PMCID string | Sentences string | ner list |
|---|---|---|
PMC9429973 | The circRNA expression profile of this gene differs among the MDS and AML cell lines, as well as among the six AML cell lines. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"circRNA",
"expression",
"profile",
"of",
"this",
"gene",
"differs",
"among",
"the",
"MDS",
"and",
"AML",
"cell",
"lines",
",",
"as",
"well",
"as",
"among",
"the",
"six",
"AML",
"cell",
"lines",
"."
]
}
] |
PMC9780037 | Cyt c was cryopreserved in a solution containing ethylammonium nitrate and 1-butyl-3-methylimidazolium thiocyanate ionic liquids. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Cyt",
"c",
"was",
"cryopreserved",
"in",
"a",
"solution",
"containing",
"ethylammonium",
"nitrate",
"and",
"1-butyl-3-methylimidazolium",
"thiocyanate",
"ionic",
"liquids",
"."
]
}
] |
PMC11240571 | Post radiotherapy, changes in PD-L1 expression were compared. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Post",
"radiotherapy",
",",
"changes",
"in",
"PD-L1",
"expression",
"were",
"compared",
".",
"("
]
}
] |
PMC10329237 | Data were expressed as the mean ± SD for at least three independent tests. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Data",
"were",
"expressed",
"as",
"the",
"mean",
"±",
"SD",
"for",
"at",
"least",
"three",
"independent",
"tests",
"."
]
}
] |
PMC11047729 | Oleic acid decreases telomerase activity competitively to the telomerase substrate primer . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Oleic",
"acid",
"decreases",
"telomerase",
"activity",
"competitively",
"to",
"the",
"telomerase",
"substrate",
"primer",
"."
]
}
] |
PMC11297139 | Furthermore, the in vitro droplet assay showed that EWS/FLI1 forms co-condensate with ARID1A WT (Fig. 6b). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Furthermore",
",",
"the",
"in",
"vitro",
"droplet",
"assay",
"showed",
"that",
"EWS/FLI1",
"forms",
"co-condensate",
"with",
"ARID1A",
"WT",
"(",
"Fig.",
"6b",
")",
"."
]
}
] |
PMC7504302 | In a follow up study, the same group performed a large-scale drug screen consisting of seven common compounds (cisplatin, carboplatin, oxaliplatin, vinorelbine, gemcitabine, pemetrexed, and doxorubicin) and their combinations (cisplatin + pemetrexed, cisplatin + gemcitabine, carboplatin + pemetrexed, oxaliplatin + gemcitabine, and oxaliplatin + vinorelbine) on a set of 81 different primary cultures. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"a",
"follow",
"up",
"study",
",",
"the",
"same",
"group",
"performed",
"a",
"large-scale",
"drug",
"screen",
"consisting",
"of",
"seven",
"common",
"compounds",
"(",
"cisplatin",
",",
"carboplatin",
",",
"oxaliplatin",
",",
"vinorelbine",
",",
"gemcitabine",
",",
"pemetrexed",
",",
"and",
"doxorubicin",
")",
"and",
"their",
"combinations",
"(",
"cisplatin",
"+",
"pemetrexed",
",",
"cisplatin",
"+",
"gemcitabine",
",",
"carboplatin",
"+",
"pemetrexed",
",",
"oxaliplatin",
"+",
"gemcitabine",
",",
"and",
"oxaliplatin",
"+",
"vinorelbine",
")",
"on",
"a",
"set",
"of",
"81",
"different",
"primary",
"cultures",
"."
]
}
] |
PMC10253553 | Sample lysis and protein extraction in RPPA lysis buffer were carried out by the RPPA Core. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Sample",
"lysis",
"and",
"protein",
"extraction",
"in",
"RPPA",
"lysis",
"buffer",
"were",
"carried",
"out",
"by",
"the",
"RPPA",
"Core",
"."
]
}
] |
PMC11767817 | Equal amounts of protein (150 μg) for all samples were mixed with a cocktail of biotinylated detection antibodies and incubated with array membranes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Equal",
"amounts",
"of",
"protein",
"(",
"150",
"μg",
")",
"for",
"all",
"samples",
"were",
"mixed",
"with",
"a",
"cocktail",
"of",
"biotinylated",
"detection",
"antibodies",
"and",
"incubated",
"with",
"array",
"membranes",
"."
]
}
] |
PMC11252553 | Finally, differential cell counting and viability analysis were performed by an FCM instrument. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Finally",
",",
"differential",
"cell",
"counting",
"and",
"viability",
"analysis",
"were",
"performed",
"by",
"an",
"FCM",
"instrument",
"."
]
}
] |
PMC11637820 | The infection caused can be due to a particular bacterial strain (monomicrobial) or by the action of multiple bacterial strains (polymicrobial) . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"infection",
"caused",
"can",
"be",
"due",
"to",
"a",
"particular",
"bacterial",
"strain",
"(",
"monomicrobial",
")",
"or",
"by",
"the",
"action",
"of",
"multiple",
"bacterial",
"strains",
"(",
"polymicrobial",
")",
"."
]
}
] |
PMC11684821 | More recent work has shown that some αβ T cells can recognize nonprotein, foreign, intracellular antigens presented by the CD1 family of proteins and MHC-related protein 1 (MR1), which also assemble with β2-microglobulin and adopt a highly similar fold and structure to MHC-I (4, 5). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"More",
"recent",
"work",
"has",
"shown",
"that",
"some",
"αβ",
"T",
"cells",
"can",
"recognize",
"nonprotein",
",",
"foreign",
",",
"intracellular",
"antigens",
"presented",
"by",
"the",
"CD1",
"family",
"of",
"proteins",
"and",
"MHC-related",
"protein",
"1",
"(",
"MR1",
")",
",",
"which",
"also",
"assemble",
"with",
"β2-microglobulin",
"and",
"adopt",
"a",
"highly",
"similar",
"fold",
"and",
"structure",
"to",
"MHC-I",
"(",
"4",
",",
"5",
")",
"."
]
}
] |
PMC10523483 | E and F) Detection of mRNA levels of GCLC and H1C in A549 cells treated with 16-h 100 μM tBHQ (E) or 48-h 10 μM ML385 (F). ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"E",
"and",
"F",
")",
"Detection",
"of",
"mRNA",
"levels",
"of",
"GCLC",
"and",
"H1C",
"in",
"A549",
"cells",
"treated",
"with",
"16-h",
"100",
"μM",
"tBHQ",
"(",
"E",
")",
"or",
"48-h",
"10",
"μM",
"ML385",
"(",
"F",
")",
".",
"("
]
}
] |
PMC10174970 | We compared the genetic similarity between PAAD cell lines and human tissue to choose the most appropriate cell lines. • | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"We",
"compared",
"the",
"genetic",
"similarity",
"between",
"PAAD",
"cell",
"lines",
"and",
"human",
"tissue",
"to",
"choose",
"the",
"most",
"appropriate",
"cell",
"lines",
".",
"•"
]
}
] |
PMC11607638 | The isolated rat pancreatic acini were perifused with buffer alone (F), or with CCK 10 pM (G). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"isolated",
"rat",
"pancreatic",
"acini",
"were",
"perifused",
"with",
"buffer",
"alone",
"(",
"F",
")",
",",
"or",
"with",
"CCK",
"10",
"pM",
"(",
"G",
")",
"."
]
}
] |
PMC9688728 | It is noteworthy that this pathway, when parsing clustered data, does not appear significant, when searching against the SMPDB library. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"It",
"is",
"noteworthy",
"that",
"this",
"pathway",
",",
"when",
"parsing",
"clustered",
"data",
",",
"does",
"not",
"appear",
"significant",
",",
"when",
"searching",
"against",
"the",
"SMPDB",
"library",
"."
]
}
] |
PMC11585254 | The next day, cells were washed with 1 ml serum-free DMEM containing 20 mM HEPES, pH 7.4, and then serum starved for 3 hours in the same medium. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"next",
"day",
",",
"cells",
"were",
"washed",
"with",
"1",
"ml",
"serum-free",
"DMEM",
"containing",
"20",
"mM",
"HEPES",
",",
"pH",
"7.4",
",",
"and",
"then",
"serum",
"starved",
"for",
"3",
"hours",
"in",
"the",
"same",
"medium",
"."
]
}
] |
PMC2193049 | The material was then loaded onto a column and washed extensively with 20 mM Tris–HCl (pH 7.6), and 50 mM NaCl to remove unattached material. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"material",
"was",
"then",
"loaded",
"onto",
"a",
"column",
"and",
"washed",
"extensively",
"with",
"20",
"mM",
"Tris",
"–",
"HCl",
"(",
"pH",
"7.6",
")",
",",
"and",
"50",
"mM",
"NaCl",
"to",
"remove",
"unattached",
"material",
"."
]
}
] |
PMC8358006 | Using a lentiviral-based RNA interference (short hairpin RNA (shRNA)) approach, we knocked down TBX20 in KYSE510 cells and quantified cell growth in vivo (Fig. 5c). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Using",
"a",
"lentiviral-based",
"RNA",
"interference",
"(",
"short",
"hairpin",
"RNA",
"(",
"shRNA",
")",
")",
"approach",
",",
"we",
"knocked",
"down",
"TBX20",
"in",
"KYSE510",
"cells",
"and",
"quantified",
"cell",
"growth",
"in",
"vivo",
"(",
"Fig.",
"5c",
")",
"."
]
}
] |
PMC11748335 | E As an example, a snapshot of Integrated Genome Viewer (IGV) software is shown. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"E",
"As",
"an",
"example",
",",
"a",
"snapshot",
"of",
"Integrated",
"Genome",
"Viewer",
"(",
"IGV",
")",
"software",
"is",
"shown",
"."
]
}
] |
PMC10669128 | Thus, CDK inhibitors can be a valuable therapeutic strategy for patients with LMS . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Thus",
",",
"CDK",
"inhibitors",
"can",
"be",
"a",
"valuable",
"therapeutic",
"strategy",
"for",
"patients",
"with",
"LMS",
"."
]
}
] |
PMC11779605 | Sample names are listed at the bottom of the map (A, ascites; T, tumor). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Sample",
"names",
"are",
"listed",
"at",
"the",
"bottom",
"of",
"the",
"map",
"(",
"A",
",",
"ascites",
";",
"T",
",",
"tumor",
")",
"."
]
}
] |
PMC7192625 | A portion chromosome 1 on the Hi-C network for GM06690 (35) showing contacts with FitHiC P-value < 0.05. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"portion",
"chromosome",
"1",
"on",
"the",
"Hi-C",
"network",
"for",
"GM06690",
"(",
"35",
")",
"showing",
"contacts",
"with",
"FitHiC",
"P-value",
"<",
"0.05",
"."
]
}
] |
PMC11216402 | To compare the expression of these DE TFs in normal stomach and normal fibroblast, we used GTEx normal stomach and GTEx normal fibroblast to rank the expression values of these DE TFs (between Mes and ENCODE-fibroblast) in the independent GTEx stomach and fibroblast expression profiles. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"To",
"compare",
"the",
"expression",
"of",
"these",
"DE",
"TFs",
"in",
"normal",
"stomach",
"and",
"normal",
"fibroblast",
",",
"we",
"used",
"GTEx",
"normal",
"stomach",
"and",
"GTEx",
"normal",
"fibroblast",
"to",
"rank",
"the",
"expression",
"values",
"of",
"these",
"DE",
"TFs",
"(",
"between",
"Mes",
"and",
"ENCODE-fibroblast",
")",
"in",
"the",
"independent",
"GTEx",
"stomach",
"and",
"fibroblast",
"expression",
"profiles",
"."
]
}
] |
PMC10142392 | Self-assembled structures (micelles) have been widely studied as encapsulation agents for various drugs and proteins . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Self-assembled",
"structures",
"(",
"micelles",
")",
"have",
"been",
"widely",
"studied",
"as",
"encapsulation",
"agents",
"for",
"various",
"drugs",
"and",
"proteins",
"."
]
}
] |
PMC7185206 | Understanding mechanisms of PD-(L)1 inhibitor resistance is crucial in improving antitumor immunity and survival. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Understanding",
"mechanisms",
"of",
"PD-(L)1",
"inhibitor",
"resistance",
"is",
"crucial",
"in",
"improving",
"antitumor",
"immunity",
"and",
"survival",
"."
]
}
] |
PMC11696576 | Replacing the oxygen atom of GK419 by sulfur (compound GK427) led to increased inhibition of cPLA2α (XI(50) 0.0010), which is comparable to GK420. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Replacing",
"the",
"oxygen",
"atom",
"of",
"GK419",
"by",
"sulfur",
"(",
"compound",
"GK427",
")",
"led",
"to",
"increased",
"inhibition",
"of",
"cPLA2α",
"(",
"XI(50",
")",
"0.0010",
")",
",",
"which",
"is",
"comparable",
"to",
"GK420",
"."
]
}
] |
PMC9954564 | Although no association involving this SNP has been reported so far, according to HaploReg v.4.1, this site resembles a TF binding motif activated in the T-lymphocyte subtypes, monocytes, B, NK, spleen, and GM12878 lymphoblastoid cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Although",
"no",
"association",
"involving",
"this",
"SNP",
"has",
"been",
"reported",
"so",
"far",
",",
"according",
"to",
"HaploReg",
"v.4.1",
",",
"this",
"site",
"resembles",
"a",
"TF",
"binding",
"motif",
"activated",
"in",
"the",
"T-lymphocyte",
"subtypes",
",",
"monocytes",
",",
"B",
",",
"NK",
",",
"spleen",
",",
"and",
"GM12878",
"lymphoblastoid",
"cells",
"."
]
}
] |
PMC8427838 | For charge state 2 peptides, slope m = 3.1, and the offset b = 1. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"For",
"charge",
"state",
"2",
"peptides",
",",
"slope",
"m",
"=",
"3.1",
",",
"and",
"the",
"offset",
"b",
"=",
"1",
"."
]
}
] |
PMC8922418 | Shannon et al. showed that targeting range of SpCas9 and its engineering variants was strongly restricted to its recognition sequence PAM to contain the guanines. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Shannon",
"et",
"al.",
"showed",
"that",
"targeting",
"range",
"of",
"SpCas9",
"and",
"its",
"engineering",
"variants",
"was",
"strongly",
"restricted",
"to",
"its",
"recognition",
"sequence",
"PAM",
"to",
"contain",
"the",
"guanines",
"."
]
}
] |
PMC11402217 | •Raw data and processed data were uploaded to Mendeley Data and are available via https://doi.org/10.17632/kb6g5n2nnz.1. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"•Raw",
"data",
"and",
"processed",
"data",
"were",
"uploaded",
"to",
"Mendeley",
"Data",
"and",
"are",
"available",
"via",
"https://doi.org/10.17632/kb6g5n2nnz.1",
"."
]
}
] |
PMC10411253 | ELISA of the secreted AMH in the transfected COS cell culture media using antibodies specific to the C-terminal bioactive domain. * | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"ELISA",
"of",
"the",
"secreted",
"AMH",
"in",
"the",
"transfected",
"COS",
"cell",
"culture",
"media",
"using",
"antibodies",
"specific",
"to",
"the",
"C-terminal",
"bioactive",
"domain",
".",
"*"
]
}
] |
PMC11770746 | To make sure that the anticancer effect of encapsulated cisPt(Pac)(OH) derives solely from the prodrug in the delivery vehicle, we subjected mice to high doses of empty micelles (250 mg/kg) resulting in a negligible change in tumor growth inhibition (8.6% TGI) with no decrease in body weight. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"To",
"make",
"sure",
"that",
"the",
"anticancer",
"effect",
"of",
"encapsulated",
"cisPt(Pac)(OH",
")",
"derives",
"solely",
"from",
"the",
"prodrug",
"in",
"the",
"delivery",
"vehicle",
",",
"we",
"subjected",
"mice",
"to",
"high",
"doses",
"of",
"empty",
"micelles",
"(",
"250",
"mg/kg",
")",
"resulting",
"in",
"a",
"negligible",
"change",
"in",
"tumor",
"growth",
"inhibition",
"(",
"8.6",
"%",
"TGI",
")",
"with",
"no",
"decrease",
"in",
"body",
"weight",
"."
]
}
] |
PMC10165258 | As the fluorescence intensity from these solutions would scale directly with dilutions of the stock solution, the fluorescence intensity measured on droplets of the drug stock was used for determining the drug concentration in each of the droplets. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"As",
"the",
"fluorescence",
"intensity",
"from",
"these",
"solutions",
"would",
"scale",
"directly",
"with",
"dilutions",
"of",
"the",
"stock",
"solution",
",",
"the",
"fluorescence",
"intensity",
"measured",
"on",
"droplets",
"of",
"the",
"drug",
"stock",
"was",
"used",
"for",
"determining",
"the",
"drug",
"concentration",
"in",
"each",
"of",
"the",
"droplets",
"."
]
}
] |
PMC11767817 | The 5637 cells were exposed to MK-2206 at a concentration range of 1.5 μM, 3 μM, 6 μM, 12 μM, 25 μM, and 50 μM for 24 h. The IC50 value calculated for MK-2206 was 14.9 µM. The dose–response curve for MK-2206 is presented in Figure 11A. | [
{
"tags": [
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"5637",
"cells",
"were",
"exposed",
"to",
"MK-2206",
"at",
"a",
"concentration",
"range",
"of",
"1.5",
"μM",
",",
"3",
"μM",
",",
"6",
"μM",
",",
"12",
"μM",
",",
"25",
"μM",
",",
"and",
"50",
"μM",
"for",
"24",
"h.",
"The",
"IC50",
"value",
"calculated",
"for",
"MK-2206",
"was",
"14.9",
"µM.",
"The",
"dose",
"–",
"response",
"curve",
"for",
"MK-2206",
"is",
"presented",
"in",
"Figure",
"11A",
"."
]
}
] |
PMC9786247 | Nevertheless, it is tempting to speculate that selection for bacterial host adaptation and virulence starts early in the infection process, i.e., inside the initial C. burnetii target cells, such as lung macrophages and dendritic cells, which was not mimicked by the model applied herein. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Nevertheless",
",",
"it",
"is",
"tempting",
"to",
"speculate",
"that",
"selection",
"for",
"bacterial",
"host",
"adaptation",
"and",
"virulence",
"starts",
"early",
"in",
"the",
"infection",
"process",
",",
"i.e.",
",",
"inside",
"the",
"initial",
"C.",
"burnetii",
"target",
"cells",
",",
"such",
"as",
"lung",
"macrophages",
"and",
"dendritic",
"cells",
",",
"which",
"was",
"not",
"mimicked",
"by",
"the",
"model",
"applied",
"herein",
"."
]
}
] |
PMC10589262 | Because the surface expression of MT-KIT was low, twice the amount of biotin-labeled lysates was used for GIST cells than in CC cell lysates. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Because",
"the",
"surface",
"expression",
"of",
"MT-KIT",
"was",
"low",
",",
"twice",
"the",
"amount",
"of",
"biotin-labeled",
"lysates",
"was",
"used",
"for",
"GIST",
"cells",
"than",
"in",
"CC",
"cell",
"lysates",
"."
]
}
] |
PMC7192625 | This might be related to differences in transcription factor occupancy at these regions. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"might",
"be",
"related",
"to",
"differences",
"in",
"transcription",
"factor",
"occupancy",
"at",
"these",
"regions",
"."
]
}
] |
PMC11714165 | p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"p",
"<",
"0.05",
",",
"*",
"*",
"p",
"<",
"0.01",
",",
"*",
"*",
"*",
"p",
"<",
"0.001",
",",
"and",
"*",
"*",
"*",
"*",
"p",
"<",
"0.0001",
"."
]
}
] |
PMC10978090 | TPE sessions are isovolemic, resulting in a globally neutral fluid balance postprocedure. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"TPE",
"sessions",
"are",
"isovolemic",
",",
"resulting",
"in",
"a",
"globally",
"neutral",
"fluid",
"balance",
"postprocedure",
"."
]
}
] |
PMC11739484 | No. 4390824). | [
{
"tags": [
"O",
"O",
"O",
"O"
],
"tokens": [
"No.",
"4390824",
")",
"."
]
}
] |
PMC11700340 | study tries to explore a novel target of linagliptin to provide a more descriptive mechanism of linagliptin as an anticancer. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"study",
"tries",
"to",
"explore",
"a",
"novel",
"target",
"of",
"linagliptin",
"to",
"provide",
"a",
"more",
"descriptive",
"mechanism",
"of",
"linagliptin",
"as",
"an",
"anticancer",
"."
]
}
] |
PMC9429973 | No statistically significant difference in post-SAT PFS (HR 1.23 p=0.592) and OS (HR 1.84, p=0.312) between patients submitted to transplant before and after 2016, despite more intensive therapeutic protocols (100% triplets and 24.5% anti-CD38-based regimens in former period compared with duplets in the first). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"No",
"statistically",
"significant",
"difference",
"in",
"post-SAT",
"PFS",
"(",
"HR",
"1.23",
"p=0.592",
")",
"and",
"OS",
"(",
"HR",
"1.84",
",",
"p=0.312",
")",
"between",
"patients",
"submitted",
"to",
"transplant",
"before",
"and",
"after",
"2016",
",",
"despite",
"more",
"intensive",
"therapeutic",
"protocols",
"(",
"100",
"%",
"triplets",
"and",
"24.5",
"%",
"anti-CD38-based",
"regimens",
"in",
"former",
"period",
"compared",
"with",
"duplets",
"in",
"the",
"first",
")",
"."
]
}
] |
PMC9429973 | Patients were classified according to the Adapted Genetic Risk (AGR) as previously described by Silveira DRA et al. Clinical data and basal laboratory values were retrieved from medical charts. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Patients",
"were",
"classified",
"according",
"to",
"the",
"Adapted",
"Genetic",
"Risk",
"(",
"AGR",
")",
"as",
"previously",
"described",
"by",
"Silveira",
"DRA",
"et",
"al.",
"Clinical",
"data",
"and",
"basal",
"laboratory",
"values",
"were",
"retrieved",
"from",
"medical",
"charts",
"."
]
}
] |
PMC6133382 | Previous gp120 vaccine trials such as RV144 failed to detect glycan-independent VRC01-like antibodies even though the VRC01 epitope was present on at least 2 different gp120s used for immunization. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Previous",
"gp120",
"vaccine",
"trials",
"such",
"as",
"RV144",
"failed",
"to",
"detect",
"glycan-independent",
"VRC01-like",
"antibodies",
"even",
"though",
"the",
"VRC01",
"epitope",
"was",
"present",
"on",
"at",
"least",
"2",
"different",
"gp120s",
"used",
"for",
"immunization",
"."
]
}
] |
PMC11502962 | Immunohistochemistry and immunofluorescence were performed on the tissue microarray with the following antibodies: rabbit polyclonal antibodies against human CD8 (ZEN Bio, Lot No:10011860), CD206 (Protein tech, Lot No:00080496), MIF (ZEN Bio, Lot No:20200101), and CXCR4 (ZEN Bio, Lot No: BJ10221968), and monoclonal mouse antibody against human CD68 (Abcam, Lot No:00098190). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Immunohistochemistry",
"and",
"immunofluorescence",
"were",
"performed",
"on",
"the",
"tissue",
"microarray",
"with",
"the",
"following",
"antibodies",
":",
"rabbit",
"polyclonal",
"antibodies",
"against",
"human",
"CD8",
"(",
"ZEN",
"Bio",
",",
"Lot",
"No:10011860",
")",
",",
"CD206",
"(",
"Protein",
"tech",
",",
"Lot",
"No:00080496",
")",
",",
"MIF",
"(",
"ZEN",
"Bio",
",",
"Lot",
"No:20200101",
")",
",",
"and",
"CXCR4",
"(",
"ZEN",
"Bio",
",",
"Lot",
"No",
":",
"BJ10221968",
")",
",",
"and",
"monoclonal",
"mouse",
"antibody",
"against",
"human",
"CD68",
"(",
"Abcam",
",",
"Lot",
"No:00098190",
")",
"."
]
}
] |
PMC11637284 | This strongly suggests that the side of the T. brucei p166 α-helix containing hydrophobic amino acids faces the kinked TAC60 α-helix, rather than the side with the highly conserved D1492 and E1495 (Fig 7A, top). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"strongly",
"suggests",
"that",
"the",
"side",
"of",
"the",
"T.",
"brucei",
"p166",
"α-helix",
"containing",
"hydrophobic",
"amino",
"acids",
"faces",
"the",
"kinked",
"TAC60",
"α-helix",
",",
"rather",
"than",
"the",
"side",
"with",
"the",
"highly",
"conserved",
"D1492",
"and",
"E1495",
"(",
"Fig",
"7A",
",",
"top",
")",
"."
]
}
] |
PMC5034105 | Consistent with ZIKV's tropism for the human rhabdomyosarcoma (RD) cell line, myalgia and arthralgia with periarticular edema are common features in symptomatic ZIKV infection. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Consistent",
"with",
"ZIKV",
"'s",
"tropism",
"for",
"the",
"human",
"rhabdomyosarcoma",
"(",
"RD",
")",
"cell",
"line",
",",
"myalgia",
"and",
"arthralgia",
"with",
"periarticular",
"edema",
"are",
"common",
"features",
"in",
"symptomatic",
"ZIKV",
"infection",
"."
]
}
] |
PMC8996378 | Diterpenoids, an important group of bioactive compounds in natural products, have been playing an important role in drug discovery. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Diterpenoids",
",",
"an",
"important",
"group",
"of",
"bioactive",
"compounds",
"in",
"natural",
"products",
",",
"have",
"been",
"playing",
"an",
"important",
"role",
"in",
"drug",
"discovery",
"."
]
}
] |
PMC10482220 | Other RNA-binding proteins associated with SGs include the poly(A)+ binding protein I (PABP-I) and the mRNA stabilizing protein HuR (Kedersha et al., 2002). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Other",
"RNA-binding",
"proteins",
"associated",
"with",
"SGs",
"include",
"the",
"poly(A)+",
"binding",
"protein",
"I",
"(",
"PABP-I",
")",
"and",
"the",
"mRNA",
"stabilizing",
"protein",
"HuR",
"(",
"Kedersha",
"et",
"al.",
",",
"2002",
")",
"."
]
}
] |
PMC10996034 | The medium for the A2780 cell line was additionally supplemented with 1% L-glutamine (Procell Life Science & Technology Co., Ltd.). | [
{
"tags": [
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"medium",
"for",
"the",
"A2780",
"cell",
"line",
"was",
"additionally",
"supplemented",
"with",
"1",
"%",
"L-glutamine",
"(",
"Procell",
"Life",
"Science",
"&",
"Technology",
"Co.",
",",
"Ltd.",
")",
"."
]
}
] |
PMC5941560 | In 1990, Cheng and Haas detected a heterozygous, stop-gained single-nucleotide substitution in codon 196 (R196*) in Jurkat cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O"
],
"tokens": [
"In",
"1990",
",",
"Cheng",
"and",
"Haas",
"detected",
"a",
"heterozygous",
",",
"stop-gained",
"single-nucleotide",
"substitution",
"in",
"codon",
"196",
"(",
"R196",
"*",
")",
"in",
"Jurkat",
"cells",
"."
]
}
] |
PMC8524093 | After these events, all individual nsPs are produced and the synthesis of the structural proteins is initiated. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"After",
"these",
"events",
",",
"all",
"individual",
"nsPs",
"are",
"produced",
"and",
"the",
"synthesis",
"of",
"the",
"structural",
"proteins",
"is",
"initiated",
"."
]
}
] |
PMC9429973 | Image: Summary/Conclusion: POD12 and POD24 are associated with unfavorable outcomes and worse OS. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Image",
":",
"Summary/Conclusion",
":",
"POD12",
"and",
"POD24",
"are",
"associated",
"with",
"unfavorable",
"outcomes",
"and",
"worse",
"OS",
"."
]
}
] |
PMC11760643 | P2X7 was present on all blood mononuclear leukocyte subsets analysed (Figure 3). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"P2X7",
"was",
"present",
"on",
"all",
"blood",
"mononuclear",
"leukocyte",
"subsets",
"analysed",
"(",
"Figure",
"3",
")",
"."
]
}
] |
PMC10988555 | FT-IR [KBr, cm]: 3082–3076 (νC–H, aromatic rings); 1604 (νC=N, phen); 1583–1433 (νC=C, aromatic rings); 1261(νCF3SO3); 873–696 (δC–H, aromatic rings). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"FT-IR",
"[",
"KBr",
",",
"cm",
"]",
":",
"3082–3076",
"(",
"νC",
"–",
"H",
",",
"aromatic",
"rings",
")",
";",
"1604",
"(",
"νC",
"=",
"N",
",",
"phen",
")",
";",
"1583–1433",
"(",
"νC",
"=",
"C",
",",
"aromatic",
"rings",
")",
";",
"1261(νCF3SO3",
")",
";",
"873–696",
"(",
"δC",
"–",
"H",
",",
"aromatic",
"rings",
")",
"."
]
}
] |
PMC7305184 | Nevertheless, some variations between generations within the same experimental group (within CTRL group, within CTRL + EP group and within EP group) can be observed at intermediate electric fields/experimental points which however do not provide evidence of cells developing adaptive resistance. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Nevertheless",
",",
"some",
"variations",
"between",
"generations",
"within",
"the",
"same",
"experimental",
"group",
"(",
"within",
"CTRL",
"group",
",",
"within",
"CTRL",
"+",
"EP",
"group",
"and",
"within",
"EP",
"group",
")",
"can",
"be",
"observed",
"at",
"intermediate",
"electric",
"fields/experimental",
"points",
"which",
"however",
"do",
"not",
"provide",
"evidence",
"of",
"cells",
"developing",
"adaptive",
"resistance",
"."
]
}
] |
PMC8526701 | We found the BRD9 inhibition downregulates TUFT1 expression and dephosphorylated AKT (Fig. S2G). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"We",
"found",
"the",
"BRD9",
"inhibition",
"downregulates",
"TUFT1",
"expression",
"and",
"dephosphorylated",
"AKT",
"(",
"Fig.",
"S2",
"G",
")",
"."
]
}
] |
PMC8916024 | This study found that the microbial diversity of the sediment was significantly higher than that of the snails gut (P < 0.001), but there was no significant difference between the gut flora of adult and juvenile snails (P > 0.05). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"study",
"found",
"that",
"the",
"microbial",
"diversity",
"of",
"the",
"sediment",
"was",
"significantly",
"higher",
"than",
"that",
"of",
"the",
"snails",
"gut",
"(",
"P",
"<",
"0.001",
")",
",",
"but",
"there",
"was",
"no",
"significant",
"difference",
"between",
"the",
"gut",
"flora",
"of",
"adult",
"and",
"juvenile",
"snails",
"(",
"P",
">",
"0.05",
")",
"."
]
}
] |
PMC6181431 | Different numbers of colonies were seen for the different A704 derivative lines that varied to a small extent with and without doxycycline. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Different",
"numbers",
"of",
"colonies",
"were",
"seen",
"for",
"the",
"different",
"A704",
"derivative",
"lines",
"that",
"varied",
"to",
"a",
"small",
"extent",
"with",
"and",
"without",
"doxycycline",
"."
]
}
] |
PMC10898159 | In vivo, targeting the Hh pathway can reduce KIT mRNA and re-enhance the sensitivity of GIST cells to TKIs. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"vivo",
",",
"targeting",
"the",
"Hh",
"pathway",
"can",
"reduce",
"KIT",
"mRNA",
"and",
"re-enhance",
"the",
"sensitivity",
"of",
"GIST",
"cells",
"to",
"TKIs",
"."
]
}
] |
PMC11534377 | To quantify migration, images from three randomly selected fields were taken and analyzed. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"To",
"quantify",
"migration",
",",
"images",
"from",
"three",
"randomly",
"selected",
"fields",
"were",
"taken",
"and",
"analyzed",
"."
]
}
] |
PMC3931643 | Knocking down eIF4E or adding back 4EBP1 can help circumvent the resistance to asTORi, sensitizing cap dependent translation and potentiating cell death. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Knocking",
"down",
"eIF4E",
"or",
"adding",
"back",
"4EBP1",
"can",
"help",
"circumvent",
"the",
"resistance",
"to",
"asTORi",
",",
"sensitizing",
"cap",
"dependent",
"translation",
"and",
"potentiating",
"cell",
"death",
"."
]
}
] |
PMC10203589 | Moreover, in addition to finding that FGF18 is highly expressed in HCC tissues and cell lines, Li’s team also found that FGF18 mediates the regulation of miR-139 on HCC progression. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Moreover",
",",
"in",
"addition",
"to",
"finding",
"that",
"FGF18",
"is",
"highly",
"expressed",
"in",
"HCC",
"tissues",
"and",
"cell",
"lines",
",",
"Li",
"’s",
"team",
"also",
"found",
"that",
"FGF18",
"mediates",
"the",
"regulation",
"of",
"miR-139",
"on",
"HCC",
"progression",
"."
]
}
] |
PMC9577200 | It is considered a general proliferation stimulator as a scaffold for microbial adhesion and diffusion, not as a bactericide or microbial agent. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"It",
"is",
"considered",
"a",
"general",
"proliferation",
"stimulator",
"as",
"a",
"scaffold",
"for",
"microbial",
"adhesion",
"and",
"diffusion",
",",
"not",
"as",
"a",
"bactericide",
"or",
"microbial",
"agent",
"."
]
}
] |
PMC11435360 | The BBN mice received 0.05% BBN-supplemented tap water (BBN) for 12 weeks to induce BC development, followed by access to untreated tap water for the remainder of the experiment. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"BBN",
"mice",
"received",
"0.05",
"%",
"BBN-supplemented",
"tap",
"water",
"(",
"BBN",
")",
"for",
"12",
"weeks",
"to",
"induce",
"BC",
"development",
",",
"followed",
"by",
"access",
"to",
"untreated",
"tap",
"water",
"for",
"the",
"remainder",
"of",
"the",
"experiment",
"."
]
}
] |
PMC11536589 | The resistance mechanisms to KRAS inhibitor MRTX1133 against PDAC in vitro and in vivo were characterized by RNA sequencing, reverse transcript polymerase chain reaction, cytotoxicity test, plasmid transfection, lentivirus transfection, lipid peroxidation detection, malondialdehyde levels detection, glutathione levels detection, western blot, immunofluorescence, nude mice tumorigenesis experiment and immunohistochemistry. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"resistance",
"mechanisms",
"to",
"KRAS",
"inhibitor",
"MRTX1133",
"against",
"PDAC",
"in",
"vitro",
"and",
"in",
"vivo",
"were",
"characterized",
"by",
"RNA",
"sequencing",
",",
"reverse",
"transcript",
"polymerase",
"chain",
"reaction",
",",
"cytotoxicity",
"test",
",",
"plasmid",
"transfection",
",",
"lentivirus",
"transfection",
",",
"lipid",
"peroxidation",
"detection",
",",
"malondialdehyde",
"levels",
"detection",
",",
"glutathione",
"levels",
"detection",
",",
"western",
"blot",
",",
"immunofluorescence",
",",
"nude",
"mice",
"tumorigenesis",
"experiment",
"and",
"immunohistochemistry",
"."
]
}
] |
PMC11742864 | If this condition is not well treated, it will lead to cancer cachexia. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"If",
"this",
"condition",
"is",
"not",
"well",
"treated",
",",
"it",
"will",
"lead",
"to",
"cancer",
"cachexia",
"."
]
}
] |
PMC11754784 | n = 3 from three independent experiments). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"n",
"=",
"3",
"from",
"three",
"independent",
"experiments",
")",
"."
]
}
] |
PMC10810426 | siRNA depletion was carried out for 48 h prior to infection with MLV. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"siRNA",
"depletion",
"was",
"carried",
"out",
"for",
"48",
"h",
"prior",
"to",
"infection",
"with",
"MLV",
"."
]
}
] |
PMC11673902 | The axial force pushes the cell away from the ends of the fiber, stretching the cell in the direction of the beam axis (Figure 6). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"axial",
"force",
"pushes",
"the",
"cell",
"away",
"from",
"the",
"ends",
"of",
"the",
"fiber",
",",
"stretching",
"the",
"cell",
"in",
"the",
"direction",
"of",
"the",
"beam",
"axis",
"(",
"Figure",
"6",
")",
"."
]
}
] |
PMC9429973 | In addition, we also identified a novel C>T mutation at position 9 (g.9C>T) in 2% of CLL cases, which was associated with splicing abnormalities both in primary cases and transduced CLL cell lines. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"addition",
",",
"we",
"also",
"identified",
"a",
"novel",
"C",
">",
"T",
"mutation",
"at",
"position",
"9",
"(",
"g.9C",
">",
"T",
")",
"in",
"2",
"%",
"of",
"CLL",
"cases",
",",
"which",
"was",
"associated",
"with",
"splicing",
"abnormalities",
"both",
"in",
"primary",
"cases",
"and",
"transduced",
"CLL",
"cell",
"lines",
"."
]
}
] |
PMC8973085 | A few drops of triethylamine were added to a mixture of 3a or 3b (10 mmol) and the appropriate α-haloketone (namely, ethyl chloroacetate, phenacyl chloride, chloroacetone, or chloroacetonitrile) (10 mmol) in absolute ethanol (15 mL). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"few",
"drops",
"of",
"triethylamine",
"were",
"added",
"to",
"a",
"mixture",
"of",
"3a",
"or",
"3b",
"(",
"10",
"mmol",
")",
"and",
"the",
"appropriate",
"α-haloketone",
"(",
"namely",
",",
"ethyl",
"chloroacetate",
",",
"phenacyl",
"chloride",
",",
"chloroacetone",
",",
"or",
"chloroacetonitrile",
")",
"(",
"10",
"mmol",
")",
"in",
"absolute",
"ethanol",
"(",
"15",
"mL",
")",
"."
]
}
] |
PMC11565047 | These data can be reanalyzed with a precise gene expression threshold notably by selecting precise fold-change cutoffs, or with different pair-wise combinations to compare treatments’ impact on the VCaP transcriptome. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"These",
"data",
"can",
"be",
"reanalyzed",
"with",
"a",
"precise",
"gene",
"expression",
"threshold",
"notably",
"by",
"selecting",
"precise",
"fold-change",
"cutoffs",
",",
"or",
"with",
"different",
"pair-wise",
"combinations",
"to",
"compare",
"treatments",
"’",
"impact",
"on",
"the",
"VCaP",
"transcriptome",
"."
]
}
] |
PMC9429973 | Serum iron concentrations decreased 3 h after first vamifeport dose (Day 1) in all vamifeport-treated patients (mean [SD] decrease: QD -11.3 [7.2] µmol/L; BID -17.0 [9.6] µmol/L) and were maintained below baseline levels at 3–4 h post vamifeport administration at each visit throughout the remaining treatment period. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Serum",
"iron",
"concentrations",
"decreased",
"3",
"h",
"after",
"first",
"vamifeport",
"dose",
"(",
"Day",
"1",
")",
"in",
"all",
"vamifeport-treated",
"patients",
"(",
"mean",
"[",
"SD",
"]",
"decrease",
":",
"QD",
"-11.3",
"[",
"7.2",
"]",
"µmol/L",
";",
"BID",
"-17.0",
"[",
"9.6",
"]",
"µmol/L",
")",
"and",
"were",
"maintained",
"below",
"baseline",
"levels",
"at",
"3–4",
"h",
"post",
"vamifeport",
"administration",
"at",
"each",
"visit",
"throughout",
"the",
"remaining",
"treatment",
"period",
"."
]
}
] |
PMC11388384 | We genetically labeled sender and receiver cell membranes with mTurquoise2-CAAX and mCherry-CAAX respectively, and diluted the receivers with unlabeled NIH3T3 bystander cells to allow for better cell segmentation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"We",
"genetically",
"labeled",
"sender",
"and",
"receiver",
"cell",
"membranes",
"with",
"mTurquoise2-CAAX",
"and",
"mCherry-CAAX",
"respectively",
",",
"and",
"diluted",
"the",
"receivers",
"with",
"unlabeled",
"NIH3T3",
"bystander",
"cells",
"to",
"allow",
"for",
"better",
"cell",
"segmentation",
"."
]
}
] |
PMC11786704 | A–C) Cell viability of RAW 264.7 cells, DC2.4 cells and NIH3T3 cells after incubating with capsules for 24 h and 72 h. (D) Cellular uptake of capsules in RAW 264.7, DC2.4 and NIH3T3 cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"I-CellLine",
"O",
"O",
"B-CellLine",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"I-CellLine",
"O",
"B-CellLine",
"O",
"B-CellLine",
"O",
"O"
],
"tokens": [
"A",
"–",
"C",
")",
"Cell",
"viability",
"of",
"RAW",
"264.7",
"cells",
",",
"DC2.4",
"cells",
"and",
"NIH3T3",
"cells",
"after",
"incubating",
"with",
"capsules",
"for",
"24",
"h",
"and",
"72",
"h.",
"(",
"D",
")",
"Cellular",
"uptake",
"of",
"capsules",
"in",
"RAW",
"264.7",
",",
"DC2.4",
"and",
"NIH3T3",
"cells",
"."
]
}
] |
PMC9100622 | Though it was not shown in these reports that zoledronic acid acted by inhibiting the MVA pathway, these observations converge with ours to point out the MVA pathway as an important dependency in Ewing sarcoma. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Though",
"it",
"was",
"not",
"shown",
"in",
"these",
"reports",
"that",
"zoledronic",
"acid",
"acted",
"by",
"inhibiting",
"the",
"MVA",
"pathway",
",",
"these",
"observations",
"converge",
"with",
"ours",
"to",
"point",
"out",
"the",
"MVA",
"pathway",
"as",
"an",
"important",
"dependency",
"in",
"Ewing",
"sarcoma",
"."
]
}
] |
PMC10900886 | Statistical analysis was performed using unpaired t-test. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Statistical",
"analysis",
"was",
"performed",
"using",
"unpaired",
"t-test",
"."
]
}
] |
PMC11345828 | Solvents for reactions, extraction, and washing were ACS reagent grade, and solvents for chromatography were HPLC grade. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Solvents",
"for",
"reactions",
",",
"extraction",
",",
"and",
"washing",
"were",
"ACS",
"reagent",
"grade",
",",
"and",
"solvents",
"for",
"chromatography",
"were",
"HPLC",
"grade",
"."
]
}
] |
PMC11021472 | Our current results point towards a function of circZDHHC11 which is independent of sequestering miR-150, potentially by binding to and modifying functionality of other molecules. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Our",
"current",
"results",
"point",
"towards",
"a",
"function",
"of",
"circZDHHC11",
"which",
"is",
"independent",
"of",
"sequestering",
"miR-150",
",",
"potentially",
"by",
"binding",
"to",
"and",
"modifying",
"functionality",
"of",
"other",
"molecules",
"."
]
}
] |
PMC10957991 | With the knowledge of bead displacement field, stiffness of the matrix and manual drawing of the cell boundary, we could compute the cell-exerted tractions by utilizing Fourier transform traction microscopy. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"With",
"the",
"knowledge",
"of",
"bead",
"displacement",
"field",
",",
"stiffness",
"of",
"the",
"matrix",
"and",
"manual",
"drawing",
"of",
"the",
"cell",
"boundary",
",",
"we",
"could",
"compute",
"the",
"cell-exerted",
"tractions",
"by",
"utilizing",
"Fourier",
"transform",
"traction",
"microscopy",
"."
]
}
] |
PMC11806106 | Again, methadone and buprenorphine displayed the slowest off-rate. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Again",
",",
"methadone",
"and",
"buprenorphine",
"displayed",
"the",
"slowest",
"off-rate",
"."
]
}
] |
PMC11640247 | In contrast, neurons expressing pCAG-Myc-RAC3-R66W significantly remained in the VZ/subventricular zones (VZ/SVZ) and the intermediate zone (IZ) (bin 2 and 3) (Figure 4B,C). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"contrast",
",",
"neurons",
"expressing",
"pCAG-Myc-RAC3-R66W",
"significantly",
"remained",
"in",
"the",
"VZ/subventricular",
"zones",
"(",
"VZ/SVZ",
")",
"and",
"the",
"intermediate",
"zone",
"(",
"IZ",
")",
"(",
"bin",
"2",
"and",
"3",
")",
"(",
"Figure",
"4B",
",",
"C",
")",
"."
]
}
] |
PMC8875242 | By conducting accumulation studies in hPCIS and measuring bidirectional transport across Caco-2 cell monolayers using RHD123 as a model transport substrate, we recently showed that atazanavir, lopinavir, maraviroc, ritonavir, saquinavir, ledipasvir, and daclatasvir inhibit ABCB1 in the intestine . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"By",
"conducting",
"accumulation",
"studies",
"in",
"hPCIS",
"and",
"measuring",
"bidirectional",
"transport",
"across",
"Caco-2",
"cell",
"monolayers",
"using",
"RHD123",
"as",
"a",
"model",
"transport",
"substrate",
",",
"we",
"recently",
"showed",
"that",
"atazanavir",
",",
"lopinavir",
",",
"maraviroc",
",",
"ritonavir",
",",
"saquinavir",
",",
"ledipasvir",
",",
"and",
"daclatasvir",
"inhibit",
"ABCB1",
"in",
"the",
"intestine",
"."
]
}
] |
PMC11367146 | The percentage of cell proliferation was checked by measuring the absorbance with a microplate reader at 570 nm. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"percentage",
"of",
"cell",
"proliferation",
"was",
"checked",
"by",
"measuring",
"the",
"absorbance",
"with",
"a",
"microplate",
"reader",
"at",
"570",
"nm",
"."
]
}
] |
PMC11306019 | Although conventional cytotoxicity assays have not detected any antagonistic effects for these three polyphenols at physiologically achievable concentrations (as shown in Supplementary Figures S1, S2), our results indicate that a smaller quantity of polyphenols is sufficient to neutralize BTZ at lower concentrations. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Although",
"conventional",
"cytotoxicity",
"assays",
"have",
"not",
"detected",
"any",
"antagonistic",
"effects",
"for",
"these",
"three",
"polyphenols",
"at",
"physiologically",
"achievable",
"concentrations",
"(",
"as",
"shown",
"in",
"Supplementary",
"Figures",
"S1",
",",
"S2",
")",
",",
"our",
"results",
"indicate",
"that",
"a",
"smaller",
"quantity",
"of",
"polyphenols",
"is",
"sufficient",
"to",
"neutralize",
"BTZ",
"at",
"lower",
"concentrations",
"."
]
}
] |
PMC9429973 | In acute myeloid leukemia and in non-Hodgkin lymphomas, Vγ9Vδ2 T cells-based immunotherapy has shown encouraging results both in preclinical models and in early phase clinical trials. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"acute",
"myeloid",
"leukemia",
"and",
"in",
"non-Hodgkin",
"lymphomas",
",",
"Vγ9Vδ2",
"T",
"cells-based",
"immunotherapy",
"has",
"shown",
"encouraging",
"results",
"both",
"in",
"preclinical",
"models",
"and",
"in",
"early",
"phase",
"clinical",
"trials",
"."
]
}
] |
PMC7612475 | The sequences are listed as follows: SF3B1_5 – TACGAGTTTGCTTGGTCAGAA; SF3B1_7 – GACCGGGAAGATGAATACAAA and siSCR – AGCAGCACGACTTCTTCAAGT. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"sequences",
"are",
"listed",
"as",
"follows",
":",
"SF3B1_5",
"–",
"TACGAGTTTGCTTGGTCAGAA",
";",
"SF3B1_7",
"–",
"GACCGGGAAGATGAATACAAA",
"and",
"siSCR",
"–",
"AGCAGCACGACTTCTTCAAGT",
"."
]
}
] |
PMC11332076 | B: No detection of F-iIR or F-iIGF1R dimers. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"B",
":",
"No",
"detection",
"of",
"F-iIR",
"or",
"F-iIGF1R",
"dimers",
"."
]
}
] |
PMC11451829 | Grade 1. ( | [
{
"tags": [
"O",
"O",
"O",
"O"
],
"tokens": [
"Grade",
"1",
".",
"("
]
}
] |
PMC9429973 | A statistical hypothesis testing was carried out (Wilcoxon). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"statistical",
"hypothesis",
"testing",
"was",
"carried",
"out",
"(",
"Wilcoxon",
")",
"."
]
}
] |
PMC11700340 | The plates were incubated for 24 hrs. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"plates",
"were",
"incubated",
"for",
"24",
"hrs",
"."
]
}
] |
PMC4360730 | The biological sample serving as input (i.e. biosample; e.g. hepatic stellate cell—CL:0000632 and Hep-G2—EFO:0001187 in Figure 1). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"biological",
"sample",
"serving",
"as",
"input",
"(",
"i.e.",
"biosample",
";",
"e.g.",
"hepatic",
"stellate",
"cell",
"—",
"CL:0000632",
"and",
"Hep-G2—EFO:0001187",
"in",
"Figure",
"1",
")",
"."
]
}
] |
PMC11354225 | MTT was added and cells were incubated for 2 h in darkness at 37 °C with 5% CO2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"MTT",
"was",
"added",
"and",
"cells",
"were",
"incubated",
"for",
"2",
"h",
"in",
"darkness",
"at",
"37",
"°",
"C",
"with",
"5",
"%",
"CO2",
"."
]
}
] |
PMC11549062 | Based on the titer determination results, knockdown lentivirus or control lentivirus was added to the medium at the appropriate multiplicity of infection and incubated for approximately 24 h. Following this, the medium was replaced with a normal complete medium supplemented with puromycin (ST551, Beyotime, Shanghai, China) to establish stable cell populations for subsequent experiments. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Based",
"on",
"the",
"titer",
"determination",
"results",
",",
"knockdown",
"lentivirus",
"or",
"control",
"lentivirus",
"was",
"added",
"to",
"the",
"medium",
"at",
"the",
"appropriate",
"multiplicity",
"of",
"infection",
"and",
"incubated",
"for",
"approximately",
"24",
"h.",
"Following",
"this",
",",
"the",
"medium",
"was",
"replaced",
"with",
"a",
"normal",
"complete",
"medium",
"supplemented",
"with",
"puromycin",
"(",
"ST551",
",",
"Beyotime",
",",
"Shanghai",
",",
"China",
")",
"to",
"establish",
"stable",
"cell",
"populations",
"for",
"subsequent",
"experiments",
"."
]
}
] |
PMC10047551 | Short-term stimulation (24 h) induced PD-L1 mRNA expression in HCC827 cells (Figure 2B). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Short-term",
"stimulation",
"(",
"24",
"h",
")",
"induced",
"PD-L1",
"mRNA",
"expression",
"in",
"HCC827",
"cells",
"(",
"Figure",
"2B",
")",
"."
]
}
] |
PMC8170755 | Finally, enhanced chemiluminescence (Thermo Fisher Scientific Inc.) was used followed by exposure to radiographic film to detect secondary antibody binding. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Finally",
",",
"enhanced",
"chemiluminescence",
"(",
"Thermo",
"Fisher",
"Scientific",
"Inc.",
")",
"was",
"used",
"followed",
"by",
"exposure",
"to",
"radiographic",
"film",
"to",
"detect",
"secondary",
"antibody",
"binding",
"."
]
}
] |
PMC3203927 | As already mentioned, as a microtissue grows beyond a certain size, nutrient and oxygen depletion become limiting factors leading to the inhibition of cell proliferation and initiation of angiogenic signaling. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"As",
"already",
"mentioned",
",",
"as",
"a",
"microtissue",
"grows",
"beyond",
"a",
"certain",
"size",
",",
"nutrient",
"and",
"oxygen",
"depletion",
"become",
"limiting",
"factors",
"leading",
"to",
"the",
"inhibition",
"of",
"cell",
"proliferation",
"and",
"initiation",
"of",
"angiogenic",
"signaling",
"."
]
}
] |
PMC11754432 | Western analysis (A: N = 6, B: N = 4, D: N = 4 or 3 for cocktail treated) of total and phospho STAT1 (Y701) relative to control siRNA. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Western",
"analysis",
"(",
"A",
":",
"N",
"=",
"6",
",",
"B",
":",
"N",
"=",
"4",
",",
"D",
":",
"N",
"=",
"4",
"or",
"3",
"for",
"cocktail",
"treated",
")",
"of",
"total",
"and",
"phospho",
"STAT1",
"(",
"Y701",
")",
"relative",
"to",
"control",
"siRNA",
"."
]
}
] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.