electron microscopy were performed with a technaig cryo ( fei company , hillsboro , or , usa ) at an operating voltage of 200 kev . cells were grown on 5% sheep - blood agar for 24 h. a bacterial suspension was pre - fixed in 5% ( volume / volume ) glutaraldehyde in phosphate buffer ( gibco , waltham , ma , usa ) for at least 1 h at room temperature , washed in the same buffer and stained with 1% ( weight / volume ) ammonium molybdate 1% . catalase activity , as determined by an i d color catalase test kit ( biomrieux ) and oxidase activity , assayed by applying the cells to moistened discs impregnated with dimethyl - p - phenylenediamine ( biomrieux ) . biochemical tests were performed with the commercially available api zym and api 50 ch strips and were used to characterize the biochemical properties of the strain according to the manufacturer 's instructions . the evolutionary history was inferred using the maximum likelihood method based on the jtt matrix - based model . hinton agar supplemented with 5% sheep blood medium ( biomrieux ) and the results were interpreted using the european committee on antimicrobial susceptibility testing ( eucast ) guidelines . the antibiotics used in this study were penicillin , oxacillin , vancomycin , teicoplanin , linezolid , gentamicin , ciprofloxacin , trimethroprim - sulphamethoxazole , fosfomycin , doxycycline , erythromycin , clindamycin , rifampicin and colistin . dna extracted through the biorobot ez 1 advanced xl ( qiagen , hilden , germany ) paired end library was pyrosequenced on the 454_roche_titanium . the global 297 979 passed filter sequences generated 85.84 mb with a length average of 281 bp . these sequences were assembled on the gsassembler from roche with 90% identity and 40 bp as overlap ( roche , basel , switzerland ) . it leads to 15 scaffolds and 309 large contigs ( > 1500 bp ) , generating a genome size of 2.94 mb , which corresponds to a coverage of 29.2 genome equivalent . the genome was annotated by rapid annotation using the subsytem technology ( rast ) bioserver . blast2go optimizes the function transfer from homologous sequences through an elaborate algorithm that considers the similarity , the extension of the homology , the database of choice , the go hierarchy , and the quality of the original annotations . the resistome was analysed with the arg - annot ( antibiotic resistance gene - annotation ) database and blastp in genbank . the exhaustive bacteriocin database available in our laboratories ( bacteriocins of the urmite database ; http://drissifatima.wix.com/bacteriocins ) was performed by collecting all currently available sequences from the databases and from ncbi . protein sequences from this database allowed putative bacteriocins from human gut microbiota to be identified using blastp methodology . actinomyces polynesiensis ( polinesiense masc . adj . of , the ancient greek name for the islands of french polynesia , where the strain was isolated ) . actinomyces polynesiensis grew slowly , with characteristics similar to those of the filamentous fungi ; which have the ability to grow in branched filaments and to form settlers and the typical mycelium seen with other smaller beaded white colonies ( fig . 1 ) . actinomyces polynesiensis ms2 was grown anaerobically on 5% sheep - blood - enriched columbia agar at 37c . optimal growth was achieved anaerobically using chocolate agar + polyvitex with 5% co2 at 37c and no growth was observed under aerobic conditions . acid production was observed for the following carbohydrates , with api 50 ch negative for d - arabinose , l - xylose , d - adonitol , methyl--d - xylopyranoside , l - sorbose , l - rhamnose , dulcitol , inuline , d - tagatose , d - fucose , l - arabitol , potassium 2- and 5-gluconate ; all other acid production was positive ( table 1 ) . further identification was performed using a 16s rrna nucleotide sequence ( genbank accession number hf952919 ) gene closely related ( 99.8% ) to actinomyces 152r-3 ( genbank accession number dq278863.1 ) ( fig . this value was lower than the 95% 16s rrna gene sequence threshold recommended by stackebrandt and elbers to delineate a new genus without carrying out dna - dna hybridization . ms2 was resistant to oxacillin , second - generation ( cefoxitine ) and third - generation cephalosporins ( ceftriaxone ) , trimethroprim - sulphamethoxazole , fosfomicin , erythromycin and clindamycin but was susceptible to vancomycin , teicoplanin , linezolid , gentamicin , ciprofloxacin , doxycycline , rifampicin and colistin ( fig . 2 ) . ms2 is 2 943 271 bp with a 70.80% g+c content assembled into 15 scaffolds ( 309 contig ) . a total of 2080 genes ( 91% ) were assigned to putative functions ( by clusters of orthologous groups ) and 216 ( 9% ) genes were identified as unknown function and 110 were rnas , ten genes were 5s rrna , nine genes were 16s rrna and four genes were 23s rrna . the distribution of genes into clusters of orthologous group functional categories is presented in table 2 and the properties and statistics of the genome are summarized in table 3 . ms2 includes penicillin - binding protein ( 296 amino acids ) , metallo - hydrolase enzyme ( 239 amino acids ) and the major facilitator superfamily ( table 4 ) . the analysis of the genome has not demonstrated the presence of bacteriocin and non - ribosomal polyketide synthase . on the basis of the phylogenetic analysis , the novel species actinomyces polynesiensis str . ms2 ms2 has been submitted to the ebi database under bioproject i d : prjeb1958 with accession number on genbank database ccxh01000000 and 16s rrna accession number hf952919 . | actinomyces polynesiensis strain ms2 gen . nov . , sp . nov . is a newly proposed genus within the family actinomycetaceae , isolated from the stools of a healthy individual in raiatea island ( french polynesia , south pacific ) .
actinomyces massiliensis is an anaerobic , gram - positive organism . here
we describe the features of this organism , together with the complete genome sequence and annotation2 943 271 bp with a 70.80% g+c content , assembled into 15 scaffolds and containing 2080 genes . |
we enrolled eighteen patients ( mean age 43,67 11,28 years , 7 females and 11 males ) affected by myotonic dystrophy type 1 , followed by the unit of neurorehabilitation at the university hospital of pisa . patients were entered into the study if they met the following criteria :
established clinical and genetic diagnosis of dm1.ability to perform physical exercise ( lower limbs less impairment ) . established clinical and genetic diagnosis of dm1 . exclusion criteria were : clinically manifest pulmonary or cardiac disorders , fever , neoplasms , diabetes and insulin insensitivity . the control group was formed by fifteen healthy subjects : 10 females and 5 males , mean age 43.2 years . to study oxidative metabolism we assessed blood lactate levels before and after a submaximal incremental exercise on a treadmill . the exercise protocol consisted of 11 steps , of 2-min duration each step , at a constant speed of 3 km / h . the slope was 0% at the start level and increased of 2.5% at each step . capillary hemoglobin o2 saturation and heart rate were monitored during the exercise : if the patient reached 75% of the maximum theoretical heart rate ( 220-patient s age ) , the test was stopped , so keeping the exercise predominantly aerobic . venous blood samples were executed at rest and at 5 , 10 and 30 min after the end of exercise .. blood samples were collected in edta tubes from the antecubital vein . lactate was rapidly analyzed through an enzimatic assay , based on the conversion of lactate to piruvate and h2o2 by lactate oxidase . in the presence of the h2o2 formed , peroxidase catalyzes the oxidative condensation of chromogen precursor to produce a coloured dye with adsorption maximum at 520 nm . the increase in absorbance at 520 nm is directly proportional to lactate concentration in the sample , as described by chisari et al . analysis of the differences in mean values was performed using the z test , performed on average values . all subjects of the control group completed the exercise ( 11 steps ) while the patients performed 9 steps on average ( tab . the lactate resting values were comparable between dm1 patients and the control group : 1.56 mmol / l vs 1.63 mmol / l respectively . lactate values were significantly higher in dm1 patients compared to controls at any given time during the recovery period ( fig . the first datum emerging in this study is the early exercise - related fatigue arising in dm1 patients compared to controls , as they performed a mean number of 9 steps , while the latter completed the exercise ( 11 steps ) ( tab . , patients revealed normal lactate values at rest , which reached significantly higher levels during recovery after exercise ( fig . 1 ) . these findings suggest an early activation of anaerobic metabolism , not proportional to workload executed , thus evidencing an alteration in oxidative metabolism of such dystrophic patients . during an increasing exercise , the working muscles and various tissues require more atp production due to glycolytic or glycogenolytic pathway , and this mechanism leads to the final increase in lactate levels . during steady state sub - maximal exercise , the lactate concentration in the lactate pool remains constant and the rate of oxygen consumption is the measure of the whole body energy expenditure ; when exercise intensities arise above steady state , a major concentration is attributed to an increase in the rate of lactate production or result from a decrease in the rate of lactate removal . the lactate anion together with decreased muscle ph seem to be involved in muscle function disturbances , such as impairing excitation - contraction coupling , modifying protein conformation , altering channel properties and depressing the activity of key enzymes in glycolysis . consequently , it may be crucial for exercising muscle cells to delay ph decline and lactate accumulation in the cytosol , to prevent muscle performance impairment . the present study confirms what emerged in a previous one proposed by barnes et al . in which it was investigated the glycogenolytic pathway by using p magnetic resonance spectroscopy : indeed they revealed an abnormal glycogenolytic atp - production , during the first minute of aerobic exercise . in addition , the proportion of the total requirement provided by glycogenolysis resulted greater than in controls , revealing values similar to that in the control subject performing heavier works . during aerobic exercise in both calf muscle and flexor digitorum superficialis , phosphocreatine was depleted more rapidly in patients than in controls , evidencing how consistent is the metabolic demand in wasted muscle cells . evidenced that the removal of lactate and protons from skeletal muscle is important to maintain force and prevent fatigue during continuous and intermittent supramaximal exercises in well - trained subjects . our data confirm the findings observed in an another study conducted by siciliano et al . they reported an early activation of anaerobic metabolism in dm1 patients , after performing an incremental bicycle exercise , as far as lactate threshold was achieved at values ranging from 30 to 50% of the predicted normal maximal power output ( pnpomax ) , while controls reached it at 60 - 70% . hence , they concluded that the early achievement of lactate threshold represent a critical point , reflecting metabolic modifications in the oxidative metabolism . briefly , an evidence of oxidative impairment in dm1 patients emerged in the work of barnes et al . , while an indirect assumption is proposed by toscano et al . anyway , angelini pointed out that depletion in neuronal nitric oxide synthase is frequently found and may correlate with post - exercise fatigability in duchenne muscular dystrophy and in sarcoglicanopathy , while in dm1 two different types of fatigue may be found . in fact , probably the cortical atrophy and the presence of white matter lesions could explain the mechanism of central fatigue , while the muscular fibers atrophy could count for peripheral fatigue . moreover , another aspect probably implied in the presence of abnormal lactate levels in these patients is the predominant atrophy of type 1 fibers evidenced by histological studies of skeletal muscle sections . the histochemical analysis leads to the original division of muscle fibers into type i ( slow - twitch ) and type ii ( fast - twitch ) , evidencing how the greater myoglobin and capillary content in red muscles contributes to their greater oxidative capacity compared with white muscles . it could then be argued that the prevalent atrophy of slow - twitch muscle fibers in dm1 could represent one of the possible mechanism implied in the altered oxidative capacity evidenced in such patients , thus providing basis for the abnormal lactate levels assessed performing our aerobic protocol . so , as far as lactate determination during cycle or treadmill ergometry is used for diagnostic purpose in mitochondrial myopathies , this submaximal exercise could be a tolerable and safety method to assess aerobic capacity in this kind of patients . the interest of our study consists of the fact that our protocol is a safe , non exhaustive and easy reproducible method to be performed in such patients , who may frequently present early structural and functional myocardial abnormalities , strongly associated with cardiac conduction alterations . our findings confirm the alteration in oxidative capacity of dm1 skeletal muscle , which could negatively influence motor performances of these patients . the relevance to know one of the mechanisms implied in fatigue in dm1 consists of the possibility to state aerobic capacity of these patients , in order to plane specific rehabilitative protocols . in fact , in patients affected by mitochondrial myopathies , taivassalo et al . investigated the role of a specific aerobic training , consisting of an 8-week aerobic program performed on a treadmill for 20 up to 30 minutes , under constant supervision and heart rate monitoring , associated with stretching exercise , warm - up and cool - down periods . they demonstrated an increase of aerobic capacity with a decrease of 30 % in lactate concentration at rest and after exercise , that was correlated with a reduced fatigue and improved tolerance to daily activities . in patients affected by polymyositis / dermatomyositis , bertolucci et al . evidenced a precocious fatigability and higher lactate values after performing a submaximal aerobic exercise : they revealed an improvement both in muscle performance and in a reduction of fatigue symptom after a period of specific aerobic training . this safe and easily reproducible protocol could be used to address aerobic training programs , which were provided to be a safety method to increase fitness , endurance and level of physical activity , in order to improve maximal muscle oxidative capacity and blood lactate removal ability , probably implied in early fatigability that arise in these patients . in conclusion , this kind of exercise protocol could provide a valid and safe method to evaluate aerobic capacity in myotonic dystrophy patients , able to reveal precocious alteration in oxidative metabolism of such patients and to direct rehabilitation trainings aiming at improving aerobic performances . | myotonic dystrophy type 1 ( dm1 ) is a dominantly inherited disease comprehending multiple features .
fatigue and exhaustion during exercise often represent significant factors able to negatively influence their compliance to rehabilitation programs .
mitochondrial abnormalities and a significant increase in oxidative markers , previously reported , suggest the hypothesis of a mitochondrial functional impairment .
the study aims at evaluating oxidative metabolism efficiency in 18 dm1 patients and in 15 healthy subjects , through analysis of lactate levels at rest and after an incremental exercise test . the exercise protocol consisted of a submaximal incremental exercise performed on an electronically calibrated treadmill , maintained in predominantly aerobic condition .
lactate levels were assessed at rest and at 5 , 10 and 30 minutes after the end of the exercise .
the results showed early exercise - related fatigue in dm1 patients , as they performed a mean number of 9 steps , while controls completed the whole exercise .
moreover , while resting values of lactate were comparable between the patients and the control group ( p=0.69 ) , after the exercise protocol , dystrophic subjects reached higher values of lactate , at any recovery time ( p<0,05 ) .
these observations suggest an early activation of anaerobic metabolism , thus evidencing an alteration in oxidative metabolism of such dystrophic patients . as far as intense aerobic training
could be performed in dm1 patients , in order to improve maximal muscle oxidative capacity and blood lactate removal ability , then , this safe and validate method could be used to evaluate muscle oxidative metabolism and provide an efficient help on rehabilitation programs to be prescribed in such patients . |
induction of labour is performed in about 20% of all pregnancies and successful induction is reported to be related to cervical characteristics , or ripeness ( pandis et al . , 2001 ; laencina et al . , 2007 ; vrouenraets et al.,2005 ) . although cervical ripeness can be established with the bishop score , this frequently used method shows a high inter - and intra - observer variability ( laencina et al . , 2007 ; vrouenraets et al . , 2005 ; bishop , 1964 ) . alternatively , transvaginal ultrasonographic measurement of cervical length may be a more objective method for assessing cervical status ( pandis et al . cervical length was measured with a ruler ; it appeared that digital examination significantly underestimated cervical length by an average of 13.6 mm compared with the ruler measurement ( jackson et al . , 1992 ) . birth by caesarean delivery is generally more hazardous than a normal vaginal delivery ( yeast et al . , 1999 ) , or at least poses more risks for subsequent pregnancies ( kwee et al.,2007 ) . therefore , we hypothesized that prediction of the success rate of induction of labour might lead to a reduction in caesarean delivery and thereby its complications . results of studies comparing the usefulness of the bishop score versus transvaginal cervical ultrasonography in predicting the success of labour induction are conflicting ( pandis et al . , 2007 ; strobel et al . , 2006 ; rozenberg et al . , 2005 ; moreover , most of these studies used different induction strategies ( mostly a 24-hour period ) and various definitions of success were used . the present longitudinal study explores the use of transvaginal ultrasonographic measurement of cervical length versus the bishop score , prior to induction , to predict the mode of delivery within 4 days ( 96 hours ) . preinduction cervical assessment was undertaken in 110 women who were included in this study from march 2007 through december 2007 . inclusion criteria were : singleton pregnancy , live fetus in cephalic presentation , and undergoing induction of labour at 37 to 42 weeks of gestation ( gestational age determined by ultrasound fetometry ) for a variety of indications ; prom > 48 h , hellp syndrome or pre - eclampsia , diabetes maternal or gravity related , prolonged pregnancy , restricted intra - uterine fetal growth , amniotic fluid problems , elective inductions and gestational cholestasis . exclusion criteria were : any reason for priming and/or contra - indication for induction of labour : suspicion of fetal distress at admission , previous history of uterine surgery or contra - indications for prostaglandins or vaginal delivery . the attending obstetrician performed a digital examination of the cervix and noted the bishop score on a dedicated study form . to calculate ripeness of the cervix , bishop scores were scored separately for nulliparous and multiparous women , according to the guidelines of the dutch society of obstetrics and gynaecology ( table i ) . the score used for nulliparous women has the components : consistency , cervical position , effacement of the cervix , degree of dilatation , and station of the presenting part ( range 0 - 10 ) ; for multiparous women the score components are : degree of dilatation , and station of the presenting part ( range 0 - 4 ) . cervical length was then measured by a transvaginal ultrasound scanner ( hitachi eub-5500 , japan ) with a 10 mhz v53w r10 probe . all ultrasound measurements were carried out according to standard protocol : i.e. women are examined in a dorsal lithotomy position with an empty urinary bladder . once the cervical canal is identified the probe is withdrawn slightly so there is no pressure of the tip of the probe on the cervix . a sagittal plane through the cervix is identified where the external cervical os , the cervical canal and the internal cervical os is visible . the length of the cervix is measured from the outer to the inner cervical os as a straight line . it is important to include only that part of the cervical canal that is bordered by the endocervical mucosa . the agents used for induction were dinoprostone gel on the first 2 days and , if necessary , misoprostol tablets intravaginal on the third or fourth day . digital examination was made 5 h after the first intravaginal administration ; if necessary , a second dose of dinoprostone was then administered . the maximum dose of dinoprostone in 24 h was 3 mg given in two doses . on the third and fourth day a maximum of 75 g misoprostol in 24 h could be applied intravaginally in three doses at intervals of 4 h. external cardiotocography was regularly performed to monitor the condition of the fetus . onset of labour was defined as the time when cervical dilatation reached at least 3 cm with completed cervical effacement . intravenous oxytocin administration was started when there was an arrest of dilatation , according to the hospital protocol . for analgesia , intramuscular pethidine and/or epidural anaesthesia was offered . in the present study , successful outcome was defined as induction resulting in vaginal delivery within 96 h. the need for caesarean delivery for presumed fetal distress ( e.g. abnormal fetal heart rate with fetal acidosis ph < 7.20 ) , or for a durable arrest of dilatation for at least 2 h , or no descent of the fetal head for at least 1 h despite adequate uterine contractions , was decided by the attending physician . medical records were reviewed for data on age , ethnicity , parity , gestational age , indication for labour induction , agent used for induction , augmentation of oxytocine , use of analgesia , time period between induction and delivery , apgar score at 1 and 5 min , umbilical artery ph at birth , fetal weight at birth , and mode of delivery . univariate analysis was used to test several variables ( age , weight at birth , indications for induction of labour , bishop score , cervical length ) predicting the successful outcome . receiver operating characteristic ( roc ) curves were used to assess the efficacy of the bishop score and cervical length in predicting the outcome . sensitivity , specificity , likelihood ratios , and positive and negative predictive values were calculated . the study population included 110 at term women of whom 66 were nulliparous and 44 multiparous . vaginal delivery within 96 h was achieved in 48 ( 73% ) nulliparous and in 40 ( 91% ) multiparous women ; i.e. in 80% of the total group . 1 ) . there was a significant difference in age , cervical length , bishop score and successful induction between nulliparous and multiparous women ( table ii ) . * p - value < 0.05 one - way anova * * oligohydramnion , polyhydramnion , stained amniotic fluid prom ( prelabour rupture of membranes ) hellp ( haemolysis elevated liver enzymes and low platelets ) significantly more nulliparous women needed more oxytocin augmentation and analgesia . there was no significant difference in neonatal outcomes between the subgroups ( table iii ) . * p - value < 0.05 one - way anova univariate analyses were performed for nulliparous and multiparous women to determine the significance of the following items possibly involved in predicting successful induction of labour : age , weight at birth , indications for induction of labour , bishop score and cervical length . univariate analysis of the possible predictors of success showed that only the bishop score in nulliparous women was significant for predicting the outcome of success . roc curves were computed for the bishop score and cervical length in nulliparous and multiparous women . only the bishop score in nulliparous women showed a significant relationship between this variable and success of induction ( area under the curve 0.679 ; se 0.730 ; p < 0.05 ; 95% ci : 0.536 - 0.823 ) ( table iv ) . the best cut - off value for the bishop was 3 , with a sensitivity of 56.3 % and a specificity of 72.2% ( table v ) . * p - value > 0.05 , se = standard error lr+ = positive likelihood ratio ; l- = negative likelihood ratio ; ppv = positive predictive value ; npp = negative predictive value the results show that only the bishop score in nulliparous women was a predictor of success of induction . the overall chance of vaginal delivery within 96 h in nulliparous women is 72.7 % ( pre - test probability ) . a bishop score of 3 corresponded with a positive likelihood ratio of 2.03 , resulting in a post - test probability of 84% . results of studies comparing cervical length with cervical palpation were not conclusive ( pandis et al . , 2001 ; tan et al . , 2007 ; strobel et al . , 2006 ; rozenberg et al . , 2005 ; rane et al . , ( 2007 ) , cervical length and bishop score proved to be predictors of successful labour ; however , their outcome of success was defined as vaginal delivery within 12 h and 60 h respectively . in addition , women in their study with an unfavourable bishop score ( < 6 ) received 1 or 2 doses of prostaglandin gel . if labour was not triggered within 24 h and the bishop score continued to be < 6 , the bishop score and ultrasonographic scores were recorded and a second dose of prostaglandine gel was given . in that case cervical characteristics would probably have been changed by the gel and may have lost their predictive value . if labour was not triggered after 24 h , the bishop score and ultrasonographic scores were recorded and oxytocin induction was started . moreover , laencina et al . ( 2007 ) showed that some women received oxytocin even when the bishop score was less than six . in contrast , in the present study ultrasonographic cervical measurement was performed just before intravaginal prostaglandin was applied . these methodological differences may explain the different results found compared with the present study ( laencina et al . , 2007 ) . found that cervical length measured by ultrasound was an independent predictor of vaginal delivery within 24 h. however , the only indication for induction was prolonged pregnancy ( at 41 + 3/7 and 42 + 1/7 weeks of gestation ) in nulliparous women ( roman et al . , 2004 ) . in our study population , the multiple indications for induction of labour might explain the differences between these two studies . ( 1998 ) also found that the transvaginal ultrasonographic evaluation of the cervix before induction of labour does not improve the prediction of cervical inducibility obtained by the bishop score . ( 2007 ) , we chose a longer interval ( 96h ) between start of induction and vaginal delivery in order to avoid caesarean delivery as much as possible . although cervical length measured by ultrasonography appears to be a more objective and precise measure , other cervical variables might be involved in predicting ripeness of the cervix ; if this is so , then the bishop score is certainly more valuable than the cervical length measured by ultrasound . ( 2003 ) suggested that a combination of cervical length , posterior cervical angle and occipital position may be of more value in the prediction of induction of labour . in their study , the sonographic parameters were superior to the bishop score in predicting the outcome of induction ; however , the odds ratios were moderate . a limitation of our study is the small numbers involved in the indications for induction of labour . a future study with larger numbers of women is required in order to make subgroup analyses for different indications . it is encouraging , however , that in their study on 240 women , pandis et al . ( 2001 ) found the same optimal cut - off point for the bishop score ( i.e. 3 ) as we found in our study . in conclusion , the present study indicates that the bishop score is a predictor of successful vaginal delivery in nulliparous women , and that ultrasound measurement of cervical length does not contribute to the prediction of successful vaginal delivery . over a period of 96 h ( with cardiotocography monitoring ) , it appears to be a safe procedure to start induction of labour with prostaglandins and , if necessary , followed by administration of oxytocin . in our study population this resulted in a success rate of 80% vaginal delivery and a low caesarean delivery rate of 17% . vaginal examination is necessary to evaluate the progress of induction of labour , and in our experience the art of manual assessment still exists in clinical practice . | objectives : to compare the value of transvaginal ultrasonographic measurement of the cervical length versus the bishop score , prior to induction of labour , in predicting the mode of delivery within four days.materials and methods : this longitudinal study included 110 women ( at term , singleton , vertex presentation ) in whom induction of labour was performed at 37 - 42 weeks of gestation .
cervical length on transvaginal ultrasound and the bishop score were assessed prior to induction according to standard protocol .
medical records were reviewed for relevant demographic and clinical data.primary outcome criterion was successful vaginal delivery within 96 h. univariate analyses and receiver operating characteristic ( roc ) curves were used to examine differences between variables possibly predicting outcome.results : of the 110 women 66 were nulliparous and 44 multiparous .
vaginal delivery within 96 h was successful in 48 ( 73% ) nulliparous and in 40 ( 91% ) multiparous women ( i.e. in 80% of the total population ) .
the overall rate of caesarean delivery was 17%.there was a significant difference between nulliparous and multiparous women in age , cervical length ( mean in mm in nulliparous women : 29.31 , range : 5.00 - 56.00 ; in multiparous women : 37.04 , range : 12.00 - 56.00 ) , bishop score and successful induction , but no significant difference between these subgroups in neonatal outcomes.only the bishop score in nulliparous women showed a significant relationship between this variable and predicting successful labour induction ( area under the roc curve 0.679 ; standard error 0.73 ; p < 0.05 ; 95% ci : 0.536 - 0.823).the best cut - off value for the bishop score was 3 , with a sensitivity of 56.3% and a specificity of 72.2%.conclusion : in this study group significant independent prediction of vaginal delivery within 96 h is provided by the bishop score but only in nulliparous women .
transvaginal ultrasonographic measurement of cervical length is not a significant independent predictor of vaginal delivery within 96 h. |
f - box and wd40 domain - containing protein 7 ubiquitin - specific protease 28 skp1cullin1f - box protein fbw7 , the substrate recognition subunit of the scf ( skp1cullin1f - box protein ) ubiquitin ligase , promotes ubiquitination and turnover of multiple oncoproteins . mutations in fbw7 frequently occur in human cancers ( most notably in colorectal carcinomas and t - cell leukemias ) and compromise substrate ubiquitination . accumulation of fbw7 substrates , such as myc , mcl1 , and cyclin e , fuels tumorigenesis by driving cell proliferation , survival , and genomic instability . fbw7 also promotes its own degradation via autocatalytic ubiquitination , either in response to signaling or when substrate levels become low . fbw7-dependent substrate ubiquitination is countered by the usp28 deubiquitinating enzyme . in human tumor cell lines , shrna - mediated depletion of usp28 downregulates myc levels and attenuates proliferation . as a cysteine protease that stabilizes myc , a key driver of cancer progression , interestingly , however , recent studies have revealed a range of genetic alterations in usp28 in human tumors , including amplifications , deletions , and point mutations . for example , usp28 is overexpressed in colorectal and ovarian carcinomas , whereas prostate carcinomas and melanomas harbor recurrent focal deletions at the usp28 locus . furthermore , usp28 protein expression is downregulated in several cancer types relative to normal tissue , suggesting that loss of usp28 may also be beneficial during tumorigenesis . analysis of usp28 knockout mice may help reconcile these controversial observations . as expected from in vitro studies , ablation of one allele of usp28 in contrast , complete loss of usp28 produces tissue - specific effects in the intestine fbw7 substrates are further downregulated whereas in other tissues , including lung , liver , and pancreas , they match or exceed the wildtype levels . interestingly , fbw7 is regulated reciprocally ; it remains stable upon loss of usp28 in the intestine but is downregulated in most other tissues and in cultured mouse embryonic fibroblasts ( mefs ) , suggesting that usp28 controls fbw7 stability in a tissue - specific manner . indeed , experiments in mefs and human tumor cells demonstrate that usp28 directly deubiquitinates and stabilizes fbw7 . importantly , deubiquitination of fbw7 requires significantly lower levels of usp28 than needed for fbw7 substrates , explaining the differential response to mono- and biallelic deletion of usp28 . apparently , half of the normal dose of usp28 maintains stable fbw7 , but is not sufficient for fbw7 substrate stabilization . in contrast , complete knockout of usp28 triggers autocatalytic ubiquitination and degradation of fbw7 , sparing fbw7 substrates . autocatalytic ubiquitin transfer by fbw7 consistent with these findings , inhibition of pin1 restores fbw7 levels and drives fbw7 substrate degradation in usp28-null mefs . in tissues of usp28 knockout mice , pin1 expression inversely correlates with fbw7 levels , suggesting that the abundance or activity of pin1 may determine the outcome of usp28 loss for fbw7 substrates . usp28-dependent control of fbw7 and its substrates closely resembles regulation of mdm2 and p53 by the hausp deubiquitinase . hausp stabilizes both mdm2 and p53 , but its higher affinity for mdm2 results in a biphasic response to the loss of hausp . other deubiquitinase ligase pairs will likely exhibit a similar relationship , revealing a common regulatory paradigm in ubiquitin networks . we propose that dual control of fbw7 activity by usp28 maintains physiological levels of fbw7 substrates during homeostasis ( fig . 1 ) . activation of usp28 will stabilize both fbw7 substrates and fbw7 , suppressing prolonged accumulation of proto - oncoproteins . a similar principle is observed in the regulation of several oncogenic transcription factors ; for example , phosphorylation events that activate myc and jun simultaneously prime them for degradation , creating a time - restricted window of activity . potentially , such mechanisms evolved as safeguards against unscheduled activation of proto - oncoproteins and the emergence of cancer - initiating cells . usp28 limits fbw7-mediated ubiquitination of proto - oncogenic substrates , but primarily deubiquitinates and stabilizes fbw7 . during homeostasis , the fbw7usp28 complex maintains low levels of fbw7 substrates . loss of usp28 triggers autocatalytic ubiquitination and turnover of fbw7 , leading to the accumulation of fbw7 substrates and promoting oncogenic transformation . overexpression ( oe ) of usp28 blocks both autocatalytic and substrate - directed ubiquitination by fbw7 and equivalently enhances cell transformation . usp28 limits fbw7-mediated ubiquitination of proto - oncogenic substrates , but primarily deubiquitinates and stabilizes fbw7 . during homeostasis , the fbw7usp28 complex maintains low levels of fbw7 substrates . loss of usp28 triggers autocatalytic ubiquitination and turnover of fbw7 , leading to the accumulation of fbw7 substrates and promoting oncogenic transformation . overexpression ( oe ) of usp28 blocks both autocatalytic and substrate - directed ubiquitination by fbw7 and equivalently enhances cell transformation . in a cell culture model of oncogenic transformation , loss of usp28 strongly upregulates fbw7 substrates and promotes anchorage - independent growth ( fig . 1 ) . intriguingly , ectopic expression of usp28 in this system equivalently stabilizes fbw7 substrates and promotes transformation , despite highly increased levels of fbw7 . thus , opposite extremes of usp28 abundance produce equivalent phenotypes through opposite mechanisms : complete loss destabilizes fbw7 , whereas overexpression stabilizes both fbw7 and its substrates . a prediction derived from our analysis is that usp28 may function as a tumor promoter or suppressor in different tissues , depending on whether the signaling context favors autocatalytic ubiquitination of fbw7 . in the intestine accordingly , in a mouse model of apc - driven driven intestinal cancer , ablation of usp28 attenuates tumorigenesis and prolongs survival . in tissues where the signaling favors autocatalytic turnover of fbw7 , deletion of usp28 may functionally mimic fbw7 loss - of - function and promote tumorigenesis . our observations in mefs predict that under these conditions , loss and overexpression of usp28 may equivalently upregulate fbw7 substrate levels and help establish or maintain the malignant state . we imagine that bifunctional regulatory motifs , similar to the usp28fbw7fbw7 substrate circuit , are widespread in signaling networks and could explain the occurrence of opposite genetic alterations of a single gene in cancer . work in the popov laboratory is supported by the german research foundation ( dfg research grant po14583/1 and po14584/1 ) and by an institutional grant from the deutsche krebshilfe . | the usp28 deubiquitinase antagonizes fbw7-mediated turnover of multiple oncoproteins , including myc , jun , and notch , and promotes tumorigenesis in the intestine .
our recent study reveals that usp28 also counteracts autocatalytic ubiquitination of fbw7 , suggesting a complex role for usp28 in the regulation of fbw7 activity and tumor development . |
mechanical aids fail to adequately remove plaque biofilm , for which chemical plaque control is often recommended as an adjunct to mechanical plaque control to help maintain gingival health . a number of chemical agents like phenolic compounds , bis - biguanides , pyrimidines , quaternary ammonium compounds , oxygenating agents , halogens , heavy metal salts which have antiseptic or antimicrobial action have been used , with variable success , to inhibit plaque formation and the development of gingivitis . chlorhexidine ( chx ) is the most studied and effective antiseptic for plaque inhibition and prevention of gingivitis when used twice daily as mouth rinse . chx besides its side effects including : brown discoloration of the teeth , some restorative materials and mucosa ; bitter taste and a slight increase in supragingival calculus formation is known as gold standard of antimicrobial rinses because of broad - spectrum activity and substantivity of 812 h. in order to overcome such side effects the world health organization advice researchers to investigate the possible use of natural products such as herb and plant extracts . a number of clinical studies have shown the effects of using mouthwashes extracted from herbs such as myrtus communis , qureucus infectoria , capparis spinosa , and cinnamon in the prevention of dental plaque accumulation and subsequent gingival inflammation . there is the minimum evidence that proves the efficacy of herbal mouth rinses and their ability to control plaque - induced gingivitis . thus , the aim of this study was to evaluate the clinical changes after the usage of herbal oral rinse and 0.12% chx . this randomized controlled clinical trial was carried out in the department of periodontology and implantology , m a rangoonwala college of dental sciences and research center , pune . the study population consisted of 152 individuals , who were systemically healthy , between 20 and 50 years of age and with moderate to severe plaque - induced gingivitis were enrolled in the study . they were equally distributed in the test ( n = 76 ) and the control group ( n = 76 ) . participants were excluded from the study if they suffered from nonplaque induced gingivitis or periodontitis , history of antibiotic use and use of any form of herbal products in the last 90 days , need for antibiotic premedication , patients using mouth rinse within the last 3 months , pregnant women , habit of smoking or any form of smokeless tobacco and with systemic diseases . patients were selected on the basis of inclusion and exclusion criteria and were randomly assigned using a coin toss to :
group i ( test group ) : hiora herbal oral rinse that consists of piper betle ( nagavalli ) , bhibhitika ( terminalia bellerica ) , pilu ( salvadora persica ) commonly known as meswak , gandharpura tailum , yavani , ela , peppermint satvagroup ii ( control group ) : peridex that consists of 0.12% chx . group i ( test group ) : hiora herbal oral rinse that consists of piper betle ( nagavalli ) , bhibhitika ( terminalia bellerica ) , pilu ( salvadora persica ) commonly known as meswak , gandharpura tailum , yavani , ela , peppermint satva group ii ( control group ) : peridex that consists of 0.12% chx . the clinical examination included gingival index ( lo and silness , 1967 ) and plaque index ( silness and lo , 1964 ) which were recorded at baseline and postoperatively after 21 days . all the patients in group i and group ii were instructed to use the assigned mouth rinse 15 ml twice daily for 30 s in conjunction to their normal oral hygiene routine . participants from both the groups were advised to use the colgate medium bristle toothbrush and colgate total toothpaste . patients were recalled at weekly interval to check for the oral hygiene and the oral hygiene was reinforced in noncompliant patients . is done using independent sample t - test after confirming the underlying normality assumption . within group statistical comparison of all the parameters is done using paired sample t - test after confirming the underlying normality assumption of differences . the relative percentage change in both the parameters is calculated using following the formula : ( baseline - 21 days ) 100/(baseline ) . is done using independent sample t - test after confirming the underlying normality assumption . within group statistical comparison of all the parameters is done using paired sample t - test after confirming the underlying normality assumption of differences . the relative percentage change in both the parameters is calculated using following the formula : ( baseline - 21 days ) 100/(baseline ) . group i did not yield statistically significant results than group ii in the proportion of gingival index scores and plaque index scores of baseline parameters [ table 1 ] . intergroup comparison of baseline parameters when within group comparison of pretreatment and posttreatment scores was done , plaque index scores of posttreatment were statistically significant [ table 2 ] . when between group comparison of relative percentage change in study parameters was done group ii results were statistically significant as compared to group i [ table 3 ] . intragroup comparison of pre- and post - mouthwash treatment ( plaque index ) inter group comparison of relative percentage change in study parameters when within group comparison of pretreatment and posttreatment scores was done , gingival index scores of posttreatment were statistically significant [ table 4 ] . when between group comparison of relative percentage change in study parameters was done group ii results were statistically significant as compared to group i [ table 3 ] . when within group comparison of pretreatment and posttreatment scores was done , plaque index scores of posttreatment were statistically significant [ table 2 ] . when between group comparison of relative percentage change in study parameters was done group ii results were statistically significant as compared to group i [ table 3 ] . intragroup comparison of pre- and post - mouthwash treatment ( plaque index ) inter group comparison of relative percentage change in study parameters when within group comparison of pretreatment and posttreatment scores was done , gingival index scores of posttreatment were statistically significant [ table 4 ] . when between group comparison of relative percentage change in study parameters was done group ii results were statistically significant as compared to group i [ table 3 ] . the purpose of this study was to determine the comparative effects of herbal oral rinse ( hiora ) to 0.12% chx ( peridex ) on gingival health and plaque accumulation over time . hiora herbal oral rinse consists of p. betle ( nagavalli ) , bhibhitika ( t. bellerica ) , pilu ( s. persica ) commonly known as meswak , gandharpura tailum , yavani , ela , peppermint satva . suggests that there are certain ingredients in herbal oral rinses that exhibit evidence of anti - inflammatory and anti - fungal therapeutics effects . it is a medicinal plant that has been used by many people in africa , south america , middle east and asia . s. persica contains a number of identified antimicrobials and prophylactic components including fluorides , alkaloids , sulfur compounds and volatile oils such as benzyl isothiocyanate . they alter the characteristics of the early plaque settlers streptococcus sanguinis , streptococcus mitis and actinomyces species and make them less adherent . the anionic components s. persica has an antimicrobial activity against streptococcus aureus , streptococcus mutans , streptococcus fecalis , lactobacillus , pseudomonas aeruginosa , and candida albicans . in this regards , almas et al . compared antimicrobial activity of eight commercially available mouth rinses and 50% miswak extract against seven microorganisms . they found that mouth rinses containing chx had the maximum antibacterial activity while miswak extract had low antibacterial activity . hydrochavicol in p. betle inhibits expression of pro - inflammatory cytokine , tumor necrosis factor- , disrupts the permeability barrier of the microbial membrane of s. mutans and actinomyces species and also has an astringent action . methyl salicylate in gandharpura taila , cineole in ela , thymol in yavani and menthol in peppermint satva impart a fragrant and refreshing effect . additional research conducted by scherer et al . demonstrated that herbal oral rinse reduced gingival bleeding after 3 months of use as compared to placebo . chlorhexidine is effective against an array of microorganisms including gram - positive and gram - negative organisms , fungi , yeast and viruses . the ability of an oral rinse to be retained in the oral cavity and maintain potency over an extended length of time has been debated . lang stated the substantivity of an antimicrobial agent needs sufficient contact time with a microorganism in order to inhibit or kill it . chx , with a substantivity of 12 h is considered to be highly effective ; whereas , the substantivity of herbal mouth rinse is unknown . hence , in the present study , comparison was made between herbal oral rinse ( hiora ) and 0.12% chx ( peridex ) to see their effectiveness . in this study , there was a statistically significant reduction in the proportion of gingival index scores and plaque index scores in the chx group . however , in a study done by chatterjee et al . , 2011 herbal oral rinse is equally effective in reducing periodontal indices as chx . however , there is not enough statistically significant evidence to suggest that herbal oral rinse had a greater effect in reducing gingival index scores . with the proliferation of herbal oral care products , it is important for clinicians to make evidence - based decisions when making product recommendations . research needs to be conducted to determine the substantivity of herbal mouth rinse as well as to determine its antimicrobial effects on gingivitis , plaque biofilm accumulation , and related bacteria . suggestions for future studies include : ( 1 ) expand study population to include broader disease status , and varied age group ( 2 ) extend study to 6 months ( 3 ) add stains and calculus indices . within the limitations of the study when herbal oral rinse was compared to 0.12% chx , 0.12% chx mouth rinse effectively reduced the clinical symptoms of plaque - induced gingivitis , and had a statistically significant effect on the reduction of plaque scores . | background : chlorhexidine ( chx ) is considered as a gold standard of antimicrobial rinses .
various herbal oral rinses are available in the market .
however , little is known of its effectiveness.aim:the aim of this study was to evaluate the clinical changes after the usage of herbal oral rinse and 0.12% chx.materials and methods : in a randomized clinical trial , 76 patients with dental plaque - induced gingivitis were assigned to group i ( herbal oral rinse - hiora ) and 76 patients with dental plaque - induced gingivitis to group ii ( 0.12% chlorhexidine - peridex ) .
gingival index and plaque index scores were recorded at baseline and 21 days after scaling.results:intragroup comparison in both groups showed that plaque index and gingival index scores were statistically significant after 21 days as compared to baseline .
intergroup comparison showed that plaque index scores and gingival index scores were statistically significant in group ii as compared to group i.conclusion:when herbal oral rinse was compared to 0.12% chx , 0.12% chx mouth rinse effectively reduced the clinical symptoms of plaque - induced gingivitis . |
mycoses of the glabrous skin are predominantly triggered by dermatophytes , while members of the trichophyton genus , including trichophyton rubrum , are among the most commonly diagnosed fungal pathogens in poland . raubitschekii are usually found in africa , southeast asia , australia and south america [ 1 , 2 ] . in recent years , however , there have been a few cases in germany and italy ; hence , the pathogen should be considered as undoubtedly present in europe [ 3 , 4 ] . to date , there has been no described case of an infection caused by this pathogen in poland . a 34-year - old polish caucasian male was admitted to the dermatology clinic of the poznan university of medical sciences due to the presence of an erythematous , exfoliating , clearly distinct lesion located on the index finger of the right hand , spreading onto surrounding areas ( figs . 1 , 2).fig . 1side of the index finger hospital admission datefig date of the second sample acquisition during the follow - up appointment at the department of medical mycology , poznan university of medical sciences side of the index finger date of the second sample acquisition during the follow - up appointment at the department of medical mycology , poznan university of medical sciences the first signs of the disease had appeared in august 2012 , after a contact with raw fish the patient is a cook . due to a suspicion of erysipeloid , the patient underwent an antibiotic therapy ( intravenous clindamycin , 2 600 mg daily , for the period of 5 days ) coupled with steroids administered topically . a swab for bacteriological , skin biopsy for histopathological and a sample for mycological examinations were acquired . other examinations , such as the mycological culture and histopathology , were awaited for during the stay of the patient at the clinic . due to the lack of significant improvement , the patient was discharged , while any further procedures were performed on an outpatient basis at the dermatology counseling service of the clinic . the results of the histopathological examination indicated a widened , swollen epidermis with a thickened stratum granulosum and a thick stratum corneum , in which there were numerous , round , fungal spores of 2.5 m in diameter ( figs . 3 , 4 ) . due to discrepancies in the results , a second sample for mycological examination was acquired during a follow - up appointment . 3a thickened , swollen epidermis . a thick stratum corneum with numerous pathogenic fungi . moderate , mixed inflammatory infiltrates present in the dermis . hematoxylin and eosin stain , objective lens magnification : 10fig . hematoxylin and eosin stain , objective lens magnification : 60 a thickened , swollen epidermis . a thick stratum corneum with numerous pathogenic fungi . hematoxylin and eosin stain , objective lens magnification : 10 numerous spores in the stratum corneum . hematoxylin and eosin stain , objective lens magnification : 60 itraconazole ( daily dose 100 mg ) was administered orally . the mycological cultures were maintained for 20 days at 25 c on two kinds of media : sabo sabouraud dextrose agar with chloramphenicol and sabo sabouraud dextrose agar with chloramphenicol and actidione . a fungal colony with a reddish brown color and a brownish reverse , strongly furrowed , suede - like surface and a raised center 6 ) . a urease test , carried out on christiansen s medium , and dermatophyte test medium examination were both positive . since the strain matched the original description , it was identified as t. rubrum var . a 20-day - old colony grown on sabouraud agar mediumfig . 6
trichophyton rubrum var . raubitschekii . microscopic image ( magnification 400 , lactophenol cotton blue ) . raubitschekii . microscopic image ( magnification 400 , lactophenol cotton blue ) . numerous macro- and microconidia the following 3 weeks brought a further improvement in the dermatological status ( fig . it was decided to continue the itraconazole treatment while the topical drug was switched to a pyridinone derivative . the patient received itraconazole for a period of 2 months , yet due to low tolerance to the topical drug , the pyridinone derivative was no longer administered . afterward , the patient showed no signs of the infection.fig . 7
top of the right hand after 3 weeks of itraconazole treatment
top of the right hand after 3 weeks of itraconazole treatment in order to reassess the diagnosis , we analyzed a ribosomal rna genomic fragment and the urease gene of this isolate as described by hiruma et al . . because the isolate ceased to grow on any new media , we isolated its dna from a plate deposited for long - term storage at our clinic . one hundred and twenty milligrams of the colony was acquired from the deposited agar plate and ground in liquid nitrogen . dna was isolated with the use of the column - based genematrix plant & fungi dna purification kit ( eurx , poland ) that includes both rnase a and proteinase k. firstly , we analyzed a fragment containing partial 18s rrna gene , its1 , 5.8s rrna gene , its2 and partial 28s rrna gene with the use of common its1 and its4 primers for pcr and sequencing . pcr was performed with the following ingredients : 25 pmol of its1 and its4 primers each , 0.5 l of faststart taq dna polymerase ( 2.5 u , roche ) , 10 l of 5 gc - rich solution , 5 l of 10 pcr buffer with 20 mm mgcl2 , 1 l of dntps ( 10 mm each ) , 5 ng of dna sample , all in a volume of 50 l . pcr was performed with the following program : pre - denaturation4 min , 95 c ; amplification35 [ denaturation : 1 min , 95 c ; annealing : 1 min , 55 c ; elongation : 1 min , 72 c ] ; cooling : 1 min , 40 c . gel electrophoresis and paired - end sequencing revealed a 692-bp - long fragment , presenting a 100 % coverage with multiple genbank t. rubrum entries and with our own t. rubrum reference strain . secondly , urease gene fragment was amplified by pcr with the following ingredients : 25 pmol of trure1s and trure1r primers each , 0.5 l of faststart taq dna polymerase ( 2.5 u , roche ) , 10 l of 5 gc - rich solution , 5 l of 10 pcr buffer with 20 mm mgcl2 , 1 l of dntps ( 10 mm each ) , 0.5 l of dmso , 5 ng of dna sample , all in a volume of 50 l . touchdown pcr was performed with the following program : pre - denaturation4 min , 95 c ; amplification35 [ denaturation : 1 min , 95 c ; annealing 1 min , 6963 c , step size 0.5 c , step delay 0 ; elongation : 1 min , 72 c ] ; cooling1 min , 40 c . gel electrophoresis revealed that the product was approximately 330 bp long , suggesting a urease - positive t. rubrum rather than t. rubrum var . , the genomic sequence of a raubitschekii urease amplicon should also include a 68-bp intron and a 9-bp - long coding insertion ( ddbj ab719058 , cbs 100084 ) . this analysis revealed a sequence of 329 bp ( including primers ) presenting a 100 % coverage with xm_003233873 ( t. rubrum cbs 118892 urease ( terg_05790 ) mrna ) and with the corresponding genomic sequence ( nw_003456423.1 , gene i d : 10376003 ) . both the 68-bp intron and the 9-bp insertion , specific to the cbs 100084 raubitschekii strain , were missing . based on these results , it is more likely that the isolate was , in fact , a urease - positive t. rubrum.fig . 8gel electrophoresis of the urease gene pcr amplicon . left lane approximately 329-bp fragment , right lane puc19 dna / mspi marker ( fermentas ) gel electrophoresis of the urease gene pcr amplicon . left lane approximately 329-bp fragment , right lane puc19 dna / mspi marker ( fermentas ) initially , it had been described as a separate species trichophyton raubitschekii [ 5 , 9 ] , yet molecular studies revealed it to be a variant of t. rubrum [ 4 , 8 ] . it was described to differ from other t. rubrum variants by a limited growth , reddish brown color , the presence of numerous macro- and microconidia and the ability to produce urease [ 5 , 8 , 10 ] . noteworthy , the polish taxonomic key in operation states that the urease activity is the criterion for differentiation between t. rubrum var . the characterization of urease - positive t. rubrum that are distinct from t. rubrum var . raubitschekii has clearly complicated the diagnostic process [ 2 , 7 ] . the vast majority of t. rubrum var . raubitschekii cases originate in asia , africa and south america [ 1 , 2 , 12 ] . furthermore , he did not claim contacts with anyone traveling to these regions , nor with people showing lesions that might be mycotic . furthermore , brasch et al . described a different german case , involving a 32-year - old male cameroonian student with well distinct , erythematous , exfoliating lesions located on the abdomen as well as on both hands . a culture grown on sabouraud medium at 26 c and a urease test led to the diagnosis of t. rubrum var . both the cameroonian and the described polish patients responded well to their oral itraconazole treatments . to date , there have been eight described cases in central europe . the described polish case is exceptional , as it appears not to be linked with africa in any way . cultures and urease tests were performed on samples originating from different parts of the skin of 95 greek and 10 bulgarian patients . the pathogen originated from lesions of tinea manuum ( one case ) , tinea corporis ( one case ) , tinea cruris ( one case ) and tinea unguium ( three cases ) . the group originated from and resided in greece and bulgaria at the time of the study . they all had not traveled to the aforementioned endemic regions nor abroad for the past 6 months . raubitschekii will probably become the method of choice for distinguishing between the quite alike urease - positive t. rubrum and t. rubrum var . the procedure is straightforward and can easily be modified for probe or melting curve assays . for the time being , it has to be approached with caution as only one t. rubrum var . raubitschekii isolate ( cbs 100084 ) has been analyzed in this way so far . at the moment , public whole genome sequencing projects include multiple t. rubrum and two t. rubrum var . the results of these projects may answer the question whether the urease allele of the cbs 100084 strain is the specific marker of all t. rubrum var . raubitschekii isolates , as suggested by hiruma et al . in the meantime , we encourage other researchers to reassess their t. rubrum var . rubrum , there seems to be a necessity of including both into the polish and other central european diagnostic schemes , as their identification obviously poses a challenge at the moment . moreover , it is noteworthy that the histopathological examination turned out to be very useful , if not necessary , in the diagnostic process . it enabled the adequate treatment to be implemented even before the results of the mycological cultures and molecular studies were available . | we report a case of a 34-year - old polish caucasian male who was diagnosed with tinea manuum caused by trichophyton rubrum var . raubitschekii
. it would be the first described case of a dermatophytosis caused by this fungus in poland and one of a few cases in central europe described so far .
admittedly , it would be the first case in central europe with no evidence pointing to african origin .
the clinical condition improved after administering itraconazole ( daily dose 100 mg orally ) supplemented with a topical treatment , while the patient was totally cured after 2 months .
the histopathological examination turned out to be highly useful in the diagnostic process .
the genetic analysis of the urease gene pointed to a urease - positive t. rubrum rather than t. rubrum var .
raubitschekii . |
histologically it can be categorized as one of five histologic subtypes : capillary , cavernous , venous , arteriovenous or mixed . case reports describe hemangiomas of the chest wall arising from intercostal muscles ( intramuscular , intercostal ) or from the medullary canal of the rib ( bone hemangioma ) . we describe a patient with an intercostal venous hemangioma presenting as a chest wall tumor , for which resection of the chest wall was successfully accomplished . a 36-year - old male was admitted to the clinic of thoracic surgery for a slowly progressing chest mass and six - month pain of the thoracic spine and left chest . there was no medical history of trauma of the chest wall and no oncological disease . during clinical examination a slowly growing soft resistance located dorso - laterally in the range of the seventh to ninth rib on the left chest chest magnetic resonance ( mr ) imaging showed a well - bordered tumor of the left chest wall , with a size of 9.5 x 9 x 3 cm with calcifications , overgrowing to the seventh and eighth intercostal space ( fig . the patient underwent surgery . a complete resection of the tumor with the left seventh , eighth and ninth ribs and their intercostal muscles was successfully accomplished ( fig . microscopically , structures of benign vascular lesions corresponding to intramuscular venous hemangioma with numerous phleboliths were found in adipose tissue and striped muscle in the resected chest wall . the patient was discharged on the seventh postoperative day , and presently , ten months after the operation , he is doing well , without any evidence of local recurrence . coronal t2-weighted mr images of the intercostal hemangioma of the chest wall ( a ) and enhancement by contrast media ( b ) reconstruction of the chest wall with used polypropylene mesh ( a ) . intramuscular hemangiomas occur most often in people under 30 years of age and show no sex predilection . generally they are considered to be congenital , but factors such as chest trauma or repetitive bruises may play a role in development of intramuscular hemangioma [ 2 , 3 ] . patients with intercostal hemangioma clinically may present with palpable mass of the thoracic wall , soft - tissue bulging , pain or a combination of these signs and symptoms . intercostal hemangioma should be included in the differential diagnosis of primary soft tissue chest wall tumors , such as fibromas , lipomas , giant cell tumors , neurogenic tumors , desmoids , soft tissue sarcomas , connective tissue tumors and metastatic tumors . conventional radiography hemangiomas may be seen as an ill - defined soft - tissue mass . regional ribs may show periostitis , trabecular coarsening and cortical changes such as thickening , thinning or erosion . computed tomography ( ct ) of the chest localizes and characterizes chest wall hemangioma , its effect on adjacent structures and it can also reveal phleboliths . a preliminary diagnosis may be established by mr examination , when classic mr findings are present : tumor mass of low or intermediate signal intensity in t1-weighted images and a high signal intensity in t2-weighted images ( vascularity is manifested as a high signal intensity ) . invasive diagnostic techniques , such as open or percutaneous ( ct - guided or echo - guided ) needle biopsy are also available , but needle biopsy of hemangioma may cause bleeding . in the case of big hemangiomas , a preoperative embolization of hemangiomas with the aim to minimize the risk of intraoperative complications like excessive bleeding , intercostal hemangiomas are managed by complete surgical chest wall resection with clean surgical margins . the next decision about skeletal reconstruction posterior defects that lie above the fourth rib and are covered by the scapula do not need to be reconstructed . the choice of synthetic prosthetic material depends on the location of the defect , its size and surgeon 's preference and experience . in conclusion presumptive diagnosis was based on mr , resection was performed for definitive diagnosis and treatment . | the authors describe a case of a 36-year - old patient who had six months pain of the thoracic spine and left chest .
a soft slowly growing resistance was present on the dorso - lateral side of the left chest wall , in the range of the seventh to ninth rib . according to the medical history
, the patient did not have any prior trauma and malignancy .
a well - defined tumor of the left chest wall with calcifications , which grew to the seventh and eighth intercostal space , was present on computed tomography ( ct ) and magnetic resonance ( mr ) scans .
the patient underwent resection of the tumor with the chest wall and reconstruction with polypropylene mesh .
histologically , it was a venous hemangioma , one of very rare tumors of the chest wall . |
particularly , the formation of a friable floating thrombus in the proximal aortic arch creates a life - threatening risk of stroke and peripheral embolization ( 1 , 2 , 3 , 4 , 5 ) . here , we present the case of an 82-year - old woman with massive thoracoabdominal aortic thrombosis secondary to iatrogenic cushing syndrome . to our knowledge , this is the first reported case in which massive thoracoabdominal aortic thrombosis with a proximal floating end occurred secondary to iatrogenic cushing syndrome . an 82-year - old woman was admitted to the emergency department for dyspnea ( new york heart association class iii ) . her history included rheumatoid arthritis with long - term glucocorticoid treatment ( including deflazacort 9 mg ) for 20 years . her vital signs were as follows : blood pressure , 110/70 mm hg , pulse , 83/min , and respiratory rate , 20/min . physical examination revealed central obesity , a rather ambiguous buffalo hump , short neck , and moon face . a diagnosis of iatrogenic cushing syndrome was made based on the clinical presentation , such as the history of steroid administration and cushingoid morphology . laboratory tests were normal except for elevated n - terminal b - type natriuretic peptide , creatine kinase mb fraction , troponin t , and d - dimer ( 5264 pg / ml , 19.73 ng / ml , 0.268 ng / ml , and 1809 ng / ml , respectively ) . laboratory tests for thrombophilia ( including lupus anticoagulant , anticardiolipin antibodies , and antiphospholipid antibodies ) and internal malignancy screens were negative . two - dimensional transthoracic echocardiography ( tte ) demonstrated an anterior wall motion abnormality and prominent epicardial fat . a suprasternal notch view showed large thrombi in the aortic arch with a proximal floating end ( fig . aortic computed tomography ( ct ) was performed using a 128-slice scanner ( ingenuity ct , philips healthcare , best , the netherlands ) . contrast - enhanced electrocardiography ( ecg)-gated ct was performed from the mid - neck to the inguinal level in a craniocaudal direction using the following parameters : a detector collimation of 64 0.625 mm , a gantry rotation time of 330 ms , tube voltage of 100 kv , and 200 mas per rotation . an aortic ct scan showed extensive thrombi from the distal ascending thoracic aorta to the proximal descending thoracic aorta and distal abdominal aorta ( fig . thrombi were not detected in arch vessels , including the brachiocephalic trunk , left common carotid , and subclavian arteries . coronary ct angiography ( ccta ) was performed using a 640-slice scanner ( aquilion one , toshiba medical systems , nasu , japan ) . contrast - enhanced ecg - gated coronary ct was performed from 2 cm below the carina to upper abdomen level in a craniocaudal direction using the following parameters : a detector collimation of 320 0.5 mm , a gantry rotation time of 350 ms , tube voltage of 100 kv , and 50 mas per rotation . ccta demonstrated a suspicious tight stenosis without definite plaque in the mid left anterior descending coronary artery ( fig . we prescribed hydrocortisone 10 mg once daily after the diagnosis of thrombus due to adrenal insufficiency . another aortic ct scan and tte were performed 3 weeks later , showing a slightly decreased amount of thrombus in the thoracic and abdominal aorta ( fig . a follow - up suprasternal notch tte view showed that the amount of thrombus in the aortic arch had decreased and the proximal floating end of the thrombus had disappeared ( fig . aortic thrombosis is an uncommon , often serious , condition that most commonly involves the abdominal aorta . formation of a friable floating thrombus , particularly in the proximal aortic arch , creates a life - threatening risk of stroke and peripheral embolization ( 1 , 2 , 3 , 4 , 5 ) . many factors , such as atherosclerosis , dissection , trauma , malignancy , and coagulopathies , have been associated with aortic thrombosis . it has been demonstrated that steroids may cause direct endothelial injury of large arterial vessels ( 6 ) . steroids may act directly on the vascular system , inducing intimal thickening in some predisposed persons . intimal hyperplasia with or without overlying thrombosis has been reported in women who take oral contraceptives or who are pregnant , and in a few men with hepatic illnesses ( 7 , 8) . although malignancy and coagulopathies have been associated with aortic thrombosis , in our patient , the results of thrombophilia and internal malignancy screens were normal . however , the patient had been self - medicated with a potent glucocorticoid for 20 years . our assumption is that a hypercoagulable state resulting from the medication may have played a thrombogenic role in this case . ( 9 ) suggested that a high - dose glucocorticoids might augment hemostasis , which may contribute to unfavorable vascular events by increasing platelet activation and von willebrand factor - dependent thrombosis . treatment of the aortic thrombosis was considered essential because of the threat of serious systemic embolization . however , there is no consensus regarding whether anticoagulation therapy alone or surgical intervention leads to the most favorable result ( 3 ) . this condition seemed to be associated with myocardial ischemia resulting from a tight focal stenosis with an atheromatous plaque in the mid left anterior descending coronary artery , demonstrated with multidetector coronary ct angiography . however , we did not decide to conduct coronary angiography or revascularization of the coronary artery because of the massive aortic thrombosis . vascular thrombosis occurs in patients with cushing syndrome and is a relatively well - known complication . however , a huge floating extensive thrombus in the aorta has not been reported before . this is the first case in which the cause of massive thoracoabdominal aortic thrombosis with proximal floating end in a patient with iatrogenic cushing syndrome was confirmed by suprasternal notch tte view and a ct scan . | massive thoracoabdominal aortic thrombosis is a rare finding in patients with iatrogenic cushing syndrome in the absence of any coagulation abnormality .
it frequently represents an urgent surgical situation .
we report the case of an 82-year - old woman with massive aortic thrombosis secondary to iatrogenic cushing syndrome .
a follow - up computed tomography scan showed a decreased amount of thrombus in the aorta after anticoagulation therapy alone . |
one - third of patients with epilepsy have seizures that are resistant to pharmacological therapy . resective surgery is effective for patients with pharmacoresistant epilepsy who have a localized area of epileptogenic tissue in noneloquent cortex . these masses of disorganized neuronal tissue are usually associated with gelastic seizures , intellectual disabilities , and behavioral changes . tissue destruction can achieve seizure freedom rates ranging from 30 to 50% in mixed adult pediatric populations . a recent series of 14 patients treated with mri - guided stereotactic laser ablation of hypothalamic hamartomas achieved seizure freedom in 86% with a mean follow - up of nine months . none of these patients suffered focal neurological deficits , neuroendocrine disturbances , or memory losses . we present a young man who underwent mri - guided stereotactic laser ablation of a hypothalamic hamartoma following a right temporal lobectomy for resection of a focal cortical dysplasia . his case illustrates the need to assess for dual pathology in treatment of pharmacoresistant epilepsy and the potential complications of mri - guided stereotactic laser ablation . a 19-year - old right - handed man had attention deficit disorder and treatment - resistant focal epilepsy with weekly seizures ( behavioral arrest , incomprehensible speech , and postictal confusion ) since the age of nine . seizures persisted despite trials with 12 antiepileptic drugs used in up to three - drug combinations , steroids , intravenous gamma globulin , modified atkin 's diet , and a vagus nerve stimulator . on video - eeg , seizures involved bilateral changes evolving more over the right hemisphere . magnetoencephalography showed multifocal bilateral polyspike - and - wave discharges as well as right frontal temporal occipital discharges . magnetic resonance imaging demonstrated a subtle cortical abnormality in the right insula and frontal operculum , with subtle atrophy of the right fornix and mammillary body . neuropsychological testing targeting delayed memory recall showed story memory delayed recall ( dr ) 50th percentile , list learning dr 75th percentile , and figure copy dr 14th percentile ( table 1 ) . intracarotid amobarbital testing revealed left language dominance and right hemispheric memory impairment ( right hemisphere memory [ left injection ] score : 7/12 ; left hemisphere memory [ right injection ] score : 12/12 ) . when the patient was 17 years old , intracranial eeg monitoring with right hemispheric grids , strips , and depths captured 49 seizures : 32 had broad onset over the right lateral temporal , mesial temporal , frontal , and occipital lobes and insula , while 17 arose from depth electrodes in the right posterior mesial temporal lobe . he underwent resection of the right lateral temporal and mesial cortex , along with the inferior insula and frontal operculum . he remained active in varsity lacrosse , maintained a 3.5 gpa in a competitive high school , had a close circle of friends , and was accepted to his first - choice college . a brief neuropsychological screen revealed list learning dr 50th percentile , figure copy immediate recall ( ir ) , and dr 18th percentile ( table 1 ) . when he was 18 , repeat mri demonstrated the right temporal lobectomy and now an 8-mm hypothalamic hamartoma on the right , not recognized on multiple previous mri studies ( fig . in retrospect , the patient now admitted that his seizures both before and after the lobectomy included mirthless laughter . he was referred to a center with expertise at mri - guided stereotactic laser ablation and underwent this procedure . he reported feeling as though he was in a dream with events happening in a disjointed fashion . three weeks postoperative , he required hospitalization for agitation and suicidal ideation and was diagnosed with a severe amnestic syndrome with confabulation . video - eeg monitoring captured several complex partial seizures with impaired responsiveness and bilateral ictal discharges . repeat mri showed not only successful ablation of the hamartoma but also unexpected contrast enhancement that crossed the midline involving the bilateral medial mammillary bodies and adjacent anteromedial left thalamus ( fig . neuropsychological testing ( table 1 ) revealed a dense anterograde amnesia ( story memory ir 1st percentile , dr 0.1 percentile ; list learning ir 2nd percentile , dr 1st percentile ; and figure copy dr 1st percentile ) , with impaired attention and processing speed . neuropsychological testing ( table 1 ) eight months after hamartoma ablation demonstrated improved attention , concentration , and immediate recall but severe deficits in delayed recall ( story memory ir 13th percentile , dr 2nd percentile ; list learning ir 18th percentile , dr < 0.1 percentile ; and figure copy memory dr < 0.1 percentile ) . clinically , he has a disabling amnestic syndrome . he deferred his college education plans and is unable to drive because of ongoing seizures . they cause medically refractory epilepsy associated with some combination of gelastic and other seizure types , cognitive impairment ( epileptic encephalopathy ) , and behavioral changes including aggression . removal or destruction of the hamartoma can control seizures and improve cognition , especially in children . magnetic resonance imaging - guided laser ablation is a minimally invasive technique that uses mri - guided placement and application of thermal heat to destroy a tissue focus . among 14 patients with medically refractory epilepsy due to hypothalamic hamartoma who underwent stereotactic laser ablation , 11 ( 79% ) became seizure - free after a single treatment ; another patient became seizure - free after a second ablation ( 12/19 ; 86% ) . there were no surgical complications previously associated with traditional operative techniques , such as neuroendocrine disturbances , visual changes , or hemiparesis . our patient 's case is the first reported serious complication of mri - guided stereotactic laser ablation of hypothalamic hamartoma . the presence of bilateral postoperative changes in the mammillary bodies suggests that the laser ablation may have been sufficient to account for his deficits . one group reported on a patient who also presented with such dual pathology : a 35-year - old man who underwent removal of a left temporal subarachnoid cyst and resection of temporal neocortex for treatment of intractable complex partial seizures . similar to our patient , targeted questioning revealed that he had always experienced short outbursts of genuine laughter , which he had not felt was abnormal . postoperative mri , ictal pet , and spect revealed an 8-mm hypothalamic hamartoma retrospectively present on preoperative scanning . three other patients underwent partial or total resection of a hypothalamic hamartoma and later had temporal lobectomies . in two of these cases , there were no pathological abnormalities found in the resected temporal lobe tissue ; pathology in the third case is not described . secondary epileptogenesis was postulated as the cause of the temporal lobe focus after removal of the hypothalamic hamartoma . transient memory loss ( two months ) following lesionectomy of the hamartoma was seen in one of the cases but did not worsen further after the temporal lobectomy . by contrast , a fourth patient had mesial temporal sclerosis and a 5-mm hypothalamic hamartoma and presented with epigastric rising sensation , dizziness , and fear . video - eeg recording localized seizure onset to the right temporal lobe , and she became seizure - free after a right temporal lobectomy . gelastic seizures not only are associated with hypothalamic hamartomas but also occur with seizure foci due to diverse pathologies , including focal cortical dysplasias in the temporal , frontal , and parietal lobes . our case was unique in having both a hypothalamic hamartoma and pathologically confirmed focal cortical dysplasia . the hypothalamic hamartoma was missed at several academic medical centers but was present before the right temporal lobectomy , although subtle . mild brain shift from the original resection widened the appearance of the third ventricle and made the hamartoma obvious . our patient 's original seizures may have been attributable to the right temporal focal cortical dysplasia , the hypothalamic hamartoma , or a network involving the two abnormalities . anterograde amnesia can result from disruption of mesial temporal lobe structures or the mesial diencephalon . diencephalic ( mammillary bodies and medial thalamus ) pathology can result from alcoholism , malnutrition , infection , trauma , or infarct [ 1719 ] . however , many cases show damage involving other portions of the memory network , including the hippocampus . our case is unique since anterograde amnesia resulted from a right temporal lobectomy followed by an ablative lesion that unfortunately extended into both medial mammillary nuclei with greater involvement contralateral to the lobectomy . it is likely that the bilateral nature of the temporal diencephalic lesion led to amnesia . this case illustrates the potential for severe memory deficits following laser ablation of hypothalamic hamartomas . since many children who undergo this procedure are very young or have moderate - to - severe intellectual disability , it may be difficult to assess memory function in these individuals . it is worthwhile to consider dual pathology in epilepsy and the potential morbidity of mri - guided laser ablation of hypothalamic hamartomas , especially in a patient with a prior temporal lobectomy . | a 19-year - old man with cortical dysplasia and intractable focal seizures underwent a right temporal lobectomy .
a hypothalamic hamartoma was subsequently recognized , and he then underwent mri - guided stereotactic laser ablation .
unfortunately , he sustained damage to the bilateral medial mammillary bodies and suffered significant memory loss .
we review laser ablation therapy for hypothalamic hamartomas and the anatomy of the memory network .
we postulate that his persistent memory disorder resulted from a combination of the right temporal lobectomy and injury to the bilateral medial mammillary bodies . |
ready - to - use wafers for flow and control layers of the 640-chamber mitomi design from ( design name dtpad , stanford microfluidics foundry ) . the flow wafer features 15 m high features , rounded by photoresist reflow , whereas the control wafer features a rectangular cross - section . microfluidic chips were cast in polydimethylsiloxane ( pdms ) from these wafers . for the control layer , sylgard 184 ( dow corning ) base and curing agent were mixed at a ratio of 5:1 by weight , poured onto the wafer , degassed , and partially cured for 20 min at 80 c . for the flow layer wafer , a 20:1 base to curing agent mixture of sylgard 184 was spin - coated for 75 s at 1600 rpm and partially cured for 30 min at 80 c . the control layer chips were cut out , inlet holes were punched and the chips were aligned onto the spin - coated pdms on the flow layer wafer . after baking the two - layer chips for 90 min at 80 c , they were cut , removed from the wafer and inlet / outlet holes were punched . microfluidic chips were stored for up to 6 weeks . for the construction of the fusion proteins , a ratio of 0.07 pmol vector to 0.3 pmol of insert was used for the fusion reaction . the dockerin type i gene was isolated from the xylanase - dockerin type i construct with primers 3 and 4 . the genes of interest were designed in such a way that they already contained overlapping sequences with their neighboring partners ( pet28a and dockerin type i ) . in the case of the spectrin , two domains were linked with a flexible glycine - serine ( x6)-linker . for fibronectin , four type iii domains were fused separated by glycine - serine ( x6)-linkers . the expression vector in all cases was a pet28a plasmid with a modified multiple cloning site ( sequence attached ) . after construction , clones were verified via sequencing and amplified in neb5alpha e. coli cells . a 2460 mm # 1 thickness coverslip ( thermo scientific ) was silanized with 3-aminopropyldimethyl - ethoxysilane ( abcr ) following literature protocols . the dna solution containing 1 % ( w / v ) nuclease - free bovine serum albumin ( carl roth ) in nuclease - free water , was micro - spotted under humid atmosphere onto the silanized coverslip using the gix microplotter ii ( sonoplot ) and a glass capillary with a 30 m tip diameter ( world precision instruments ) according to the manufacturer s instructions in a rectangular 4016 pattern with 320 m column pitch and 678 m row pitch . alignment of the dna array and the microfluidic chip was done manually using a stereomicroscope . bonding between the glass cover slip and microfluidic device was achieved by thermal bonding for 5 h at 80 c on a hot plate . details on device operation and force spectroscopy measurements can be found in the supplementary information . ready - to - use wafers for flow and control layers of the 640-chamber mitomi design from ( design name dtpad , stanford microfluidics foundry ) . the flow wafer features 15 m high features , rounded by photoresist reflow , whereas the control wafer features a rectangular cross - section . microfluidic chips were cast in polydimethylsiloxane ( pdms ) from these wafers . for the control layer , sylgard 184 ( dow corning ) base and curing agent were mixed at a ratio of 5:1 by weight , poured onto the wafer , degassed , and partially cured for 20 min at 80 c . for the flow layer wafer , a 20:1 base to curing agent mixture of sylgard 184 was spin - coated for 75 s at 1600 rpm and partially cured for 30 min at 80 c . the control layer chips were cut out , inlet holes were punched and the chips were aligned onto the spin - coated pdms on the flow layer wafer . after baking the two - layer chips for 90 min at 80 c , they were cut , removed from the wafer and inlet / outlet holes were punched . a ratio of 0.07 pmol vector to 0.3 pmol of insert was used for the fusion reaction . the dockerin type i gene was isolated from the xylanase - dockerin type i construct with primers 3 and 4 . the genes of interest were designed in such a way that they already contained overlapping sequences with their neighboring partners ( pet28a and dockerin type i ) . in the case of the spectrin , two domains were linked with a flexible glycine - serine ( x6)-linker . for fibronectin , four type iii domains were fused separated by glycine - serine ( x6)-linkers . the expression vector in all cases was a pet28a plasmid with a modified multiple cloning site ( sequence attached ) . after construction , clones were verified via sequencing and amplified in neb5alpha e. coli cells . a 2460 mm # 1 thickness coverslip ( thermo scientific ) was silanized with 3-aminopropyldimethyl - ethoxysilane ( abcr ) following literature protocols . the dna solution containing 1 % ( w / v ) nuclease - free bovine serum albumin ( carl roth ) in nuclease - free water , was micro - spotted under humid atmosphere onto the silanized coverslip using the gix microplotter ii ( sonoplot ) and a glass capillary with a 30 m tip diameter ( world precision instruments ) according to the manufacturer s instructions in a rectangular 4016 pattern with 320 m column pitch and 678 m row pitch . alignment of the dna array and the microfluidic chip was done manually using a stereomicroscope . bonding between the glass cover slip and microfluidic device was achieved by thermal bonding for 5 h at 80 c on a hot plate . details on device operation and force spectroscopy measurements can be found in the supplementary information . | single - molecule force spectroscopy enables mechanical testing of individual proteins , however low experimental throughput limits the ability to screen constructs in parallel .
we describe a microfluidic platform for on - chip protein expression and measurement of single - molecule mechanical properties .
we constructed microarrays of proteins covalently attached to a chip surface , and found that a single cohesin - modified cantilever that bound to the terminal dockerin - tag of each protein remained stable over thousands of pulling cycles .
the ability to synthesize and mechanically probe protein libraries presents new opportunities for high - throughput mechanical phenotyping . |
during july 2007july 2011 , six patients from the mediterranean coast city of elche , spain , who had high fever and inoculation eschars received a diagnosis of infection with r. sibirica mongolitimonae ( table ) . for laboratory confirmation , dna was extracted from eschars , lymph nodes ( fine - needle aspiration ) , and blood samples by using the qiaamp tissue kit ( qiagen , hilden , germany ) , according to the manufacturer s instructions . for molecular detection , 200400 ng of dna from each sample was subjected to pcr targeting the 23s-5s rrna intergenic spacer , followed by hybridization with specific probes by reverse line blotting , as described ( 15 ) . when using the probe for r. sibirica mongolitimonae , a positive hybridization signal was obtained from eschar samples from all 6 patients ; this result was confirmed by sequencing ( 100% similarity to a reference r. sibirica mongolitimonae strain [ genbank accession no . hq710799 ] in all cases in the 357 bp sequenced ) . to further confirm this result , nested pcr targeting the gene for outer membrane protein a was performed as described ( 15 ) ; these sequences ( 514 bp ) also showed 100% similarity to a reference r. sibirica mongolitimonae strain ( genbank accession no . * na , not available ; ast , aspartate aminotransferase ; alt , alanine aminotransferase . serologic response was analyzed by using an in - house microimmunofluorescence assay for igg and igm , performed as described ( 4 ) ; r. conorii and r. sibirica mongolitimonae were used as antigens , and cutoff values were 1:40 for igg and 1:20 for igm . acute- and convalescent - phase serum samples were obtained from 3 case - patients and single serum samples from the other 3 case - patients . results for samples from 2 case - patients were negative , but results for the remaining 4 samples showed low to medium titers . these results are consistent with previous reports ( 6 ) , in which 30% of cases had a positive igm result and 50% had negative or near - cutoff igg results . all 6 case - patients lived in elche and its surroundings ( 230,112 inhabitants ) . three of the cases occurred during the spring , which is when 10/18 cases reported in the literature occurred ( 414 ) . all 6 case - patients had fever ( 38.5c39.5c ) , myalgia , and headache ; in the cases from the literature , 18/18 patients had fever , 13/18 myalgia , and 11/18 headache . in our study , 1 case - patient was confused and drowsy on arrival at the emergency department . all 6 case - patients had a single inoculation eschar develop : 2 on the neck , 2 on a lower limb ( figure ) , 1 on the scalp , and 1 on an upper limb . five ( 83% ) case - patients had enlarged lymph nodes in the region from which the eschar drained , as reported for 10/18 ( 55% ) cases from the literature . three case - patients ( 50% ) had lymphangitis extending from the eschar to the draining lymph nodes ( figure ) , compared with 6/18 ( 33% ) in cases from the literature . inoculation eschar on popliteal area and discrete maculopapular elements in patient with lymphangitis infected with rickettsia sibirica mongolitimonae , spain , 2011 . for 4/6 ( 67% ) case - patients , a generalized maculopapular rash developed on the palms and soles but not the face ; for 2 case - patients these findings are consistent with our review of the literature , which indicated rash occurring in 13/18 ( 72% ) cases . all 6 case - patients recovered without sequelae after antimicrobial drug treatment using doxycycline or azithromycin . fournier et al . ( 4 ) , who reported 7 cases of r. sibirica mongolitimonae infection in 2005 , proposed the name lymphangitis - associated rickettsiosis for the disease , on the basis of associated clinical features . however , for the case - patients reported here , the most common clinical signs and symptoms were fever and skin eschar , similar to those from previously reported case series ; 5 of the case - patients reported here showed regional lymph node enlargement , 4 rash , and 3 lymphangitis . because only 24 total cases have been reported and other rickettsioses produce lymphadenopathy and lymphangitis , the term lympangitis - associated rickettsiosis may be unwarranted for this disease . in our case series , 1 case - patient had mental confusion after 10 days of a febrile disease before hospitalization and was found to be hyponatremic . in this patient , the eschar was located on the scalp , and neither rash nor other clinical clues were suggestive of rickettsiosis . the patient had increased c - reactive protein plasma levels and the highest serologic antibody titers for r. sibirica mongolitimonae of the 6 case - patients ( table , patient 1 ) . since r. sibirica mongolitimonae was isolated from h. asiaticum ticks in 1991 ( 1 ) , it has been recovered from h. truncatum ticks in sub - saharan africa ( 6 ) and h. anatolicum excavatum ticks in greece ( 7 ) . however , in spain , r. sibirica mongolitimonae has been detected in 2/8 tick species tested ( rhipicephalus pusillus and rh . bursa ) at similar percentages ( 3.7% and 3.6% , respectively ) but not from hyalomma spp . pusillus ticks from portugal was positive for r. sibirica mongolitimonae ( 8) , while testing of other tick species , including h. lusitanicum , rh . ( h. lusitanicum and h. marginatum ) ticks have not been found to be infected in spain does not mean that these ticks are not vectors for r. sibirica mongolitimonae . ticks are a vector for this rickettsia on the iberian peninsula , and our findings confirm that this rickettsia species is circulating in spain , where specific vectors have yet to be described . in summary , we report 6 cases of human infection with r. sibirica mongolitimonae that occurred in the same geographic area of spain . our results indicate that pcr of eschar samples is the most useful diagnostic procedure for this pathogen ; samples from all 6 case - patients had positive results , while test results for 1 whole blood sample and 2 lymph node samples were negative . however , the limited number of samples does not make it possible to infer specific diagnostic sensitivities . the epidemiology and pathogenicity of illness caused by r. sibirica mongolitimonae infection require further investigation . an active search for the vector of r. sibirica mongolitimonae in countries of the mediterranean region is necessary to complete the epidemiology of this rickettsiosis , which is likely to be more widespread than originally assumed . in particular , clinicians caring for patients who have traveled to the mediterranean coast of spain should consider this rickettsiosis in the differential diagnosis . | human infection with rickettsia sibirica mongolitimonae was initially reported in 1996 , and reports of a total of 18 cases have been published .
we describe 6 additional cases that occurred in the mediterranean coast region of spain during 20072011 .
clinicians should consider this infection in patients who have traveled to this area . |