PMCID string | Sentences string | ner list |
|---|---|---|
PMC9429973 | 82% (19/23) of which had unfavorable cytogenetics (defined by the presence of del (17p) or p53 mutation, t (4:14), t (14:16), t (14:20), amp (1q)). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11297139 | Tested proteins include PrLD1, ARID, PrLD2, Pfam, PrLD(Y/S) mutant, and full-length ARID1A. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Tested",
"proteins",
"include",
"PrLD1",
... |
PMC3995603 | Consequently, the need to efficiently manage the AD response while reducing side effects has led to the development of alternative remedies. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Consequently",
... |
PMC11672881 | CU, a polyphenol extracted from turmeric, demonstrates chemo-preventive and anti-tumor effects by regulating transcription factors and signaling pathways, such as the PI3K/mTOR, GSK-3beta, and Ras/Raf/MEK pathways . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6160470 | Subsequently, cells were treated with freshly prepared compound solutions in blocking buffer and incubated for an additional 10 minutes at 37 °C. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC9429973 | Spleen size reduction is a function of baseline spleen size and was recently shown to be independent prognostic factor in composite PMF and SMF cohort of ruxolitinib treated patients. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9910796 | Transfected Cos cells, plated at 80% confluency in 35 mm plates, were lysed in 1ml of 0.1% Triton X-100 in PBS containing a protease inhibitor cocktail (complete mini-EDTA free, Sigma). | [
{
"tags": [
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11672602 | Positive control of breast carcinoma was used, magnification X100. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Positive",
"control",
"of",
"breast",
"carcinoma",
"was",
"used",
",",
"magnification",
... |
PMC9429973 | Methods: We analyzed multiple RNAseq gene expression data sets of cultured and uncultured human HSPCs from developmental and postnatal hematopoietic tissues to identify genes associated with self-renewing HSCs. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8409415 | The sequences of the primers used were as follows: human CD70 (180 bp), forward primer 5‐GCCCTATGGGTGCGTCCTGC‐3 and reverse primer 5‐AGCCTGGGGTCCTGCTGAGG‐3; β‐actin (174 bp), 5‐AGCCTCGCCTTTGCCGA‐3 (forward), and 5‐CTGGTGCCTGGGGCG‐3 (reverse). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11349530 | MCP-1 produced by cancer cells can attract macrophages and induce Wnt-1 upregulation, downregulating E-cadherin junctions in breast cancer cells and stimulating tumor cell dissemination (70). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | The early PFS and OS appears comparable to historical real-world outcome of intensified regimens such as R-DA-EPOCH. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"early",
"PFS",
"and",
"OS",
"appears... |
PMC4695073 | It involves several factors assembling with an ordered and stepwise manner. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"It",
"involves",
"several",
"factors",
"assembling",
"with",
"an",
"ordered",
"and",
... |
PMC11718109 | Excitation wavelengths between 405 and 640 nm, CFI SR Plan ApoIR 60XC WI objective lens and SoRa lens-switched light path at 1x, 2.8x or 4x were used. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC4360730 | Missing ontology terms or terms that contain inconsistencies are reported to the ontology developers via public issue tracking systems. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Missing",
"ontology",
"terms",
"o... |
PMC9429973 | Image: Summary/Conclusion: ThisCART19A cells demonstrated potent CD19-dependent cytotoxicity and no xenogentic GvHD in murine models. | [
{
"tags": [
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Image",
":",
"Summary/Conclusion",
":",
... |
PMC10213199 | In the HL 60 cell line, JYL activated proteasome-related functions. | [
{
"tags": [
"O",
"O",
"B-CellLine",
"I-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"the",
"HL",
"60",
"cell",
"line",
",",
"JYL",
"activated",
"p... |
PMC9429973 | No differences were found of older age and other known risk factors. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"No",
"differences",
"were",
"found",
"of",
"older",
"age",
"and",
"other",
... |
PMC10329237 | It seems that the combination of drugs was more effective than the single ones in regulating the oxidative parameters in A549 cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O"
],
"tokens": [
"It",
... |
PMC11462673 | B Motif analysis of LDB1 binding sites in 6 T-CEM cells using Homer (22). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"B",
"Motif",
"analysis",
"of",
"LDB1",
"bindi... |
PMC11194678 | Total RNA was reverse transcribed by using PrimerScript RTreagent Kit with gDRNA Eraser (Takara) according to the manufacturer’s instructions. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Total",
"RNA... |
PMC11354225 | In HaCat cells, EGCG (<12.5 μM, >24 h) shows antioxidant and cytoprotective capabilities . | [
{
"tags": [
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"HaCat",
"cells",
"... |
PMC7305184 | Electroporation or pulsed electric field (PEF) treatment can cause increase in membrane permeability and allows molecules, for which the membrane is mostly impermeable, to cross. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7192625 | A considerable number of papers have suggested interpreting chromatin structure as a network, either starting from Hi-Ccontact maps interpreted as distance matrices, see for example (17–23), or also increasingly using alternative chromosome capture techniques that detect longer-range specific contacts directly (24). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Methods: Chemical biology, animal models, functional genetics Results: BTM-3566 is a small molecule based on a pyrazolothiazol-backbone. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Methods",
":",
"C... |
PMC10577955 | Where the activated caspase-8 can directly stimulate caspase-3 activity . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Where",
"the",
"activated",
"caspase-8",
"can",
"directly",
"stimulate",
"caspase-3",
"activity",
"."
]... |
PMC9429973 | Many circRNAs have been shown to bind microRNAs (miRNAs), thus making miRNAs unavailable to regulate protein-coding gene expression. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Many",
"circRNAs",
... |
PMC11502962 | The interaction numbers and interaction weights of cell-to-cell were analyzed in G01 and G02 as shown in Figure 3 . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"interaction",
"numbers",
"... |
PMC11095939 | We first performed ChIP-qPCR to confirm the significantly decreased binding intensity of Mecp2 at proximal promoter regions of both Rara and Nr1h3 upon exit quiescence (Figure 7A). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11180402 | Cancer metastasis includes multiple steps, such as local tumor cell invasion, entry into the vasculature, cancer cell exit from circulation, and colonization at distal sites . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11697065 | To quantify expression of the human transgenes, the FASTA sequences of the antibody chains were added to the Chinese hamster reference genome. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"To",
... |
PMC11670407 | Survival analysis was performed using the R software package "survival" to investigate the correlation between the expression levels of key genes and prognosis, and to observe the differences in the expression of key genes in normal tissues and paracancerous tissues, and the above bioinformatic analyses were visualized using the R software. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Exploiting new forms of cell death therefore may allow novel therapeutic options to limit survival or occurrence of resistant clones. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Exploiting",
"new",
"forms",... |
PMC11026382 | 20 µL of the recovery culture was serially diluted and plated on LB-agar with 50 µg/mL thymidine and 30 µg/mL chloramphenicol, to permit quantification of transformants and estimate library coverage following ligation into the alternate TYMS backgrounds. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11767817 | From a chemical perspective, BF2–curcumin complexes can serve as fluorescent dyes since this modification improves fluorescence quantum yields and increases Stokes shifts . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"From",
... |
PMC7185206 | P < .05 was considered statistically significant. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"P",
"<",
".05",
"was",
"considered",
"statistically",
"significant",
"."
]
}
] |
PMC11638255 | Fig. 1), with these results underscoring an exclusive relationship between copper chelation and tumoral neutrophil recruitment. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Fig.",
"1",
")",
",",
"with",
"t... |
PMC11143482 | The phrase ‘humanised mice’ has often been used to refer to genetically engineered immunodeficient mice that enable the growth of human immune cells . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC9954564 | Although not as extensively investigated as the 14 bp insertion/deletion (INDEL) and +3142, +3187 was already evaluated for preeclampsia , septic shock , malaria , leprosy , celiac disease , rheumatoid arthritis , schizophrenia , HTLV1 infection , bipolar disorder , epithelial ovarian cancer , and vitiligo ; it is observed in the latter similar association pattern, which is expected once there is a sample overlap between both studies. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11539788 | qRT‒PCR analysis of RNF19A mRNA levels in normal and BCa tissues. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"qRT‒PCR",
"analysis",
"of",
"RNF19A",
"mRNA",
"levels",
"in",
"normal",
"and",
... |
PMC11730000 | CHO-K1 cells were obtained from the Institute of Pharmacology and Toxicology, Würzburg, Germany. | [
{
"tags": [
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"CHO-K1",
"cells",
"were",
"obtained",
"from",
"the",
... |
PMC11629461 | The alternating (340/380 nm) excitation light intensity at the cell level was 0.370–1.092 μWatt/cm. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"alternating",
"(",
"340/380",
"nm",
")",
... |
PMC11727062 | This includes a range of natural products and their derivatives, such as agaric (if ‘acacia ear’ refers to a type of mushroom), heavy floor (which may need clarification or correction), paclitaxel alkaloids, and essential oils (Xiao et al. 2012). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6024716 | The study was conducted in two directions; first, the focus was on finding microRNA that have a direct effect on protein expression; and the second was focused on finding specific genes whose inactivation by siRNA improved expression. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10729469 | Antigen-specific Tregs migrate and accumulate at the site of cognate antigen expression where they exert both bystander and antigen-specific immune responses, and reduce complications associated with broad immunosuppression . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11737091 | Box plot depicting the IHC staining scores for DBF4 in 69 paired ccRCC samples. *, | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Box",
"plot",
"depicting",
"the",
"IHC",
"staining",
... |
PMC11401350 | In this context, we previously used an anti-PD-1 antibody in combination with a non-canonical NF-kB inhibitor to treat mice bearing AITL tumors. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
... |
PMC11337594 | The activated CASP3 initiated apoptosis, while simultaneously continuing to cleave the GSDME, thereby triggering pyroptosis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"activated",
"CASP3",
"initiated",
"apoptos... |
PMC9532503 | Fig. 1Diagrams showing the expression vectors with the cloned light (A) and heavy chain (B) sequences. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Fig.",
"1Diagrams",
"showing... |
PMC10631132 | Scale bars: A, C, E, G = 250 µm, B, D, F, H = 50 µm TRAP staining of cells following osteoclast differentiation in conjunction with methyl green nuclear counterstaining. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11731614 | MIPS was set as on, included charge states = 2–7 (reject unassigned). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"MIPS",
"was",
"set",
"as",
"on",
",",
"included",
"ch... |
PMC10890307 | Interestingly, qP Lactate of MCR-5 cells was higher when they were grown in Glc/pH6.2/N as compared to when they were cultured in Glc/pH6.2/H, indicating that MRC-5 cells can produce lactate under normoxia as well as under hypoxia (Table 3). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9412887 | A variety of hybrid nanoparticles have been widely studied for overcoming cancer drug resistance, including breast cancer, ovarian cancer, lung cancer, and melanoma. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11767725 | This metabolic shift reduces ATP availability and affects keratinocyte turnover, creating niches that favor anaerobic or facultative anaerobic microbes such as C. acnes and Pseudomonas aeruginosa. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Aims: To conduct an SLR on the real-world HRQoL burden across the entire spectrum of thalassemia and report evidence gaps. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Aims",
":",
"To",... |
PMC4839679 | To further define the G1/G0 arrest observed with PBRM1 re-expression we wished to determine whether increased apoptosis contributes to the G1/G0 cell cycle block. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11549062 | Additionally, carotid plaque apoptosis was assessed through TUNEL staining. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Additionally",
",",
"carotid",
"plaque",
"apoptosis",
"was",
"assessed",
"through",
"TUNEL",
"st... |
PMC9429973 | Methods: In this prospective, single-arm, phase 2 trial, we recruited patients aged 18–70 years with newly diagnosed NKTCL who were EBV-DNA positive in plasma in Henan People’s Hospital. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11637284 | The TAC60 segment Q178-M194 marks the minimal p166 binding site in the IMS domain of TAC60, which is in agreement with the domain identified in the AlphaFold2 structure model. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Most activating receptors, cell adhesion molecule receptors and chemokine receptors exhibited enhanced expression on expanded NK cells (figure 1a). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Most",
"acti... |
PMC9429973 | Due to imatinib resistance during follow-up, 40.5% of patients require the use of newer generation of TKI. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Due",
"to",
"imatinib",
"resistan... |
PMC11754784 | Source data are provided as a Source Data file. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Source",
"data",
"are",
"provided",
"as",
"a",
"Source",
"Data",
"file",
"."
]
}
] |
PMC11615218 | Advances in genome editing have also helped overcome metabolic restriction in tumor microenvironments. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Advances",
"in",
"genome",
"editing",
"have",
"also",
"helped",
"overcome",... |
PMC11635519 | The cells were selected with the hygromycin antibiotic. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"cells",
"were",
"selected",
"with",
"the",
"hygromycin",
"antibiotic",
"."
]
}
] |
PMC11612315 | Noxious heat-evoked withdrawal behaviors in rats are suppressed during self-initiated chocolate eating and the ingestion of sucrose. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Noxious",
"heat-evoked",
"withdrawal",
"behaviors",
... |
PMC11257988 | Thus, the development of clinical SOS1 compounds in combination with MEK inhibitors and potentially other RTK/MAPK pathway inhibitors holds promise for significant clinical benefits . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11723947 | a Pattern of expression of genes overexpressed in Treg-exposed HP1γ KO Tconv compared with WT Tconv. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"a",
"Pattern",
"of",
"expression",
"of",
"g... |
PMC11766174 | As a negative control, Jurkat cells were used to set the baseline (Figure 2C,D; ‘0’ cells condition). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],... |
PMC10877303 | The stability and rigidity of these protein-ligand complexes throughout the simulation period were confirmed through a molecular dynamics simulation study. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"stability",
"and",
... |
PMC10728200 | H GIST-T1 and 882 cells were treated with IM (50 nM for T1 and 200 nM for 882) for 12 h with or without STUB1 knockdown, and the relative lipid ROS levels were assayed via flow cytometry. | [
{
"tags": [
"B-CellLine",
"I-CellLine",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
... |
PMC7081114 | In China, its incidence and mortality ranked fourth and third, respectively. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"China",
",",
"its",
"incidence",
"and",
"mortality",
"ranked",
... |
PMC10938336 | Apoptosis, which is a process of planned cell death, can be brought on by a variety of factors, including cellular stress, DNA damage, and immune surveillance. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6835428 | Thus, their effectiveness in siRNA delivery can be significantly diminished. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Thus",
",",
"their",
"effectiveness",
"in",
"siRNA",
"delivery",
"can",
"be",
"signif... |
PMC5963610 | White bars=100μm. | [
{
"tags": [
"O",
"O",
"O"
],
"tokens": [
"White",
"bars=100μm",
"."
]
}
] |
PMC11218145 | However, an evaluation of mitochondrial uncouplers as anti-cancer agents in a model of MPM, both in vitro and in vivo, is still lacking. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11604768 | Our engineered reporters are activated by transcription factors and report on signal input at a layer in signal transduction independent of genomic context. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Our",
... |
PMC11593713 | They differ in the course of infection, the susceptibility of populations, the seasonality of circulation, and the mode and ease of transmission. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11026382 | Through this mini-screen we selected two mutations that stably expressed, purified robustly, and yielded intermediate activities: TYMS R127A and Q33S (Fig. 2a). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11470999 | Melanoma has the highest incidence of brain metastasis among all cancers. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Melanoma",
"has",
"the",
"highest",
"incidence",
"of",
"brain",
"metastasis",
"among",
... |
PMC11697065 | The stained cells were analysed by a MACSQuant flow cytometer with APC and FITC double-positive population measured according to manufacturer’s specifications. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"stain... |
PMC11411004 | Taken together, the results of the this study suggest that the small-molecule dual-targeting inhibitor I-4 can be used as an effective chemical additive to improve the yield of monoclonal antibodies in recombinant CHO cell cultures. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9479186 | We designed three target shRNA for NDUFC1, respectively, 5’-AAAGAAGAAATGGGCTGGAAT-3’, 5’-GTGGATCTATCTCATCAAACA-3’, 5’-ATCAAAGTTCTACGTGCGAGA-3’. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"We",
"designed",
"three",
"target",
"s... |
PMC4360730 | Here, we present the ontologies we use to annotate experimental metadata to provide improved searching capabilities across the data and to build a technical framework for ensuring the accuracy of the metadata. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Most of parameters and scoring systems analyzed were useful to predict outcome from diagnosis or from treatment initiation to last follow up. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Most",
"of",... |
PMC11222184 | Total protein isolation was performed with RIPA buffer and total protein concentration was determined using the BCA protein assay kit. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Total",
"protein",
"isolatio... |
PMC6133382 | Similarly, we noted a significant improvement in the binding of the PGT126 and PGT128 bN-mAbs that require oligomannose glycans at the N301 and N332 glycosylation sites in the stem of the V3 domain . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11283030 | E-cad: E-cadherin, N-cad: N-cadherin, Vim: Vimentin. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"E-cad",
":",
"E-cadherin",
",",
"N-cad",
":",
"N-cadherin",
",",
"Vim",
":",
"V... |
PMC8481254 | This evidence broadens our understanding of the antitumor mechanism of CA and suggests that CA is a potential antitumor drug for the prevention and treatment of diabetes-associated liver cancer. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC5600151 | Another study from this group also showed that alkylated PAMAM G1 dendrimer could be used in siRNA delivery. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Another",
"study",
"from",
"this",
"gr... |
PMC9429973 | Therefore, targeting cells with lower CHD4 expression with compounds targeting DNA/RNA synthesis may have an impact on patient outcome. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Therefore",
",",
"targeting"... |
PMC11365983 | Cells and isolated tissue were lysed in 1.5% SDS lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA, 1.5% SDS) supplemented with protease/phosphatase inhibitor cocktail (1 mM PMSF, 10 µg/ml aprotinin, 10 µg/ml leupeptin or Halt Protease Inhibitor Cocktail (Thermo); 0.5 mM Na3VO4, 5 mM NaF, 10 mM β-glycerophosphate) and passed through QIAshredder columns (Qiagen). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Results: We screened 286 pts between 2016 and 2020, whereof 20 were excluded mainly due to lack of genetic aberration or no HCT performed. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC9429973 | National Clinical Research Center for Hematologic Disease, Beijing Key Laboratory of Hematopoietic Stem Cell Transplantation; XiaoJun Huang, Correspondence. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"National",
"Clinical",
... |
PMC11765879 | The peaks were detected at 280 nm by Waters© Empower chromatographic software version 3.8.0. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"peaks",
"were",
"detected",
"at",
"280",
"nm",
... |
PMC11323699 | Furthermore, macrophages treated with a PARPi displayed a pro-inflammatory phenotype marked by increased expression of IL-1β . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Furthermore",
",",
"macrophages",
"treated",
"wit... |
PMC11509309 | Extracts displaying an anti-prion activity against both [PSI+] and [URE3] yeast prions were then selected for further analysis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Extracts",
"... |
PMC9429973 | Further longitudinal studies with inferential statistics are needed in this context. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Further",
"longitudinal",
"studies",
"with",
"inferential",
"statistics",
"are",
"needed",
... |
PMC11585994 | T-cell acute lymphoblastic leukemia (T-ALL) is a malignant hematological disease with limited targeted therapy options. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"T-cell",
"acute",
"lymphoblastic",
"leukemia",
"(... |
PMC11679033 | In general, obtained results indicate that potentially useful effects of CBD established on the lymphocyte model are modulated by the presence of CIT. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11461025 | More recently, there have been reports that have demonstrated that ERK activation facilitates apoptosis of cells treated with a number of different drugs (Cagnol and Chambard 2010; Sugiura et al. 2021) . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.