Datasets:

VikramJi

/

patent-classification

like 0

duct element 10 is disposed on opposite sides of the particular row of pedestals 18 cooperating with the duct element the duct element of the fig4 embodiment acts in a dual capacity as a combined stringer for supporting in part the elevated floor 23 and as a dual cell arrangement for containing and segregating various wires and other interconnections running below the floor 23 referring again to fig2 and 4 and assuming this figure represents a plan view of a floor system using the embodiment illustrated in fig4 it is evident that the duct element 10 supports those portions of the elevated floor 23 which are directly over the duct elements 10 however areas of the floor 23 which are not directly over the duct elements 10 are supported by the pedestals 18 thus in the case of the fig4 embodiment certain of the floor panels 24 are supported in part by the pedestals 18 and in part by the duct element 10 an alternative preferred embodiment of the present invention is illustrated in fig5 in this embodiment the access floor panels 24 are supported directly by the pedestals 18 rather than by the cells 11 and the duct element 10 resides entirely below the top of the pedestal 18 in the embodiment illustrated in fig5 the adjustable collar 25 includes an upper platform 30 which supports the access floor panels as shown the access floor panels may be secured.

drying spray drying and freeze drying in addition to the salmonella gallinarum variant of the present invention the feedstuff of the present invention may further comprise a typical additive useful for improving the preservation of the feedstuff the feedstuff comprising the salmonella gallinarum variant of the present invention may be vegetable matter such as a cereal nut a by product of food processing millet fiber pharmaceutical by product a vegetable oil starch oil seed meals and cereal remnants or animal matter such as proteins minerals fats mineral oils unicellular proteins animal planktons and leftover food etc examples of the feed additive comprising the salmonella gallinarum variant of the present invention include but are not limited to various agents for preventing quality deterioration and improving utility such as binders emulsifiers preservatives amino acids vitamins enzymes probiotics flavoring agents non protein nitrogen compounds silicates buffer colorants extracts oligosaccharides etc also a mixing agent may be within the scope of the feed additive in accordance with still a further aspect thereof the present invention provides a method for treating the salmonella gallinarum infectious disease fowl typhoid using the pharmaceutical composition the composition of the present invention may be administered to animals in the form of a pharmaceutical preparation to animals or in the form of being mixed with feedstuff or water preferably it is mixed in the form of a feed additive with feedstuff before administration so long as it allows the composition of the present invention to reach tissues or cells of interest any administration route such as non oral intraartery intradermal transdermal intramuscular intraperitoneal intravenous subcutaneous oral or intranasal route may be taken the treating method of the present invention.

e g polyethylene glycol has a molecular weight between about 100 and about 2000 in embodiment 49 the molecular weight is between about 100 and about 1000 in embodiment 50 the molecular weight is between about 200 and about 1000 compounds that can be prepared by the methods i e compounds of formula i of the disclosure include embodiment 51 in embodiment 52 the disclosure provides method of any one of embodiments 1 32 wherein the compound of formula i is in embodiment 53 the disclosure provides method of any one of embodiments 1 52 wherein reacting the compounds of formula ii is at temperature between about 30 to about 100 u00b0 c in embodiment 54 temperature is between about 40 to about 80 u00b0 c in embodiment 55 temperature is about 50 to about 70 u00b0 c in embodiment 48 temperature is about 50 u00b0 c in embodiment 56 temperature is about 65 u00b0 c in embodiment 57 the disclosure provides method of any one of embodiments 1 56 wherein reacting the compounds of formula ii is at pressure of about 100 psi to about 1500 psi in embodiment 58 the pressure is between about 300 psi to about 1000 psi in embodiment 59 the pressure is between about 500 psi to about 1000 psi in embodiment 60 the pressure is between about 600 psi to about 800 psi in embodiment 61 the pressure is about 600 psi in embodiment 62 the pressure is about 700 psi in embodiment 63 the pressure is about 750 psi in embodiment 64 the.

on its periphery and hub portions of reduced diameter on each side a centrally disposed rectangular opening is provided in which a double acting lead screw is mounted a pair of jaws are threadedly mounted on the lead screw for movement toward or away from each other dependent upon the direction of rotation of the lead screw a two piece body is provided which defines an elongated handle and two parallel spaced apart members which terminate in a generally circular enlarged ratchet holding head having circular openings in which the hub portions of the ratchet disk are received a pawl is provided for controlling the direction of ratchet movement application_number US 78650577 A description referring now to the drawings the wrench of the present invention is denoted generally by the reference numeral 10 it can be seen to include a main body 12 defining a handle 14 as best shown in fig2 of the drawings the body 12 is formed of two members 16a and 16b which are connected along parting line 18 and held fixed together by rivets 20a 20b and 20c when the members 16a and 16b are assembled as shown in fig2 the body includes two parallel spaced apart members 22a and 22b which terminate in a generally circular enlarged ratchet holding head 23 with each of the members 22a and 22b having apertures 24a and 24b formed therein for receiving for rotational movement a ratchet member 26 pawl 34 is provided for.

the contrary and surprisingly an improvement of the selectivity could be observed in cases where r2 and r3 are the same and consist of a hydrocarbon group with 1 to 4 carbon atoms in view of the high selectivity and activity of the process according to the invention the amide and other reactants can be led at a relatively high flow rate over the catalyst notwithstanding the fact that the amide is quite diluted in the carrier gas in view of obtaining a high selectivity especially to avoid alcohol and undesired dialkylamines in the product stream the amount of catalyst or in other words the contact time with the catalyst is preferably sufficient to convert more than 95 wt preferably more than 98 wt and more preferably more than 99 wt of the amide the catalyst is preferably a fixed bed catalyst if the desired amine is a tertiary amine with r2 and r3 being the same any secondary amine present in the product which is separated off from the gaseous stream which has passed over the catalyst can be converted quite easily to the desired tertiary amine by an additional alkylation step in a fixed bed reactor containing 15 g of cucr catalyst leuna 1970t a mixture of n n dimethyldecylamide dma and h 2 is introduced the mixture with a molar composition of amide auxiliary amine h 2.

example powered by an external power source of conventional design so as to be an energy parasitic system proximate the end of acoustic enclosure 16 opposite the end in which ventilating air is introduced into the interior of enclosure 16 outlet opening 70 is formed into the top wall of enclosure 16 a ventilation exhaust duct or stack 72 is in air flow communication with the interior of enclosure 16 via outlet opening 70 air forced through ventilation intake duct 42 and the interior of enclosure 16 passes through exhaust duct 72 to atmosphere as shown exhaust duct 72 includes a flue portion 74 equipped with a heat exchanger 76 heat exchanger 76 which may configured similarly to heat exchanger 46 and include multiple spaced fluidly interconnected tube sections arranged transversely to the air flowing through the exhaust duct serves to draw heat off of the ventilating air in order to power absorption refrigeration unit 90 that supplies chillant to heat exchanger 46 in particular the high temperatures experienced by turbine 10 which may reach up to between about 2000 u00b0 f and 3500 u00b0 f results in high temperature ventilation exhaust gases flowing through duct 72 ventilation exhaust gases typically expelled from enclosure 16 through duct 72 have temperatures ranging from 200 u00b0 f to 700 u00b0 f heat exchanger 76 is connected with absorption refrigeration system 90 via thermally insulated conduits 81 and 82 that route high temperature water or steam.

mutagenesis using the u201c quikchange site directed mutagenesis kit u201d from stratagene ubp1mg sacii 5 u2032 ggcatagtagtattttttta ccgcgg tggtg seq id no 14 accatctaaactacattgt ubp1md sacii 5 u2032 acaatgtagtttagatggtcacca ccgcgg t seq id no 15 aaaaaaatactactatgcc using the ubp1mg and ubp1md primers marked in bold in fig1 recognition sequences for the sacii enzyme underlined were inserted into the interior of the ubp1 coding sequence thanks to this a 169 bp fragment was removed during the digestion of the pt7 7argstopubi ubp1 plasmid with the sacii restrictase this resulted in a new plasmid which we designated pt7 7argstopubi ubp1 u03b4c it contains the coding sequence shown in fig5 other plasmids coding alternate hybrid mutants according to the present invention containing the ubi sequence were produced in an analogous fashion bld21 e coli bacteria were transformed with a plasmid containing the ubp1 protease gene or one of its mutants during the culturing it was determined that the removal of the transmembrane domain facilitated the culturing and shortened the time from 30 to about 12 hours it was also observed that the cells producing the mutant according to the present invention returned to the original shape fig7 bld21 e coli bacteria containing the appropriate plasmid were cultured on lb medium containing ampicillin 50 mg ml at 25 u00b0 c over 12 h until od 600 1 and subsequently induced with the addition of iptg isopropylthiogalactoside after 2 5 h the bacteria were centrifuged the cell pellet was suspended in lysis buffer and incubated for 30 min at 20 u00b0 c triton x 100 was added to a final concentration of 1 the mixture was sonificated and centrifuged the supernatant was applied to an sp column the strong cationite sepharose.

designates a corner post assembly that includes a main support tube 11 at least one side member 12 extending alongside that tube for substantially its full length a pair of upper and lower end caps 13 and 14 respectively that secure the side member 12 and tube 11 together as well as performing other functions and a vertical riser 15 connected to each side member 12 the riser may extend the full height of the side member or as indicated in fig2 the riser 15 39 may have a length height less than that of the side member thus the length of the riser may be selected to meet the needs of the user and to suit the requirements of a particular installation the term 34 riser 34 is used here to mean a vertical member that would ordinarily be a component of a panel or frame structure intended to be connected to and supported by the corner post assembly for example in fig2 risers 15 and 15 39 constitute the vertical side members of panel structures p and p 39 respectively whether the structure constitutes an open panel a closed panel or is used for screening or to provide support for shelving or furniture components is not material to this disclosure panel structures and their uses are well known in the art and for purposes of describing this invention it is believed sufficient to point out that the utility of the riser lies in the fact that it constitutes the side member of what might otherwise be.

of the stresses set up by the cooling fluid on the internal walls of the u shaped duct and thus makes it possible to improve its solidity and as a result the longevity of the evaporator according to the invention it is clear that the invention is not restricted to the use of identical dimples 9 but extends equally to the use of dimples of varied shapes dimples of varied shapes will be used regularly distributed for example in a similar manner to the distribution of the dimples 9 in fig1 for example dimples with a circular base cylindrical dimples of various diameters can be used as well as dimples with elliptical oval polygonal regular or non regular polygons or other bases the use of dimples 9 of varied shapes also allows the acoustic energy to be distributed over a wide frequency band avoiding high amplitude acoustic peaks in fig3 however the preferred example of plates 13 according to the present invention can be seen similar to those of plate 13 in fig2 but including dimples 9 of varied shapes distributed in random manner in the u shaped concave region in the example shown cylindrical dimples 9 of various diameters are used dimples in the shape of a rectangular parallelepiped of various lengths and orientations and dimples with elliptical bases it is clear that other shapes of dimples for example dimples with a triangular or star shaped base of irregular shape or others do not depart from the.

32 is deflected by way of air guide elements 40 and also flows along the surface of the air supply channel 32 wherein the air supply channel 32 through its curvature also produces a deflection a closure flap 38 serves the purpose of completely blocking the cross section of the air vent 30 in which case depending on the setting of the closure flap 38 the quantity of outflowing air as well as the issue of air is set vertically extending slats 36 serve for deflecting the air around the pivot axes of the slats 36 which extend through the bearing pins 18 of the slats 36 horizontally extending slats 34 serve for deflecting the air perpendicularly to the vertically extending slats 36 the horizontally extending slats 34 have bearing pins 42 by way of which the slats 34 are pivotably mounted in the housing 31 of the air vent 30 the slats 34 can be connected by way of coupling elements so that when pivotation of one slat 34 takes place the other slats 34 execute a corresponding movement the slats 36 are similarly rotatably mounted in the housing 31 of the air vent 30 by way of the bearing pins 18 and coupled together by way of a coupling rod and the pins 30 to be pivotable in common the closure flap 38 is pivotably mounted in the housing 31 of the air vent 30 by way of the bearing pins 44 and can.

or on a hydraulic component connected to it the pressure detected by the pressure sensor 28 is forwarded to the control unit 1 which has evaluation means that from the characteristic change in the pressure the pressure begins to rise steeply find that the clutch part has reached the stop simultaneously via the distance detection the control unit has information about the instantaneous regulating distance of the actuator final control element 24 at that time by means of the information present in the control unit 1 the control unit can for instance compare the course of pressure and regulating distance stored in memory with the actual course of pressure and regulating distance detected via the distance detector 30 and the pressure sensor 28 and ascertain a deviation plausibility test if a deviation occurs then for instance the characteristic curve used for triggering the actuator can be corrected in accordance with the actual values as a result it is attained that in future actuations by means of triggering of the actuator 2 the clutch can be set to defined states since the corrected characteristic curve has been adapted to the varying hydraulic distance boost in a further exemplary embodiment however it may also be provided that instead of the pressure of the hydraulic system a trigger signal of the actuator is monitored for instance the current intensity through the electric motor 21 of the actuator 2 can be monitored by providing means suitable for this on the actuator or in the control unit upon contact of the clutch part 47 with the stop 40 a characteristic increase in the current then occurs on.

the flap compression section 16 once the balloon is positioned in the flap forming section 12 the balloon is inflated and deflated as described above the balloon wrapping tool is then advanced proximally relative to the catheter 20 until the balloon 20 is in the flap wrapping section 14 and finally in the flap compression section 16 once the balloon is successfully formed wrapped and compressed the balloon wrapping tool 10 is slid distally off the distal end of the catheter 22 in another illustrative embodiment the balloon wrapping tool 10 is advanced in a distal direction down the shaft of the catheter and over the balloon in accordance with this embodiment and referring to fig1 the balloon wrapping tool 10 can be provided in a coaxial arrangement with a catheter shaft 32 and releasably secured to a manifold 36 of the catheter 30 the flap forming section 12 is positioned distal of the flap wrapping section 14 and the flap wrapping section 14 is positioned distal of the flap compression section 16 relative to the catheter 30 in this configuration and after the balloon 34 has been inflated during a medical procedure and subsequently withdrawn proximally from the body the balloon wrapping tool 10 is released from the manifold 36 of the catheter.

or other graphic overlay not shown could be incorporated into the original banner 12 for camouflaging the original orientation difference between the line screen patterns 14 and 16 such overlays can be printed separately or incorporated into the line screen patterns as higher order variations in amplitude or frequency any reproduction of such overlays would be independent of differences between the orientations of the line screen patterns 14 and 16 an alternative copy protected document 50 is shown in fig5 and 6 with latent images 60 and 62 hidden within a visually integrated setting 64 as a background u2014 together forming a banner 52 on a substrate 68 which can be overprinted by a text or graphics indicium 58 depicted by the word u201c logo u201d the latent images 60 and 62 depicting the word u201c valid u201d are formed by a line screen pattern 54 oriented at an approximately 45 degree angle to the orthogonal axes of the document 50 the visually integrated setting 64 is formed by the line screen pattern 56 also oriented at an approximately 45 degree angle to the orthogonal axes of the document 50 in addition to being oriented at the same angle e g 45 degrees the two line screen patterns 54 and.

appreciated that the tabs 12 will also assist in spacing the flange member 8 of the gas generator 2 and the base plate member 3 the same predetermined distance apart it is envisaged that the predetermined distance apart will be between 2 millimetres and 10 millimetres it is to be further appreciated that when the above arrangement is assembled as has been described the apertures 20 and further apertures 21 provided around the periphery of the opening 19 of the fabric layer 17 of the air bag 4 are permitted to slide along the studs 9 and the tabs 12 respectively thus the part of the first fabric layer 17 of the air bag 4 adjacent to the opening 19 may move from a position adjacent the flange member 8 of the gas generator 2 to a position adjacent the base plate member 3 referring now to fig2 in an accident situation gas will be injected from the gas generator 2 into the air bag 4 in a direction substantially as shown by arrow 23 this direction of flow of gas from the gas generator 2 will give the entire air bag momentum in the direction shown by the arrow 23 and the first fabric layer 17 will be.

and a condenser lens 17 a filter attenuating member 21 and an energy measuring device 19 are disposed on the transmission side of the beam splitter 16 the condenser lens 17 the filter 21 and the energy measuring device 19 compose a laser energy measuring unit 32 the scanner mirrors 5 a and 5 b are positioned by being rotated centering on axes of rotation respectively by scanners 6 a and 6 b the total reflection mirror 4 c the scanners 6 a and 6 b and the f u03b8 lens 3 are mounted on a machining head 7 the machining head 7 is arranged to be movable in a direction of an arrow z by a z axis motor 13 a printed circuit board 8 is fixed on an x y table 9 movable in directions of arrows x and y while facing the f u03b8 lens 3 the size of a machining area 10 defined by the diameter of the f u03b8 lens 3 is about 50 mm u00d7 50 mm next a machining operation of the laser machining apparatus 31 will be explained prior to machining the f u03b8 lens 3 is positioned in the direction of the arrow z based on a surface of the printed circuit board 8 and a center of the machining area 10 to be machined is positioned on an optical axis of the f u03b8 lens 3 the two step cylinder 11 is also operated to position the optimum mask hole 12 a for the diameter.

subsequent passings of the caryopses exiting from the first decorticator 108 a into two other respective decortication machines 108 b and 108 c caused the removal of the intermediate and inner bran layers again in the powder form the caryopses exiting from the third decorticator machine 108 c were subjected to a dynamic air current cooling prior to being fed to a conventional mill 109 for milling here the decorticated caryopses were milled according to the standard working modes for the milling of whole caryopses obtaining in the end 85 kg of a flour s composed essentially of endosperm with an ash content of 0 77 in weight of the total weight and a protein content of 11 0 in weight of the total weight the third powder exiting from the last decorticator 108 c was a bran fraction d characterised by the composition shown in the following table 2 from the pooling of the aforementioned third bran fraction with the flour in a 1 9 weight ratio a durum whole wheat semolina was obtained having an ash content of 1 30 and a protein content of 11 6 a whole grain pasta was prepared according to the present invention with the durum whole wheat semolina thus obtained using it in the conventional production process of traditional durum wheat semolina pasta in place of the refined durum wheat semolina by the traditional steps of kneading with water forming by extrusion and drying to a humidity content of 12 0 the pasta thus prepared was subjected.

yarn 22 is knitted in every stitch in the anchor section 12 the nylon yarn 24 knit in courses i through iv may be for example 40 denier 13 filament textured yarn the nylon yarn denier is selected to provide the correct bulk and the elastomer yarn in courses i and iii can range from 70 denier to 560 denier depending upon the amount of garment vertical compression desired the heavier denier is required for a support type garment and the lighter denier for a non support garment the criticality of denier relates to the type and size of garment being produced the width of the turned welt anchor section may be between 1 4 inch up to or approaching 2 inches depending on the size and configuration of the garment the single ply wide band section 14 consists of a plain knit construction of textured nylon 30 knit in all courses and having elastomer yarns knit in every stitch of every other course the width of the single ply section may be from 2 inches to 4 inches but must be wider than the turned welt anchor portion in fig2 nylon yarn 30 is knit in each of courses i ii iii and iv such course i through iv being repeated in identical fashion throughout the combined area or width of the wide band section 14 an elastomer could be knit in every course of the wide band 14 if.

database 108 may include information to identify which user in a plurality of users has been granted the authority of a project planner which user in the plurality of users has been granted the authority of a candidate manager and which user in the plurality of users has been granted the authority of a staffing manager the third database 110 may include a description of a universe of candidates for possible placement as staff in any given project plan the i o unit 118 may permit communication with external devices not shown for example the i o unit 118 may allow a user to input or read data from the first second and or third databases 106 108 110 rules governing access to databases may be stored in memory or in any database table 1 illustrates one possible set of rules during the course of the program planning cycle a user having an assigned role may or may not be able to gain access to any given database based on the user 39 s role and a staffing state in accordance with one embodiment a grant of authority to modify a database is preceded by the system 39 s examination of a set of rules such as those.

of modifier this particular pigment not present within a low viscosity dispersion is conventional and propylene carbonate provided excellent viscosity modifications at each level viscosity measurements cps for 0 1 3 5 10 and 15 additions by weight of modifier viscosity measurements cps for 0 1 2 3 5 10 and 15 by weight additions of modifier at lower concentrations pc is a much more effective viscosity modifier than eg viscosity measurements cps for 0 1 3 5 10 and 15 by weight additions of modifier propylene carbonate is an excellent viscosity modifier for this specific pigment dispersion viscosity measurements cps for 0 1 3 5 10 and 15 by weight additions of modifier for this specific pigment not in a liquid dispersion intially all of these provided excellent viscosity modifying characteristics viscosity measurements cps for 0 1 2 3 5 10 and 15 by weight additions of modifier propylene carbonate and butyrolactone are much more effective viscosity modifiers than ethylene glycol for this specific pigment dispersion viscosity measurements cps for 0 1 3 5 10 and 15 by weight additions of modifier this pigment is initially present as a paste and is made from about 25 40 carbon black 75 u2212 60 polyether polyol and a small amount of other additives the cyclic compounds such as propylene carbonate butyrolactone and caprolactone are.

closely space the transmission line from the ground plane is an important factor to consider in selecting the shape of wedge portion 61 it should be appreciated that balun 60 includes conductive vias 32 u2032 which may be the same as or similar to conductive vias 32 described above in conjunction with fig1 1b it should also be appreciated that balun 60 could benefit from the double via structure described above in conjunction with fig1 i e the use of two vias such as vias 32 34 in fig1 balun 60 also includes vias 40 u2032 which may be the same as or similar to vias 40 described above in conjunction with fig1 1c i e provided using a backdrill and fill technique as described in conjunction with fig1 1b it should be noted that portions of conductor 62 have been removed to expose dielectric channels 64 the purpose of channel 64 is produce strong coplanar coupler realizing the benefits mentioned above referring now to fig4 4b in which like elements of fig1 3b are provided having like reference designations throughout the several views a balun 70 further includes a plurality of ground blocks here four ground blocks 72 a 72 d generally denoted 72 with a respective one of ground blocks 72 a 72 d disposed in a respective one of each.

algorithm is provided for adjusting the operating temperature span of an exhaust hood 34 similar to the previous techniques described the control system 72 operates in step 210 the fan speed according to a current temperature span and varies the speed according to the continuously monitored exhaust temperature next in step 212 the control system 72 determines if the exhaust temperature is at least 20 more than the minimum temperature of the current temperature span if not then monitoring continues if however the exhaust temperature is 20 into the temperature span then the control system 72 in step 214 determines if either a the fan has been operating for at least an hour or b it has been an hour since this exemplary algorithm has increased the fan speed if either of the conditions in step 214 are satisfied then the control system 72 analyzes the exhaust temperature in step 216 to determine if it is stable one exemplary test for stability is to determine if the temperature has not varied by u2213 3 u00b0 f over a one minute time period if the exhaust temperature is stable then the control system 72 in step 218 increases the fan speed by 20 or to 100 if already operating above 80 for a predetermined time period such as for example one minute during and after the time period.

connected with each other and are located on a corresponding circular path so that an all around tilt preventing support ofthe inner profiled section 4 inside the outer profiled section 3 results for example four larger and four smaller inner contour sections 3 1 exist which are distributed around the inner profiled section 4 over more than 180 u00b0 for assuring the tilt preventing support the inner profiled section 4 is flattened only on two oppositely located long sides and has in its interior longitudinally extending screw channels 4 3 for mounting a mounting element of the head element 7 on the front face in this embodiment the inner profiled section 4 can be rotated around the vertical or linearly extending axis in the outer profiled section 3 if rotation around the vertical axis is to be avoided it is possible such as shown in fig4 for a transverse pin 4 4 to be conducted through the inner profiled section 4 which protrudes on both sides past the outside of the inner profiled section 4 and projects into holding grooves 3 4 on both sides which are formed in the inner contour of the outer profiled section 3 as fig2 b shows it is also possible to use a simple profiled tube with circular cross section as the inner profiled section 4 whose outer contour sections 4 1 are supported safe against tilting and slidingly in a corresponding manner by the rounded inner contour sections 3 1 the same as the inner profiled section 4 in accordance with fig2 a here too as in connection with fig4 a rotation prevention can be provided by a.

variable reference voltage source 118 such as a potentiometer connected across low voltage supply rails to vary the power output of the dimmer the operator varies the potentiometer slider the higher the reference voltage the smaller the width of the pulses output by the comparator 117 as a smaller proportion of each sawtooth generated by the generator 116 rises above the reference voltage from the potentiometer 118 where the dimmer is to operate in a rack as shown in fig4 the variable reference voltage may be supplied from the control electronics 505 or could comprise a digital to analogue converter receiving a digital control word from the control electronics 505 pwm controllers comprising single integrated circuits providing components 116 and 117 are known in order to improve the stability against changing loads a negative feedback system may be employed measuring the output voltage and adjusting the pwm ratio to achieve the desired output preferably however the pulse generator 115 comprises a control unit 150 such as a microprocessor with a program storage read only memory rom and may also comprise an analogue to digital converter 151 providing a signal input to the control unit 150 and a potentiometer 152 variable by the user to provide an analogue control signal the value a of the analogue control signal is read as shown in fig1 by the control unit 150 via the adc 151 and an output line of the control unit 150 is switched high for a.

led module 10 and the supporting frame 21 can be adjusted according to the area that requires illumination the led module 10 can be rotated upwards so that the angle between the led module 10 and the horizontal ground gradually increases by adjusting the illumination angle of the led module 10 the led module 10 can direct light to a certain height fig4 5 show a multifunctional module type light which may include a light emitting module 1 and a supporting assembly 2 the light emitting module 1 may include a plurality of mutually independent led modules 10 two led modules 10 are provided here the two led modules 10 can be connected by a connecting assembly 3 each led module 10 may include a heatsink 11 a light transmitting cover 12 fixed on the heatsink 11 a driving device 13 and an led light panel the light transmitting cover 12 may be formed thereon with a plurality of reflectors to meet light distribution requirements in different angles the supporting assembly 2 may include a supporting frame 21 and a positioning assembly 22 the supporting frame 21 may be installed on the light emitting module 1 in a manner that an angle thereof can be adjustable through the positioning assembly 22 the supporting frame 21 may include two installation feet 211 connecting with the light emitting module 1 and.

assurer qa can display and print numerous parameterizable metric evaluations and reports besides the recording of cyclic metrics as shown in fig2 it is equally possible to record statistics collected in isolation such as review metrics in particular time quantity and error statistics the screenshots shown in fig3 to 10 are used below to illustrate the invitation to a review for this purpose an appropriate link is clicked on the first user interface 20 shown in fig3 of an intranet in any desired browser e g in netscape or explorer this first click 21 starts a qmt client which is the user interface for the project collaborator a second user interface 22 shown in fig4 is then set up in which a password 23 needs to be entered if the password 23 is correct a third user interface 24 shown in fig5 is set up in which a second click 25 is used to select the desired actions in this context the individual links are combined to form groups of themes by way of example the following actions can be selected under the group u201c actions u201d u201c invitation to a review u201d u201c release declaration u201d u201c additional review u201d u201c completion of a milestone u201d and u201c comment on a review u201d the following can be selected under the heading u201c reports u201d u201c project overview u201d u201c project status u201d and u201c review time schedule u201d in addition descriptions of the review and release process of the qmt.

particular embodiment the slide 393 is provided additional support and guidance from a right guide rod 381 and a left guide rod 383 fig4 shows an exploded perspective view of the first embodiment of the invention 101 the wall of aperture 335 in the retaining block 333 linearly guides the sliding support arm 311 one or more magnets 337 frictionally engage sliding support arm 311 providing resistance of movement of the sliding support arm 311 through the retaining block 333 the magnets 337 fit within lateral apertures 339 the magnets 337 are covered by plugs 341 preventing removal of the magnets 337 once the unit 301 is assembled the swing arm 331 is pivotally connected by a hinge 389 to the elongated chest piece 367 the sliding support arm 311 is pivotally connected to the swing arm support 321 by a pin 315 passing through an aperture 313 in the sliding support arm 311 a lower aperture 323 in the swing arm support 321 receives a portion of the pin 315 the upper portion of the swing arm support 321 is pivotally connected to the elongated chest piece 361 by an upper pin 327 passing through an upper aperture 325 in the swing arm support 321 and an aperture.

are arranged around the first downstream side intermediate transfer roll 20 b from the upstream side to the downstream side with respect to the rotating direction of the first downstream side intermediate transfer roll 20 b further regarding the arrangement of the members around the second intermediate transfer roll 30 the first upstream side intermediate transfer roll 20 a the first downstream side intermediate transfer roll 20 b the toner sensor 8 the final transfer roll 40 the cleaning roll 310 and the brush roll 313 are arranged around the second intermediate transfer roll 30 from the upstream side to the downstream side with respect to the rotating direction of the second intermediate transfer roll 30 each of the first intermediate transfer rolls 20 a and 20 b is formed by providing a silicone rubber layer on a metal pipe and forming thereon a high release coating layer while the acceptable resistance value thereof normally ranges from 10 5 to 10 9 u03c9 in this example it is approximately 10 8 u03c9 this electrical resistance value is higher than that of the cleaning rolls 210 a 210 b and 310 and the requisite surface potential for transferring toner images from the photosensitive drums 10 y through 10 k to the first intermediate transfer rolls 20 a and 20 b normally ranges from approximately 250 through 500 v and an optimum potential value can be set according to the toner charging condition the ambient temperature the humidity etc like the first intermediate transfer rolls 20 a and 20 b.

2 butyl octanol 2 hexyl decanol and or 2 octyl dodecanol other suitable compounds of formula v are those in which r 6 is an aliphatic saturated linear or branched alkyl group containing 8 to 16 carbon atoms o is a number of 2 to 7 and m is a number of 3 to 7 these compounds are addition products of monohydric alcohols of the described type alkoxylated first with 2 to 7 moles ethylene oxide and then with 3 to 7 moles propylene and or butylene oxide in another preferred embodiment the rinse agents contain fatty alcohol polyglycol ethers which are products of the addition of first propylene oxide and then optionally ethylene oxide accordingly the ethers in question are fatty alcohol polypropylene glycol polyethylene glycol ethers which preferably correspond to formula vi r 7 o ch 2 ch 3 cho r ch 2 ch 2 o q h vi in which r 7 is an alkyl and or alkenyl group containing 8 to 22 carbon atoms r is a number of 1 to 10 and q is a number of 0 to 15 compounds such as these are described for example in de a1 43 23 252 particularly preferred representatives of the compounds corresponding to formula vi are those in which r 7 is an aliphatic saturated linear or branched alkyl chain containing 8 to 16 carbon atoms r is a number of 1 to 5 and q is a number of 1 to 6 these compounds are preferably products of the addition of 1 to 5 moles propylene oxide and 1 to 6 moles ethylene oxide.

state the holding members 6 formed in the pushed in portion 5 and the holding members 6 formed on the inner peripheral coating body 24 are located so as to have the narrow spacing a therebetween within the space formed by the inner peripheral surface 14 of the core material 2 and to be opposed to each other next a manufacturing process for an automotive extrusion molded product in accordance with the present invention will be explained with reference to an embodiment shown in fig1 the synthetic resin core material 2 having a u shape in the cross section is extrusion molded in a first die 26 by using a first extruder 25 into which a hard synthetic resin is poured and the synthetic resin core material 2 is cooled by being caused to pass through a cooling tank 27 next the cut portions 7 8 having various shapes are punched out from the synthetic resin core material 2 having a u shape in the cross section by using a punching machine 28 and subsequently the synthetic resin core material 2 having the cut portions 7 8 is carried to a second die 29 in the second die 29 the coating body 3 the pushed in portion 5 connected to the coating body and holding members 6 projectingly provided at the outer periphery of the pushed in portion 5 are integrally extrusion molded on the synthetic resin core material 2 having the cut portions 7 8 by using a second extruder 30 into which a soft synthetic resin is.

with the embodiment of 123 and in another embodiment at 124 the pos transaction manager uses a key that is registered to the consumer to decrypt the encrypted information at 130 the pos transaction manager completes the transaction on behalf of the consumer and the retailer based on the information and transaction details for the transaction according to an embodiment at 131 the pos transaction manager sends receipt details back to the mobile device to display on completion of the transaction for viewing by the consumer and or for storage by the consumer fig2 is a diagram of another method 200 for credit card processing according to an example embodiment the method 200 hereinafter u201c mobile transaction app u201d is implemented as instruction and programmed within memory and or a non transitory computer readable processor readable storage medium that executes on one or more processors of a handheld device the processors of the handheld device are specifically configured to execute the mobile transaction app the mobile transaction app is operational over a network the network is wired wireless or a combination of wired and wireless whereas the pos transaction manager the fig1 above describes processing associated with credit card transaction processing from one or more devices controlled by or accessible to a retailer the mobile transaction app describes processing associated with credit card transactions from the perspective of a consumer 39 s mobile device that interacts with the retailer 39 s devices pos devices at 210 the mobile transaction app recognizes a wireless connection request from a payment.

a curvilinear deflection around about 1 4 34 to a 3 8 34 radius of curvature provides a most acceptable shave and provides an even shave for all normally contoured surfaces to be shaved without requiring the use of a guard in front of the cutting edge 16 other than its normal spacing away from surface 18 when twisted into a spiral form a 0 004 34 blade 0 10 34 long and about 11 2 34 wide can be turned so that its opposite ends are rotated at 90 one with respect to the other an even more flexible blade is shown in fig3 wherein a blade 20 may be provided with a series of longitudinal or horizontal slots that are parallel to or at 90 with respect to the cutting edge while a conventional procedure makes use of a series of successive pulling strokes to complete a shave when a razor with two shaving edges as shown in fig2 is used a desired shaving action can be performed in one half the time as the razor is both pushed and pulled over the surface to be shaved when used in this manner a series of quick reciprocating shaving strokes are used to speed up the shaving process this procedure can be followed because the blade 10 is pressed flat against the skin being shaved and is bent by the fingertips or thumb disposed along the support behind the back side of the blade 10 to press first one and then the other one of the two shaving edges.

support for example back plate interface 17 support point 21 or bearing interface 23 the advantage of next insert 34 as an extension of stator carrier section 12 is that in particular the attachment to wheel bearing 22 is made more rigid and more stable than in a plastic embodiment like the specific embodiment in fig7 this is because of on the one hand the material properties of metal in particular steel and on the other hand because metal is more aging resistant than plastic and does not have a tendency to creep fig3 shows a three dimensional view of cooling device 26 cooling device 26 has cooling jacket section 28 which is formed by 3 to 4 rows of cooling coils 31 which wind around main axis of rotation 1 in particular in the form of a coiled spring or spiral inflow outflow section 29 which is formed by further lines which are laid so that the desired areas of stator carrier section 12 and or electronics receiving section 13 are cooled is located on the side facing toward stator carrier section 12 for example inflow outflow section 29 includes a cooling plate which is located in a radial plane in relation to main axis of.

a low pressure high temperature gas liquid mixture 14 enters the compressor 12 and is compressed to a higher pressure in the figures liquid streams are represented by a solid line gas streams are represented by a dashed line and gas liquid mixtures are represented by combined solid and dashed lines because the liquid and gas are in intimate thermal contact during compression and the thermal capacitance of liquids is typically significantly greater than that of the gas within the mixture 14 the system 10 is operated so that the heat of compression of the gas within the mixture 14 is absorbed by the liquid within the mixture 14 preferably to the extent that the gas is compressed nearly isothermally this relationship can be quantified as the capacitance rate ratio c ratio defined as where m l and c l are respectively the mass flow rate and thermal capacitance of the liquid the product of m l and c l is the thermal capacitance rate of the liquid m g and c p g are respectively the mass flow rate and thermal capacitance of the gas and the product of m g and c p g is the thermal capacitance rate of the gas from the above equation it is evident that the c ratio of the system 10 will depend on the particular gas and liquid used and their relative.

an ungrounded two terminal source or from two terminals of a three terminal source where one terminal is positive phased with respect to ground and the other terminal is negative phased cable 40 within the well 30 may also have a metallic armor the upper parts of the well 30 include a surface casing 44 a flow line 45 connection to a product gathering system not shown a wellhead chamber 46 a pump rod lubricator or bushing 47 a pump rod 48 a production tubing 49 a pump 50 and a tubing anchor 51 the pump 50 may be located below the liquid level 59 at any depth the casing string in well 30 is grouted as at 52 down to and beyond the packer hanger 53 that attaches the upper casing to the more horizontal portions of the casing blank spacers 54 and a screen electrode assembly 38 the outermost portions of the screen electrode assembly 38 in the horizontal borehole 37 includes the blank steel spacer section 54 fiber reinforced plastic frp or other electrical insulator pipe sections 55a 55b and 55c a positive electrode 56a and a negative electrode 56b these electrodes are formed from sections of steel pipe the polarity designates the positive or negative phased a c terminals or connections direct current is not used both the.

such as a tree according to the following method steps firstly tying a knot 50 to form a first loop 52 at an end 54 of rope 46 and positioning rope 46 as a second loop 56 around vertical support 48 as illustrated in fig1 secondly forming a third loop 58 and extending third loop 58 into first loop 52 as illustrated in fig2 thirdly extending first end 18 of yoke 10 into third loop 58 until rope 46 is engaged by arms 22 and 24 as illustrated in fig3 fourthly drawing third loop 58 tight to capture first end 18 of yoke 10 and coupling male coupling 36 of first pole 12 with female coupling 26 of yoke 10 as illustrated in fig4 fifthly engaging rope 46 in transverse slot 42 of second pole 14 and using second pole 14 to lift rope 46 to a desired height on vertical support 48 while concurrently using first pole 12 to lift yoke 10 to said desired height as illustrated in fig5 sixthly drawing second loop 56 tight and removing second pole 14 and first pole 12 thereby leaving rope 46 secured solely by yoke 10 to vertical support 48 as illustrated in fig6 and 7 by following the method steps described rope 46 can be secured to vertical support 48 typically a tree in a campground at a height of 5 or 6 feet above one 39 s reach while standing at ground level when it is time to leave the campground and rope 46 is to be removed this is accomplished by catching loop 28 which depends from.

of springs for exerting a preload on the bearing some or all of the springs are at least partly made of a shape memory alloy so that the preload on the bearing can be adjusted with changes in temperature of the springs application_number US 57905990 A description referring to fig3 a machine tool includes a bed 1 a table 2 a column 3 a spindle head 4 and plural motors 5 6 7 11 a workpiece w is set on the table 2 the table 2 can move by means of the motor 5 in two opposite directions x perpendicular to the drawing the column 3 can move in two opposite directions y1 y2 by means of the motor 6 the spindle head 4 can move in two opposite directions z1 z2 by means of the motor 7 a tool holder 10 is detachably attached to a spindle 12 in the spindle head 4 a tool 13 held by the tool holder 10 rotates by means of the motor 11 referring to fig 1 the spindle 12 is rotatably supported by a frame 15 via upper ball bearings 16 17 and lower ball bearings 18 19 a tube shaped lower extension 20 has a flange 22 fixed to the frame 15 by means of bolts 23 a.

first portion 48 of the locking shaft includes fingers 38 for engaging the fastening loops 18 within the receptacle as the locking shaft 26 is pushed down as illustrated in fig3 a second portion 40 of the locking shaft 26 cooperates with three coded wheels 42 each wheel 42 must be aligned with a particular code c visible to the user before the locking shaft 26 may move code c comprises indicia disposed upon the wheels 42 in predetermined locations when the indicia of the three wheels are aligned in the predetermined locations locking shaft 26 can move a tip 44 of the second portion 40 of the locking shaft 26 engages an alarm enabling switch 46 so as to enable the alarm device 10 as described below should the user encounter an assailant or robber the user simply uses the left foot to push an activation button 50 for a short period of time this activates the device 10 to produce a loud tone in order to deactivate the device 10 the code c has to be entered through the use of the plurality of locking wheels 42 which engage the locking shaft 26 the locking shaft is then pulled up so as to disengage the tip portion 44 from the alarm enabling switch 46 so as to deactivate the alarm device as.

of the web server computer 1 as is the identity of each user in the queue when a user reaches the head of the queue the web server computer 1 assigns one of a number of agents to contact the user at step 160 in fig3 the agents are connected to the web server with the agent connection means 6 in this example the agents communicate with computer 1 using personal computers 20 23 and the computer 1 recognizes each agent by their associated computer when a user reaches the head of the queue the computer analyses the relevant database or memory record for business and private users respectively if the user represents a business and has been contacted by a particular agent on a previous occasion the computer may choose to instruct the particular agent to contact the user as is the case here for user b 1 in fig4 a alternatively the computer 1 may choose another user if the agent of choice is busy for a long period similarly specific agents may be assigned to deal solely with private users some agents may also have specific areas of expertise which can be matched to the needs of the user for example agent operating computer 22 may be an expert on workstations and.

in the infrared region of an incident optical wave to that end it proposes the use of a birefringent acousto optic crystal whereof the propagation speed of acoustic waves is slow such as compounds of mercury which acousto optic crystal comprises on one of its faces a piezoelectric transducer designed to generate a transverse acoustic wave with wave vector whereof the energy propagates according to the same axis but in the opposite direction to the energy of the incident optical wave knowing that the optical wave resulting from the acousto optic interaction between the incident optical wave and the acoustic wave with wave vector is diffracted perpendicularly or almost perpendicularly to the direction of the incident optical wave application_number US 23735408 A description in the example depicted in fig1 the schematic depiction of the optical slowness curves upper dials and the acoustic slowness curve lower dials shows in the orthonormal system defined by the axes 110 and 001 of the birefringent crystal that two solutions are possible which lead to acoustic wave vectors k 2 u03c0 u0192 v u03b8 a of very different lengths and therefore very different acoustic frequencies u0192 in the visible and near infrared region where the acousto optic material of choice is teo 2 only the short vector k can be used since the long vector corresponds to.

98 the plunger is biased by a spring 100 to keep holding magnet 94 in close proximity to switch 92 actuator 98 is connected to the vacuum advance or to an intake source of vacuum on the engine when engine speed is reduced the vacuum pull increases and the actuator 98 retracts plunger 96 and magnet 94 allowing switch 92 to open and de energize solenoid 82 this closes valve 78 and shuts off the water supply to the boiler pack a flasher 168 starts spasmodic operation of solenoid 82 if high vacuum persists longer than a predetermined time for the boiler feed to be shut off when the engine speed picks up vacuum is reduced and actuator 98 releases plunger 96 so that magnet 94 can close switch 92 control valve 78 is then again responsive to control by switch 84 pump 74 is driven by a motor 102 which is controlled by a temperature responsive speed control 104 the basic arrangement being well known a thermal sensor 106 is installed in the head water jacket next to outlet 158 to detect cylinder temperature and the speed control 104 adjusts the water flow rate accordingly to maintain proper heat balance.

perpendicular magnetic film 297 on a central moveable member 295 to which is applied an input signal 242 when the frequency of the input signal is around the resonant frequency of device 295 vibration of the hard magnetic film 206 occurs next to the magnetic film 297 on fixed supports 291 and 292 are mounted a pair of cip gmr sensors 293 on either side of the film 297 other sensor types could alternatively be used the output voltage across the electrodes 294 of each sensor will vary proportionally to the perpendicular or vertical displacement of the hard magnetic film 297 to increase the signal to noise ratio of the output of the device 290 a differential signal detection method is implemented noise results from sources such as fluctuation to the voltage supply and thermal noise because the two sensors 293 x and 293 y are arranged on opposite sides of the hard magnetic film 297 they will detect opposite directions of the magnetic field m the directions of magnetisation of the pinned layers in each sensor are the same this results in a positive output voltage for a positive displacement of the magnetic film 297 for one sensor 293 x and a negative output voltage for the same displacement using the other sensor 293 y and vice versa by applying these outputs to a differential detector 299 the output is the combined output of the two sensors 293 x and 293 y the noise from the device 290 is also reduced due to cancelling of noise common to both sensors.

second parallel side walls 54 and 56 respectively a laterally extending cam roller shaft 58 fig2 is supported between the first and second side walls 54 and 56 and a cam roller 60 is axially supported for rotation about the cam roller shaft 58 fig1 through 4 show elongate first and second keeper plates 62 and 64 respectively mounted on outer surfaces of the respective first and second side walls 54 and 56 of the slide 14 with fasteners such as screws 66 as illustrated best by fig3 and 4 the first keeper plate 62 extends beyond the cam roller 60 to engage the first positive return member 38 as shown by fig2 and 3 in the partially blocked view of the first keeper plate 62 the inner side of the first keeper plate 62 has a relieved portion that leaves a linear surface 65 the linear surface 65 is substantially parallel to the first return flange 44 of the first positive return member 38 to engage the first return flange 44 when the driver 16 moves upwardly although this feature is not shown the second keeper plate 64 is configured in reverse of the first keeper plate 62 to engage the return flange 45 of the second positive return member 40 as shown by fig2 and 5 the lower portion 50 of the slide 14 has first and second parallel sides 68 and 70 respectively that depend vertically from the central portion 48 the lateral thicknesses of the upper portion 46 and of the lower portion 50 of the slide 14 are less than the width of the.

which tag 182 applies tag 184 shows that the originator has selected the text between tag 184 and tag 186 to not be viewable by the engineering departments the attribute names and values such as u201c dept u201d an attribute and u201c eng u201d a variable can be defined when the features are implemented in an email system or other application in such a case they would be defined by a software manufacturer alternatively a system administrator can define the variables at a time of setting up or configuring an email system with section access setting ability another possibility is to allow users of the system to define attribute values and other parameters of the system the text between tags 188 and 190 includes a hyperlink that has an indicator which is only viewable and operable by a recipient named u201c lakshmi dutt u201d as defined by the u201c linkable u201d tag the hyperlink is to an external document such as a document on the company network or the internet so that recipients other than lakshmi dutt will not be able to access the hyperlink or external document or even to know that the word u201c marketing u201d is associated with a hyperlink text between tags 194 and 200 is only viewable by a group of recipients identified as belonging to a u201c special product dev team.

a2v vsp intervals at the faster rates in cases where there are very few vsp paces detection will work with the longer vsp in these cases an algorithm that switched to a vsp like that of fig5 below at high pacing rates would decrease the number of vsp events if multiple vsp events occurred in a specified amount of time the device would switch to the vsp method described in fig4 fig5 illustrates a ventricular safety pacing method having a short trigger zone the ventricular safety pacing method of fig5 includes an a2v vsp timing interval 50 having a length of 110 ms terminating at a vsp pace point 58 where a vsp pace is delivered if a ventricular event is sensed by the device within the trigger zone a blanking interval of 30 ms is indicated at 52 followed by a 40 ms long trigger zone indicated at 54 the blanking interval begins with atrial pacing event 56 as before one method according to the present invention may be briefly described with reference to fig6 if a high rate pacing is not desired at step 60 then the ventricular safety pacing method 61 of fig3 is used if a high rate of pacing is desired at step 60 then it must be determined at step 62 whether n vsp paces have occurred in the last m seconds in other words determine whether a limit number n of paces occurred within.

by comparison with literature data for lipids analysis in the extracellular polymeric substances the methods proposed by smolders et al 1994 were used with modification pure fatty acids sigma aldrich were used as external standard freeze dried extracellular polymeric substance samples and fatty acid standards were weighed using an analytical balance and transferred into tubes with screw caps one milligramme of c15 fatty acid in 1 propanol was used as internal standard 1 5 ml of a mixture of concentrated hcl and 1 propanol 1 4 and 1 5 ml of dichloroethane were added into the tubes and heated for 2 h at 100 u00b0 c after cooling free acids were extracted from the organic phase with 3 ml water one millilitre of the organic phase was filtered over water free sodium sulphate into gc vials the lipids in the organic phase were analyzed by gas chromatography model 6890n agilent usa equipped with a fid on an hp innowax column size exclusion chromatography was performed with a superdex 75 10 300 gl column akta purifier system ge healthcare elution was carried out at room temperature using pbs at constant 0 4 ml min flow rate and detection was monitored by following the absorbance of the eluted molecules at 210 nm superdex 75 10 300 gl ge healthcare column separates molecules of 1 000 to 150 000 daltons da with a total exclusion volume of 7 9 ml measurement of the elution volume of dextran standards 1000 da 5000 da 12000 da 25 000 da and 50 000 da led to the calibration equation mw molecular weight of the molecule in dalton da ve elution volume in ml assayed at the top of the peak chromatogram profiles were recorded with unicorn 5 1 software ge healthcare peak retention.

portulaca pilosa plant and a matrikin mimetic peptide the active ingredients are provided in a base medium of oils and waxes with fragrances and moisturizers added to provide a more consumer friendly product table 1 sets out a preferred listing of active ingredients and table 2 sets out a preferred listing of the inactive ingredients a component of the invented lip balm product is dehydrated microspheres of marine collagen and glycosaminoglycans these microspheres have the capacity to rehydrate in the presence of water and regain their initial volume while dehydrated the microspheres are small enough to penetrate crevices in lips the microspheres increase in size through absorption of moisture in the lips which causes a smoothing of the lip surface the microspheres are slowly degraded by enzymes in the lip which allows the microspheres to release the moisture initially absorbed from the lips returning the moisture to the lips the microspheres are preferably comprised of marine atelocollagen and marine chrondroitin sulfate as disclosed in u s pat nos 5 395 620 5 420 248 and 5 622 656 as well as non us counterparts another component of the invented lip balm product is a synthetic ceramide and anti irritant compound skin tissue has a protective layer referred to as a lipid bilayer which helps bind corneocytes to protect skin tissue from external damage the lipid bilayer is itself comprised of ceramides fatty acids and cholesterol skin tissue with decreased ceramide levels have.

historically improve brand recognition in particular areas and that are authorized to be in such an upsell by the content provisions rules the example above is by no means limiting with respect to an upsell myriad other research may be incorporated for an upsell as will be apparent to those skilled in the art in view of the disclosure herein for example inferences about customers of certain products may be made based on the time of day an audio visual work to be associated with the requested ad is generally accessed by viewers sites from which viewers access such content geographical location of frequent viewers and the like and such inferences may be used to upsell an ad requester to ads in a certain geography at a certain time or in a certain media outlet as such the content provision rules and the upsells and research associated therewith may have access to or be accessible from advertising and research engines in any media outlet accessible from any communication point in the present invention such communication points may of course include networked environments wireless network environments television cabled and satellite environments personal electronic device environments and the like further the access to the present invention of such external advertising engines may allow for the publishing of new applications in accordance with.

up truck 12 is fully extended as shown in fig1 that is the first and second ramp members 30 32 are separated such that only the front end 64 of the second ramp member 32 overlies the rear end 46 of the first ramp member 30 and the two members are pivoted to an angle no greater than 45 degrees from the horizontal surface of the support frame 14 the orientation of the ramp assembly 16 is controlled by cables 118 secured between the front end 44 of the first ramp member 30 and the support frame 14 the sled 34 is also moved to its most rearward position such that it lies adjacent the ground and the rear end 66 of the second ramp member 32 as shown in fig3 the motorcycle 11 is then moved to the apparatus 10 and the front wheel 78 of the motorcycle 11 is placed within the wheel well 96 as discussed above the pivoting lock member 106 is released and the wheel well 96 is pivoted forward to its loading position to easily receive the front wheel 78 of the motorcycle 11 once the front wheel 78 is positioned with the wheel well 96 the front end 78 of the motorcycle 11 is then secured to the sled 34 by the various retaining straps 108 coupled to the sled 34 the motorcycle 11 is pulled forward using the winch system until the wheel well 96 rotates back to its retained position at that time the pivoting lock member 106 engages the support bracket 104 to securely hold the wheel well 96 in the desired position for further loading once the front end of the motorcycle.

al biotechnology ny 1992 august 10 8 894 8 ueda et al biochim biophys acta 2003 mar 17 1631 2 160 8 ko et al appl environ microbiol 2006 june 72 6 4207 13 hara et al arch microbiol 2001 november 176 5 364 9 kanayama et al j bacteriol 1998 february 180 3 690 8 cells preferred according to the invention are characterized in that the decrease in enzymatic activity is achieved by modification of at least one gene comprising one of the sequences selected from the previously stated nucleic acid sequence groups a and b the modification being selected from the group comprising preferably consisting of insertion of foreign dna into the gene deletion at least of parts of the gene point mutations in the gene sequence and subjecting the gene to the influence of rna interference or exchange of parts of the gene with foreign dna in particular of the promoter region foreign dna means in this context any dna sequence that is u201c foreign u201d to the gene and not to the organism i e even candida tropicalis endogenous dna sequences can in this context function as u201c foreign dna u201d in this context it is in particular preferable for the gene to be interrupted by insertion of a selection marker gene therefore the foreign dna is a selection marker gene the insertion preferably having been effected by homologous recombination into the gene locus in this context it may be advantageous if the selection marker gene is expanded with further functionalities which in their turn make subsequent removal from the gene possible this can be achieved for example with a cre loxp system with flippase recognition targets frt.

the host interface provides access to the diagnostic registers in most of the complex logic on the chip except for the host interface itself this advantageously permits the host cpu to obtain direct access to register contents in the specialized chip application_number US 8765402 A description the numerous innovative teachings of the present application will be described with particular reference to the presently preferred embodiment by way of example and not of limitation standard scan chain testing during chip production test all full scan or some partial scan of the internal registers are put into a test mode so that they can be driven by the chip tester as a shift register this allows test patterns to be shifted into and out of the chip under control of the tester and this is how most chips are tested during manufacture the area overhead associated with this method stems from the need to connect the registers together into a scan chain only during test mode this re configuration is done using multiplexers at the input to every register in the design in test mode the multiplexers are switched to route the output from each register directly to the input of the next register in the chain these multiplexers are therefore only used during test mode and are redundant once the manufacturing process is complete in circuit testing using scan chains it is often necessary to build into a chip some extra circuitry to allow parts of the design to either be observed or controlled directly during operation this otherwise redundant logic can significantly improve debugging.

4 9 such irregularities can make it easier for the thread removal head to make direct contact with the thread ends and also give the thread removal head a larger total surface area and thus larger working surface for the material in the thread removal head in the case when it is made from a material that u201c grips u201d as above for example the surface can be configured as a bumpy surface see fig2 and 7 or as a grooved surface see fig4 5 6 8 and 9 the bumps 5 the space between them the grooves or slots 7 and the space between them can have adapted characteristic dimensions typically being in the range of 1 5 mm the grooves or slots as shown in fig4 and 5 can lie in the circumferential direction about the common lengthwise axis of the shaft 1 and thread removal head 3 i e each groove or slot will lie in a plan perpendicular to the lengthwise axis the grooves can also have a different orientation such as in the lengthwise direction of the shaft 1 i e strictly speaking lying in a plane passing through the lengthwise axis of the shaft see fig8 or they can also extend in helical manner over the thread removal head 39 s surface with a suitable pitch angle e g in the range between 45 u00b0 and 60 u00b0 in relation to the lengthwise axis of the shaft see fig6 the grooves.

complex that additionally is capable of performing both single and dual kv u201c dual energy u201d imaging the proposed scatter elimination technique using a coarse high transparency grid 32 or crossed coarse grids as opposed to fine granularity relatively low transparency grids the shadow mask 36 containing both absorbing elements for scatter estimation and spatially varying filtration for dual energy imaging for the purpose of correcting beam hardening artifacts the use of a shadow mask 36 that can be left in place during the diagnostic scan and methods for estimating the residual scatter and reconstructing the resulting data the use of a low current scout scan to determine the appropriate detector offset in addition to estimating appropriate exposure time appropriate exposures are presently estimated using a scout scan the use of a detector that is smaller than necessary in conjunction with apparatus for moving the detector 30 relative to the source 26 and an appropriate x ray collimator 28 to improve the precision of measurements by reducing scatter and by measuring some portions of the object twice relative to others adapting the measurement system x ray collimation and detector position dynamically to the size of the object to accomplish the above objectives i e appropriate detector position for each frame is not estimated from scout scan but rather from previous frames estimating the pedestal or dark signal for each channel that does not require turning off the x ray source 26 or acquiring additional u201c blank u201d frames between x ray exposures u201c dithering u201d the position of the detector 30 in order to reduce visually disturbing artifacts generating u201c panoramic u201d or conventional linear tomography images from the reconstructed ct volume extensive simulations and a.

US 2004161081 A1 abstract an asymmetrical digital subscriber line communication system enhances the signal to noise ratio of the received signals by conducting a pll process with a tone conditioned on the most superior snr instead of a fixed tone an improvement in data rate is thereby achieved application_number US 77032704 A description it should be understood that the description of the preferred embodiment is merely illustrative and that it should not be taken in a limiting sense in the following detailed description several specific details are set forth in order to provide a thorough understanding of the present invention it will be apparent however to one skilled in the art that the present invention may be practiced without these specific details practical embodiments of the invention will be explained in conjunction with the drawings the adsl annex a standard defines the 64 tone as a reference signal to obtain loop timing thus a central station loads a signal with constellation information of 1 i on the 64 tone and then a remote terminal obtains the loop timing between the central station and itself by conducting a pll operation with the 64 tone during such a process of channel analysis it is impossible for the remote terminal to obtain the loop timing from other tones because the central station sends irregular constellation values to other tones that is as shown in fig5 a qam analysis resulting from a pll operation with a tone other than the 64 tone shows that the phases are considerably distance from the 45 degree mark this is because the.

require intelligence and digital predistortion on the base station side before entering the bus a traditional kartesian feedback loop possesses no problem the purpose is to make the function of the transmitter foreseeable the transmission line is located between other parts of the baseband and the base station unit the only task of the transmission line is to carry forward the raw data from base station units the data is in a digital format and is down converted and decimated this arrangement is to simplify the connection between different parts of the baseband an optional feature for supporting some receiver algorithms e g irc interference reduction combining in diversity receiving and combining is to sent the data to the transmission line together with a clock signal indicating sampling interval in relation to transmission bus feedback loop can be taken into consideration in a function of adaptivity and intelligence the used transmission formats can be defined freely but should be kept simple no synchronisation clock is needed because tcu can synchronise itself to the received signal when most of the baseband functions are moved from base station units to the digital exchange no complicated interfaces between base station units and the digital exchange are needed this fact leads to many benefits from the system operation and maintenance point loads of the different sectors can be redivided flexible if loads increase suddenly in some sector simplified base station architecture in regard of base station and exchange interfaces no complex interface between the exchange and the base station.

regions of these uppermost column components extend upwardly through and beyond the building roof which is shown generally at 50 in fig2 a 2 b the upper end of column component 12 a as such is illustrated in these two figures roof 50 and the regions surrounding the upwardly projecting column components are fully weather sealed by the presence of an appropriately installed waterproof membrane 51 this membrane covers the upwardly facing surface area of the roof and u201c curls upwardly u201d and sealingly along the sides of projecting column components as is illustrated for the sides of column component 12 a in fig2 a 2 b the nominally open upwardly facing ends of the projecting column components are reversibly closed and weather sealed by appropriate removable caps such as cap 52 for column component 12 a these caps are configured as can be seen for cap 52 in fig2 b with downturned perimeter skirts such as skirt 52 a each of which skirts with the associated cap in place sealingly overlaps both the upper open end of a column component and the adjacent upwardly extending portion of membrane 51 one can thus see that after nominal completion of a building the utility access ports provided by the structure and practice of the invention are available at roof level such ports are thus available for use at different locations in a building frame essentially throughout the u201c life u201d of a building frame possessing them important aspects of the utility of the present invention will now be described beginning with fig1 and 3 shown generally at 54 56 58 in fig1 are.

deal a message to be printed on the coupon and various counts recording the activity of the coupon deal validation of a coupon presented for redemption involves first reading a coupon look up number from the coupon this number relates the coupon to a specific coupon deal record which has as one of its data fields a manufacturer 39 s number and a family code if the manufacturer 39 s number and the family code match with similar fields for an item in the customer 39 s order the coupon is valid and an appropriate discount is applied to the order the coupon look up file includes two types of record the coupon index record cir and the coupon deal record cdr both types of record begin with a six byte key in the following format str1 the x field indicates the record type if x 00 the record is a coupon index record and if x 01 the record is a coupon deal record the five byte data field is different for each of the two record types as will be apparent from the following formats the coupon index record format is as follows str2 the item code contains the uniform product code for the product in binary form the sixth byte identifies the record as a coupon index record and the clu provides a link between a triggering product and a particular coupon deal record to allow the purchase of one product to trigger more than one coupon deal a coupon index record may contain up to two additional clu fields and flag fields following the format illustrated above accordingly the purchase of one.

the latch bolt slots 204 with flexible tab 194 during the sliding process of trigger cap 114 from locked position and unlocked position long cap shaft 152 is continuously pressed by flexible tab 194 this improves preferable contact between trigger cap 114 and latch bolt 118 with a flexible tab those skilled in the art will realize and understand upon reading this description that other and or different mechanisms may be used to fulfill this curve sliding track and preferable contact since in the locked position base stopping pin 180 shown in fig5 and latch stopping pin 196 shown in fig6 contacts with each other on their inclined surface when a force is pushing trigger cap 114 toward front wall 134 latch stopping pin 196 is able to pass the limitation of base stopping pin 180 if the force is larger than the resistant force from base stopping pin 180 therefore latch bolt 118 can be actuated not only by actuator 120 but also by trigger cap 114 manually fig1 a d show an acting process of latch mechanism 100 fig1 a depicts a locked position of latch mechanism 100 latch bolt 118 extends out of housing 110 and is received by latch bolt receiver 125 on latch keeper 126 actuator 120 is in a retracted position and resisted by bevel wall 128 shown in fig2 on latch keeper 126 one embodiment of latch mechanism 100 is.

c and fig1 d each depict a pouch 1 which is equipped with a grip handle 3 and 3a respectively at the side and modified so as to be convenient for use in fig2 the numeral 4 depicts a shank the numeral 5 depicts a core having a moderate elasticity such as sponge or felt mounted on the upper end of the shank and the numeral 6 depicts a flexible cover wrapping the surface of the core which cover comprises natural rubber or a soft plastic membrane or film the manner of using a thus constructed toilet utensil will be self evident from the above explanations fig3 depicts a toilet utensil which comprises a base board 7 equipped with a grip handle 3b a core 5a mounted on said base board and a cover 6a wrapping the surface of said core fig4 depicts a toilet utensil which comprises a hollow and elastic core 8 which was molded integrally with a grip handle 3c similar to handle 3 of fig1 c and a cover 6b which wraps the surface of said core the surface of the cover 6b may be either smooth or pear skin like where the cover is smooth it makes it possible to apply toiletries very thinly where the cover is pear skin like it permits application of toiletries somewhat thickly accordingly the cover preferably is detachable and has a smooth surface and a pear skin like back thus.

deionized water under vigorous stirring next 29 7 grams of a hexachloroiridium acid solution h 2 ircl 6 24 27 wt ir umicore hanau germany are added to the suspension under stirring and diluted with 50 ml of deionized water the suspension is then heated to 70 u00b0 c after reaching the temperature 50 ml of a 0 1 m naoh solution are added and diluted with further 500 ml of deionized water the final ph of 7 5 is adjusted using 10 wt naoh temperature and ph are kept at the same level for about 4 hours finally the product is isolated by filtration and washed with 1 5 liters of deionized water the catalyst is dried in an vacuum oven overnight the product is then calcined at 400 u00b0 c in an box oven in air for 1 hour the bet surface area remains very high at 59 m 2 g thus indicating the excellent catalytic activity of the material 150 ml of deionized water are poured into a 2 liter beaker 24 86 grams of hexachloroiridiumacid hydrate 38 65 wt ir umicore hanau germany are dissolved in 50 ml of deionized water the solution is added to the beaker under vigorous stirring and diluted with 50 ml of deionized water two times the solution is heated to 70 u00b0 c after having reached the temperature 4 grams of naoh are dissolved in 50 ml.

for an additional 4 hours at room temperature finally ligand 1 was synthesized by adding separate solutions of oxalyl chloride and compound 5 in tetrahydrofuran very slowly using a syringe pump this process is required to reduce other side reactions and maximize macrocycle production in fact the structure of 5 may be helpful to some extent in keeping the two amine groups close together which can easily react with oxalyl chloride to form the macrocycle during the reaction the macrocycle precipitates out from the solution and can be recovered just by simple filtrations washing with water was necessary to remove any triethylamine hydrochloride salt which co precipitates with the ligand during reaction the resulting product was transferred to a round bottom flask and 200 ml of diethyl ether added the mixture was sonicated for 15 minutes and then filtered the precipitate was collected and rinsed with additional ether to further purify the material the resulting product was dried for 12 hours under vacuum at 80 u00b0 c to yield the desired macrocyclic ligand 1 the 1 h nmr spectra for all the intermediates including the macrocycle were obtained and indicates the formation of the compounds after synthesizing the ligand 1 the fe complex 2 was developed ligand 1 was first deprotonated using a strong base and reacted with ferrous chloride in dry tetrahydrofuran more specifically 1 200 mg 0 61 mmol was dissolved in 30.

known app ref value is used with expression k 6 as described in step 308 to effect a pumping current modification based on the sensor internal reference chamber oxygen partial pressure step 404 activates the pump control mechanism queries the developing sensor nernst voltage and updates the value of app ref based on the applied charge preset in steps 401 and 403 and the aforementioned sensor calibration factor in step 405 a judgment is made as to whether the value of anv is within the nw limit as described in step 206 if the judgment is yes the sensor is considered to be substantially at null and control is passed from method m 400 back to the supervisory program if the judgment is no the sensor is not yet at the null point and control is passed to step 406 in step 406 a judgment is made as to whether the value of anv is less than the mvtrip value as described in step 208 if the judgment is no the dynamic reduction trigger point mvtrip has not been reached and control is passed back to step 403 using the updated value of app ref if the judgment in step 406 is yes then control is passed to the dynamic reduction algorithms of steps 407 through 409 in step 407 the pump current magnitude control variable value is modified as function of two factors k 3 as described in step.

of a volume of 125 litres 4 cubic feet at this stage the sterilization chamber is still under the effect of a partial vacuum of about 670 mbar in an optional second step the pressure level is raised to about 900 mbar using oxygen as a filing gas this pressure level is maintained for about 20 mm after the sterilization period the vacuum is reapplied preferably at a pressure of about 1 0 mbar again once the vacuum reaches 0 1 mbar the humidification phase is recommenced followed by the renewed injection of an oxygen ozone sterilization gas mixture followed by the sterilization period the cycle of applying a vacuum of about 1 0 mbar injecting sterilization gas humidifying and sterilizing can be repeated and the number of repeat sterilization cycles mini cycles selected to achieve complete sterilization of the instruments preferably between any two successive sterilization cycles a re conditioning step is effected as described above to remove any condensed water from the sterilization chamber the number of repeat cycles used in an experimental set up of a method in accordance with the invention including a 125 litres 4 cubic foot chamber was 2 repeat cycles this set up conformed to the security assurance level standards of the fda sal 10 6 to remove all remaining ozone and humidity in the sterilization chamber 10 after complete sterilization after all successive sterilization cycles a ventilation phase is engaged the.

of the reinforcing face plate 50 even if the sizes of the upper and lower transverse frame members 4 5 and the pair of left and right vertical frame members 6 6 are reduced the frame 7 is not deformed by the weight of the stone plate 8 further since the stone plate 8 rests on the stone resting piece 27 of the lower transverse frame member 5 no high stress is applied on the adhesively bonded portions and therefore it is possible to prevent the stone plate 8 from detaching from the frame 7 further as shown in fig2 the intermediate transverse frame members 9 in the embodiment shown is formed in an approximately rectangular hollow shape by an indoor side vertical plate 40 an outdoor side vertical plate 41 an upper plate 42 and a lower plate 43 the upper and lower plates 42 and 43 have an upward piece 44a and a downward piece 44b formed integrally therewith at their respective inner ends further the upper and lower plates 42 and 43 have a rising piece 45 and a hanging down piece 46 formed integrally therewith at their respective outer ends so that they may be located flush with the outside surface of the outdoor side longitudinal plate 41 further the outdoor side vertical plate 41 has.

48 and brace 44 defines a second adjustment slot 50 brace 42 and brace 44 are coplanar face 46 is similar to face 24 and includes flanges 52 similar to flanges 28 another alternative apparatus 16 u2033 is shown in fig5 apparatus 16 u2033 generally includes a brace 54 and a face 56 brace 54 can define at least one adjustment slot 58 a plurality of flanges 60 extend outwardly from face 56 each successive pair of flanges 60 limits movement of one bar such as post tensioning bar 18 or rebar 20 other flange configurations also are possible for example instead of having two flanges for each bar there could be a total of n 1 flanges for every n bars thus three flanges could be used to receive two bars with the first bar housed between the first and second flanges and the second bar housed between the second and third flanges yet another alternative apparatus 16 u2032 u2033 is shown in fig6 apparatus 16 u2032 u2033 generally includes a brace 70 and a face 72 brace 70 can include at least one adjustment slot 74 a plurality of flanges 76 a d extend outwardly from face 72 in a direction generally perpendicular to the previously described embodiments thus flanges 76 a d extend in a plane perpendicular rather than parallel to the longitudinal axis of the bar flanges 76 a d define a bar receiving area 78 flanges 76 a and 76 b are generally coplanar flanges 76 c and 76 d also are generally coplanar as shown in fig6 flanges 76 a and 76 c are on a first side.

adjacent processor 39 s storage for both the current and neighboring segment values from a hardware point of view the differences between implementing a fan fold or cut and stack approach are not that great the main issue resides in the design of the processors at the edges of the design which must keep track of both new processed data and old unprocessed data for each point as well as having access to data of odd and even numbered segments by increasing the storage associated with each processing element pe and folding or cutting and stacking the mapping between the physical processors and virtual bit map very large problems can be manipulated given the novel addressing and memory addressing scheme adopted herein all the instruction types of the architecture including the neighbor instruction with a processor in each problem point can be implemented by a much smaller array processor by defining the number of segments in terms of rows and columns the edge values for the virtual bit map problem can be supplied from a limited number of registers as shown in detail below certain advantages accrue from following the fanfold or cut and stack technique the fanfold approach as can be seen from fig1 a has the advantage of not requiring wiring wrapped around the processor board such wrapped wires are necessary in the cut an stack approach to transfer values from the opposite side of the segment the countervailing problem in the use of the fanfold technique is that while the processor element pe can get the value of the adjacent crossboundry point from its own memory i e for an even numbered segment being operated on the processor element looks to the odd half of the memory.

during play of the base game or the bonus event advancing to the next bonus level may also result in the player being provided with additional credits 102 fig1 a the player has no idea which tool 110 will be effective for advancing into each bonus level 705 706 in a preferred embodiment a random number generator function 708 determines which tool or tools 110 will be effective for advancing the player at the time of play of the bonus event fig7 shows examples of tools 110 fig1 a that may be randomly selected for entry into each level 704 705 706 of the bonus event winning tools 110 are selected from a pool of five different tools 110 herein exemplified as tnt 710 spade 712 pick 714 laser 716 and phaser 718 shown schematically as simplified shapes the symbols for these tools 110 are shown on each level for advancing into the next level as depicted any three of the five tools 710 712 714 716 718 may be randomly selected by a random number generator 200 fig1 one of these three tools is subsequently required for advancement 722 beyond each of the first bonus level 704 and subsequent.

is closed up a user rotates the knob 300 and then the coupling projection 301 arranged on the knob 301 slides in the sliding grooves 401 and 402 of the link 400 by the rotating knob 300 and rotates the link 400 accordingly the rotating link 400 makes the door damper 200 which has a same rotary axis and whose end is coupled with the link rotated around the axis if the duct inside as shown fig2 or 3 is closed up by the rotation of the damper door 200 the pressure of fluid is applied to the damper door 200 at this time the power applied to the damper door 200 is transferred to the knob 300 by the link 400 at this moment the coupling projection 301 of the knob 300 is located in the end of the sliding grooves 401 and 402 of the link 400 and then the round coupling projection 301 is surface contacted with the end of the half rounded sliding grooves 401 and 402 because of the surface contact numberless many points exist but the points located in the farthest from the rotary center of the knob among such contact points builds up one line and the normal line of those indicates the direction of the power which is applied to the knob.

the rotary blade 2 in its operating position the mail piece 15 is fed by the postage meter under the rotating blade 2 and enters a nip between rotating feed roller 4 b and idler roller 4 a the feed rollers 4 a and 4 b then draw the mail piece 15 past the blade 2 and the opened mail piece 15 is ejected the mail piece is guided by mail guide 16 to provide a straight cut adjacent to the edge 18 of the mail piece to avoid damage to the contents while the rotary cutter is in its operating position as shown in fig5 the print head carrier 12 is in its service station position behind the mail guide 16 the dotted line indicates the position of the print head carrier when the print head is in the operative printing position when the rotary cutter 2 is in the retracted position the rotary cutter is disposed to lie behind the surface of the mail guide 16 that is engaged by the mail pieces so that the rotary cutter cannot engage and damage the outgoing franked mail pieces it is to be understood that the foregoing represents just one embodiment of the invention others of which will no doubt appear to the skilled reader without deviation from the true scope of the invention as claimed in the appended claims in one embodiment as illustrated in.

a point in the water beneath the boat 12 so that the boat 12 can pull on and off the lift 16 when afloat a carriage or mechanism 17 of the lift 16 is raised or lowered in order to either disembark or store the boat 12 depending on the user 39 s action upon entry of the boat 12 into the canopy 10 and temporarily mooring in position for operation of the lift 16 the seams 39 of the end curtain 36 can be closed using fasteners not shown using the lift 16 the boat 12 can be raised with its wakeboard tower 14 aligned with the raised center portion 20 upon confirmation of alignment the lift 16 can be engaged and the entire boat 12 lifted out of the water so that the boat 39 s gunwale is raised proximate the downwardly depending curtains 24 26 32 to provide substantial weather protection shown in fig2 lift 16 is preferably mounted on posts 60 62 64 66 which posts 60 62 64 66 also support canopy 10 it will be noted that the spacing of posts 60 62 64 66 is such that they are generally located proximate the intersection between the center portion 20 and entry portion 18 at the entry end and the intersection between center portion 20 and front end portion 22 in this manner entry portion 18 and front end portion 22 are supported in.

the hammocks 1066 were not present there exists the possibility that the thin knife blades 1062 could bend and warp or kink into these gaps by placing the hammocks 1066 therebetween any possibility of impermissible bending of the knife blades 1062 is prevented fig5 is provided to show the extreme bending extent of the hammocks 1066 and the blades 1062 therebetween in a test bed made for such a purpose it is noted that the upper hammock 1066 is not utilized in an upward bend with respect to fig5 because it tracks the inside surface of the curve at the critical bending area in contrast the lower hammock 1066 is utilized to substantially prevent the knife blades 1062 therebetween two in this exemplary embodiment from impermissibly bending into the gap of the test bed because each hammock 1066 is held rigidly at either end and is made out of a substantially non elastic material e g of stainless steel it forms a sling or u201c hammock u201d that supports the bent knife blade s 1062 therebetween fig5 illustrates a cross section through the articulation lock release slide 1120 and clearly shows the distal connection bend of the unlock pullrod 1104 inside the slide 1120 in such a configuration proximal displacement of the unlock pullrod 1104 causes a corresponding proximal displacement of the slide 1120 to unlock the teeth 1121 of the slide 1120 from between the corresponding teeth 1041 on.

to the width of the quarter part to which the large load is applied whereby the sliding resistance of the peripheral ends and the central part is increased and fuel efficiency is worsened on the other hand according to the sliding bearing 3 of this embodiment the width of the quarter part 12 c to which the large load is applied is large and the widths of the peripheral ends 12 a and the central part 12 b are small whereby the sliding resistance can be reduced at the part to which the large load is not applied while securing enough oil film at the part to which the large load is applied next an explanation will be given on the manufacturing method of the sliding bearing 3 having the above configuration firstly a long and narrow material wound coil like is supplied intermittently by a predetermined length at a time and the long and narrow material is cut along a direction perpendicularly a lengthwise direction thereof whereby a flat plate material 21 which is strip like shaped is obtained subsequently as shown in fig3 end surfaces of four sides of the flat plate material 21 are cut parts which are made into the.

grease upon rinsing and wringing out while the invention is not to be limited to any particular theory it is believed that the treatments in accordance with the invention result in a film formation at least partially coating and adhering to the individual fibers while yet retaining the fibrous structure of the web matrix examples of such compositions include carboxy methyl cellulose and derivatives such as cmc4h1 available from hercules polycarboxylic resins cross linked with a bivalent metal ion such as carbopol 934 available from b f goodrich hydroxy ethyl ether starch derivatives such as penford gum 230 available from pennick and ford company and polyacrylates such as polyacrylamide resins available as prym 119 from sun chemical company and polymeric pc from dow corporation for improved softness each of the treatment compositions may include up to about 40 percent of a softening agent such as polyethylene glycol available as carbowax 1000 from union carbide the treatment will preferably add up to about 5 percent by weight of the total treatment composition but the useful range will vary widely depending upon the intended application and may include for example up to about 10 percent by weight also the composition may contain up to about 4 percent by weight of a wetting agent such as dioctyl sodium sulfosuccinate available as aerosol ot 75 from american cyanamid application of the treatment composition may be by any convenient means for liquids known to.

particularly useful for treating conditions wherein the treatment area dangles or is loose in particular the embodiment of fig5 is useful in gynecological treatments in the embodiment of fig5 the tip 75 of the aspiration sheath or catheter 70 is a rounded end the aspiration sheath or catheter 70 includes a lateral slot or opening 19 on one side the ultrasonic probe 23 with an ultrasonic tip 21 which may include a bevel 20 is mounted for axial sliding movement within the aspiration sheath or catheter 70 at least one aspiration passage 23 is created in the space between the ultrasonic probe 22 and the interior wall of the aspiration sheath or catheter 70 accordingly as suction is applied to the aspiration fitting or luer 13 a negative pressure or suction is formed at the aspiration passage 23 to draw away any destroyed or cavitated plaque and any residual or irrigation fluid at the proximal end of the tip 75 is a grasping surface or backstop 76 this grasping surface or backstop 76 serves as an opposed surface to the ultrasonic tip 21 thereby allowing dangling or loose treatment areas to be grasped during treatment in operation the aspiration sheath or catheter 70 is directed to a treatment area until the dangling or loose treatment area.

brake disc arrangement includes a brake disc carrier 18 which may be made of for example sheet steel the brake disc carrier 18 has on its periphery suitably dimensioned openings or cutouts 68 spaced at specific intervals which permit radial removal of the brake pad 36 the brake disc carrier 18 which is configured as one piece provides a central substantially circular fastening section 20 with walls adjacent to the outer periphery which extend outwardly in an inclined direction and form a disc shaped contour with the fastening section 20 the downward slope of the walls is continued in carrier sections 61 extending substantially parallel to the axis of the wheel the carrier sections 61 terminate above the connecting elements 24 which are cast integrally with the friction ring 26 of the brake disc the friction ring 26 shown in fig2 includes two axially spaced annular friction surfaces 26a 26b connected together by ribs 62 with ventilation ducts between the ribs the connecting element 24 is cast integrally with the annular friction surface 26a on the side close to the brake disc carrier 18 in such a manner that it protrudes radially a slight amount that is in the range of between 1 0 mm and 5 mm and preferably between 1 mm and 2 5 mm from the friction surface outer periphery in this arrangement the difference between the outside diameter of the connecting element 24 and the outside diameter of the annular friction surface 26a corresponds approximately to the sheet steel thickness of the connecting element 24 as shown in fig3 the connecting element 24 includes a plurality of bores 72 closed throughout which are penetrated by the material as it is being cast prior to the welding operation for attaching the.

aspect of the invention a header format includes a legacy preamble having at least one legacy long training field and an extended portion having at least n additional long training fields on each of the n transmit antennas wherein one or more of the at least n additional long training fields are comprised of only one orthogonal frequency division multiplexing symbol the extended portion optionally comprises one or more repeated ofdm symbols for frequency offset estimation in one implementation the extended portion comprises a first high throughput long training field comprised of two repeated ofdm symbols and n u2212 1 high throughput long training fields comprised of only one ofdm symbol in another variation the extended portion comprises n high throughput long training fields comprised of only one ofdm symbol application_number US 201113012964 A description the present invention provides preamble formats and techniques for preamble training for mimo system the training phase of a mimo transmission will contain two phases the first training phase is a legacy training phase particularly suited for example to wlan ofdm legacy systems and the second phase is particularly suited to a multiple antenna system such as a mimo system to overcome the problems in the prior systems the automatic gain control agc of a receiver will perform one training sequence during the first training phase and the.

the binding modes that are most consistent with the data this approach eliminates the requirement for protein assignments and explicit distance restraints as described herein the algorithm can also predict protein assignments from which explicit distance restraints can subsequently be derived these restraints can then be incorporated into a docking procedure thereby facilitating an iterative refinement process it is noted that in embodiments of the present methods peak predictions and or observations can be ascribed to either individual atoms or nuclei or groups of atoms or nuclei that are magnetically similar magnetically similar atoms or nuclei are atoms nuclei that are present in magnetic similar environments which thereby give rise to peaks having a similar chemical shift thus magnetically similar atoms or nuclei can be grouped together and treated as an individual unit it is therefore implicit in the following description that when the term atom is recited unless explicitly stated or unless context demands otherwise the term u201c atom u201d is used interchangeably with the term group which refers to a collection of magnetically similar atoms following long standing patent law convention the terms u201c a u201d and u201c an u201d mean u201c one or more u201d when used in this application including the claims as used herein the terms u201c observed peak u201d.

provided with an enlarged thickness annular section 128 which defines a generally circular opening 130 through which the driving shaft 124 extends in a similar manner the end section 122 of the housing 112 is provided with an annular section 132 which defines an opening not shown through which the driven shaft 126 extends the aforesaid annular openings are communicable with an internal clutch chamber generally designated by the numeral 134 within which the clutch actuating mechanism for drivingly connecting the driving shaft 124 with the driven shaft 126 is located as will hereinafter be described in detail as shown in fig3 the driving shaft 124 is provided with an annular driving hub generally designated by the numeral 136 which defines a central axially extending bore 38 within which the inner end of the driving shaft 124 is received the hub 136 and shaft 124 are drivingly connected with one another by any suitable keyway means or the like whereby upon rotation of the driving shaft 124 the hub 136 will rotate concomitantly therewith the driving hub 136 includes a radially outwardly extending inner end section generally designated by the numeral 140 and carries or supports an oil seal ring assembly 142 having a radially outwardly disposed section 143 which is communicable via a suitable oil supply conduit 144 with an oil manifold.

and blocking gas distribution in the present invention a heat sink concept is utilized by the provision of an elongated metal strip preferably stainless steel contained within each of the slots 22 fig8 shows a strip 50 constituting a strap like configuration with a flat elongated body portion 52 having opposite planar surfaces and an integral end tab portion 54 projecting at a right angle to the body portion 52 a strip 50 is placed to extend substantially the full length within each slot 22 as shown in fig9 whereby the end tab 54 rests against the base end 18 of the plug 12 fig1 illustrates the base end 18 of the plug 12 with a strip 50 disposed in each of the slots 22 whereby the respective end tabs 54 overlie the surface of base end 18 of plug 12 in a direction lateral to the opening of the slot 22 each strip 50 at least one third and preferably about one half the available area within the slot 22 with the width of the strip being such that it extends substantially the full depth 34 d 34 of the slot 22 as shown in fig4 and the thickness of the strip being one half the slot width 34 w 34 the presence of the strip 50 with the slot 22 and its full expanse.

the container 20 from the inside thereof to block tightly against the container 20 and continuously fix the socket 23 and the container 20 via the fixing element 25 so that the assembling processes can be finished moreover for more effective and easily assembling the socket the present invention can further include a set of fixing devices separately set on the socket 23 and the container 20 with this set of fixing devices the fixing element 25 as shown in fig3 will not be needed any more and the operator only need to process a translation or a rotation and the socket 23 can be fixed on the container 20 as shown in fig4 which illustrates the assembling and structural schematic view in the second embodiment according to the present invention a female thread is set at an inner surface of a surrounding structure 320 of an opening 301 on a container 30 and a male screw is set on a connecting section 330 of a socket 33 the surrounding structure 320 and the connecting section 330 are the fixing devices which can mutually integrate to each other in this situation the assembling steps are as described above electrically connecting a circuit board not shown please refer to fig3 to the socket 33.

acetate hexane gave 16 6 g of 1 2 cyclosulfinyl 6 hexyl bromide in 92 yield the ratio of isomers in the product obtained was 1 1 83 rt 13 69 and 13 96 min based on the analysic data from gc column db 1 0 32 mm u00d7 30 m flow rate 1 2 ml min injection temperature 250 u00b0 c detector fid 280 u00b0 c 70 u2192 290 u00b0 c 10 u00b0 c min 1 h nmr in cdcl 3 ppm u03b41 5 2 1 6h m 3 44 2h t 3 96 0 65h t 4 36 0 35h m 4 53 0 7h m 4 72 0 65h dd 5 00 0 65h qn to a solution of s 1 2 cyclosulfinyl 5 hexyl chloride 6 g 30 3 mmol in acetonitrile 30 ml in a round flask equipped with a reflux condenser were added sodium carbonate 9 64 g 91 0 mmol and benzylamine 9 75 g 91 0 mmol according to the similar procedure as shown in the example 12 after being refluxed for 15 hrs to complete the reaction the reaction mixture was filtrated to remove solids and then the solvent was evaporated under reduced pressure the purification of the product using column chromatography on silica gel gave 5 96 g of s benzyl 3 hydroxymethylpiperridine in 96 yield the expected by product 3 hydroxyazepine was not formed at all 1 h nmr in cdcl 3 ppm u03b41 5 u02dc 1 75 6h m 2 25 1h m 2 6 1h m 2 95 1h m 3 48 1h d 3 59 1h dd 3 93 1h dd 4 13 1h.

an embodiment of the invention will now be described with reference to the flow chart of fig3 in this embodiment each physical port of the first switch is coupled to only one device and the first switch 22 is configured to only enable a single mac media access control address per physical port thus for example the three robot arms 20 a c and a controller could not be attached to a hub with the hub connected to one of the physical ports of the first switch 22 thus the first switch 22 can be configured to control the traffic between each device to prevent broadcast storms and other security related problems in this embodiment it is assumed the manufacturing floor is isolated properly from the corporate network and or the internet also as described above devices networked on the manufacturing floor tend to utilize a limited number of specialized protocols such as the common industrial protocol cip as is known in the art upper layer applications that use tcp transmission control protocol or udp user datagram protocol are identified by a tcp udp port number packets transmitted utilizing tcp or udp include a source and destination tcp udp port numbers for each physical port of the switch connected to a device in the workgroup only packets with tcp udp port numbers identifying the protocol used by the device connected are allowed ingress to the first switch 22 for example the tcp port number for cip for transmission by either tcp or udp is 0xaf12 and this tcp port number is included in each packet transmitted by a connected device the first switch is configured to.

foregoing embodiment in fig1 a slider 63 of the above described start switch rides on an arcuate stripe of copper foil 64a on a substrate 64 when the lid 4 is fully open as shown in the drawing the slider 63 lies beyond the copper foil stripe 64a but when the lid 4 is slightly moved toward the closing position the slider 63 contacts with it these parts or the slider 63 and the copper foil stripe 64a are electrically connected to a control circuit to be described below fig1 in block diagram shows a corresponding control circuit of this embodiment to that of fig1 of the foregoing embodiment a start switch 103 39 has the same function as that of the start switch 103 of the foregoing embodiment but is different from the latter in that it is closed when the slider 63 and the copper foil stripe 64a of fig1 contact with each other reference numeral 114 represents a cartridge detection switch for detecting when the cartridge p has been seated in the cartridge chamber 8c 115 is a publicly known rewind control circuit for controlling the rewinding of the film when the start switch 103 39 is closed under the conditions that the cartridge detection switch 114 detects that the cartridge p has been seated in the chamber 8c and the the inverter 105 produces the output representing that the film leader detection switch 104 is in 34 off 34 state or when the stretch detection circuit 107 has detected occurrence of a stretching it produces an output signal which is applied to.

31 may also feature tethers made of a stretchable and durable material that will be used to connect the top to the base specifically when the top is unlatched from the base 31 the tethers not shown in any drawings allow the user to shift the top off the back end of the base 31 for quick fastening without completely removing the top from the rest of the apparatus the interior of the base may also have numerous anchoring points and securing mechanisms to secure cargo in compartments or to fasten the base to an exterior mounting device when removal of top 30 is desired the user will operate the locking safety latches 36 as generally indicated in fig1 the latches may be padlocked or otherwise key locked in order to prevent tampering or access to the cargo the apparatus also features one or more removable front and back panels 34 as shown the front and back panels are open windows to provide pet ventilation and removable panels may be replaced if desired with similarly sized and arranged adjustable louvers mesh or screen panels or solid panels to create various states of closure this may have particular utility in the transportation of an animal when additional protection is required when the cargo transported is general cargo however it may be more desirable.

raw oscillometric pulse amplitude with the higher weight is to be corrected slightly in the next process the lower weight means the probability that the raw oscillometric pulse amplitude is affected by the motion induced artifacts is higher that is the reliability of the raw oscillometric pulse amplitude with the lower weight is lower and therefore the raw oscillometric pulse amplitude with the lower weight is to be corrected significantly in the next process according to characteristics of general blood pressure signal waveforms without motion induced artifacts at least twenty six fuzzy logic rules can be defined the following are definitions of some fuzzy logic rules taken as examples u201c if amplitude is mid and slope is a little steep als weight 1 u201d u201c if amplitude is max and slope is a little steep als weight 0 4 u201d and as shown in fig5 d the dot marks are the sequence of raw oscillometric pulse amplitudes and the star marks are the weights respectively calculated for each of the raw oscillometric pulse amplitudes the weight of each of the raw oscillometric pulse amplitudes is between 0 and 1 next the controlling processing unit 18 corrects each of raw oscillometric pulse amplitudes by use of the raw oscillometric pulse amplitudes neighboring said one raw oscillometric pulse amplitude having weights higher than a threshold to calculate the target oscillometric pulse amplitude corresponding to said one raw oscillometric pulse amplitude that is the raw oscillometric pulse amplitudes with higher reliability neighboring each of raw oscillometric pulse amplitudes are used to calculate or.

result in lower temperatures in the heating mode when the earth coil is acting as an evaporator pressure drop results in warmer temperatures in the inlet portion of the coil and colder temperatures toward the outlet the varying evaporating temperature results in a decrease in the log mean temperature difference between the coil and the earth which adversely impacts performance somewhat of an offset to the degradation of lmtd is the fact that increased refrigerant velocity increases the refrigerant side heat transfer coefficient and air source evaporators are normally circuited with up to a 7 psi drop r 22 and still obtain performance about equal to coils circuited for a two to four psi pressure drop if greater pressure drops are encountered the coil performance is decreased and additional circuits are required to meet the heating and cooling requirements an insufficient pressure drop indicates that the tube diameters are too large and the charge of refrigerant will be large if the tube diameters are too small the pressure drop will be too great and coil performance will suffer a careful calculation will determine the optimum pressure drop without degrading performance the factors involved include cost of tubing cost of refrigerant and cost of installation if longer heat exchangers are required this generally results in 10 11 psi pressure drop as being optimum in the future with greater costs for copper and refrigerant and labor higher or lower pressure drops may be more cost effective the demonstration project has shown that three vertical 100 foot heat exchangers consisting of 80 feet of 3 8 inch od tube 100 feet of 1 2 inch od tube and 80 feet of 5 8 inch od tube work well with a 4 ton heat pump as do.

the stop disk the actuator is preferably a stepping motor and the adjusting cam preferably has a spiral shape application_number US 70399996 A description referring to the drawings in particular the invention comprises a guide rail 2 for a carriage 3 that can be moved along on the said guide rail is fastened to a support plate 1 a folding rail 4 comparable to the folding rail disclosed in de 80 27 080 u1 is detachably fastened to the carriage 3 like the prior art folding rail the folding rail 4 is adjustable in a manner not specifically explained here and is also interchangeable with other folding rails having a different shape and different dimensions together with the folding rail 4 the carriage 3 can be moved to and from by means of a compressed air cylinder 5 between an inserting position shown in the drawing and a working position in which the folding rail 4 places the fabric to be provided with a fold in the correct position for sewing under a feed rail not shown the desired tuck depth of the fold or of a tuck which are to be formed depends on the shape and width of the folding rail 4 and is additionally determined by.

of transfer tubes 89 typically seven which have opposing ends and surround third passage 82 transfer tubes 89 extend from upstream of first injector 75 to an annular plenum 90 which is adjacent second injector 87 depending on the mode of operation first passage 80 transfer tubes 89 and annular plenum 90 may contain either fuel or air for a combustor having a first combustion chamber and a second combustion chamber as shown in fig5 fuel is supplied to first passage 80 transfer tubes 89 and annular plenum 90 and injected through second injector 87 in an effort to transfer the flame from a first combustion chamber to a second combustion chamber in this type of combustion system 10 there is a first combustion chamber or primary combustion chamber 25 and at least one primary fuel nozzle 28 delivering fuel to primary combustion chamber 25 where initial combustion occurs adjacent to and downstream of primary combustion chamber 25 is a secondary combustion chamber 26 with the combustion chambers separated by a venturi 27 primary fuel nozzles 28 surround secondary fuel nozzle 70 which injects fuel towards secondary combustion chamber 26 to support combustion downstream of venturi 27 from fig5 it can be seen that all fuel from premix secondary fuel nozzle 70 is injected such that it must premix with the surrounding air and pass through cap swirler 91 prior to entering secondary combustion chamber 26 prior art designs allowed fuel from secondary fuel nozzles to pass directly into secondary combustion chamber 26 without passing through cap swirler 91 thereby directly initiating and supporting a pilot flame which is typically a source of high emissions.

5 there is shown the lockpin 16 which has a cylindrical body portion 46 with a front end 40 and a rear end 42 the rear end 42 is preferrably configured as bayonet shaped with at least two radial projections 48 an opening 44 is disposed in front end 40 and is adapted to receive a wrench or other tool not shown used to rotate the lockpin 16 in a preferred embodiment the opening 44 has a non circular hexagonal operating portion rotation of the wrench after its insertion into the opening 44 by an operator serves to rotate the lockpin 16 the lockpin 16 extends through bore 24 in the cutting head 12 and may be attached to the cutting head 12 by any suitable means in the embodiment shown in fig1 a circular groove 41 is constructed in the lockpin 16 near the middle of the lockpin 16 a clamp 45 is disposed in the shank 14 such that it secures the lockpin 16 by means of fitting into the groove 41 in an alternative embodiment as shown in fig6 a circular groove 47 surrounds the front end 40 of the lockpin 16 and a pin 43 is disposed in a bore 39 within the cutting head 12 perpendicular to the longitudinal axis of the cutting head 12 in order to secure the lockpin 16 in the bore 24 in a like manner the pin 43 extends into.

should be no contact of the coated exterior of the core 12 with any other surface the oven is maintained in the range of 345 u00b0 plus or minus 5 u00b0 for a time of 16 to 18 minutes following this heat exposure the roller is removed from the oven and hung for cooling following temperature reduction to room temperature the coating is removed from the non primed surfaces such as the end caps 314 and the axle shafts 316 at this stage the plastisol coating 318 exhibits a smooth surface which is unacceptable for use in a pre stretch system in order to prepare the surface of the coating 318 the axle shafts 316 are mounted on the center line in a lathe such as a 5c collect lathe drive with a 1 inch tapered roller in a tail stock adapter the outer diameter of the coating 318 is then turned to reach the desired outer diameter it has been found that a speed of 360 revolutions per minute and a feed rate of 0 030 inches is acceptable for this purpose as the smooth surface is stripped by the lathe from the roller it can be seen that an underlying porous cellular structure of the coating 318 is revealed the machining process provides a cellular coating thickness of at least 1 8 inch and preferably of 1 8 inch to 1 4 inch cylindrical in shape and coaxial with the rotation axis.

shaped blade 528 has grooves cut into the back side of blade face 514 when the two l shaped blades are positioned back to back these grooves form air channels running from interior bottom 526 to the ports 522 located in the rounded blade tip 520 sides 512 seal these channels lateral side gap 513 may be sealed by welding or by resin fig2 depicts the blade clamps which secure air combs 510 to the wheel hub assembly angles 612 correspond to angles 316 fig1 and 20 and angles 416 fig2 22 blade clamp 610 fits over the edges of air comb 510 screws inserted through holes 614 correspond to holes 518 in air comb 510 and holes 424 in outer wheel hub 410 in addition the method of decortication described in this disclosure provides a suitable means for constructing a highly efficient and effective decortication machine capable of achieving the rapid throughput capacities required to economically operate said decortication machine in cooperation with modern forage or combine harvesting equipment as well as equal or exceed the throughput of modern stationary decortication systems there are undoubtedly numerous modifications and arrangement of parts that may be construed from this invention the previous description provides guidelines for building and operating this invention and is not meant to limit the operation of this invention in so far as potential modifications and arrangements relate to the following claims consistent with the description herein and the appended drawings some features of exemplary embodiments include 1 a variable throughput decortication machine possessing a unique decortication element which.

required to obtain a fully hardened coating the increase in viscosity over time was also measured for the composition of the catalyzed bath to judge the efficiency of the u03b1 acetylenic ketones as inhibitor the results are reported in the table i which follows the procedure of example 1 was repeated except that a different inhibitor was selected the results are reported in table i below table i______________________________________ concentration of the hardening inhibitor in the resin time at gelation timenature of by 110 u00b0 c at 20 u00b0 c in hthe inhibitor weight mole kg sec and min______________________________________none none none 10 30 min1 octyn 3 one 0 25 2 1 u00d7 10 sup 2 10 12 7 h1 octyn 3 one 0 50 4 1 u00d7 10 sup 2 10 12 14 h1 octyn 3 one 0 63 5 0 u00d7 10 sup 2 12 25 h8 chloro 1 0 22 1 4 u00d7 10 sup 2 15 4 hoctyn 3 one8 chloro 1 0 50 3 0 u00d7 10 sup 2 15 10 hoctyn 3 one8 chloro 1 0 68 4 1 u00d7 10 sup 2 15 19 hoctyn 3 one8 chloro 1 0 73 4 6 u00d7 10 sup 2 18 24 hoctyn 3 one2 hydroxy 3 0 50 4 5 u00d7 10 sup 2 15 60 hhexyn 4 one1 trimethyl 0.

drying the used particulate hemp is performed with heat and air the used particulate hemp may then be stored in a storage station 44 similar to the storage station 25 tests commissioned by the applicant show that for at least one particular strain of hemp the hemp pellets contain about 0 02 of cbd thus the tests indicate that the processed hemp is not devoid of the cbd oil initially contained in the hemp stalks as mentioned before the content or amount of cbd oil in the processed hemp may be increased by using different strains of hemp and if the hemp stalks that are processed include the leaves or the flower buds it will be appreciated that the system of the illustrated embodiment may also be suited for other types of organic matter and crops it will also be appreciated that a particular shape of each one of the hemp products may vary so long as each individual particle of each hemp product fits within the corresponding size range it will also be appreciated that binding materials are not necessary to produce any one of the hemp fines crumbs or pellets in the system 10 of the illustrated embodiment the hemp products produced by the system 10 and corresponding method have many applications the following are attributes of hemp may lend to its advantages in the applications which are mentioned later i bast fiber length is 5 millimetres to 40 millimetres in length ii primary bast fibers which may be most favourable for certain applications are long and low in lignin content.

a sectional view showing the main composition of an example of the copier according to the present invention first the copy process of this copier will be briefly explained a photoreceptor drum 10 on which a photosensitive layer is coated or vapor deposited is rotated clockwise by a drive means not shown while the photoreceptor drum 10 is being rotated the residual toner on the photoreceptor drum 10 is removed by a cleaning means 27 which will be explained later and a precharging exposure lamp 28 is lit so that the electrical charge remaining locally on the circumferential surface of the photoreceptor drum 10 can be removed then the photosensitive layer of the photoreceptor drum 10 is uniformly charged by a charger 16 a halogen lamp 121 mounted on a carriage 12 which horizontally slides synchronously with the rotation of the photoreceptor drum 10 irradiates document d which is set on a platen 11 light emitted by the halogen lamp is reflected on document d the reflected light passes through a slit not shown mirror 122 mirrors 131 132 mounted on a movable mirror unit 13 lens 14 and mirror 15 and then an image is formed on the photoreceptor drum 10 which will be described later that is the photoreceptor drum 10 is exposed with the light reflected on document d and an electrostatic latent image is formed on the surface the aforementioned carriage 12 and movable mirror unit 13 are driven by a stepping motor through a wire connected with the stepping motor and moved respectively in the same direction at speed v and 1 2 v next this electrostatic latent image is developed by a developing unit 17 in which toner is accommodated so that a toner image is formed on the surface of the.

a wellbore in the embodiment of fig2 a and 2b the coil spring and data wire 135 are disposed around an outer diameter of the mandrel 110 to minimize interference with the bore of the tool 100 in order to install the jar in a drill string each end of the jar includes an inductive coupling ensuring that a signal reaching the jar from above will be carried through the tool to the drill string and any component therebelow the induction couplings because of their design permit rotation during installation of the tool in another embodiment a series of coils at the end of one of the jar components communicates with a coil in another jar component as the two move axially in relation to each other fig3 a show a jar 100 with a housing 105 having a number of radial coils 150 disposed on an inside surface thereof each of the coils is powered with a conductor running to one end of the tool 100 where it is attached to drill string a single coil 155 is formed on an outer surface of a mandrel 110 and is wired to an opposing end of the tool the coils 150 155 are constructed and arranged to remain in close proximity to each other as the tool operates and as the mandrel moves axially in relation to the housing in fig3 a a single coil 150 is opposite mandrel coil 155 in fig3 b a view of the tool 100 after the mandrel has moved the coil 155 is partly adjacent two of the coils 150 but close enough.

configuration data 201 may be all provided at once or may be provided at different times during the custom view construction process in one embodiment the configuration data 201 is declarative the type of configuration data 201 might not be standardized but may differ according to the type of custom view to be generated there are a variety of view construction modules 202 that might each correspond to a particular custom view type there might be numerous view construction modules 202 available to the custom view generator 210 however in fig2 there are only four view construction modules 202 a 202 b 202 c and 202 d illustrated the ellipses 202 e represents however that there may be fewer than this number or more that this number u2014 perhaps many more referring to fig3 a view construction module 300 is schematically illustrated the view construction module 300 includes various parameters that might depend on the type of custom view that the view construction module 300 may correspond to in this specific example the view construction module 300 is illustrated as including five parameters 301 302 303 304 and 305 however the number of parameters may differ according to the custom view and according to the degree to which that custom view has been parameterized accordingly the ellipses 306 represents that there may be other types of views as well the parameters of the view construction module 300 may be populated by the configuration data 201 if the view construction module 300 is to be used to generate a custom view the logic 310 of the view construction module 300 may then be used with the various populated parameters as inputs to define underlying behavior of the view for instance if.

line in fig1 and raised position which is denoted a in fig2 and creates a notably wide angle between boom and ground extend and retract of the boom itself 4 is provided by a hydraulic actuator 11 housed within stage 5 whose top end hinges with the top end of boom stage 6 via pin 12 and whose bottom end hinges likewise with the bottom end of stage 5 via pin 13 located at the top end of said boom assembly 4 at the top end of stage 6 thereof in fact one has a second boom assembly 16 which in the embodiment shown herein comprises two stages 17 and 18 see fig1 caused to slide coaxially one within the other the rear end of the outer of said stages stage 17 is fixed immovably to the top end of said boom stage 6 such that the longitudinal axes of respective boom assemblies 4 and 16 create an obtuse angle say of 110 u00b0 which will cause boom 16 to lie horizontal once stage 5 of the first boom assembly 4 is raised fully into position a see fig2 it will be observed that boom assembly 16 projects forward from stage 6 of the first boom along a path aligning with the longitudinal axis of prime mover 2 extend and retract of the second boom 16 thus described is brought about by further hydraulic actuator 25 this fixed at one end to stage 17 via lugs 22 and at the remaining forward end to stage 18.

running down the arm of the user the dotted lines 163 166 at the junctures between the finger stalls 153 156 and the palm portion 151 represent the position of the joint lines between the fingers and palm of a hand inserted in the glove similarly the dotted lines 173 176 represent the first joint lines on each finger and likewise the dotted lines 183 186 represent the second joint lines of each finger the joint lines 163 166 173 176 and 183 186 are illustrated to show the critical positioning of the abrading units 190 on the glove 150 as hereinafter set forth the glove 150 is provided with a plurality of abrading units 190 with each abrading unit being critically positioned to provide maximum flexibility of the entire glove 150 as seen the abrading units 190 include circular units 195 on each of the finger stalls 153 156 and generally rectangular abrading units 200 on the palm 151 the thumb 152 is provided with a plurality of rectangular units 210 each of the circular abrading units 195 is positioned on its respective finger stall 153 156 intermediate the joint lines to permit maximum flexibility of the glove 150 at each and every joint line specifically there is provided circular abrading units 195 between the joint lines 163 and 173 between the joint lines 173 and 183 and between the joint line 183 and the distal end of the finger stall 153 a similar construction is provided for each of the finger stalls 154 155 and 156 with respect to the abrading units 200 on the palm 151 each of.

device to have reduced isolation edge leakage current four different types of pmos transistors were fabricated in one experiment the characteristics of each type of pmos transistor employed in the experiment are listed in table 1 all of the pmos transistors in the experiment received a two step buried channel implant in table 1 the u201c blocked isolation edge u201d column indicates whether the pmos transistor received a second buried channel implant i e bci 2 where the isolation edge is blocked e g see fig1 b as shown in table 1 type 1 and type 3 pmos transistors did not receive a second buried channel implant where the isolation edge is blocked the type 2 and type 4 pmos transistors received a second buried channel implant with blocked isolation edge for the type 2 and type 4 pmos transistors the distance between an edge of an opening of the blocking implant mask and an edge of the isolation trench e g see dimension d 1202 of fig1 is about 0 28 u03bcm the u201c width length u201d column shows the width of the active region of the pmos transistor e g see dimension d 704 of fig1 and the length of its gate e g see dimension d 1362 of fig1 for example a type 1 pmos transistor did not receive a buried channel implant with blocked isolation edge has an active region width of 25 u03bcm and has a gate.

be rotated into threaded bore 20 the tip 40 is received within the channel 36 which as noted has a slightly enlarged entry 38 sized to freely accept the tip 40 as the drive member 42 continues to be rotated so as to be advanced along bore 20 the tip 40 engages the down sloping bottom surface 37 of channel 36 thereby camming the stop member 30 towards the fully extended position reached as the drive member 42 is advanced to the bottom of the channel 36 further advance of the drive member 42 causes the tip 46 to be received within recess 28 the drive member 42 thereby firmly holding the stop member 30 in place within the holder body 14 stated another way the drive member 42 exerts a camming force causing extension movement of the stop member by engagement with the sloping bottom 37 of the channel 36 with the tip 46 the stop member 30 is thereby advanced to the left upon continued descent of the drive member 42 in engagement with the bottom surface of the channel 36 thereby pushing the stop member 30 to the left into its extended position with one end 32 fully protruding from the holder body 14 as seen in fig4 the one end 32 of stop member 30 when extended is aligned below fixed stop f on the surrounding vault structure s to be restrained thereby preventing complete escape or removal of the cover c the channel 36 has upper sides 39 slightly converging.

the elongated flat section 24 further includes a first end 28 and a second end 30 further the step flashing unit 16 includes a vertical surface 32 and a horizontal surface 34 turning now to fig2 there is shown a side view of the system 10 for protecting walls roofs including the detachable flashing channel 12 attached to the wall 11 and the step flashing unit 16 located at intersection of the roof 14 and the wall 11 the detachable flashing channel 12 includes the fastening section 18 the flat section 20 the curved section 22 and the elongated flat section 24 the fastening section 18 further includes means 36 for attaching the detachable flashing channel 12 to the wall 11 in summary the present invention generally provides a system 10 for protecting walls roofs from water including but no limited to the detachable flashing channel 12 attached to the wall 11 and the step flashing unit 16 located at intersection of the roof 14 and wall 11 more particularly and in one preferred embodiment the system 10 for protecting walls roofs from water includes a j shape detachable flashing channel 12 mounted on the wall 11 and an l shape step flashing unit 16 located at an intersection of the roof 14 and wall 11 in another preferred embodiment of the present invention there is provided a system 10 for protecting walls roofs from water including the detachable flashing channel 12 attached to the wall 11 and the step flashing unit 16 located at an intersection of the roof 14.