Datasets:
OTAR3088
/
BioData-CellLine_annotated

Dataset card Data Studio Files
xet
Community
1
PMCID
string
Sentences
string
ner
list
PMC11772585
H The cell apoptosis was determined by Annexin V/PI double staining (n = 6).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "H", "The", "cell", "apoptosis", "was", "determined", ...
PMC11483468
Early candidate peptides had high molecular weights and poor stability (26).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Early", "candidate", "peptides", "had", "high", "molecular", "weights", "an...
PMC11546117
Considering the scarce scientific evidence on safely using medicines by pregnant and lactating women, the funded European project ConcePTION (https://www.imi-conception.eu/) supported and encouraged the development and validation of non-clinical in vitro, in vivo, and in silico models to predict the passage of medicines across the blood–milk barrier .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11106977
Interestingly, O-GlcNAcylation modification functionally increased transcriptional activity in the Hh/ Gli pathway in tumor cells (Fig. 3) .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Interestingly", ",", "O-GlcN...
PMC10291556
As shown in Figure 3A, the concentration of lactate excreted by HeLa cells into media was considerably reduced by treatment with Pt(IV) complexes 3 and 4 containing DCF ligands; the effect was dependent on the number of coordinated DCF molecules.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11530949
ROS Measurements The H2DCFDA kit was utilized to assess the ROS generated by the extract and the doped NPs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ROS", "Measurements", "The", "H2D...
PMC9429973
In CAPTIVATE, pts received three 28-d cycles of I, followed by 12 cycles of I+V (I 420 mg/d orally; V ramp-up to 400 mg/d orally).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11724582
First- and second-generation EGFR-TKIs have been listed successively, and great progress has been made in their clinical treatment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "First-", "and", "second-generation", ...
PMC11225860
Aneuploidy is a direct outcome of this instability.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Aneuploidy", "is", "a", "direct", "outcome", "of", "this", "instability", "." ] } ]
PMC8922418
The pegRNA consists of three elements: a sgRNA corresponding to the target site, a primer binding sequence, and a reverse transcription template storing genetic information for targeting (Anzalone et al., 2019).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7229095
Media in CLD have different requirements depending on the process step.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Media", "in", "CLD", "have", "different", "requirements", "depending", "on", "the", "...
PMC9512971
It is considered that the epidemic strain at the time was a D614G strain, but no data on the type of strain were collected for this study.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11752767
This phenomenon may result from the recognition of the MAGE-A12 protein expressed in a subset of neurons in the human brain, leading to a calamitous immune response to the white matter.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
CYT-338 bound MM cell lines with ~ 2-fold higher mean fluorescence intensity than anti-CD38 monoclonal antibody (mAb) or daratumumab alone.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "CYT-338", "b...
PMC6379402
In the main paper, we use initial solutions based on singular value decomposition of the average adjacency matrix , where a is the number of to be decomposed adjacency matrices, following the idea of Qiao.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC4270159
KHM-3S: p-EGFR Y1068.
[ { "tags": [ "O", "O", "O", "O", "O" ], "tokens": [ "KHM-3S", ":", "p-EGFR", "Y1068", "." ] } ]
PMC9429973
While retrospective data suggest PTCy show low rates of chronic GVHD, potential disadvantages of PTCy include increased risks of CMV reactivation, veno-occlusive disease (VOD), haemorrhagic cystitis and exposure of donor haematopoiesis to high-dose alkylator resulting in DNA damage and potential for secondary myeloid neoplasia.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10957991
In the case of cardiac fibroblasts, TRPV4-dependent differentiation seems to be orchestrated by both biochemical and mechanical cues and involves actomyosin-regulating Rho kinase pathway.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC10976516
In addition to boosting the trafficking of cells to tumors, cell carriers, and their viral payloads, can be altered to enhance many elements of cell-mediated OV delivery, such as loading capacity, virus generation, and delivery to tumor cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6160470
The cell viability was evaluated by MTT assay after 72 h of incubation, and the percentage of viable cells was calculated.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "cell"...
PMC9370419
Twenty-four hours after transfection, the cells from one well were digested and cultured in a 10 cm dish, subjected to 300 µg/mL hygromycin, and selected for two weeks.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11737091
For further analysis, the tumor tissue sections were stained for Ki-67 to enhance the validity of the vivo experiments.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "further", "analysis",...
PMC9780037
A recent review discusses the biochemical properties of cyt c that enable its repurposing as a proapoptotic chemotherapeutic drug and describes several cyt c cell delivery systems for cancer therapy.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11626627
In previous studies, we discovered that ERβ promotes the progression of ccRCC by regulating the circATP2B1/miR-204–3p signaling pathway.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "previous", "studies", ",", ...
PMC11306019
MAC, was adopted from Br J Haematol.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "MAC", ",", "was", "adopted", "from", "Br", "J", "Haematol", "." ] } ]
PMC11765988
The underlying link remains uncertain but may involve chronic immune system activation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "underlying", "link", "remains", "uncertain", "but", "may", "involve", "ch...
PMC10914904
vtRNAs may remain unprocessed and protected from methylation by the SRSF2 protein.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "vtRNAs", "may", "remain", "unprocessed", "and", "protected", "from", "methylation", ...
PMC11515150
Cytotoxicity of 12 C CAR-NK cells and NT-NK cells against normal T cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cytotoxicity", "of", "12", "C", "CAR-NK", "cells", "and", "NT-NK", "c...
PMC11670407
P < 0.05, **P < 0.01 vs. the corresponding control Since ROS are known to trigger or promote the mitochondrial apoptotic pathway under cisplatin treatment and GPX4 functions as a resistance molecule to ROS , we hypothesized that increased cisplatin-induced apoptosis due to OTULIN depletion in osteosarcoma cells is associated with GPX4 deficiency and increased mitochondrial oxidative stress.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11679892
In addition, no significant change was observed in Bcl-2 gene expression.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "addition", ",", "no", "significant", "change", "was", "observed", "in", ...
PMC11093197
To measure RAS activity, we performed a RAS‐GTP binding assay.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "measure", "RAS", "activity", ",", "we", "performed", "a", "RAS‐GTP", "binding",...
PMC10631132
In short, cells were fixed using 4% PFA, washed, staining mix was added to the plate and incubated for 20 min at 37°C.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
For sITP, overall IRR was 1.37 [1.06; 1.74] for any fracture, and 1.65 [1.16; 2.29] for hip – and femoral fractures.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8633974
Each of the experiments were performed in triplicate.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Each", "of", "the", "experiments", "were", "performed", "in", "triplicate", "." ] } ]
PMC5925824
GloResponse NFAT-luc2/PD1 Jurkat cells (Promega) were re-suspended in assay buffer at a concentration of 1.25 × 10 /ml and added to the plate at 40 μl per well.
[ { "tags": [ "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Although hematopoietic stem cell transplantation involves a high risk of mortality, it is nowadays the only curative treatment for MF.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Although", "hematopoiet...
PMC11787355
Nevertheless, to experimentally assess potential off-targets, we applied ARDitox, an in silico artificial intelligence (AI)-based prediction tool for off-target TCR binding.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11719944
As a result, further immunological assessments of the phenotype and function of relevant T cell subtypes are essential for more accurate prediction, monitoring, and classification of patients with T1D.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Clinical and laboratory features, as well as outcome measures (response rates, progression free and overall survival) were compared between patients with and without concomitant statin use.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11747885
However, significant differences in viability levels were observed when cells were exposed to 40 μM menadione, a compound known to induce ROS-based cellular stress.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11594806
This Gs signaling, initiated by extracellular ADO, activates adenylate cyclase, leading to intracellular accumulation of cyclic AMP (cAMP).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", ...
PMC5311252
miR-372-3p or the reference small RNA RNU48 were reverse-transcribed using Bio-Rad MyCycler thermal cycler with TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific, 4366596) according to product protocol, and miR-372-3p or RNU48 RT primer from TaqMan MicroRNA Assay (Life Technolgies, 4427975.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11502443
Non-normalized Emin and Emax values are summarized in Supplementary Table S1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Non-normalized", "Emin", "and", "Emax", "values", "are", "summarized", "in", "Supplementary...
PMC8345486
The MTT assay was performed as described in the Supplementary Materials in some experiments with drugs for comparison with NR results.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "MTT", "ass...
PMC8903741
Therefore, it was difficult to promptly confirm the transfection efficiency and to selectively differentiate the antibody gene-transfected clones.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Therefore", ",", "it", "was", ...
PMC11209164
A slightly greater but statistically significant enhancement in impact on virus titers was observed with TPF-VSVΔ51 compared to DMF- VSVΔ51.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "slightly", "greater", ...
PMC11711127
The study showed that NK cells in EAE mice can induce anergy in CD4+ T cells upon histidine triad nucleotide binding protein 1 (HINT1)/heat shock protein 70 (Hsp70) treatment rather than inducing necrosis or apoptosis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
V. Bumbea, H. Bumbea, L. Ardelean, L. Radulescu, L. Damian, I. Dumitru, C. Lambert, V. Popov, C. Tomuleasa, A.-M. Vladareanu Dyalisis, Emergency Hospital Bucharest; University of Medicine and Pharmacy Carol Davila Bucharest; Hematology Blood and Marrow Transplant Unit; Nephrology; Blood Unit, Emergency University Hospital Bucharest, Bucharest, Romania; CHU de Saint Etienne, Saint Etienne, France; Hematology, Clinical Colentina Hospital Bucharest, Bucharest; Hematology, Institute of Onclology Cluj Napoca; University of Medicine and Pharmacy Iuliu Hateganu, Cluj Napoca; Hematology, Emergency University Hospital Bucharest, Bucharest, Romania Background: COVID-19 infection is known to associate an important inflammatory response with high risk for organ damages and thrombotic events.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11632064
ES, enrichment score; NES, normalized enrichment score; NOM p, nominal P-value; FDR q, false-discovery rate q-value.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ES", ...
PMC11361748
On day 2, cells were treated with 20 nM TPA in full serum medium for 6 h. After rinsing (1× PBS), 2 ml serum-reduced medium (0.1% FBS) was added cells incubated for another 24 h. CM was collected using a 3 ml syringe (BD Syringe) and filtered through a 0.22 μm PVDF syringe filter (Millipore #SLGVM33RS), divided into aliquots and stored at −20°C until use.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7192625
In addition, Hi-C cannot easily assess the significance of inter-chromosomal interactions.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "addition", ",", "Hi-C", "can", "not", "easily", "assess", "the"...
PMC11774747
Consequently, no immediate rejection of CAR-VST by recipient T cells was observed even after multiple infusions.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Consequently", ",", "no", "immediate", "rejection...
PMC9429973
Methods: Diagnostic bone marrow samples from 261 children with B-ALL and 22 matching samples drawn from 21 patients at first or second relapse were investigated by digital multiplex ligation-dependent probe amplification (digitalMLPA) using the ALL-specific D007 probemix.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9243326
The numbers and lengths of 5′ UTRs, 3′ UTRs, and CDSs were identified using the ANGEL software.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "numbers", "and", "lengths"...
PMC9164404
The increased expression of ABAT in the Abplatin-treated cells might be the one of reasons for its cell killing effect.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "increased", "expressi...
PMC11350568
As indicated in Figure 3a,b, by co-incubating AptGs with Cy5-Sgc8c or FAM-HG1–9, AptG-1 could still efficiently bind to CCRF-CEM, forming a stable TMPDS.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", ...
PMC10907726
Importantly, numerous studies have reported the inhibitory effects of DATS in various cancers, including breast cancer, gastric cancer, glioblastoma, hepatocellular carcinoma, esophageal cancer, and bladder cancer [, , , , ].
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11286266
S1P and S2P cleavage sites were also mutated to increase expression yield.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "S1P", "and", "S2P", "cleavage", "sites", "were", "also", "mutated", "to", ...
PMC11588008
This finding indicated that HUC-MSCs had significant repair and clearance effects on abnormal ROS generated by PM-induced damage to ovarian cancer cells (Figure 5a and b).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11291490
d The expression of E protein was measured in vivo.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "d", "The", "expression", "of", "E", "protein", "was", "measured", "in", "vivo", "." ] ...
PMC11277157
PARK7 (DJ-1) was extensively studied for its function as an oxidative stress sensor and in executing the oxidative stress cellular response.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "PARK7",...
PMC10588957
The Statistical Product and Service Solutions software (SPSS version 22.0) was used for data analyses.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "Statistical", "Product", "and", "Service",...
PMC10607604
EMT, which is induced by PTPN13 KO/KD in our model, plays an important role in platinum salt resistance in various tumor types (for review, ), including ovarian cancer (for review, ).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
None of the controls had anti-PF4/polyanion antibodies.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "None", "of", "the", "controls", "had", "anti-PF4/polyanion", "antibodies", "." ] } ]
PMC11706776
G Effect of GW542573X on CCE using Mn quenching assay and the normalized Mn quenching slope (N = 28 for Control and N = 20 for GW542573X condition). *
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11040965
Similar effects are obtained with decitabine treatment of U266 and RPMI 8226 cells, suggesting that proteasome subunit genes are mainly regulated by methylation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O"...
PMC11335267
All mice from either background were males of 16–20 weeks of age.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "All", "mice", "from", "either", "background", "were", "males", "of", "16–20", ...
PMC6799808
β-Tubulin served as a loading control.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "β-Tubulin", "served", "as", "a", "loading", "control", "." ] } ]
PMC11788920
The sequence of the 27 nt long PQS of the c-Myc promoter is follows: TGGGGAGGGTGGGGAGGGTGGGGAAGG, with the underlined five G-tracts shown to form two different GQ structures .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Continuous variables are reported as means with standard deviations, while categorical variables are presented as percentages.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Continuous", "variables", "are", "reported", "as"...
PMC9429973
CD7-ablated CAR T cells (KO7CAR) were derived by electroporation of bulk T cells with CD7-targeting Cas9-gRNA RNP 24 hours before 7CAR transduction.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11013014
Compound 22 exhibits activity on both HL60 and HCT116 cell lines at 10 µM with viabilities of 14% and 21%, respectively.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC9429973
Thus, treatment of MF pts with thrombocytopenia confers a unique challenge and unmet medical need.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "treatment", "of", "MF", "pts", "wit...
PMC11694066
For replication fork labeling, cells received prewarmed medium containing 100 μmol/L 5-chloro-2′-deoxyuridine and were incubated at 37°C and 5% CO2 for 30 minutes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11627398
These results showed that SLC31A1, MTF1, LIAS and LIPT1 may serve as potential biomarkers for the diagnosis of septic shock.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "res...
PMC11045125
This is the first demonstration that latent EBV infection combined with Myc over-expression in normal human B cells is sufficient to induce Burkitt-like lymphomas in mice.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11607321
The generation of large-scale multi-omic datasets is both time and resource-intensive, thereby positioning MOSA as a valuable tool for in silico testing and prioritization of drug targets for experimental validation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
All patients received the full dose as planned, except for 1 patient at the 36-month follow-up visit who experienced infusion/technical problems.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "All", "patie...
PMC7185206
Additional cell lines, inhibitors, and concentrations shown in Supplemental Figures 3 and 4. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additional", "cell", "lines", ",", "inhibitors", ",", ...
PMC10482220
Thus, the recruitment of domain D to SGs could simply be mediated by its affinity for RNA.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "the", "recruitment", "of"...
PMC11658074
WB analysis confirmed the increased APN levels in AT-EVs (Fig. S14).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "WB", "analysis", "confirmed", "the", "increased", "APN", "levels", "in", ...
PMC5811757
Based on the recommendations of the Cell Bank (ECACC) to maintain high P-gp levels, 10μM Doxorubicin (Tedec-Meiji Farma, S.A, Spain) was added to the culture medium once a week, usually after each passage.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11509309
Thus, the level of luciferase expressed in these cells is proportional to the level of CHOP induction.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "the", "level", "of", ...
PMC9429973
ORR for 29 pts who crossed over to ZO was 24.1%.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ORR", "for", "29", "pts", "who", "crossed", "over", "to", "ZO", "was", ...
PMC11720808
Data are shown as mean ± SD (n=5). **
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Data", "are", "shown", "as", "mean", "±", "SD", "(", "n=5", ")", "."...
PMC11472569
It has been reported to transport several anticancer drugs, including mitoxantrone, topotecan, and irinotecan.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "has", "been", "reported", "to", "tran...
PMC9429973
Continuous variables were compared with Mann-Whitney U test, and categorical using Chi-square or Fisher´s exact tests.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Continuous", "variables", "were", "compared", "wi...
PMC11742864
Platinum-based drugs are the basic drugs for lung cancer chemotherapy, but resistance is also unavoidable.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Platinum-based", "drugs", "are", "the", "basic", "drug...
PMC11719944
Exhausted T cells lose their normal functions, such as producing cytokines, killing cells, and multiplying, and start expressing multiple co-inhibitory receptors (CTLA-4, PD-1, LAG-3, TIM3, and TIGIT).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Tumor CLL B-cells weakly express a B cell receptor (BCR) on the surface which is composed, in the vast majority of cases, of immunoglobulins (Ig) of the mu (µ) and delta (δ) isotypes and Ig class-switched CLL are rare, raising the question of abnormalities in the Ig gene recombination machinery in this B-cell cancer.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8592717
PCA can also be extracted from dried almond hulls (Prunus amygdalus Batsch) .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "PCA", "can", "also", "be", "extracted", "from", "dried", "almond...
PMC11746948
After 30 s vortex, then the samples were sonicated for 10 min in ice-water bath.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "After", "30", "s", "vortex", ",", "then", "the",...
PMC11621565
16 µg/ml of curli CsgA and PSMα1 did not modify the mRNA levels of α-synuclein in dopaminergic-differentiated SH-SY5Y cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "16", "µg/ml", "of", "cur...
PMC10547921
PDC is an equivalent antibody–drug conjugate that overcomes some of the limitations of ADC and has many unique advantages.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "PDC", "is", "an",...
PMC10831439
Error bars show SD.
[ { "tags": [ "O", "O", "O", "O", "O" ], "tokens": [ "Error", "bars", "show", "SD", "." ] } ]
PMC10882807
The relative expression level of hsa_circ_0005397 in HCC tissues were normalized to normal tissues (n = 57). (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "relative", "expressio...
PMC11638255
A single-cell dissociation was achieved by passing the mixture through a 70μm MACS SmartStrainer (Miltenyi Biotec, Germany; #130-110-916).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11552389
FSIP1 expression was assessed in melanoma and normal tissue samples. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "FSIP1", "expression", "was", "assessed", "in", "melanoma", "and", "normal", "tissue", ...
PMC11185260
Mice with established tumors were injected twice a week for 6 injections of scL-SMARCB1 (30µg DNA/injection, intravenously administered).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Mice", "with...
PMC8903741
Dysregulated MMP9 expression and its abnormal activity are involved in pathological processes that contribute in chronic inflammation, tumorigenesis, and metastasis [2–4].
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...