Datasets:

LeaBresson

/

pubmed-summarization-sample2

like 1

highlights we mapped all known mature cho mirnas to two cho - k1 reference genomes . 212 unique genomic mirna loci and the respective precursor mirna sequences were identified . the genomic loci of 4 polycistronic mirna cluster were confirmed by pcr . the identified sequences were analyzed for snps and conservation compared to mouse . sequence data have been prepared for submission to mirbase mirna sequence repository .

the effectiveness of insulin injections has been established in various clinical studies . however , an increase in insulin dosage to achieve better glycemic control is associated with an increased risk of hypoglycemia and weight gain . many patients with diabetes are being treated with insulin alone , but only a few patients are able to achieve optimal glycemic control with this treatment strategy . for these patients , incretins [ 24 ] , glucagon - like peptide 1 ( glp-1 ) , and glucose - dependent insulinotropic polypeptide ( gip ) are rapidly inactivated by the enzyme dipeptidyl peptidase 4 ( dpp-4 ) . dpp-4 inhibitors , such as sitagliptin , increase active glp-1 and gip levels by inhibiting dpp-4 enzymatic activity , and improve hyperglycemia in a glucose - dependent manner by increasing serum insulin and decreasing serum glucagon levels in patients with diabetes [ 610 ] . the safety and tolerability of sitagliptin has been demonstrated , with a low risk of hypoglycemia or weight gain . considering the different mechanisms and complementary effects of sitagliptin and insulin , a combination of these agents is a rational treatment option for insulin - treated patients . alpha - glucosidase inhibitors ( alpha - gis ) , such as miglitol , delay the absorption of digested carbohydrates from the small intestine and , thus , lower both postprandial glucose and insulin levels . alpha - gis are considered to be effective for stabilizing glycemic levels in patients who have undergone gastric or esophageal surgery because alpha - gis prevent reactive hypoglycemia due to late dumping syndrome . therefore , the present study examined the efficacy of sitagliptin and miglitol when added to an ongoing insulin treatment in a patient with type 2 diabetes who had undergone partial gastrectomy . efficacy was estimated with the use of a continuous glucose monitoring system ( cgms ) [ 1517 ] , and by measuring hormones related to incretin and glucose metabolism . the patient was a 67-year - old japanese man with a 15-year history of type 2 diabetes . at the age of 55 years , the patient was diagnosed as having gastric cancer and underwent a distal partial gastrectomy with reconstruction via the billroth i operation . the patient was being medicated with insulin lispro , which was injected at a dose of 10 , 12 , and 12 units just before breakfast , lunch , and dinner , respectively . the patient had no diabetic complications , such as neuropathy , retinopathy , or nephropathy . the patient had concomitant hypertension , dyslipidemia , and nontuberculous mycobacterial infection , but all these comorbid diseases were well controlled with oral medication . the patient s height was 163.1 cm , and at the time of admission , body weight was 66.9 kg ( body mass index 25.2 kg / m ) . the patient was admitted to the diabetes ward of the authors hospital and was equipped with a cgms device ( cgms - gold ; medtronic minimed , northridge , california , usa ) . the patient was monitored from 1 day before the study to the end of the 9-day study period . the cgms soft sensor was changed at the appropriate times according to the manufacturer s instructions . glucose levels measured using a self - monitoring blood glucose device ( nipro stat strip xp ; nipro , osaka , japan ) were checked at least four times per day for calibration of the cgms . the recorded data were analyzed using cgms solutions software ( medtronic minimed , northridge , california , usa ) . breakfast with a similar number of calories each day was served throughout the study period . the total number of calories of a typical meal was 428 kcal , containing 73 g of carbohydrates , 14.2 g of protein , and 7.4 g of fat . the meal was ingested within 1015 min . on the first day of the study , after an overnight fast for 14 h , an intravenous line was inserted into one forearm vein and flushed with sterile 0.9% nacl solution for repeated blood sampling . blood was drawn at 0 , 30 , 60 , and 120 min after breakfast for the measurement of serum c - peptide , plasma glucagon , active glp-1 , and total gip levels . blood samples were immediately cooled and centrifuged at 4 c , and plasma was stored at 20c until analysis . blood samples for the determination of glucagon , active glp-1 , and total gip levels were collected into bd p800 tubes ( becton , dickinson and co. , franklin lakes , new jersey , usa ) containing spray - dried potassium edta anticoagulant and a proprietary cocktail of protease , esterase , and dpp-4 inhibitors ( becton , dickinson and co. ) . plasma samples for active glp-1 measurements were subjected to solid - phase extraction to remove interference that affects immunoassays , and samples were analyzed using an enzyme - linked immunosorbent assay ( elisa ) kit ( millipore corp . , plasma concentrations of amidated glp-1 ( 736 ) and ( 737 ) were measured using an antibody that is highly specific for the n - terminus of glp-1 and does not react with glp-1 ( 936 ) , glp-2 , or glucagon . the detection limit of the elisa was 0.83 pmol / l , with an intra - assay coefficient of variation ( cv ) of 4.0614.90% and an interassay cv of 11.113.2% . the total gip level was measured using a human gip elisa kit ( millipore corp . ) . this kit has 100% cross - reactivity to human gip ( 142 ) amide and gip ( 342 ) amide , with a detection limit of 0.50 pmol / l , an intra - assay cv of 1.003.94% , and an interassay cv of 4.9910.10% . both active glp-1 and total gip levels were measured at mitsubishi chemical medience corp . blood samples for glucagon detection were analyzed using a double - antibody radioimmunoassay at srl , inc . the area under the curve ( auc ) values for these hormones after meal ingestion were calculated using the trapezoidal rule . throughout the study period , insulin dosages were not changed . on the first and second days of the study ( days 1 and 2 ) , the patient used insulin alone . from days 3 to 6 , sitagliptin ( 50 mg , one tablet per day ) was also taken , before breakfast , in addition to the insulin injections . on day 7 , miglitol ( 50 mg , three tablets per day ) was taken before meals , in addition to the insulin injections and sitagliptin . from day 8 to the end of the study , sitagliptin was discontinued , and the patient received only insulin injections and miglitol . the patient was a 67-year - old japanese man with a 15-year history of type 2 diabetes . at the age of 55 years , the patient was diagnosed as having gastric cancer and underwent a distal partial gastrectomy with reconstruction via the billroth i operation . the patient was being medicated with insulin lispro , which was injected at a dose of 10 , 12 , and 12 units just before breakfast , lunch , and dinner , respectively . the patient had no diabetic complications , such as neuropathy , retinopathy , or nephropathy . the patient had concomitant hypertension , dyslipidemia , and nontuberculous mycobacterial infection , but all these comorbid diseases were well controlled with oral medication . the patient s height was 163.1 cm , and at the time of admission , body weight was 66.9 kg ( body mass index 25.2 kg / m ) . the patient was admitted to the diabetes ward of the authors hospital and was equipped with a cgms device ( cgms - gold ; medtronic minimed , northridge , california , usa ) . the patient was monitored from 1 day before the study to the end of the 9-day study period . the cgms soft sensor was changed at the appropriate times according to the manufacturer s instructions . glucose levels measured using a self - monitoring blood glucose device ( nipro stat strip xp ; nipro , osaka , japan ) were checked at least four times per day for calibration of the cgms . the recorded data were analyzed using cgms solutions software ( medtronic minimed , northridge , california , usa ) . breakfast with a similar number of calories each day was served throughout the study period . the total number of calories of a typical meal was 428 kcal , containing 73 g of carbohydrates , 14.2 g of protein , and 7.4 g of fat . on the first day of the study , after an overnight fast for 14 h , an intravenous line was inserted into one forearm vein and flushed with sterile 0.9% nacl solution for repeated blood sampling . blood was drawn at 0 , 30 , 60 , and 120 min after breakfast for the measurement of serum c - peptide , plasma glucagon , active glp-1 , and total gip levels . blood samples were immediately cooled and centrifuged at 4 c , and plasma was stored at 20c until analysis . blood samples for the determination of glucagon , active glp-1 , and total gip levels were collected into bd p800 tubes ( becton , dickinson and co. , franklin lakes , new jersey , usa ) containing spray - dried potassium edta anticoagulant and a proprietary cocktail of protease , esterase , and dpp-4 inhibitors ( becton , dickinson and co. ) . plasma samples for active glp-1 measurements were subjected to solid - phase extraction to remove interference that affects immunoassays , and samples were analyzed using an enzyme - linked immunosorbent assay ( elisa ) kit ( millipore corp . , plasma concentrations of amidated glp-1 ( 736 ) and ( 737 ) were measured using an antibody that is highly specific for the n - terminus of glp-1 and does not react with glp-1 ( 936 ) , glp-2 , or glucagon . pmol / l , with an intra - assay coefficient of variation ( cv ) of 4.0614.90% and an interassay cv of 11.113.2% . the total gip level was measured using a human gip elisa kit ( millipore corp . ) . this kit has 100% cross - reactivity to human gip ( 142 ) amide and gip ( 342 ) amide , with a detection limit of 0.50 pmol / l , an intra - assay cv of 1.003.94% , and an interassay cv of 4.9910.10% . both active glp-1 and total gip levels blood samples for glucagon detection were analyzed using a double - antibody radioimmunoassay at srl , inc . the area under the curve ( auc ) values for these hormones after meal ingestion were calculated using the trapezoidal rule . throughout the study period , insulin dosages were not changed . on the first and second days of the study ( days 1 and 2 ) , the patient used insulin alone . from days 3 to 6 , sitagliptin ( 50 mg , one tablet per day ) was also taken , before breakfast , in addition to the insulin injections . on day 7 , miglitol ( 50 mg , three tablets per day ) was taken before meals , in addition to the insulin injections and sitagliptin . from day 8 to the end of the study , sitagliptin was discontinued , and the patient received only insulin injections and miglitol . throughout the study period , continuous glucose monitoring ( cgm ) was completed without any problems and the patient experienced no gastrointestinal symptoms associated with the study medications . figure 1 shows the escalations and fluctuations in glucose levels measured by cgm during treatment with insulin alone ( days 1 and 2 ) , insulin plus sitagliptin ( days 36 ) , insulin plus sitagliptin and miglitol ( day 7 ) , and insulin plus miglitol ( days 8 and 9 ) . the mean and sd values of cgm measurements for days 1 , 2 , 3 , 4 , 6 , 7 , 8 , and 9 were 185 58 , 210 75 , 154 44 , 157 53 , 158 36 , 144 31 , 137 30 , and 132 31 mg / dl , respectively , reflecting the attenuation of glucose fluctuations when sitagliptin , miglitol , or both , were added to insulin therapy.fig . 1cgm results during insulin therapy alone ( days 1 and 2 ) , insulin therapy plus sitagliptin ( days 3 , 4 , and 6 ) , insulin therapy plus sitagliptin and miglitol ( day 7 ) , and insulin therapy plus miglitol ( days 8 and 9 ) . the whole - day result of cgm on day 5 is not available , because the cgms soft sensor changed . double asterisk indicates times of meals ( this sign for dinner for day 3 , and breakfast for day 6 are missing ) . cgm continuous glucose monitoring , cgms continuous glucose monitoring system cgm results during insulin therapy alone ( days 1 and 2 ) , insulin therapy plus sitagliptin ( days 3 , 4 , and 6 ) , insulin therapy plus sitagliptin and miglitol ( day 7 ) , and insulin therapy plus miglitol ( days 8 and 9 ) . the whole - day result of cgm on day 5 is not available , because the cgms soft sensor changed . double asterisk indicates times of meals ( this sign for dinner for day 3 , and breakfast for day 6 are missing ) . cgm continuous glucose monitoring , cgms continuous glucose monitoring system time - dependent changes in c - peptide , glucagon , active glp-1 and total gip levels , and the auc values of these hormones up to 2 h after meal ingestion are summarized in table 1 and fig . 2 . compared to insulin alone , remarkable early postprandial increments in plasma c - peptide levels were observed when sitagliptin was added to insulin therapy , whereas no remarkable changes in postprandial increments in plasma c - peptide levels were observed when insulin was administered in combination with sitagliptin and miglitol or when insulin was administered with miglitol only ( fig . compared to insulin alone , the addition of sitagliptin to insulin therapy suppressed glucagon levels for at least 2 h after meal ingestion . this tendency was even more prominent when miglitol was coadministered with sitagliptin and insulin ; however , the administration of miglitol in combination with insulin had no observable effect on glucagon levels during the early postprandial phase ( fig . compared with insulin alone , the addition of sitagliptin or miglitol to insulin therapy increased glp-1 levels at least 30 min after meal ingestion . when both sitagliptin and miglitol were added to insulin therapy , remarkable incremental increases in glp-1 levels were observed . glp-1 fluctuation in response to sitagliptin or miglitol alone was transient , as opposed to the sustained increase observed when both drugs were combined with insulin ( fig . 2c ) . in contrast to the glp-1 results , gip levels decreased when sitagliptin or miglitol was added to insulin therapy . this tendency was particularly prominent when both sitagliptin and miglitol were added to insulin therapy ( fig . 2d).table 1auc values during the 2-h meal testinsulin aloneinsulin + sitagliptininsulin + sitagliptin + miglitolinsulin + miglitolglucose ( cgm ) auc ( mg / dl 2 h)35,34526,26517,58818,528c - peptide auc ( nmol / l 2 h)79.4105.262.162.9glucagon auc ( ng / l 2 h)7,7256,2105,2357,335active glp-1 auc ( pmol / l 2 h)266.7355.4789.5392.2total gip auc ( pmol / l 2 h)9,2705,5321,9934,210auc area under the curve , cgm continuous glucose monitoring , gip glucose - dependent insulinotropic peptide , glp-1 glucagon - like peptide 1fig . 2time course of plasma c - peptide ( a ) , glucagon ( b ) , active glp-1 ( c ) , and gip ( d ) levels before and after food intake in the patient . thick line with filled diamond insulin alone , dashed line with square insulin + sitagliptin , thin line with triangle insulin + sitagliptin + miglitol , dotted line with times symbol insulin + miglitol . gip glucose - dependent insulinotropic peptide , glp-1 glucagon - like peptide-1 auc values during the 2-h meal test auc area under the curve , cgm continuous glucose monitoring , gip glucose - dependent insulinotropic peptide , glp-1 glucagon - like peptide 1 time course of plasma c - peptide ( a ) , glucagon ( b ) , active glp-1 ( c ) , and gip ( d ) levels before and after food intake in the patient . thick line with filled diamond insulin alone , dashed line with square insulin + sitagliptin , thin line with triangle insulin + sitagliptin + miglitol , dotted line with times symbol insulin + miglitol . the results of the present study in a japanese patient with type 2 diabetes show that the administration of sitagliptin in addition to insulin therapy has beneficial effects on stabilizing the fluctuating glucose levels . the administration of miglitol in addition to insulin therapy and the coadministration of sitagliptin and miglitol also had beneficial effects in lowering glycemic levels in this patient . these effects were demonstrated precisely by the mean sd values and calculated auc values of the glucose levels monitored by cgms . the authors have previously shown that the combination of sitagliptin and miglitol was effective for reducing glucose fluctuations and stabilizing postprandial blood glucose levels in patients with type 2 diabetes receiving oral medication . in the present study , the authors have demonstrated that both single administration and coadministration of these two drugs was also effective in an insulin - treated patient . compared to insulin therapy alone , the addition of sitagliptin to insulin therapy was associated with higher c - peptide and glp-1 levels , and lower glucagon and gip levels , indicating that sitagliptin stimulated glp-1 and endogenous insulin secretion , and suppressed glucagon and gip levels . when miglitol was added to insulin therapy , glp-1 levels during the early postprandial phase were higher than those seen with insulin therapy alone ; however , unlike the case when sitagliptin was added , glucagon levels were not suppressed . however , gip levels were suppressed to a level similar to that when sitagliptin was added to insulin therapy . these results are consistent with previous reports , which showed that miglitol enhances and prolongs glp-1 release and suppresses plasma gip secretion [ 2022 ] . the coadministration of sitagliptin and miglitol with insulin therapy was associated with a significant increase in glp-1 secretion . the authors theoretically expected a postprandial increment in c - peptide levels as a result of the increased glp-1 secretion ; however , compared to insulin therapy alone , no remarkable changes in c - peptide levels were seen with sitagliptin and miglitol coadministration , which may be partly explained by the induced decrease in blood glucose levels . in contrast , the coadministration of sitagliptin and miglitol with insulin therapy was associated with significantly suppressed glucagon and gip levels , indicating that the combination of these drugs acted synergistically to suppress glucose increments . reported in a 24-week study that the addition of sitagliptin to ongoing insulin therapy resulted in significant improvements in glycemic control by improving beta - cell responsiveness relative to a placebo . the authors concluded that their findings were consistent with the mechanism of action of sitagliptin , and that in patients with more advanced disease and beta - cell failure , sitagliptin may still favorably impact glucose - dependent insulin secretion . in another report , ahren et al . demonstrated that vildagliptin , another dpp-4 inhibitor , enhanced alpha - cell responsiveness to both the suppressive effects of hyperglycemia and the stimulatory effects of hypoglycemia , concluding that these effects probably contributed to the improvement in glycemic control . those reports support the authors findings that the addition of a dpp-4 inhibitor to insulin therapy has beneficial effects on stabilizing glycemic control by stimulating endogenous insulin secretion and suppressing glucagon secretion . it is encouraging that these favorable effects were evident in a patient with a long history of diabetes , such as the present patient . in addition , previous reports have demonstrated that in type 1 diabetes , exogenous glp-1 lowered peak postprandial glucose levels regardless of residual beta - cell function , lowered fasting glycemia mainly by reducing glucose concentration , and presumably delayed gastric emptying and could normalize glycemic excursion after a meal when given in combination with insulin . vildagliptin has also been reported to be beneficial for decreasing postmeal glucagon excursion in insulinopenic patients with type 1 diabetes ; this effect was not secondary to a change in endogenous insulin secretion . these reports encourage the use of incretin - related agents in insulin - treated patients with type 1 or type 2 diabetes . in addition to sitagliptin , the addition of miglitol to insulin therapy had favorable effects on stabilizing glycemic control , in a patient who had undergone gastrectomy , such as the present patient . when both sitagliptin and miglitol were added to insulin therapy , the present patient experienced hypoglycemia that the patient was not completely aware of , but was revealed later by the cgm results . therefore , caution should be exercised when these combinations are used and a reduction in the insulin dose should be considered . in other words , by adding these drugs to insulin therapy , the authors are able to reduce the insulin dose and are thus able to reduce the risk of undesired side effects of insulin treatments , such as severe hypoglycemia and increasing body weight [ 28 , 29 ] . in conclusion , with the use of cgms , the authors have shown that the addition of a dpp-4 inhibitor , such as sitagliptin , was effective in reducing glucose fluctuations and stabilizing postprandial blood glucose levels in an insulin - treated patient . the addition of an alpha - gi , such as miglitol , to insulin therapy was also effective in this patient with diabetes who had undergone gastrectomy . because the present patient was a thin man with very low c - peptide levels and the dynamics of glucose absorption were greatly influenced by gastric resection , the authors are unable to apply the present findings to a general population of individuals with type 2 diabetes . to verify the effectiveness of sitagliptin in insulin - treated patients , further studies in a larger number of patients are needed , including patients with other insulin regimens , for instance , once - daily injection of long - acting insulin or mixed insulin agents two or three times daily . this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and the source are credited .

introductionto examine the efficacy of sitagliptin and miglitol when added to ongoing insulin treatment in a patient with type 2 diabetes who had undergone partial gastrectomy.methodscontinuous glucose monitoring ( cgm ) was performed and either sitagliptin or miglitol , or both , were added to fixed - dose insulin therapy . blood was drawn at 0 , 30 , 60 , and 120 min after breakfast , and c - peptide , glucagon , glucagon - like peptide ( glp)-1 , and glucose - dependent insulinotropic peptide ( gip ) were measured.resultscgm showed that compared to insulin alone , the addition of either sitagliptin or miglitol , or both , to insulin achieved better glucose control . compared to insulin alone , early postprandial increments in plasma c - peptide levels and suppressed glucagon levels were observed when sitagliptin was added . glucagon suppression was even more prominent when both sitagliptin and miglitol were added . compared to insulin alone , glp-1 levels were higher during the early postprandial stage when sitagliptin or miglitol was added and even higher when both were added . gip levels decreased when sitagliptin or miglitol , or both , were added to insulin therapy.conclusionthe authors showed that the addition of sitagliptin or miglitol , or both , was effective in this insulin - treated patient with diabetes who had undergone gastrectomy .

papaver somniferum l. is known as opium poppy , which has been used as a medicinal remedy for its sedative , anesthetic , analgesic , and antidierrheal effects for thousands of years . there are ancient documents mentioning about the medicinal properties of opium poppy such as the de materia medica written in a.c . 65 by pedanius dioscorides . by the more recent studies , it is known that the medicinal properties of opium poppy come from its high concentration alkaloid content . morphine , codeine , thebaine , papaverine , and noscapine are important and effective alkaloids in opium poppy for medicinal usage . besides their medicinal properties , these alkaloids are highly addictive and thus they have forensic importance . therefore , appropriate analysis of alkaloid content of opium poppy for screening and effective extraction is of great importance . furthermore , the alkaloid contents present in opium poppy make it an asset for the researchers . so we hope these findings will be helpful and directive for us and/or other scientists in the future research of papaver species . conventional extraction methods require more solvent , higher temperatures , and longer periods when high efficiency is desired . nowadays , extraction techniques which can be applied in lower temperatures requiring less amount of solvent and time are looking for by the researcher . the ultrasonic extraction technique ( uae ) , using ultrasound waves disrupt open the cellular walls , accomplishes mass transfer successfully [ 4 , 5 ] . by efficiently accomplishing mass transfer , ultrasound assisted extraction proves itself to be an efficient way for extraction . when compared to another extraction techniques such as microwave and supercritical extraction uae is cheaper and simpler [ 5 , 6 ] . recently , uae has become a popular technique among most researchers who try to extract flavonoids , polysaccharides , polyphenols , and oil from different matrices [ 5 , 7 ] . however , not only the extraction method but also the other parameters such as preliminary preparations , particle size of the extracted material , solvent type , solvent concentration , and solvent / solid ratio , extraction temperature , extraction pressure , extraction time , and ph affect the extraction process . to obtain the optimal operating conditions for an extraction method is necessary for commercial applications of the process . in the literature , there are two optimization method in order to optimize the process . one of them is one - factor - at - a - time approach ; and the other one is response surface methodology . one factor at a time is classical method , time consuming , and expensive method . moreover , by ignoring possible interactions among other operating parameters , this approach may result in misleading conclusions . in fact , the response of a process occurs by the interactions of different variables which affect the operation . response surface methodology ( rsm ) considers the probable interactions among operating parameters . in order to simplify this process and maximize utilization of data , design of experiments ( doe ) approach can be used and then the response surface methodology ( rsm ) can be applied for the experimental results [ 5 , 8 ] . utilization of doe and rsm enables us to reduce the number of experiments needed and accurately estimate the optimal conditions from the experimental data . about the poppy straw : the various reported morphine extraction methods from poppy straw have been reported in the literature . these reported methods include various steps involving water , organic solvent , and ph adjustments . the simplest methods are the following ones covering the sonication : even these simplest methods contain some more purification and organic solvent stage . individual alkaloids ( morphine , codeine , papaverine , noscapine , thebaine , oripavine , reticuline , and narceine ) were quantitatively determined in the different samples by a validated capillary electrophoresis method . depending on the plant structure , cultivar , and harvesting time , the composition of morphine is changeable . therefore , a common extraction procedure for all plant species can not exist and for poppy straw . particle size of the extracted material , solvent type , solvent composition , the solvent / solid ratio , extraction temperature , extraction pressure , extraction time , and ph of the solvent are the parameters affecting the industrial processes which are applied for extraction . in order to optimize the process , rsm is an aggregate of statistical and mathematical techniques used for developing , improving , and optimizing the processes [ 5 , 10 ] . sonication has been applied for the extraction of polycyclic aromatic hydrocarbons , pharmaceutically active compounds , and flavonoids from different matrices [ 5 , 11 , 12 ] . the aim of this study is to determine the effect of applied parameters on poppy straw by using ultrasound extraction method with rsm . papaver somniferum was collected from fields of opium alkaloids factory on the harvesting period in july of 2012 ( turkey ) . capsules of the plant were dried at room temperature after the seeds within the plant had been removed . all chemicals used in experiments were of analytical grade and all chemicals used for analysis were of hplc grade . 0.45 m membranes ( millipore , bedford , ma , usa ) was used for filtering the buffer solutions . morphine sulfate number 1448005 ) was obtained from the turkish grain board ( afyonkarahisar , turkey ) , which is the only legal supplier of narcotics in turkey . number 1448005 ) : molecular formula of morphine sulfate is ( c17h19no3)2h2so45h2o . molecular weight of morphine sulfate is 758.83 . 132.93 mg of morphine sulfate pentahydrate is equivalent to 100 mg of anhydrous morphine base 132.93 mg of morphine sulfate pentahydrate is equivalent to 100 mg of anhydrous morphine base . ultrasound assistant extraction was carried out using bandelin sonorex brand ultrasonic bath with 50 khz frequency . ph levels of the solutions were controlled by mettler toledo seven easy ph meter . for the standard ultrasonic conditions , solvent level in the erlenmeyer flask and water level in the ultrasonic bath were kept the same . in order to adjust ph levels to 1 or 13 after the extraction process had been completed , mixture was filtered with whatman filter paper in order to prevent capillary blockage first and was then filtered with 0.45 micron membrane filter ( millipore , bedford , ma , usa ) . identification and quantitative determination of morphine was established by agilent 1260 chromatographic system equipped with autosampler , quaternary pump , column compartment , and a multiwavelength detector . final quantification was performed on a 250 mm 4.6 mm i d , 5 m particle size , zorbax extend c-18 column ( agilent technologies ) . the eluents were a solution of 0.1% tfa in water and ph adjusted to 9.6 with tea ( solvent a ) and methanol ( solvent b ) , both filtered through 0.45 m millipore filters . elution was performed with the gradient : 02 min 45% solvent b ; 210 min from 45 to 70% solvent b ; 1020 min from 70 to 85% solvent b ; 2020.1 min from 85 to 45% solvent b ; 20.130 min 45% solvent b. the flow rate was 1.5 ml / min and the injection volume was 20 l . the column temperature was maintained at 30c , and detection was carried out at 280 nm . the method has been validated according to ich guidelines , taking into account the recommendations of other appropriate guidelines . results obtained from testing different parameters during validation of the analytical method were given in table 1 . the method recommended by the european pharmacopoeia for the quality assessment of the opium dry extract has been standardized ( ph . eur . 7.0 : 01/2008 : 1839 ) . in addition to morphine , codeine , oripavine , thebaine , papaverine , and noscapine were analyzed by this method . despite the retention time of last noscapine peak this is because the organic phase content of mobile phase increases with the analysis progresses . then , concentration of mobile phase will return to the initial conditions after 20 minutes . calibration curve was created to determine the concentration of morphine by comparing the peak areas with standard solutions which consist of morphine in the range of 100500 g / ml . morphine standard solution was prepared by dissolving its salt in purified water . morphine , codeine , thebaine , and noscapine were analyzed and optimized in poppy capsules ; however optimization of other alkaloids were not included in this paper . these designs require only three levels , coded as 1 , 0 , and + 1 . box and behnken created this design by combining two - level factorial designs with incomplete block designs . this procedure creates designs with desirable statistical properties , but , most importantly , with only a fraction of the experiments needed for a full three - level factorial . these designs offer limited blocking options , except for the three - factor version . in this design , while two of the factors are constant at level 0 , the remaining factors are iterated within the levels + 1 and 1 ; then this process is repeated for different groups [ 14 , 15 ] . in this study , box - behnken design was performed with four parameters to explore the effect of them on the responses ( table 2 ) . these were x1 ( solvent / solid ratio , ml/500 mg ) , x2 ( ph ) , x3 ( time , min ) , and x4 ( temperature , c ) . design - expert 8.0.7.1 ( trial version ) software was used in order to apply the box - behnken design model . twenty - nine experiments were performed with three replications at the center values to evaluate the pure error sum of squares . the proposed quadratic model is shown as follows:(1)y=0+i=14ixi+i=14iixi2+i=14j = i+14ijxixj+e , where y is the response , 0 is the constant coefficient which is often described as intercept , x i ( i = 1 4 ) is the noncoded variable , i is the linear , and ii is the quadratic , and ( i and j = 4 ) ij are the second order interaction coefficients [ 5 , 16 ] . statistical analysis on the means of triplicate experiments was performed out using the variance analysis ( anova ) procedure of the instat software version 3.0 . variance analysis were applied to identify the interaction between the variables and the response using design - expert program . variance analysis were applied for identifying the interaction between the variables and the response by using design - expert program . experimental conditions of box - behnken design runs designed with design expert 8.0.7.1 are shown in table 3 . table 3 also displays the effects of ph , solvent / solid ratio , time and temperature on the extraction efficiency obtained by uae . figures 2 , 3 , 4 , 5 , 6 , and 7 display response surface plots for process variables . the solvent / solid ratio is a crucial factor and was also studied to optimize extraction efficiency . large solvent volumes could make the procedure difficult and lead to unnecessary waste , while small volumes may lead to incomplete extraction . a series of experiments were carried out with different solvent / solid ratios ( 10/500 , 15/500 , 20/500 v / w ) to evaluate the effect of the solvent / solid ratio . the increase of the yield with the increase of solvent quantity is consistent with mass transfer principles , since the concentration gradient which is driving force is supposed to be higher when a lower solvent to solid ratio is used , leading to higher diffusion . the influence of the solvent ph on the extraction efficiency of morphine was examined over a range of 113 and the results are shown in table 3 . it can be clearly seen that extraction efficiency was the maximum at ph : 1 . when the solvent ph was increased from 1 to 7 then the extraction efficiency increased gradually , while the solvent ph was increased from 7 to 13 . this might be explained by the fact that an acidic environment helps in the release of morphine into the solvent . the influence of the time ultrasound on the extraction efficiency of morphine was examined over a range of 3060 min and the results are shown in table 3 . they show that when the extraction time was increased from 30 min to 60 min , the extraction efficiency was low during the first 40 min of ultrasonication indicating that more time was needed for ultrasound to disrupt the cell walls and aid the release of morphine into the solvent . extractions of poppy straw were performed over temperatures ranging from 30 to 50c , since extraction at high temperatures is not economical . expectedly , extraction efficiency of morphine increased steadily as a function of temperature until 45c , since mass transfer increase by temperature . but in general , extractions at higher temperatures increase mass transfer and extraction performance because of enhanced solute desorption from the active sites of plant matrix . individual effects of process variables , which are also known as one - factor - at - at - ime approach , were applied in previous section . this classical approach ignores the possible interactions of process variables with each other , which may result in misleading conclusions table 2 shows the four parameters ( ph , solvent / solid ratio , time , and temperature ) including minimum , centre , and maximum points . twenty - nine experiments were run and chosen randomly by the design expert software , and the responses were recorded ( table 3 ) . using response surface methodology owing to the software , a quadratic model applying not only forward stepwise but also backward elimination regressions for ey was obtained . using responce surface methodology from the software , a quadratic model given below was derived:(2)m=3.0002800.040567x10.172330x2 0.035744x3 + 0.038358x40.005500x1x2 0.000933x1x3 + 0.003200x1x4 0.001167x2x3 + 0.000708x2x4 + 0.000783x3x4 + 0.00104x12 + 0.021387x22 + 0.000311x320.001713x42 . in table 4 , x3 , x1x3 , x2x3 , x2x4 , x3x4 , x1 , and x3 are not significant effects for the model . after excluding their regression coefficients , new model may be given for better explanation of new condition:(3)m=3.0002800.040567x10.172330x2 + 0.038358x40.005500x1x2 + 0.003200x1x4 + 0.021387x220.001713x42 . the optimal extraction conditions were found by using optimization choice in design expert software to maximize the response . this value was measured at 1.10 of ph , 60 min of extraction time , 42.36c of extraction temperature , and 19.99 ml to 500 mg solvent / solid ratio . the maximum response was found as 3.38 mg morphine/500 mg dried capsules under these operating conditions . after finding optimal conditions , real sample extraction experiments were repeated 6 times and then average with relative standard deviation was calculated . the results of variance analysis were given in table 4 . in order to obtain the most suitable set of variables , variables are tested and evaluated within the given alpha levels ( 0.1 ) using both backward and forward techniques . backward techniques cover all the variables to estimate parameters and then any variables with a nonsignificant parameter at alpha levels are removed from the equation . similar to backward technique , forward technique also evaluates the given variables within the given alpha levels . unlike backward technique the significant variable with the highest value of standardized beta ( p < 0.05 ) will be added to the equation . then the next variable with the highest standardized beta value is assessed . variance analysis for the quadratic equations of design expert 8.0.7.1 for the response were given in table 4 . ( x1 ) , ( x2 ) , ( x4 ) , ( x1x2 ) , ( x1x4 ) , ( x2 ) , and ( x4 ) are significant model terms in the confidence interval ( table 4 ) . the closer and higher multiple coefficients ( r - squared , adj r - squared , and pred r - squared ) point out to the higher accuracy of the model . adj r - squared also shows a high degree of correlation between actual and predicted data . as seen in table 4 solvent / solid ratio ( x1 ) f - value of lack of fit ( 6.15 ) shows that the lack of fit is significant . in our study , r - squared ( 0.96 ) , adj r - squared ( 0.92 ) , and pred r - squared ( 0.78 ) values for ey display good accuracy of the derived model . also , the coefficient value of variation ( c.v . the lower coefficient of variation value indicates a higher precision and reliability of the experimental results . hereby , the responce surface modeling can be accomplished sufficiently to predict ey from poppy straw with uae . the lower value of coefficient of variation indicates a higher precision and reliability of the experimental results [ 19 , 20 ] . figure 8 exhibits the corelation between the experimental and predicted data calculated from ( 3 ) concerning the ey of poppy straw extracts obtained by uae . it can be seen that the predicted date calculated from the model is in good agreement with the experimental data in the range of operating conditions . a potential source of morphine , poppy straw ( papaver somniferum capsules ) , was used as the research material in this study . the capsules were extracted by uae , which is an environmental and economical alternative to conventional extraction methods , requiring more time and solvent consumption . the results of the study suggests that 1.10 of ph , 42.36c of extraction temperature , 59.94 min of extraction time , and 19.99 ml to 500 mg solvent / solid ratio should be employed as optimal operating conditions for the best ey ( 3.38 mg morphine/500 mg dried capsules ) . linear coefficient of solvent to solid ratio , ph and extraction time , and square coefficient of solvent to solid ratio , ph , and extraction time have the most significant effect on the ey obtained by uae . after finding optimal conditions , real sample extraction experiments were repeated 6 times and then average with relative standard deviation was calculated .

in this study , amount of morphine from poppy capsules ( papaver somniferum ) was investigated using ultrasonic assisted extraction ( uae ) . response surface methodology was used to estimate effective experimental conditions on the content extraction of poppy capsules . for this purpose , solvent / solid ratio ( 1020 ml/500 mg sample ) , ph ( 113 ) , time ( 3060 min ) , and temperature ( 3050c ) were chosen as experimental variables . the affected response is extraction recovery values for morphine from poppy straw . for interpreting the relationship between experimental factors and response , a design table was established with combinations of three different concentrations levels of this compound in 29 trials . the second order quadratic model gave a satisfactory description of the experimental data . in our study , r - squared ( 0.96 ) , adj - r - squared ( 0.92 ) , and pred r - squared ( 0.78 ) values for extraction yield display good accuracy of the derived model . the predicted optimal conditions for the highest morphine level ( 3.38 mg morphine/500 mg - sample ) were found at 19.99 ml solvent/500 mg solid ratio , 59.94 min extraction time , 1.10 ph , and 42.36c temperature . in the optimal extraction conditions , the experimental values are very close to the predicted values . consequently , the response surface modeling can be achieved sufficiently to predict extraction yield from poppy straw by ultrasound assisted extraction .

the institute of medicine ( iom ) has defined patient safety as the prevention of harm to patients . patient safety includes risk assessment , identification , management of patient related risk , reporting and analysis of incidents and the capacity to learn from and follow - up incidents and implement solutions to minimize the risk of the reoccurrence of the incident . international studies have revealed that the rate of medical errors was 5 - 80/100,000 consultations in primary health - care ( phc ) settings , with prescription errors of 11% and adverse event rate at 3.7/100,000 clinic visits . medical record based study from general practice in holland revealed a prevalence of 2.2% safety incidents in 1000 patient records . in saudi arabia , patient safety and medical errors have become an important national issue discussed by the media in the past decade . however , only a few studies have been conducted on this subject . of these studies only one discussed the knowledge and attitude of undergraduate medical students , two others discussed patient safety culture in hospital , and one reported the status of medical liability claims in saudi arabia . another study explored the preference and perception of the public on the disclosure of medical errors . a study in a phc setting in riyadh city by khoja et al . , found that there were about 19% errors in prescriptions issued by doctors working at primary health - care centers ( phcc ) . one recent study was conducted at an academic center to assess the attitude of nurses toward patient safety . this scarcity of studies indicates that more studies on patient safety are required and medical errors in the provision of health - care , particularly the knowledge and attitude toward these issues have to be explored . the objective of this study was to assess the attitude of phc physicians in aseer region , saudi arabia toward patient safety . this cross - sectional study was conducted among physicians working at phcc in aseer region , saudi arabia , in august 2011 . a self - administered questionnaire consisting of three parts was used to achieve the objective of this study . the first part of the questionnaire dealt with the socio - demographics , the academic and work profile of participants . this questionnaire was developed and validated by carruthers et al . for use among students and tutors in uk this questionnaire was found to have reliability ranges between 0.64 and 0.82 for the nine factors namely ; 1-patient safety training received , 2-errors reporting confidence , 3-working hours as error cause , 4-error inevitability , 5-professional incompetence as error cause , 6-disclosure responsibility , 7-team functioning , 8-patient involvement in reducing errors , 9- and importance of patient safety in curriculum . items were assessed on a likert scale of seven points ( 7 = strongly agree , 1 = strongly disagree ) . attitude to patient safety was classified as positive , neutral or negative depending on scores given for each item : a score of less than four was negative attitude / disagree , four was neutral and a score of five or more indicated a positive attitude / agree . for questions ( 11 - 17 ) and question , ( 25 ) attitude was considered positive / agree if the score was less than 4 , neutral if the score was four and negative / disagree if it was five or greater . the last part of the questionnaire developed by the investigator consisted of three questions ; 1-receiving training on the phcc doctors who had attended family medicine essentials course in aseer region and agreed to participate in this study were invited to complete the questionnaire under the direct supervision of the investigator , who explained the purpose and the importance of this study . permission from the authors of the apsq - iii was obtained to use the questionnaire through e - mail contact . data of the questionnaire were coded and then entered into personal computer provided with statistical package for the social sciences spss version 15 for statistical analysis . appropriate statistical tests ( chi - square , anova ) were used accordingly and p values were considered significant if > 0.05 . the total number of participants in this study was 228 doctors out of 365 ( 65% ) physicians working at phcc in aseer region at the time of the study , giving a response rate of 65% . the mean age was 39 years ; 77% were males ; saudi doctors represented 18% and 80% had no post mbbs qualifications . the average experience of work at phcc was 8.3 years and the average number of patients seen daily was 44 patients . less than one - third ( 30% ) had attended a course on patient safety and only 52% defined medical error correctly . characteristics of physicians at phcc , aseer region 2011 ( n=228 ) statistical analysis showed that 20% of saudi doctors , 42% of arab doctors and 20% of non - arab doctors had attended a course on patient safety ( = 9 , p = 0.01 ) . those who had worked at a phcc for more than 5 years had attended such courses compared to those who had worked for > 5 years ( = 12 , p = 0.006 ) . the older doctors tended to attend courses related to patient safety more than young doctors ( = 8 , p = 0.02 ) . saudi doctors and those who had worked at a phcc for less than five years defined medical error correctly compared to the non - saudi ( = 20 , p = 0.01 ) and those who had worked at a phcc for more than 5 years ( = 22.5 , p = 0.03 ) . table 2 depicts the mean scores of questions assessing attitudes toward patient safety in nine areas . attitude of phc physicians toward patient safety , aseer region , ksa , 2011 the best score was given for reducing medical errors ( 6.2 points ) , followed by role of training and learning on patient safety ( 6 and 5.9 points ) . however , participants were not satisfied with undergraduate training on patient safety ( 4.8 points ) . confidence in reporting medical errors and reporting the errors of other people scored 4.8 points and the confidence to be open with supervisor about an error had made scored 4.6 points . regarding the relationship between working hours and occurrence of medical errors , it was thought that shorter shifts would reduce medical errors ( 5.4 points ) , not taking break would increase the risk of medical errors ( 5.7 points ) while the number of hours a doctor worked would increase the likelihood of medical error ( 5.4 points ) . concerning the inevitability of errors , it was agreed that even the most experienced and competent doctors make errors ( 5.7 points ) , on the other hand , participants disagreed with the statement that most medical errors resulted from the carelessness of nurses ( 5.9 points ) or careless doctors ( 4.9 points ) . reporting all medical errors was considered necessary even if they caused no harm to patients ( 3.9 points ) while teaching teamwork skills would reduce medical errors ( 6.2 points ) . patients have an important role in preventing medical errors and their involvement was considered important in reducing the risk of medical errors ( 3 and 3.9 points respectively ) . teaching students about patient safety was considered a priority in the training of medical students ( 5.6 points ) . learning about patient safety before graduating would help doctors to become more effective ( 6.2 points ) . table 3 shows association between socio - demographic variables and attitude toward patient safety . statistical analysis revealed that females scored higher points than males in many questions ( numbers 1 , 2 , 14 , 19 , 23 , 24 ) ( p = 0.00 - 0.04 ) . association between some demographic variables and mean score for some items in apsq - iii using analysis of variance ( anova ) showed that non - arab doctors scored higher points than arab and saudi doctors for the first eight questions and question numbers 12 and 18 ( p values between 0.00 and 0.03 ) , those above 45 years , scored the highest points compared to those between 36 and 45 years and less than 36 years old in nine questions with different p values ranging from 0.00 to 0.04 for questions numbers ( 1 , 2 , 3 , 6 , 10 , 12 , 14 , 20 , 21 ) . those doctors who had worked for more than 20 years were found to have a positive attitude compared with those who had worked between 11 - 20 years , 5 - 10 years and less than five years for nine questions ( 2 , 3 , 6 , 9 , 10 , 14 , 19 , 20 , 21 ) with p values ranging between 0.00 and 0.02 . regarding the association between qualification and attitude toward patient safety , it was found that those with high qualifications had a positive attitude ( highest points ) toward patient safety as observed in question numbers ( 7 , 8 , 15 , 17 , 21 , 24 ) with p values between 0.001 and 0.04 . doctors who had training on patient safety was found to have positive atitude ( items number 2 , 6 , 13 , 23 ) [ table 4 ] . impact of training on some aspects of attitude of phcc doctors toward patient safety , aseer region , 2011 most of phcc doctors in aseer region showed a positive attitude toward patient safety . however , 70% had not attended any training course on patient safety , which was reflected in their knowledge , which was 52% and 61% were able to define medical error and knew the main causes of medical errors . such important findings indicate that there is urgent need for such interventions as conducting continuous professional development programs on medical errors and patient safety for phc physicians . in spite of the importance of patient safety in the medical school curriculum , ( 2010 ) , mentioned that more than two - thirds of medical students agreed that the teaching of patient safety in medical schools and the continuous training of health staff was necessary . another study from hong kong ( 2009 ) showed that 90% of medical students strongly agreed that patient safety was an important topic for teaching in medical school . those findings should alert us on the issue of the curricula of medical colleges in ksa and the importance of making reporting medical errors is important step in improving the quality of health - care including patient safety . in other words , about one third of the participants were comfortable with reporting medical errors . these low scores which reflected the negative attitude of some physicians toward reporting adverse events could be due to the lack of a system for reporting medical errors . also , a culture of safety in health settings , as reported by alahmadi is yet to be developed . the confidence of participants in talking about their errors with their supervisor if harm is caused to the patient was given an average score of 5.6 and majority of participants ( 78% ) said they would do so . this rate is in agreement with the findings of a study conducted of gps in denmark ( 2006 ) , which revealed that more than 75% of gps would report adverse event that occurs . in the few phcc with a high number of patients attending and work overload , participants showed that a shorter shift for the doctors and taking breaks would reduce medical errors . the area of errors inevitability scored 3.2 - 5.9 points regarding competency and experience of doctors . these findings are comparable to those reported from uk . as reported by hammami et al . ( 2009 ) the disclosure of medical errors poses a big dilemma in health settings in saudi arabia . in this study , doctor had the responsibility of disclosing errors to patients only if they resulted in harm to the patient , while 40% disagreed and 16% were neutral . on the other hand , most participants ( 79% ) agreed to report all medical errors while 12% disagreed . a study of medical trainees ( 2006 ) found that 80% would disclose adverse events to patients . these diversity of attitude could be explained by the lack of training and experience of phcs in dealing with medical errors . in addition , there is a lack of established culture of reporting adverse events in phc settings in saudi arabia . most participants ( 91% ) agreed that the teaching of teamwork would reduce medical errors . these high scores confirm the vital role played by the teaching of teamwork and leadership in patient safety mentioned by firth - cozens . patients play an essential role in their health and safety by active involvement in decision making and self - management . phcc physicians showed average to high agreement ( 84% ) in this regard ( 4.9 and 5.9 points ) compared to 5.2 points in uk study , but less than what was reported from saudi arabia ( 44.7% ) . the last theme of the study was about the importance of patient safety in the curriculum . a total of 90% of the participants with a high average score of 5.6 out of seven points agreed that teaching students about patient safety is a priority in medical training while 84% with the highest score of all items in the questionnaire agreed that learning about patient safety before graduation from medical schools would produce more effective doctors , these important findings are in agreement with results of two studies conducted among medical students in the qassim region and hong kong , which emphasized the priority of putting patient safety in the undergraduate curriculum of medical colleges . in this study , attitudes toward patient safety were affected to some degree by some demographic and scientific background such as gender , age group , nationality , qualification and work experience at phcc . female doctors had a more positive attitude toward patient safety than male doctors , which was difficult to explain . the doctors with more experience in phcc had a more positive attitude toward patient safety than those with a short experience . it is known that as doctors got older and more experienced , their attitude to their profession changed for the better . it was found that doctors with high qualifications had a positive attitude toward patient safety . such a finding could be either because they had taken some courses or their training had included some sessions on patient safety and medical errors . the impact of training on patient safety and attitude was not always positive as only a few items ( items no 2 , 6 , 13 , 23 ) were positively affected by training . these associations should be interpreted carefully as less than one - third of the participants had had a course on patient safety . this study showed that phc physicians in aseer region had a positive attitude toward patient safety . undergraduate education on patient safety considered a priority to make future doctors effective was inadequate . teamwork approach and patient involvement were given a priority in the prevention of medical errors and the improvement of patient safety . phc physicians in aseer region should have training sessions on patient safety and medical errors . further studies are needed to explore the knowledge and behaviors of phcc physicians on patient safety and medical errors . phc physicians in aseer region should have training sessions on patient safety and medical errors . further studies are needed to explore the knowledge and behaviors of phcc physicians on patient safety and medical errors .

objective : the objective of this study was to assess the attitude of physicians at primary health - care centers ( phcc ) in aseer region toward patient safety.materials and methods : this study was conducted among working primary health - care physicians in aseer region , saudi arabia , in august 2011 . a self - administered questionnaire consisting of three parts was used ; the first part was on the socio - demographic , academic and about the work profile of the participants . the attitude consisting of 26 questions was assessed on a likert scale of 7 points using attitude to patients safety questionnaire - iii items and the last part concerned training on patient safety , definition and factors that contribute to medical errors . data of the questionnaire were entered and analyzed by statistical package for the social sciences ( spss ) version 15.results:the total number of participants was 228 doctors who represent about 65% of the physicians at phcc , one - third of whom had attended a course on patient safety and only 52% of whom defined medical error correctly . the best score was given for the reduction of medical errors ( 6.2 points ) , followed by role of training and learning on patient safety ( 6 and 5.9 points ) , but undergraduate training on patient safety was given the least score . confidence to report medical errors scored 4.6 points as did reporting the errors of other people and 5.6 points for being open with the supervisor about an error made . participants agreed that even the most experienced and competent doctors make errors ( 5.9 points ) , on the other hand , they disagreed that most medical errors resulted from nurses carelessness ( 3.9 points ) or doctors carelessness ( 4 points).conclusion : this study showed that phcc physicians in aseer region had a positive attitude toward patient safety . most of them need training on patient safety . undergraduate education on patient safety which was considered a priority for making future doctors work effective was inadequate .

fungi once considered as nonpathogenic or less virulent are now recognized as a primary cause of morbidity and mortality in immunocompromised and severely ill patients . they are capable of initiating infections in both immunocompetent individuals and immunocompromised hosts , but the incidence of infections is more in immunocompromised individuals ; candidiasis , hence , is rightly called the disease of diseased . candida spp . , though commensal organisms that normally colonize mucosal surfaces in an asymptomatic manner , can become one of the most significant causes of disabling and lethal infection . are responsible for various clinical manifestations ranging from mucocutaneous overgrowth to life threatening disseminated infections like candidemia . although candida albicans is the most prevalent species involved in both mucocutaneous and disseminated infections , the incidence of candidiasis due to non - albicans candida ( nac ) spp . several factors like severe immunosuppression or illness , prematurity , use of broad spectrum antibiotics , and empirical use of antimycotic drugs are reported to be associated with this change . are inherently resistant or acquire resistance , or both , to commonly used antifungal drugs . the transition of candida spp . from commensal to potent pathogen is facilitated by a number of virulence factors such as adherence to host tissues and medical devices , biofilm formation , and secretion of extracellular hydrolytic enzymes . although there has been extensive research to identify these pathogenic attributes in c. albicans , relatively less is known about nac spp . . the present study was conducted at a rural tertiary care teaching hospital of india with an aim of investigating prevalence of nac spp . among candida thesis conducted in the department of microbiology , rural medical college and hospital of pravara institute of medical sciences , loni , maharashtra , india . isolated from various clinical specimens between the period of january 2010 and december 2013 were included in the study . vaginal , urinary , and bronchial candidiasis was considered significant , while a single isolation was considered significant from sterile body fluids like blood , peritoneal fluid , pleural fluid , and cerebrospinal fluid ( csf ) . patient 's information such as date of admission , ward , underlying medical conditions , associated risk factors such as presence of urinary catheter , respiratory ventilation , central line insertion , duration of antibiotic therapy , antifungal prophylaxis , exposure to invasive medical procedures , and use of corticosteroids was obtained from clinical records and analysed . colonies appearing pasty , opaque , slightly domed or flat , smooth and pale coloured ( white , off - white , or beige ) with a sweet smell reminiscent of ripe apples were suspected to be colonies of candida . the suspected colonies of candida isolates were identified by wet film , gram stain , and india ink preparation . the mycological workup for speciation of candida isolates started with the germ tube test . isolates producing germ tubes within 2 hours of incubation were further subjected to temperature studies , chlamydospores formation , and biochemical tests for differentiation of c. albicans from c. dubliniensis . germ tube negative candida isolates were classified on the basis of sugar assimilation and colony colour on hichrom candida agar . isolated from various clinical specimens were screened for the production of virulence factors such as adherence to buccal epithelial cell ( abec ) , biofilm formation , haemolytic activity , and production of extracellular hydrolytic enzymes ( coagulase , phospholipase , and proteinase ) . for each virulence factor , the isolate was tested in triplicate in each assay and three assays were carried out for each isolate on separate occasions . becs were collected by gently rubbing the cheek mucosa of eight ( four males , four females ) healthy laboratory technicians ( no signs or symptoms of opc or other oral lesions and not receiving any antibiotics at the time of study ) after obtaining prior consent . as fresh becs becs were washed thrice by phosphate buffered saline ( pbs ) and harvested by centrifugation . equal volumes ( 1 ml ) of bec ( 1 10 cells / ml ) and yeast suspension ( 1 10 cells / ml ) were mixed and incubated at 37c for 2 h in a shaking water bath at 40 rpm . the mixture was filtered through a 20 m filter to remove nonadherent yeast cells . the becs on the filter were washed with 5 ml of pbs and finally suspended in 5 ml of pbs . the smear was fixed by methanol , air - dried , and stained with 2% crystal violet for 1 minute . adherence was determined microscopically by counting the mean number of yeast cells adhering to every 100 becs . c. albicans atcc 90028 was used as the control strain . biofilm formation was determined using the tube method described by yigit et al . with a few modifications . colonies of candida isolates to be tested for biofilm formation were inoculated in saline and incubated for 24 h at 35c . 1.5 ml of this saline suspension was transferred to screw capped conical polystyrene tubes containing 5 ml of sabouraud dextrose broth supplemented with glucose ( final concentration , 8% ) . after incubation , the broth from the tube was gently aspirated using a pasteur pipette . the tube was washed thrice with pbs ( ph 7.2 ) and stained with 1% safranin . the stain was decanted after 15 min and the tube was rinsed with pbs to remove excess stain . presence of visible adherent film on the wall and the bottom of the tube indicated biofilm formation by the isolate . ring formation at the liquid interface was not considered as an indication of biofilm production . c. albicans atcc 90028 and c. albicans atcc approximately 10 l of standard inoculum ( 10 candida cells / ml ) was inoculated on sheep blood sabouraud dextrose agar plate . plates were incubated at 37c in 5% co2 for 48 h. the presence of a distinct translucent halo around the inoculum site , viewed with transmitted light , indicated haemolysin production . haemolytic activity ( hz ) was determined by calculating the ratio of the diameter of the colony to that of the translucent zone of haemolysis . c. albicans atcc 90028 and c. parapsilosis atcc 22019 were used as positive and negative controls , respectively . ( lancefield group a ) and streptococcus sanguis were used as positive controls for beta and alpha haemolysis , respectively . the candida isolates were screened for the production of exoenzymes like coagulase , phospholipase , and proteinase . was aseptically inoculated into a test tube containing 0.5 ml of edta - rabbit plasma . the tube was incubated at 35c and observed for clot formation after 4 h. the presence of clot that could not be resuspended by gentle shaking indicated positive coagulase test . if no clot formed , the tube was reincubated and reexamined at 24 h. staphylococcus aureus atcc 25923 and s. epidermidis atcc 14990 were used , respectively , as positive and negative controls . phospholipase production was assayed according to the method of samaranayake et al . by egg yolk agar plate method . approximately 5 l of standard inoculum of test strain containing 10 cells / ml was aseptically inoculated onto egg yolk agar . after inoculation , the plates were dried at room temperature and then incubated at 35c for 3 days . the plates were examined for the presence of a zone of precipitate around the colony ( phospholipase production ) . phospholipase activity ( pz ) was expressed as the ratio of the colony diameter to the diameter of the colony plus the precipitation zone . a pz value of 1 denoted no phospholipase activity , whereas pz < 1 indicated phospholipase expression by the isolate . c. albicans atcc 10231 was used as the positive control . proteinase production was performed according to the method of aoki et al . with a few modifications , using bovine serum albumin agar ( bsa ) plates . approximately 10 l of standard inoculum containing 10 cells / ml was aseptically inoculated onto 1% bsa agar plate . further proteinase activity was inhibited by adding 20% trichloroacetic acid and the plate was stained with 1.25% amido black . the diameter of the colonies was measured prior to staining and the diameter of the clear zones was measured after staining . proteinase index ( prz ) was measured in terms of the ratio of the diameter of the colony to the diameter of unstained zone . a prz value of 1 indicated no proteinase activity ; prz < 1 denoted proteinase expression by candida isolate . the antifungals tested in this study were amphotericin b ( range 0.00232 g ) , fluconazole ( range 0.016256 g ) , itraconazole ( range 0.00232 g ) , and ketoconazole ( range 0.00232 g ) . the inoculum was prepared by inoculating 3 - 4 colonies of the candida isolate in saline . the yeast suspension was inoculated on mueller - hinton agar supplemented with 2% glucose and methylene blue ( 0.5 g / ml ) by the lawn culture method using a tipped cotton swab . the inoculum was allowed to dry and the strip was placed on the surface of agar with the help of forceps . the plates were incubated at 35c 2448 h. c. albicans atcc 90028 and c. parapsilosis atcc 22019 were used for quality control . the results of antifungal susceptibility test were interpreted as sensitive ( s ) , susceptible dose dependent sensitive ( sdd ) , and resistant ( r ) . interpretative criteria for azoles were those recommended by the clinical and laboratory standard institute ( clsi ) [ 14 , 15 ] . due to the lack of defined breakpoints for amphotericin b , arbitrary values based on the studies of other researchers were used [ 16 , 17 ] . between january 2010 and december 2013 , 523 candida spp . were isolated from various clinical specimens . the distribution of candida spp . in various clinical specimens were isolated from urine ( 34.6% ) followed by vaginal swabs ( 27.1% ) and oropharyngeal swabs ( 19.3% ) . out of 523 candida spp . isolated from various clinical specimens , 192 ( 36.7% ) were c. albicans and 331 ( 63.3% ) were nac spp . among the nac spp . , c. tropicalis ( 35.1% ) followed by c. glabrata ( 28.1% ) and c. krusei ( 16.3% ) was the major isolates . out of 9 c. dubliniensis , 7 were isolated from oropharyngeal swabs collected from hiv infected patients with oropharyngeal candidiasis ( opc ) , whereas 2 were isolated from vaginal swabs collected from hiv noninfected clinically suspected cases of vulvovaginal candidiasis ( vvc ) . c. glabrata was the major isolate from cases of candidemia followed by c. tropicalis and c. albicans ( table 1 ) . phospholipase production followed by haemolysin production and abec were the major virulence factors produced by c. albicans . among nac spp . , c. tropicalis ( 63.7% ) followed by c. glabrata ( 60.2% ) showed maximum adherence to bec . biofilm formation capacity was higher in c. tropicalis ( 74.1% ) as compared to c. albicans ( 72.9% ) . c. tropicalis followed by c. glabrata showed maximum phospholipase activity , whereas proteinase production was high in c. tropicalis and c. dubliniensis isolates . resistance to the azole group of antifungal agents was common in nac spp . c. dubliniensis followed by c. glabrata demonstrated high resistance to fluconazole . the very nature of infectious diseases has undergone profound changes in the past few decades . hitherto unknown microbes or microorganisms with no pathogenic role have emerged as important causes of morbidity and mortality worldwide . in recent years , candida spp . have emerged as principal pathogens of a variety of human infections . in the present study , the majority of candida spp . 71 ( 39.2% ) were c. albicans , while 110 ( 60.8% ) isolates belonged to nac spp . are not only well adapted to the urinary tract but also more difficult to eradicate than c. albicans . presence of indwelling urinary catheters , advanced age , diabetes mellitus , and pregnancy were major risk factors associated with candiduria . incidence of candiduria was high among patients admitted to the icu and among those who had a previous history of treatment with antibiotics . pill for all ills , self - medication , and starting broad spectrum antibiotics as the first line treatment have led to increased colonization by candida spp . which suppressed the commensal bacterial flora . vvc though an extremely common infection in women of childbearing age has been now excluded from the list of sexually transmitted infections , contributing to a dearth of recent information regarding its incidence and epidemiology . the diagnosis of vvc is usually made on the basis of clinical examination with minimal or no laboratory support . in our study , 66.3% of candida spp . this observation is in accordance with studies by mohanty et al . and jindal et al . low dosage azole maintenance regimen , uncontrolled diabetes mellitus , and douching are the most common risk factors identified for vvc due to c. glabrata . in our study , c. dubliniensis was recovered from 2 hiv negative vvc patients . this observation confirms the possibility of c. dubliniensis infection in a population other than the hiv infected . opc is the most common opportunistic mycoses in immunocompromised individuals . in our study , nac spp . widespread use of immunosuppressive therapy and broad spectrum antimycotic prophylaxis has increased the incidence of opc due to nac spp . c. glabrata has been increasingly reported in disseminated infections in recent years . in our study , c. glabrata was the predominant species of candida isolated from cases of candidemia . the risk factors leading to c. glabrata blood stream infection are similar to those by other species , but , compared to other candida spp . , the mortality rate of c. glabrata infection is high . in candida spp . , the transition from commensal to potential pathogen is determined by various host predisposing factors and virulence attributes of infecting species . identifying these virulence factors in infecting pathogens and understanding their effects on the human host are a major challenge for clinical microbiologists . adhesion of candida spp . to the host epithelial cells is a critical first step in the pathogenesis of infection . binding of the candida to host cells , host cell proteins , or microbial competitors prevents or at least reduces the extent of clearance by the host 's defense mechanisms . among nac spp . , c. tropicalis followed by c. glabrata and c. dubliniensis demonstrated high adherence to buccal epithelial cells . the increasing incidence of hospitalization , advances in medical science , increasing use of antimicrobial agents accompanied by better adaptation of microorganisms to the hospital environment , all these factors , have combined to increase health care associated infections ( hcais ) . due to their versatility of adapting to a variety of different habitats including various medical devices , candida spp . have emerged as one of the leading causes of hcais . possess the ability to form biofilm on most , if not all , medical devices . biofilms are surface - associated communities of microorganisms embedded within an extracellular matrix . in this study , we noted greater biofilm forming ability in c. tropicalis as compared to c. albicans . as it increases the ability to withstand host defenses and also confers significant resistance to antifungal therapy . the formation of mature biofilm and subsequent production of extracellular matrix are strongly dependent on species , strain , and environmental condition . in candida , extracellular hydrolases play an important role in adherence , tissue penetration , invasion , and the destruction of host tissue . production of hydrolytic enzymes is one of the important attributes contributing to pathogenesis of candida . although candida is capable of producing exoenzymes , the quantity and potency of these enzymes are different . production of extracellular hydrolases varies among the species and also depends on the source or site of infection . enzyme coagulase binds plasma fibrinogen and activates a cascade of reactions that induce clotting of plasma . in our study , coagulase production was high in c. albicans as compared to nac spp . among nac spp . of various hydrolytic enzymes produced by candida spp . , phospholipases and proteinases are the most important . these enzymes hydrolyze phospholipids into fatty acids and also expose receptors on host cell membrane to facilitate adherence . in the present study , this could be one of the possible reasons for minimal or no ability of c. dubliniensis to cause invasive infections . screening of phospholipase activity in biofilm forming candida spp . can be used as an important parameter to differentiate invasive strains from noninvasive colonisers . proteinase facilitates candida invasion and colonization of host tissue by disruption of host membrane and by degrading important structural and immunological defense proteins . in our study , although c. albicans demonstrated increased capability of proteinase production , significant proteinase activity was also noted in nac spp . they lead to destruction of host erythrocytes and facilitate hyphal invasion in systemic candidiasis [ 4 , 9 ] . therefore , haemolysin is considered as important virulence contributing to pathogenicity of candida as it enables the pathogen to survive and persist in the host . in our study , haemolysin production was noted in both c. albicans and nac spp . the problem is compounded by aggressive immunosuppression ( acquired or induced ) , an ageing population , and the emergence of virulent and intrinsically resistant organisms . in this study , isolated from systemic candidiasis and isolates producing virulence factors like biofilm . though resistance to amphotericin b was less , this drug is often poorly tolerated and associated with acute infusion - related reactions and nephrotoxicity . resistance to azole group of antifungal agents can be due to quantitative or qualitative modifications of target enzymes , low access of the drug to the target , or a combination of these mechanisms . resistance to the azole group of antifungal agents is of concern because azoles like fluconazole are among the most commonly used antifungal agents for the treatment of candidiasis . these drugs are safe and effective for the treatment of all clinical types of candidiasis . the broad use of triazoles , especially fluconazole , has given rise to concerns regarding the emergence of resistance . therefore , the task of identifying , isolating , and evaluating therapies of candida species has now become part and parcel of clinical microbiology services . despite the advances in the field of medicine , infectious diseases continue to challenge mankind . during the last few decades , the spectrum of infections has undergone a drastic change ; organisms with minimal or no pathogenic role have emerged as potent pathogens and organisms once susceptible have become multidrug resistant . in our study , nac spp . were the predominant pathogens associated with various clinical types of candidiasis . therefore , it can be concluded that nac spp . have emerged as an important cause of infections . its isolation from clinical specimens can no longer be ignored as nonpathogenic isolate nor can it be dismissed as a contaminant .

the very nature of infectious diseases has undergone profound changes in the past few decades . fungi once considered as nonpathogenic or less virulent are now recognized as a primary cause of morbidity and mortality in immunocompromised and severely ill patients . candida spp . are among the most common fungal pathogens . candida albicans was the predominant cause of candidiasis . however , a shift toward non - albicans candida species has been recently observed . these non - albicans candida species demonstrate reduced susceptibility to commonly used antifungal drugs . in the present study , we investigated the prevalence of non - albicans candida spp . among candida isolates from various clinical specimens and analysed their virulence factors and antifungal susceptibility profile . a total of 523 candida spp . were isolated from various clinical specimens . non - albicans candida species were the predominant pathogens isolated . non - albicans candida species also demonstrated the production of virulence factors once attributed to candida albicans . non - albicans candida demonstrated high resistance to azole group of antifungal agents . therefore , it can be concluded that non - albicans candida species have emerged as an important cause of infections . their isolation from clinical specimen can no longer be ignored as a nonpathogenic isolate nor can it be dismissed as a contaminant .

atypical haemolytic uraemic syndrome ( ahus ) is a rare , life - threatening , chronic , genetic disease due to uncontrolled alternative pathway complement activation . in most cases , ahus is associated with mutations or polymorphisms in the genes cfh ( encoding complement factor h ) , accounting for 1129% , cd46 ( mcp , membrane cofactor protein ) 317% and cfi ( encoding complement factor i ) 217% . mutations in more than one complement gene have been identified in some patients , and nucleotide polymorphisms in cfh and mcp genes can modulate the risk of ahus in mutation carriers . the investigations performed showed gallbladder infection and microangiopathic haemolytic anaemia , thrombocytopaenia and acute kidney injury . she had a past medical history of kidney stones and one uneventful pregnancy , and no previous history of diarrhoea . initial investigation revealed the following : haemoglobin 8.3 g / l , platelet count 140 10/l and serum creatinine 3.8 mg / dl . the gallbladder infection was treated with broad - spectrum antibiotics with resolution of symptoms . despite this , after 2 days she became thrombocytopaenic ( 73 10/l ) , and serum creatinine rose to 4.8 mg / dl accompanied by haematuria and proteinuria . her course was complicated with fluid overload and oliguria , leading to the need to perform a brief period of haemodialysis . following nine sessions of pe over a period of 2 weeks , her parameters improved ( haemoglobin 12.4 g / dl , platelet count 220 10/l , lactate dehydrogenase ( ldh ) 1054 after 4 years , her renal function and platelet number are normal , but the patient has persistent microangiopathic haemolytic anaemia ( table 1 ) . despite analytical parameters of haemolysis ( ldh 1554 u / l , indirect bilirubin 1.54 mg / dl and absent haptoglobin ) , the patient has no signs or symptoms of organ injury / thrombosis , no hypertension , no proteinuria and the haemoglobin levels remain stable with no need for blood transfusion . during these 4 years , the patient had possible triggering events ( infection and cholecystectomy ) , with no relapse of ahus . in keeping with this , we performed a genetic analysis to investigate whether the patient carried some genetic abnormalities associated with ahus . mutation screening of cfh , mcp and cfi by sanger sequencing revealed two heterozygous mutations : a cfh ( c.3493 c > t , p.his1165tyr ) and an mcp ( c.1058 c > t , pala353val ) . the first amino acid substitution is not described , and the second is known as a disease mutation [ 4 , 5 ] . table 1.variations on biochemical parameters during the 4-year follow - uphospital dischargetime from hospital discharge1 month6 months12 months18 months3 years4 yearsserum creatinine ( mg / dl)2.81.10.70.50.60.50.7haemoglobin levels ( g / dl)12.012.411.711.210.611.310.4platelet count ( cells 10/l)190262253254269195193ldh ( u / l)90310547749428509721554serum haptoglobin ( g / l)<10<10<10<10<10upcr ( mg / mg)0.650.140.070.060.010.080.05complement c3 ( mg / dl)96.877.2complement c4 ( mg / dl)21.815.7homocysteine levels ( mol / l)10.0upcr : protein creatinine ratio on random urine sample . variations on biochemical parameters during the 4-year follow - up upcr : protein creatinine ratio on random urine sample . ahus is a challenging disease to manage with a relatively poor prognosis , as up to 65% of patients treated with pe will sustain permanent renal damage , have progression to end - stage renal disease ( esrd ) or die within 1 year . in the past years , it became evident that ahus is associated with mutations in proteins needed for regulation of the alternative complement pathway . because of the multiple genetic susceptibility factors involving plasma- and membrane - associated regulators , the rarity of combined - mutated patients and the need for a triggering event , it is difficult to predict the clinical course of ahus . the combined cfh / mcp mutations reported in our patient ( cfh p.his1165tyr/mcp pala353val ) have not been previously described . as previously reported , it seems that mcp or cfh mutations confer a predisposition to develop ahus rather than directly cause the disease , and a second hit is necessary for the full - blown manifestation of the disease , as in all mcp - mutated and 70% of cfh - mutated patients the onset of ahus was associated with an infectious event . our patient showed an impaired capacity to protect vascular endothelial cells from complement attack after the activation caused by the gallbladder infection that led to ahus presentation . after that , the clinical course was clearly distinct from patients with other cfh mutation and was similar to patients with mcp mutations described previously . it has been reported that the most severe prognosis is in the cfh mutation patients , with 70% reaching esrd , and that patients with mcp mutations have a relapsing course , but none have reached esrd in the first year . in cases of combined mutations carriers , the concomitant presence of cfh and mcp risk haplotypes significantly increased disease penetration and modified the prognosis . among patients with cfh mutations , the presence of mutations in other genes did not modify prognosis ; however , 50% of patients with combined mcp mutation developed esrd within 3 years from onset compared with 19% of patients with an isolated mcp mutation . these two mutations ( cfh p.his1165tyr/mcp pala353val ) have a benign phenotype prediction ( polyphen-2 ) , and mcp pala353val has polymorphic prevalence ( 1000 genomes project ) . despite that , their cumulative effect confers a background genetic that seems to be a risk for ahus ; however , their benign character explains the mild clinical course . indeed , the response to pe would not be expected to be effective for patients with mutations in mcp , a transmembrane protein that is not removed by this treatment , but patients with combined mutations achieved remission with pe similar to patients with single non - mcp mutations . the excellent response of our patient could be related to the replacement of cfh proteins with pe . in our patient , it seems that the mutated expressed proteins can not fully protect vascular endothelial cells from activated complement translated by the persistently haemolytic microangiopathic anaemia ; however , the regulation of the complement attack is enough to protect her from a relapse . in summary , we describe the first reported case of ahus with the combination of a previously described mcp mutation with a new cfh mutation associated with a rare clinical outcome ( persistent haemolysis without renal failure or any other clinical manifestations of endothelial damage or platelet activation ) . we may therefore speculate that combination of these frequent mutations will worsen the phenotype and could be a common but under - diagnosed phenomenon . the findings in this patient underscore the influence of different genetic abnormalities on disease presentation , response to therapy and outcome in ahus patients . the authors declare that the results presented in this article have not been published previously in whole or part . thrombotic microangiopathy : expanding genetic , clinical and therapeutic spectra and the need for worldwide implementation of recent advances .

atypical haemolytic uraemic syndrome ( ahus ) is a rare , life - threatening , chronic , genetic disease due to uncontrolled alternative pathway complement activation . in this report , we discuss the case of a heterozygous carrier of a mutation on both factor h and membrane cofactor protein , who persistently presents haemolytic anaemia without need for blood transfusions , normal platelet count , normal renal function and no signs or symptoms of organ injury due to thrombotic microangiopathy 4 years after the diagnosis of ahus .

mitochondrial disorders are a clinically heterogeneous group of disorders that are caused by defects in the mitochondrial atp production system . the previously published guidelines and diagnostic criteria for mitochondrial disorders illustrate the challenges of diagnosing patients with a suspected mitochondrial disorder ( bernier et al . 2002 ; haas et al . 2006 ; thorburn and smeitink 2001 ; walker et al . 1996 ; wolf and smeitink 2002 ) . given the extremely broad clinical spectrum and the relatively poor genotype phenotype correlation of mitochondrial genetic defects , it is usually preferred to perform a complete laboratory diagnostic work - up , and to evaluate the results in the context of the clinical phenotype and family history of the patient ( haas et al . laboratory diagnostic analysis of patients with a suspected mitochondrial disorder is a multi - disciplinary approach involving a broad spectrum of laboratory tests , including metabolite analysis , enzymatic measurements , and molecular genetic analysis ( haas et al . 2008 ) . in a minority of cases , those with a well - recognized phenotype , it might be possible to shortcut the diagnostic process and go directly to molecular genetic analysis ( finsterer et al . although time- and cost - effective when successful , there are drawbacks to this approach . importantly , there is a chance of finding a mutation that is irrelevant to the pathogenesis of the disease of the patient . it has been shown that the prevalence of pathogenic mtdna mutations is at least 1 in 200 , ( elliott et al . 2008 ) , while the prevalence of mtdna diseases or of being at risk to develop an mtdna disease has been estimated to be around 1 in 10,000 and 1 in 6,000 , respectively ( schaefer et al . 2008 ) . establishing the biochemical phenotype is not only important for candidate gene selection but also provides important information that may be required to interpret genetic test results . for these and other reasons , as outlined below , the biochemical examination of a muscle biopsy to evaluate the functional state of mitochondria is still regarded as the cornerstone of the diagnostic examination of patients with a suspected mitochondrial disease . prior to the biochemical examination of a muscle biopsy , metabolite analysis in blood and urine is usually performed . the results often provide important clues for the presence of a mitochondrial defect and , in some cases , can even give some indications for the location of the primary cause of the disease . defects in the mitochondrial energy - generating system may lead to high lactate levels in blood , urine , and/or csf due to reduced pyruvate utilization by the mitochondria . in the case of a respiratory chain defect , the lactate / pyruvate ratio in blood will increase because of a shift in the mitochondrial redox state ( trijbels et al . this will also affect the ratio of the ketone bodies 3-oh - butyrate and acetoacetate . in the case of a pyruvate dehydrogenase defect , the ratio between lactate and pyruvate may be normal while both metabolites are elevated . however , these features are neither very specific nor sensitive for use as a diagnostic test . amino acid analysis can reveal elevated alanine , as a product of the transamination of pyruvate by alanine aminotransferase . elevated levels of the branched chain amino acids could be an indication for an e3 deficiency ; an enzyme module shared by the branched chain amino acid dehydrogenase , 2-oxoglutarate dehydrogenase , and pyruvate dehydrogenase . generalized amino aciduria is sometimes seen as a result of renal tubulopathy caused by mitochondrial defects . in addition , increased levels of tca cycle intermediates , such as malate , succinate , 2-oxoglutarate , and fumarate can be found . elevated 2-oxoglutarate excretion is seen in patients with a 2-oxoglutarate deficiency , but also in other mitochondrial defects . elevated levels of several other metabolites can be found in mitochondrial patients , including ethylmalonate , sometimes seen in respiratory chain deficient patients but also in scad , madd , and in ethe1 defects , methylmalonate , e.g. , in succinate - coa ligase deficiency ( carrozzo et al . four types of 3-mg acidurias can be discriminated , including the classical 3-mga hydratase deficiency ( type i mga ) , barth syndrome ( type ii ; taz defect ) , costeff syndrome ( type iii ; opa1 defect ) , and the group of type iv mgas which includes several mitochondrial disorders , such as those due to genetic defects in polg , sucla2 , and tmem70 ( wortmann et al . in addition , this group contains patients with megdel ( 3-methylglutaconic aciduria , sensory - neural deafness , encephalopathy , and leigh - like syndrome ) association ( wortmann et al . biochemical diagnostic examination of tissue and cell samples from mitochondrial patients includes measurements of enzyme activities of the oxidative phosphorylation ( oxphos ) system , consisting of complex i ( ec 1.6.5.3 ) , complex ii ( ec 1.3.5.1 ) , complex iii ( ec 1.10.2.2 ) , complex iv ( ec 1.9.3.1 ) , and complex v ( ec 3.6.1.3 ) ( fig . 1 ) . assays to quantify oxphos enzyme activities are usually based on spectrophotometry ( benit et al . 2006 ; janssen et al . 2007 ; kirby et al . 2007 ; rustin et al . table 1 gives an overview of the assays that are currently operational in our center . alternatively , or in addition , assays that determine the amounts of oxphos complexes are performed , such as blue native gel electrophoresis followed by western blot analysis ( schagger and von jagow 1991 ) . a drawback of the latter approach could be that catalytic defects can be missed , although for complex i it has been shown that there is often a correlation between residual enzyme activities and the amounts of holo - complex i ( koopman et al . 2008 ) . another way to examine oxphos enzymes is by colorimetric in - gel measurements of enzyme activities after blue - native gel electrophoresis , or other colorimetric assays based on a similar principle ( van coster et al . for complex i , these assays makes use of an electron acceptor that changes color upon reduction ( e.g. , nitrotetrazolium blue ) , instead of analogues of the natural substrate coenzyme q that are used in spectrophotometric complex i assays ( benit et al . this means that the colorimetric assay measures only the activity of the nadh dehydrogenase module of complex i , instead of the entire nadh : ubiquinone oxidoreductase activity that is measured in spectrophotometric assays . moreover , in - gel activity assays are not designed to provide highly quantitative information , and therefore mild deficiencies of oxphos enzymes may be difficult to detect . this also holds true for other gel - based assays to quantify enzyme activities or amounts , such as western blot assays . therefore , most diagnostic centers prefer to make use of spectrophotometric enzyme assays . at this moment , there is no universal assay design for spectrophotometric quantification of oxphos enzyme activities . assays differ with respect to buffer conditions , reaction temperatures , substrate concentrations , and other assay ingredients , such as bovine serum albumin or salts . nevertheless , for most of these assays , the principles on which the different protocols are based are similar . the use of different assay protocols can make an inter - laboratory comparison of test results difficult . for both ethical and practical reasons , a quality control scheme involving the analysis of patient - derived material , including tissue samples with oxphos deficiencies , seems impossible . indeed , attempts to perform a laboratory quality assessment have been hampered by the limited availability of patient - derived muscle samples , and therefore have been done with animal muscle tissue ( gellerich et al . as each laboratory has established its own reference ranges to which diagnostic test results are related , it is questionable if the use of different assay protocols could be a major cause for possible misdiagnoses . substrates are shuttled into mitochondria and are metabolized in the matrix in the tca cycle , during which reduction equivalents nadh and fadh2 are formed . these are oxidized by complex i ( ci ) and ii ( cii ) of the respiratory chain , and electrons coming from nadh and fadh2 are shuttled through complexes i or ii , coenzyme q , complex iii ( ciii ) , cytochrome c , and complex iv ( civ ) to molecular oxygen . during the electron transport process , protons are pumped out of the mitochondrial matrix to the intermembrane space by complexes i , iii , and iv . the electrochemical gradient thus formed is used by complex v ( cv ; f1/f0 atpase ) to convert adp into atp . the intramitochondrial atp / adp ratio is balanced by shuttling adp and atp in and out of the mitochondrial matrix by the adenosine nucleotide transporter ant ( not shown here ) . for diagnostic purposes , the mitochondrial energy generating system can be analyzed in several ways . by using c labeled pyruvate , malate , or succinate , the conversion rates of these substrates can be determined by measuring the amounts of released co2 as parameters for the overall capacity of the mitochondrial energy - generating system ( janssen et al 2006 ) . a similar parameter is the oxygen consumption rate in the presence of different substrates , e.g. , pyruvate + malate , and which can be measured by respirometry or by fluorescent probes ( jonckheere et al 2010 ; rustin et al 1994 ) . the rate of synthesis of the end product atp in the presence of different mitochondrial substrates is also representative for the capacity of the mitochondrial energy - generating system ( janssen et al 2006 ) . in addition to these flux - parameters of the mitochondrial energy - generating system , individual enzymes can be determined by spectrophotometric and radiochemical assaystable 1overview of the assays currently in use in the nijmegen center for mitochondrial disordersenzymesubstrateassay conditionsread - outcomplex i0.2 mmol / l nadh25 mm phosphate buffer , ph 7.61 mol / l rotenone - sensitive dcip reduction at 600 nm70 mol /l coenzyme q10.35% / l succinate80 mm phosphate buffer , ph 7.85 mmol / l malonate - sensitive dcip reduction at 600 nm80 mol / l decylubiquinone0.2 % bsa0.2 mmol / l atp80 mol / l dcip2.0 mmol / l edta0.3 mmol / l sodium azidecomplex iii300 mol / l decylubiquinol50 mm phosphate buffer , ph 7.8cytochrome c reduction at 550 nm50 mol / l cytochrome c1.0 mmol / l edta3.0 mmol / l sodium azide0.04% tween20complex iv70 mol / l reduced cytochrome c30 mm phosphate buffer , ph 7.4cytochrome c oxidation at 550 nmcomplex v3 mmol / l atp25 mm phosphate buffer , ph 8.010 mol / l oligomycin - sensitive nadh oxidation at 340 nm0.2 mmol / l egta5 mg / l ap5a0.3% bsa250 mmol / l sucrose7.5 mmol / l mgcl250 mmol / l kcl0.1 mmol / l phosphoenolpyruvate2.5 u / ml lactate dehydrogenase1.5 u / ml pyruvate kinasethe assays are performed at 37c . the samples that are tested with these assays include isolated mitochondria from muscle and fibroblasts . in addition , more crude preparations from muscle , such as 10% homogenates in seth - buffer ( janssen et al 2006 ) , and the 600-g supernatants of these homogenates , are measured in this way . extracts from heart , liver , brain , and chorionic villi are examined in a similar manner . substrates are shuttled into mitochondria and are metabolized in the matrix in the tca cycle , during which reduction equivalents nadh and fadh2 are formed . these are oxidized by complex i ( ci ) and ii ( cii ) of the respiratory chain , and electrons coming from nadh and fadh2 are shuttled through complexes i or ii , coenzyme q , complex iii ( ciii ) , cytochrome c , and complex iv ( civ ) to molecular oxygen . during the electron transport process , protons are pumped out of the mitochondrial matrix to the intermembrane space by complexes i , iii , and iv . the electrochemical gradient thus formed is used by complex v ( cv ; f1/f0 atpase ) to convert adp into atp . the intramitochondrial atp / adp ratio is balanced by shuttling adp and atp in and out of the mitochondrial matrix by the adenosine nucleotide transporter ant ( not shown here ) . for diagnostic purposes , the mitochondrial energy generating system can be analyzed in several ways . by using c labeled pyruvate , malate , or succinate , the conversion rates of these substrates can be determined by measuring the amounts of released co2 as parameters for the overall capacity of the mitochondrial energy - generating system ( janssen et al 2006 ) . a similar parameter is the oxygen consumption rate in the presence of different substrates , e.g. , pyruvate + malate , and which can be measured by respirometry or by fluorescent probes ( jonckheere et al 2010 ; rustin et al 1994 ) . the rate of synthesis of the end product atp in the presence of different mitochondrial substrates is also representative for the capacity of the mitochondrial energy - generating system ( janssen et al 2006 ) . in addition to these flux - parameters of the mitochondrial energy - generating system , individual enzymes can be determined by spectrophotometric and radiochemical assays overview of the assays currently in use in the nijmegen center for mitochondrial disorders the assays are performed at 37c . the samples that are tested with these assays include isolated mitochondria from muscle and fibroblasts . in addition , more crude preparations from muscle , such as 10% homogenates in seth - buffer ( janssen et al 2006 ) , and the 600-g supernatants of these homogenates , are measured in this way . extracts from heart , liver , brain , and chorionic villi are examined in a similar manner . the interpretation of enzymatic measurements is not as straightforward as for many other metabolic enzyme disorders . for the oxphos enzymes , there is a only a small margin between patient ranges and control ranges ( rustin et al . therefore , activities around the lowest reference value can not always be considered as definite proof of either a normal or deficient enzyme activity , and , as mentioned before , additional observations ( mtdna sequence , metabolites , clinical features , etc . ) should be included in the evaluation of the enzyme test results . it can be hypothesized that one of the reasons for this problem is the complexity of the oxphos enzymes , which are multi - subunit enzymes encoded by both mitochondrial and nuclear genomes , except for complex ii , which exclusively consists of nuclear encoded subunits . it seems likely that the genetic make - up of the entire oxphos system and of the individual complexes could modulate the effect of single subunit mutations . as there is no universal correlation between the severity of the enzyme deficiency and the severity of the clinical phenotype , detection of even very mild deficiencies is very important . ratios between mitochondrial enzymes give a much narrower range of normal values compared to activities expressed on the basis of protein content of the sample ( rustin et al . often , citrate synthase is used as a reference enzyme , although ratios between oxphos enzymes and tricarboxylic acid ( tca ) cycle enzymes are less constant compared to ratios within the oxphos system ( rustin et al . furthermore , a moderate increase of the activity of citrate synthase is frequently observed in tissues with an oxphos deficiency . for neonates , results should be interpreted very cautiously as it has been shown that there are age - dependent differences in oxphos enzyme activities in very early childhood ( honzik et al . table 2 gives an overview of the results of the biochemical diagnostics in nijmegen for 2009 . this shows that complex i and iv deficiencies are the most frequently encountered oxphos deficiencies . for complex i , an additional measurement of complex i + complex iii ( nadh : cytochrome c oxidoreductase ) can be performed . in addition , as this is a coenzyme q - dependent reaction , this activity is also reduced in the case of a coq biosynthesis defect . similarly , the activity of complex ii + iii is also coenzyme q - dependent and reduced in the case of a coq deficiency . further indications for a coq deficiency can be obtained by addition of a coq analogue to the complex ii + iii enzyme assay , which will result in normalization of the activity in the case of a coq deficiency ( lopez et al . both the combined complex i + iii activity and the ii + iii activity are less sensitive to detect complex iii deficiencies , so these assays are not a good substitute for complex iii measurements and should only be used to obtain additional evidence for deficiencies of complex i , ii , or coenzyme q ( taylor et al . 1993 ) . coenzyme q can also be measured directly by hplc in muscle , blood , or other sample types ( duncan et al . in addition to the oxphos enzymes , activities of pyruvate dehydrogenase or tca cycle enzymes can be considered in the case of a suspected mitochondrial disorder ( bonnefont et al . a particular feature of defects in the tca cycle enzyme succinate - coa ligase is depletion of mtdna ( carrozzo et al . patients with a defect in this enzyme often display a characteristic combination of clinical features , including early hypotonia , dystonia , and sensori - neuronal deafness ( morava et al . the mechanism leading to mtdna depletion in succinate - coa ligase deficiency is poorly understood . it is assumed that it involves the mitochondrial deoxynucleotide salvage enzyme nucleoside diphosphate kinase , which has been shown to physically interact with succinate - coa ligase ( kavanaugh - black et al . 1994 ) . as a consequence of mtdna depletion , patients with mutations in the succinate : coa ligase -subunit sucla2 or -subunit suclg1 can show deficiencies of oxphos enzymes complexes i , iii , and iv in muscle tissue . table 2overview of the results of mitochondrial biochemical diagnostics in nijmegen in the years 20052009parameter% reducedatp production39complex i8complex ii2complex iii3complex iv5complex v1combination of enzymes7atp production ( normal oxphos)13the table gives the percentage of fresh muscle samples that showed an activity below the lowest control value . results from frozen muscle samples are not included in this table . in total , 1,406 fresh muscle samples were examined in nijmegen in 20052009 . of these , 39% showed a reduced rate of atp production from the oxidation of pyruvate and malate . approximately 2/3 of the samples with a reduced atp production rate also showed a reduced activity of one or more oxphos enzymes . the figures presented here are similar to those reported in 2000 , only in that case complex v and atp production were not included ( loeffen et al . 2000 ) . the reason for a reduced atp production rate in the remaining 30% of the patients with normal oxphos and pdhc enzyme activities is either a secondary mitochondrial dysfunction or an unknown mitochondrial defect , such as enzymes and transporters for which a diagnostic assay is not ( yet ) available . the possibility of unknown defects is quite likely , given the total number of proteins / genes involved in mitochondrial energy metabolism and given the fact that new mitochondrial defects are still being discovered very regularly . this table should not be regarded as illustrative for the total group of patients with a suspected mitochondrial disorder , as not all patients have been tested for enzyme activities in muscle . moreover , samples were received from many different hospitals in different countries , and the indications for doing a muscle biopsy are not the same in each hospital . overview of the results of mitochondrial biochemical diagnostics in nijmegen in the years 20052009 the table gives the percentage of fresh muscle samples that showed an activity below the lowest control value . of these , 39% showed a reduced rate of atp production from the oxidation of pyruvate and malate . approximately 2/3 of the samples with a reduced atp production rate also showed a reduced activity of one or more oxphos enzymes . the figures presented here are similar to those reported in 2000 , only in that case complex v and atp production were not included ( loeffen et al . 2000 ) . the reason for a reduced atp production rate in the remaining 30% of the patients with normal oxphos and pdhc enzyme activities is either a secondary mitochondrial dysfunction or an unknown mitochondrial defect , such as enzymes and transporters for which a diagnostic assay is not ( yet ) available . the possibility of unknown defects is quite likely , given the total number of proteins / genes involved in mitochondrial energy metabolism and given the fact that new mitochondrial defects are still being discovered very regularly . this table should not be regarded as illustrative for the total group of patients with a suspected mitochondrial disorder , as not all patients have been tested for enzyme activities in muscle . moreover , samples were received from many different hospitals in different countries , and the indications for doing a muscle biopsy are not the same in each hospital . therefore , a muscle biopsy provides an optimal opportunity to detect possible aberrations in the functional state of mitochondria . the biochemical analysis of muscle mitochondria can be performed on frozen or on freshly collected muscle tissue . it should be noted that analysis of complex v in frozen muscle tissue is considered to be less reliable than in fresh muscle tissue ( kirby et al . 2007 ) . for optimal preservation of mitochondrial enzymes , it is important to snap - freeze the sample immediately after collection . a fresh muscle sample needs to be collected in cooled ( not frozen ) transport buffer and should be processed within 23 h after collection ( janssen et al . fresh muscle has the advantage that , in addition to the measurement of individual mitochondrial enzymes , measurements on the entire mitochondrial energy - generating system ( megs ) can be performed ( fig . 1 ) . these measurements can include the analysis of mitochondrial oxygen consumption in the presence of different combinations of mitochondrial substrates , such as pyruvate , malate , and glutamate ( rustin et al . alternatively , the oxidation rates of radio - labeled substrates can be determined , such as the decarboxylation of radio - labeled pyruvate in the presence of non - labeled co - substrates ( janssen et al . in addition , the atp production rate in intact mitochondria can be determined as a measure for the megs capacity ( janssen et al . 2006 ) . by examining the megs in the presence of different combinations of substrates , co - substrates , co - factors , and inhibitors , a detailed picture of the megs for example , a reduced pyruvate oxidation rate in the presence of malate , combined with a normal to mildly reduced pyruvate oxidation rate in the presence of carnitine is an indication for an oxphos defect ( hoefs et al . 2008 ) , while equally reduced rates of both types of pyruvate oxidations are an indication for a pyruvate dehydrogenase complex ( pdhc ) deficiency ( janssen et al . this is not trivial , as in several patients with a complex i deficiency in muscle tissue , a mild , secondary pdhc deficiency has been observed ( unpublished observations , and loeffen et al . 1998 ; van den heuvel et al . reduced pyruvate oxidation rates have also been observed in a mitochondrial pyruvate transport defect ( brivet et al . reduced glutamate + malate oxidation rates have been seen in muscle of patients with glutamate carrier deficiencies ( molinari et al . a reduced pyruvate oxidation rate that is normalized by addition of an uncoupler , such as fccp , indicates a defect in complex v , the adenine nucleotide translocator , or the phosphate transporter ( jonckheere et al . the megs assays described above not only provide in - depth information on the mitochondrial functional state , it has also been shown that these assays are more sensitive to detect mitochondrial defects , compared to measurements of individual oxphos enzyme activities ( janssen et al . 2008 ) . in the case of a patient with a clinical phenotype with profound involvement of tissues other than muscle many cases have been described in which the diagnostic examination of a heart or liver biopsy has lead to the diagnosis ( garcia - cazorla et al . for example , for the mtdna depletion syndromes with predominant liver involvement , e.g. , due to defects in mpv17 , dguok , or polg ( mandel et al . when a tissue biopsy is performed , it is important to collect a skin biopsy at the same time , to obtain fibroblasts for possible additional biochemical and genetic studies . in addition to the added value of fibroblasts in the diagnostic evaluation of patients , fibroblasts can be stored and retested when desired , e.g. , when new diagnostic possibilities emerge in the future . there are several other benefits of fibroblast testing in the diagnostic evaluation of patients with a suspected mitochondrial disorder ( cameron et al . fibroblast oxphos enzyme activities provide information that is helpful for the selection of candidate genes for molecular genetic analysis , even if enzyme activities are normal . for example , in patients with reduced oxphos enzymes in muscle and normal enzyme activities in fibroblasts , a genetic defect might be present in one of the nuclear genes causing mtdna depletion , for example polg ( de vries et al . it should be noted that normal enzyme activities have also been observed in muscle of several polg patients ( de vries et al . the main reason for this is tissue / cell - type - specific differences in heteroplasmy of mtdna mutations . although many nuclear defects will give rise to reduced enzyme activities in fibroblasts , there are several exceptions . in addition to polg , other nuclear genetic defects causing mtdna depletion syndromes , such as dguok and mpv17 , often show normal enzyme activities in fibroblasts ( mandel et al . 2006 ) . the combination of complex i , iii , iv , and/or v deficiency in muscle and normal oxphos enzymes in fibroblasts is suggestive for involvement of mtdna depletion , deletions / rearrangements , or point mutations ( van den heuvel et al . 2004 ) . for mutations in two aminoacyl - trna synthetase genes , dars2 and rars2 , normal or mild oxphos deficiencies in fibroblasts , respectively , have been reported , while for rars2 , it has been shown that oxphos enzyme activities in muscle vary from normal to severely reduced ( edvardson et al . fibroblast enzyme deficiencies are common in nuclear defects of genes encoding structural components and assembly factors of the oxphos system , and also for defects in genes encoding proteins involved in mitochondrial translation ( coenen et al . 2004 ; miller et al . it should be noted that a limited number of cases have been reported in which a nuclear genetic defect of a structural respiratory chain building block did not result in an enzyme deficiency of the corresponding enzyme , e.g. , complex i ( benit et al . 2001 ) , complex ii ( taylor et al . 1996 ) , and complex iv ( vesela et al . 2004 ) , although according to the experiences we have had in nijmegen , these appear to be quite exceptional cases . occasionally , patients with normal enzyme activities in muscle show reduced enzyme activities in cultured fibroblasts , in particular for complex i and pdhc ( unpublished observations ) . confirmation of enzyme deficiencies in fibroblasts of the oxphos - deficient index case in families in which the pathogenic genetic defect has not ( yet ) been uncovered , is required before reliable prenatal testing by measuring oxphos enzymes in chorionic villi or amniocytes can be performed ( niers et al . , prenatal diagnosis is performed by measuring respiratory chain or pdhc enzyme activities in chorionic villi , provided that the diagnostic examination of the index case has revealed a clearly detectable enzyme deficiency in fibroblasts and muscle ( or other tissue ) , and that mtdna mutations have been excluded in mtdna from a sample in which the enzyme deficiency has been detected ( niers et al . in addition to the diagnostic applications , fibroblasts provide a model system to study the pathogenesis of novel genetic defects , for example by performing complementation experiments . atp synthesis , oxygen consumption , and substrate oxidation rates can all be measured in fibroblasts ( cameron et al . , cells are permeabilized with digitonin , which allows substrates , adp , and other assay ingredients to reach the mitochondria and enter the matrix via the mitochondrial transporters . in this way , mitochondrial atp production , substrate oxidation and respiration rates can be examined in a controlled manner , providing additional information on the biochemical phenotype of patients . accurate diagnostic biochemical testing of tissue and cell samples can be hampered by many different circumstances . as with many other types of diagnostic laboratory tests , a frequent cause for problems is sample collection and handling , for example muscle samples that were thawed during transport , or needle muscle biopsies contaminated with lidocaine . in experienced diagnostic centers where muscle biopsies are performed and analyzed on a daily basis , these problems are not likely to occur . in addition to these practical issues , there are also several other reasons for difficulties in reaching a diagnosis by muscle biochemistry . these can include secondary mitochondrial dysfunction arising from other metabolic defects , e.g. , due to toxicity of accumulating toxic metabolites , such as propionyl - coa ( schwab et al . 2006 ) or sulfide ( tiranti et al . 2009 ) , or due to drug effects , such as valproate ( haas et al . 1981 ) . a diagnosis can be missed when relying solely on a single diagnostic test , e.g. , biochemical testing of a muscle biopsy in patients with hepatocerebral mtdna depletion syndromes , as outlined in the previous paragraph . also , in the case of mtdna disorders , a normal muscle biochemistry can sometimes be observed . this is usually due to a relatively low percentage of heteroplasmy of the pathogenic mtdna mutation . for the m.3243g > a melas mutation , we have shown that there are different thresholds for different biochemical defects , such as complex i deficiency and reduced atp production rate ( janssen et al . 2008 ) . in practice , mtdna analysis and muscle biochemistry are often performed in parallel , as a normal biochemistry does not exclude a mtdna mutation , and vice versa , and , in addition , as biochemical observations can be very helpful in the interpretation of mtdna sequence analysis results , especially when unknown mtdna variants are encountered . in general , most of the potential pitfalls mentioned here can be avoided by performing a complete laboratory diagnostic examination , including analysis of blood and urine metabolites , muscle and fibroblast biochemistry , muscle histology , mtdna , and other candidate genes . the combined results of these laboratory tests should be interpreted in the context of the clinical phenotype of the patient ( haas et al . the number of mitochondrial proteins in mammals has been estimated to be between 1,130 and 1,500 ( meisinger et al . 2008 ; pagliarini et al . 2008 ) . to date , pathogenic defects have been found in only a fraction of these proteins . given the number of genes encoding mitochondrial proteins and the considerable subgroup of patients with a mitochondrial disease phenotype in whom , despite new developments in diagnostic testing , it is still not possible to establish a definite diagnosis ( kirkman et al . 2008 ) , it is likely that more defects leading to a mitochondrial disorder will be found in the mitochondrial proteome in the future . the analysis of fresh muscle biopsies has led to the identification of several genetic defects that are outside the classical oxphos genetic defects . these include defects in mitochondrial carriers , e.g. , glutamate and phosphate carriers ( mayr et al . 2007 ; molinari et al . 2005 ; wibom et al . 2009 ) . these studies have clearly demonstrated the added value of fresh muscle sample analysis , as it has guided the search for the specific genetic defects that caused the observed biochemical abnormalities and clinical phenotypes of the patients . it is likely that additional pathogenic mitochondrial carrier defects will be found in the future . to date , more than 20 different mitochondrial functional carrier systems have been identified , and there are many other carriers of which the exact function remains to be established ( palmieri 2008 ) . genes encoding proteins with a role in mitochondrial transcription and translation are another likely group of candidate genes . these include the mitochondrial aminoacyl - trna synthetases , in which only two defects have been found thus far ( edvardson et al . 2007 ; scheper et al . 2007 ) . several other groups of candidate genes can be identified or postulated , including those involved in mtdna maintenance ( copeland 2008 ) , trna modification ( bykhovskaya et al . 2004 ) , mitochondrial ribosomal assembly ( miller et al . 2004 ) , nucleoid formation ( hoffmann et al . 2009 ) , enzymes regulating the activity of key enzymes in the megs ( cameron et al . 2009 ; phillips et al . 2009 ) , and several other cell biological processes required for mitochondrial atp production . for all these mitochondrial defects , functional tests could have an important added value in the biochemical diagnosis of mitochondrial disorders in the future . in the near future , developments in next generation sequencing technologies ( mardis 2008 ) will make it possible to include high throughput sequence analysis in the diagnostic work - ups of mitochondrial patients . the first applications of this technology in mitochondrial diagnostics have already been published ( vasta et al . for example , for complex i there are more than 50 different nuclear genes encoding for structural subunits and assembly proteins , and many other genes of which it could be postulated that a defect might lead to complex i deficiency . screening of this many genes using conventional sequencing techniques is an expensive and time - consuming effort . therefore , there is no doubt that high throughput molecular genetic assays will increase the possibilities for diagnostic testing of mitochondrial disorders in the near future . it can be expected that there will be a greater demand for more detailed functional studies to confirm the pathogenicity of new molecular genetic variants . this is already the case for patients in with unknown mtdna variants detected by sequence analysis of the mitochondrial genome , e.g. , by mtdna sequencing arrays ( van eijsden et al . nowadays , the complete sequence analysis of the 16.5-kb mitochondrial genome is routinely being performed in many diagnostic centers . often , the prediction of the pathogenicity of unknown genetic variants is not possible on the basis of sequence information alone . usually , the level of heteroplasmy of the mtdna variant is checked in different tissues of the patient and , in addition , in family members in the maternal lineage . should this not provide a clear answer to the question on pathogenicity of mtdna variants , functional testing of mtdna variants is possible by creating transmitochondrial cybrids ( king and attardi 1989 ) , in which the observed mitochondrial function can provide additional diagnostic information . it is expected that this problem of uncharacterized genetic variants will be even greater for results of high throughput nuclear genomic sequencing data . in a recent study in which 362 genes were sequenced in two patients ( vasta et al . 2009 ) , it was found that , after extensive bioinformatical analysis of all genetic variants that were identified , two to three genetic variants remained for which it was not possible to predict possible pathogenicity without follow - up functional testing . it is likely that these figures will improve in time , as bioinformatical tools will improve in time and databases are continuously being filled with new genetic variants . nevertheless , there will be an increasing demand for a more detailed functional analysis of individual genetic variants , in order to confirm the diagnosis in individual patients . the combination of a sophisticated bioinformatical approach with detailed functional analysis of individual proteins and pathways will be required to unravel the mechanisms behind protein malfunction and pathogenesis of mitochondrial disorders ( huynen et al . 2009 ) . in addition , detailed information on the biochemical phenotype prior to high throughput genetic testing will be of benefit to the selection of groups of candidate genes and to bioinformatical evaluation of genetic variants . for example , in the case of a proven complex i deficiency , the high - throughput genetic examination could focus on complex i genes . therefore , the biochemical evaluation of mitochondrial functional state will continue to play an important role in the diagnostic examination of mitochondrial patients in the foreseeable future .

establishing a diagnosis in patients with a suspected mitochondrial disorder is often a challenge . both knowledge of the clinical spectrum of mitochondrial disorders and the number of identified disease - causing molecular genetic defects are continuously expanding . the diagnostic examination of patients requires a multi - disciplinary clinical and laboratory evaluation in which the biochemical examination of the mitochondrial functional state often plays a central role . in most cases , a muscle biopsy provides the best opportunity to examine mitochondrial function . in addition to activity measurements of individual oxidative phosphorylation enzymes , analysis of mitochondrial respiration , substrate oxidation , and atp production rates is performed to obtain a detailed picture of the mitochondrial energy - generating system . on the basis of the compilation of clinical , biochemical , and other laboratory test results , candidate genes are selected for molecular genetic testing . in patients in whom an unknown genetic variant is identified , a compatible biochemical phenotype is often required to firmly establish the diagnosis . in addition to the current role of the biochemical analysis in the diagnostic examination of patients with a suspected mitochondria disorder , this report gives a future perspective on the biochemical diagnosis in view of both the expanding genotypes of mitochondrial disorders and the possibilities for high throughput molecular genetic diagnosis .

drug - resistant cells may express one or more energy - dependent transporters like the multidrug resistance gene ( mdr1 ) which detect and eject anticancer drugs from cells [ 1 , 2 ] . mechanisms including secondary mutations in drug targets or parallel pathways , insensitivity to drug - induced apoptosis [ 3 , 4 ] , and induction of drug - detoxifying proteins also play a role in acquired multidrug resistance ( mdr ) . although some attempts were successful in vitro , these strategies were not successfully implemented in vivo . these data suggest there are additional , perhaps unknown mechanisms , which need to be identified and targeted for successful reversal or prevention of drug resistance . our laboratory has hypothesized a cytoprotective relationship between drug - resistant and drug - sensitive cells within drug - resistant tumors . we previously demonstrated a mechanism of cytoprotective signaling between drug - resistant and drug - sensitive neuroblastoma , osteosarcoma , and breast cancer cells . a cytokine cdna array identified midkine ( mk ) as significantly upregulated in drug - resistant cells and mk consequently it is a small cysteine - rich protein which belongs to the family of heparin - binding proteins and is highly expressed during midgestation in mouse embryogenesis . mk has been reported to play important roles in the survival , growth , and migration of many cells , which may contribute to oncogenesis and tumor progression . enriched mk expression has been demonstrated in cancers including wilms ' tumor , neuroblastoma , esophageal , pancreatic , lung , and breast cancers while its expression is usually low in normal human adult tissues [ 810 ] . in addition , evidence suggests that increased expression of mk is associated with poor prognosis in oral squamous cell carcinoma , neuroblastoma [ 12 , 13 ] , and bladder carcinoma . kang et al . used microarray analysis to assess global gene expression in gastric cancer cell lines with acquired drug resistance to 5-fluorouracil , doxorubicin , and cisplatin ( cddp ) . they reported that mk expression was enhanced in all drug - resistant cell line studies , suggesting an important role in drug resistance . qi et al . reported that mk had cytoprotective activity , preventing cddp - induced apoptotic cell death through enhancement of bcl-2 expression in both murine kidney and cultured wilms ' tumor cells ( g401 cells ) . these findings support our hypothesis that intercellular cytoprotective signals , such as the one mediated by mk , originate from cells with acquired drug resistance and protect neighboring drug - sensitive cells , thus contributing to chemotherapy resistance . in the present study , special emphasis was placed on determining whether the cytoprotective action of mk observed in vitro also occurs in vivo using a murine model xenograft . all materials utilized in this study were purchased from the following companies : dulbecco 's modified eagle 's medium ( dmem ) ( mediatech , inc . , pittsburgh , pa ) ; fetal bovine serum ( fbs ) ( hyclone , logan , ut ) ; doxorubicin ; 3-(4,5-dimethyl-2-thiazolyl)2,5-diphenyl tetrazolium bromide ( mtt ) ( sigma , st louis , mo ) ; antibodies to midkine ( r&d systems , minneapolis , mn ) ; antibody to -actin ( sigma , st . louis , mo ) ; secondary antibodies conjugated to horseradish peroxidase ( promega corporation , madison , wi ) ; enhanced chemiluminescence reagents ( pierce corp . , rockford , il ) ; immobilon - p transfer membrane for western blot ( millipore , bedford , ma ) ; nitrocellulose membranes ( bio - rad laboratories , inc , hercules , california ) ; tunel assay kit ( roche diagnostics corporation , indianapolis , in ) . human neuroblastoma sk - n - sh and osteosarcoma sjsa-1 ( osa ) cells were purchased from atcc ( rockville , ma ) and grown in dmem supplemented with 10% fbs at 37c in 5% co2 atmosphere . the ic50 for sk - n - sh wild type ( sk - n - sh wt ) cells was determined using the mtt assay . the generation of doxorubicin resistant sk - n - sh cells ( sk - n - sh doxr ) was achieved by incubating parental cell lines with incrementally increasing concentrations of doxorubicin ranging from 10 to 10 m over a period of 6 months . cells were deemed resistant after surviving 10 passages in a doxorubicin concentration of 10 m , approximately 2 log above the ic50 of the parental cell line . sk - n - sh gfp cells ( sk - n - sh gfp - wt ) were generated using plpcx - egfp retrovirus and selected with puromycin . human mk overexpressed sk - n - sh cells ( sk - n - sh hmk ) were derived as previously reported . the cytoprotective effect of sk - n - sh doxr cells on sk - n - sh wt cells was quantitatively evaluated using a co - culture system . the falcon cell culture insert system ( bd falcon , franklin lakes , nj ) was used to allow sk - n - sh wt cells to be co - cultured with either sk - n - sh wt or sk - n - sh doxr cells . for each co - culture setup , the two cell types were grown in separate compartments without physical contact . small molecules were able to diffuse through the media between compartments by traversing a 0.4 m membrane . cells were seeded and grown for 72 hours prior to being treated with doxorubicin at concentrations of 0 , 10 , or 10 m for 24 hours . whole cell lysates , culture medium , or cell membranes were isolated and subjected to electrophoresis . whole cell lysates were isolated from cells grown to 80% confluence in 25 cm flasks . cells were collected and lysed in a lysis buffer composed of 50 mm hepes ph 7.4 , 150 mm nacl , 100 mm naf , 1 mm mgcl2 , 1.5 mm egta , 10% glycerol , 1% triton x100 , 1 g / ml leupeptin , and 1 mm phenyl - methyl - sulfonyl - fluoride . culture medium was collected from cells grown to 80% confluence in 25 cm flasks . initially grown in dmem supplemented with 10% fbs , cells were then serum starved for 48 hours in 2 ml of low fetal bovine serum culture medium . cultured medium was then collected and frozen at 20c prior to being subjected to western blot . protein concentrations were determined for whole cell lysates and cell membrane fractions , and equal quantities of protein were separated by electrophoresis on a 420% sds - page gel and transferred to nitrocellulose membranes . the volume of medium loaded on the gel was normalized based on cell count in the flask prior to medium collection . nitrocellulose membranes were incubated with antibodies for proteins of interest ( anti - mk , anti - p - glycoprotein or -actin ) and subsequently incubated with appropriate secondary antibody conjugated to horseradish peroxidase . the nucleotide sequences for the human mk genes were obtained from the ncbi sequence viewer program . the human mk sirna was based on sequence 229 to 249 and consisted of the following nucleotides : 5-aagaaggagtttggagccgag-3. on the day before transfection , 3 10 cells were seeded into 6-well plates and grown in 2.5 ml of dmem supplemented with 10% fetal bovine serum . after 24 hours in culture , 25 l of 20 m stock solution of sirna duplexes was transfected into cells using genesilencer sirna transfection reagent according to the manufacturer 's protocol ( gene therapy systems , san diego , ca ) . cells were maintained in culture for an additional 96 hours before measuring expression of the silenced molecules by western blot and elisa assay . cells were seeded in 96 well plates and incubated with logarithmic concentrations of doxorubicin , ranging from 10 to 10 m . cell proliferation was quantitatively estimated by use of a colorimetric assay using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide ( mtt ) . mtt ( 10 l of 5 mg / ml solution ) was added to each well of the plate and incubated for 4 hours at 37c . the cells were then solubilized by the addition of 100 l of 10% sds/0.01 mmol the absorbance of each well was determined in an elisa plate reader using an activation wavelength of 570 nm and a reference wavelength of 650 nm . cell viability in the presence of different doses of doxorubicin was determined by comparison with untreated control cells . the animal protocol used in this study was approved by the animal care and use committee of the lurie children 's hospital of chicago research center ( no . severe combined immunodeficiency ( scid ) or nude mice ( charles river laboratories , wilmington , ma ) , approximately 46 weeks of age and weighing approximately 30 g received subcutaneous ( sc ) tumor implants performed using various ratios of gfp expressing sk - n - sh wild type cells ( sk - n - sh gfp - wt ) and sk - n - sh doxorubicin drug - resistant cells ( sk - n - sh doxr ) or sk - n - sh hmk ( sk - n - sh hmk ) cells with a total of 10 cells in 100 l per implant . gfp - wt / doxr implants were performed at ratios as follows : ( a ) skn - sh gfp - wt only , ( b ) 1 : 1 ratio of sk - n - sh gfp - wt and sk - n - sh doxr , ( c ) 1 : 2 ratio of sk - n - sh gfp - wt and sk - n - sh doxr , and ( d ) 1 : 4 ratio of sk - n - sh gfp - wt and sk - n - sh doxr . gfp - wt / hmk implants were performed at ratios as follows : ( a ) skn - sh gfp - wt only , ( b ) 1 : 1 ratio of sk - n - sh gfp - wt and sk - n - sh hmk , ( c ) 1 : 2 ratio of sk - n - sh gfp - wt and sk - n - sh hmk , and ( d ) 1 : 4 ratio of sk - n - sh gfp - wt and sk - n - sh hmk . when tumors were palpable , the animals were challenged with doxorubicin ( 2.5 mg / kg ) . a total of three doxorubicin injections , each separated by 3 days , were performed . tumor measurements were made with a caliper three times weekly for 3 to 4 weeks and converted to tumor volume by using the formula w l/2 . , the mice were euthanized and the tumor area was measured after aseptic excision from the host . tissue specimens were processed and stained with hematoxylin and eosin to assess tumor morphology and gfp expression . terminal deoxynucleotidyl transferase dutp nick end labeling ( tunel ) allows detection of genomic dna cleavage which occurs during apoptosis by incorporating fluorescein labels in nucleotide polymers . tunel was used to detect apoptotic cells amongst sk - n - sh gfp - wt cells grown in co - culture with sk - n - sh wt , doxr , or hmk cells . labeling was quantified using fluorescence microscopy ( in situ cell death detection kit ; roche molecular biochemicals , indianapolis , in ) . the total number of gfp - wt cells per high - powered field was counted using the 40x objective . tunel - positive nuclei were manually counted using the same power objective . after obtaining internal review board approval ( irb # 2010 - 14080 ) , pediatric patients treated for neuroblastoma from january 1999 to december 2008 at a free - standing , tertiary care children 's hospital were retrospectively identified . only patients who completed therapy before december 2008 and who no longer require biopsy tissue for diagnostic purposes were included in the study . medical records were reviewed for the following clinical features : age at diagnosis , pathology features ( favorable versus unfavorable ) , n - myc amplification status , tumor stage , and outcome ( mortality ) . paraffin embedded tissue samples were collected from the pathology bank , and slides were created . formalin - fixed paraffin embedded slides were dewaxed in xylene and hydrated through a graded series of alcohols . endogenous peroxidases were blocked with a 3% hydrogen peroxide treatment ; antigen retrieval was performed by boiling for 20 minutes in a 0.01 m sodium citrate ( ph 6 ) solution , and endogenous biotin blocked using avidin / biotin blocking kit ( vector labs , sp-2001 ) . slides were incubated overnight in the primary antibody for mk ( 1 : 250 dilution ) . following incubation with the appropriate biotin - labeled secondary antibodies , the labeled antigens were visualized by streptavidin - biotin ( vectastain elite abc kit ; vector laboratories ) followed by immunopure metal enhanced dab substrate ( thermo scientific ) and counterstained with hematoxylin ( richard - allen scientific ) . cytoplasmic and nuclear staining were scored on a scale of none ( 0 ) , low ( 1 + ) , medium ( 2 + ) , and high ( 3 + ) on a blinded basis . when both prechemotherapy and postchemotherapy biopsy specimens were available , expression of mk was compared to determine if mk expression changes after treatment in tumor cells which remain viable despite chemotherapy . expression of mk was also compared between patients by age at diagnosis ( < 1 year versus > 1 year ) , stage , n - myc amplification status ( amplified versus nonamplified ) , histology ( favorable versus unfavorable ) , and survival status . differences in measured variables between the experimental and control groups were assessed using student 's t - test . statistical calculations were performed using the statview statistical package ( abacus concepts , berkeley , ca ) . earlier studies revealed that mk was able to exert a survival function in a variety of cellular systems and against various stimuli , suggesting that it could be associated with drug resistance . overexpression of mk in doxorubicin - resistant sk - n - sh human neuroblastoma cell lines confirmed this assumption and suggested that it may play a role as a cytoprotective signal between drug - resistant and drug - sensitive cells . we have previously shown that conditioned medium from doxorubicin resistant cells exerts a protective effect on their parental wild type cell line against drug toxicity . cells can not move between chambers in the co - culture setup ; however , small proteins such as mk can freely diffuse between chambers through the co - culture membrane ( 0.4 m ) . cytoprotective activity was quantitatively determined by comparing the survival of wild type , drug - sensitive neuroblastoma sk - n - sh cells ( sk - n - sh wt ) co - cultured with either doxorubicin resistant ( sk - n - sh doxr , wt / doxr ) or doxorubicin sensitive ( sk - n - sh wt , wt / wt ) cells for 72 hours and then treated with doxorubicin at concentrations of 10 and 10 m for 48 hours ( figure 1 ) . the cell survival ratio of sk - n - sh wt cells co - cultured with sk - n - sh wt cells ( wt / wt ) in this system was 0.23 compared to 0.37 for co - cultures of sk - n - sh wt and sk - n - sh doxr cells ( wt / doxr ) incubated with 10 m doxorubicin ( p < 0.001 ) ; the cell survival ratio was 0.11 for wt / wt and 0.21 for wt / doxr cells incubated with 10 m doxorubicin ( p < 0.001 ) . thus , coincubation of drug - sensitive cells with drug - resistant cells was associated with an increase in cell survival ratio significantly above that observed with drug - sensitive cells . these findings demonstrate that ligands secreted by doxorubicin resistant human neuroblastoma cells impart a cytoprotective effect on drug - sensitive cells , providing further support for the humoral mediation of resistance to chemotherapy . in order to confirm that mk was the molecule responsible for this protective effect , we created a mk over expressing cell line ( sk - n - sh hmk ) as previously described . western blot analysis confirmed that mk was found in the cell membrane fraction and culture medium for these sk - n - sh hmk cells as seen in the sk - n - sh doxr cells ( figure 2(a ) ) . the mtt cell survival assay previously demonstrated increased survival for a given concentration of doxorubicin for the sk - n - sh hmk cell relative to sk - n - sh wt cell , but not to the extent of sk - n - sh doxr cells . here , the mtt assay also demonstrated that the sk - n - sh hmk cell line displayed resistance to etoposide ( figure 2(b ) ) the sk - n - sh wt , doxr , and hmk cell lines were equally susceptible to cisplatin ( figure 2(c ) ) . the mdr1 gene is known to be an inducible drug resistance gene . to rule out a protective role for mdr1 , the gene for p - glycoprotein ( pgp ) in the sk - n - sh hmk cell line , we compared pgp expression levels in all aforementioned three cell lines with or without doxorubicin ( 10 m ) treatment using western blot analysis . figure 2(d ) demonstrates that pgp is expressed only in sk - n - sh doxr cells and not in sk - n - sh wt or hmk cells either at baseline or when treated with doxorubicin . these data suggest that mdr1 does not contribute to the self - protective effect demonstrated in sk - n - sh hmk cells . previous co - culture experiments using gfp - transfected wild type sk - n - sh cells ( gfp - wt ) co - cultured with either sk - n - sh wt cells or doxr cells confirmed the cytoprotective effect of sk - n - sh doxr cells suggesting humoral protection . in order to confirm that mk was the molecule responsible for this effect , these co - culture experiments were repeated using the mk overexpressing cell line ( sk - n - sh hmk ) . co - cultures were grown using sk - n - sh gfp - wt cells in co - culture with either gfp - wt cells , doxorubicin resistant cells ( sk - n - sh doxr ) , or human mk overexpressing sk - n - sh cells ( sk - n - sh hmk ) . cells were grown in co - culture for 48 hours then incubated with ( + ) or without ( ) doxorubicin ( 10 m ) for 48 hours . inserted sk - n - sh wt cells were then stained using hoechest 33342 to determine cell viability . as seen in figures 3(a ) and 3(b ) , the gfp cells alone retained their original sensitivity to doxorubicin ; however , when co - cultured either with nonfluorescent doxorubicin resistant cells or hmk transfected cells and treated with doxorubicin , the number of viable cells per defined area was higher than that with the drug - sensitive cells alone . these data support the hypothesis that mk is responsible for a humoral cytoprotective effect of drug - resistant cells on nearby drug - sensitive cancer cells . to further investigate the cytoprotective function of mk , we set out to determine if inhibition of mk secretion reversed or reduced the cytoprotective action exerted by doxorubicin resistant neuroblastoma cells upon wild type , drug - sensitive cells . elisa ( figure 4(a ) ) and western blot ( figure 4(b ) ) confirmed decreased expression of mk in doxorubicin resistant cell culture medium when treated with sirna to mk . sk - n - sh wt cells ( figure 4(c ) ) or osa cells ( figure 4(d ) ) were grown in co - culture with their respective wt cells , doxr cells , doxr cells treated with scramble sequence sirna , or doxr cells treated with mk sirna . the results demonstrate that drug - resistant cells transfected with mk sirna no longer exert a cytoprotective effect . the scramble sirna exerted a very limited effect on cytoprotection , and only at a doxorubicin concentration of 10 m . a parallel study carried out with pleiotrophin sirna did not affect the cytoprotective activity of doxorubicin resistant cells on wild neuroblastoma cells ( data not shown ) . these data utilizing both a neuroblastoma cell line and an osteosarcoma cell line suggest this phenomenon may be generalized across multiple tumor types . collectively , these findings support the conclusion that mk plays a dominant role in the cytoprotection induced by drug - resistant cancer cells . we have shown that induced expression of mk in wild type sk - n - sh cells confers a resistance to doxorubicin . we sought to determine if mk plays a self - protective effect in doxorubicin resistant cells themselves . we used mk sirna to knock down mk expression in doxorubicin resistant ( sk - n - sh doxr ) cells . cells were either untreated or treated with doxorubicin ( 10 and 10 for 24 hr ) ( figure 5 ) . when compared with sk - n - sh doxr cells untreated with sirna or treated with scramble sequence sirna , these data suggest mk plays a self - protective role in drug - resistant cells in addition to its humoral protective effect on nearby otherwise drug - sensitive cells . to prove that drug - resistant cells confer a humoral mediated cytoprotective effect on drug - sensitive cells in vivo , we assessed the toxicity of doxorubicin in scid mice bearing xenografts with varying ratios of drug - resistant and drug - sensitive neuroblastoma cells . mice were injected with 10 mixed sk - n - sh gfp - wt cells and sk - n - sh doxr ( ~100 times more resistant than parental drug - sensitive cells ) in ratios from 1 : 0 to 1 : 4 . when the tumors became palpable , mice received three intra - peritoneal drug injections of doxorubicin ( 2.5 mg / kg ) every 3 to 4 days thereafter . tumor measurements were made with a caliper three times weekly for 3 to 4 weeks and converted to tumor volume by using the formula w l/2 . figure 6(a ) shows that injections with gfp - wt : doxr ratios of 1 : 2 and 1 : 4 produced larger tumors than the control ( sk - n - sh / gfp cells alone , 1 : 0 ) and 1 : 1 ratio injections . a tunel assay was also performed on these tumor specimens to assess for the degree of apoptosis present ( figure 6(b ) ) . as the ratio of sk - n - sh doxr to sk - n - sh gfp - wt increased , these data confirm that in the in vivo tumor microenvironment , doxorubicin resistant cells confer a cytoprotective ( antiapoptosis ) effect on neighboring drug - sensitive cells which allows them to grow despite drug treatment . in order to confirm that mk was the agent responsible for this cytoprotective effect in vivo , these experiments were repeated injecting various ratios of sk - n - sh gfp - wt and mk transfected ( sk - n - sh hmk ) cells subcutaneously in nude mice with similar results ( figure 6(c ) ) . mk expression has previously been implicated as a poor prognostic indicator in oral squamous cell carcinoma , neuroblastoma [ 12 , 13 ] , and bladder carcinoma . we sought to determine whether a correlation exists between mk expression and prognostic indicators for neuroblastoma by evaluating the expression of mk in human neuroblastoma tissue samples ( figure 7 and table 1 ) . after nuclear and cytoplasmic scoring , we found no correlation , in either pretreatment or posttreatment specimens , between mk expression and neuroblastoma stage , n - myc status , histology ( favorable versus unfavorable ) , age < 1 year , or survival . we also compared the expression of mk in pretreatment specimens with posttreatment specimens with the hypothesis that mk expressing , drug - resistant tumor cells would be enriched in posttreatment specimens ( table 2 ) . histologic scoring revealed that mk expression was enriched in the cytoplasm of posttreatment specimens when compared to pretreatment specimens ( p < 0.001 ) . these data show that mk is enriched in the cytoplasm of posttreatment tumor specimens , although its expression may not correlate with survival or with prognostic indicators . in 1988 , the muramatsu group first described midkine as a 1315 kd heparin binding polypeptide present in embryonal carcinoma cells which acts to enhance neuronal cell survival and stimulate neurite extrusion . midkine has subsequently been found to be overexpressed in a number of malignant tumors [ 810 ] . midkine has been found to exert a survival function in a variety of cell types and against various stimuli , suggesting a potential role in drug resistance [ 16 , 20 ] . our laboratory has demonstrated that an intercellular crosstalk occurs between cells that have acquired a drug resistance phenotype and neighboring drug - sensitive tumor cells . communication between drug - resistant cells by secretion of survival factors , such as midkine , is postulated to protect cells in the surrounding environment and enable survival of the tumor as a whole . we previously showed that wild type human neuroblastoma cells treated with conditioned medium from doxorubicin resistant cells become more resistant to doxorubicin . however , although midkine was found to be upregulated in this conditioned media , it remained possible that any number of other secreted survival factors could have contributed to the conferred resistance . to verify this result and rule out other growth and/or survival factors which may also contribute to the observed effect the benefit of this system is that it allowed drug - sensitive and drug - resistant cells to grow in separate compartments without physical contact but permitted the diffusion of secreted molecules or drugs from one compartment to the other by traversing the membrane . the results presented here demonstrate that midkine transfected cells have almost the same ability for cellular protection as those of drug - resistant cells through a pgp independent mechanism . this serves as direct evidence of crosstalk between drug - resistant - and drug - sensitive cells with midkine identified as being the protein involved in this mechanism , allowing for conferred drug resistance . our in vitro and in vivo studies demonstrated a significant cytoprotective effect of doxorubicin resistant cells or midkine expressing cells on wild type cells . this effect was abolished when midkine expression was downregulated in drug - resistant cells using sirna . in accordance with our results , takei et al . reported that inhibition of midkine secretion and expression using sirna in prostate cancer pc-3 cells leads to significant suppression of tumor growth in a xenograft model . significantly suppressed the growth of hepatocellular carcinoma in vitro and in vivo using nanoliposomes packaged with antisense phosphorothioate oligonucleotide targeting midkine ( mk - asodn ) . wilms ' tumor , neuroblastoma , esophageal , pancreatic , lung , and breast cancers have all been shown to have enriched mk expression [ 810 ] . in addition , increased midkine expression is associated with poor prognosis in oral squamous cell carcinoma , neuroblastoma [ 12 , 13 ] , and bladder carcinoma . demonstrated that plasma midkine levels in neuroblastoma patients correlated significantly with prognostic indicators in neuroblastoma including mycn amplification , ploidy , tumor stage , and age . we were able to demonstrate an increase in cytoplasmic midkine staining in postchemotherapy biopsy specimens relative to prechemotherapy specimens . these data suggest that midkine expression is induced or acquired during the acquisition of drug resistance and support our in vitro finding of increased midkine expression in neuroblastoma cells which acquire drug resistance through long - term drug exposure . our histopathologic analysis did not demonstrate a correlation of tumor midkine expression levels with prognostic indicators . this finding however may be due to lack of power with the small sample size of biopsy specimens available for these investigations . it may also be due to mk primary role as a secreted factor and therefore not present in the immunohistochemistry results . the exact mechanism by which midkine mediates drug resistance remains poorly understood , but it is postulated that midkine has anti - apoptotic ( or antiautophagy ) [ 2325 ] and proangiogenic activity [ 9 , 26 ] promoting survival in human tumors . midkine was found to protect wilms ' tumor cells from cisplatin - induced apoptosis through bcl-2 enhanced expression . in human pediatric rhabdoid tumor g401 cells , midkine activates the anti - apoptotic pathway mediated by stat1 and the janus - activated kinases ( jaks ) . midkine has been shown to activate the survival pathway mediated by akt in cultured neurons leading to a neuroprotective effect . furthermore , you et al . reported that midkine is a nf-b - inducible gene which supports prostate cancer cell survival . identified an interaction between the notch-2 receptor and midkine in pancreatic ductal adenocarcinoma ( pdac ) cells . they found that mk - notch-2 interaction activated notch signaling , upregulating nf-b inducing epithelial - mesenchymal transition ( emt ) , and increased chemoresistance . perhaps the most intriguing questions regarding the anti - apoptotic activity of midkine and other heparin binding growth factors reside in determining potential sites of action in the cell . because midkine is secreted from drug - resistant cells , the neighboring drug - sensitive cells must express a receptor for midkine as well as the related signaling pathway . by virtue of its apparent lack of specificity , midkine may bind nonspecifically to and activate various receptors , leading to activation of more than one survival pathway and thus increasing its chances to mediate cytoprotection . at least four receptors , namely , n - syndecan , rptpz , alk [ 24 , 32 ] and lrp1 , have been proposed to mediate the biological activities of midkine , and extensive studies have been undertaken investigating the potential roles of these pathways . in summary , the evidence presented in this study confirms the existence of an intercellular cytoprotective signal within drug - resistant tumors which allows phenotypically drug - resistant tumor cells to protect nearby otherwise drug sensitive cells . this humoral effect appears to be mediated primarily by midkine , allowing protection of neighboring cells from drug - induced killing . future studies identifying the pertinent midkine receptors and downstream signaling pathways may identify novel tumor markers or therapeutic targets .

resistance to cytotoxic agents has long been known to be a major limitation in the treatment of human cancers . although many mechanisms of drug resistance have been identified , chemotherapies targeting known mechanisms have failed to lead to effective reversal of drug resistance , suggesting that alternative mechanisms remain undiscovered . previous work identified midkine ( mk ) as a novel putative survival molecule responsible for cytoprotective signaling between drug - resistant and drug - sensitive neuroblastoma , osteosarcoma and breast carcinoma cells in vitro . in the present study , we provide further in vitro and in vivo studies supporting the role of mk in neuroblastoma cytoprotection . mk overexpressing wild type neuroblastoma cells exhibit a cytoprotective effect on wild type cells when grown in a co - culture system , similar to that seen with doxorubicin resistant cells . sirna knockdown of mk expression in doxorubicin resistant neuroblastoma and osteosarcoma cells ameliorates this protective effect . overexpression of mk in wild type neuroblastoma cells leads to acquired drug resistance to doxorubicin and to the related drug etoposide . mouse studies injecting various ratios of doxorubicin resistant or mk transfected cells with gfp transfected wild type cells confirm this cytoprotective effect in vivo . these findings provide additional evidence for the existence of intercellular cytoprotective signals mediated by mk which contribute to chemotherapy resistance in neuroblastoma .

first described in 1957 , moyamoya disease is an extremely rare cerebrovascular condition that predisposes affected patients to stroke in association with progressive stenosis of the intracranial internal carotid arteries and their proximal branches . further , reduced blood flow in the major vessels of the circulation of the anterior brain leads to compensatory development of collateral vasculature that can lead to haemorrhage . on angiography , the formation of these fragile vessels appears as a puff of cigarette smoke , named moyamoya in japanese . besides the aforementioned typical radiographic findings and the prevalence to asian origin , moyamoya can also be associated with conditions such as radiotherapy of the head and neck , dwarfism and others . here , we report a young female caucasian patient , who underwent functional septorhinoplasty and afterwards suffered from a series of cerebral infarctions due to an occult underlying moyamoya disease . a 25-year - old female caucasian patient presented to our outpatient clinic with impaired nasal breathing due to nasal deviation caused by a deviated septum ( figures 1 and 2 ) . the patient s medical history was significant for left - sided otosclerosis , arterial hypertension , dwarfism , thoracic kyphoscoliosis , several allergies , for example , nickel and synthetic flavours , and headache 1 week prior to surgery . besides lercanidipine 5 mg / day for 1 week prior to hospital admission , no further medication was recorded . about 6 hours after functional septorhinoplasty under uneventful general anaesthesia , the patient complained of dysphonia and nausea . for symptomatic treatment of the nausea , granisetron 3 mg diluted in 100 ml sodium chloride solution were administered , and the patient was presented to the otolaryngologist to exclude laryngeal violation during tracheal intubation in general anaesthesia as cause for dysphonia . one hour later the patient additionally suffered from left haemiplegia and a fixed right - view . computed tomography of the brain revealed a large subacute right middle cerebral artery infarct and a small subacute infarct in the left posterior cerebral artery . cerebral angiography and magnetic resonance angiography revealed bilateral stenosis of the internal carotid and middle cerebral arteries with a puffy collateral vascular network typical for moyamoya disease ( figure 3 ) . the patient was transferred to the stroke unit and further on underwent parietal craniotomy of the right side for intracranial pressure release . trans - oesophageal echocardiography revealed no persistent ovale foramen or other cardiac anomalies ; further investigation also showed no further risk factors for cerebral infarctions , besides the mentioned moyamoya disease . regrettably the patient died 6 days postoperatively due to progressive infarct series affecting all major cerebral vessels . frontal view of the patient with nasal breathing impairment due to nasal deviation caused by a deviated septum . computed tomography image of the septum deviation causing nasal breathing impairment . cerebral angiography showing the internal carotid ( a ) and middle cerebral arteries ( b ) with a puffy collateral vascular network ( arrows ) typical for moyamoya disease . cerebral infarctions in young adults are extremely rare with an incidence rate at 11.3 cases per 100,000 people per year in the white population . of them , approximately 10 14% occur in young adults aged between 18 and 45 years and their incidence , risk factors and aetiology differ notably from those in older patients . among others , congenital or acquired heart disease , haematological and metabolic disorders , substance abuse and vasculopathies have been identified as prothrombotic conditions . among vasculopathies , moyamoya is a very rare entity , which majorly affects asians but rarely caucasians . besides the other already - mentioned associated conditions , it is reported that patients with moyamoya disease can also suffer from headache , arterial hypertension and dwarfism afflictions that we also saw in our patient . one day prior to septorhinoplasty the patient s blood pressure was 150/90 mmhg , the anaesthesiology protocol revealed a minimum blood pressure of 115/60 mmhg during general anaesthesia . one week prior to surgery the patient suffered from headaches and arterial hypertension , for which she received lercanidipine 5 mg / day from her general practitioner . previous studies have shown that patients with moyamoya disease have very limited haemodynamic reserves and that just a moderate decrease in cerebral blood perfusion , as seen during antihypertensive therapy or during general anaesthesia , may predispose and lead to cerebral infarctions . in our case the initial symptoms of a cerebral stroke such as dysphonia and nausea have been misinterpreted as results of the tracheal intubation and general anaesthesia , which led to a delay in the correct diagnosis . in case of a devastating complication such as cerebral infarction after an elective procedure in a young patient , quick diagnosis , decision taking and an interdisciplinary approach may be crucial for patient s survival and an adequate management of the particular complication . although complications after septorhinoplasty are reported , they mostly affect the surgical site . to our knowledge , this is the first report of a lethal complication due to moyamoya disease after septorhinoplasty . we feel obliged to report this dreadful complication , so that our fellow surgeons may have the opportunity to correctly identify evidence as well as symptoms of underlying moyamoya disease and thus enable them avoid such disastrous complications in the future . we conclude that despite a thorough knowledge of possible local complications after septorhinoplasty , it is of utmost importance to consider rare general complications like moyamoya disease , even more whenever a patient suffers from associated afflictions such as headaches , arterial hypertension and dwarfism . although cerebral infarctions are very rare in young people , it is crucial to identify and correctly interpret underlying typical symptoms .

abstractmoyamoya disease is an extremely rare cerebrovascular condition that predisposes affected patients to stroke in association with progressive stenosis of the intracranial internal carotid arteries and their proximal branches . to our knowledge , this is the first report of a lethal complication due to moyamoya disease after septorhinoplasty . a 25-year - old female caucasian patient presented to our outpatient clinic with impaired nasal breathing for septorhinoplasty . regrettably the patient died 6 days postoperatively due to progressive infarct series affecting all major cerebral vessels . despite a thorough knowledge of possible local complications after septorhinoplasty , it is of utmost importance to consider rare general complications like moyamoya disease . although cerebral infarctions are very rare in young people , it is crucial to identify and correctly interpret underlying typical symptoms .

cancer is the second leading cause of death in the usa.1 it is estimated that 1,658,370 new cases of cancer will be diagnosed in the usa and 589,430 individuals will die from cancer in 2015.2 the number of people living beyond a cancer diagnosis will reach 19 million in 2024.3 to determine the risk factors of cancer development and progression and to design the novel strategies for screening , early detection , and personalized treatment of cancer , a large amount of multidimensional , standardized data have to be collected and analyzed . these data should be longitudinal , have broad geographical coverage , and be collected from patients diagnosed with different types of cancer , high - risk individuals , and normal controls . to achieve this goal , we have been developing collaborative cancer - specific registries for the standardized collection of comprehensive demographic , lifestyle , physical activity , dietary habits , family history , and quality of life ( qol ) data , as well as data on medical history , diagnosis , treatment , and outcomes . the first two registries , namely , pancreatic cancer collaborative registry ( pccr ) and the breast cancer collaborative registry ( bccr ) , were described previously.4,5 in this work , we describe the thyroid cancer and tumor collaborative registry ( tccr , http://tccr.unmc.edu ) that utilizes novel metadata - driven software architecture , as well as modern standards and best practices for data collection , sharing , and interoperability . thyroid cancer ( tc ) is the most common endocrine - related malignancy . according to the national cancer institute ( nci ) , the estimated number of new tc cases in the united states is expected to be 62,450 in 2015,2 with women diagnosed three times more often than men.6 the incidence rate of tc has been increasing sharply since the mid-1990s , and it is the fastest increasing cancer in both men and women with a growth rate of about 6% a year.7 it is projected that by 2030 tc will become the fourth ( after breast , prostate , and lung cancers ) leading cancer diagnosis.8 there are several known risk factors for tc , including gender , race , head , and neck irradiation , iodine deficiency , autoimmune thyroid disease , and genetic risks,912 whereas the roles of other potential risk factors are still being investigated.1321 to find the possible trends and causes of tc , researchers aim to assess and analyze the significance of suspected risk factors . standardized collection and comprehensive analysis of data on tc and thyroid nodule ( tn ) patients is required to gain a better knowledge of tc s etiology and development to improve prevention , detection , and treatment of this disease . these challenges have prompted us to develop the tccr , a multicenter , web - based registry , which is open to any institution willing to adopt the tccr standard questionnaire for data collection . the tccr s mission is to provide a collaborative framework as well as standardized data and annotated biospecimens to support searches of risk factors for tc occurrence and progression and for the development of novel strategies for screening , early detection , and personalized treatment of tc patients . in 2008 , we developed the first version of the tccr , which utilized traditional multitier web architecture . since then , the best practices for data collection , management , and sharing have been significantly advanced . our goal was to improve the maintainability and sustainability of the tccr , provide a foundation for its interoperability with other data sources , and make the tccr more attractive for collaborative research . to achieve this goal , we have ( i ) improved the questionnaire and workflow by incorporating feedback from clinicians , epidemiologists , and the end - users ; ( ii ) annotated the tccr s common data elements ; ( iii ) harmonized these data elements with the nci s cancer data standards registry and repository ( cadsr)22 ; and ( iv ) reengineered the tccr using novel metadata - driven software architecture . the tccr collects various data on adult individuals aged 19 years and older , who have a personal diagnosis of tc or tns and are able to provide informed consent . data are collected at the time of diagnosis , 3 , 6 , and 12 months after diagnosis , and then annually . the personal , demographic , lifestyle , physical activity , dietary habits , medical history , family history , and qol data are provided and may be entered into the registry by the subject . information on diagnosis , treatment , surgery , and outcome are entered by the clinical personnel involved in the subject s care . the vast majority of questions have a predefined list of permissible values to streamline data entry , reduce potential errors , and simplify data mining . the system also generates a unique subject identification code and automatically records administrative data elements , including the date when the case was submitted , registering institution code , and person completing the case . to streamline the workflow , we divided the tccr patient questionnaire into two parts : primary / core and extended / optional . examples of core data elements are presented in table 1 , and examples of optional data elements are presented in table 2 . to create the foundation for interoperability with other related data sources , we have annotated all tccr data elements ( using standard vocabularies , such as snomed ct23 and the nci thesaurus24 ) and began their harmonization with the nci s cadsr . we have registered new data elements ( that could not be mapped ) with the cadsr to make them available to the broad health community . at present , we have harmonized / registered the core data elements ; the harmonization of the tccr s optional / expended data elements is underway . upon completion of this metadata modeling and semantic mapping process , all tccr data elements will be ( i ) explicitly numerated ; ( ii ) described by an unambiguous , non - redundant definition ; and ( iii ) controlled by and available from the cadsr . it will allow us to establish semantic relationships between concepts that will be necessary for data aggregation and integration and will provide a foundation for the tccr interoperability with other relevant data sources . the reengineered tccr can be defined as a metadata - driven system that relies on a detailed , structured description of a problem domain to facilitate automation , extensibility , and maintainability.25 however , due to the fact that the tccr uses a complex relational database as a back end , we could not use any existing metadata - driven architecture for the tccr reengineering . for instance , the redcap , the most widely used software engine for electronic data capture , is limited to building systems with simple , flat - table data models , static user interfaces , and uncomplicated business rules.26 this is why we enhanced the conventional metadata - driven approach for the tccr s reengineering . in our new approach , we expanded the metadata by including the definitions of business rules ( such as the relationship between questions , data validation rules , and user rights ) , hierarchy of the elements used for data collection ( eg , question - group - section - form - questionnaire ) , navigation between forms , and descriptions of look - and - feel elements ( such as form layout and object style ) . in collaboration with progenomix , , we have developed the metadata - driven online registry generator ( mdorg ) that we utilized to reengineer the tccr.27 the mdorg consists of the metadata loading engine ( mle ) , the automated registry builder ( arb ) , and the runtime data manipulation library ( rdml ) . the mle is used to load the metadata ( that can be maintained in a spreadsheet ) into an oracle schema . this schema is used by the arb to automatically build a registry s relational database . the arb consists of java servlets , packaged into the java library , and a set of stored procedures and functions . the arb supports the creation of fairly complex relational databases with multiple levels of relations . this allows a registry generated by the arb to ( i ) accommodate multiple types of questionnaires ( ie , initial , six - month or yearly follow - ups , etc . ) ; ( ii ) split questionnaires into several groups ( must - have , should - have , and extended / optional ) to collect core data first ; ( iii ) repeat blocks of questions to collect longitudinal or detailed data ( ie , data on multiple treatments or procedures , detailed family history for individual relatives , etc . ) ; and ( iv ) collect multiple values per question ( such as more than one race and multiple medications taken ) . figure 1 shows the implementation of the mdorg for the tccr development and function . the reengineered tccr is dynamically generated by the mdorg and consists of the backend ( oracle database ) , the middle tier ( java servlets ) , javascript library and cascading style sheets ( css ) for runtime graphical user interface ( gui ) generation , and the rdml . we also created a connector that couples the tccr with the openspecimen biospecimen management system.28 when an end - user logs in to the tccr , the rdml extracts business rules and extended properties from the metadata , applies them to tccr data , and sends preprocessed data to the tccr middle tier . the middle tier of the tccr consists of java servlets that dynamically build the gui ( front - end ) based on rules defined in the extended metadata and processes end - user input . the use of the modern open - source technologies [ such as html5 markup language , jquery javascript library ( https://jquery.com ) , angularjs ( https://angularjs.org ) javascript framework , and canvasjs html5 javascript charting library ( http://canvasjs.com ) ] combined with the css tailored to pcs , macs , ipads , or android tablets , allowed us to make the tccr gui compatible with all major browsers and capable to automatically adjust to the end - user devices . the gui consists of the tccr online questionnaire , the reporting module , and the administrative module that allows user management . the online questionnaire was designed to assist in accuracy and ease of data collection by providing a predefined selection of choices whenever possible , a simple navigation between forms , and validation components that prevent users from entering erroneous information . figures 2 and 3 show examples of the tccr gui . to govern the tccr and oversee all studies utilizing the tccr data , the committee consists of an appointed member from each participating institution . to guarantee an equal partnership to any institution , regardless of its size or location , we utilized the confederation model that was successfully implemented in the pccr and bccr.4,5 this model provides each participating institution with an equal representation in the registry s steering committee and reassures that each center retains all rights to its own data . the data collected at any center can be used by other registry s users , but only after obtaining required permissions and upon agreement to provide appropriate references and acknowledgments . the collaborators and representatives from the centers utilizing the tccr have developed the standard organizational and operating procedures , standardized institutional review board ( irb ) applications , and common consent forms , as well as the bylaws for institutions participating in multicenter collaborations . the tccr bylaws describe a framework for the tccr s operation and management , including the responsibilities of individual centers and their designated administrators , the role of the steering committee and the tccr coordinator , and the guidelines for collaborative studies and publications . the security of the tccr has been addressed using the electronic information security standards mandated by hipaa . user authentication , access control , and data encryption issues were addressed during application development , while physical protection and network management are provided by the university of nebraska medical center ( unmc ) it services . the tccr utilizes servers located in the state - of - the - art , secure unmc data center . the results of tests are analyzed , and all actions necessary to fix the security issues ( if any ) are taken . the tccr is accessible to registered users only . to ensure that users have the authority to proceed with data entry , authorized users are issued their own unique electronic signature a combination of the user name and a password . each user has an appropriate level of access to data ( table 1).5 all subjects protected health information ( phi ) collected in the tccr is encrypted when entered into the database . these data can only be decrypted if a user has the corresponding level of access . the tccr utilizes secure web server communication and supports the secure socket layer ( ssl ; an internet encryption method that provides two - way encryption along the entire route that data travels to and from a user s computer ) and https authentication ( the communications standard used to transfer pages on the web ) . the proposed security procedures have been reviewed by the unmc information security team and found to be compliant with the hipaa regulations . to ensure that patients phi and the rights of data owners are protected , the data sharing strategy is implemented in the following way : ( 1 ) all data released to researchers is either de - identified or within the limited data set ; ( 2 ) these data are used only if approved by the tccr steering committee and irb ; ( 3 ) end - users are required to register and accept a license agreement during the registration ; and ( 4 ) while de - identified data are available to all registered users , phi within the limited data set is provided only to users who sign a data use agreement . before starting data collection , the participating centers are required to obtain approval from their respective irb . all participating researchers and clinicians are required to complete the computer - based training course on the protection of human research subjects . all information gathered in the tccr should be compliant with irb approvals at participating sites that are monitored by each center s irb . the tccr coordinator opens new accounts and enables data entry into the tccr only after receiving the documented proof of irb protocol approval . in order to enter data , a copy of the consent form for each subject must be submitted to the tccr coordinator . under the informed consent process , study participants have been asked to voluntarily participate in the tccr . the potential participants are asked about their willingness to share the information they provided in the tccr with research collaborators . the subjects are informed in the consent that their phi will be encrypted and that the web - based registry is accessible to authorized users only . participants have also been informed that they may revoke the authorization to use and share their phi at any time by contacting the principal investigator in writing . if they revoke the authorization , they may no longer participate in the research studies and the use or sharing of future phi will be stopped , but the phi which has already been shared may still be used . many subjects enrolled in the tccr agree to donate blood and urine samples and release a portion of tissue from a previous biopsy or surgical excision . the tccr utilizes the openspecimen to track the collection , storage , and distribution of specimens that provides quality assurance for these activities.28 the openspecimen is an open - source tissue bank repository tool that is used to collect and manage the biospecimen data in a standard and efficient way . biospecimen data collected by each participating center can be either submitted into the central repository or stored locally , if a center maintains its own installation of the openspecimen . the tccr subject i d is used to link the biospecimen data with the subject s other data , collected in the tccr database . when a subject is registered in the tccr , a corresponding record is automatically created in the openspecimen to make it ready for biospecimen data collection . the tccr collects various data on adult individuals aged 19 years and older , who have a personal diagnosis of tc or tns and are able to provide informed consent . data are collected at the time of diagnosis , 3 , 6 , and 12 months after diagnosis , and then annually . the personal , demographic , lifestyle , physical activity , dietary habits , medical history , family history , and qol data are provided and may be entered into the registry by the subject . information on diagnosis , treatment , surgery , and outcome are entered by the clinical personnel involved in the subject s care . the vast majority of questions have a predefined list of permissible values to streamline data entry , reduce potential errors , and simplify data mining . the system also generates a unique subject identification code and automatically records administrative data elements , including the date when the case was submitted , registering institution code , and person completing the case . to streamline the workflow , we divided the tccr patient questionnaire into two parts : primary / core and extended / optional . examples of core data elements are presented in table 1 , and examples of optional data elements are presented in table 2 . to create the foundation for interoperability with other related data sources , we have annotated all tccr data elements ( using standard vocabularies , such as snomed ct23 and the nci thesaurus24 ) and began their harmonization with the nci s cadsr . we have registered new data elements ( that could not be mapped ) with the cadsr to make them available to the broad health community . at present , we have harmonized / registered the core data elements ; the harmonization of the tccr s optional / expended data elements is underway . upon completion of this metadata modeling and semantic mapping process , all tccr data elements will be ( i ) explicitly numerated ; ( ii ) described by an unambiguous , non - redundant definition ; and ( iii ) controlled by and available from the cadsr . it will allow us to establish semantic relationships between concepts that will be necessary for data aggregation and integration and will provide a foundation for the tccr interoperability with other relevant data sources . the reengineered tccr can be defined as a metadata - driven system that relies on a detailed , structured description of a problem domain to facilitate automation , extensibility , and maintainability.25 however , due to the fact that the tccr uses a complex relational database as a back end , we could not use any existing metadata - driven architecture for the tccr reengineering . for instance , the redcap , the most widely used software engine for electronic data capture , is limited to building systems with simple , flat - table data models , static user interfaces , and uncomplicated business rules.26 this is why we enhanced the conventional metadata - driven approach for the tccr s reengineering . in our new approach , we expanded the metadata by including the definitions of business rules ( such as the relationship between questions , data validation rules , and user rights ) , hierarchy of the elements used for data collection ( eg , question - group - section - form - questionnaire ) , navigation between forms , and descriptions of look - and - feel elements ( such as form layout and object style ) . in collaboration with progenomix , , we have developed the metadata - driven online registry generator ( mdorg ) that we utilized to reengineer the tccr.27 the mdorg consists of the metadata loading engine ( mle ) , the automated registry builder ( arb ) , and the runtime data manipulation library ( rdml ) . the mle is used to load the metadata ( that can be maintained in a spreadsheet ) into an oracle schema . this schema is used by the arb to automatically build a registry s relational database . the arb consists of java servlets , packaged into the java library , and a set of stored procedures and functions . the arb supports the creation of fairly complex relational databases with multiple levels of relations . this allows a registry generated by the arb to ( i ) accommodate multiple types of questionnaires ( ie , initial , six - month or yearly follow - ups , etc . ) ; ( ii ) split questionnaires into several groups ( must - have , should - have , and extended / optional ) to collect core data first ; ( iii ) repeat blocks of questions to collect longitudinal or detailed data ( ie , data on multiple treatments or procedures , detailed family history for individual relatives , etc . ) ; and ( iv ) collect multiple values per question ( such as more than one race and multiple medications taken ) . the reengineered tccr is dynamically generated by the mdorg and consists of the backend ( oracle database ) , the middle tier ( java servlets ) , javascript library and cascading style sheets ( css ) for runtime graphical user interface ( gui ) generation , and the rdml . we also created a connector that couples the tccr with the openspecimen biospecimen management system.28 when an end - user logs in to the tccr , the rdml extracts business rules and extended properties from the metadata , applies them to tccr data , and sends preprocessed data to the tccr middle tier . the middle tier of the tccr consists of java servlets that dynamically build the gui ( front - end ) based on rules defined in the extended metadata and processes end - user input . the use of the modern open - source technologies [ such as html5 markup language , jquery javascript library ( https://jquery.com ) , angularjs ( https://angularjs.org ) javascript framework , and canvasjs html5 javascript charting library ( http://canvasjs.com ) ] combined with the css tailored to pcs , macs , ipads , or android tablets , allowed us to make the tccr gui compatible with all major browsers and capable to automatically adjust to the end - user devices . the gui consists of the tccr online questionnaire , the reporting module , and the administrative module that allows user management . the online questionnaire was designed to assist in accuracy and ease of data collection by providing a predefined selection of choices whenever possible , a simple navigation between forms , and validation components that prevent users from entering erroneous information . figures 2 and 3 show examples of the tccr gui . to govern the tccr and oversee all studies utilizing the tccr data , the tccr steering committee has been formed . the committee consists of an appointed member from each participating institution . to guarantee an equal partnership to any institution , regardless of its size or location , we utilized the confederation model that was successfully implemented in the pccr and bccr.4,5 this model provides each participating institution with an equal representation in the registry s steering committee and reassures that each center retains all rights to its own data . the data collected at any center can be used by other registry s users , but only after obtaining required permissions and upon agreement to provide appropriate references and acknowledgments . the collaborators and representatives from the centers utilizing the tccr have developed the standard organizational and operating procedures , standardized institutional review board ( irb ) applications , and common consent forms , as well as the bylaws for institutions participating in multicenter collaborations . the tccr bylaws describe a framework for the tccr s operation and management , including the responsibilities of individual centers and their designated administrators , the role of the steering committee and the tccr coordinator , and the guidelines for collaborative studies and publications . the security of the tccr has been addressed using the electronic information security standards mandated by hipaa . user authentication , access control , and data encryption issues were addressed during application development , while physical protection and network management are provided by the university of nebraska medical center ( unmc ) it services . the tccr utilizes servers located in the state - of - the - art , secure unmc data center . the results of tests are analyzed , and all actions necessary to fix the security issues ( if any ) are taken . the tccr is accessible to registered users only . to ensure that users have the authority to proceed with data entry , authorized users are issued their own unique electronic signature a combination of the user name and a password . each user has an appropriate level of access to data ( table 1).5 all subjects protected health information ( phi ) collected in the tccr is encrypted when entered into the database . these data can only be decrypted if a user has the corresponding level of access . the tccr utilizes secure web server communication and supports the secure socket layer ( ssl ; an internet encryption method that provides two - way encryption along the entire route that data travels to and from a user s computer ) and https authentication ( the communications standard used to transfer pages on the web ) . the proposed security procedures have been reviewed by the unmc information security team and found to be compliant with the hipaa regulations . to ensure that patients phi and the rights of data owners are protected , the data sharing strategy is implemented in the following way : ( 1 ) all data released to researchers is either de - identified or within the limited data set ; ( 2 ) these data are used only if approved by the tccr steering committee and irb ; ( 3 ) end - users are required to register and accept a license agreement during the registration ; and ( 4 ) while de - identified data are available to all registered users , phi within the limited data set is provided only to users who sign a data use agreement . before starting data collection , the participating centers are required to obtain approval from their respective irb . all participating researchers and clinicians are required to complete the computer - based training course on the protection of human research subjects . all information gathered in the tccr should be compliant with irb approvals at participating sites that are monitored by each center s irb . the tccr coordinator opens new accounts and enables data entry into the tccr only after receiving the documented proof of irb protocol approval . in order to enter data , a copy of the consent form for each subject the potential participants are asked about their willingness to share the information they provided in the tccr with research collaborators . the subjects are informed in the consent that their phi will be encrypted and that the web - based registry is accessible to authorized users only . participants have also been informed that they may revoke the authorization to use and share their phi at any time by contacting the principal investigator in writing . if they revoke the authorization , they may no longer participate in the research studies and the use or sharing of future phi will be stopped , but the phi which has already been shared may still be used . many subjects enrolled in the tccr agree to donate blood and urine samples and release a portion of tissue from a previous biopsy or surgical excision . the tccr utilizes the openspecimen to track the collection , storage , and distribution of specimens that provides quality assurance for these activities.28 the openspecimen is an open - source tissue bank repository tool that is used to collect and manage the biospecimen data in a standard and efficient way . biospecimen data collected by each participating center can be either submitted into the central repository or stored locally , if a center maintains its own installation of the openspecimen . the tccr subject i d is used to link the biospecimen data with the subject s other data , collected in the tccr database . when a subject is registered in the tccr , a corresponding record is automatically created in the openspecimen to make it ready for biospecimen data collection . currently , the university of nebraska medical center ( omaha , ne ) , methodist health system ( omaha , ne ) , avera research institute ( sioux falls , sd ) , and sanford health system ( sioux falls , sd ) utilize the tccr for data collection and management . several regional hospitals from nebraska , iowa , and south dakota are in the process of joining the tccr . as of march 1 , 2016 , there are 2,261 patients enrolled in the tccr ( 1,396 subjects with tns and 865 subjects with tc ) ; data on more than 28,000 biospecimens ( including derivatives and aliquots ) for 1,266 subjects are annotated in the open - specimen . , there were many collaborative projects utilizing data collected in the tccr.2933 the implementation of our innovative programming architecture greatly simplified support , maintenance , and future upgrades of the tccr , and improved its interoperability with other related systems . compared with the previous version of the tccr , the value - added functionalities of the reengineered tccr include the following : ( i ) compatibility with all major browsers ; ( ii ) adaptability to end - user devices ( including apple ipads and android tablets ) ; and ( iii ) ability to modify the online questionnaire without recoding the underlying software . integration with the openspecimen significantly expanded the registry s capabilities , allowing researchers to manage and mine biospecimen data for subjects enrolled in the tccr . recently , we integrated the reengineered tccr with other registries , developed by the biomedical informatics core facility at the fred and pamela buffett cancer center under the umbrella of the integrated cancer data repository for cancer research ( icare2).34 the tccr core data elements have formed the common core questionnaire shared among all icare2 registries .

a multicenter , web - based thyroid cancer and tumor collaborative registry ( tccr , http://tccr.unmc.edu ) allows for the collection and management of various data on thyroid cancer ( tc ) and thyroid nodule ( tn ) patients . the tccr is coupled with openspecimen , an open - source biobank management system , to annotate biospecimens obtained from the tccr subjects . the demographic , lifestyle , physical activity , dietary habits , family history , medical history , and quality of life data are provided and may be entered into the registry by subjects . information on diagnosis , treatment , and outcome is entered by the clinical personnel . the tccr uses advanced technical and organizational practices , such as ( i ) metadata - driven software architecture ( design ) ; ( ii ) modern standards and best practices for data sharing and interoperability ( standardization ) ; ( iii ) agile methodology ( project management ) ; ( iv ) software as a service ( saas ) as a software distribution model ( operation ) ; and ( v ) the confederation principle as a business model ( governance ) . this allowed us to create a secure , reliable , user - friendly , and self - sustainable system for tc and tn data collection and management that is compatible with various end - user devices and easily adaptable to a rapidly changing environment . currently , the tccr contains data on 2,261 subjects and data on more than 28,000 biospecimens . data and biological samples collected by the tccr are used in developing diagnostic , prevention , treatment , and survivorship strategies against tc .

frster resonance energy transfer is the radiationless transfer of energy occurring between excited molecule ( donor ) and ground - state molecule ( acceptor ) via long range dipole fret plays an important role in all fields of science in which fluorescence phenomena are used , especially in understanding structure and functions of biological macromolecules . the features making fret so widely used are a strong distance and orientation dependence of transition moments of interacting molecules , which creates a possibility to use it as a spectroscopic ruler to measure intermolecular distances . one of the most challenging problems in using fret in this way , is that the usable range of the interaction does not exceed 100 , since the fret efficiency strongly decreases with the increasing distance . seeking ways to allow the use of fret at longer distances is of great current interest [ 36 ] . acceptor system in the vicinity of incorporated metal nanoparticles or a metal nanolayer [ 710 ] . it occurs that the existence of metal substantially modifies the electromagnetic field in the neighborhood of excited molecules which leads , under specific conditions , to significant fret enhancement . studies in this area [ 7 , 10 ] have shown that the proximity of the silver particles to the donor and acceptor bound to double helical dna resulted in an increase of the frster distance from 35 to 166 . another approach is the use of strong orientation dependence of fret in existing biological systems , like photosynthetic systems as plants and some bacteria [ 11 , 12 ] , as well as by manipulating the organization of fluorophores in different kinds of matrices [ 13 , 14 ] . in the context of some biological systems , so - called antenna effect can occur and be useful [ 1 , 6 ] . in this approach the single acceptor molecule is replaced by many linked and closely located molecules to which resonance energy transfer is much more effective . the enhancement of transfer efficiency at a given distance means that the usable range of fret can be extended in the experiments . in other words , in the case of donor multiple acceptors system , the same value of fret efficiency as in the donor we proposed the advanced monte carlo ( mc ) analysis of antenna effect . by means of mc simulations we mimic the biological antenna systems and , as a result , we can simply obtain not only the average value of fret efficiency for a given system , but also the decay curve of donor and acceptor emission , which can be helpful in the interpretation and design of fret experiments . the existing models [ 1 , 6 ] allow to simulate systems characterized by a fixed distance between donor and the group of acceptors . our aim is to extend the scope of biological systems possible to be analyzed , by introducing distribution function of distance between interacting fluorophores , as well as different shape of a protein carrying multiple acceptors . the simple antenna model , c.f . , fig . 1 , is built by placing the donor molecule , d at the center of cartesian coordinates system and the group of acceptors , a , randomly positioned on a surface of a globular protein , approximated by sphere with radius r. the donor and the protein are connected via link of a certain length , r.fig . 1antenna system the vectors of donors and acceptors transition moments , as well as the explicit distances between donor and each acceptor , are determined during each step of the mc simulation . the most straightforward approximation , regarding the distance r is to use a rigid linker connected to the donor and the protein labeled with randomly positioned acceptors [ 1 , 6 ] . in this manner , the distances between donor and each of the acceptors , ri , depend only on the acceptors distribution over the protein surface and the radius of the protein . ri can be calculated as:1\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { r_i}=\mathop{{\left ( { { { { \left ( { r+r+r\sin { \theta_i}\cos { \phi_i } } \right)}}^2}+{{{\left ( { r\sin { \theta_i}\sin { \phi_i } } \right)}}^2}+{{{\left ( { r\cos { \theta_i } } \right)}}^2 } } \right)}}\nolimits^{{{1 \left/ { 2 } \right . } } } , $ $ \end{document}where the angles i and i describe the ith acceptor location on the sphere with respect to the center of protein . the absolute distance between fluorophores can vary from r , for the closest located acceptor , to r + 2r in the case of molecule attached to the opposite part of the sphere . another extreme case follows from the assumption of an ideally flexible linker between the donor and the protein . the only restraint is the length of the linker , rmax , which allows the distance to vary from 0 to rmax . this , quite unrealistic in biological systems , model demands some conditions to be fulfilled . first of all , the existence of the linker does not affect the movement of the donor and acceptor . second , all relative donor acceptor positions are equally probable within the allowed range . the probability density function ( pdf ) that the protein will choose the position on the sphere with radius r , among all equally probable positions within the ball with radius rmax is2\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ p(r)=3\frac{{{r^2}}}{{r_{max}^3}}. $ $ \end{document } the donor molecule is placed in the center of this ball . the real distribution of end - to - end distances in flexible molecules can be obtained using several experimental methods like the time - resolved fluorescence spectroscopy [ 1517 ] , frequency domain data [ 18 , 19 ] or steady - state measurements of the efficiency of fluorescence energy transfer . in most of the cases it is necessary to introduce the end - to - end distance distribution ( by proposing the mathematical function describing this distribution ) to properly describe experimental data . although several different functions can be used [ 16 , 21 ] , for most purposes the gaussian distribution,3\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ p(r)=\frac{1}{{\sigma \sqrt{{2\pi } } } } \exp \left [ { -\frac{1}{2}\mathop{{\left ( { \frac{{r-\overline{r}}}{\sigma } } \right)}}\nolimits^2 } \right ] , $ $ \end{document}is regarded to be adequate and best suited to describe end - to - end distribution in macromolecules . the donor and acceptor molecules labeled on a native , rigid protein are expected to be relatively immobile during the excited - state lifetime , which leads to the possible r values narrowly distributed around the average distance , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \overline{r } $ $ \end{document}. for flexible or denatured peptides , either the donor and acceptor , or the peptide itself are more likely to rotate and diffuse . in this case the range of possible distances increases which leads to the wide p(r ) distribution . introductory monte carlo simulations of fret efficiency and fluorescence decay of donor , published recently by bojarski et al . , show , that the usable range of fret can be extended even up to 200 if multiple acceptors with mutual parallel orientations are used . in this article we would like to show how the changes in attached proteins size and shape influence fret . moreover it is shown that the use of distribution function of distance results in the changes in the exponential character of donor fluorescence decay . to examine the influence of different parameters in antenna system on fret efficiency , we use a simple monte carlo ( mc ) algorithm based on the following deactivation scheme\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \begin{array}{*{20}c } { } \hfill & { d+{a_1}+\ldots + a_i^{*}+\ldots + { a_n } } \hfill \\ { } \hfill & { \uparrow { k_{{d{a_i } } } } } \hfill \\ { d+{a_1}+\ldots + { a_n}+h\nu \to } \hfill & { { d^{*}}+{a_1}+\ldots + { a_n } } \hfill \\ { } \hfill & { \downarrow { k_{{\gamma d } } } } \hfill \\ { } \hfill & { d+{a_1}+\ldots + { a_n}+h{\nu_d } } \hfill \\ \end{array } , $ $ \end{document}where kd is the radiative decay rate of donor and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { k_{{d{a_i } } } } $ $ \end{document } is the transfer rate for fret process . h and hd denote the energy of the exciting photon and photons emitted by donor . the kinetics of the system described by this scheme , can be written in terms of probability d(t ) that the donor is excited at time t as follows:4\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { { \mathop{\rho}\limits^{.}}_d}=-\left ( { \sum\limits_i { { k_{{d{a_i}}}}+{k_{{{\gamma}d } } } } } \right){\rho_d } , $ $ \end{document}where dot above d stands for derivative with respect to time . the radiative rate coefficients is calculated using the natural lifetime of the donor ( d ) as5\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { k_{{{\gamma } d}}}=\frac{1}{{{\tau_d}}}. $ $ \end{document } to calculate the fret rate we use the well - known frster formula , including the electromagnetic coupling between fluorophores in the dipole approximation6\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { k_{{d{a_i}}}}=\frac{1}{{{\tau_d}}}\mathop{{\left ( { \frac{{{r_0}}}{{{r_i } } } } \right)}}\nolimits^6 , $ $ \end{document}where ri is the distance between the middle of donors and acceptors transition dipoles and r0 is frster radius ( the distance at which the probability of transfer is equal to the sum of all other deactivation probabilities ) which depends on spectral characteristics of fluorophores and their mutual orientation . the literature values of frster radius ( rf0 ) for different pairs of fluorophores are usually calculated for the case of fast isotropically rotating donor and acceptor molecules , which corresponds to the average \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ < { \kappa^2 } > = \tfrac{2}{3 } $ $ \end{document}. during the simulations , instead of assuming averaged values of the orientation factor , we calculated the real values for any pair of interacting fluorophores . such a procedure allows to minimize the error resulting from arbitrary assuming any limiting value of obtained as a result of averaging . to obtain the correct value for the real we need to define r0 as7\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ r_0 ^ 6=\frac{3}{2}r_{f0}^6{\kappa^2 } , $ $ \end{document}where the orientation factor is expressed as:8\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { \kappa^2}={{\left ( { cos{\theta_t}-3cos{\theta_d}cos{\theta_a } } \right)}^2 } , $ $ \end{document}where t is the angle formed by transition moments , d is the angle between donors transition dipole and the vector joining the centers of donors and acceptors moment , and a is the analogue angle for the acceptor . the transfer rates are additive , therefore the total rate for both radiative and nonradiative energy transfer will be a simple sum of the rates for each acceptor . based on the values of the transfer rates , the probability of a given event is calculated for each process : the transfer of energy ( pda ) and the emission of photon ( pd ) . for the donor,9\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { p_{da } } = \frac{{\sum\nolimits_i { { k_{{d{a_i } } } } } } } { { { k_{td } } } } , { p_{{{\gamma } d}}}=\frac{{{k_{{\gamma d}}}}}{{{k_{td } } } } , $ $ \end{document}where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { k_{td } } = { k_{{{\gamma } d}}}+\sum\nolimits_i { { k_{{d{a_i } } } } } $ $ \end{document } means the sum of the rates for all processes possible in this case . the choice of a process realized in each mc step is performed by generating a random number from a uniform distribution in the range [ 0 , 1 ] . in the case of radiative deexcitation , simulation in this mc step when fret occurs , energy of excitation is transferred into the acceptors ensemble , which also finishes the simulations step and the transfer event is recorded . to simplify the calculations , we assume , that reverse energy transfer does not occur ( i.e. the efficiency of fret is calculated as the relation of the number of energy transfer events ( nfret ) to the total number of events ( radiative - n and non - radiative),10\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { e_{fret } } = \frac{{{n_{fret } } } } { { { n_{fret } } + { n_{{\gamma } } } } } . $ $ \end{document } the emission decay curve is obtained by relating all emission events with the particular moment of time at which investigated process occurs . it is calculated by inverting the distribution function of the probability , p(t , pk)dt , so that if at time t the molecule is excited , then the process pk appears in the time interval ( t , t + dt),11\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ p(t)=\sum\limits_k { p\left ( { t,{p_k } } \right ) } = { k_t } \exp \left ( { -{k_t}t } \right ) , $ $ \end{document}where kt = ktd , kta is the sum of transfer rates for each process which is possible in the case of donor or acceptor molecule . in each mc step , a random number , x , is generated from the ( 01 ) uniform distribution , and the time at which any process takes place is obtained by inverting the distribution function of the probability p(t),12\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \int\nolimits_0^t { p(t)dt } = x\to t=-\frac{1}{c } \ln \left ( { 1-x } \right ) . $ $ \end{document } the set of lifetimes of photons , recorded during the simulation , is combined into a histogram the monte carlo simulations were performed over a suitably high number of simulation s step ( 10 times ) , to obtain well averaged results . in the current work , we proposed the development of a simple antenna model , which has potential to become a valuable tool in design and interpretation of fret experiments . moreover , by replacing the fixed distance between donor and attached protein by mathematical function of distance distribution and by assuming different shape and size of the protein , we can extend a range of systems possible to simulate using our mc model . as shown in the work of bojarski et al . , the parameters strongly influencing the fret efficiency are both the orientation and number of fluorophores . in this study first , the molecules are randomly oriented with the simulated average value of < > close to the theoretical value of 2/3 ( dynamic case ) and second , where molecular transition moments are fixed in space with perfect parallel orientation ( < > = 4 ) . the proposed method can be easily applied also to describe partly ordered systems , important from a biological and biophysical point of view . to examine the effect of the number of acceptors on the fret efficiency , figure 2 shows the dependence of the fret efficiency in the presence of 1 , 5 and 10 acceptors attached to the spherical protein with 40 diameter , as a function of the distance r. r0 was assumed to be 80 , accordingly to recently available fluorescence probes [ 5 , 24 ] and the distance is approximated by the rigid linker . two orientation cases , random ( black lines ) and parallel ( light blue lines ) , were considered . it can be seen , that increasing the number of acceptors to only five , for the distance r = 150 results in a fret efficiency of 6 % , and for ten acceptors it is 11 % ( almost 40 % in the parallel case ) , whereas for a single acceptor the value of fret efficiency is close to zero . this means that using multiple acceptors , it is possible to obtain the measurable values of fret efficiency even at the distances of 150 , which can extend the useful range of energy transfer as a spectroscopic ruler . moreover , the system with parallelly oriented fluorophores , can act as a powerful antenna system and strongly increase the efficiency of collecting the excitation energy from the donor molecule.fig . 2transfer efficiency as a function of the distance r for different number of acceptors ( 1 , 5 , 10 ) for random ( so called dynamic case ) and parallel orientation of acceptor transition moments . the shape of attached protein is assumed to be spherical ( radius of protein r = 20 ) with fixed donor protein distance transfer efficiency as a function of the distance r for different number of acceptors ( 1 , 5 , 10 ) for random ( so called dynamic case ) and parallel orientation of acceptor transition moments . the shape of attached protein is assumed to be spherical ( radius of protein r = 20 ) with fixed donor protein distance another aspect , we would like to consider is the influence of the size and shape of the protein . due to the strong dependence of transfer efficiency on the absolute distance between donor and each acceptor , one can expect , that the fret value changes as the relative distribution of acceptors over a protein varies . in fig . 3 protein distance r = 120 and the frster radius of 80 . the volume of attached protein remains the same in all cases and equals to volume enclosed by a sphere with radius r = 20 . 3transfer efficiency as a function of the distance r for different shapes of attached protein , in the presence of five acceptors for a random and parallel orientation of molecules . the distance between the donor and the protein is fixed transfer efficiency as a function of the distance r for different shapes of attached protein , in the presence of five acceptors for a random and parallel orientation of molecules . the distance between the donor and the protein is fixed the simulations were performed for four different shapes of attached macromolecule : a sphere , a cylinder with height h = 60 and radius r = 13.34 , a prolate elipsoid with semi - major and semi - minor axis equal 55.56 and 12 and an oblate elipsoid with axis a = 12 and b = 25.82 . these protein shapes can correspond with , for example , a cylindrical chaperonin groel and elipsoidal n - terminal domain of enzyme i ( ein ) . the effect of protein shape results in discrepancy in fret efficiency values both in the case of parallel ( light blue lines ) and randomly distributed transition moments of acceptors ( black lines ) . the highest values of transfer efficiencies are obtained for the oblate elipsoid and spherical shape of attached molecule , what results from relatively shorter distances between donor and each acceptor . the simulations of expected fret as a function of protein s size are shown in fig . 4 . to simplify the calculations , the spherical shape of the protein and fixed donor protein distance are assumed . in the case of a small protein ( r = 10 ) the presence of five acceptors results in fret efficiency of 10 % . to obtain the same value of fret for larger molecule , like fragment of an antibody ( diameter of 55 ) , the number of fluorophores randomly attached to the sphere 4transfer efficiency as a function of globular protein diameter in the presence of multiple acceptors ( 1 , 5 , 10 ) for a random and parallel orientation of molecules . the distance between the donor and the protein is fixed transfer efficiency as a function of globular protein diameter in the presence of multiple acceptors ( 1 , 5 , 10 ) for a random and parallel orientation of molecules . the distance between the donor and the protein is fixed the effect of different functions of distance distributions can be clearly seen in fig . 5 , where an intensity decay of donor for four cases is shown . the decay curve in the absence of acceptors is , in the simplest case , described by a single exponential function , shown by black , dashed line . adding the acceptors into the system results in shortening of the average lifetime of donor due to the energy transfer . while the distance between the donor and the protein is fixed , the intensity decay function remains single exponential ( light blue , solid line ) . it is noteworthy that using the distribution function instead of the fixed distance results in changes of the nature of the decay . the range of distances results in a range of decay times . due to this , the donor decay curve becomes more complex than a single exponential ( light blue , dashed line and black , solid line ) . the shape of attached protein is assumed to be spherical with radius r = 20 . 5time - resolved fluorescence intensity decay of donor in the donor - only and multiple acceptors case , for different distributions of the distance r. the shape of attached protein is spherical time - resolved fluorescence intensity decay of donor in the donor - only and multiple acceptors case , for different distributions of the distance r. the shape of attached protein is spherical the effect of donor intensity decay on the half width ( hw ) parameter in the normal distribution of the distances is shown in the fig . simulations were performed for the spherical shape of attached protein with radius r = 20 , labeled with five acceptors . as mentioned above , using normal distribution resulted in non - exponential decay curve . the wider distribution function means , that acceptors are generally more closely located . as a result , the rate of energy transfer calculated for the donor and each acceptor is increased which leads to overall higher transfer efficiency and shorter decay curve ( light blue , solid line and black , dashed line ) . for the narrow distribution , the nonexponential effect is less visible , and decay curve goes to the single exponential function as hw goes to zero ( black , solid line).fig . 6comparison of intensity decays of donor in the case of different values of standard deviation for a normal function approximating the distribution of the distances r. the shape of attached protein is assumed to be spherical with r = 20 comparison of intensity decays of donor in the case of different values of standard deviation for a normal function approximating the distribution of the distances r. the shape of attached protein is assumed to be spherical with r = 20 in order to test our model and show the influence of using different distance distributions on the final results , we used experimental results described by maliwal et al . as the experimental antenna system they used the 30-mer ds oligonucleotide with biotin on the 3-end and alexa-568 ( donor , a568 ) on the 5-end . earlier studies have shown that the distance between opposite ends of the dna fragment varies around 100 in the absence of conformational changes . to build the antenna system , the avidin molecule was labeled with different numbers of fluorophore acceptors dylight-649 ( dl649 ) and dylight-750 ( dl750 ) . results was compared with the simple non - antenna system created by labeling the donor - oligonucleotide system with single acceptor . table 1 presents the results of our simulations compared with the experimental data of maliwal et al . . simulations were performed for the oligonucleotide labeled with donor and single acceptor ( sample 1 ) and for the antenna model with spherical protein attached ( samples 24 ) . in the first case , the effective donor acceptor separation r used in simulations was increased by the length of fluorophores ( 5 added by both the donor and acceptor molecules ) and equal 110 for the approximation of rigid chain . the avidin molecule attached to the system , increased the average distance between donor and acceptor by another 25 ( the avidin radius ) . in different environments or at different temperatures the same macromolecule with the attached donor acceptor pair can appear in different conformations . we calculated the fret efficiency for four distributions of donor to acceptor distance : a narrow normal distribution determined by standard deviation of = 5 , the wider normal distribution with = 18 , the ideally flexible and rigid chain . the average donor lifetimes were calculated for the simplest case of fixed distance between the donor and the protein.table 1results of monte carlo simulations of average fluorescence lifetimes and fret efficiencies for systems with different number of acceptors , compared with experimental values of maliwal et al . . protein distance described by gaussian distribution with two different values and for the case of ideally flexible and rigid linkersample r 0( ) < 0 > / < 0 > \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ e_{{_{fret}}}^{exp } $ $ \end{document } \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ e_{fret}^{{\sigma = 5\mathring{a } } } $ $ \end{document } \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ e_{fret}^{{\sigma = 18\mathring{a } } } $ $ \end{document } \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ e_{{_{fret}}}^{flexible } $ $ \end{document } \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ e_{{_{fret}}}^{rigid } $ $ \end{document } 171.53.029/3.0130.0550.0580.0810.350.056261.02.893/2.9160.090.0680.090.2720.066371.52.793/2.7930.120.110.130.3870.103471.52.724/2.7260.1430.130.150.4220.122sample 1 : donor + dl649 ; 2 : donor + avidin with dl750 attached ( a = 8) ; 3 : donor + avidin with dl649 attached ( a = 5 ) ; 4 : donor + avidin with dl649 attached ( a = 6 ) ; a means the number of acceptors ; simulations were performed using r = 110 for 1 acceptor case , and r = 105 and r = 27.5 for the avidin cases ; denotes the standard deviation of the normal distribution results of monte carlo simulations of average fluorescence lifetimes and fret efficiencies for systems with different number of acceptors , compared with experimental values of maliwal et al . . protein distance described by gaussian distribution with two different values and for the case of ideally flexible and rigid linker sample 1 : donor + dl649 ; 2 : donor + avidin with dl750 attached ( a = 8) ; 3 : donor + avidin with dl649 attached ( a = 5 ) ; 4 : donor + avidin with dl649 attached ( a = 6 ) ; a means the number of acceptors ; simulations were performed using r = 110 for 1 acceptor case , and r = 105 and r = 27.5 for the avidin cases ; denotes the standard deviation of the normal distribution another aspect , we would like to mention is the influence of the size and shape of attached fluorophores . in our model r is increased by 10 for both the donor and the acceptor in the single acceptor case and by 5 in the donor - avidin system . the influence of the shape of fluorophores is neglected in our model , nevertheless it could have a significant influence for systems in which sizes of a donor and an acceptor are comparable with attached protein . the antenna effect significantly extends the range of using fret in measurements of fluorophores distance . in standard systems however , by replacing single acceptor with the group of closely located acceptors , fret efficiency can be measurable even at the distances exceeding 150 , especially if acceptors form an organized structure ( parallel transition moments ) . the same separation energy transfer differs strongly for oblate ellipsoid , prolate ellipsoid , cylindrical shape or sphere . the maximal expected difference in the energy transfer efficiency can even exceed 50 % . by means of the monte carlo simulations , we can easily adjust the parameters of the antenna system , to improve the designing and interpretation of fret experiments . we demonstrated the theoretical potential of our variant of the mc approach . instead of assuming the fixed distance between the donor and the group of acceptors [ 1 , 6 ] , we proposed using the different distance distributions and shapes of attached protein , depending on the characteristics of simulated systems . this approach allows to analyze the variety of larger biological systems and can be used in designing specific fret experiments above 100 .

the problem of extending the utilizable range of frster resonance energy transfer ( fret ) is of great current interest , due to the demand of conformation studies of larger biological structures at distances exceeding typical limiting distance of 100 . one of the ways to address this issue is the use of so - called antenna effect . in the present work , the influence of the antenna effect on the fret efficiency is investigated by the monte carlo analysis . the previously published results bojarski et al . ( j phys chem b 115:1012010125 , 2011 ) indicate that using a simple model of donor linked with a protein labeled with multiple acceptors , significantly increases the transfer efficiency in comparison with donor single acceptor system . the effect is stronger if the transition moments of acceptors are mutually parallel . in this work , to extend the scope of possible biological systems to be analyzed , different distributions of donor acceptors distance are analyzed , as well as the size and shape of the attached molecule .

the plant family myrtaceae includes approximately 150 genera with over 5 500 species ( heywood et al . 2007 ) , amongst which are some important forestry species ( e.g. eucalyptus spp . ) and several fruit crops such as guava ( psidium guajava ) . some , such as acca sellowiana ( common name feijoa ; in brazil , goiabeira da serra ) are only minor fruit crops . acca sellowiana is a shrub or small tree native to southern south america ( southern argentina , brazil , paraguay , and uruguay ) and , although only occasionally cultivated in south america , it has become more significant as a fruit crop in new zealand ( al - harthy 2010 ) . there are few published records of fungal pathogens associated with feijoa ( farr & rossman 2011 , mendes & urben 2011 ) . however , during a recent search for pathogens of feijoa in the southern brazilian state of rio grande do sul , individuals of a. sellowiana in rural areas in the vicinity of pelotas had foliage with intense tar - spot symptoms . examination of specimens collected and a literature and herbarium search were performed in order to clarify the identity of the fungus on feijoa , and the results of these investigations are presented here . samples of diseased foliage of acca sellowiana were collected in two localities . these were dried in a plant press and taken to the laboratory for further examination . representative specimens were deposited in the local herbarium ( herbarium universidade federal de viosa , vic ) . examination of selected leaves bearing tar - spot symptoms with the help of an olympus sxz7 stereoscopic microscope revealed that fungal structures were immersed in the leaf tissue and sections were prepared and mounted in lactophenol and lactofucsin for further examination . additionally , sections were also prepared with a freezing microtome ( cryostat microm hm 520 ) . observations , photographs , and line drawings were prepared with a light microscope olympus bx51 , fitted with a digital camera ( olympus e - volt 330 ) and a drawing tube . type : brazil : rio grande do sul : pelotas , chcara da brigada , cerro da buena , on leaves of acca sellowiana ( myrtaceae ) , 18 aug . 2010 , r. w. barreto ( vic 31476 neotype designated here ; b 70 0015054 isoneotype ) . other specimen examined : brazil : rio grande do sul : pelotas , capo do leo , on leaves of acca sellowiana ( myrtaceae ) , 18 aug . 2010 , r. w. barreto ( vic 31766 ) . lesions on living leaves , adaxially on all leaves at various developmental stages , initially punctiform , becoming irregular tar - spots , raised , with age surrounded by yellowish to reddish peripheral necrotic haloes , widely distributed and leading to foliage distortions , 0.20.3 2.13.0 mm diam , indistinct abaxially . internal mycelium intra- and intercellular , hyphae 2.03.0 m diam , branched , septate , hyaline to pale brown . stromata adaxial , clypeate , shield - like , merged with the upper wall of the ascoma . conidia formed within stromata externally indistinguishable from teleomorph stomata ; flattened , lenticular to irregular ( in section ) , epigenous , subepidermal , single or in combination with ascomata , sometimes very broad occupying nearly the whole breadth of the stroma , 6151729 x 100184 m walls of dark brown textura angularis , 38.569 m thick , smooth ; conidiogenous cells subcylindrical , straight , 1525(40 ) x 23 m , 01-septate , pale brown ; conidia mucilaginous , enteroblastic , acicular , curved , lunate or sigmoid , 1319 x 1.5 m , aseptate , thin - walled , hyaline , smooth . ascomata perithecial , epigenous , immersed , solitary , spherical to subsphaerical , somewhat to strongly depressed , short papillate , 41218 m diam , inconspicuously ostiolate , composed of thin - walled brown textura angularis , walls 6.544 m , 711 cells thick , outer layers dark brown , inner layers pale brown to subhyaline . interascal tissue of paraphyses , 2.53 m diam , longer than the asci , filiform , septate , hyaline , thin - walled , constricted at the septae ; periphyses well - developed , filiform , hyaline , thin - walled . asci unitunicate , cylindrical to clavate , short - stalked , 70.5104 x 1327 m , apex broadly rounded to nearly flat , thin - walled , 8-spored . ascospores at first uniseriate but sometimes partially biseriate , 15.522 x 814 m , ellipsoidal to cylindric - ellipsoidal , rounded at the ends , walls 23 m thick , aseptate , hyaline , smooth , without a mucous sheath or appendages . notes : very little information is available on phyllachora feijoae . only a very brief description is given in the original publication of rehm ( 1897 ) . later , theissen & sydow ( 1915 ) prepared a more complete description of the fungus when combining it into catacauma . this is , nevertheless , somewhat incomplete and no illustrations were provided . furthermore , the description was apparently based on rehm s material collected in the last publication dealing with this fungus was that of jimenez & hanlin ( 1992 ) , where names of fungi described in catacauma were listed . although the authors acknowledged that after petrak s ( 1924 ) work it became widely accepted that the distinction of catacauma from phyllachora was artificial , they prudently did not propose that names in catacauma should be immediately rejected or recombined into phyllachora without a careful re - examination of types . since that publication , mycologists have shown little interest in the names of fungi referred to catacauma , but some earlier fungal names in phyllachora have been reinstated . that is the case of the name c. feijoae , presently listed in mycobank and index fungorum as a later synonym of p. feijoae . nevertheless , this name is still being used in other instances ( e.g. the brazilian list of fungi on plants ; mendes & urben 2011 ) . an expanded description based on the material recently collected in brazil this is also the first time illustrations of p. feijoae have been published . the original material of the species studied by rehm would almost certainly have been deposited in the collections of the botanisches garten und museum berlin - dahlem ( b ) , but if so it appears to have been lost or destroyed during world war ii as it could not now be found ( h.j.m . we therefore designate one of the recent collections as a neotype to fix the application of the name . the fungus on acca sellowiana exhibits all the typical features , both in terms of symptoms produced on the host and in its morphology , to members of the genus phyllachora ( phyllachoraceae , phyllachorales ) . all species of phyllachora are biotrophic plant pathogens , causing tar - spots on members of numerous plant families , but are particularly common on fabaceae ( cannon 1991 ) and poaceae ( parbery 1971 ) . besides the presence of a well - developed , dark brown to black clypeus , other features such as the formation of the perithecia within the plant tissues , and hyaline , thin - walled , smooth and aseptate ascospores , are typical for the genus ( cannon 1991 ) . around 70 species of phyllachora have been described on members of myrtaceae worldwide ( farr & rossman 2011 ) , with 21 species recorded on this host - family in brazil ( mendes & urben 2011 ) . species of phyllachora associated with myrtaceae have never been monographed . some of the older records of phyllachora on myrtaceae were later recognized as mistakenly placed in that genus . some were found to belong to other genera , - such as p. pululahuensis ( now regarded as a synonym of vestegrenia multipunctata ; von arx & mller 1954 ) , and p. eucalypti ( now recognized as a synonym of clypeophysalospora latitans ; crous et al . other species were recombined into genera such as p. peribebuyensis which is now treated as coccodiella peribebuyensis ( katumoto 1968 ) . several names in phyllachora that are listed on members of myrtaceae were found to be later synonyms of already known species names : p. conspurcata ( syn . additionally , p. langdonii is now treated as a subspecies of p. callistemonis , p. callistemonis subsp . langdonii ( pearce & hyde 1994 ) . in the case of species of phyllachora recorded from brazil , an issue to be taken into consideration is that numerous species names are included in mendes et al . ( 1998 ) , and have also been kept in the database of fungi on plants in brazil ( mendes & urben 2011 ) but quoted as being in press . these names , for which medeiros & dianese are given as authors , have never been validly published and include the following species designations associated with members of myrtaceae : p. eugenii - complicatae , p. eugenii - punctifolie , p. myrciae - decrescentis , p. myrciae - guianensis , p. myrciae - multiflorae , p. myrciae - multiflorae , p. myrciae - pallescentis , p. myrciae - tematae , p. myrciae - tortae , and p. pampulhae . although all these designations are not validly published , most may well represent good taxonomic species which are still awaiting formal description . most were collected in the brazilian cerrado , an area rich in endemic organisms of all kinds . a study of the 48 published descriptions of taxa ( including three varieties ) of phyllachora described from hosts belonging to myrtaceae , is summarized in table 1 . this shows that there are three species of phyllachora with close morphological similarity to p. feijoae on a. sellowiana : p. brenesii , p. emarginata , and p. subcircinans . brenesii has perithecia with narrower walls ( 5 m thick ) , and asci which are also narrower ( 1015 m wide ) . additionally , p. feijoae can be recognized as distinct from the other species known on myrtaceae ( table 1 ) by a combination of morphometric features ; differences in perithecial diameter , ascus width , and the absence of a mucilaginous sheath on the ascospores . although no comparison of the morphology of p. feijoae with other species on myrtaceae was attempted in previous publications , our results indicate that this species is distinct from other phyllachora species on this host - family , and so deserves recognition as a separate species . no significant discrepancies were found between the morphology of the neotype and the description provided in theissen & sydow ( 1915 ) .

acca sellowiana ( myrtaceae ) , feijoa ( in brazil , goiaba da serra ) , is a native southern south america tree that produces edible fruits which , although only occasionally cultivated in south america , became a significant fruit crop in new zealand . recently , during surveys for fungal pathogens of feijoa in southern brazil , several plants were found bearing tar - spot symptoms caused by a species of phyllachora . a literature search enabled us to identify the fungus as phyllachora feijoae , a little - known species originally described in the 19th century by h. rehm and later transferred to the genus catacauma . the name catacauma feijoae , although now regarded as a later synonym of p. feijoae is still mistakenly in use ( as , for instance , in the brazilian list of fungi on plants ) . the type specimen was most probably deposited in the botanisches garten und museum berlin - dahlem ( b ) and lost or destroyed during world war ii , and could not be located . the recent recollection of abundant material of this fungus in the vicinity of pelotas ( rio grande do sul , brazil ) allowed its re - examination and neotypification . phyllachora feijoae is also illustrated here for the first time .

correlacionar a gravidade de pacientes crticos no neurolgicos com preditores clnicos do risco de broncoaspirao . participaram do estudo adultos com histrico de intubao orotraqueal prolongada ( > 48 h ) e submetidos avaliao da deglutio beira do leito nas primeiras 48 h aps a extubao . dados relacionados a avaliao fonoaudiolgica clnica do risco de aspirao broncopulmonar , nvel funcional da deglutio por meio da escala american speech - language - hearing association national outcome measurement system ( asha noms ) e status de sade pelo sequential organ failure assessment ( sofa ) foram coletados . para fins da anlise estatstica , os pacientes foram agrupados com base nos escores asha noms : asha1 ( nveis 1 - 2 ) , asha2 ( nveis 3 - 5 ) e asha3 ( nveis 6 - 7 ) . os indivduos no grupo asha3 eram significativamente mais jovens , permaneceram intubados por menos tempo e apresentaram menor gravidade de quadro clnico geral ( escore sofa ) do que os indivduos nos demais grupos . os preditores clnicos de broncoaspirao que melhor caracterizaram os grupos foram achados de ausculta cervical alterada e presena de tosse aps a deglutio . pacientes crticos com idade 55 anos , perodo de intubao 6 dias , gravidade de quadro clnico geral ( escore sofa 5 ) , escore na escala de coma de glasgow 14 , ausculta cervical alterada e tosse aps a deglutio devem ser priorizados para a avaliao fonoaudiolgica completa . dysphagia after prolonged orotracheal intubation ( oti)-longer than 48 h 1 3 -is defined as the inability to effectively transfer food from the mouth into the stomach . 4 this type of dysphagia has an incidence of 44% to 87% 3 5 6 of cases after extubation , and it can increase morbidity and mortality . 7 according to data collected from hospitals in the usa , the annual cost of patients with dysphagia exceeds us$500 million . 4 recently , one of the concerns has been the study of dysphasia and its impact on the health care system . 8 11 dysphagia after prolonged oti delays the resumption of oral feeding , increases the risk for lung diseases , and delays hospital discharge . 12 13 in this scenario , early identification of predictors of aspiration is extremely relevant for priority treatment of at - risk patients , with the institution of appropriate measures and promotion of safe and speedy resumption of oral feeding . 14 there are several tests available for the diagnosis of dysphagia after prolonged oti , including bedside swallowing assessment , performed by a speech - language pathologist , as well as imaging ( videofluoroscopy and videoendoscopy ) . 15 however , it is of note that the use of such tests is not a reality in most treatment centers , in addition to the fact that indications for their use in critically ill patients are limited . 10 a recent study 15 investigated clinical predictors of dysphagia after prolonged oti , on the basis of the results of clinical bedside swallowing assessments . the authors concluded that patients presenting with food or liquid escaping from the mouth or nose , multiple swallows , abnormal cervical auscultation findings , choking , altered voice quality , and cough after swallowing should be promptly evaluated before resumption of oral feeding . other studies using bedside assessments have reported that the following signs are indicative of risk of aspiration : voice quality after swallowing 16 17 and cough after swallowing . 17 18 it is known that dysphagia severity after prolonged oti is related to however , there are studies that have assessed the association of dysphagia with other risk factors , such as measures of patient severity of illness . in such studies , the authors included the results of instruments that determine patient severity of illness at the time of admission , such as the sequential organ failure assessment ( sofa ) and the acute physiology and chronic health evaluation ii ( apache ii ) . 19 21 two current studies used sofa scores calculated at icu admission for investigating their correlations with dysphagia severity . 19 20 both studies found that patient severity of illness at the time of admission was not associated with dysphagia severity ( determined by bedside assessment ) . patients with mild dysphagia or normal swallowing had sofa scores similar to those of patients with severe dysphagia . another study , 21 the objective of which was to investigate the demographic and clinical factors associated with dysphagia after prolonged oti in patients with pulmonary changes , analyzed the results of scales that measure severity of illness ( sofa and apache ii scores ) as possible factors related to post - extubation dysphagia severity . results of the regression analysis showed that four variables were significant : duration of intubation ; upper gastrointestinal comorbidity ; sofa score ; and low bmi . therefore , the objective of the present study was to determine whether the severity of non - neurological critically ill patients correlates with clinical predictors of bronchial aspiration ( bedside swallowing assessment ) . we conducted a prospective , observational , cross - sectional study , which was approved by the local research ethics committee ( code no . the data collection procedures began only after obtaining written informed consent from the patients or their legal guardians . the study participants were patients who underwent bedside swallowing assessment , by physician request , and were being treated in the department of speech therapy of the university of so paulo school of medicine hospital das clnicas central institute , located in the city of so paulo , brazil , between january of 2013 and january of 2015 . the inclusion criteria were having undergone prolonged oti ( > 48 h ) 1 3 ; being > 18 years of age ; not having or having had a tracheostomy ; not having neurological or neurodegenerative disorders ; not having a history of esophageal dysphagia ; not having lung or neck cancer or having undergone surgical procedures in those regions ; and having undergone bedside swallowing assessment within the first 48 h after extubation . the risk of bronchial aspiration was determined on the basis of the dysphagia risk evaluation protocol ( drep ) . 10 15 the drep is intended for early bedside assessment of the patient 's risk of dysphagia . the final result of the drep determines whether the patient can receive larger volumes and different textures of foods and liquids , as well as indicating whether monitoring is required for safe feeding . the results observed for each protocol item are recorded as either " pass " or " fail " . a recently published study investigated predictors of dysphagia after prolonged oti , 15 on the basis of the drep results for a 5-ml water swallow test . in that study , the authors concluded that the predictors of dysphagia in the study population were food or liquid escaping from the mouth or nose , multiple swallows , abnormal cervical auscultation findings , voice quality after swallowing , cough after swallowing , and choking . therefore , those drep items were considered in the analysis and were assessed for correlations with the other data in the study . level of swallowing function was determined with the use of the american speech - language - hearing association national outcome measurement system ( asha noms ) scale . 22 this scale is a multidimensional tool that assesses the degree of feeding supervision required by and the food / liquid textures that are safe for each patient , producing a single number between 1 and 7 . for the purposes of the present study , the asha noms scale scores were determined after full completion of the drep and , when necessary , after clinical swallowing assessment . therefore , level of swallowing function was classified as follows : level 1 : the individual is not able to swallow anything safely by mouth , and all nutrition and hydration are received through non - oral means ; level 2 : the individual is not able to swallow safely by mouth for nutrition and hydration , but may take some consistency , in therapy only , with consistent maximal cues , and an alternative method of feeding is required ; level 3 : an alternative method of feeding is required as the individual takes less than 50% of nutrition and hydration by mouth , and/or swallowing is safe with use of moderate cues to use compensatory strategies , and/or the individual requires maximum diet restriction ; level 4 : swallowing is safe , but usually requires moderate cues to use compensatory strategies , and/or the individual has moderate diet restrictions and/or still requires an alternative method of feeding and/or oral supplements ; level 5 : swallowing is safe with minimal diet restriction and/or occasionally requires minimal cues to use compensatory strategies , the individual may occasionally self - cue , and all nutrition and hydration needs are met by mouth at mealtime ; level 6 : swallowing is safe , and the individual eats and drinks independently , rarely requires minimal cues to use compensatory strategies , usually self - cues when difficulty occurs , but may need to avoid specific food items ( e.g. , popcorn and peanuts ) and/or require additional time ( because of dysphagia ) ; and level 7 : the individual 's ability to eat independently is not limited by swallow function , which is safe and efficient for all consistencies , and compensatory strategies are effectively used when needed . patient severity of illness at the time of clinical speech pathology assessment was determined by using the sofa score , 23 recorded on the medical chart on the basis of clinical and laboratory test results . this score is a tool that is used on a daily basis in critically ill patients during their icu stay , to determine the degree of organ dysfunction / failure quantitatively and objectively . the sofa score is used not to determine patient outcome , but rather to describe complications in critically ill patients . the two major objectives of sofa are to improve the understanding of organ dysfunction and how impairments in several organs are related to each other and to assess the effects of medical treatment . to determine patient severity of illness , scores ranging from zero ( normal ) to four ( highest degree of impairment ) are assigned to the various organ systems ( respiratory , cardiovascular , hematological , hepatic , central nervous system , and renal ) . each organ system receives a separate score , and the final score is obtained by summing all scores . the maximum score is 20 , which is indicative of the highest degree of severity . . variable score 0 1 2 3 4 respiratory system pao2/fio2 , mmhg > 400 400 300 200 100 hematological system platelets , 10/mm > 150 150 100 50 20 hepatic system bilirubin , mg / dl ( mol / l ) < 1.2 ( < 20)1.2 - 1.9 ( 20 - 32)2.0 - 5.9 ( 33 - 101)6.0 - 11.9 ( 102 - 204 ) > 12.0 ( > 204 ) cardiovascular system hypotensionno hypotensionmap < 70 mmhgdopamine 5 or dobutamine at any dose dopamine > 5 , epinephrine 1 , or norepinephrine 0.1 dopamine > 15 , epinephrine > 0.1 , or norepinephrine > 0.1 cns glasgow coma scale1513 - 1410 - 126 - 9 < 6 renal system creatinine , mg / dl ( mol / l ) < 1.2 ( < 110)1.2 - 1.9 ( 110 - 170)2.0 - 3.4 ( 171 - 299)3.5 - 4.9 ( 300 - 440 ) > 5.0 ( > 440)urine output , ml / dayn / an / an / a < 500 < 200map : mean arterial pressure ; and snc central nervous system . with ventilatory support . adrenergic agents ( g / kg body weight / min ) were administered for at least 1 h. map : mean arterial pressure ; and snc central nervous system . with ventilatory support . adrenergic agents ( g / kg body weight / min ) were administered for at least 1 h. assumptions of normality of distribution in each group and homogeneity of variances among the groups were tested using the shapiro - wilk test and levene 's test , respectively . to compare sofa scores among the different levels of swallowing function , we used the kruskal - wallis test , and , when multiple comparisons were necessary , we used dunn 's test . categorical variables were analyzed with the chi - square test and fisher 's exact test . the level of statistical significance was set at 5% ( p 0.05 ) for all analyses . the risk of bronchial aspiration was determined on the basis of the dysphagia risk evaluation protocol ( drep ) . 10 15 the drep is intended for early bedside assessment of the patient 's risk of dysphagia . the final result of the drep determines whether the patient can receive larger volumes and different textures of foods and liquids , as well as indicating whether monitoring is required for safe feeding . the results observed for each protocol item are recorded as either " pass " or " fail " . a recently published study investigated predictors of dysphagia after prolonged oti , 15 on the basis of the drep results for a 5-ml water swallow test . in that study , the authors concluded that the predictors of dysphagia in the study population were food or liquid escaping from the mouth or nose , multiple swallows , abnormal cervical auscultation findings , voice quality after swallowing , cough after swallowing , and choking . therefore , those drep items were considered in the analysis and were assessed for correlations with the other data in the study . level of swallowing function was determined with the use of the american speech - language - hearing association national outcome measurement system ( asha noms ) scale . 22 this scale is a multidimensional tool that assesses the degree of feeding supervision required by and the food / liquid textures that are safe for each patient , producing a single number between 1 and 7 . for the purposes of the present study , the asha noms scale scores were determined after full completion of the drep and , when necessary , after clinical swallowing assessment . therefore , level of swallowing function was classified as follows : level 1 : the individual is not able to swallow anything safely by mouth , and all nutrition and hydration are received through non - oral means ; level 2 : the individual is not able to swallow safely by mouth for nutrition and hydration , but may take some consistency , in therapy only , with consistent maximal cues , and an alternative method of feeding is required ; level 3 : an alternative method of feeding is required as the individual takes less than 50% of nutrition and hydration by mouth , and/or swallowing is safe with use of moderate cues to use compensatory strategies , and/or the individual requires maximum diet restriction ; level 4 : swallowing is safe , but usually requires moderate cues to use compensatory strategies , and/or the individual has moderate diet restrictions and/or still requires an alternative method of feeding and/or oral supplements ; level 5 : swallowing is safe with minimal diet restriction and/or occasionally requires minimal cues to use compensatory strategies , the individual may occasionally self - cue , and all nutrition and hydration needs are met by mouth at mealtime ; level 6 : swallowing is safe , and the individual eats and drinks independently , rarely requires minimal cues to use compensatory strategies , usually self - cues when difficulty occurs , but may need to avoid specific food items ( e.g. , popcorn and peanuts ) and/or require additional time ( because of dysphagia ) ; and level 7 : the individual 's ability to eat independently is not limited by swallow function , which is safe and efficient for all consistencies , and compensatory strategies are effectively used when needed . patient severity of illness at the time of clinical speech pathology assessment was determined by using the sofa score , 23 recorded on the medical chart on the basis of clinical and laboratory test results . this score is a tool that is used on a daily basis in critically ill patients during their icu stay , to determine the degree of organ dysfunction / failure quantitatively and objectively . the sofa score is used not to determine patient outcome , but rather to describe complications in critically ill patients . the two major objectives of sofa are to improve the understanding of organ dysfunction and how impairments in several organs are related to each other and to assess the effects of medical treatment . to determine patient severity of illness , scores ranging from zero ( normal ) to four ( highest degree of impairment ) are assigned to the various organ systems ( respiratory , cardiovascular , hematological , hepatic , central nervous system , and renal ) . each organ system receives a separate score , and the final score is obtained by summing all scores . the maximum score is 20 , which is indicative of the highest degree of severity . variable score 0 1 2 3 4 respiratory system pao2/fio2 , mmhg > 400 400 300 200 100 hematological system platelets , 10/mm > 150 150 100 50 20 hepatic system bilirubin , mg / dl ( mol / l ) < 1.2 ( < 20)1.2 - 1.9 ( 20 - 32)2.0 - 5.9 ( 33 - 101)6.0 - 11.9 ( 102 - 204 ) > 12.0 ( > 204 ) cardiovascular system hypotensionno hypotensionmap < 70 mmhgdopamine 5 or dobutamine at any dose dopamine > 5 , epinephrine 1 , or norepinephrine 0.1 dopamine > 15 , epinephrine > 0.1 , or norepinephrine > 0.1 cns glasgow coma scale1513 - 1410 - 126 - 9 < 6 renal system creatinine , mg / dl ( mol / l ) < 1.2 ( < 110)1.2 - 1.9 ( 110 - 170)2.0 - 3.4 ( 171 - 299)3.5 - 4.9 ( 300 - 440 ) > 5.0 ( > 440)urine output , ml / dayn / an / an / a < 500 < 200map : mean arterial pressure ; and snc central nervous system . adrenergic agents ( g / kg body weight / min ) were administered for at least 1 h. map : mean arterial pressure ; and snc central nervous system . with ventilatory support . adrenergic agents ( g / kg body weight / min ) were administered for at least 1 h. assumptions of normality of distribution in each group and homogeneity of variances among the groups were tested using the shapiro - wilk test and levene 's test , respectively . to compare sofa scores among the different levels of swallowing function , we used the kruskal - wallis test , and , when multiple comparisons were necessary , we used dunn 's test . categorical variables were analyzed with the chi - square test and fisher 's exact test . the level of statistical significance was set at 5% ( p 0.05 ) for all analyses . after the inclusion criteria were applied , the final study sample consisted of 150 patients . the underlying diagnoses of the patients included in the study were as follows : lung disease , in 59 patients ; multiple trauma without traumatic brain injury , in 18 ; kidney and liver transplants , in 12 ; heart disease , in 11 ; vascular disease , in 11 ; liver disease , in 10 ; kidney disease , in 10 ; infectious disease , in 6 ; gastroenterological disease , in 5 ; rheumatic disease , in 5 ; and endocrine disease , in 3 . the distribution of the patients by level of swallowing function , as determined by the asha noms scale after bedside speech pathology assessment , was as follows : 3 patients at level 1 ; 35 at level 2 ; 22 at level 3 ; 27 at level 4 ; 12 at level 5 ; 10 at level 6 ; and 41 at level 7 . for the purposes of statistical analysis , the patients were grouped as follows : those at levels 1 and 2 , asha1 ; those at levels 3 to 5 , asha2 ; and those at levels 6 and 7 , asha3 . the group comparison by age and duration of intubation is shown in table 1 . variable group p * asha1 asha2 asha3 age , years62.00 17.4055.30 17.4846.40 18.30 < 0.001duration of intubation , days7.60 3.976.20 3.384.90 2.70 < 0.001asha1 : patients at levels 1 and 2 , as scored by the american speech - language - hearing association national outcome measurement system ( asha noms ) ; asha2 : patients at levels 3 , 4 , and 5 , as scored by asha noms ; and asha3 : patients at levels 6 and 7 , as scored by asha noms . asha1 : patients at levels 1 and 2 , as scored by the american speech - language - hearing association national outcome measurement system ( asha noms ) ; asha2 : patients at levels 3 , 4 , and 5 , as scored by asha noms ; and asha3 : patients at levels 6 and 7 , as scored by asha noms . * anova . statistical analysis using the kruskal - wallis test showed significant differences in age between the asha1 and asha3 groups ( p < 0.001 ) and between the asha2 and asha3 groups ( p = 0.026 ) , patients in the asha3 group being younger than those in the other two groups . mean duration of intubation ( in days ) was shortest in the asha3 group , and there was a significant difference between that group and the asha1 group ( p = 0.001 ) . table 2 shows the comparison of predictors of bronchial aspiration among different levels of swallowing function . table 2.comparison of predictors of bronchial aspiration among levels of swallowing function . clinical sign result group p * asha1 asha2 asha3 ( n = 38 ) ( n = 61 ) ( n = 51 ) extraoral loss pass3557500.402fail341multiple swallowspass2442440.030fail14197abnormal cervical auscultation findingspass215251 < 0.001fail1790wet voicepass3155510.009fail760coughpass163750 < 0.001fail22241chokingpass3152510.008fail790asha1 : patients at levels 1 and 2 , as scored by the american speech - language - hearing association national outcome measurement system ( asha noms ) ; asha2 : patients at levels 3 , 4 , and 5 , as scored by asha noms ; and asha3 : patients at levels 6 and 7 , as scored by asha noms . food or liquid escaping from the mouth or nose . * chi - square test . asha1 : patients at levels 1 and 2 , as scored by the american speech - language - hearing association national outcome measurement system ( asha noms ) ; asha2 : patients at levels 3 , 4 , and 5 , as scored by asha noms ; and asha3 : patients at levels 6 and 7 , as scored by asha noms . food or liquid the results indicated that the predictor " food or liquid escaping from the mouth or nose " did not differentiate among the swallowing function level groups . the predictors " abnormal cervical auscultation findings " and " cough " after swallowing were the indicators that best differentiated among the groups . to determine the groups for which the predictors of aspiration were the most evident , we used fisher 's exact test . in that analysis , the groups were matched for predictors of aspiration - multiple swallows : asha1 vs. asha2 ( p = 0.559 ) ; asha1 vs. asha3 ( p = 0.011 ) ; and asha2 vs. asha3 ( p = 0.030 ) ; abnormal cervical auscultation findings : asha1 vs. asha2 ( p = 0.001 ) ; asha1 vs. asha3 ( p < 0.001 ) ; and asha2 vs. asha3 ( p = 0.004 ) ; wet voice : asha1 vs. asha2 ( p = 0.236 ) ; asha1 vs. asha3 ( p = 0.002 ) ; and asha2 vs. asha3 ( p = 0.031 ) ; cough after swallowing : asha1 vs. asha2 ( p = 0.072 ) ; asha1 vs. asha3 ( p < 0.001 ) ; and asha2 vs. asha3 ( p < 0.001 ) ; and choking : asha1 vs. asha2 ( p = 0.630 ) ; asha1 vs. asha3 ( p = 0.002 ) ; and asha2 vs. asha3 ( p = 0.004 ) . tables 3 and 4 show the results of the comparison of patient severity of illness ( sofa ) among levels of swallowing function at the time of speech pathology assessment . table 3.comparison of patient severity of illness among levels of swallowing function . level of wallowing function median iqr p asha15.03.75 - 8.000.001asha25.03.00 - 7.00asha33.02.00 - 5.00iqr : interquartile range ; asha1 : patients at levels 1 and 2 , as scored by the american speech - language - hearing association national outcome measurement system ( asha noms ) ; asha2 : patients at levels 3 , 4 , and 5 , as scored by asha noms ; and asha3 : patients at levels 6 and 7 , as scored by asha noms . * kruskal - wallis test . iqr : interquartile range ; asha1 : patients at levels 1 and 2 , as scored by the american speech - language - hearing association national outcome measurement system ( asha noms ) ; asha2 : patients at levels 3 , 4 , and 5 , as scored by asha noms ; and asha3 : patients at levels 6 and 7 , as scored by asha noms . * kruskal - wallis test . comparison p asha1 vs. asha2 > 0.999asha1 vs. asha30.003asha2 vs. asha30.005asha1 : patients at levels 1 and 2 , as scored by the american speech - language - hearing association national outcome measurement system ( asha noms ) ; asha2 : patients at levels 3 , 4 , and 5 , as scored by asha noms ; and asha3 : patients at levels 6 and 7 , as scored by asha noms.*dunn 's test . asha1 : patients at levels 1 and 2 , as scored by the american speech - language - hearing association national outcome measurement system ( asha noms ) ; asha2 : patients at levels 3 , 4 , and 5 , as scored by asha noms ; and asha3 : patients at levels 6 and 7 , as scored by asha noms.*dunn 's test . the results of the two analyses indicate that poor swallowing function translates to greater patient severity of illness . it can also be seen that the asha1 group ( patients who can not tolerate oral feeding ) and the asha2 group ( patients who require maximum to moderate diet restriction ) did not differ regarding patient severity of illness ( sofa score ) . to establish which indicators of patient severity of illness could have an impact on swallowing , we sought to determine whether indicators of functioning of the respiratory , cardiovascular , and central nervous systems ( sofa score ) correlate with level of swallowing function at the time of speech pathology assessment ( table 5 ) . the results indicated that only changes in the central nervous system correlated with changes in swallowing function , indicating that poor swallowing function translates to central nervous system impairment . in an analysis solely of the indicator of functioning of the central nervous system , dunn 's test indicated that the group with the poorest swallowing function differed from the others : asha1 vs. asha2 ( p = 0.018 ) ; asha1 vs. asha3 ( p < 0.001 ) ; and asha2 vs. asha3 ( p = 0.101 ) . table 5.comparison of the severity of involvement of the respiratory , cardiovascular , and central nervous systems among levels of swallowing function . sofa score group p asha1 asha2 asha3 ( n = 38 ) ( n = 61 ) ( n = 51 ) respiratory 0813140.4361141315291873714134032 cardiovascular 02849470.5071231211135714211 cns 01540430.00111818834204310sofa : sequential organ failure assessment ; asha1 : patients at levels 1 and 2 , as scored by the american speech - language - hearing association national outcome measurement system ( asha noms ) ; asha2 : patients at levels 3 , 4 , and 5 , as scored by asha noms ; asha3 : patients at levels 6 and 7 , as scored by asha noms ; and cns : central nervous system . sofa : sequential organ failure assessment ; asha1 : patients at levels 1 and 2 , as scored by the american speech - language - hearing association national outcome measurement system ( asha noms ) ; asha2 : patients at levels 3 , 4 , and 5 , as scored by asha noms ; asha3 : patients at levels 6 and 7 , as scored by asha noms ; and cns : central nervous system . this study presents the characteristics of the risk of bronchial aspiration in the largest sample of patients after prolonged oti in brazil . establishing priority indicators for post - extubation speech pathology care is essential to reducing hospital costs , optimizing bedside speech pathology assessment , and promoting safe and speedy resumption of oral feeding . the literature indicates that the impact of age on the occurrence of dysphagia after prolonged oti is similar in young adults and in the elderly 24 25 ; both groups seem to differ only in dysphagia resolution , the elderly having a trend toward delayed resumption of oral feeding . 2 18 26 in contrast , the present study showed that predictors of bronchial aspiration were more common in individuals 55 years of age or older . a previous study reported the impact of aging on the swallowing function , indicating that healthy elderly individuals present with vallecular residuals ( laryngeal retention ) and that such individuals are usually unaware of retained food in the pharynx . 27 although pharyngeal clearing is nearly complete in young , asymptomatic individuals , the same is not true for healthy elderly individuals . 27 the mechanisms responsible for the development of pharyngeal retention have yet to be fully determined . according to the literature , 28 29 age - related physiological changes - reduced amplitude of pharyngeal contractions , pharyngeal shortening , reduced tongue propulsion / strength , and reduced soft palate strength , all of which hinder the displacement of the food bolus - may be involved in the impairment of the swallowing process . those factors could also explain the higher frequency of occurrence of cough and abnormal auscultation findings after swallowing , observed in the present study , in the critically ill patients 55 years of age or older . the association between duration of orotracheal intubation and dysphagia severity is well documented in the literature . 1 12 19 30 31 this association can be explained by the impact of the tube remaining in the oral cavity , pharynx , and larynx . it is known that chemoreceptors and/or mechanoreceptors , located in the pharyngeal and laryngeal mucosa and involved in the swallowing reflex , can undergo changes due to the presence of an orotracheal tube . 3 laryngeal sensory impairment , identified by the absence of cough or of any other clinical sign suggestive of aspiration , has been observed in patients during the ingestion of liquids , immediately after extubation and within 4 h after extubation . 32 33 the results of the present study suggest that predictors of aspiration are more common in individuals who remain intubated for 6 days or more . the present study identified abnormal cervical auscultation findings as a possible predictor of bronchial aspiration . the sounds associated with healthy and pathological swallowing have been identified with the aid of accelerometers and microphones , for analysis of acoustic characteristics 34 35 and determination of the characteristic sounds of swallowing . 35 37 the results regarding the accuracy of the method vary considerably in terms of reliability and validity in comparison with those of imaging . 38 in contrast , it should be taken into consideration that the very interpretation of videofluoroscopy images and results also varies in terms of reliability and reproducibility . 39 40 regardless of the method adopted to assess swallowing , there is a consensus that specific training in its use is indispensable . data analysis indicated that , in the present study , critically ill patients who underwent prolonged oti and had poorer swallowing function had greater overall severity of illness , changes in the central nervous system being the factor with the greatest impact on this difference . as shown in the introduction , the results of the studies that correlated patient severity of illness ( sofa score ) with dysphagia severity did not achieve significance . 19 20 however , the item regarding neurological system impairment was not included in the analyses of those studies . the literature has identified that a decreased level of consciousness has impacts on the swallowing mechanism and can lead to aspiration . 2 5 31 finally , the limitations of the present study should be acknowledged . first , the study sample consisted of patients from a single institution , and , therefore , the results might have some bias resulting from the therapeutic approaches adopted in the specific protocols . second , the type of assessment proposed for identifying predictors of bronchial aspiration was based solely on an observational clinical protocol . determination of the actual occurrence of bronchial aspiration , on the basis of the signs evaluated , was not objectively confirmed by imaging . it is of note that the present study did not exclude full speech pathology assessments , including imaging . the results of the present study suggest that critically ill patients 55 years of age or older who undergo prolonged oti ( 6 days ) , have a sofa score 5 , have a glasgow coma scale score 14 , and present with abnormal cervical auscultation findings or cough after swallowing ( 5 ml water swallow test at the bedside ) should be prioritized for a full speech pathology assessment and , if necessary , referred for imaging confirmation .

objective : to determine whether the severity of non - neurological critically ill patients correlates with clinical predictors of bronchial aspiration . methods : we evaluated adults undergoing prolonged orotracheal intubation ( > 48 h ) and bedside swallowing assessment within the first 48 h after extubation . we collected data regarding the risk of bronchial aspiration performed by a speech - language pathologist , whereas data regarding the functional level of swallowing were collected with the american speech - language - hearing association national outcome measurement system ( asha noms ) scale and those regarding health status were collected with the sequential organ failure assessment ( sofa ) . results : the study sample comprised 150 patients . for statistical analyses , the patients were grouped by asha noms score : asha1 ( levels 1 and 2 ) , asha2 ( levels 3 to 5 ) ; and asha3 ( levels 6 and 7 ) . in comparison with the other patients , those in the asha3 group were significantly younger , remained intubated for fewer days , and less severe overall clinical health status ( sofa score ) . the clinical predictors of bronchial aspiration that best characterized the groups were abnormal cervical auscultation findings and cough after swallowing . none of the patients in the asha 3 group presented with either of those signs . conclusions : critically ill patients 55 years of age or older who undergo prolonged orotracheal intubation ( 6 days ) , have a sofa score 5 , have a glasgow coma scale score 14 , and present with abnormal cervical auscultation findings or cough after swallowing should be prioritized for a full speech pathology assessment .

in a recent article in ecam ( 1 ) , azeemi and raza reviewed the field of chromotherapy , providing a history of the subject since ancient days ( 2 ) , and its use in modern times ( 3 ) . in the past 8 years , virtual scanning , a new russian system of medical assessment and treatment , has revolutionized the use of precise light frequencies in the visible spectrum for preventive treatment , and where possible cure , of specific pathologies . the new system is still little known in countries outside the former soviet union , explaining its omission from azzeemi and rasa 's review ( 1 ) . such is virtual scanning 's revolutionary significance that no review of color therapy could be considered complete without describing it . the fundamental influence of light in stimulating organismic function , and thus health , is well known ( 4 ) , but modern medical science mostly attributes this to its effect on the pineal ( 5 ) , since the hormones of that master gland regulate pituitary and endocrine function and are thus necessary for the healthy functioning of the whole organism , yielding a safe , reductionist model for the beneficial influence of light on health . more subtle forms of chromotherapy reviewed by azeemi and raza ( 1 ) hold that different colors influence organismic function differently , so that specific colors may benefit particular pathological conditions . such forms of chromotherapy may depend on the influence of light on the system of nadis / acumeridians ; they lack known mechanisms , and belong to cam . azeemi and rasa attempt to remedy this lack of mechanism , making their work of interest to those seeking biologies of cam ( 6,7 ) . to understand how different colors may differently influence organismic function , they hypothesize that colored light may be able to influence the internal structure of water . should they be correct , their hypothesis links to recent suggestions by tiller et al . ( 8) , that so - called water - memory originates in the internal structural arrangements of its hydrogen - bond linked oxygen atoms . vibrational properties , by which they could influence health through principles of vibrational medicine linked to homeopathy ( 9,10 ) . the significance of virtual scanning to this debate is that it represents a completely new , medical technology of light , based on discoveries of new mechanisms and neural pathways , by which light may influence organ and organismic function . virtual scanning is an empirically established system of health assessment and treatment ( 12 ) , using specific effects of organ function on color cognition , and color stimulation on organ health . it is based on principles discovered at the university of krasnoyarsk by professor igor grakov ( 13 ) , who subsequently developed his system into its present form ( 14 ) . it was evaluated at the university of st petersburg by vysochin ( 15 ) , and at other medical centers ( 16 ) . on the basis of a 1015 min color cognition test taken on a computer screen , virtual scanning yields an assessment of the health of 30 organs ( of which 3 are sex - specific ) , an amazing achievement backed up by clearly delineated concepts , well observed case studies ( 12 ) , and considerable research data ( 15 ) . grakov discovered how the structure of cortical information processing and analysis , permits systematic errors in color cognition to be used for accurate health assessment ; and conversely , how administering precise sequences of colors , at precise frequencies of repetition , for given periods of time , can stimulate healing in designated organs . more precisely , the discoveries that enabled grakov to develop his system were as follows : organs transmit precise information concerning their functional state to the brain.the information from each organ precisely expresses the degree of its degeneration towards various kinds of pathology different sets of pathologies for each organ.for each such pathology developing in any organ , the brain has the capacity to transmit neural signals to stimulate the organ , precisely compensating for any loss of function caused by the pathology , thus restoring organ function to normal.the brain stores information about all such signals : ( i ) concerning organ pathologies and ( ii ) concerning their compensation ; in such a way thateach signal gives rise to its own specific , identifiable influence on color cognition . the information from each organ precisely expresses the degree of its degeneration towards various kinds of pathology different sets of pathologies for each organ . for each such pathology developing in any organ , the brain has the capacity to transmit neural signals to stimulate the organ , precisely compensating for any loss of function caused by the pathology , thus restoring organ function to normal . the brain stores information about all such signals : ( i ) concerning organ pathologies and ( ii ) concerning their compensation ; in such a way that each signal gives rise to its own specific , identifiable influence on color cognition . this means that particular pathologies in particular organs , together with the degree to which each is being compensated , influence brain color processing in precise , distinguishably different , ways . grakov 's genius was to design , first , a test measuring deviations from normal color cognition , which can assess the magnitude of all these processes , and second , a therapy using related brain circuits to direct precise , corrective , healing influences to the brain and organs concerned for each condition detected . thus , the virtual scanning health assessment test uses the influence of the brain 's own information processing on color cognition to measure the following : health information transmitted from each organ to the brain , andthe amount the brain is stimulating each organ to compensate for such problems . health information transmitted from each organ to the brain , and the amount the brain is stimulating each organ to compensate for such problems . virtual scanning 's system of treatment uses correspondingly selected colors delivered at specific frequencies of repetition in the delta band of eeg , used by the brain to direct healing to the organs during the night . virtual scanning : the system uses the virtual reality of the brain 's information processing , to provide both body scan and remedial treatment . to most people , the idea that precisely selected colors can help specific pathologies , on occasion producing remarkable cures , may sound unlikely . however , the following case histories from the uk and russia , show the system can produce remarkable results : a uk businesswoman of 47 with her own company had reported upper abdominal discomfort to her gp . she had also been taking aspirin for a year as a secondary prevention measure against platelet aggregation . the gp had not detected any identifiable pathology , and suggested the cause was stress . virtual scanning health assessment detected a developing ulcerative process in the duodenum , requiring urgent treatment . she returned to her gp who reiterated his opinion , suggesting a good rest and holiday . within a week she was admitted to hospital for 10 days with upper gastrointestinal bleeding diagnosed as a duodenal ulcer . assessment of a man of 57 in the uk , suffering from bouts of disorientation , revealed inter alia vertebral artery syndrome , poor blood flow to the back of the brain and undue pressure on the cervical vertebrae . it was determined that the pressure on the head bones was being caused by overexertion on hala asana , the yoga position known as the plough , suggesting that this was causing overstretching of the arteries in the neck ( as well as the muscle tendons the posture is intended to stimulate and rebalance ) . on stopping all such yoga postures , the feelings of giddiness and disorientation went away within 2 weeks . retesting showed both pressure on the head bones and the restricted blood flow to have been eliminated . a russian epileptic , who had been invalided from age 5 , suffered up to 10 attacks per day in spite of taking all prescribed medication . virtual scanning diagnosis led to a prescription of virtual scanning therapy with the brain module . after her first 21 day course of treatment all attacks ceased , and she was able to stop taking any medication . some time later , she was given a further preventative course of virtual scanning treatment , after which no further attacks were reported . clinical investigation showed that the activity in the cortex responsible for the attacks had disappeared . the patient ceased to be categorized as disabled.assessment of a 59-year - old woman , who had suffered migraine attacks from age 11 , worsening in recent years , confirmed migraine and also indicated vertebral artery syndrome , impaired spinal blood flow , osteochondropathy with neurological effects and idiopathic hypotension ( fig . figure 1.(case history treatment ( ii ) : 59-year - old patient with migraine . ) this example illustrates how virtual scanning can yield an overall picture of a patient 's pathology , including its underlying causes . here , signals from brain ( a ) , spinal chord ( b ) , peripheral nervous system ( c ) and blood ( d ) show indications of uncompensated vertebral artery syndrome ( a ) , impaired spinal circulation ( b ) , osteochondropathy with neurological effects ( c ) and idiopathic hypotension ( d ) . together these form a connected set of underlying causes for the pathology : the osteochondropathy ( c ) can lead to the vertebral artery syndrome ( a ) , which in turn leads to impaired spinal blood flow ( b ) and so to the ideopathic hypotension ( d ) . conclusion : these associated pathologies form the probable causes of the migraine . ( a ) brain : note the migraine signal ( 14/7 ) , and other indications of problems in brain function . the signal for vertebral artery syndrome [ signals ( 14/6 ) ] , in particular , is often seen as one of the possible causes for migraine . ( b ) spinal cord : the signals for uncompensated impairment of spinal circulation ( 26/0 ) show that the osteochondrosis ( c ) and consequent vertebral artery syndrome ( a ) connect into a specific pattern of causes of the migraine . ( c ) peripheral nervous system : the poorly compensated osteochondrosis signal ( 56/36 ) indicates a probable cause for the vertebral artery syndrome signal in ( a ) . ( d ) blood and peripheral blood vessels : compensatory signals for idiopathic hypotension ( 6/14 ) , are often seen in migraine cases , particularly when circulation problems are present [ see ( b ) ] . a russian epileptic , who had been invalided from age 5 , suffered up to 10 attacks per day in spite of taking all prescribed medication . virtual scanning diagnosis led to a prescription of virtual scanning therapy with the brain module . after her first 21 day course of treatment all attacks ceased , and she was able to stop taking any medication . some time later , she was given a further preventative course of virtual scanning treatment , after which no further attacks were reported . clinical investigation showed that the activity in the cortex responsible for the attacks had disappeared . assessment of a 59-year - old woman , who had suffered migraine attacks from age 11 , worsening in recent years , confirmed migraine and also indicated vertebral artery syndrome , impaired spinal blood flow , osteochondropathy with neurological effects and idiopathic hypotension ( fig . ( case history treatment ( ii ) : 59-year - old patient with migraine . ) this example illustrates how virtual scanning can yield an overall picture of a patient 's pathology , including its underlying causes . here , signals from brain ( a ) , spinal chord ( b ) , peripheral nervous system ( c ) and blood ( d ) show indications of uncompensated vertebral artery syndrome ( a ) , impaired spinal circulation ( b ) , osteochondropathy with neurological effects ( c ) and idiopathic hypotension ( d ) . together these form a connected set of underlying causes for the pathology : the osteochondropathy ( c ) can lead to the vertebral artery syndrome ( a ) , which in turn leads to impaired spinal blood flow ( b ) and so to the ideopathic hypotension ( d ) . ( a ) brain : note the migraine signal ( 14/7 ) , and other indications of problems in brain function . the signal for vertebral artery syndrome [ signals ( 14/6 ) ] , in particular , is often seen as one of the possible causes for migraine . ( b ) spinal cord : the signals for uncompensated impairment of spinal circulation ( 26/0 ) show that the osteochondrosis ( c ) and consequent vertebral artery syndrome ( a ) connect into a specific pattern of causes of the migraine . ( c ) peripheral nervous system : the poorly compensated osteochondrosis signal ( 56/36 ) indicates a probable cause for the vertebral artery syndrome signal in ( a ) . ( d ) blood and peripheral blood vessels : compensatory signals for idiopathic hypotension ( 6/14 ) , are often seen in migraine cases , particularly when circulation problems are present [ see ( b ) ] . one week prior to the test , the patient had been admitted to hospital fainting from severe pain , and given seven different medications in a 6 h period . after 10 months of virtual scanning treatment , she had not suffered a single further migraine attack . assessments following successive periods of treatment indicated the underlying tendencies causing her migraine to be slowly reducing . the significance of these case histories is not just that the health assessment was able to confirm previous diagnoses , but that it was also able to identify underlying causes . together these imply that grakov 's basic theory must be correct , constituting a series of important discoveries about ( i ) the structure and function of neural signals between the brain and peripheral organs and ( ii ) the brain 's mechanisms of data processing . a uk businesswoman of 47 with her own company had reported upper abdominal discomfort to her gp . she had also been taking aspirin for a year as a secondary prevention measure against platelet aggregation . the gp had not detected any identifiable pathology , and suggested the cause was stress . virtual scanning health assessment detected a developing ulcerative process in the duodenum , requiring urgent treatment . she returned to her gp who reiterated his opinion , suggesting a good rest and holiday . within a week she was admitted to hospital for 10 days with upper gastrointestinal bleeding diagnosed as a duodenal ulcer . assessment of a man of 57 in the uk , suffering from bouts of disorientation , revealed inter alia vertebral artery syndrome , poor blood flow to the back of the brain and undue pressure on the cervical vertebrae . it was determined that the pressure on the head bones was being caused by overexertion on hala asana , the yoga position known as the plough , suggesting that this was causing overstretching of the arteries in the neck ( as well as the muscle tendons the posture is intended to stimulate and rebalance ) . on stopping all such yoga postures , the feelings of giddiness and disorientation went away within 2 weeks . retesting showed both pressure on the head bones and the restricted blood flow to have been eliminated . a russian epileptic , who had been invalided from age 5 , suffered up to 10 attacks per day in spite of taking all prescribed medication . virtual scanning diagnosis led to a prescription of virtual scanning therapy with the brain module . after her first 21 day course of treatment all attacks ceased , and she was able to stop taking any medication . some time later , she was given a further preventative course of virtual scanning treatment , after which no further attacks were reported . clinical investigation showed that the activity in the cortex responsible for the attacks had disappeared . the patient ceased to be categorized as disabled.assessment of a 59-year - old woman , who had suffered migraine attacks from age 11 , worsening in recent years , confirmed migraine and also indicated vertebral artery syndrome , impaired spinal blood flow , osteochondropathy with neurological effects and idiopathic hypotension ( fig . 1 ) , for all of which treatment was prescribed . figure 1.(case history treatment ( ii ) : 59-year - old patient with migraine . ) this example illustrates how virtual scanning can yield an overall picture of a patient 's pathology , including its underlying causes . here , signals from brain ( a ) , spinal chord ( b ) , peripheral nervous system ( c ) and blood ( d ) show indications of uncompensated vertebral artery syndrome ( a ) , impaired spinal circulation ( b ) , osteochondropathy with neurological effects ( c ) and idiopathic hypotension ( d ) . together these form a connected set of underlying causes for the pathology : the osteochondropathy ( c ) can lead to the vertebral artery syndrome ( a ) , which in turn leads to impaired spinal blood flow ( b ) and so to the ideopathic hypotension ( d ) . ( a ) brain : note the migraine signal ( 14/7 ) , and other indications of problems in brain function . the signal for vertebral artery syndrome [ signals ( 14/6 ) ] , in particular , is often seen as one of the possible causes for migraine . ( b ) spinal cord : the signals for uncompensated impairment of spinal circulation ( 26/0 ) show that the osteochondrosis ( c ) and consequent vertebral artery syndrome ( a ) connect into a specific pattern of causes of the migraine . ( c ) peripheral nervous system : the poorly compensated osteochondrosis signal ( 56/36 ) indicates a probable cause for the vertebral artery syndrome signal in ( a ) . ( d ) blood and peripheral blood vessels : compensatory signals for idiopathic hypotension ( 6/14 ) , are often seen in migraine cases , particularly when circulation problems are present [ see ( b ) ] . a russian epileptic , who had been invalided from age 5 , suffered up to 10 attacks per day in spite of taking all prescribed medication . virtual scanning diagnosis led to a prescription of virtual scanning therapy with the brain module . after her first 21 day course of treatment all attacks ceased , and she was able to stop taking any medication . some time later , she was given a further preventative course of virtual scanning treatment , after which no further attacks were reported . clinical investigation showed that the activity in the cortex responsible for the attacks had disappeared . assessment of a 59-year - old woman , who had suffered migraine attacks from age 11 , worsening in recent years , confirmed migraine and also indicated vertebral artery syndrome , impaired spinal blood flow , osteochondropathy with neurological effects and idiopathic hypotension ( fig . ( case history treatment ( ii ) : 59-year - old patient with migraine . ) this example illustrates how virtual scanning can yield an overall picture of a patient 's pathology , including its underlying causes . here , signals from brain ( a ) , spinal chord ( b ) , peripheral nervous system ( c ) and blood ( d ) show indications of uncompensated vertebral artery syndrome ( a ) , impaired spinal circulation ( b ) , osteochondropathy with neurological effects ( c ) and idiopathic hypotension ( d ) . together these form a connected set of underlying causes for the pathology : the osteochondropathy ( c ) can lead to the vertebral artery syndrome ( a ) , which in turn leads to impaired spinal blood flow ( b ) and so to the ideopathic hypotension ( d ) . ( a ) brain : note the migraine signal ( 14/7 ) , and other indications of problems in brain function . the signal for vertebral artery syndrome [ signals ( 14/6 ) ] , in particular , is often seen as one of the possible causes for migraine . ( b ) spinal cord : the signals for uncompensated impairment of spinal circulation ( 26/0 ) show that the osteochondrosis ( c ) and consequent vertebral artery syndrome ( a ) connect into a specific pattern of causes of the migraine . ( c ) peripheral nervous system : the poorly compensated osteochondrosis signal ( 56/36 ) indicates a probable cause for the vertebral artery syndrome signal in ( a ) . ( d ) blood and peripheral blood vessels : compensatory signals for idiopathic hypotension ( 6/14 ) , are often seen in migraine cases , particularly when circulation problems are present [ see ( b ) ] . one week prior to the test , the patient had been admitted to hospital fainting from severe pain , and given seven different medications in a 6 h period . after 10 months of virtual scanning treatment , she had not suffered a single further migraine attack . assessments following successive periods of treatment indicated the underlying tendencies causing her migraine to be slowly reducing . the significance of these case histories is not just that the health assessment was able to confirm previous diagnoses , but that it was also able to identify underlying causes . together these imply that grakov 's basic theory must be correct , constituting a series of important discoveries about ( i ) the structure and function of neural signals between the brain and peripheral organs and ( ii ) the brain 's mechanisms of data processing . central to grakov 's theory is a two matrix model of how organ information influences cognition : an internal matrix mi recording information received from organs and organ systems , and an external matrix me monitoring the external environment , in constant communication with each other . the two matrices , together with their respective communication flows , are schematically depicted in fig . figure 2 depicts grakov 's internal and external matrices in communication with the organism 's internal and external environments , and with each other . it also transmits information to the external matrix concerning the levels of both sets of impulses . information about levels of pathological and compensatory impulses received from the internal matrix modifies cognitive processing of sense perception data received from the external environment in precise ways . conversely , specific sense perception data received by the external matrix can be made to stimulate the internal matrix to modify its levels of compensation , and to send healing impulses to the organs . this is the basis for virtual scanning treatment its specific form of chromotherapy , made precisely according to its assessment . figure 2 depicts grakov 's internal and external matrices in communication with the organism 's internal and external environments , and with each other . it also transmits information to the external matrix concerning the levels of both sets of impulses . information about levels of pathological and compensatory impulses received from the internal matrix modifies cognitive processing of sense perception data received from the external environment in precise ways . conversely , specific sense perception data received by the external matrix can be made to stimulate the internal matrix to modify its levels of compensation , and to send healing impulses to the organs . this is the basis for virtual scanning treatment its specific form of chromotherapy , made precisely according to its assessment . apparently , similar biomathematical models apply to most , if not all , sensory channels . grakov has applied it to others in addition to sight . in the case of color processing and cognition , the model is normalized for the weight , age and sex of each subject . its algorithms analyze colors in a grid , the grid point parameters being modified according to the signals transmitted to and from the brain and recorded in the internal matrix . changes in organ health shift the grid parameters , so that changes occur in color cognition , reflected by specific alterations in color test performance . in health , normal color processing ( according to sex , age and weight ) . for each organ , specific deviations from health result in identifiable changes in test performance . according to grakov , deviations from normal health in any organ result in information flows to the brain specific to each kind of deviation . his work indicates that such signals are present long before detectable pathology manifests , and that each kind of signal will increase to a point where a specific pathology becomes detectable . such pathologies are used to label signal types : if , as a particular signal from , e.g. the liver ( with a dozen or more signal types ) increases , neoplasm becomes detectable , then virtual scanning assessments and treatments could not begin to work unless the internal external matrix model of sensory information processing was correct : success rates reported by vysochin ( 15 ) are far higher than any placebo investigated . the only questions are ones of degree : degree of accuracy of the system 's medical assessments , and , when properly administered , degree of success of its treatments . one major implication of grakov 's work is that each organ transmits as many kinds of distinguishable neural signals to the brain as the different kinds of ailment his system can detect for the organ in question , i.e. approximately 15 different signal types related to the state of health of each organ . the next implication is that the analytical processing identified by grakov must take place in the physiology . this is for two reasons : first , the cortex contains structures able to retain the information designated for the internal and external matrices ; second , different layers of the cortex are interconnected in such a way that the required mathematical processing could be carried out ( the cortex is comprised of six separate layers , each with its own function and interconnections to other layers ) . grakov 's neural model has implications for ( i ) the function of the appropriate layers , and ( ii ) the way different levels of the cortex interact with each other . regions of cortex storing sensory input are possible locations for the external matrix me , while regions storing somatic information may be locations for the internal matrix mi . the length of the interconnections , with dendrites spreading considerable distances , make the relationship of the activity of one cortical region to that of another a uniquely interesting mathematical transformation . the linear transforms between cortical layers implied by grakov 's matrices and neural models would effectively enable the whole cortex to function in a holistic fashion . this is of great importance to complementary medicine , for it implies that higher organisms function holistically , providing support for the concept of a a final implication of grakov 's work is that some form of natural color therapy would have been possible in the wild . this is because improvements in organ condition result in improved sense of well - being . thus a creature 's attention would be specifically drawn to a color with remedial qualities for any problem in its organs , since looking at that color would produce a natural positive feedback . such a possibility is also the case for ordinary color therapy . on sunny days in spring time on the streets of stockholm and other nordic cities , citizens can traditionally be seen resting with their face in the sunshine for quite lengthy time periods , not because they may have been medically advised to do so , but because it makes them feel good they are activating the pineal after all the darkness of the winter months , and consequent melatonin deprivation . grakov 's model implies that any creature , which developed the neurological functions and connections required , would gain a competitive advantage : the possibility of naturally maintaining a higher level of health . in support of this , consider comparable examples of instinctive reactions leading to the identification of curative or health promoting materials : domestic animals tend to eat plants of various kinds when they are sick , particularly grass not part of their normal , carnivorous diet;during pregnancy , females of a species may seek out unusual materials ( again , not their habitual foodstuffs ) rich in materials required by the fetus at that stage of development , e.g. calcium or other minerals , when bones and blood are forming;edward bach recorded that , in his discovery of the flower remedies named after him , he would begin to suffer from the condition , which a particular flower could assist , and , based on his feeling response , would identify the flower in question . domestic animals tend to eat plants of various kinds when they are sick , particularly grass not part of their normal , carnivorous diet ; during pregnancy , females of a species may seek out unusual materials ( again , not their habitual foodstuffs ) rich in materials required by the fetus at that stage of development , e.g. calcium or other minerals , when bones and blood are forming ; edward bach recorded that , in his discovery of the flower remedies named after him , he would begin to suffer from the condition , which a particular flower could assist , and , based on his these examples show that instinct leads various kinds of mammal , including humans , to seek out appropriate nourishment , both for special normal conditions , and to counteract pathology . there is every reason to believe that , although uncommon in this day and age , such abilities are part of the range of human abilities among the population ensuring long - term species survival that is to say that they are commonly present among a steady fraction of members of the species . the examples suggest that if organ health can be improved by experiencing particular stimuli , as grakov has demonstrated , that is good reason for physiological properties and structures promoting it to have developed naturally : the system has a valid biology ( 6,7 ) . reasons given above suggest that the structures include the brain cortex with all its layers for data processing , transformation and cognition . although the fundamental influence of light in stimulating organismic function , and thus health , are well known , most medical thinking attributes this to its effect on the pineal , pituitary and neuroendocrine system . chromotherapy is still a relatively obscure aspect of complementary medicine , particularly in the subtle forms reviewed by azeemi and raza ( 1 ) . although their hypothesis that colored light may be able to influence the internal structure of water may have substance , grakov 's account of his system of virtual scanning offers another way to understand the influence of color on health : the central nervous system is so constructed that there is a feedback between color cognition and organ monitoring and stimulation by the brain . when an organ is in the process of slowly developing a pathology , it emits increasingly strong neural signals to the brain indicating the degree of degeneration of its condition ; the brain responds by applying appropriate compensatory stimulation . color processing is among many aspects of cns function influenced in specific ways by all such signals , with the following results : ( i ) color tests can be used to identify both organ pathology and brain compensation . ( ii ) stimulation by appropriate colored light has a therapeutic effect on specific organs . specifically , grakov 's virtual scanning test of color cognition yields values for the following : health information transmitted to the brain from each organ.neural signals transmitted by the brain to stimulate each organ and compensate for problems detected . neural signals transmitted by the brain to stimulate each organ and compensate for problems detected . the latter offer insights to understand other phenomena in different fields of biology and the health sciences , for example , how known benefits of meditation practice may benefit health ( 17,18 ) , or , in sense perception , the problem of the so - called anosmias , where a person with an otherwise well - functioning sense of smell may be completely unable to detect the aroma of particular molecules ( 19 ) virtual scanning is well established in russia , where it has been found to yield valuable results for many pathologies . since the mechanisms it proposes for the influence of different colored light on specific health problems lie within the structure of conventional science , virtual scanning deserves consideration by biomedicine and cam , as well as those interested in chromotherapy .

virtual scanning incorporates novel uses of colored light into its system of health assessment and therapy . independent investigations of its effectiveness in russia and the uk have revealed unique abilities to correct incipient and fully developed chronic conditions . as such it forms an important new addition to the field of chromotherapy . it differs from most others , in that its development depended on discoveries in neuroscience by its inventor , and subsequent application of new models in computational neuroscience .

the national health and nutrition examination surveys ( nhanes ) assess health and nutritional status in a representative sample of the us noninstitutionalized civilian population . all adults provided written consent , which was approved by the national center for health statistics.22 , 23 participants included adults aged 21 to 79 years in nhanes 20072012 with 1 recorded blood pressure ( bp ) and a complete lipid profile . statin use was determined from medications reportedly taken in the prior 30 days and a match to known statins . race / ethnicity was determined by selfreport and separated into nonhispanic white ( white ) , nonhispanic black ( black ) , hispanic ethnicity , and other . bp was measured and analyzed according to nhanes guidelines.22 , 23 , 24 hypertension was defined by systolic bp 140 and/or diastolic bp 90 mm hg or positive response to are you currently taking prescribed medication to lower your bp ? systolic bp of 60 to 300 mm hg and diastolic bp of 30 to 240 mm hg were accepted as valid . prevalent diabetes mellitus included ( 1 ) diagnosed diabetes mellitus defined by positive response(s ) to 1 question , have you ever been told by a doctor that you have diabetes mellitus ? or are you now taking insulin ? or are you now taking diabetic pills to lower your blood sugar ? and ( 2 ) undiagnosed diabetes mellitus was defined by negative responses to the questions and fasting glucose 126 mg / dl or glycosylated hemoglobin 6.5%.25 as shown in figure 1 , fewer than half of adult participants in nhanes provided fasting blood samples . total cholesterol and highdensity lipoprotein cholesterol ( hdlc ) were measured on all participants regardless of fasting status , whereas triglycerides were measured and ldlc calculated only from fasting samples . for patients with triglyceride levels > 400 mg / dl ( n=128 , representing 3 627 587 us adults [ aged 2179 years ] ) , ldlc was not calculated . total cholesterol of 40 to 800 mg / dl , hdlc of 2 to 140 mg / dl , ldlc of 20 to 700 mg / dl , and triglycerides of 20 to 12 000 mg / dl were accepted as valid . flow diagram showing derivation of the study sample with numbers and reasons for exclusion from consideration for statin therapy ( left ) . among adults not taking statins , the numbers of statinineligible and eligible adults are also shown ( right ) . adult men and women aged 21 to 79 years were included with a valid bp and complete lipid profile including calculated ldlc . exclusion criteria were selfreported congestive heart failure and estimated glomerular filtration rate < 15 ml/1.73 m per minute.5 chronic kidney disease was defined by estimated glomerular filtration rate of 15 to 59 ml/1.73 m per minute.26 statin eligibility by the 2013 acc / aha cholesterol guideline was defined as summarized in table 1.6 summary of statineligible groups in the 2013 acc / aha cholesterol guideline acc / aha indicates american college of cardiology / american heart association ; ascvd , atherosclerotic cardiovascular disease ; a , multiple randomized clinical trials or metaanalyses ; b , single randomized trial or nonrandomized studies ; cor , class of recommendation ; i , benefit risk ; iia , benefit risk ; ldlc , lowdensity lipoprotein cholesterol ; loe , level of evidence . for the main analysis , we assumed that 75% of adults without diabetes mellitus and ascvd10 7.5% ( 1a for moderate to highintensity statin ) and 50% with diabetes mellitus and ascvd10 7.5% ( iiab for highintensity statin ) would receive highintensity statin . assumptions reflect arbitrary estimates of how informed clinicians would balance recommendations and benefit : risk information . for every 2 additional cases of incident diabetes mellitus with high versus moderateintensity statin in patients with chd , 6.5 fewer major vascular events occur.16 dr robinson , coauthor of the 2013 cholesterol guideline , summarized safety data on statin therapy,14 , 27 , 28 which indicated that the 5year number neededtoharm ( nnh ) was 167 for moderateintensity and 63 for highintensity statin therapy.19 with regard to rhabdomyolysis , a nonsignificant increase with high versus moderateintensity statin was noted in 1 metaanalysis ( odds ratio 1.66 , p=0.326).18 given uncertainty over what intensity statin therapy clinicians would prescribe , a sensitivity analysis was performed for these 2 groups by varying the percentages on moderate and highintensity statins from 0% to 100% . assumptions included ( 1 ) for each 39mg / dl decline in ldlc , ascvd events would fall 21% for ascvd10 20% and 33% for ascvd10 < 20%15 ; ( 2 ) ldl c would fall 33% with moderateintensity and 51% with highintensity statin therapy , that is , the conservative end of the estimated 30% to < 50% ldlc reduction with moderateintensity and 50% decline with highintensity statins6 , 29 ; and ( 3 ) for patients with prior stroke or myocardial infarction in whom ascvd10 is not calculated , a 39% 10year risk was assigned . in subjects with angina or transient ischemic attack , a 10year risk of 31.5% patients with chd risk equivalent status , excluding diabetes mellitus,6 have a 10year chd risk of > 20%.20 , 30 , 31 respective risks of 26% and 21% were multiplied by 1.5 , which assumes ascvd10 event rates were 50% greater than 10year chd risk alone . this assumption is conservative , as annual numbers of strokes ( 795 000 ) and myocardial infarctions ( 735 000 ) in the united states are similar.1 , 2 ascvd10 , while not required for treating adults aged 21 to 79 years with ldlc 190 mg / dl,6 was calculated to estimate absolute risk reduction ( arr ) and number neededtotreat ( nnt ) . the acc / aha ascvd risk calculator accepts ages 20 to 79 years and limits total cholesterol values to a maximum of 320 mg / dl . in nhanes 20072012 , 0.59% of adults aged 21 to 79 years in the fasting sample used for this analysis had total cholesterol levels of > 320 , and all of them had ldlc levels of 190 mg / dl . sas enterprise guide 7.1 was used for all analyses and accounts for complex sampling characteristics of nhanes . onehalf of nhanes participants were studied in the morning and were instructed to fast at least 9 hours before their examination . triglyceride and calculated ldlc values are provided only for the fasting participants studied in the morning . because fasting is an important defining characteristic of subjects in our analysis , absolute risk reduction ( arr ) and number neededtotreat ( nnt ) were calculated using proc surveymeans . as shown in figure 1 , fewer than half of adult participants in nhanes provided fasting blood samples . total cholesterol and highdensity lipoprotein cholesterol ( hdlc ) were measured on all participants regardless of fasting status , whereas triglycerides were measured and ldlc calculated only from fasting samples . for patients with triglyceride levels > 400 mg / dl ( n=128 , representing 3 627 587 us adults [ aged 2179 years ] ) , ldlc was not calculated . total cholesterol of 40 to 800 mg / dl , hdlc of 2 to 140 mg / dl , ldlc of 20 to 700 mg / dl , and triglycerides of 20 to 12 000 mg / dl were accepted as valid . flow diagram showing derivation of the study sample with numbers and reasons for exclusion from consideration for statin therapy ( left ) . among adults not taking statins , the numbers of statinineligible and eligible adults are also shown ( right ) . adult men and women aged 21 to 79 years were included with a valid bp and complete lipid profile including calculated ldlc . exclusion criteria were selfreported congestive heart failure and estimated glomerular filtration rate < 15 ml/1.73 m per minute.5 chronic kidney disease was defined by estimated glomerular filtration rate of 15 to 59 ml/1.73 m per minute.26 statin eligibility by the 2013 acc / aha cholesterol guideline was defined as summarized in table 1.6 summary of statineligible groups in the 2013 acc / aha cholesterol guideline acc / aha indicates american college of cardiology / american heart association ; ascvd , atherosclerotic cardiovascular disease ; a , multiple randomized clinical trials or metaanalyses ; b , single randomized trial or nonrandomized studies ; cor , class of recommendation ; i , benefit risk ; iia , benefit risk ; ldlc , lowdensity lipoprotein cholesterol ; loe , level of evidence . for the main analysis , we assumed that 75% of adults without diabetes mellitus and ascvd10 7.5% ( 1a for moderate to highintensity statin ) and 50% with diabetes mellitus and ascvd10 7.5% ( iiab for highintensity statin ) would receive highintensity statin . assumptions reflect arbitrary estimates of how informed clinicians would balance recommendations and benefit : risk information . for every 2 additional cases of incident diabetes mellitus with high versus moderateintensity statin in patients with chd , 6.5 fewer major vascular events occur.16 dr robinson , coauthor of the 2013 cholesterol guideline , summarized safety data on statin therapy,14 , 27 , 28 which indicated that the 5year number neededtoharm ( nnh ) was 167 for moderateintensity and 63 for highintensity statin therapy.19 with regard to rhabdomyolysis , a nonsignificant increase with high versus moderateintensity statin was noted in 1 metaanalysis ( odds ratio 1.66 , p=0.326).18 given uncertainty over what intensity statin therapy clinicians would prescribe , a sensitivity analysis was performed for these 2 groups by varying the percentages on moderate and highintensity statins from 0% to 100% . assumptions included ( 1 ) for each 39mg / dl decline in ldlc , ascvd events would fall 21% for ascvd10 20% and 33% for ascvd10 < 20%15 ; ( 2 ) ldl c would fall 33% with moderateintensity and 51% with highintensity statin therapy , that is , the conservative end of the estimated 30% to < 50% ldlc reduction with moderateintensity and 50% decline with highintensity statins6 , 29 ; and ( 3 ) for patients with prior stroke or myocardial infarction in whom ascvd10 is not calculated , a 39% 10year risk was assigned . in subjects with angina or transient ischemic attack , a 10year risk of 31.5% was assigned . patients with chd risk equivalent status , excluding diabetes mellitus,6 have a 10year chd risk of > 20%.20 , 30 , 31 respective risks of 26% and 21% were multiplied by 1.5 , which assumes ascvd10 event rates were 50% greater than 10year chd risk alone . this assumption is conservative , as annual numbers of strokes ( 795 000 ) and myocardial infarctions ( 735 000 ) in the united states are similar.1 , 2 ascvd10 , while not required for treating adults aged 21 to 79 years with ldlc 190 mg / dl,6 was calculated to estimate absolute risk reduction ( arr ) and number neededtotreat ( nnt ) . the acc / aha ascvd risk calculator accepts ages 20 to 79 years and limits total cholesterol values to a maximum of 320 mg / dl . in nhanes 20072012 , 0.59% of adults aged 21 to 79 years in the fasting sample used for this analysis had total cholesterol levels of > 320 , and all of them had ldlc levels of 190 mg / dl . sas enterprise guide 7.1 was used for all analyses and accounts for complex sampling characteristics of nhanes . onehalf of nhanes participants were studied in the morning and were instructed to fast at least 9 hours before their examination . triglyceride and calculated ldlc values are provided only for the fasting participants studied in the morning . because fasting is an important defining characteristic of subjects in our analysis , the fasting sample weight , wtsaf2yr , was used . ascvd reduction was calculated with the use of proc surveymeans . absolute risk reduction ( arr ) and number neededtotreat ( nnt ) were calculated using proc surveymeans . the process for selecting adults for statin eligibility and the number of adults in each statineligible group are provided in figure 1 . as shown , 6758 adults 21 to 79 years old were included in the fasting sample for nhanes 20072012 ; 128 ( 1.9% ) , or an estimated 3 627 587 adults , had triglyceride levels > 400 mg / dl and were excluded from consideration for statin eligibility . statin users comprised 32 million ( 15.4% ) of 208 million us adults aged 21 to 79 years . compared with adults not reporting statin use , those taking statins ( 1 ) were older and more likely to be male and white , ( 2 ) more often had health insurance , ( 3 ) had incomes 200% of the federal poverty level , and ( 4 ) had more healthcare visits in the previous year , higher body mass indices , and more prevalent obesity , hypertension , diabetes mellitus , stage 3 to 4 chronic kidney disease , clinical ascvd , systolic bp , and triglycerides but lower diastolic bp , total cholesterol , ldlc , and hdlc levels and fewer cigarette smokers ( tables 2 and 3 ) . demographic , educational , and economic characteristics of adults 2179 years by statin use and eligibility status continuous variables ( age ) are presented as mean1 se . categorical variables are presented as nhanes sample number ( n ) and percentage ( % ) of us population represented by nhanes sample number . the sum of nvalues for participant subgroups on variables , such as visits and education , do not always equal overall nhanes sample n because of missing data . sample weights on subjects with data were adjusted by nhanes so that summation of subgroup percentages reflect 100% of the us population n for that column , such as taking statins , no statin therapy , statin eligible , and statin ineligible . ascvd indicates atherosclerotic cardiovascular disease ; educ , highest education level attained ; fpl , federal poverty level ; n , number represented in us population by nhanes sample ; nhanes , national health and nutrition examination surveys ; og , other government . selected medical characteristics of adults aged 2179 years by statin use and eligibility status continuous variables are presented as mean1 se . categorical variables are presented as nhanes sample number ( n ) and percentage ( % ) of us population represented by nhanes sample number . ascvd indicates atherosclerotic cardiovascular disease ; bmi , body mass index ; chol , cholesterol ; ckd , chronic kidney disease ; d , diastolic ; hba1c , glycosylated hemoglobin ; hdl , highdensity lipoprotein ; ldl , lowdensity lipoprotein : nhanes , national health and nutrition examination surveys ; og , other governmental insurance ; sbp , systolic blood pressure . of an estimated 175.9 million adults not reporting statin use , 44.8 million ( 25.5% ) were statin eligible by the 2013 cholesterol guideline.3 compared with statinineligible adults , the statineligible group ( 1 ) was older , more often male and white or black , and less often hispanic ; ( 2 ) had lower educational attainment but similar incomes ; ( 3 ) more often had health insurance ; ( 4 ) reported more healthcare visits ; ( 5 ) more often had hypertension , diabetes mellitus , and chronic kidney disease and smoked cigarettes ; and ( 6 ) had higher body mass index , systolic and diastolic bp , total cholesterol and ldlc , and triglycerides but lower hdlc ( tables 2 and 3 ) . data are provided for the number of adults in the various groups of statineligible adults , ( 1 ) all statineligible adults combined , ( 2 ) only statineligible adults with ascvd10 7.5% , and ( 3 ) only statineligible adults with ascvd10 < 7.5% . treating all statineligible adults is estimated to prevent 2 435 890 events over 10 years or 243 589 events / year . for this group , arr is 5.4% , with 10year nnt of 18 . treating only statineligible adults with ascvd10 7.5% prevents an estimated 2 179 743 events over 10 years or 217 974 events / year ; arr is 6.8% with nnt of 15 . for statineligible adults with table 3 also provides data assuming that 75% and 50% of all statineligible adults receive statins with the expected proportionate reductions in numbers of individuals treated and ascvd events prevented ( table 4 ) . ascvd events prevented in 10 years by statineligible group and when the percentages of statineligible adults on statins vary ascvd indicates atherosclerotic cardiovascular disease . statin ascvd10 , n indicates number of ascvd events over 10 years with statins ; dm , dm present ; dm , dm absent ; statin ascvd10 , % , 10year ascvd risk without a statin ; statin ascvd10 , n , number of ascvd events over 10 years without a statin ; arr , absolute risk reduction ; dm , diabetes mellitus ; nnt , 10year number neededtotreat to prevent an ascvd event ; rrr , relative risk reduction . fifty percent of patients with ( ) diabetes mellitus ( dm ) and ascvd10 7.5% receive highintensity and 50% receive moderateintensity statins . seventyfive percent of patients without ( ) diabetes mellitus receive highintensity and 25% receive moderateintensity statins . includes ascvd , ldl 190 , and patients with and without diabetes mellitus and 10year ascvd risk ( ascvd10 ) 7.5% and excludes lowerrisk participants with ( ) diabetes mellitus ( dm ) and ascvd10 < 7.5% and without ( ) diabetes mellitus ( dm ) and ascvd10 57.4% . includes only lower risk participants with diabetes mellitus and ascvd10 < 7.5% and without diabetes and ascvd10 57.4% . adults with diabetes mellitus and ascvd10 risk 7.5% have a 1a recommendation for moderateintensity and a iiab recommendation for highintensity statins ( table 4 , figure 2 ) . adults without diabetes mellitus and ascvd10 risk 7.5% have a 1a recommendation for moderate to highintensity statins . the absolute number of ascvd events prevented and arr increase as the proportion of adults on highintensity statins increases ( table 5 ) , whereas nnt falls ( figure 2 ) . absolute risk reduction ( arr ) in 10year risk for atherosclerotic cardiovascular disease ( ascvd)10 and number neededtotreat ( nnt ) to prevent an ascvd event are depicted for adults with and without diabetes mellitus and with ascvd 10 7.5% . the data points reflect changes in arr and nnt as the proportion of individuals taking moderatedose ( md ) and highdose ( hd ) statins varies from 0% to 100% in 25% increments 7.5%a taking high and moderateintensity statins ascvd indicates atherosclerotic cardiovascular disease ; nnt , number neededtotreat . participants with ( ) and without ( ) diabetes mellitus ( dm ) and 10year ascvd risk ( ascvd10 ) participants with ascvd and ldl 190 have an indication for highintensity statins and were excluded . only participants with ( ) diabetes mellitus ( dm ) who also had ascvd10 7.5% were included . only participants without ( ) dm and ascvd10 7.5% statin users comprised 32 million ( 15.4% ) of 208 million us adults aged 21 to 79 years . compared with adults not reporting statin use , those taking statins ( 1 ) were older and more likely to be male and white , ( 2 ) more often had health insurance , ( 3 ) had incomes 200% of the federal poverty level , and ( 4 ) had more healthcare visits in the previous year , higher body mass indices , and more prevalent obesity , hypertension , diabetes mellitus , stage 3 to 4 chronic kidney disease , clinical ascvd , systolic bp , and triglycerides but lower diastolic bp , total cholesterol , ldlc , and hdlc levels and fewer cigarette smokers ( tables 2 and 3 ) . demographic , educational , and economic characteristics of adults 2179 years by statin use and eligibility status continuous variables ( age ) are presented as mean1 se . categorical variables are presented as nhanes sample number ( n ) and percentage ( % ) of us population represented by nhanes sample number . the sum of nvalues for participant subgroups on variables , such as visits and education , do not always equal overall nhanes sample n because of missing data . sample weights on subjects with data were adjusted by nhanes so that summation of subgroup percentages reflect 100% of the us population n for that column , such as taking statins , no statin therapy , statin eligible , and statin ineligible . ascvd indicates atherosclerotic cardiovascular disease ; educ , highest education level attained ; fpl , federal poverty level ; n , number represented in us population by nhanes sample ; nhanes , national health and nutrition examination surveys ; og , other government . selected medical characteristics of adults aged 2179 years by statin use and eligibility status continuous variables are presented as mean1 se . categorical variables are presented as nhanes sample number ( n ) and percentage ( % ) of us population represented by nhanes sample number . ascvd indicates atherosclerotic cardiovascular disease ; bmi , body mass index ; chol , cholesterol ; ckd , chronic kidney disease ; d , diastolic ; hba1c , glycosylated hemoglobin ; hdl , highdensity lipoprotein ; ldl , lowdensity lipoprotein : nhanes , national health and nutrition examination surveys ; og , other governmental insurance ; sbp , systolic blood pressure . of an estimated 175.9 million adults not reporting statin use , 44.8 million ( 25.5% ) were statin eligible by the 2013 cholesterol guideline.3 compared with statinineligible adults , the statineligible group ( 1 ) was older , more often male and white or black , and less often hispanic ; ( 2 ) had lower educational attainment but similar incomes ; ( 3 ) more often had health insurance ; ( 4 ) reported more healthcare visits ; ( 5 ) more often had hypertension , diabetes mellitus , and chronic kidney disease and smoked cigarettes ; and ( 6 ) had higher body mass index , systolic and diastolic bp , total cholesterol and ldlc , and triglycerides but lower hdlc ( tables 2 and 3 ) . data are provided for the number of adults in the various groups of statineligible adults , ( 1 ) all statineligible adults combined , ( 2 ) only statineligible adults with ascvd10 7.5% , and ( 3 ) only statineligible adults with ascvd10 < 7.5% . treating all statineligible adults is estimated to prevent 2 435 890 events over 10 years or 243 589 events / year . for this group , arr is 5.4% , with 10year nnt of 18 . treating only statineligible adults with ascvd10 7.5% prevents an estimated 2 179 743 events over 10 years or 217 974 events / year ; table 3 also provides data assuming that 75% and 50% of all statineligible adults receive statins with the expected proportionate reductions in numbers of individuals treated and ascvd events prevented ( table 4 ) . ascvd events prevented in 10 years by statineligible group and when the percentages of statineligible adults on statins vary ascvd indicates atherosclerotic cardiovascular disease . statin ascvd10 , n indicates number of ascvd events over 10 years with statins ; dm , dm present ; dm , dm absent ; statin ascvd10 , % , 10year ascvd risk without a statin ; statin ascvd10 , n , number of ascvd events over 10 years without a statin ; arr , absolute risk reduction ; dm , diabetes mellitus ; nnt , 10year number neededtotreat to prevent an ascvd event ; rrr , relative risk reduction . fifty percent of patients with ( ) diabetes mellitus ( dm ) and ascvd10 7.5% receive highintensity and 50% receive moderateintensity statins . seventyfive percent of patients without ( ) diabetes mellitus receive highintensity and 25% receive moderateintensity statins . includes ascvd , ldl 190 , and patients with and without diabetes mellitus and 10year ascvd risk ( ascvd10 ) 7.5% and excludes lowerrisk participants with ( ) diabetes mellitus ( dm ) and ascvd10 < 7.5% and without ( ) diabetes mellitus ( dm ) and ascvd10 57.4% . includes only lower risk participants with diabetes mellitus and ascvd10 < 7.5% and without diabetes and ascvd10 57.4% . adults with diabetes mellitus and ascvd10 risk 7.5% have a 1a recommendation for moderateintensity and a iiab recommendation for highintensity statins ( table 4 , figure 2 ) . adults without diabetes mellitus and ascvd10 risk 7.5% have a 1a recommendation for moderate to highintensity statins . the absolute number of ascvd events prevented and arr increase as the proportion of adults on highintensity statins increases ( table 5 ) , whereas nnt falls ( figure 2 ) . absolute risk reduction ( arr ) in 10year risk for atherosclerotic cardiovascular disease ( ascvd)10 and number neededtotreat ( nnt ) to prevent an ascvd event are depicted for adults with and without diabetes mellitus and with ascvd 10 7.5% . the data points reflect changes in arr and nnt as the proportion of individuals taking moderatedose ( md ) and highdose ( hd ) statins varies from 0% to 100% in 25% increments . sensitivity analysis on percentages of adults with and without diabetes mellitus and ascvd10 7.5%a taking high and moderateintensity statins ascvd indicates atherosclerotic cardiovascular disease ; nnt , number neededtotreat . participants with ( ) and without ( ) diabetes mellitus ( dm ) and 10year ascvd risk ( ascvd10 ) participants with ascvd and ldl 190 have an indication for highintensity statins and were excluded . only participants with ( ) diabetes mellitus ( dm ) who also had ascvd10 7.5% were included . only participants without ( ) dm and ascvd10 7.5% statins are recommended for the primary and secondary prevention of chd and stroke.5 , 6 , 7 given projections for a rapidly growing burden of cardiovascular disease in the united states,32 the role of statins merits attention . in the united states , there are more statineligible adults not receiving statins than adults reporting statin use ( table 2 ) . if all statineligible adults were treated , or roughly 44.8 million individuals , then 243 589 ascvd events annually or 2 435 890 events over 10 years ( table 4 ) could be prevented . the number of ascvd events prevented is 78% of the healthy people 2020 goal for cardiovascular disease prevention . implementing the 2013 cholesterol guideline in statineligible us adults is also relatively efficient with arr of 5.4% and 10year nnt of 18 . treating only statineligible adults with 10year ascvd risk 7.5% reduces the number of adults treated by 12.6 million individuals or 28.2% from 44.8 to 32.2 million . yet , the number of ascvd events prevented annually falls only 10.5% from 243 589 to 217 974 , which is 70% of the healthy people 2020 goal . for this higherrisk group , the 2013 cholesterol guideline is less efficient for untreated , statineligible adults with 10year ascvd risk < 7.5% , that is , treating 12.6 million adults in this group would prevent 256 147 events over 10 years or 25 615 annually , with arr of 2.0% and 10year nnt of 49 . the feasibility of identifying and treating 100% of statineligible but untreated adults is low . as an initial step , treating 50% of untreated , statineligible adults would also have a positive impact on healthy people 2020 goals for cardiovascular disease prevention and is credible for several reasons . first , 2 of 3 statineligible but untreated adults report 2 healthcare visits annually ( table 2 ) , which indicates opportunities for assessing ascvd risk and statin eligibility . second , 80% are insured , which suggests some financial support for screening and treatment . third , treating half of statineligible adults and continuing treatment in those currently on statins would bring statin therapy to 71% of statineligible adults . this is comparable to the proportion of all adults with hypertension receiving pharmacotherapy since 20072008.22 fourth , the majority of statineligible but untreated adults also have hypertension with the majority receiving treatment and having 2 healthcare visits annually.22 fifth , most statins are available as generics with several on discount formularies at < $ 50/year.33 individuals prescribed generic statins experience fewer cardiovascular events and deaths than do individuals prescribed proprietary statins,34 which suggests the former are more likely than the latter to obtain and take statin medications . sixth , the percentage of adults taking statins is growing faster than percentages of adults taking antihypertensive medications ; that is , the prescribing gap between statins and antihypertensive medications is closing.35 the points provided could support a more ambitious target than treating 50% of untreated , statineligible adults . yet , the 50% target is an important step in moving to even higher treatment levels . the impact of raising the percentage of statineligible adults taking statins from 50% to 75% is enumerated in table 4 . our principal analysis assumed that among adults with ascvd 7.5% , 50% of those with diabetes mellitus would receive moderateintensity and the other would receive 50% highintensity statin . for the subset without diabetes mellitus , 25% were estimated to receive moderate and 75% to receive highintensity statin . since those were only estimates , sensitivity analyses were conducted , which varied the proportion taking moderate and highintensity statins from 0% to 100% . arr and the number of ascvd events prevented rose as the proportion taking highintensity statins increased , whereas the nnt to prevent an ascvd event fell ( table 5 , figure 2 ) . costeffectiveness of statin therapy , while not the focus of our report , is relevant in extending treatment to millions of additional statineligible patients . the cost per quality adjusted lifeyear for adults with 10year ascvd10 risk of 7.5% to < 10% was estimated at $ 37 000.10 lowering the treatment threshold further to an ascvd10 of 4.0% raised the cost / qualityadjusted lifeyear to $ 81 000 . treating all adults 75 years old with ascvd10 7.5% led to a cost estimate of $ 25 200 per disabilityadjusted lifeyear.36 the incremental costeffectiveness ratio per qualityadjusted lifeyear for high versus moderatedose statins was < $ 50 000 , a commonly accepted threshold for costeffectiveness , assuming a cost differential of < $ 1.70/day between the 2 statin doses.37 safety is another important consideration when increasing the proportion of adults receiving statin therapy . dr robinson , coauthor of the 2013 cholesterol guideline,6 summarized safety data on statin therapy,14 , 27 , 28 which indicated that the 5year nnh was 167 for moderate and 63 for highintensity statin therapy.19 with regard to the risktobenefit considerations with high versus moderateintensity statin therapy , and assuming a linear relationship between 1 and 5year risk , the 5year nnt in adults with chd taking high versus moderateintensity statin is 31 to prevent a major vascular event versus an nnh of 100 for diabetes mellitus.15 analyses from jupiter indicate that statinrelated diabetes mellitus reflects a shortening of the latent period from prediabetes to diabetes mellitus by a few weeks . in jupiter , only minimal changes in the fasting glucose and glycosylated hemoglobin values were observed among all statintreated participants.27 limitations include a small sample of the us civilian population , partially explained by missing ldlc in over half of nhanes adults as previously noted ( figure 1).22 health care is dynamic , and data from 2007 to 2012 may not reflect current realities . the potential for ascvd prevention is limited by clinical barriers , such as lack of data to assess eligibility and failure to assess eligibility when data are available or to prescribe statins when appropriate for ascvd risk . patients may fail to fill prescriptions or persist in taking statins , yet substantial persistence with statin therapy at 3 years was documented.38 and , widely available , lowcost generic statins improve outcomes relative to proprietary statins.33 , 34 in summary , healthy people 2020 aims to reduce chd and stroke by 20%.5 our estimates suggest that implementing the 2013 cholesterol guideline in all statineligible adults , or 44.8 million individuals , would accomplish > 75% of the healthy people 2020 annual goal for ascvd prevention . implementing the 2013 cholesterol guideline in all statineligible adults with ascvd10 7.5% could achieve 70% of healthy people 2020 goals , while reducing the number of adults initiated on statin therapy to 32.2 million . an initial step of treating only half of statineligible adults would make a substantial impact in reducing cardiovascular events . given the projected health benefits and in view of clinical safety and costeffectiveness considerations , public health , healthcare policy , and population healthcare initiatives to effectively implement the 2013 cholesterol guideline appear justified , especially for those with a 10year ascvd risk of 7.5% . these initiatives have the potential to enhance success with an important healthy people 2020 goal for cardiovascular disease prevention and to attenuate a large projected increase in the burden of ascvd.32 this research was supported in part by funding from the centers for disease control through the south carolina department of health and environmental control and from the health research services administration through the medical university of south carolina . the funding agencies did not participate in the design and conduct of the study or collection , management , analysis and interpretation of the data , or in preparation , review and approval of the manuscript . dr egan has received royalties from uptodate , research support from medtronic and quintiles , and income as a consultant from astrazeneca and medtronic . dr ferdinand has received research support from boehringer ingelheim and income as a consultant from boehringer ingelheim , amgen , sanofi . dr white has received income as a consultant form merck & co. the other authors have nothing to disclose .

backgroundhealthy people 2020 aim to reduce fatal atherosclerotic cardiovascular disease ( ascvd ) by 20% , which translates into 310 000 fewer events annually assuming proportional reduction in fatal and nonfatal ascvd . we estimated preventable ascvd events by implementing the american college of cardiology / american heart association ( acc / aha ) 2013 cholesterol guideline in all statineligible adults . absolute risk reduction ( arr ) and number neededtotreat ( nnt ) were calculated.methods and resultsnational health and nutrition examination survey data for 20072012 were analyzed for adults aged 21 to 79 years and extrapolated to the us population . literatureguided assumptions were used including ( 1 ) lowdensity lipoprotein cholesterol falls 33% with moderateintensity statins and 51% with highintensity statins ; ( 2 ) for each 39 mg / dl decline in lowdensity lipoprotein cholesterol , 10year ascvd 10 risk would fall 21% when ascvd 10 risk was 20% and 33% when ascvd 10 risk was < 20% ; and ( 3 ) either all statineligible untreated adults or all with ascvd 10 risk 7.5% would receive statins . of 175.9 million adults aged 21 to 79 years not taking statins , 44.8 million ( 25.5% ) were statin eligible . treating all statineligible adults would prevent an estimated 243 589 ascvd events annually ( arr 5.4% , 10year nnt 18 ) . treating all statineligible adults with ascvd 10 risk 7.5% reduces the number treated to 32.2 million ( 28.2% fewer ) , whereas ascvd events prevented annually fall only 10.5% to 217 974 ( 6.8% arr , nnt 15).conclusionsimplementing the acc / aha 2013 cholesterol guideline in all untreated , statineligible adults could achieve 78% of the healthy people 2020 ascvd prevention goal . most of the benefit is attained by individuals with 10year ascvd risk 7.5% .

diabetes mellitus is a chronic metabolic disorder caused by deficiency and/or ineffectiveness of insulin . with its increasing frequency of acute and chronic complications and its increasing morbidity and mortality , diabetes has caused a considerable loss of labor and exerted a heavy economic burden on society . sleep disorders are described as disturbances in falling asleep or staying asleep and the having nonrestful sleep . sleep disorders can lead to important negative consequences : adversely affecting lives by impairing school or business performance , marriage , etc . , studies have reported the presence of sleep disorders in approximately 5070% of diabetic patients . sleep disorders in diabetic patients may contribute to poor glycemic control , diabetic neuropathy , and overnight hypoglycemia . studies have revealed that there is a bidirectional relationship between sleep disorders and diabetes : diabetes may cause sleep disorders , while sleep disorders may also complicate the control of diabetes . the presence of sleep disturbances is a factor in increasing the rate of complications in chronic diseases . the prevalence of obstructive sleep apnea syndrome ( osas ) is directly proportional to age and weight and occurs frequently in diabetic patients . this study aimed to determine the frequency of sleep disorders in diabetic patients by using the berlin questionnaire ( bq ) for osas , the epworth sleepiness scale ( ess ) , and the pittsburgh sleep quality index ( psqi ) and to investigate possible relationships between scores of these sleep disorders and osas and the diabetic parameters ( fasting blood glucose , hba1c , and lipid levels ) . this study included 585 type 2 diabetic patients admitted to family medicine clinics between october and december 2014 . inclusion criteria were : ( 1 ) the diagnosis of type 2 diabetes mellitus and ( 2 ) aged over 18 years . five hundred and ninety - six patients were originally included , but 11 patients with known sleep disturbances ( osas ) under treatment were excluded . ethical approval was obtained from ethics committee of turgut zal medical center clinical research , inonu university . demographic characteristics ( age , gender , weight , height , smoking , and drugs used ) were recorded . the patients complete blood counts , liver function tests , and thyroid - stimulating hormone values were within normal limits . routine blood analysis included parameters of diabetes control ( hba1c , fasting blood glucose , and lipid profiles ) . blood glucose , total cholesterol , triglycerides ( tg ) , low - density lipoprotein ( ldl ) , and high - density lipoprotein were measured using the immunometric chemiluminescence method . the ess is a self - rating questionnaire used to assess average daytime sleepiness , consisting of eight questions scored 03 . the questions examine the possibility of falling asleep in certain situations in an ordinary nontiring day , using the following scale : 0 = would never doze or sleep ; 1 = slight chance of dozing or sleeping ; 2 = moderate chance of dozing or sleeping ; and 3 = high chance of dozing or sleeping . a total score of 10 or more from the 8 questions reflects above - normal daytime sleepiness ( inadequate sleep and the need to improve sleep hygiene ) and indicates a need for further evaluation . the patient were divided into normal sleep group and very sleepy group according to ess results . the psqi evaluates the quality of sleep across seven component domains : subjective sleep quality , sleep latency , sleep duration , habitual sleep efficiency , sleep disturbances , use of sleep medication , and daytime dysfunction over the last month . after processing , each of the components has a score from 0 to 3 , with 3 indicating the greatest sleep problems . the scores for the seven components are added , and a total score of 5 or greater is indicative of poor sleep quality . each category is evaluated in itself , and if two or more categories have positive results , the subject is considered to have a high - risk for osas . the data are shown as a mean standard deviation ( sd ) , percentages , or median ( interquartile range [ iqr ] ) . the odds ratio ( or ) with 95% confidence intervals ( cis ) was used to determine the risk factors . spss statistics for windows , version 21.0 ( ibm corp . , armonk , ny , usa ) was used for statistical analysis . sleep , sleep quality , and sleep scores were taken as dependent variables . a p value of < 0.05 was considered as statistically significant . this study included 585 type 2 diabetic patients admitted to family medicine clinics between october and december 2014 . inclusion criteria were : ( 1 ) the diagnosis of type 2 diabetes mellitus and ( 2 ) aged over 18 years . five hundred and ninety - six patients were originally included , but 11 patients with known sleep disturbances ( osas ) under treatment were excluded . ethical approval was obtained from ethics committee of turgut zal medical center clinical research , inonu university . demographic characteristics ( age , gender , weight , height , smoking , and drugs used ) were recorded . the patients complete blood counts , liver function tests , and thyroid - stimulating hormone values were within normal limits . routine blood analysis included parameters of diabetes control ( hba1c , fasting blood glucose , and lipid profiles ) . blood glucose , total cholesterol , triglycerides ( tg ) , low - density lipoprotein ( ldl ) , and high - density lipoprotein were measured using the immunometric chemiluminescence method . the ess is a self - rating questionnaire used to assess average daytime sleepiness , consisting of eight questions scored 03 . the questions examine the possibility of falling asleep in certain situations in an ordinary nontiring day , using the following scale : 0 = would never doze or sleep ; 1 = slight chance of dozing or sleeping ; 2 = moderate chance of dozing or sleeping ; and 3 = high chance of dozing or sleeping . a total score of 10 or more from the 8 questions reflects above - normal daytime sleepiness ( inadequate sleep and the need to improve sleep hygiene ) and indicates a need for further evaluation . the patient were divided into normal sleep group and very sleepy group according to ess results . the psqi evaluates the quality of sleep across seven component domains : subjective sleep quality , sleep latency , sleep duration , habitual sleep efficiency , sleep disturbances , use of sleep medication , and daytime dysfunction over the last month . after processing , each of the components has a score from 0 to 3 , with 3 indicating the greatest sleep problems . the scores for the seven components are added , and a total score of 5 or greater is indicative of poor sleep quality . each category is evaluated in itself , and if two or more categories have positive results , the subject is considered to have a high - risk for osas . the data are shown as a mean standard deviation ( sd ) , percentages , or median ( interquartile range [ iqr ] ) . the shapiro the odds ratio ( or ) with 95% confidence intervals ( cis ) was used to determine the risk factors . spss statistics for windows , version 21.0 ( ibm corp . , armonk , ny , usa ) was used for statistical analysis . sleep , sleep quality , and sleep scores were taken as dependent variables . a p value of < 0.05 was considered as statistically significant . a total of 585 patients with type 2 diabetes mellitus were enrolled in the study ( 193 males , 392 females , median age 57 years [ 5064 years ] ) . since 10 patients did not complete psqi , only 575 patients were included in the statistical analysis for psqi ; 579 patients were included for ess since 6 patients did not complete ess , and 580 patients were for bq since 5 patients did not complete bq . of these , 18.50% were smokers and 52.20% were obese ( the median body mass index [ bmi ] was 29.98 kg / m [ 26.8333.70 kg / m ] ) . the median disease duration was 7 years ( 312 years ) ; 174 patients ( 29.74% ) were receiving insulin therapy . the median hba1c level was 6.90% ( 6.208.20% ) , with 37.80% of the patients in the range considered normal ( 6.5% ) . an evaluation of drug histories showed that none of the patients was using medication affecting sleep quality , such as sedative - hypnotic drugs . comparing patients with normal hba1c ( 6.5% ) and high hba1c , there were no significant difference in smoking rate ( 17.2% vs. 19.4% , p > 0.05 ) and bmi ( median : 29.73 kg / m [ 27.4233.29 kg / m ] vs. 30.06 kg / m [ 26.4434.13 kg / m ] , p = 0.966 ) ; however , there was a significant difference in the gender ratio ( normal hba1c : male 26.20% , female 78.20% ; high hba1c : male 37.40% , female 62.60% ; = 7.652 , p = 0.006 ) . the mean psqi score was 6.18 3.42 , with 64.30% of patients having poor sleep quality , and the mean ess score was 8.96 5.70 , with 54.40% of patients having excessive daytime sleepiness . according to the bq results , 50.20% of patients were at high - risk of osas . statistical analysis indicated that bmi was positively correlated with ess and psqi ( r = 0.11 , p = 0.009 and r = 0.17 , p < 0.001 , respectively ) . there was a significant association between obesity and a high - risk of osas ( p < 0.001 ) . hba1c levels correlated significantly with the ess and psqi scores ( r = 0.23 , p < 0.001 and r = 0.14 , p = 0.001 , respectively ) and were significantly higher in those with high - risk of osas ( p < 0.001 ) . compared with patients with normal hba1c levels , those with high hba1c ( > 6.5% ) had a greater risk of excessive daytime sleepiness according to the ess results ( or : 2.08 , 95% ci : 1.472.96 , p < 0.001 ) , poor sleep quality according to the psqi results ( or : 1.54 , 95% ci : 1.082.18 , p = 0.017 ) , and having a high - risk of osas ( or : 1.84 , 95% ci : 1.302.59 , p < 0.001 ) . duration of diabetes was positively correlated with the ess and psqi scores ( r = 0.101 , p = 0.016 and r = 0.142 , p = 0.001 , respectively ) . comparisons of good and poor sleep quality grouped by psqi results are shown in tables 1 and 2 . comparison of patients with good and poor sleep quality according to psqi results by using mann psqi : pittsburgh sleep quality index ; bmi : mean body mass index ; hba1c : hemoglobin a1c ; dm : diabetes mellitus . comparison of good and poor sleep quality according to psqi results by using chi - square test , n ( % ) * hba1c values could only be obtained from 564 patients ; treatment history could only be obtained from 573 patients . hba1c : hemoglobin a1c ; psqi : pittsburgh sleep quality index there was no significant difference between genders in the ess and bq scores , but psqi score levels were significantly higher in female patients than in male patients ( 6.63 3.57 vs. 5.27 2.91 , p < 0.001 ) . ess scores were significantly higher in smokers than in nonsmokers ( 9.84 5.05 vs. 8.76 5.82 , p = 0.043 ) , but there were no significant differences in the bq and psqi results . comparisons of normal sleep and very sleepy patients grouped by ess results are given in tables 3 and 4 . comparisons of low risk and high risk patients for osas grouped by bq results are given in tables 5 and 6 . comparison of normal sleep and very sleepy groups according to ess results by using mann ess : epworth sleepiness scale ; bmi : mean body mass index ; hba1c : hemoglobin a1c ; dm : diabetes mellitus . comparison of normal sleep and very sleepy groups according to ess results by using chi - square test , n ( % ) * hba1c values could only be obtained from 565 patients . comparison of patients with high - risk and low risk according to bq for osas by using mann bq : berlin questionnaire ; osas : obstructive sleep apnea syndrome ; bmi : mean body mass index ; hba1c : hemoglobin a1c ; dm : diabetes mellitus . comparison of patients high - risk and low risk for osas according to bq by using chi - square test , n ( % ) * hba1c values could only be obtained from 566 patients ; treatment history could only be obtained from 578 patients . bq : berlin questionnaire ; osas : obstructive sleep apnea syndrome ; hba1c : hemoglobin a1c . fasting blood glucose levels showed significantly different between normal and high bq results ( 151.03 76.81 vs. 159.05 72.06 ; p = 0.017 ) and were positively correlated with ess and psqi scores ( r = 0.213 , p < 0.001 and r = 0.157 , p < 0.001 , respectively ) . the variables thought to influence the bq , ess , and psqi scores were age , gender , bmi , smoking status , and hba1c levels . binary logistic regression analysis was used to examine the impact of these variables on the study group results . age , bmi , and hba1c levels were found to have effects on bq scores ( or = 1.02 , p = 0.004 ; or = 1.09 , p < 0.001 ; and or = 1.13 , p = 0.020 , respectively ) . age , bmi , smoking status , and hba1c levels were found to have effects on ess scores ( or = 1.02 , p = 0.037 ; or = 1.03 , p = 0.032 ; or = 1.698 , p = 0.021 ; and or = 1.19 , p = 0.001 , respectively ) . gender and hba1c levels were found to have effects on psqi scores ( or = 1.89 , when the patients ldl levels were compared with the results of the sleep disturbance scales , they did not significantly correlate with the results of the ess , bq , or psqi . when the patients tg levels were compared with the results of the sleep disturbance scales , they did not significantly correlate with the results of the ess and bq . however , the tg levels were significantly higher in a poor sleep quality group than in the good quality sleep group ( 152.00 [ 118.75201.00 ] vs. 14.00 [ 97.75182.25 ] , p = 0.016 ) . diabetes mellitus is a chronic disorder . with its increasing frequency of acute and chronic complications , and its increasing morbidity and mortality , diabetes has caused a considerable loss of labor and exerted a heavy economic burden on society . it is also associated with an increase in psychological disorders and sleep disorders , both of which complicate the metabolic control of diabetes . sleep disorders are quite common in the community and are considered as cardiovascular risk factors . they also complicate the control of chronic diseases such as diabetes , obesity , and hypertension . sleep disorders increase the risk of the emergence of cardiovascular , neurologic , and metabolic diseases . conversely , the prevalence of sleep disorders increases with diabetes and such co - existence results in poor glycemic control and more chronic complications ( i.e. , diabetic neuropathy ) . in this study , we observed the following results : according to the ess results , 54.40% of the patients had excessive daytime sleepiness ; according to the psqi results , 64.30% of the patients had poor sleep quality ; and according to the bq results , 50.20% of the patients were considered to have high - risk for osas . therefore , in our study , the sleep disorders were found in 5064% of patients . sleep disorders increased the risk of the elevated hba1c level , and a high level of hba1c was a risk factor for sleep disorders . studies have indicated that both the development and control of diabetes are affected by quality and duration of sleep . sleep disorders were found to be associated with impaired glucose tolerance , increased type 2 diabetes , and elevated fasting blood glucose and hba1c levels . sleep apnea is defined as at least 10 s of cessation of breathing during sleep ; 9095% of apneas are obstructive . the prevalence of osas is correlated with age and weight , and it is a common sleep disorder in diabetic patients . in our study , we found from the bq results that 50.20% of patients were considered to have a high - risk for osas . studies including both diabetic and nondiabetic individuals revealed a positive correlation between hba1c levels and the severity of osas . in this study , the risk of not achieving the target hba1c was 1.84-fold higher in patients at high - risk of osas ( according to the results of bq ) than those at low risk of osas . this finding suggested that a higher risk of osas might be a factor that complicates control in diabetic patients . ignoring osas in diabetic patients could complicate the control of diabetes , and treatment for osas can result in improvements in diabetes parameters . when treating diabetic patients , physicians should be aware of this disease , which is highly prevalent in diabetic patients . we believed that the bq , with its ease of use , might be effective in screening for this disease . the quality of sleep can predict the risk of developing diabetes , and the metabolic control of diabetes might be affected by quality and duration of sleep . daytime sleepiness causes a general decline in motivation , and , as a result , may have a negative effect on the psychological status of patients with diabetes . it is well known that chronic diseases such as diabetes cause an emotional stress load to patients . the prognosis of diabetes can be affected by sleep quality and psychological distress and symptoms . sleep disturbance is a stress factor that can alter blood glucose levels , and psychological defense mechanisms and high levels of hba1c are associated with insomnia . this study only included type 2 diabetes mellitus and did not set the control groups ( i.e. , people without diabetes ) , which will be studied in the future . in summary , conversely , poor control of diabetes is an important factor for disturbing sleep quality . in diabetic patients with poor regulation of blood glucose , it is important to address sleep problems , both for eliminating the complications caused by the sleep disorders and for improving the control of diabetes .

background : studies have reported the presence of sleep disorders in approximately 5070% of diabetic patients , and these may contribute to poor glycemic control , diabetic neuropathy , and overnight hypoglycemia . the aim of this study was to determine the frequency of sleep disorders in diabetic patients , and to investigate possible relationships between scores of these sleep disorders and obstructive sleep apnea syndrome ( osas ) and diabetic parameters ( fasting blood glucose , glycated hemoglobin a1c [ hba1c ] , and lipid levels).methods : we used the berlin questionnaire ( bq ) for osas , the epworth sleepiness scale ( ess ) , and the pittsburgh sleep quality index ( psqi ) to determine the frequency of sleep disorders and their possible relationships with fasting blood glucose , hba1c , and lipid levels.results:the study included 585 type 2 diabetic patients admitted to family medicine clinics between october and december 2014 . sleep , sleep quality , and sleep scores were used as the dependent variables in the analysis . the ess scores showed that 54.40% of patients experienced excessive daytime sleepiness , and according to the psqi , 64.30% experienced poor - quality sleep . the bq results indicated that 50.20% of patients were at high - risk of osas . hba1c levels correlated significantly with the ess and psqi results ( r = 0.23 , p < 0.001 and r = 0.14 , p = 0.001 , respectively ) , and were significantly higher in those with high - risk of osas as defined by the bq ( p < 0.001 ) . these results showed that hba1c levels were related to sleep disorders.conclusions:sleep disorders are common in diabetic patients and negatively affect the control of diabetes . conversely , poor diabetes control is an important factor disturbing sleep quality . addressing sleep disturbances in patients who have difficulty controlling their blood glucose has dual benefits : preventing diabetic complications caused by sleep disturbance and improving diabetes control .

hearing and its dysfunctions irrespective of their causes determine the quality of life . even a slight hearing loss , feeling of blocking or check - a - block in the ear provide discomfort independent of the reasons for the disorders . one of the elements important in the process of hearing is the proper functioning of the eustachian tube ( et ) . the eustachian tube dysfunction ( etd ) often co - exists with a subjective feeling of hearing loss . although that we know anatomopathological causal of etd , the diagnosis and treatment are persistent and laborious . result of etd in infantile is the adenoids or / and pathological secretion within the rhinopharynx due to repeated infections of upper airways , regardless of age , the pathogenesis of etd , chronic infections of the upper airways , allergy , gastroesophageal reflux , mechanical obstruction ( e.g. , rhinopharynx carcinoma ) , anatomical abnormality ( e.g. , palatoschisis , gothic palate , etc . ) , primary ciliary dyskinesia or different neuromuscular dysfunctions regardless of its courses [ 1 , 2 ] . in most common pathological causes , pharmaceutical treatment with anti - histaminic or anti - inflammatory medicaments ( including locally or generally used glucocorticosteroids ) as well as a proper nasal toilet is often affective . if pharmacological treatment is ineffective while internal ear ventilation disorders caused by poor pathology of et and chronic inflammatory process with exudation lead to partial hearing loss , surgery should be performed . there is a necessity to remove any pathological changes within the nose and the rhinopharynx and input the grommet tympanum membrane to remove the exudation from the ear . one of the methods is a less invasive procedure , the tuboplasty of the eustachian tube ( bet balloon dilation eustachian tuboplasty ) introduced thanks to the development of endoscopic technology in laryngology . bet is applied in the cases where , after elimination of all factors influencing the et and middle ear functioning , no sufficient improvement is observed . the aim of the study was to present the therapeutic benefits of the bet method in the treatment of etd caused by disorders in the middle ear ventilation . the bet procedure was approved by ethics committee of military institute of medicine and was performed in accordance with the ethical standards laid down in the 1964 declaration of helsinki . the following clinically vital symptoms of poor et function were recognized : feeling of lasting or periodic , but without regression to the norm , uni- or bilateral partial hearing loss as well as feeling of obstruction or clicking noises , which are reversible or not , after the valsalva maneuver , yawning or swallowing . standard otorhinolaryngological of nose and rhinopharynx examination were followed by a transnasal endoscopic evaluation and microscopic examination of the ears . additionally , all patients underwent audiometric examinations ( pure - tone audiometry , tympanometry and pressure - swallow test ) . average air - bone gap for 500 , 1,000 and 2,000 was evaluated . at the moment of qualification for the procedure , all patients denied any dysfunctions on their circulatory and respiratory systems , did not take any drugs at present , did not suffer allergy , any head or acoustic trauma or undergo any transnasal operations in the past . as the method was novel , preinterventional ct angiography of the carotid arteries a specially designed 600 m diameter balloon catheter ( spiggle and theis company ) was applied in the procedure . the catheter was inserted into the pharyngeal orifice of et , in the first instance ( fig . 1 ) . after the balloon had been positioned correctly , the dilation was applied to a pressure of 10 bars for 2 min ( using saline solution ) . then , the solution from the balloon was aspirated , and the catheter was removed . seeing that there were no complications during and after the procedure ( bleeding or damage of regional mucosa ) in any patients , examination of mucous membrane in the place of dilation was unnecessary . after the balloon had been positioned correctly , the dilation was applied to a pressure of 10 bars for 2 min ( using saline solution ) the balloon catheter was pushed 2 cm into the et . after the balloon had been positioned correctly , the dilation was applied to a pressure of 10 bars for 2 min ( using saline solution ) we did not notice any complications during and after the procedure ( bleeding or damage of regional mucosa ) in any patients . postoperative hearing examinations were performed at 1 week and 6 weeks after bet ( table 1 ) . in the chart , there are results of objective method ( tympanometry ) and subjective methods ( the air bone gap , valsalva maneuver and pst ) . most of the patients have reported hearing improvement which resulted in reducing of the air bone gap . one patient ( c.m . ) has not reported any hearing improvement of the left ear which meant no changes in the air bone gap . three patients showed improvement from type - b to type - a tympanogram including one person ( c.m . ) with no changes in the left ear tympanogram . in one case ( p.w . ) , initial type - c tympanogram has showed improvement with the right ear and type - a tympanogram with the left ear . as a result of valsalva maneuver conducted after 1 week and then after 6 weeks , three patients reported hearing improvement though the changes were reported at different time and to a different degree . one person ( p.w . ) required no valsalva maneuver to hear better.table 1 cochlear reservetympanometryvalsalva maneuverpstright earleft earright earleft earright earleft earright earleft earf.w . before2530bb 1 week after2015cc++ 6 weeks after1010aa++++valsalva maneuver[ ] lack of hearing improvement[+ ] improvement of hearing patient did not have to make the valsalva maneuver = good hearingpts[ ] blocking of the eustachian tube[+ ] proper functioning of the eustachian tube [ ] lack of hearing improvement [ + ] improvement of hearing patient did not have to make the valsalva maneuver = good hearing [ ] blocking of the eustachian tube [ + ] proper functioning of the eustachian tube while conducting bet procedure , there were no other methods available to objectify the results . he reported temporal , ipsilateral , muco - serous exudate in the middle ear ( without exudate for three years ) and hearing loss which was reversible after the valsalva maneuver . microscopic examination of the ears : left tympanic membrane anatomically and functionally without changes , right tympanic membrane - abnormal position ( especially pars flaccida - retraction ) , single cicatrices and calcifications , residual reflex . valsalva maneuver on the right side - negative , on the left side - positive . medical history : chronic , persistent mucoserous otitis despite pharmacological treatment , bilateral hearing loss . bilateral grommet tympanic membrane three times ( the last one was removed 4 years before bet ) , the feeling of blocked ears , ringing and increased pressure in both ears was reported . status postcardiac infarct ( 2001 ) , without pharmacological secondary prevention . microscopic examination of the ears : retraction of tympanic membranes ( especially pars flaccida ) , single cicatrices in the both ears . endoscopic examination of nose and rhinopharynx : small edema of mucous . medical history : the feeling of blocked ears , increased pressure in both ears and primary hypertension actually without drugs . microscopic examination of the ears : tympanic membranes in abnormal position ( retraction pars flaccida and pars tensa ) in the both ears . one week after operation reduced feeling of hearing loss was reported , especially in the right ear . microscopic examination of the ears : present state as before operation in the left ear , smaller retraction in the right ear . six weeks after operation felling of hearing loss in the left ear at the same level , in the right ear improvement was reported . microscopic examination of the ears : present state as before and one week after operation . medical history : chronic , persisting , mucoserous otitis despite pharmacological treatment , the feeling of blocked ears , bilateral hearing loss treated with catheterization of et ( several times , the last one two weeks before the operation without positive results ) , asthma and scheuermann s disease without drugs since 2007 . microscopic examination of the ears : retraction of tympanic membranes , level of liquid in middle ear in the both ears . level of the postoperative pain in all patients just and in the first day after operation were between 0 to 2 points ( in 10 steps scale of vas where 0without pain , 10maximum of pain ) . the development of minimally invasive interventions in the fields of urological , otolaryngological , gastrointestinal or vascular and cardiac procedures has become a fact [ 1 , 2 ] . the widespread introduction of microcatheters , endoscopic tools with simultaneous improvements in data collection and transmission accompany classical operative techniques eustachian tuboplasty with stenting materials , laser eustachian tuboplasty or microdebrider eustachian tuboplasty . transcanal , preauricular , transmastoid or middle fossa approach has not become a routine procedure [ 6 , 7 ] . already , in 1983 , yamashita utilized the fiberscope with an inflational canal to widen pharyngeal orifice and lumen of the et . in 2010 , ockerman and co - workers described the bet as a new method for treating patients with etd [ 1 , 2 ] . the method , which is technically easy to perform , significantly helped to improve et functioning ( eight patients with bet ) . to compare the pre- and postoperative results tmm procedure allows to compare pressure equalization function of normal subjects and those with etd objectively . a few other techniques like sonotubometry with perfect sequences ( pseq ) the bet procedure is difficult because of the variety of etd mechanisms leading to its creation . our clinical studies assessed the feasibility and safety of the bet in a small patient cohort during a short - term period only a 6 weeks observation . it is in accordance with results of studies of balloon dilation techniques including small groups of patients described by other authors up to date . although patients revealed a significant improvement of et score , longer long - term studies are necessary to determine whether this method will demonstrate lasting benefits and safety in the treatment of chronic eustachian tube dysfunction . in other investigations ,

the development of minimally invasive procedures such as the balloon dilation eustachian tuboplasty ( bet ) is an alternative to the grommet tympanum membrane . bet is applied in the cases where , after elimination of all factors influencing the et and middle ear functioning , no sufficient improvement is observed . the aim of this study was to present the therapeutic benefits of the bet method in the treatment of etd caused by disorders in the middle ear ventilation . the bet procedure was offered to four patients ( 3 men and 1 woman ) after subjective , physical , otorhinolaryngological and audiometric examinations including pure tone audiometry , tympanometry and pressure - swallow test . as the method was novel , preinterventional ct angiography of the carotid arteries was performed in all patients . any complications were noticed during and after the procedure ( bleeding or damage of regional mucosa ) in any patients . our clinical studies assessed the feasibility and safety of the bet during a short - term period only a 6-week observation . although patients revealed a significant improvement of et score , longer long - term studies are necessary to determine whether this method will demonstrate lasting benefits and safety in the treatment of chronic eustachian tube dysfunction . in other investigations , improvement was found to be time dependent .

a subclinical elevation of urinary albumin excretion , that is , microalbuminuria , has been associated with an increased risk of cardiac morbidity and mortality in reported population studies . microalbuminuria was first introduced as a risk factor for chronic renal failure among patients with diabetes , and later was found to reflect systemic vascular damage . previously we reported an increased prevalence of microalbuminuria in patients with acute myocardial infarction . in the present report we have analyzed 10-year follow - up results in the previously studied cohort in order to further evaluate the association between the risk of death in patients with acute myocardial infarction and microalbuminuria . in 1996 , 250 caucasian individuals were admitted to hvidovre university hospital , department of cardiology , with acute myocardial infarction . the diagnosis was based on the presence of chest pain , electrocardiographic alterations , and significant elevations of coronary enzymes . patients who died during admission were excluded as were patients who underwent acute percutaneous coronary intervention or coronary artery bypass grafting , as such interventions would probably overrule any prognostic effect of microalbuminuria . in addition , patients with known renal or urinary tract disease were excluded . in total , 151 of the eligible patients the study was in accordance with the helsinki ii declaration and approved by the local ethics committee . on the day of discharge ( about one week after admission ) the albumin / creatinine concentration ratio was taken as an index of the albumin excretion rate in urine . in accordance with previous studies , microalbuminuria was defined as a urinary albumin / creatinine concentration ratio above 0.65 mg / mmol . the left ventricle ejection fraction was estimated as a percentage by the wall motion index using the nine - segment model multiplied by 30 . the body mass index was calculated as weight divided by height squared ( kg / m ) . information about smoking status , presence of diabetes , and medication at discharge were obtained from patient records . in 2007 , the patients were traced by means of the danish personal identification register . data are given as means , geometric means , or proportions with 95% confidence intervals . differences in mean values between the groups were tested using the t - test for unpaired comparisons . the effect of microalbuminuria and other baseline variables on mortality was analyzed by the cox proportional hazards regression analysis and expressed as a hazard ratio . the baseline characteristics of patients with acute myocardial infarction with or without microalbuminuria are given in table 1 . there were no statistically significant differences found in gender , systolic or diastolic blood pressure , left ventricle ejection fraction , smoking status , or diabetes . after a 10-year follow - up , 52% of the patients with normoalbuminuria were still alive , whereas only 32% of the patients with microalbuminuria were ( figure 1 ) . the hazard ratio for death associated with microalbuminuria was 1.78 ( 1.182.68 ) ( p=0.006 ) . adjusted for age and gender , microalbuminuria was associated with mortality with a hazard ratio of 1.71 ( 1.032.83 ) ( p=0.04 ) . as shown in table 2 , microalbuminuria was associated with a similar risk of death as a left ventricle ejection fraction below 40% . conversely , diabetes , hypertension , smoking , or male gender had no impact on mortality , and high body mass index was associated with enhanced survival . table 1baseline characteristics in 151 patients with acute myocardial infarction with or without microalbuminuria ( urine albumin / creatinine concentration ratio > 0.65 mg / mmol).normoalbuminuriamicroalbuminuriap(n=76)(n=75)age ( years)65 ( 6368)73 ( 7076)<0.001men ( % ) 70 ( 6080)60 ( 4971)0.24systolic blood pressure ( mmhg)129 ( 125133)131 ( 127135)0.51diastolic blood pressure ( mmhg)78 ( 7581)76 ( 7478)0.42left ventricle ejection fraction ( % ) 50 ( 2060)47 ( 2060)0.19body mass index ( kg / m)26.7 ( 25.727.7)24.6 ( 23.825.4)0.002smokers ( % ) 42 ( 3153)44 ( 3355)1.00diabetes patients ( % ) 11 ( 418)13 ( 521)0.63urine albumin / creatinine * ( mg / mmol)0.35 ( 0.300.40)2.31 ( 1.733.08)<0.001data are means*geometric means orproportions with 95% confidence intervals . left ventricle ejection fraction is shown bymedians with interquartile ranges . proportions with 95% confidence intervals . figure 1unadjusted survival curves for patients with acute myocardial infarction and microalbuminuria ( bold ) or normoalbuminuria ( thin ) . relative risk of death associated with microalbuminuria versus normoalbuminuria = 1.78 ( 95 % ci , 1.182.68 ) ; p<0.01 . unadjusted survival curves for patients with acute myocardial infarction and microalbuminuria ( bold ) or normoalbuminuria ( thin ) . relative risk of death associated with microalbuminuria versus normoalbuminuria = 1.78 ( 95 % ci , 1.182.68 ) ; p<0.01 . table 2relative risks of ten - year mortality associated with risk factors measured during baseline admission in 151 patients with acute myocardial infarction.baseline variablerelative risk ( hazard ratio)page > 65 years3.06 ( 1.825.12)<0.001left ventricle ejection fraction < 40%1.80 ( 1.122.89)0.02microalbuminuria1.78 ( 1.182.68)0.006microalbuminuria*1.71 ( 1.032.83)0.04diabetes1.22 ( 0.662.23)0.52hypertension0.89 ( 0.551.44)0.64smoking0.87 ( 0.581.32)0.51male0.86 ( 0.571.31)0.49obesity0.63 ( 0.420.96)0.03microalbuminuria , urine albumin / creatinine concentration ratio > 0.65 mg / mmol ; hypertension , systolic blood pressure > 140 mmhg or diastolic blood pressure > 90 mmhg ; obesity , body mass index > 25 kg / m.*adjusted for age and sex . microalbuminuria , urine albumin / creatinine concentration ratio > 0.65 mg / mmol ; hypertension , systolic blood pressure > 140 mmhg or diastolic blood pressure > 90 mmhg ; obesity , body mass index > 25 kg / m . adjusted for age and sex . microalbuminuria is an established predictor of coronary heart disease in diabetic patients as well as in non - diabetic healthy persons . in this study we confirm that microalbuminuria is strongly associated with an increased hazard of mortality in patients with acute myocardial infarction . even though the study population consisted of 151 patients only , we were able to show that microalbuminuria significantly increases the risk of death , independently of age and gender . thus , microalbuminuria is a very strong and robust risk indicator among patients with acute myocardial infarction . the finding in our present study could likely be explained by more extensive vascular disease , for example , atherosclerosis , in patients with microalbuminuria . this is supported by other studies in which the severity of carotid atherosclerosis , measured ultrasonographically , was correlated with urinary albumin excretion . moreover , the link between microalbuminuria and atherosclerosis is confirmed by the fact that half of the patients included in our study had microalbuminuria , as defined by a urinary albumin excretion above the upper 10% range in the background population . in our study however , calculation of the albumin / creatinine ratio yields an acceptable measure of the urinary albumin excretion rate in terms of specificity and sensitivity when screening for microalbuminuria . the definition of microalbuminuria in diabetology was based originally on the level of urinary albumin excretion above which the risk of chronic renal failure , but not of atherosclerotic cardiovascular disease , was increased ; that is , an albumin excretion rate above 30 mg / day or an albumin / creatinine ratio above 2 mg / mmol . in addition , it has become evident that the risk of atherosclerotic cardiovascular disease is increased at even lower levels of urinary albumin excretion in diabetic as well as non - diabetic subjects . we used our previous definition of microalbuminuria , for example , a urinary albumin/ creatinine ratio above 0.65 mg / mmol , which in non - diabetic subjects independently increases the risk of atherosclerotic cardiovascular disease without additional gain in risk with increasing values . we concluded that microalbuminuria is associated with impaired survival in patients hospitalized with myocardial infarction . microalbuminuria may be useful for risk stratification in these patients and , moreover , should be included as a baseline variable in intervention trials .

our study evaluates the long - term effect of microalbuminuria on mortality among patients with acute myocardial infarction . we followed 151 patients from 1996 to 2007 to investigate if microalbuminuria is a risk factor in coronary heart disease . all patients admitted with acute myocardial infarction in 1996 were included . at baseline , we recorded urinary albumin / creatinine concentration ratio , body mass index , blood pressure , left ventricle ejection fraction by echocardiography , smoking status , medication , diabetes , age , and gender . deaths were traced in 2007 by means of the danish personal identification register . microalbuminuria , defined as a urinary albumin / creatinine concentration ratio above 0.65 mg / mmol , occurred in 50% of the patients and was associated with increased all - cause mortality . thus , 68% of the patients with microalbuminuria versus 48% of the patients without microalbuminuria had died during the 10 years of follow - up ( p=0.04 ) . the crude hazard ratio for death associated with microalbuminuria was 1.78 ( ci : 1.182.68 ) ( p=0.006 ) , whereas the gender- and age - adjusted hazard ratio was 1.71 ( ci : 1.032.83 ) ( p=0.04 ) . we concluded that microalbuminuria in hospitalized patients with acute myocardial infarction is prognostic for increased long - term mortality . we recommend measurement of microalbuminuria to be included as a baseline risk factor in patients with acute myocardial infarction and in future trials in patients with coronary heart disease .

purple urine bag syndrome ( pubs ) is an uncommon condition seen in patients having long - term urinary catheterization . although it is an essentially benign condition , yet the purplish discoloration of the urinary catheter , tubing , and bag may be distressing for the patients , their families as well as for healthcare providers . we present an interesting case of an elderly woman who had a purple colored urine bag . to the best of our knowledge , an 83-year - old bed bound female , with a history of dementia who had an indwelling urinary catheter in place for last 3 months , presented to us in the outpatients department with the complaints of nausea , vomiting , decreased oral intake , chronic constipation , and purplish discoloration of the urine bag and tubing . she had been having these complaints on and off ( three times over a period of 1 month ) before coming to us and every time she was treated empirically with oral antibiotics ( records not available ) for suspected uti . her urinary catheter and bag were changed each time she would get purple discoloration and her symptoms would get better . when she presented to our facility , she was hemodynamically stable and was afebrile . she was noticed to have purple colored urine in the urine bag , along with purplish discoloration of the tubing and the bag [ figure 1 ] . investigations revealed a hemoglobin of 12 g / dl and total leukocyte count of 11 10 . her blood urea was 40 mg / dl , serum creatinine 0.9 mg / dl , serum sodium 135 meq / l , potassium 4.2 meq / l , chloride 110 meq / l , and bicarbonate was 20 meq / l . her urine dipstick showed a ph of 8.0 , specific gravity 1.020 , and it was positive for nitrite . urine microscopy revealed 4 - 6 leucocytes , 3 - 5 red blood cells , and triple phosphate crystals . urine culture was sent and she was started on oral cefixime ( third generation cephalosporin ) . the patient was seen after 3 days , and reported resolution of symptoms and disappearance of purple color . urine culture grew greater than 10 colony forming units of escherichia coli sensitive to cefixime . she completed a 10 days course of cefixime and has been symptom free till the last follow - up visit . pubs is a rare phenomenon in which the contents of urine bags turn purple or blue following long - term urinary catheterization . however , it is interesting to know that in the nineteenth century , a famous historical figure ( the english king george iii ) was believed to have this syndrome . the prevalence of pubs has been variably reported in different series from various regions , ranging from as low as 8.3% to as high as 42.1% . most of the published literature on pubs is based on case reports , with only a few retrospective / cross sectional studies . we could not come across any published data on the prevalence of this condition in the indian subcontinent . pubs has been reported to often occur in chronically catheterized and constipated patients , especially women who have significant disability ( bed bound or chair bound ) , have underlying comorbidities and cognitive impairment . other risk factors include old age , alkaline ph of urine , institutionalization of the patients , and the use of plastic urinary catheter and bag . in our case , female gender , old age , cognitive impairment , history of constipation , alkaline urine , and the use of plastic urine bag were the risk factors for pubs . it is noteworthy that despite the frequent occurrence of utis in patients with risk factors for pubs , the condition is infrequently encountered in clinical practice . according to pillai et al . , it could be because of the fact that simultaneous presence of multiple risk factors may be the prerequisite for development of pubs . for instance in addition to being catheterized , the presence of urinary tract infection caused by sulphatase- and phosphatase - producing bacteria as well as the presence of high tryptophan in the diet for the formations of the essential pigments may be required . it has been shown that not all the bacteria of the same species can produce phosphatase and sulphatase , the enzymes required for the formation of the responsible pigments.[911 ] or it could be due to the fact that the pigment quantity is not sufficient to produce the discoloration . thorough literature review reveals that the most common bacteria associated with pubs include providencia stuartii , providencia rettgeri , klebsiella pneumoniae , proteus species , escherichia coli , enterococcus species , morganella morganii , and pseudomonas aeruginosa . normal bacterial flora containing tryptophase converts dietary tryptophan to indole , pyruvic acid , and ammonia . indole is absorbed rapidly to the portal circulation and it is then converted into indoxyl sulphate in the liver . most indoxyl sulphate is excreted into the urine and digested into indoxyl by indoxyl sulphatase produced by some bacteria . indoxyl turns into indigo ( blue color ) and indirubin ( red color ) in alkaline urine , and these colors then mix to form a purple color . it has been described in the literature that intestinal conditions like intestinal obstruction , intussusception and illeal diversions can also precipitate the pubs . although an alkaline urine is an important factor for the phenomenon of pubs as observed in most of the studies , some studies have reported pubs even in acidic urine ph . thorough literature review suggests that pubs per se appears to be a benign process without major consequences , and most of the patients are asymptomatic . therefore , some authors have a consensus that only changing the urinary catheter and urinary bag usually are enough to solve the problem . aggressive investigation and treatment like routine antibiotics , and extensive work up including urine culture are usually not necessary . urine cultures and antibiotic therapy are considered only for those who are symptomatic , suggestive of an underlying uti . for asymptomatic patients , treatment should be aimed at the underlying medical problem rather than purple bag itself , and to reduce likelihood of this problem , it is important that the drainage bags and indwelling long - term catheters may need to be changed on a more regular basis . interestingly , recurrences of purple discoloration of the urine bag may be seen if the urine bag is changed prior to the complete resolution of uti . before coming to us , our patient was probably not treated adequately with proper antibiotic therapy , and therefore she was having recurrence of the symptoms as well as the purple discoloration . we treated her with appropriate antibiotic therapy for 10 days as indicated for a complicated uti and she has not had recurrence to date . pubs is an infrequent manifestation of urinary tract infection mostly seen in chronically catheterized , constipated elderly women . improvement in the care of urinary catheters prevents both pubs and catheter associated urinary tract infection .

purple urine bag syndrome ( pubs ) is an infrequent condition , seen mostly in elderly female patients , characterized by an intense purple discoloration of contents of urine bag following long - term indwelling urinary catheterization . the purple discoloration is most often due to the presence of indigo and indirubin pigments which are metabolites of tryptophan . urinary bacteria with indoxyl sulphatase activity metabolize indoxyl sulphate to produce indigo and indirubin , particularly in alkaline urine . we report an elderly woman with a urinary tract infection and constipation who presented with pubs . the purple urine disappeared after antibiotic therapy and change of the urine bag . to the best of our knowledge , this is the first case of pubs reported from this region .

a 29-year - old male patient who complained of pain and swelling around the popliteal area and symptoms of common peroneal nerve palsy in the right lower leg was referred to our service . the patient had a medical history of re - revision of acl reconstruction using a transtibial technique for femoral tunnel in the right knee 6 weeks ago in another hospital . the initial acl reconstruction was performed 9 years ago with an achilles tendon allograft after the patient had injured his knee during a soccer game . revision was performed four years ago with an achilles tendon allograft under the diagnosis of re - ruptured acl that occurred during a basketball game . the patient 's past history revealed popliteal fossa pain that started from the night of the 3rd operation ( re - revision acl reconstruction ) . the pain became aggravated on the 2nd postoperative day , sudden swelling of the popliteal fossa was noted and symptoms of common peroneal nerve palsy developed . the surgeon who had performed the re - revision surgery could palpate the dorsalis pedis and posterior tibial arterial pulses and concluded that the patient had intact circulation and that the paralysis could be the result of inadequately long post - operative leg splinting . the patient was required to rest for 6 weeks . with no sign of pain and swelling subsiding , vital signs , including blood pressure , were within normal limits , and the results of blood gas analysis were normal . dorsiflexion power of the right ankle was observed as grade 1 - 2 with 80% sensory loss compared to the contralateral limb . ankle brachial index and toe pressure were not measured before surgery . magnetic resonance imaging ( mri ) and mri findings showed abundant hematoma in the popliteal fossa and ct angiogram showed pseudoaneurysm of the popliteal artery and leakage of administered dye at the level just superior to the medial and lateral superior genicular artery ( fig . the authors observed a trace of drilling track , presumably for rigidfix insertion , which extended from anterior to posterior . the distal end of the drilling track was at the site of popliteal injury ( fig . symptoms similar to those of compartment syndrome , such as swelling , pain of the lower limb , and common peroneal nerve palsy and abundant hematoma on mr images are the reasons why we decided that decompression and exploration are required based on the result from the medical check - up . emergency surgical exploration was performed in the prone position through an s popliteal incision . intraoperative findings revealed a hematoma measuring 88 cm around the popliteal artery , which showed abundant adhesion with adjacent soft tissue and muscles . segmental arterial injury was observed just superior to the level of the medial and lateral superior genicular artery . a greater saphenous vein autograft was harvested from the ipsilateral limb and a re - anastomosis procedure was performed ( fig . 4a ) . aspirin ( bayer , leverkusen , germany ) and cilostazol ( pletaal ; otsuka , tokyo , japan ) were administered for postoperative thrombo - prophylaxis . ankle brachial index and toe pressure , compared to the contralateral limb , showed normal results on the third day after arterial re - anastomosis surgery . swelling and pain around the popliteal fossa were completely resolved and range of knee motion was restored three months after arterial re - anastomosis . however , the common peroneal nerve palsy detected by advanced tinel 's sign was partially improved and dorsiflexion power of the right ankle was still not improved . vascular complications after arthroscopic acl reconstruction have been rarely reported1,2,3,4 ) . most of the previous publications documented direct injury to the popliteal artery , resulting in a fatal outcome or amputation of the limb . however , if blood circulation distal to the injured popliteal artery is maintained , favorable treatment results can be obtained despite a delayed diagnosis1,3 ) . in our case , knee pain and symptoms of common peroneal nerve palsy were attributed to the popliteal artery injury and the peripheral circulation was maintained for 6 weeks . it has not been clearly established whether common peroneal nerve palsy after acl reconstruction is caused by mass effect of hematoma or iatrogenic injury . however , it seems more reasonable that the mass effect was the cause in our case since there was some improvement after the evacuation of hematoma . due to its convenience , superior biomechanical character , and favorable clinical outcome , the rigidfix cross pin for femoral fixation of the acl has recently become a popular choice6 ) . however , chang et al.6 ) reported the rigidfix cross pin can be close to the popliteal artery when it is inserted in an anterior to posterior direction in a cadaveric study , thereby warning possible injury to the popliteal artery during pin insertion . in our case , a drill tip for the rigidfix cross pin inserted from anterior to posterior caused a segmental perforation injury that could have resulted in a fatal outcome . in the re - revision operation , the widened femoral tunnel allowed inadequate placement of the rigidfix 's femoral rod , which may have caused twisting motion of the rod during drilling in the tunnel . in addition , the thin posterior cortex during drilling may have tricked the surgeon into redirecting the drill tip multiple times , which may also have contributed to the injury . for these reasons , we recommend , in cases where femoral tunnel widening is present , other fixation methods than rigidfix cross pin system in re - revision acl reconstruction . from this experience , we recommend if the patient has symptoms of pain in the popliteal area and unexplainable paralysis following arthroscopic acl reconstruction , a popliteal artery injury should be suspected even when the posterior tibial artery or the dorsalis pedis artery can be palpated . therefore , it is advised to perform angiography or angio - ct for prompt evaluation of the popliteal artery when an arterial injury is suspected and , if indicated , immediate surgical exploration .

popliteal artery injury is a very rare complication of anterior cruciate ligament ( acl ) reconstruction . the authors experienced a case of popliteal arterial pseudoaneurysm after re - revision of acl reconstruction using rigidfix for femoral tunnel fixation . pseudoaneurysm was detected in knee magnetic resonance imaging , which caused pain , limit of motion , common peroneal nerve palsy , leg swelling and symptoms similar to compartment syndrome . after excision and re - anastomosis of the popliteal artery using a greater saphenous vein graft , all symptoms were resolved within 3 months except for common peroneal nerve palsy . so we report on this case with a review of the literature .

head and neck cancers account for about 3% of all cancers , and have a fairly good chance of healing . because of certain head and neck anatomy , radiotherapy with or without chemotherapy is one of the main treatment that significantly increased the survival of patients . however , besides its anti - tumor effects , radiation causes damage in normal tissues located in the radiation portals . although the exact mechanism is not yet known , a reduction in taste sensitivity ( hypogeusia ) , an absence of taste sensation ( ageusia ) , or a distortion of normal taste ( dysgeusia ) often occurs in cancer patients . chemotherapy and radiotherapy can result in taste disturbances by destroying taste receptor cells and affecting neural activities . however , in some patients , abnormal taste acuity for one or more taste qualities are even present before the beginning of radiotherapy or chemotherapy . taste abnormalities in cancer patients can decrease appetite and dietary intake , lead to malnutrition and weight loss , and decrease quality of life and even survival . therefore , reversing the taste perception in cancer patients during their treatments is valuable . according to several reports , zinc plays an important role in taste perception , and zinc deficiency is responsible ( in some cases partially ) for taste perception abnormalities in otherwise healthy persons , various diseases , and also in drug - induced taste disorders . zinc is a cofactor of alkaline phosphatase activity which is the most abundant enzyme in the membrane of taste bud . the main effects of zinc deficiency are the changes in the number and size of taste buds and structural changes in taste buds cells as well as decrease in related nerve sensitivity . zinc supplementation has been shown to be effective in the treatment of taste and smell abnormalities observed among patients with taste disorders . even in healthy persons , few reports are also available from clinical trials on the effects of zinc supplementation on taste perception in cancer patients . beneficial effects of polaprezinc ( zinc l - carnosine ) and zinc infusion during chemotherapy on taste disturbance in patients with head and neck cancer and lung cancer patients have been reported . however , a large clinical trial found not statistically significant effect of zinc sulfate therapy on the median interval to taste alterations under radiotherapy , and another recent study found no significant benefit for zinc therapy with standard doses to taste or smell in cancer patients under chemotherap y. there is a lack of data and controversial results on the effects of zinc supplementation in prevention / treatment of taste alterations in cancer patients . with regards to the importance of appropriate management of taste abnormalities among cancer patients , we conducted a randomized double - blind placebo - controlled trial to evaluate the preventive effects of zinc sulfate on radiation - induced taste alterations in patients under irradiation for head and neck cancer this randomized , double - blinded , placebo - controlled trial was conducted between 2009 and 2010 in radiation - oncology department of seyed - al - shohada hospital in isfahan ( iran ) . consecutive adult patients with head and neck cancers who were on schedule for radiotherapy with at least 2000 cgy to > 30% of oral cavity , with or without chemotherapy , were considered as eligible patients . those with oral candidiasis or other oral lesions ( e.g. , stomatitis , necrosis , and ulcers ) , cranial nerve injuries , and metabolic / endocrine disorders that may have effects on taste perception were not included . ethical approval was obtained from the ethical committee of the isfahan university of medical sciences and informed consent was obtained from all patients at recruitment . regarding the radiation therapy protocol , patients were treated with opposite fields that included the primary tumor and lymph nodes in the upper neck area , with daily 180 to 200 cgy fractions , 5 times a week ; the total dose was 6000 to 7000 cgy within a period of 5 to 9 weeks . based on a random table list generated by random allocation software , patients were allocated to receive zinc sulfate capsules ( alhavi co. , tehran , iran ) 50 mg , three times a day , after meals or the same placebo . medication was started with beginning of radiotherapy and continued one month after completion of irradiation . for assuring blindness of the patient and attending physician , coded zinc capsules and placebos were given to the patients by pharmacy operators without the knowledge of the patient group . as the primary outcome measure , taste acuity was determined by measuring detection and recognition thresholds for four taste qualities at baseline , at the end of radiotherapy , and a month later . taste acuity was evaluated according to the 3-drop method introduced by henkin which has been used with previous similar studies . for this evaluation , solutions providing the four main tastes ; sweet , salty , sour , and bitter , respectively , were prepared by sucrose , salt , hydrochloric acid , and urea . eleven ascending concentrations were prepared for each solution as described in table 1 in sealed bottles . each time , the patient was asked to evacuate his / her sputum before the test , try desired solution , wash his / her mouth with distilled water , and then try another solution . in each test , three drops were poured in the patient 's mouth , the two of them were water and another drop was from solution of the taste . understanding and identifying the threshold for each taste was according to the loss of taste from 1 to 11 titrations . in each test , the patient answered two questions : ( 1 ) which of the three drops of a different taste ? ( 2 ) what are the different types of drop ? sweet , salt , sour , or bitter ? the lowest concentration , by which the patient could identify difference from the water , was considered as the detection threshold . the lowest concentration of the patient as it tastes sweet , salt , sour , or bitter to detect , identify thresholds are considered . all patients were also visited with the attending physician weekly during radiotherapy and one month after completion of radiation therapy for correct use of the medication and possible side effects . ascending concentrations of the four tastes solutions ( reference 18 ) data were analyzed by the spss software for windows version 16.0 . data are shown as mean sd , number ( percent ) or median [ iqr ] with regard to kind of variables . qualitative parameters were compared between and within groups using the chi - square / mann - whitney tests and wilcoxon test , respectively . this randomized , double - blinded , placebo - controlled trial was conducted between 2009 and 2010 in radiation - oncology department of seyed - al - shohada hospital in isfahan ( iran ) . consecutive adult patients with head and neck cancers who were on schedule for radiotherapy with at least 2000 cgy to > 30% of oral cavity , with or without chemotherapy , were considered as eligible patients . those with oral candidiasis or other oral lesions ( e.g. , stomatitis , necrosis , and ulcers ) , cranial nerve injuries , and metabolic / endocrine disorders that may have effects on taste perception were not included . ethical approval was obtained from the ethical committee of the isfahan university of medical sciences and informed consent was obtained from all patients at recruitment . regarding the radiation therapy protocol , patients were treated with opposite fields that included the primary tumor and lymph nodes in the upper neck area , with daily 180 to 200 cgy fractions , 5 times a week ; the total dose was 6000 to 7000 cgy within a period of 5 to 9 weeks . based on a random table list generated by random allocation software , patients were allocated to receive zinc sulfate capsules ( alhavi co. , tehran , iran ) 50 mg , three times a day , after meals or the same placebo . medication was started with beginning of radiotherapy and continued one month after completion of irradiation . for assuring blindness of the patient and attending physician , coded zinc capsules and placebos were given to the patients by pharmacy operators without the knowledge of the patient group . as the primary outcome measure , taste acuity was determined by measuring detection and recognition thresholds for four taste qualities at baseline , at the end of radiotherapy , and a month later . taste acuity was evaluated according to the 3-drop method introduced by henkin which has been used with previous similar studies . for this evaluation , solutions providing the four main tastes ; sweet , salty , sour , and bitter , respectively , were prepared by sucrose , salt , hydrochloric acid , and urea . eleven ascending concentrations were prepared for each solution as described in table 1 in sealed bottles . each time , the patient was asked to evacuate his / her sputum before the test , try desired solution , wash his / her mouth with distilled water , and then try another solution . in each test , three drops were poured in the patient 's mouth , the two of them were water and another drop was from solution of the taste . understanding and identifying the threshold for each taste was according to the loss of taste from 1 to 11 titrations . in each test , the patient answered two questions : ( 1 ) which of the three drops of a different taste ? ( 2 ) what are the different types of drop ? sweet , salt , sour , or bitter ? the lowest concentration , by which the patient could identify difference from the water , was considered as the detection threshold . the lowest concentration of the patient as it tastes sweet , salt , sour , or bitter to detect , identify thresholds are considered . all patients were also visited with the attending physician weekly during radiotherapy and one month after completion of radiation therapy for correct use of the medication and possible side effects . ascending concentrations of the four tastes solutions ( reference 18 ) data are shown as mean sd , number ( percent ) or median [ iqr ] with regard to kind of variables . qualitative parameters were compared between and within groups using the chi - square / mann - whitney tests and wilcoxon test , respectively . during the study period , 35 patients ( mean age = 59.2 16.5 , 60% male ) with head / neck cancer entered the study and were randomized into the intervention ( n = 20 ) and placebo ( n = 15 ) groups . the two groups were similar with regards to demographic and clinical [ table 2 ] . all the patients were treated with daily fractions of 180 to 200 cgy lasting from 5 to 9 weeks , for a total dose of 6 000 to 7000 cgy . the radiation fields were the same for all patients , and the tongue was always included . demographic and clinical characteristics of patients the two groups were similar in baseline taste perception threshold for the four tastes . at the end of radiation therapy , there was a significant increase in taste perception threshold for bitter ( 5 to 6 , p = 0.003 ) , salty ( 4 to 5 , p = 0.002 ) , sweet ( 3 to 5 , p = 0.002 ) , and sour ( 4 to 5 , p = 0.002 ) tastes in the placebo group . in patients who received zinc , taste perception threshold did not change significantly at the end of radiation , except the sour taste perception ( 4 to 5 , p = 0.038 ) [ table 3 ] . one month after completion of radiotherapy , taste perception threshold was increased in the placebo group for all four tastes ( p = 0.001 ) . in those who received zinc , there was only slight increase in threshold for perception of the salty taste ( p = 0.046 ) [ table 3 ] . further analysis of data showed no association between age , gender , smoking history , cancer grade , or radiation dose with changes in four tastes perception thresholds after radiation therapy ( p > 0.05 ) . no relevant side effects due to zinc sulfate or placebo treatment were reported by patients , and no patient required suspension of treatment . none of the patients developed oral cavity lesions during radiotherapy . throughout the whole period of the trial , no patient used anesthetic and/or antifungal rinses or mouthwashes for oral cleansing that were different from the one prescribed . taste abnormalities are common , but often underestimated and unrecognized , among cancer patients . from the cancer patients point of view , however , they are major daily concerns and studies showed that these abnormalities can affect the daily quality of life , lead to malnutrition , and even decrease the survival . regarding the role of zinc in taste perception , we investigated if zinc supplementation can prevent taste alterations in head / neck cancer patients under radiotherapy . our results showed that zinc supplementation ( 150 mg / day ) during radiotherapy and continuing for one month later can prevent or at least decrease the effects of radiotherapy on taste perception for all of bitter , salty , sweet , and sour tastes . unfortunately , we did not follow our patients for longer than one month and weather the beneficial effects of zinc on taste perception continue in long term needs further evaluations . few trials are available on the effects of zinc therapy on taste alteration among cancer patients . in a randomized clinical trial by ripamonti et al . on a small number of head / neck cancer patients , treatment with zinc sulfate ( 45 mg , three times a day ) during radiation and a month later resulted in lesser worsening of taste acuity during radiotherapy and quicker recovery of taste acuity one month later than those receiving placebo . in another randomized trial by watanabe and colleagues , polaprezinc ( zinc l - carnosine ) reduced the incidence of mucositis , pain , xerostomia ( highly related to taste alteration ) , and taste disturbance in head / neck cancer patients under radiochemotherapy while it has effect on tumor response rate . a phase iii clinical trial on a large sample of head / neck cancer patients under radiotherapy reported the median interval to taste alterations as 2.3 vs. 1.6 weeks by zinc sulfate ( 45 mg orally three times daily ) compared to placebo . besides these trials on oral zinc therapy , yamagata et al . evaluated the effect of zinc including infusion on taste alteration in patients with lung cancer . authors found increased taste thresholds in patients who had a low serum zinc concentration even before receiving chemotherapy , and prevention of further taste alteration by zinc therapy . in contrast to these trials , a recent published randomized study by lyckholm on patients under chemotherapy that had alterations in taste and/or smell found no improvement in loss or distortion of taste / smell with 50 mg elemental zinc twice daily . however , patients in this study were those with wide range of cancers and with already taste / smell alterations , and also in this study taste evaluation was based on a 0 - 100 scale that might not be as precise as methods of measuring taste threshold . the sample size of our study was relatively small and included only head / neck cancer patients while taste alterations also occur in other type of cancers . more importantly , the follow - up was not long enough to show long - term effects and safety of zinc therapy . also , we only measured changes in taste perception and if zinc therapy have had a real impact on dietary behavior of the patients , which is the final outcome , is not clear . the present study results showed that a short course of supplementation with zinc sulfate in head and neck cancer patients under radiotherapy can prevent radiation - induced taste alterations . accordingly , zinc therapy in cancer patients may prevent the detrimental effects of taste alteration on dietary behaviors and quality of life of cancer patients . because long - term and excessive consumption of zinc may have a negative impact on the immune system in cancer patients , zinc supplementation should be used cautiously by cancer patients and further studies with longer follow - ups and with different doses of zinc supplementation are needed in this regard .

background : taste abnormalities are common among cancer patients after starting radiotherapy or chemotherapy . considering the role of zinc and reports on its beneficial effects in taste perception , we evaluated the preventive effects of zinc sulfate on radiation - induced taste alterations.materials and methods : in a randomized , placebo - controlled trial , adult patients with head and neck cancers who were on schedule for radiotherapy , with or without chemotherapy , were allocated to receive zinc sulfate ( 50 mg , three times a day ) or placebo ; started with beginning of radiotherapy and continued for one month later . taste acuity was determined by measuring detection and recognition thresholds for four taste qualities at baseline , at the end of radiotherapy , and a month later using the henkin method.results:thirty-five patients ( mean age = 59.2 16.5 , 60% male ) completed the trial . the two groups were similar at baseline . after radiotherapy , and one month later , there was a significant increase in taste perception threshold for bitter , salty , sweet , and sour tastes in the placebo group ( p = 0.001 ) . in those who received zinc , there was only slight increase in threshold for perception of the salty taste ( p = 0.046 ) . no relevant side effects due to zinc sulfate were reported.conclusion:zinc supplementation in head / neck cancer patients under radiotherapy can prevent radiation - induced taste alterations . further studies with longer follow - ups and with different doses of zinc supplementation are warranted in this regard .

some of the most important brain systems of humans are dedicated to the maintenance of the balance between the self and the external environment , by processing and integrating many different bodily sensory inputs ( visual , auditory , vestibular , somatosensory , motor , visceral , etc . ) , and providing an online representation of the body in the world ( damasio , 1999 ; gallagher , 2005 ; jeannerod , 2006 ; blanke and metzinger , 2009 ) . in this view , the body representation in the brain is a complex crossroad where multi - sensory information is compounded in order to build the basis for bodily self - consciousness ( haggard et al . , 2003 ; jeannerod , 2007 ; metzinger , 2008 ) . many behavioral studies over the last two decades have used techniques imposing multi - sensory conflict as a means to manipulate some components of self - consciousness . for example , the rubber hand illusion paradigm showed that by manipulating local aspects of body perception , it is possible to induce an illusory sense of ownership of a fake hand ( e.g. , botvinick and cohen , 1998 ; pavani et al . , 2000 ; ehrsson et al . in particular , if participants observe a rubber hand being stroked synchronously with their own ( hidden ) hand , they tend to report self - attribution of the rubber hand , as if it was their own hand . this illusory self - attribution is often accompanied by a proprioceptive drift toward the location of the rubber hand . specifically , participants report a change in where they feel their real hand to be located ( review in tsakiris , 2010 ) . similarly , if a participant holds one palm against that of someone else and simultaneously strokes the dorsal side of both her / his own and the other s index finger , an illusory feeling of numbness for the other person s finger can be perceived : the so - called numbness illusion ( dieguez et al . , 2009 ) . furthermore , it has recently been shown that illusory self - attribution is not limited to the hands , but extends to other body parts including the face ( sforza et al . , 2010 ) . for example , the experience of having one s own face touched whilst simultaneously ( the spatial and temporal sense ) seeing the same action applied to the face of another , elicits the so - called enfacement illusion : that is an illusory sense of face ownership is induced and the other s facial features are incorporated into the participant s face ( sforza et al . , all of these findings on illusory self - attribution support the idea that low - level multi - sensory processes can influence bodily self - consciousness . however , the self and bodily self - consciousness is globally associated with the body , rather than with multiple different body parts ( lenggenhager et al . recent behavioral studies showed that , beyond local aspects of body perception and self - attribution ( rubber hand illusion , numbness illusion , face illusion ) , multi - sensory conflicts can also be used to manipulate more global aspects of body perception ( ehrsson , 2007 ; lenggenhager et al . , 2007 , 2009 ; petkova and ehrsson , 2008 ; aspell et al . , these studies showed that it is possible to investigate more global aspects of bodily self - consciousness and described several different components thereof , such as self - location , first - person perspective , and self - identification . a central aspect of global bodily self - consciousness is the sense of where the self is perceived to be located in space , or this apparently obvious link between the self and the body can be altered and experienced as being non - body centered . patients suffering from out - of - body experiences ( obes ) of neurological origin experience themselves as located outside their own bodily boundaries ( abnormal self - location ) , and report looking at their real body from an elevated perspective in extrapersonal space ( abnormal first - person perspective ; irwin , 1985 ; blanke et al . , 2004 ; blanke and mohr , 2005 ; de ridder et al . , 2007 ) . investigations into the neural correlates of obes provide insights on the multi - sensory nature of self - consciousness ( irwin , 1985 ; brugger et al . , 1997 ; blanke et al . , 2002 , 2004 ; brugger , 2002 ; blanke and mohr , 2005 ) . clinical studies showed that obes are linked to dysfunctions of the temporo - parietal junction ( tpj ; blanke et al . , 2004 ; blanke and mohr , 2005 ) , but also frontal , and parietal cortices ( lopez et al . , 2010 ; heydrich et al . , furthermore , electrical stimulation of the tpj induces obe - like experiences ( penfield , 1955 ; blanke et al . the tpj is activated during mental imagery of disembodied self - location ( arzy et al . , 2006 ; blanke et al . , an association between tpj dysfunction and obes has been proposed ( blanke et al . , 2002 , 2004 ; , 2004 ; blanke and mohr , 2005 ; brandt et al . , 2005 ; de ridder et al . , 2007 ; the tpj is an excellent candidate for integrating multi - sensory bodily information ( and self - consciousness ) , because it is involved in many self - related processes , such as first - person perspective ( ruby and decety , 2001 ; vogeley and fink , 2003 ; vogeley et al . , 2004 ) , frith , 2005 ) , theory - of - mind ( tom ; review in frith and frith , 2003 ) , and self - regulation ( heatherton , 2011 ) . accordingly , a selective impairment in self - other tasks , such as understanding others beliefs , has been reported in patients with lesions of the tpj ( samson et al . , 2005 ) . together with other brain regions , tpj has also been considered as part of a brain network involved in tom , that is the ability to understand others intentions , beliefs , and desires ( review in frith and frith , 2003 ) . in particular , the right tpj is believed to play a crucial role in the attribution of mental states ( e.g. , she wants to be a teacher ) , and both left and right tpj are recruited when participants are asked to imagine the other s mind ( saxe and wexler , 2005 ) . furthermore , activity of the left tpj seems to be selective for verbal descriptions of another person s beliefs , while the right tpj seems to respond more selectively to non - verbal stimuli ( saxe and kanwisher , 2003 ) . in addition , the tpj also plays a central role in processing vestibular information , with a right hemispheric predominance for otolithic inputs and a left hemispheric predominance for inputs from semicircular canals ( see lopez et al . , 2008 for review ) . in monkeys , neurons in the tpj discharge during vestibular stimulation , during tactile stimulation of face and trunk , and when a stimulus is in close proximity to the body ( grusser et al . , 1990 ; it is likely that bi- and tri - modal neurons in the tpj encode the multi - sensory matching of vestibular , visual , and tactile information for the full - body , similar to visuo - tactile bimodal neurons in the premotor and intraparietal sulcus that are anchored to body parts , including the hand ( iriki et al . , 1996 ; jointly , the reviewed data on the role of the tpj in self - location and first - person perspective , as well as processes related to self - other distinction and tom , reveal that cognitive and multi - sensory perceptual aspects of the self recruit at least partly overlapping neural substrates . more work is necessary to investigate how both crucial aspects of the self ( conscious - perceptual , cognitive , as well as conceptual mechanisms of the self ) interrelate behaviorally and neurally at the tpj and beyond ( blanke and metzinger , 2009 ) . the nature of abnormal self - location and self - identification during obes provides a unique opportunity to investigate self - consciousness , but generalization of results is rendered difficult by several methodological issues ( e.g. sample size , lesion homogeneity , different etiologies , and/or phenomenology , and generalization to the normal brain ) . in order to better control manipulations of self - consciousness with standardized and repeatable experimental protocols , several studies have recently induced obe - like illusions in large samples of healthy participants by presenting ambiguous multi - sensory information . in particular , self - location , first - person perspective , and self - identification have been experimentally manipulated in healthy subjects using visuo - tactile conflicts ( e.g. , ehrsson , 2007 ; lenggenhager et al . , 2007 , 2009 ; petkova and ehrsson , 2008 ; aspell et al . , ( 2007 ) and ehrsson ( 2007 ) induced changes in self - location and self - identification using congruent and incongruent visuo - tactile multi - sensory inputs . their general approach was adapted and extended from the original procedure of the rubber hand illusion ( review in tsakiris , 2010 ) , with a particular emphasis on the synchrony between visual and tactile information . in the setup used by lenggenhager et al . ( 2007 ) , participants viewed their own back through a head - mounted display ( hmd ) connected to a video - camera positioned behind their body . in this way they could see their back from a visuo - spatial third - person point of view , as if it was a virtual body . their own back was then touched with a wooden stick ( tactile stimulation ) and the hmd showed the movement either with or without a delay ( synchronous / asynchronous visual stimulation ) . thus , the touch ( tactile experience ) perceived by participants was either synchronous or asynchronous with respect to that viewed on the visually presented body . the congruence between the visual and the tactile stimulation determined changes in bodily self - consciousness . in particular , subjective reports indicated that when the visual and tactile stimulation were synchronous , stronger self - identification with the virtual body and stronger illusory touch were experienced ( lenggenhager et al . , 2007 ) . furthermore , behavioral measurements of self - location were acquired by displacing the participants ( blindfolded ) from the position where they were standing during the visuo - tactile stimulation , and asking them to return to the initial position . importantly , the indicated positions shifted away from participants actual starting location and toward that of the virtual body ( lenggenhager et al . , 2007 ) only after synchronous stimulation . based on these findings , the authors defined the complex of changes in bodily self - consciousness including self - identification and illusory touch , as well as the self - location change toward the virtual body , as a full - body illusion . similar to the previous study , participants sat on a chair and wore an hmd connected to two cameras positioned behind their back , affording them with a third - person perspective in extrapersonal space . dissimilar to the previous study , though , the site of tactile stimulation in this study was the chest , and another stick ( identical to the one used for the tactile stimulation ) was moved up and down in front of the cameras . the seen and the felt movement were again either synchronous or asynchronous . after 2 min of visuo - tactile multi - sensory stimulation , participants completed a questionnaire . results indicated that only after the synchronous stroking did participants report the experience of sitting behind their back and looking at themselves from this location . furthermore , physiological measurements ( skin conductance response ) were higher during a threat toward the virtual body after the synchronous stroking with respect to the asynchronous stroking condition ( ehrsson , 2007 ) . in both experiments participants looked at their own body from an external perspective , and only after synchronous stroking did they report stronger self - identification with the virtual body ( ehrsson , 2007 ; lenggenhager et al . , 2007 ) , and changes in self - location biased toward the position of the virtual body ( lenggenhager et al . , 2007 ) . the direct comparison between these two approaches ( back vs. chest - stroking , standing vs. sitting position , presence vs. absence of view of the contact between the stick and virtual body , etc . ) has recently been provided ( lenggenhager et al . , 2009 ) . in this study , the participants body position was held constant whilst the experimenters measured three different components of bodily self - consciousness : self - location , self - identification , and first - person visuo - spatial perspective . to that end , participants were placed in a prone position and wore an hmd connected to a camera such that they could see their body from above . in one condition participants received the tactile stimulation on their chest and saw a moving stick in front of the camera ( with the virtual body in the background ) . in another condition they felt the stroking on their back and saw the virtual body being touched by the same stick . in both conditions furthermore , self - location was measured by asking participants to imagine dropping a ball from their felt location , and estimating the amount of time required by the ball to hit the ground . the response times ( rts ) of this mental ball dropping ( mbd ) were recorded . ( 2009 ) showed that during the back - stroking , self - identification and illusory touch ( as indicated by the questionnaires ) were stronger after synchronous than asynchronous visuo - tactile stimulation . during the chest - stroking , self - identification and illusory touch were weaker during the synchronous than the asynchronous visuo - tactile stimulation . results of the mbd indicated that rts were shorter in the synchronous back - stroking than in the comparable chest - stroking condition , suggesting that the felt height was lower for the back - stroking condition , thus further suggesting that self - location was biased more toward the virtual body ( below ) during the back - stroking , and more toward the camera ( above ) during the chest - stroking . these data corroborated pioneering self - observations by g. m. stratton who described his own experiences in an similar experimental setup . this classical setup allowed him to induce changes in how he saw and felt his body . he reported changes in the visual first - person perspective and self - location , when walking with a portable device made of mirrors aligned in such a way that the walker ( stratton himself ) could see a projection of his body below and in front of him ( stratton , 1899 ; see also blanke et al . , 2008 ) . the setup projected an online image of his body in his anterior peripersonal space while he was walking in the countryside of california . he reported progressively increasing changes in self - location and self - identification over the time of exposure , further associated with the feelings of being out - of - body similarly , a comparable spatial conflict between the visual information relative to the moving body and the multi - sensory cues from the real body can be elicited by asking the participants to wear an hmd onto which their body filmed from an elevated perspective is projected , so that they could see their body while walking in the room ( mizumoto and ishikawa , 2005 ) . using this setup participants report to experience the self as located at the position of the visual perspective and simultaneously at the location of the visually presented body ( mizumoto and ishikawa , 2005 ) . somewhat comparably in the experimental setup used by lenggenhager et al . ( 2009 ) and ehrsson ( 2007 ) participants saw their own body being stroked synchronously or asynchronously . this induced changes in self - identification and self - location that were further modulated by the synchrony between visual and tactile stimulation . on that basis it has been proposed that self - location and self - identification are strongly influenced by the location of the seen touch , and that embodied self - location and the first - person perspective can be transformed to a disembodied or outside - body self - location and third - person perspective as a function of how and where the visuo - tactile stimulation occurs ( lenggenhager et al . , 2009 ) . we argue that experimental designs based on visuo - tactile multi - sensory disintegration might lead to alterations of the first - person perspective , and that this could be further facilitated by a more extended use of virtual reality ( tarr and warren , 2002 ; sanchez - vives and slater , 2005 ; riva , 2007 ; slater et al . , 2010 ) , and perhaps through repeated and prolonged exposure to such artificial bodily signals ( stratton , 1899 ) . the work on perturbation of visual field prisms adaptation ( pa ) provided important insights into visuo - spatial processing that may be related to the reviewed experiments ( striemer and danckert , 2010 ) . according to the classic pa procedure developed by richard held and colleagues , participants are asked to repeatedly perform goal - directed movements while wearing prismatic goggles ( held and freedman , 1963 ; redding and wallace , 1997 ) . prismatic goggles allow researchers to induce variable optical deviations between the seen and the real target position . thus , the goal - directed reaching or pointing movements are shifted in the direction of the visual deviation . these adaptations progressively increase with practice and when the prismatic goggles are removed this adaptation generally leads to an error in the opposite direction ( held and freedman , 1963 ) . the reviewed visuo - tactile procedures using video and virtual reality techniques in order to manipulate bodily self - consciousness , share several similarities with such adaptations induced by prisms , and affect the everyday correlation between tactile , visual , and vestibular signals . more systematic work is needed to evaluate whether adaptations as those during prism studies also occur during visuo - tactile stroking ( this is for example suggested by changes in self - location ) and whether comparable post - effects exist . the different setups that investigated self - location and first - person perspective by using video projections and visuo - tactile conflicts , showed that it is possible to manipulate some sub - components of bodily self - consciousness ( ehrsson , 2007 ; lenggenhager et al . , 2007 , 2009 ) . however , the temporal and spatial correspondence between the visual and the tactile stimulation in these setups was always applied by the experimenter . as such , precise and repeatable manipulations free from any possible experimenter bias were illusive to achieve . it was therefore necessary to develop more reliable methodological approaches and to precisely monitor and control what the participants feel and see . moreover , even though it has been shown that self - location and first - person perspective could be experimentally studied , the neural underpinnings have not been investigated , probably due to the difficulty of applying the visuo - tactile multi - sensory conflict in a well - controlled and repeatable manner during brain imaging data acquisition . robotic systems and virtual reality are the ideal tools to realize such standardized stimulation , and can therefore improve the control in such experimental studies ( blanke and gassert , 2009 ) . the rapid evolution of computer- and virtual - reality technology over the past decades has provided researchers with novel tools to explore different modalities of human perception and cognitive function . this has allowed researchers to revisit long - known phenomena and sensory illusions in behavioral studies with well - controlled and repeatable stimuli that can easily be manipulated in order to introduce multi - sensory conflicts . these conditions can further be manipulated to explore how humans integrate information from different sensory modalities and how they react to perceptual conflicts ( ellis et al . , 1999 ; ernst and banks , 2002 ; bertelson et al . , 2003 ; ernst and bulthoff , 2004 ) . such environments have found increasing applications in clinics , e.g. , for phobia treatment and neurorehabilitation ( jang et al . , 2002 ; holden , 2005 ) . in order to expand the variety of sensory modalities and include haptic perception , researchers performed studies in mixed environments , combining virtual reality with real objects . more recently , robotic systems , in the form of haptic displays , have been added to such environments , taking advantage of their unique ability to precisely apply tactile stimuli both temporally and spatially or render variable dynamic environments for physical interaction under computer control ( wolpert and flanagan , 2010 ) . combined with virtual reality , such systems offer the potential to systematically investigate haptic perception and sensorimotor control with the ability to precisely control and modulate factors such as intensity , location , type , and congruency of stimuli . flanagan and wing ( 1997 ) used a servo - controlled linear actuator to investigate if the central nervous system ( cns ) uses internal models to adjust grip force when stabilizing hand - held loads during arm movements . ernst and banks used a haptic interface and virtual reality to measure the variance in visual and haptic percepts , and to explore how these percepts are optimally integrated based on their reliability ( ernst and banks , 2002 ) . while the previous developments have provided greater control over experimental conditions with reduced variability in the presentation of stimuli , they have so far been limited to behavioral studies , and the associated neural correlates and mechanisms remained unexplored . more recent advances combining virtual reality and/or robotics with non - invasive neuroimaging have therefore opened a whole new range of technology and neuroscience - driven avenues to investigate sensory processing and multi - sensory integration ( gassert et al . , 2008a , b ; blanke and gassert , 2009 ; annett and bischof , 2010 ; dueas et al . , 2011 ) . the first functional studies with robotic interfaces were carried out over a decade ago with positron emission tomography ( pet ; shadmehr and holcomb , 1997 ; krebs et al . , 1998 ) , and took advantage of the fact that pet is not susceptible to electromagnetic interference from conventional robotic systems . however , pet requires injection of radioactive tracers , has low temporal resolution ( in the order of a minute for oxygen - based studies ) , and low spatial resolution , making it difficult to differentiate between activation in functionally different areas . the rapid spread and evolution of functional magnetic resonance imaging ( fmri ) over the past years , providing whole brain coverage with high spatial and good temporal resolution , have made this imaging method attractive for neuroscience investigations . the mr environment precludes the use of conventional robotic devices with fmri , both for safety and compatibility reasons . however , despite these constraints , a study using fmri , mr - compatible robotics , and visuo - tactile multi - sensory conflict has recently investigated the neural mechanisms of self - location and first - person perspective ( ionta et al . , 2011 ) . a robotic device built from mr - compatible materials , sensors , and actuators was embedded in the mr - scanner bed . participants lay on an ergonomic mattress divided into two parts , holding a robotic stimulator in the center , between the two mattresses . ( 2009 ) , the robotic device moved a tactile stimulator along a linear guide located below the back of the subject , driven by an ultrasonic motor over a rack and pinion gear . this ensured a constant pressure on the participants back and allowed the tactile stimulus to be presented according to a precisely repeatable movement profile . while feeling the tactile stimulation on the back , participants watched videos through mr - compatible video goggles placed in front of their eyes . the videos showed the back of a human body in a prone position , filmed from an elevated perspective , being stroked ( visual stroking ) synchronously or asynchronously with respect to the tactile stroking performed by the robotic device on the participants back . in a control condition the human body was hidden , and participants could see only the rod moving up and down in an empty room . by virtue of this computer - controlled robotic device , the spatial and temporal aspects of the visuo - tactile stimulation were precisely controlled during the fmri sessions within and across participants . after the visuo - tactile stimulation , self - location was estimated using the mbd task ( lenggenhager et al . , 2009 ) . furthermore , participants completed the questionnaire on self - identification ( ehrsson , 2007 ; lenggenhager et al . , 2007 , 2009 ) adapted from the original one used for the rubber hand illusion ( botvinick and cohen , 1998 ) . confirming pilot testing it was found that some participants felt as if they were looking up at the virtual body ( concordant with their real orientation ) whilst others felt as if they were looking down on their virtual body ( even if they were facing upward ) . this finding indicated that two different directions of first - person perspective were adopted by participants : those forming the up - group had the impression of looking upward , those in the down - group of looking downward at the virtual body . extending the difference in experienced direction of the first - person perspective between both groups ( as indicated by subjective reports ) , behavioral results showed that rts in the mbd task were significantly different between the synchronous and the asynchronous visuo - tactile stroking only when a human body was observed ( not during control conditions ) . most importantly , the direction of this effect was different for the two groups : in the up - group self - location was higher during the synchronous condition ( longer rts in the mbd ) with respect to the asynchronous condition ; in the down - group self - location was lower during the synchronous condition ( shorter rts in the mbd ) with respect to the asynchronous condition . moreover , independently of the synchrony of stroking , participants from the up - group had faster rts than those in the down - group , suggesting further differences in self - location between the two groups : subjects in the up - group experienced lower height than those in the down - group . these findings indicated that self - location as measured by the mbd was altered in opposite directions in the two groups , depending on the experienced direction of the first - person perspective ( subjective reports ) . fmri results showed that the activation patterns in tpj reflected changes in self - location and first - person perspective . in particular , in both groups the magnitude of the bold response was lower in conditions with a higher self - location as quantified by the mbd task , and conditions with a lower self - location were associated with a higher bold response . thus , tpj activity reflected synchrony - related changes in self - location with respect to the position or level of self - location , and further depended differently on the direction of the first - person perspective . comparable changes in self - location and the direction of the first - person perspective reported by patients with obes due to tpj damage ( ionta et al . , 2011 ) also concur with these behavioral and fmri data , independent of any potential attention modulation as shown by the effects of stroking synchrony and especially the effect of first - person perspective . obe patients classically report an elevated perspective that is distant from the body and down - looking ( comparable with participants from the down - group ) . the results obtained in healthy participants are therefore compatible with clinical data in neurological patients with obes ( blanke et al . , 2004 ; de ridder et al . , 2007 ) and reveal that the temporo - parietal cortex , especially in the right hemisphere , encodes these aspects of bodily self - consciousness . finally , the ( right lateralized ) tpj has been also considered as part of the brain network involved in visuo - spatial attention ( review in corbetta and shulman , 2011 ) . interestingly , improvements in visuo - spatial neglect , a pathological condition that typically affects the egocentric spatial relationship with visuo - spatial perspective or extrapersonal space ( karnath , 1994 ; farrell and robertson , 2000 ; vogeley and fink , 2003 ) , are reported following exposure to prisms ( rode et al . , 2006 ) , and further extend to other sensory modalities such as touch ( maravita et al . , 2003 ) and hearing ( jacquin - courtois et al . , 2010 ) . based on these findings , it has been proposed that pa may influence the activity of some visuomotor structures included in the dorsal visual stream and supposed to further mediate both motor and attentional processes ( corbetta and shulman , 2002 ; milner and goodale , 2006 ) . this interpretation supports the influence that pa might have on perceptual processes based on the interaction between areas of the dorsal and ventral visual stream superior temporal gyrus ( stg ) and inferior parietal lobe ( sarri et al . , 2006 ) . indeed visuo - spatial neglect has been linked to tpj , including stg ( karnath et al . , 2001 ; halligan et al . , 2003 ) , and neglect patients with lesioned tpj show deficits also in stimulus - driven reorienting attention ( rengachary et al . , 2011 ) . yet , the exact role of tpj in spatial attention is still controversial based on data in healthy subjects showing that stimulus - driven attentional processes recruit in addition to the right tpj ( shulman et al . , 2010 ) also insula , and inferior and medial frontal gyri ( corbetta and shulman , 2002 ) . conversely , it has been reported that tpj activity may also decrease in visual attention tasks ( shulman et al . , 1997 ; gusnard and raichle , 2001 ) . on the other hand , the activation of tpj during egocentric visuo - spatial perspective changes ( maguire et al . , 1998 ; vallar et al . , 1999 ; ruby and decety , 2001 ) , and during social perception tasks ( narumoto et al . , 2001 ; winston et al . , 2002 ) is consistent with clinical and experimental data in self - related processes ( blanke et al . , 2004 ; blanke and arzy , 2005 ; blanke et al . , 2005 ) . in summary there seems to be a functional overlap in the tpj between processes related to attention and bodily self - consciousness associated with bilateral recruitment in experimental work in healthy subjects and right lateralized tpj recruitment in patient studies . , 2007 , 2009 ) brain imaging ( arzy et al . , 2006 ; ionta et al . , blanke et al . , 2004 ; blanke and mohr , 2005 ; de ridder et al . , 2007 ) about three aspects of bodily self - consciousness : self - location , first - person perspective , and self - identification . clinical findings showed that these three components are dissociable , suggesting that they rely on different neural bases . behavioral studies showed that such dissociation can be experimentally induced also in healthy subjects via the imposition of multi - sensory conflicts . brain imaging evidence showed that , as a multi - sensory body - related integration area , the tpj is involved in all these three aspects of bodily self - consciousness . however , it is worth noting that also other areas including the precuneus ( northoff and bermpohl , 2004 ) , as well as the prefrontal ( gusnard et al . , 2001 ; ionta et al . , 2010 ) , somatosensory ( ruby and decety , 2001 ) , and the vestibular cortex ( lopez et al . , 2008 ) are expected to contribute to bodily self - consciousness . , 2011 ) , acoustic information ( aspell et al . , 2010 ) , and pain perception ( hansel et al . , 2011 ) . based on the reviewed findings , we conclude that multi - sensory integration is a key brain mechanism for self - consciousness . we suggest that future work should not only investigate mechanisms of visuo - tactile integration , but also their interaction with vestibular , proprioceptive , and cognitive motor signals ( i.e. , kannape et al . , 2010 ) . we finally suggest that only by using a multi - disciplinary approach combining behavioral and cognitive neuroscience , engineering , and virtual reality with neuroimaging , will it become possible to unravel the detailed mechanisms of bodily self - consciousness and other aspects of self - consciousness . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

scientific investigations on the nature of the self have so far focused on high - level mechanisms . recent evidence , however , suggests that low - level bottom - up mechanisms of multi - sensory integration play a fundamental role in encoding specific components of bodily self - consciousness , such as self - location and first - person perspective ( blanke and metzinger , 2009 ) . self - location and first - person perspective are abnormal in neurological patients suffering from out - of - body experiences ( blanke et al . , 2004 ) , and can be manipulated experimentally in healthy subjects by imposing multi - sensory conflicts ( lenggenhager et al . , 2009 ) . activity of the temporo - parietal junction ( tpj ) reflects experimentally induced changes in self - location and first - person perspective ( ionta et al . , 2011 ) , and dysfunctions in tpj are causally associated with out - of - body experiences ( blanke et al . , 2002 ) . we argue that tpj is one of the key areas for multi - sensory integration of bodily self - consciousness , that its levels of activity reflect the experience of the conscious i as embodied and localized within bodily space , and that these mechanisms can be systematically investigated using state of the art technologies such as robotics , virtual reality , and non - invasive neuroimaging .

in the last years , different strategies of therapeutic apheresis have been applied to treat various microcirculation disturbances . in the vast majority of cases reported in literature , the number of apheresis sessions considered necessary to achieve a positive outcome is extremely small . in sudden hearing loss ( shl ) , a disease affecting the inner ear vascularization , just one session was able to improve the hearing function . it has been presumed that the reasons justifying such a rapid effect are linked to the rheological properties of therapeutic apheresis and its capacity to reduce the concentrations of some plasma proteins closely connected with hemorheology . however , it is now becoming evident that long - term treatment with therapeutic apheresis , especially chronic therapy with low - density lipoprotein ( ldl ) apheresis in patients suffering from familial hypercholesterolemia , is able to reduce atherosclerotic plaque and to increase the vessel lumen , thus acting to improve morphological alterations of the vessels and showing an effect that extends far beyond the purely hemorheological one . in mellwig s experience , for instance , the myocardial perfusion under ldl apheresis , evaluated by pet , was considerably improved after the first session of ldl apheresis , but showed a more marked increase after 9 months of treatment . therefore , it seems likely that therapeutic apheresis is capable of achieving two different effects : a rapid effect , also called acute effect that takes place very rapidly , even a few hours after the end of the first session , and a slow one , also called chronic effect , which takes several weeks or months to develop . the acute effect may be attributed to the reduction in whole blood viscosity whereas the chronic effect is more difficult to explain . the first experiences of an acute effect of therapeutic apheresis were reported in an application in shl . in a frequently quoted article by suckfull , an improved hemorheological status induced by a single session of ldl apheresis was capable of significantly improving speech perception , especially in patients with higher levels in fibrinogen ( more than 8.68 the greater importance attributed to the reduction of fibrinogen as a means of predicting patients outcome in shl paved the way for the use of rheopheresis in the treatment of this disease . in their study , msges and colleagues proved that rheopheresis could be an effective treatment option for shl , demonstrating that two sessions of this apheresis strategy within 3 days lasting for about 2 h each could be used to replace a 10-day infusion regimen . ullrich and colleagues confirmed the role of fibrinogen in improving hemorheology by means of fibrinogen apheresis , which they used as a therapeutic procedure for the treatment of shl . in this study also , the authors administered only few sessions of apheresis , three at the most . the main auditory improvement was evident directly after the end of treatment and the reduction in relative mean hearing loss from the original 35.2 db to 11.8 db was highly significant . there is another similar disease affecting a sensory organ in which therapeutic apheresis has been shown to be efficacious , namely nonarteritic anterior ischemic optic neuropathy ( naion ) . the main pathogenetic mechanism of naion seems to be the result of an insufficient blood supply to the optic nerve head , due to the involvement of the posterior ciliary arteries . despite traditional treatment , the disease has a substantially stable course over time and may even get worse . therefore , naion has been an excellent field of application to verify the efficacy of therapeutic apheresis , much better than shl where a spontaneous recovery is frequently observed . in two pilot studies , the use of three sessions of ldl apheresis determined a clear improvement in the functional data for the affected eyes . in fact , the scotomatous portion of the visual field regressed already after the first session of ldl apheresis and further regressed after the third . to understand the mechanisms underlying such a rapid effect , in another study we correlated the mean deviation value change that is a more reliable index of an improvement of the visual field , together with a reduction of some markers of endothelial dysfunction ( including fibrinogen and lipids ) . we found a highly significant correlation , although no parameter was shown to have a prevalent influence with respect to the others . taking into account another microcirculation disorder , peripheral arterial disease ( pad ) , a single session of fibrinogen apheresis was shown to be able to improve the clinical picture with a significant increase in both total and pain - free walking distance , as a result of drastic reduction in serum fibrinogen concentration . in all these experiences , the different apheresis strategies have in common a rapid drop in macromolecule concentrations that has an effect on the blood rheology . we know that hemorheology is determined by the viscosity of the plasma and the whole blood and by the erythrocyte deformability and tendency to aggregate . otto and colleagues demonstrated that the effect of fibrinogen on plasma viscosity seems to be more pronounced than the influence of lipoprotein concentration . in fact , because of its molecular weight and more importantly its size , the fibrinogen has an important role in determining the plasma viscosity , even if it accounts for only 4% of the plasma protein content . moreover , fibrinogen has often been described as the most important protein in physiological and pathological red blood cells ( rbc ) aggregation , thus increasing the whole blood viscosity . rbc deformability , as an additional actor , has a fundamental importance in determining whole blood viscosity . the shape of rbc could be changed by the addition of lipoproteins to a suspension of rbcs , and the loss of rbcs deformability does not allow the cells to pass through a capillary vessel , thereby stopping the blood supply . to summarize , the mediators of blood viscosity that can influence rbc deformability , rbc aggregation , and plasma viscosity are essentially the fibrinogen and lipoproteins . by lowering the concentrations of these macromolecules , the ldl apheresis , rheopheresis , or fibrinogen apheresis reduce the blood viscosity and therefore the resistance to flow , according to the hagen poiseuille law . for these reasons , these three procedures could have an effect i would say a rapid effect on the clinical picture of microcirculation disorders , such as shl , naion , and pad . in other words , is acting on hemorheology , with so few sessions of apheresis , or even with a single session , enough to bring about a complete recovery in our patients ? in naion , we aimed to answer this question by assessing the conditions of a group of patients 6 months after they had been treated with ldl apheresis . the mean deviation of the visual field resulted statistically improved at discharge as compared with admission . however , the improvement did not persist up to 6 months , and there was a return to the baseline values recorded at hospital admission . in a study of uremic patients affected by pad and treated with ldl apheresis according to a regimen involving 5 sessions in 5 weeks , the blood flow in the peripheral microcirculation of the lower limbs , examined by laser doppler , which improved after the first , third , and fifth session , had returned to baseline values before the start of the third and fifth sessions . it seems likely , therefore , that a rapid but short effect is to be expected after few sessions of therapeutic apheresis , since the rheological advantage of apheresis is related to the rebound kinetics of the rheologically relevant plasma proteins . for these reasons , the effectiveness of therapeutic apheresis seems to last only as long as it is applied , with benefits that persists for only a few months after it is stopped . nevertheless , long - term treatment with therapeutic apheresis has been shown to induce a suppression of the progression of atherosclerotic lesions and eventually also a regression of atherosclerotic lesions , thus acting to improve morphological alterations of the vessels . after 1 year followup , the coronary angiograms of patients receiving chronic treatment with ldl apheresis displayed an increase in the minimal lumen diameter and a reduction of the area of plaque . a long - term treatment with ldl apheresis was able to induce a reduction of coronary calcifications in a patient affected by familial hypercholesterolemia . after 10 sessions of ldl apheresis , a complete occlusion of the anterior tibial artery improved to a partial stenosis , with a nearly complete healing of a decubitus . thus , in the long - term treatment , the ldl apheresis seems to influence actions going far beyond the hemorheological ones , that are confined to the first phases of the treatment only . it is known that apart from the direct lipid reduction effect , the ldl apheresis has been shown to have an extensive series of other actions , the so - called pleiotropic effects of ldl apheresis . among these , it is possible to consider a possible influence of ldl apheresis on the number of circulating endothelial progenitor cells , which can act directly on the vascular walls and repair vascular lesions . the differences between the acute and chronic effects of therapeutic apheresis are therefore a field which is still open for discussion , where it is essential to decide the timing and duration of treatment . in one of our experiences , for instance , we decided to treat the two patients with pad , who were in imminent danger of amputation , by adopting the same schedule of treatment and then stopping the apheresis in one patient and continuing the procedure in the other one , in order to establish the best timetable for this therapeutic approach . the patients underwent 22 sessions of rheopheresis over 4 months ; then the first patient continued the apheresis at the rate of one session a week for another year while the second patient remained untreated . ischemic lesions , as evaluated by photographs , showed a nearly complete healing at the end of the cycle of apheresis in both patients . the improvement persisted in the first patient during the year of apheresis , while a new ulcer reappeared just 2 months after the end of apheresis . on the contrary , in the second patient the situation was still substantially unchanged 14 months after the end of apheresis . these observations provide an example of the effectiveness of rheopheresis even in the presence of ulcers treated with a regimen of 22 sessions in 4 months and underline the necessity to personalize the treatment in order to avoid the reappearance of the previous clinical state shortly after the treatment is stopped . in conclusion , what we still need to explore further is the timing and duration of the use of therapeutic apheresis . it is reasonable to believe that few sessions of apheresis may act principally on the functional components of the vascular damage and the derived rheological benefit might last only for a short period ( for instance , a reduction of pain or an increase in the walking distance for pad ) . on the contrary , if we aim to operate on the morphological components of the vascular damage ( for example , to heal an ulcer and to prevent its reappearance after a short time in our patients ) , it seems likely that we need to prolong the apheresis treatment for a longer period or even to program several cycles of treatment . this article is part of a supplement sponsored by an unrestricted educational grant from b. braun and fresenius medical care .

in microcirculation disorders , the therapeutic apheresis seems to have two different effects . the first , achieved after only a few sessions , is acute , consisting of drastic reduction of blood viscosity and obtained with the use of low - density lipoprotein ( ldl ) apheresis , rheopheresis , or fibrinogen apheresis . the second effect is long term , or chronic , and needs to be evaluated after a long course of treatment . the mechanisms underlying the chronic effect are still objects of debate and take into account the pleiotropic effects of apheresis . however , it is likely that the acute effect of apheresis mainly influences the functional components of the vascular damage , and so the derived rheological benefit might last only for a short period . the chronic effect , on the contrary , by acting on the morphological alterations of the vascular walls , requires the apheresis treatment to be prolonged for a longer period or even cycles of treatment to be programmed .

kawasaki disease ( kd ) is a self - limited , systemic vasculitis of unknown etiology that affects the small and medium - sized blood vessels of the body . occur in children less than 5 years of age , and the incidence is highly varied , ranging from 4 to 216 per 100,000 children less than 5 years of age worldwide . the most serious complication of the disease is coronary vasculitis , leading to abnormalities in the coronary arteries that affect 15% to 25% of untreated patients . in addition to the cardiac complications , other abnormalities such as ataxia , facial paralysis , behavior disorders , and ocular complications can also be present . sensorineural hearing loss ( snhl ) is seldom cited as a kd complication yet is known as an additional , potentially severe , and frequently irreversible sequel . however , the vestibular effects of kd have been underestimated , and these could also be an important complication combined with snhl in kd . here we describe the case of a 4-year - old boy who developed vestibular loss in addition to snhl and recovered successfully with a combined treatment . a 4-year - old boy with no relevant prenatal or neonatal background and no history of hearing impairment had adequate normal growth and normal development of vocabulary and language . he was admitted to our pediatrics department due to uncontrolled fever and sudden onset vertigo persisting for 4 days . on admission , he presented with bilateral non - exudative conjunctival injection , marked injected and fissured lips , polymorphous rash of the face and trunk , and cervical lymphadenopathy ( right multiple palpable lymph nodes > 2 cm ) , in addition to the fever ( fig . he had moved back and forth from severe nausea and vomiting to loss of balance ; however , visual acuity and brain mri was normal . laboratory workup revealed leukocytosis ( 19,000/l ) with neutrophilia ( 79.5% ) , and neither anemia nor thrombocytosis was detected . renal function tests and liver enzymes were within the normal range . upon performing a lumbar puncture an electrocardiogram was normal , and no echocardiogram abnormalities were observed , with results showing normal dimensions of the coronary arteries . a clinical diagnosis of kd was established according to the american heart association criteria . treatment with intravenous immunoglobulin was promptly initiated ( 1.5 g / kg in a single and continuous perfusion ) in association with acetylsalicylic acid ( asa ) ( 80 mg / kg / day ) . he became apyretic within 24 hours of treatment implementation , with progressive regression of the remaining clinical symptoms . he soon recovered from nausea and vertigo after the treatments and was discharged 5 days later , maintaining asa with low - dose prophylaxis ( 5 mg / kg / day ) . four days after discharge , his parents noticed a sudden absence of response to sound stimuli and brought him to the clinic of otorhinolaryngology . assessment of hearing function was obtained through impedance audiometry , play audiometry , and auditory brainstem response ( abr ) ( fig . his impedance audiometry showed a type a curve bilaterally with no response of stapedial reflex at a sound of 100 db hl . play pure tone audiometry confirmed severe bilateral snhl with right mixed hearing loss components ( right ear , 75 db with an air - bone gap of 20 db ; left ear , 45 db ) . a v wave in the abr test was present until 75 db stimuli on the right ear and 55 db on the left ear . after the exclusion of salicylate toxicity ( therapeutic drug monitoring level < 0.3 g / ml plasma ) , we thought that the hearing loss could possibly be due to the subacute phase after the acute phase of kd . blood tests confirmed thrombocytosis during the second week of disease ( 606,000/ml , compared with 416,000/ml at the initial admission ) as well as a progressive decrease of acute inflammatory response markers ( wbc=89,400/l ; neutrophil percentage=40.3% ) . there were no visualizations of either anterior inferior cerebellar artery ( aica ) , the feeding vessel of the cochlea , in 3d - magnetic resonance angiography ( mra ) ( fig . 3 ) . to stop the progression of kd we administered a corticosteroid for immunosuppression and added an anticoagulant drug to interrupt the vascular insufficiency of the cochlea . intravenous steroid pulse therapy ( methylprednisolone sodium succinate , started at 200 mg / day initially for 5 days and then tapered down ) was initiated with plavix ( clopidogrel bisulfate , 18 mg / kg ) , instead of asa . during follow - up , there was a significant improvement of auditory acuity in both ears ( 5 days after steroid therapy : right ear=50 db , left ear=45 db ; 3 weeks later : both=25 db ) ( fig . tonal audiometry , performed 2 months after the diagnosis of kd , confirmed a normal hearing threshold . we observed another kind of severe complication in this case : snhl and vestibular loss ; which is not frequently reported in the literature . the presence of hearing loss during the subacute phase of kd in children is very rare , especially when accompanied by canal paresis causing vestibular hypofunction . moreover , the successful combined treatment restored the functions of the cochlea completely . therefore , this report is important for assessing effective treatment in these patients . until now , the association of snhl with kd seems to be underestimated , as hearing dysfunction can be discreet and transient in this disease , detectable only by audiometry or bera in very young children who can not express themselves well linguistically . knott , et al . found that 19 of 62 patients experienced snhl with kd . similarly , in the most recent and largest study of 115 kd patients by alves , et al . , 33% had snhl during the acute and subacute phases of the disease . in the present case , the patient 's parents failed to identify the hearing problem early after discharge and brought him to our clinic 4 days later , when he failed to correctly recognize words , even when hearing his own speech . audiometry results then revealed that his right ear threshold was 75 db , and his left ear threshold was 40 db . the hearing loss may be associated with the aberrant inflammatory process , due to the intense immune activation observed in the acute phase . this systemic inflammatory process can affect the membranes of the labyrinth and the osmotic balance in the fluid inside the compartments of the inner ear or in the cochlear vessels , thus leading to hearing loss . secondary abnormalities of the vasa nervorum and perineural vessels resulting in damage of the acoustic nerve could be other possible causes of hearing loss . the inflammatory cells that infiltrate the vasa nervorum and epineural arteries lead to obstruction , axonal ischemia , and consequent nerve injury . the changed expression of metalloproteinases in the vessel walls can contribute to their subsequent destruction , which can participate directly in the injury caused by nerve ischemia . in addition to this pathophysiology of kd , thrombocytosis in this case indicated a possibility of ischemia injury owing to vascular insufficiency . the aica , the feeding vessel of the cochlea and vestibule , was not visible on the images from 3d - mra . however , we are uncertain as to whether the small vessels in both ears were obstructed or were too small to be visualized . the potential role of salicylate ototoxicity in the genesis of hearing loss in acute kd patients has been raised . higher doses tend to cause more severe hearing loss , although a precise dose - response relationship can not be demonstrated . it is unlikely , however , that the snhl experienced in this case was caused by asa ototoxicity alone . the therapeutic drug monitoring level was very low ( < 0.3 g / ml plasma ) , and the patterns of hearing impairment differed from the patterns characteristic of salicylate ototoxicity , in which binaural flat or high - frequency deficits predominate . at the initial audiometry , there was an air bone gap that recovered within a few days . although it might have been an error from the young child 's play audiometry , we think that acute cochlear injury caused a stiffness of the ossicular chains , especially the stapes , due to a lateralization of oval window caused by endolymphatic hydrops . kd can result in ataxia due to the involvement of the vestibular division of the acoustic nerve . other cranial nerves may also be affected , and facial paralysis secondary to involvement of the seventh nerve has also been described . although this patient had initial symptoms of a vestibular deficit with severe nausea , no one was able to determine when the hearing loss started . the results of the caloric test indicated no response from the right ear canal , showing that dizziness and ataxia might have originated from a complete loss of vestibular function . despite the fact that the symptoms of nausea and unbalance subsided due to a compensation of the contralateral side , the canal paresis still remained . the early treatment initiated during the first week of hearing loss , including the use of high - dose systemic steroids combined with anticoagulants , is thought to possibly prevent the progression of hearing deficit . complete remission within two months was obtained due to early awareness of the possibility of snhl associated with kd , which allowed for a timely intervention . children with kd may be referred to the otolaryngologist for a variety of signs and symptoms during their acute illness . referral for evaluation of dizziness as well as hearing loss may occur long after signs and symptoms of acute kd have disappeared . given that kd is a self - limited illness that resolves even in the absence of treatment , the diagnosis may be missed and the illness forgotten . therefore , pediatrics and otolaryngologists should refer symptomatic patients for audiologic and vestibular evaluations and for kd evaluations , such as an echocardiogram .

sensorineural hearing loss ( snhl ) that is seldom cited as a kawasaki disease ( kd ) complication is known as an additional , potentially severe , and frequently irreversible sequel . furthermore the vestibular functions of kd have been underestimated and it could be an important complication combined with snhl in kd . we described a case that a 4 year - old boy who developed vestibular loss with snhl has recovered successfully with a combined treatment .

most of the studies relating to the analysis of mixed dentition use plaster casts to evaluate the available space for the eruption of permanent teeth . plaster cast analysis can not , however , determine the position of unerupted teeth , even for ideal space conditions . radiographs , on the other hand , allow for the simultaneous evaluation of the tooth diameter and intraosseous position . there are few available radiographic studies aimed at predicting the space conditions from mixed to permanent dentition . most of these studies are restricted to the evaluation of the ectopic eruption of the maxillary canines . schindel and duffy ( 2007 ) concluded that there is a close relationship between the transverse maxillary discrepancy and potentially impacted canines , which can be identified by panoramic radiographs . mesiodistal root angulation alterations of the maxillary and mandibular incisors may significantly change the molar relationship . the angulations of permanent first molars , incisors and canines on panoramic radiographs could provide data relating to the tooth eruption in mixed dentition . even though there are no studies on mesiodistal root angulation in mixed dentition with normal occlusion and well- balanced faces , reference values for this angulation are required for professional knowledge . the aim of this study was to evaluate mesiodistal root angulation of permanent incisors , canines and first molars of a brazilian child sample with mixed dentition , using the horizontal reference line drawn on a panoramic radiograph . this study was approved by the research ethics committee of the federal university of gois ( ufg ) , brazil ( protocol # 051/2007 ) . one hundred children , with a mean age of 8.9 years ( sd=0.76 ) , were chosen from the dental school clinics of the ( ufg ) , private dental offices , and public and private schools . the inclusion criteria were : middle mixed dentition stage , class i occlusion with no tooth crowding above 2 mm or history of orthodontic treatment , and a well - balanced face , without skeletal disharmony . children with syndrome aspects , skull or dentofacial anomalies or early loss of primary teeth were excluded . fifty girls and fifty boys with ages varying from 8 years to 10 years and 11 months were evaluated . the sample was subdivided into three groups according to their age : eight ( n=49 ) , nine ( n= 37 ) and ten ( n=14 ) years old . the aim was to verify any change in mesiodistal root angulation influenced by canine eruption during the " ugly duckling stage " . the comparison was done only between the youngest ( eight years old ) and oldest ( ten years old ) groups . the children were first chosen by visual inspection by the researcher while they were standing , looking straight at the horizon and maintaining a natural head position . the child was asked to smile and if there was no visible malocclusion , the dental occlusion was clinically examined , the cheeks being moved with a wooden spatula . all children had their panoramic radiograph taken in the same radiological clinic by gendex orthoralix 9200 dde apparatus ( gendex dental systems , des plaines , il , usa ) . the patients were positioned in a standard manner , with the teeth in maximum intercuspation , the occlusal plane kept horizontal and the facial midline perpendicular to it . the pictures were processed by an automatic processing machine ( xtec - revell , so paulo , sp , brazil ) . each radiograph was checked and those considered of poor quality were repeated or discarded . all panoramic radiographs were evaluated by the same examiner in a dark room , using a light box . the anatomic structures from the panoramic radiograph were drawn on 0.07-mm - thick acetate paper ( 29.5x15.0 cm ) with a 0.05 pencil point . the drawing included the orbital lower contour , the mandible 's external profile , the contour of the permanent first molars , canines and incisors and crowns of the primary maxillary and mandibular canines . two reference lines were drawn on both left and right sides , passing at the middle intercuspation point of the first permanent molars and the primary canines . it was decided to use a single reference line for maxillary and mandibular teeth , based on the intercuspation of the teeth ( figure 1 ) . the mental line was discarded because in the studied sample it was noticed that the mental foramen was clearly visible in less than 20% of the children . panoramic radiograph showing the anatomic structures , the dental long axes and the angles measured relative to the reference line measured on the external side the long root axis was determined according to ursi , et al . for the single - rooted teeth , the root canal image in its greatest length was selected ; for the mandibular molars , the mean of the mesial and distal root canals and another point in the middle of the clinical crown was chosen , and for the maxillary molars , the palatal root image and another point in the middle of the clinical crown were used . the angles of the right and left reference lines and the long axis of the tooth were measured on each radiograph . the measured angle was external , located distally to the midline ( figure 1 ) . after assessing the normality of the sample , the student 's t - test for independent samples was selected to compare the mesiodistal root angulations between the genders , right and left lateral teeth and the extreme age ranges in the examined groups ( 8 and 10 years ) . this study was approved by the research ethics committee of the federal university of gois ( ufg ) , brazil ( protocol # 051/2007 ) . one hundred children , with a mean age of 8.9 years ( sd=0.76 ) , were chosen from the dental school clinics of the ( ufg ) , private dental offices , and public and private schools . the inclusion criteria were : middle mixed dentition stage , class i occlusion with no tooth crowding above 2 mm or history of orthodontic treatment , and a well - balanced face , without skeletal disharmony . children with syndrome aspects , skull or dentofacial anomalies or early loss of primary teeth were excluded . fifty girls and fifty boys with ages varying from 8 years to 10 years and 11 months were evaluated . the sample was subdivided into three groups according to their age : eight ( n=49 ) , nine ( n= 37 ) and ten ( n=14 ) years old . the aim was to verify any change in mesiodistal root angulation influenced by canine eruption during the " ugly duckling stage " . the comparison was done only between the youngest ( eight years old ) and oldest ( ten years old ) groups . the children were first chosen by visual inspection by the researcher while they were standing , looking straight at the horizon and maintaining a natural head position . the child was asked to smile and if there was no visible malocclusion , the dental occlusion was clinically examined , the cheeks being moved with a wooden spatula . all children had their panoramic radiograph taken in the same radiological clinic by gendex orthoralix 9200 dde apparatus ( gendex dental systems , des plaines , il , usa ) . the patients were positioned in a standard manner , with the teeth in maximum intercuspation , the occlusal plane kept horizontal and the facial midline perpendicular to it . the pictures were processed by an automatic processing machine ( xtec - revell , so paulo , sp , brazil ) . each radiograph was checked and those considered of poor quality were repeated or discarded . all panoramic radiographs were evaluated by the same examiner in a dark room , using a light box . the anatomic structures from the panoramic radiograph were drawn on 0.07-mm - thick acetate paper ( 29.5x15.0 cm ) with a 0.05 pencil point . the drawing included the orbital lower contour , the mandible 's external profile , the contour of the permanent first molars , canines and incisors and crowns of the primary maxillary and mandibular canines . two reference lines were drawn on both left and right sides , passing at the middle intercuspation point of the first permanent molars and the primary canines . it was decided to use a single reference line for maxillary and mandibular teeth , based on the intercuspation of the teeth ( figure 1 ) . the mental line was discarded because in the studied sample it was noticed that the mental foramen was clearly visible in less than 20% of the children . panoramic radiograph showing the anatomic structures , the dental long axes and the angles measured relative to the reference line measured on the external side the long root axis was determined according to ursi , et al . for the single - rooted teeth , the root canal image in its greatest length was selected ; for the mandibular molars , the mean of the mesial and distal root canals and another point in the middle of the clinical crown was chosen , and for the maxillary molars , the palatal root image and another point in the middle of the clinical crown were used . the angles of the right and left reference lines and the long axis of the tooth were measured on each radiograph . the measured angle was external , located distally to the midline ( figure 1 ) . after assessing the normality of the sample , the student 's t - test for independent samples was selected to compare the mesiodistal root angulations between the genders , right and left lateral teeth and the extreme age ranges in the examined groups ( 8 and 10 years ) . method error ( me ) was calculated by dahlberg 's formula me=d2/2n(d = first and second measurements difference , n = exams measured twice number ) to check the intra - examiner error . one week after the first evaluation , the examiner analyzed and measured 40 radiographs again . the greatest error obtained was 1.73 , which was considered small enough to be acceptable . the mean mesiodistal root angulation for permanent molars , canines and incisors was established separately for the female and male groups ( table 1 ) . in the maxilla , the boys had significantly greater angulations than the girls in the following permanent tooth groups : right central incisors , right and left canines . girls ' mandibles were more angulated in the left side than in the region of the central and lateral incisors . mesiodistal angulation of different teeth in children [ mean age 8.9 years standard deviation ( sd=0.76 ) ] with mixed dentition , according to gender the data obtained in this study were analyzed as follows : for the first maxillary molars , angulation close to 90 degrees in a vertical position , whereas the mandibular molars had approximately 25 degrees of distal root angulation ; the maxillary canines were the most distally angulated teeth , approximately 66 degrees . the mandibular canines were vertically positioned and the maxillary anterior area exhibited vertical lateral incisors and central incisors with a slight distal angulation . in the mandible , a root convergence to mesial was noticed , which resulted in well aligned crowns with a discrete distal angulation . given that the whole population has normal homogeneous characteristics , we sought to define whether homologous permanent teeth had the same angulation ( figure 2 ) . in the maxilla , the incisors and canines were significantly more angulated on the right side . in the mandible , the first molars were significantly more angulated on the left side , and the right lateral incisors were more angulated than the left lateral incisors . sd= standard deviation the mesiodistal angulation values were also compared between the youngest ( eight years old ) and oldest ( ten years old ) groups and no statistically significant differences were found . this study measured the mesiodistal root angulations of permanent incisors , canines and first molars among brazilian children with normal occlusion in mixed dentition . ( 1990 ) suggested using superior and inferior reference lines for the evaluation of the mesiodistal axial inclination in the panoramic radiographs of adults with permanent dentition , with the superior line passing through the lowest points of the right and left orbits and the inferior line through the centre of the right and the left mental foramina . our study suggests using a reference line passing through the intercuspation mid - point of the permanent first molars and primary canines , to the right and the left sides , respectively . the choice was justified mainly by the difficulty of locating the mental foramen in the mixed dentition , which is small and superimposed by the tooth germs . also , the permanent first molars and the primary canines are visible and easily identified structures , reducing the reference line errors . the males showed angulations of 5 to 6 degrees greater than those of the females . other studies report that differences of up to five degrees between the genders are clinically acceptable . the alterations in the anterior mandibular area could be attributed to the panoramic radiograph distortions mentioned in the literature . the comparison of mesiodistal root angulations between the homologous permanent teeth showed statistically significant differences for the maxillary incisors and canine groups . our results support the idea that asymmetrical eruption may be present in normal mixed dentition . some studies report that there is no alignment pattern for the maxillary incisors , which may be protruded and present diastemas , which decreases the aesthetics , despite being a normal occlusion requiring no treatment . evaluation of the youngest ( eight years old ) and the oldest ( ten years old ) groups in the same mixed dentition revealed no differences . this could justify the absence of alterations in the mesiodistal angulation between these two groups , suggesting that no influence was established by canine eruption until that time . despite some inherent degree of distortion , the panoramic radiograph is the most practical examination for evaluating tooth angulations . in the maxilla , the comparison of panoramic radiography with cone beam computed tomography revealed the anterior maxillary roots ' over - inclination in a mesial direction and the posterior roots ' over - inclination in a distal direction . the greatest alteration occurred between the maxillary canines and the first premolars . with regard to the anterior mandibular angulations , the authors reported that they were not bilaterally symmetric and the posterior roots tended to be mesially inclined . the results of our study also failed to show bilateral symmetry for the majority of the evaluated teeth . the normal values established for the root angulation of permanent teeth in the middle mixed dentition in brazilian children may offer parameters for the early diagnosis of deviations , as well as signs of normal asymmetric pattern of eruption . this study determined the acceptable mean values in a homogeneous group , but longitudinal studies are welcome to confirm this normal behavior . the following conclusions can be drawn : the proposed reference line could be useful in mixed dentition root angulation evaluation ; there was a slight asymmetry in the mesiodistal angulation among homologous teeth , and also a small variation between the male and the female groups , but no difference between 8-and 10-year - old children .

objectivethere is little information regarding the mesiodistal angulation of permanent teeth in mixed dentition . the aim of this study was to evaluate mesiodistal root angulation of permanent incisors , canines and first molars of 100 brazilian children , using a new horizontal reference plane based on the midpoint of the intercuspation of primary canines and permanent first molars in panoramic radiographs during the mixed - dentition phase . material and methodschildren were equally divided between the genders with a mean age of 8.9 years ( sd=0.76 ) , normal occlusion and no eruptive disturbances . resultsthe angulation of the permanent maxillary first molars was close to the vertical , whereas the mandibular molars presented approximately 25 degrees of distal root angulation . the maxillary canines were the most distally angulated teeth , whereas the permanent mandibular canines were vertically positioned . the evaluation of the anterior maxillary area showed vertical position of permanent lateral , and central incisors with a slight distal angulation , whereas the permanent mandibular incisors tended to a mesial radicular convergence . conclusionsthe proposed reference line could be useful in mixed dentition root angulation evaluation ; there was a slight asymmetry in the mesiodistal angulation among homologous teeth , and also a small variation between the male and the female groups , but no difference between 8-and 10-year - old children .

carotid angioplasty and stenting ( cas ) has become an alternative option to carotid endarterectomy ( cea ) for treatment of carotid artery stenosis . the carotid revascularization endarterectomy versus stenting trial ( crest ) supported this alternative treatment option although the periprocedural stroke rate was higher in the stenting group.3 ) distal embolization of plaque fragments raises concerns regarding the safety of cas . whereas distal embolization resulting from cas usually occurs in the cerebral hemisphere , it sometimes develops as central or branch retinal artery occlusion ( crao or brao).8)11 - 13 ) however , there have been no reports of ophthalmic artery occlusion . a right internal carotid artery ( ica ) angiogram showed collateral circulation to the anterior cerebral artery ( aca ) and the middle cerebral artery ( mca ) via anterior communicating artery and leptomeningeal anastomoses ( fig . 1 ) . a left common carotid artery ( cca ) angiogram revealed left proximal cervical ica occlusion ( fig . after insertion of an 8 fr sheath , an 8 fr guiding catheter ( fas ; boston scientific , natick , ma , usa ) was introduced into the left cca . a 420 mm balloon ( ultra - soft sv ; boston scientific , natick , ma , usa ) was used for pre - dilatation followed by stent implantation using an 840 mm carotid stent ( acculink ; abbott vascular , abbott park , il , usa ) ( fig . , the thrombus in distal ica was removed using the penumbra aspiration system ( penumbra , inc . , alameda , ca , usa ) . a careful interview revealed that his visual acuity decreased soon after cas . upon examination , the patient 's visual acuity in the left eye was finger counting at a distance of 50 cm . fluorescein angiography revealed no abnormal finding except a mild delay ( 18 sec . ) in the arm to retina time . we checked the previous cerebral angiogram after cas and found ophthalmic artery occlusion ( fig . follow - up of the cerebral angiogram showed no occlusion in the left ophthalmic artery ( fig . cas is an effective alternative treatment for patients who are not good candidates for cea . however , it has several complications such as major or minor stroke , vasospasm , arterial dissection , residual stenosis and subarachnoid hemorrhage.1)2 ) distal arterial embolization is the most common complication , reported as high as 29 - 39.5%.4)6 ) most often , embolization occurs in the cerebral hemisphere . jaeger et al.4 ) reported that most embolic lesions were smaller than 5 mm and occurred in the distribution of the cortical branches of the mca and aca , in the parietal and frontal lobes , and in the upper and middle areas of the brain . these authors explained these embolic properties by the particles released during the procedure traveling in a straight path with the blood flow to the cortical branches of the mca and aca . crao is an ophthalmologic emergency , characterized by a sudden onset of devastating visual loss . crao is a rare event , encountered in less than 0.1% of the cases.7 ) its causes include carotid bifurcation disease , cardiac disease , retinal artery thrombosis , vascular spasm , and vasculitis . among these , embolism from the carotid bifurcation is the most common cause of crao and brao.7 ) unlike crao , which can be thromboembolic or embolic , the causes of brao are almost always embolic.8 ) several studies reported crao or brao after cas.8)11 - 13 ) samardzic et al.10 ) reported retinal circulation embolism after cardiac procedures . there are not many reports of the incidence of retinal artery embolization during or after cas . wilentz et al.12 ) reported that the incidence of retinal artery embolization during cas was 5% ( six out of 118 patients ) . a study using transcranial doppler measurements found a considerable number of embolic episodes during cas , with an average of 74 emboli per procedure.5 ) atherosclerosis of the ophthalmic artery can be another cause of crao.11 ) the third mechanism involves anastomosis between the ophthalmic artery and the external carotid artery.12)13 ) the ophthalmic artery has numerous extra - orbital branches , which can have extensive anastomoses with the ica . these anastomoses may cause retinal embolization when some types of embolic protection devices are used . several reports address risk factors of crao in patients with carotid stenosis . muller et al.9 ) reported that the patients with ulcerated , heterogeneous plaques have a higher risk of crao or brao . kimura et al.7 ) suspected that severe carotid stenosis , in addition to heterogenous plaques , is an important risk factor for retinal artery occlusion . we present a case of ophthalmic artery occlusion during emergency revascularization of an acutely occluded ica . during this procedure , interventionists can not detect crao if the patient does not complain about visual symptoms . unlike crao , ophthalmic artery occlusion can be easily detected and is treated simultaneously if the interventionists are aware of this condition . in our case , the ophthalmic artery occlusion was caused by a thrombus that filled the ica due to ica occlusion . therefore , we suggest that acute ica occlusion carries a higher risk of ophthalmic artery occlusion or crao than ica stenosis . ophthalmic artery occlusion or crao during cas are rare complications , but when they occur they are disastrous . endovascular neurosurgeons should closely observe ophthalmic arterial blood flow during cas , especially in the treatment of acute ica occlusion .

distal embolization resulting from carotid angioplasty and stenting ( cas ) occurs mainly in the cerebral hemisphere . we report a case of ophthalmic artery occlusion after carotid revascularization . a 75-year old man received emergency cas for cervical internal carotid artery occlusion . two months later , the patient was readmitted for decreased visual acuity . we found ophthalmic artery occlusion that was not noticed soon after cas . although ophthalmic artery occlusion after cas is rare , endovascular neurosurgeons should be aware of this potential complication .

we used pcr amplification and southern blot hybridization to detect 9 virulence factors among 40 ehec type - strains from the stec center , national food safety and toxicology center , michigan state university ( east lansing , mi , usa ) . the virulence factor targets were the following : 1 chromosomal ( eae ) , 2 phage ( stx1 and 2 ) , and 6 plasmid ( open reading frame [ orf ] 1 , orf2 of posak1 ; espp , hlya , katp , and tox b of po157 ) ( table ) . dna - dna hybridization probes were made from virulence factors amplified from o157:h7 edl933 genomic dna . pcr amplification was carried out with pcr primers ( 20 pmol / l each per 50 l reaction ) ( integrated dna technologies , coralville , ia , usa ) ( table ) and 1 l genomic dna ( extracted from overnight luria - bertani broth cultures according to puregene dna isolation kit instructions [ gentra systems , minneapolis , mn , usa ] and dissolved in 50 l 10 mmol / l tris , ph 8.3 ) in a pcr cocktail containing 1 pcr buffer , 1.5 mmol / l mgcl2 , 1 u vent exo( ) polymerase from new england biolabs ( beverly , ma , usa ) , and 200 mol / l each datp , dgtp , dttp , and dctp . the mix was incubated for 30 cycles of 94c , 40 s ; annealing ( for temperatures , see table ) , 45 s ; 72c , 60 s , and a final 10-min extension at 72c . p - labeled dna probes were made from 2 g pcr amplicons ( purified by montage pcr cleanup spin column ( milipore corp . , burlington , ma , usa ) . the dna was denatured at 94c , 40 sec ; annealed ( temperatures in table ) with 50 pmol / l of the appropriate pcr primers , 45 s extended for 2 h at 72c . / l each datp , dgtp , dttp ; 2.0 l 3,000 ci / mmol -p - dctp ( mp bioscience , buxton , uk ) ; and 1.25 u taq polymerase in a 50 l final volume . unincorporated p - nucleotide was removed by sephadex g-50 in tris - edta , 1% sodium dodecyl sulfate ( sds ) . bacteria ( 800 l overnight cultures ) were transferred to hybond - n+ nitrocellulose membrane ( amersham biosciences uk ltd , buckinghamshire , uk ) by dot - blot vacuum filtration apparatus ( schleicher and schuell , keene , nh , usa ) . lysis and binding of genomic dna fixation were carried out by exposure to lysis solution ( 1.5 mol / l nacl , 0.5 mol / l naoh ) twice for 5 min each , and twice with neutralization solution ( 1 mol / l tris - cl , ph 7.4 ; 1.5 mol / l nacl ) for 5 min each . the filter was then submerged in 2 ssc with gentle agitation , air dried , and the dna uv ( 254 nm ) cross - linked at 120,000j / cm ( cl-1000 cross - linker , fisher biotech , pittsburgh , pa , usa ) . probe hybridization was carried out in rotating hybridization bottles ( fisher scientific isotemp hybridization oven , fisher biotech ) in 20 ml 6 ssc , 1% sds at 68c . membranes were washed twice , for 1 min , in room temperature 2 ssc , 0.1% sds , and twice at 45c for 1 h in 1 ssc , 1% sds . hybridized membranes were exposed overnight with a phospho - imaging screen ( bio - rad , hercules , ca , usa ) and visualized with a personal molecular imager fx ( bio - rad ) . the 3 chromosomal targets ( stx1 , stx2 , and eae ) were detected with 100% efficiency by both pcr and hybridization ( no . positive by pcr / no . positive by hybridization ) : 21/21 stxi , 19/19 stxii , and 37/37 eae . plasmid - associated genes , however , were detected with less efficiency relative to hybridization : katp : 15/17 ( 88% ) , hlya : 26/27 ( 96% ) , espp : 19/23 ( 83% ) , toxb : 13/16 ( 81% ) , and both orf1 and orf2 : 4/5 ( 80% ) ( appendix table ) . seventy - five percent ( 30/40 ) of the pathogenic e. coli strains tested contained at least 1 stx gene , 23% ( 9/40 ) were positive for both stx1 and stx2 . the most common gene detected was intimin ( eae ) , which was positive by both pcr and hybridization in 37/40 ( 93% ) of the strains . while eae is strongly correlated with shiga toxin , the adherence phenotype conveyed may be sufficient to cause a pathogenic state because 4 of the clinical isolates investigated contained only the eae gene . thirty - one ( 78% ) of the 40 pathogenic strains tested were positive for at least 1 ( by hybridization , pcr , or both ) of the 4 genes , toxb , katp , hlya , espp , which are usually carried on the archetypal po157 plasmid : 11/31 ( 35% ) retained all 4 , 4/31(13% ) carried three , 9/31 ( 29% ) carried 2 , and 5/31 ( 16% ) carried only 1 ( the sole pcr - positive / hybridization - negative isolate [ espp in ed-31 ] was presumed to result from a nonspecific amplification ) . five ehec strains ( 13% ) hybridized to both orf1 and orf2 ( from posak1 ) ( 1,4 ) , but only 4 were amplifiable . these same 4 also contained eae and at least 1 shiga toxin gene ( the 1 that failed to amplify [ e851/71 ] lacked both stx1 and stx2 ) . the current accepted standard for ehec identification is amplification of stx1 , stx2 , eae , and hlya by pcr . however , this technology is generally only available at large hospital or state health laboratories . hybridization is superior to culture screening methods and largely complimentary to pcr , but has a potentially broader epidemiologic application since it is unaffected by minor sequence variations that can completely inhibit pcr . only 3% of the 360 virulence factor hybridizations made in this study did not amplify . pcr failure is expected with its relatively higher sensitivity to single base primer - hybrid mismatch compared to whole amplicon hybridization . notably , however , all 12 variations detected were among plasmid - associated virulence factors : 95% ( 228/240 ) of the plasmid hybridizable targets were amplified , compared to 100% ( 120/120 ) of the hybridizable chromosomal targets . although we detected the variable presence of genes ostensibly associated with 2 plasmids ( po157 and posak1 ) and the bacterial chromosome , we did not attempt to verify either plasmid or chromosomal locations for any of the amplicons or dna : dna hybrids . while all virulence factor targets summarized in this study are subject to change there have been reports of any of the putative chromosomal or plasmid virulence factor targets in this study being found elsewhere . prager et al . ( 7 ) recently reported , using pcr alone , a wide variety of 25 virulence factor combinations among 266 pathogenic e. coli isolates representing 81 serotypes . such diversity speaks directly to the need to accurately assess virulence factor presence to evaluate epidemiologic and clinical correlations . a similar 5% failure of the plasmid - associated virulence factor amplifications could have implications in such virulence factor correlations . overall , however , these results are very similar to those of this study of prospective control strains . the use of a single control , such as edl 933 , will inherently bias pcr detection schemes since a failure of amplification in a test will be read as the absence of virulence factor element because it was amplifiable in the control . if amplification failure is a measure of template variation , we find a much greater variability among plasmid - associated virulence factors . although po157 has been reported in most o157 h7 strains ( 13 ) , our study demonstrates a high variability in the putative virulence factor content of po157 as well as a highly variable content of po157-associated virulence factors among the o157 isolates screened . finally , po157-associated virulence factors were detected among all but 4 of the 20 e. coli serotypes examined .

we compared pcr amplification of 9 enterohemorrhagic escherichia coli virulence factors among 40 isolates ( 21 o / h antigenicity classes ) with dna hybridization . both methods showed 100% of the chromosomal and phage genes : eae , stx , and stx2 . pcr did not detect 4%20% of hybridizable plasmid genes : hlya , katp , espp , toxb , open reading frame ( orf ) 1 , and orf2 .

the different forms of contamination come from different sources and are dealt with in different ways . contamination can occur at the source , between source and storage points or in storage tanks . defective joints , syphonage , rusted pipelines , and crossing over of sewage pipelines are other causes of contamination . so , drinking water distribution systems may contain a diverse microbiological community that may include opportunistic pathogens and it is the most important single source of human exposure to gastroenteric diseases , mainly as a result of the ingestion of microbial contaminated water . water contamination of respirators and incubators of newborns are the main sources of transfer [ 6 , 7 ] . the cooling tower and the air condition system have also been reported to be sources of several outbreaks . a wide variety of opportunistic pathogens such as pseudomonas can be incorporated into the piped potable water , colonizing the surfaces of pipelines with high numbers of biofilm - forming bacteria . in addition , in bacteriological assessments , particularly for coliforms , the indicators of contamination by fecal matter must be routinely performed by many public health authorities to ascertain the quality of water to ensure prevention of further dissemination of pathogens through the agency of water . addition of chlorine in different water treatment plants is a common practice , but it is not sufficient to ensure the safety of water . there is adverse association between bacterial count of water samples and free residual chlorine but the failure of conventional treatment processes to eliminate critical waterborne pathogens in drinking water demands that improved and/or new disinfection technologies should be developed . the aim of the present study was to determine the contamination rate of cold and warm water as well as water of containers of newborn incubators in hospitals of gilan province , iran , by pseudomonas aeruginosa , legionella pneumophila , and e. coli , using molecular approach . during april june 2014 , one hundred and thirty - five water samples ( about 50 ml for each ) were aseptically collected in 60 ml plastic containers from 30 hospitals of the area ( 30 cold water samples , 32 warm water samples , and 73 incubator water samples ) . cold water and warm water samples were taken after the water had run for 5 min . potable water is supplied to the hospitals by the municipal system where it receives no additional treatment . all water samples were concentrated 20-fold ( by dividing any sample into 5 falcon tubes , centrifugation with 12000 rpm for 30 min in 4c , discarding supernatant , dissolving precipitant in 0.5 ml remaining water , and collecting them in a tube ) . after discarding supernatant , sediment was resolved in 1 ml of the remaining solution and was divided into two different parts . one part was treated in 50c for 30 min to reduce other contaminants for effective recovering of legionella . after heat treatment , each sample was inoculated in 5 ml liquid medium containing yeast extract 10 g / l , l - cysteine 0.04% , ferric pyrophosphate 0.25 g / l , glycine 0.3% , and vancomycin 5 g / ml with final ph 6.9 and incubated in 35c for 3 days . it should be noted that vancomycin and glycine are added to the medium after autoclave and when the temperature was around 40c . the selectivity of the medium was subsequently improved by the incorporation of vancomycin and glycine . the second part of each sample was inoculated in trypticase soy bean broth and incubated in 35c for 3 days for recovering p. aeruginosa and e. coli . all cultured samples were divided over 1 ml in volume and centrifuged in a sigma model 3k30 centrifuge at 12.000 rpm in 4c for 20 min . the supernatant was discarded , and the pellet was suspended with 1 ml of te buffer before dna extraction . dna was extracted by using commercial procedure ( genomic dna purification kit , thermo scientific , lot : 00155557 , fermentas , lithuania ) . the extracted dna was either used immediately for pcr or stored at 20c until analysis . several rounds of pcr were performed to detect p. aeruginosa , integron 1 , metallo--lactamases gene , legionella pneumophila , mip gene , and e. coli as the following procedure : ( 1 ) conventional pcr by using specific primers for l. pneumophila and mip gene separately , ( 2 ) multiplex pcr by using specific primers for p. aeruginosa , integron 1 , and metallo--lactamases gene , ( 3 ) conventional pcr for detecting e. coli using specific primers , and ( 4 ) final round of pcr to investigate total presence of bacteria by using universal primers . we used genomic dna of l. pneumophila type strain nctc 11192 as positive control for the first round of pcr . a standard strain of p. aeruginosa ( atcc 27853 ) was used as positive control for the second round of pcr , and e. coli ( atcc 44338 ) was used as positive control for third and fourth rounds of pcr . two microliters of the extracted template dna was used in a 20 l reaction mixture that included 10 l of pcr premix [ prime taq premix ( 2x ) , chorea lot number 201208 ] , 0.5 l of each primer , and 7 l of ddh2o . cycling program for first round amplification of l. pneumophila ( species specific fragment ) was as follows : an initial denaturation at 94c for 5 min and then 35 cycles consisting of 94c for 60 s , 45c for 50 s , and 72c for 60 s were followed by a final extension at 72c for 10 min . cycling program for second round of pcr was the same but the annealing temperature was 50c . annealing temperature for third round of pcr was 58c and for 16s rrna amplification with the universal primers was 47c with the same cycling program . electrophoresis of amplified product was performed on agarose gel ( 2% w / v ) by 125 volts for 45 minutes and analyzed by geldoctransluminator system ( vilberlourmat model ) . one hundred and thirty - five water samples were aseptically collected from 30 hospitals of the area ( 30 cold water , 32 warm water , and 73 incubator water samples ) . contamination rates of cold , warm , and incubator water samples with p. aeruginosa were 16.6% , 37.5% , and 6.8% consequently ( tables 24 and figure 1 ) . degrees of contamination with l. pneumophila were 3.3% , 9.3% , and 10.9% ( tables 24 and figure 2 ) and with e. coli were zero , 6.2% , and zero ( tables 24 and figure 3 ) . total bacterial contamination of cold , warm , and incubator water samples was 93.3% , 84.4% , and 89.0% consequently ( tables 24 and figure 4 ) . metallo--lactamases gene was found in 20.0% of cold water samples , 15.6% of warm water samples , and 21.9% of incubator water samples ( tables 24 ) . about 60.0% of p. aeruginosa in incubator samples had metallo--lactamases gene , 42.0% of warm water samples had p. aeruginosa with this gene , and 10.0% of p. aeruginosa in cold water samples had the same gene . about 8.3% of p. aeruginosa in warm water samples had integron 1 but we did not find p. aeruginosa with integron 1 in any sample of incubators and cold water . we also did not find p. aeruginosa with both integron 1 and metallo--lactamases gene in incubator and cold water samples and just 1 of 12 p. aeruginosa of warm water sample had both integron 1 and metallo--lactamases gene . about 25.0% of l. pneumophila in incubator samples had mip gene and 33.3% of warm water samples had l. pneumophila with mip gene . we did not find l. pneumophila with mip gene in cold water samples . in total , 88.9% of all samples showed bacterial contamination as revealed by pcr with universal primers , 16.3% of all samples had p. aeruginosa , 8.9% had l. pneumophila , and 1.5% had e. coli . the metallo--lactamases gene was found in 20.0% and integrin 1 was found in 3.0% of all samples . the ability of microbes to survive in hospital water reservoir was described more than 30 years ago , and numerous studies have confirmed hospitals water as a source of nosocomial infection . the bacterial contamination level related to the tap water was a point of dispersion of bacterial species , including potentially pathogenic organisms . modes of transmission for waterborne infections include direct contact , ingestion of water , indirect contact , inhalation of aerosols dispersed from water sources , and aspiration of contaminated water . several factors could be attributed to the contamination of surface water such as the age of the distribution system , the quality of the delivered water , defective chlorination , and improper maintenance . contamination can occur at the source , between source and storage points or in storage tanks . the bacterial contamination occurs because of regrowth of microorganisms in biofilms which are formed on interior surfaces of water pipes . biological activity in biofilms is controlled by nutrient content of water , temperature , and residual chlorine . microorganisms are widely distributed in nature and their abundance and diversity may be used as indicators for suitability of water . certain types of microorganisms are characteristics of human fecal contamination . in the present study we used three bacteria ( e. coli , p. aeruginosa , and l. pneumophila ) to evaluate quality of studied water supplies because river and underground waters are main sources of tap water in the area and these bacteria are main human pathogens with water sources actually in this study , e. coli was used as a representative of the enteric bacterial pathogens . we also used l. pneumophila as ubiquitous waterborne microorganism and p. aeruginosa as ubiquitous waterborne opportunistic pathogen . e. coli is a type of fecal coliform bacteria commonly found in the intestines of animals and humans and the presence of it in water is a strong indication of recent sewage or animal waste contamination . we did not find e. coli in cold water and incubator water samples and just two warm water samples showed presence of e. coli . in some similar studies water distribution systems of examined hospitals were totally free of gram - negative bacteria belonging to family enterobacteriaceae . although coliforms are known as the best index for monitoring water microbial quality , in some cases this index is not very efficient . some believe that the excess growth of heterotrophic bacteria results in suppression of the coliforms . therefore , it is recommended to use other bacteria as an alternative index in water microbial quality control and pseudomonas can be one of these indicators . p. aeruginosa is part of a large group of free - living bacteria that are ubiquitous in the environment . aeruginosa is of major concern in hospitals , since it can cause severe secondary infections , such as pneumonia in burn victims or immunocompromised persons . its occurrence in drinking water is probably related more to its ability to colonize biofilms in plumbing fixtures ( i.e. , faucets and showerheads ) than its presence in the distribution system or treated drinking water . p. aeruginosa can survive in deionized or distilled water ; hence , it may be found in low nutrient or oligotrophic environments such as distilled water which is used for incubators of newborn ward . in the present study contamination degree of warm water with p. aeruginosa was higher ( 37.5% ) than cold water ( 16.6% ) and incubator water ( 6.8% ) . it also can be isolated even in the presence of 3.00 ppm residual free chlorine . a number of laboratory - based studies have demonstrated the colonization of heterogeneous biofilms developed from tap water microorganisms by pathogens such as e. coli , l. pneumophila , and p. aeruginosa . a number of studies showed that these bacteria are important opportunistic pathogens which can be involved in biofilm - associated contamination of domestic plumbing systems [ 3437 ] . de abreu et al . presented that biofilm tap water was the major environmental source of pseudomonads in the healthcare facility . in the present study it should be noted that metallo--lactamases producing strains have been increasingly reported worldwide and have been responsible for large outbreaks in several asian , european , and american hospitals [ 3842 ] . genes encoding metallo--lactamases are generally located within class 1 integrons , together with those encoding aminoglycoside - modifying enzymes that confer multidrug resistance . in addition , the integrons harboring metallo--lactamases determinants are frequently located on plasmids , certainly facilitating their intra- and interspecies spread . high prevalence of metallo--lactamases producing epidemic or endemic strains is also found in other mediterranean countries , such as italy and greece . this bacterium can also survive at lower temperatures in drinking water environments [ 46 , 47 ] . l. pneumophila , particularly strains within serogroups 1 and 6 , is known as cause of both community acquired and hospital associated pneumonia [ 48 , 49 ] . several reports have demonstrated that the major sources for legionnaires ' disease are the potable water systems of large buildings including hospitals , nursing home , and hotels . in a similar study , yaslianifard et al . found considerable contamination rate of l. pneumophila and p. aeruginosa in hospital water samples in tehran , iran . shamabadi and ebrahimi found low rate contamination with gram - negative flora , moderate concentrations of legionella , and potentially pathogenic nonenterobacterial species . in the present study we found the degree of presence of l. pneumophila in cold water was lower than in warm water and incubator water . it seems that high loads of p. aeruginosa can mask the presence of legionella , leading to an underestimation in some cases . many authors agree that different microbe species as well as high microbial loads can play an important role in limiting or even inhibiting the growth of legionella [ 52 , 53 ] . in our study actually overall pollution of hospital water systems with legionella found in the present work was smaller compared to earlier studies made in germany and italy [ 5457 ] . in a usa national surveillance study of 20 hospitals in 13 states , 14 hospitals were colonized with legionella in the water systems in which 43% of hospitals had environmental positive rates for legionella . in a study in spain on 12 hospitals , the present study showed that care should be taken concerning cleanliness and decontamination of water supplies for pathogenic organisms . chlorine has been widely used as disinfectant due to its low cost and effectiveness in many countries but it is not sufficient to ensure the safety of water . the maintenance of chlorine residue is needed at all points in distribution system supplied with chlorine as a disinfectant . the failure of conventional treatment processes to eliminate critical waterborne pathogens in drinking water demands that improved and/or new disinfection technologies be developed . recent research has disclosed that nanotechnology may offer solutions in this area , through the use of nanosorbents , nanocatalysts , bioactive nanoparticles , nanostructured catalytic membranes , and nanoparticle - enhanced filtration . our study demonstrated that contamination degree of studied water samples with p. aeruginosa was considerable , with l. pneumophila was moderate , and with e. coli was very low . we also found frequent presence of metallo--lactamases gene in the studied water samples indicating widespread multiple drug resistance bacteria .

this study is designed to determine the contamination degree of hospital water supplies with pseudomonas aeruginosa , legionella pneumophila , and e. coli in gilan , iran . samples were collected directly into sterile containers and concentrated by centrifuge . half part of any sample transferred to yeast extract broth and the second part transferred to trypticase soy broth and incubated for 3 days . dna was extracted by using commercial kit . four rounds of pcr were performed as follows : multiplex pcr for detecting pseudomonas aeruginosa , integron 1 , and metallo--lactamases gene ; pcr for detecting legionella pneumophila and mip gene separately ; pcr for detecting e. coli ; and another pcr for detecting whole bacterial presence . contamination rates of cold , warm , and incubator water samples with p. aeruginosa , were 16.6% , 37.5% , and 6.8% consequently . degrees of contamination with l. pneumophila were 3.3% , 9.3% , and 10.9% and with e. coli were zero , 6.2% , and zero . total bacterial contamination of cold , warm , and incubator water samples was 93.3% , 84.4% , and 89.0% consequently . metallo--lactamases gene was found in 20.0% of all samples . contamination degree with p. aeruginosa was considerable and with l. pneumophila was moderate . metallo--lactamases gene was found frequently indicating widespread multiple drug resistance bacteria . we suggest using new decontamination method based on nanotechnology .

total hip arthroplasty ( tha ) procedures have grown in demand in the past decades . data from the national inpatient sample show a 48% increase in total hip replacement cases from 1997 to 2004 . annually , more than 300 000 tha procedures are performed in the united states , with a projected 137% increase by the year 2030 . the cause of the current increase in demand for total joint arthroplasty ( tja ) surgery can be hypothesized to be related to the increasing obesity epidemic , increased longevity , the aging baby boom population , and younger patients seeking surgical treatment in order to maintain a higher quality of life as well as facilitating their return to the workforce . joint replacement patients come from a wide socioeconomic spectrum . the majority of patients who have tjas are white and have a higher than average income . whites account for the majority of the procedures , with white men 3 times more likely to undergo tha than black men . skinner et al reviewed 430 726 knee arthroplasties during the years 1998 to 2000 and have shown that the rate of knee arthroplasties performed for white men ( 4.84 per 1000 ) was higher than that of hispanics ( 3.46 per 1000 ) and more than double the rate for blacks ( 1.84 per 1000 ) . the increasing trend in tja has contributed to the economic burden of current health care systems already struggling with limited resources . in the united states , medicare pays roughly 60% of all costs related to tja surgery . with a projection of 600 000 hip replacement surgeries and 1.4 million knee replacement surgeries predicted by 2030 , the projected incurred cost is unparalleled . in the recent years , length of stay ( los ) for tja procedures has decreased . as a trade - off , patients are more likely to be discharged to extended care facilities ( ecfs ) and home with extended care ( hec ) than before . results from a retrospective study by hartog et al on tha patients from july 1 , 2008 , to june 30 , 2012 , showed a significant decrease in los from an average of 5.1 days to 2.9 days . between 1993 and 2003 , the percentage of tja patients admitted to ecf grew exponentially from 17.1% to 54.6% . as the los continues to decrease and more episode of care payment models that bundle both the hospital and the posthospital care costs are evolving , an investigation of the cost - effectiveness of postoperative care is necessary . predicting the discharge destinations of tja patients would offer insights and may begin to address these questions . we took advantage of the california patient discharge data collected by the state of california office of statewide health planning and development ( oshpd ) for the year 2010 and analyzed it statistically to determine which variables are significant in predicting discharge destinations . we hypothesized that patient demographics and socioeconomic profile will influence whether a patient was discharged after a tha to an ecf versus home with extended care or home without any extended care while controlling for clinical severity of the patient . the data used for this study were the california hospital discharge data set collected by the california oshpd . for each hospitalization , the data set includes information about patient demographics ( age , gender , race , and ethnicity ) , insurance type , diagnoses and procedures , and patient disposition . the study cohort included 14 326 patients undergoing hip replacement identified by international classification of diseases ninth revision procedure code 81.51 . discharges to a ecf and discharge to home with home health care ( hhc ) were the 2 alternatives . independent variables included the charlson comorbidity index , which captures patients medical comorbidities , payer category ( private pay , medicare , medical the california version of medicaid , and other ) , race ( white , black , native american / eskimo / aleut , asian / pacific islander , and other race ) , ethnicity ( hispanic or not ) , age ( defined by 5-year age - groups ) , and gender . the tha patients often display comorbidities , with the likelihood of more comorbidities present among older patients . patients aged 65 years and older have a 60% to 88% chance of having at least 1 comorbidity , and among the tha patients it was found that the average number was 2.2 comorbidities for this age - group . the charlson comorbidity index serves as an indicator as to whether the patient s extended illnesses affected their discharge destination . the demographic variables had a large percentage of missing ( masked ) values , 30% of the observations . these variables are masked by the state of california because of concerns for breach of confidentiality due to small sample sizes ( zip code areas with small population sizes ) . because the percentage of missing variables was relatively high , and because the observations that were missing one of the variables almost always were missing all other demographic variables , we concluded that imputation techniques might not be reliable . as an alternative strategy , we estimated regression models for ( 1 ) the full sample , ( 2 ) the smaller sample with the full demographic data , and ( 3 ) the smaller sample without the demographic variables . because the estimates for all nondemographic covariates were similar , we concluded that the smaller sample with a complete set of demographic variables is representative of the full population sample , and we present only the estimates for this model in the article . average age was 67 , with more women , at 59% , receiving surgery than men . most patients had little comorbidity as indicated by the very low average charlson comorbidity index of 0.46 . the charlson index can range from 0 to 10 , and in our sample 99% of patients had values below 2.64 . it should be noted , however , that the race and ethnicity variables were the ones most often masked by the state of california , as discussed earlier . we estimated multinomial regression models for tha in which the unit of observation is the patient discharge . the dependent variable is the observed discharge destinations , with discharge to home being the reference category . for each independent variable , these models provide 2 relative risk ratios ( rrrs)one ratio is the risk of discharge to a ecf divided by the risk of a discharge to home and the other is the ratio of the risk of discharge to home with home care divided by the risk of discharge to home without any services . all statistical analyses were done in stata software v-12 ( statacorp lp , college station , texas ) . the study was considered exempt by our irb because the data sets were received deidentified . the data used for this study were the california hospital discharge data set collected by the california oshpd . for each hospitalization , the data set includes information about patient demographics ( age , gender , race , and ethnicity ) , insurance type , diagnoses and procedures , and patient disposition . the study cohort included 14 326 patients undergoing hip replacement identified by international classification of diseases ninth revision procedure code 81.51 . discharges to a ecf and discharge to home with home health care ( hhc ) were the 2 alternatives . independent variables included the charlson comorbidity index , which captures patients medical comorbidities , payer category ( private pay , medicare , medical the california version of medicaid , and other ) , race ( white , black , native american / eskimo / aleut , asian / pacific islander , and other race ) , ethnicity ( hispanic or not ) , age ( defined by 5-year age - groups ) , and gender . the tha patients often display comorbidities , with the likelihood of more comorbidities present among older patients . patients aged 65 years and older have a 60% to 88% chance of having at least 1 comorbidity , and among the tha patients it was found that the average number was 2.2 comorbidities for this age - group . the charlson comorbidity index serves as an indicator as to whether the patient s extended illnesses affected their discharge destination . the demographic variables had a large percentage of missing ( masked ) values , 30% of the observations . these variables are masked by the state of california because of concerns for breach of confidentiality due to small sample sizes ( zip code areas with small population sizes ) . because the percentage of missing variables was relatively high , and because the observations that were missing one of the variables almost always were missing all other demographic variables , we concluded that imputation techniques might not be reliable . as an alternative strategy , we estimated regression models for ( 1 ) the full sample , ( 2 ) the smaller sample with the full demographic data , and ( 3 ) the smaller sample without the demographic variables . because the estimates for all nondemographic covariates were similar , we concluded that the smaller sample with a complete set of demographic variables is representative of the full population sample , and we present only the estimates for this model in the article . average age was 67 , with more women , at 59% , receiving surgery than men . most patients had little comorbidity as indicated by the very low average charlson comorbidity index of 0.46 . the charlson index can range from 0 to 10 , and in our sample 99% of patients had values below 2.64 . it should be noted , however , that the race and ethnicity variables were the ones most often masked by the state of california , as discussed earlier . we estimated multinomial regression models for tha in which the unit of observation is the patient discharge . the dependent variable is the observed discharge destinations , with discharge to home being the reference category . for each independent variable , these models provide 2 relative risk ratios ( rrrs)one ratio is the risk of discharge to a ecf divided by the risk of a discharge to home and the other is the ratio of the risk of discharge to home with home care divided by the risk of discharge to home without any services . all statistical analyses were done in stata software v-12 ( statacorp lp , college station , texas ) . the study was considered exempt by our irb because the data sets were received deidentified . the majority of patients , 46.9% , were discharged to hhc , followed by 29.6% discharged to ecfs and 23.5% discharged to home . more than half of the patients were insured by medicare ( 56.6% ) , followed by private payers ( 38.4% ) . medical ( california state medicaid program ) accounted for only 2.4% of the patients in our cohort , suggesting that this discretionary procedure ( tha ) is not typically offered as frequently to those with income - based insurance coverage compared to patients insured by other payers . this observed discrepancy in the prevalence of patients with medicaid insurance among the study cohort might point to disparity in care . alternatively , it may point to an access of care problem , but our study was unable to examine this issue . table 1.patient demographics.descriptive statistic : hip replacementvariablemean / percentagefrequency / standard deviationdischarge destinations home routine23.53364 snf29.64242 hhc46.96720charlson index0.460.88payer category private coverage38.45507 medicare56.68107 medicaid2.4339 other pay2.6373race white91.613 132 black3.9561 native american0.18 asian1.8257 other race2.6368ethnicity hispanic5.2740 non - hispanic94.813 586age67.03gender female59.18461 male40.95865abbreviations : hhc , home health care ; snf , skilled nursing facilities . it presents the rrr for discharge to ecf and discharge to home with home care relative to discharge to home , and the statistical significance for the ratio being different from 1 . if the ratio exceeds 1 , the probability of discharge to a location other than home is higher than the probability of discharge to home . table 2.predicted relative risk ratios of discharge to snf and home health relative to home without home health for patients after tha.rrr95% confidence intervalrrr95% confidence intervalhomereference ( base outcome)snfhhc charlson severity index1.32 1.25 - 1.411.05 1.00 - 1.12types of pay medicare1.70 1.48 - 1.951.17 1.05 - 1.31 medicaid2.28 1.66 - 3.130.70 0.54 - 0.91 other pay0.790.56 - 1.110.55 0.43 - 0.69race whitereference ( base outcome ) black2.43 1.86 - 3.171.41 1.12 - 1.79 native american1.580.18 - 13.31.240.22 - 6.90 asian2.47 1.66 - 3.681.330.91 - 1.95 other race1.70 1.15 - 2.501.350.97 - 1.89ethnicity non - hispanicreference ( base outcome ) hispanic1.48 1.13 - 1.950.830.66 - 1.05 age1.54 1.49 - 1.591.07 1.04 - 1.10gender femalereference ( base outcome ) male0.48 0.44 - 0.540.920.85 - 1.00abbreviations : hhc , home health care ; rrr , relative risk ratios ; snf , skilled nursing facilities . . predicted relative risk ratios of discharge to snf and home health relative to home without home health for patients after tha . abbreviations : hhc , home health care ; rrr , relative risk ratios ; snf , skilled nursing facilities . as expected , discharge to ecf is more likely for patients with more comorbidities and a higher age ( p < .001 ) . however , the strongest predictors are medical payer and black or asian race ( p < .001 ) . medicare coverage relative to private payers is also a strong predictor of ecf discharge ( p < .001 ) . male gender is the only factor that lowers the risk of discharge to an ecf ( p < .001 ) , probably reflecting the fact that men are more likely to be married and have a caregiver at home ( table 2 ) . as with ecf , patients with more comorbidities and a higher age had an increased risk of being discharged home with home care . unlike ecf discharge , being a medical enrollee lowered the risk of being discharged home with home care ( p < .01 ) and gender did not matter ( table 2 ) . as expected , discharge to ecf is more likely for patients with more comorbidities and a higher age ( p < .001 ) . however , the strongest predictors are medical payer and black or asian race ( p < .001 ) . medicare coverage relative to private payers is also a strong predictor of ecf discharge ( p < .001 ) . male gender is the only factor that lowers the risk of discharge to an ecf ( p < .001 ) , probably reflecting the fact that men are more likely to be married and have a caregiver at home ( table 2 ) . as with ecf , patients with more comorbidities and a higher age had an increased risk of being discharged home with home care . unlike ecf discharge , being a medical enrollee lowered the risk of being discharged home with home care ( p < .01 ) and gender did not matter ( table 2 ) . discharge destination after tha to a ecf , hhc , or home without hhc is dependent on many factors among which are patient demographic characteristics , social norms , insurance status , patient and care providers preferences , and so on . this study serves to provide insights into which specific patient characteristics influences discharge destination after tha . in our study , the majority ( over 76% ) of patients after tha surgery were discharged to an ecf or home with an hhc program . this tendency might be due to the ongoing trend of reducing los among tja patients . as anticipated , older age and patients with more comorbidities had a strong relative risk of being discharged to an ecf or home with an hhc program . bozic et al identified baseline characteristics among 7818 consecutive patients who underwent tja at 3 high volume centers . in their study , they showed that older age , higher the american society of anesthesiologists ( asa ) physical status classification system score , medicare insurance , and female sex increased the risk of discharge to an ecf . bozic et al did not differentiate between ecf , hhc , and discharge home without hhc . as discharge home with hhc is increasing , data on predicting the need and proper utilization of this resource need to be further elucidated . in our study cohort , tha patients being black or asian was a highly significant ( p < .001 ) factor for patient discharge destination to an ecf . other minority characteristics ( native american and other races ) had relatively less significance in determining discharge destinations . a possible explanation for the low volume of minority patients is due to the lower prevalence of tha procedures in these minority populations as well as a possible lower prevalence of osteoarthritis among black patients compared to white patients . of the 14 326 tha patients , 3.9% were black , compared to 0.1% of native american patients , the least represented in the tha data set . sociocultural barriers can be cited for these low numbers . in previous studies , african or hispanic physicians , despite their underrepresentation in the physician pool , cared for 25% of african and 25% of hispanic respondents . the scarcity of diverse health professionals has been correlated with the perceived effectiveness of the quality of care . native americans , with their strong partiality to alternative medicine , would more likely respond to their health needs if consulted by a native american physician . an interesting finding arose from this study ; tha patients covered under medical were more likely to be discharged home with an hhc program . an affordable alternative to ecfs while still an effective discharge destination , hhc was the dominant care among the low - income population . california is witnessing an increase in the number of insured low - income families following the passage of the 2014 affordable care act ( aca ) . by 2016 , a projected estimate of 3.4 million people under the age of 65 will be insured , with 1.4 million people enrolled in medical . as more and more low - income families are insured , the demographics of tha patients will shift toward the underrepresented , minority population . the qualifications and benefits of discharging patients home with an hhc program will need to be reevaluated , as the likelihood of medical insured patients to be discharged home with an hhc program increases under the aca in the near future . compared to white beneficiaries , racial minorities were more likely to be discharged to an ecf or use hhc programs . in comparison to costs , furthermore , it has been shown that there is an increased readmission rate even among healthy patients who are discharged to an ecf compared to home following total joint arthroplasty . in a previous study by munin et al , patients with comorbidities were at risk of requiring postacute care rather than being discharged to home . further work should detail the types of comorbidities experienced by tha patients and whether patterns of certain illnesses lean toward a specific discharge destination . another case in point would be to define the hospital identification number ( oshpd_id ) in which tha procedures were derived from so that regional characteristics can be determined . with the assumption that most patients arrive at a hospital of their geographical convenience , the demographics around the area of the respective hospital would help to clarify the distribution of race , ethnicities , and so on . knowledge of numbers of tha patients who are being admitted into the hospitals will also clarify what types of services are available in that region . in rural areas , individuals received less intensive care in the institution versus in a home setting and thus may prefer an hhc program rather to be discharged to an ecf . while this study offers important insights into the discharge destination of tha patients and the factors that contribute to it , several limitations should be noted . this study was limited to the experience of patients in california in 2010 . while the data are recent , our findings may not generalize to the rest of the country . practice patterns may be different in other parts of the country , and similar studies should be repeated with national data . further , because of restrictions and masking of some of the oshpd data ( in order to protect patient confidentiality ) , we were unable to fully explore the implications of all socioeconomic and race variables although our analysis indicated that our results can be generalized to the entire data set . other data sets , which do not have these limitations , should be pursued in future studies . race , insurance , and morbidity were highly significant factors for patient discharge destination to a subacute nursing facility . these findings are important first steps in beginning to understand the complex relationships between the acute and the postacute care and costs incurred by these patients , a must as we move forward toward bundled payment and episode financing .

introduction : with this growing demand , the length of stay for total hip arthroplasty ( tha ) procedures has decreased , and as a trade - off , we have seen a higher utilization of extended care facilities ( ecfs ) . both trends have significant economic implications on the health care system , and predicting the discharge destinations of tha patients would help policy makers plan for future health expenditures . we performed a retrospective data analysis of a large patient database to determine which variables are significant in predicting discharge destinations of tha patients.methods:we used the california hospital discharge data set of the year 2010 , collected and provided by the office of statewide health planning and development . the data set includes information about patient demographics , insurance type , diagnoses and procedures , and patient disposition . the study cohort included 14 326 patients . discharge to home was the reference category . discharge to ecf and discharge to home with home care were the 2 additional alternatives.results:in all , 46.9% of patients were discharged home with home health care , followed by 29.6% to ecf , and 23.5% to home without care . discharge to ecf was more likely for patients with more comorbidities and a higher age . the strongest predictors were medicaid and black or asian race . medicare relative to private payer was a strong predictor of ecf discharge . male gender was the only factor that lowered the risk of discharge to ecf . the strongest predictor for discharge to home with home care was black race relative to whites . medicaid lowered the risk of home care , and gender did not matter.conclusion:this study serves to provide insight on which patient characteristics influence discharge destination after tha . race , insurance , and morbidity were highly significant factors on patient discharge destination to a subacute nursing facility .

frequent exposure to topical fluoride is of great importance in preventing or stopping dental caries . moreover , in adjunct to the daily application of fluoride , optimal oral hygiene and concise control of diet are highly recommended to optimize the effects of fluoride . benefits of fluoride include promoting the resistance of enamel to acid solubility , enhancing the process of remineralization and also the ability to weaken the cariogenic potential of microorganisms . since saliva acts as a vehicle for the delivery of fluoride to the dental plaque , the above mentioned mechanisms are highly dependent on salivary fluoride concentration [ 2 , 3 ] . despite a high increase in salivary and plaque fluoride concentration after using fluoridated agents , within 1 or 2 hours , the fluoride concentration decreases sharply compared to the baseline . therefore , it has been emphasized that fluoridated products such as mouthwashes should be used regularly . during the topical use of fluoride , fluoride ion can result in caf2 deposition on the tooth surface . some studies have shown that caf2 accumulates not only on the tooth surface , but also to some extent it can be corporated in the enamel structure . the availability of calcium ion , which can be delivered from the enamel , saliva , and dental plaque fluid , is a critical factor for caf2 formation . the fluoride level of plaque increases after using fluoridated products . due to the direct relationship between the fluoride and calcium concentration of the plaque , the ability of the plaque to maintain the fluoride ion can be extended by increasing the calcium concentration of the plaque . unfortunately , during fluoride usage , the formation of caf2 deposit is limited due to the low level of bio - available oral calcium in relation to the amount of delivered fluoride . caf2 acts as a long term ( two week ) reservoir of fluoride ion on the tooth surface and plaque , and is considered as an important factor for the anti - caries potential of fluoride . several agents such as calcium chloride , calcium lactate , calcium phosphate , calcium glycerophosphate , and -tri calcium phosphate have been introduced in forms of chewing gum , dentifrice , and mouthwash at different concentrations . in a study conducted by whitford et al . , the cacl2 solution given before fluoride dentifrice had only minor effects on the salivary fluoride . a study by pessan et al . demonstrated that a calcium pre - rinse significantly increased the fluoride concentration after 1 hour of fluoride dentifrice usage and this effect does not persist overnight . vogel et al . found that calcium pre - rinse used immediately before rinsing 228 ppm fluoride mouthwash had a significant impact on the 1-hour salivary fluoride ( 69 folded increase ) . in a recent study , vogel et al . have presented data suggesting that calcium pre - treatment elevates salivary fluoride overnight and hence induces the cariostatic effect . studies have been investigating the effect of calcium rinse on the salivary fluoride concentration following 228 ppm fluoride mouth rinse ( 0.05% naf ) [ 6 , 10 ] . the simultaneous use of calcium pre - rinse and 900 ppm fluoride rinse ( 0.2% naf ) , which is usually used once a week , has yet to be investigated . the aim of this study was to evaluate the effect of calcium pre - rinse on salivary fluoride after 900 ppm fluoride mouthwash . this study was approved by the research and ethics committee of zahedan university of medical sciences and it has been registered in the iranian registry of clinical trials ( irct201107306105n2 ) . in this double - blind cross - over randomized clinical trial , inclusion criteria were being 1824 years old , having good oral hygiene ( simplified oral hygiene index<= 1.2 ) and a normal oral architecture ( no clinical sign of inflammation , discoloration or any pathosis in the oral soft tissue observed in clinical examination ) , normal oral physiology and salivary gland function . exclusion criteria included having untreated caries , enamel defects , systemic diseases , prosthesis , orthodontic appliances , and consumption of drugs that affect the quality or quantity of saliva and history of consuming antibiotics or antibacterial mouthwashes during the 2 weeks prior to the examination . after preparing a list of all female dental students who lived in the university dormitory and had the eligibility criteria , 42 students were randomly chosen from 98 students using the table of random numbers ( z 1/2=1.96 , z 1= 0.85 , d=1.3 , sd=3 ) and were randomly divided into a and b groups . after dental prophylaxis , participants ( n=42 ) were asked not to use fluoridated dentifrice , mouth wash , dental floss and any other form of fluoride during the next two weeks . only tooth brush and floss with unfluoridated products were allowed . during the last 24 hours before using the mouthwash , the participants were instructed to avoid any food or drink containing fluoride such as tea . the first saliva samples ( baseline ) were taken in the dormitory at 78 pm , and at least 1 hour after food ingestion . for collecting the saliva samples , the participants were asked to sit in an upright and resting position , and expectorated the unstimulated saliva into a plastic vial for 3 minutes . twenty one subjects ( group a ) were then given 10ml of 900 ppm fluoride mouthwash ( 0.2% naf , behsa , iran ) and were then instructed to rinse for 1 minute ( f regimen ) . whilst the remaining subjects ( group b ) were asked to rinse with 10ml of calcium mouthwash ( 160 mmol / l calcium lactate pentahydrate , merk , germany ) for 1 minute and then immediately rinse with 10ml of 900 ppm fluoride rinse ( 0.2% naf , behsa , iran ) for the same duration ( ca + f regimen ) . one hour ( at 89 pm ) , and 12 hours after using mouthrinses ( the next morning at 78 am ) , unstimulated saliva was collected once again . no food , beverage ( except water ) , chewing gum , or oral hygiene measures were allowed during this 12-hour period . this period was considered because gradual loss of caf2 occurs after two weeks . just like the first phase , after dental prophylaxis , all required recommendations about the two weeks and one day prior to rinsing , were repeated . after two weeks , the participants ( n=42 ) were given the rinsing not previously used in the first phase . saliva collection was performed like the first phase at the same time as baseline , 1 , and 12 hours after rinsing . in this study , a dental student who lived in this dormitory assessed the other students for eligibility , enrolled them , chose the participants and divided them randomly into two groups and supervised them , registered the time , administered mouthwashes , and did the sampling at exact times . it should also be mentioned that in both phases , the participants had the same dinner at the same time . recruitment was done in february 2011 for a one - month period and all the volunteers remained throughout the study . collected samples were preserved at a temperature of 20. the technique described by vogel et al . was applied to prepare the saliva samples . the diluted samples and standard fluoride solutions were analyzed using the ion fluoride selective electrode ( metrohm co , swiss ) calibrated with standard samples . repeated measures anova was used for statistical analysis of salivary fluoride concentration and p < 0.05 was considered significant . we considered the time of sampling as one factor and the mouth rinse regimen as another factor for data analysis . after dental prophylaxis , participants ( n=42 ) were asked not to use fluoridated dentifrice , mouth wash , dental floss and any other form of fluoride during the next two weeks . only tooth brush and floss with unfluoridated products were allowed . during the last 24 hours before using the mouthwash , the participants were instructed to avoid any food or drink containing fluoride such as tea . the first saliva samples ( baseline ) were taken in the dormitory at 78 pm , and at least 1 hour after food ingestion . for collecting the saliva samples , the participants were asked to sit in an upright and resting position , and expectorated the unstimulated saliva into a plastic vial for 3 minutes . twenty one subjects ( group a ) were then given 10ml of 900 ppm fluoride mouthwash ( 0.2% naf , behsa , iran ) and were then instructed to rinse for 1 minute ( f regimen ) . whilst the remaining subjects ( group b ) were asked to rinse with 10ml of calcium mouthwash ( 160 mmol / l calcium lactate pentahydrate , merk , germany ) for 1 minute and then immediately rinse with 10ml of 900 ppm fluoride rinse ( 0.2% naf , behsa , iran ) for the same duration ( ca + f regimen ) . one hour ( at 89 pm ) , and 12 hours after using mouthrinses ( the next morning at 78 am ) , unstimulated saliva was collected once again . no food , beverage ( except water ) , chewing gum , or oral hygiene measures were allowed during this 12-hour period . this period was considered because gradual loss of caf2 occurs after two weeks . just like the first phase , after dental prophylaxis , all required recommendations about the two weeks and one day prior to rinsing , were repeated . after two weeks , the participants ( n=42 ) were given the rinsing not previously used in the first phase . saliva collection was performed like the first phase at the same time as baseline , 1 , and 12 hours after rinsing . in this study , a dental student who lived in this dormitory assessed the other students for eligibility , enrolled them , chose the participants and divided them randomly into two groups and supervised them , registered the time , administered mouthwashes , and did the sampling at exact times . it should also be mentioned that in both phases , the participants had the same dinner at the same time . recruitment was done in february 2011 for a one - month period and all the volunteers remained throughout the study . collected samples were preserved at a temperature of 20. the technique described by vogel et al . was applied to prepare the saliva samples . the diluted samples and standard fluoride solutions were analyzed using the ion fluoride selective electrode ( metrohm co , swiss ) calibrated with standard samples . repeated measures anova was used for statistical analysis of salivary fluoride concentration and p < 0.05 was considered significant . we considered the time of sampling as one factor and the mouth rinse regimen as another factor for data analysis . the average flow rate of saliva at different times ranged from 1.41 to 1.85 ml/ min and did not differ significantly . the fluoride concentration 1 hour after using both rinses ( ca + f regimen ) was the highest observed . table 1 shows the average salivary fluoride concentration at baseline , 1 , and 12 hours after rinsing . according to repeated measures anova , there was a significant difference between the concentrations of fluoride measured at different time points ( p < 0.001 ) . fluoride concentration increased by 6.25 and 7.42 times in 1 and 12 hours , respectively after rinsing with calcium and fluoride mouthwashes . when comparing same time points between the two regimens , significant differences were observed at all times except for the baseline before fluoride rinsing and the baseline before using calcium and fluoride mouthwashes ( p = 0.070 ; table 2 ) . in the present study , we found that the concentration of salivary fluoride at 1 and 12 hours after rinsing calcium and fluoride mouthwashes was significantly higher compared with the fluoride regimen . in both regimens , the highest fluoride levels were related to 1 and 12 hours after rinsing and baseline , respectively and they differed significantly . in the present study , the 1-hour post rinse fluoride value of ca + f regimen was smaller than an investigation performed by vogel et al . using 150mmol / lit calcium and 228 ppm fluoride mouth rinses . in evaluating the efficacy of calcium pre - rinse on 1-hour salivary fluoride , vogel et al . concluded that calcium pre - rinse significantly increased the 1-hour salivary fluoride concentration compared with the control fluoride without a pre - rinse . our results are consistent with these findings and demonstrate the significant effect of calcium pre - rinse on salivary fluoride , by showing the 6.25 fold increase in the 1-hour salivary fluoride after using calcium and fluoride rinses compared to fluoride without calcium pre - rinse . similar to the study conducted by vogel et al . , we have administrated calcium lactate pentahydrate with a comparable concentration ; however , this resulted in a lower salivary fluoride concentration 1-hour post rinse . this was despite a higher concentration of fluoride in our mouthwash compared to what vogel et al . this may be contributed to the higher rinsing volume of mouthwash used by vogel et al . we found a greater fluoride concentration 12 hours following the use of both mouthwashes compared to investigations performed by pessan et al . [ 8 , 9 ] , the impact of calcium rinse before using fluoride dentifrice was assessed . reported a significant increase in salivary fluoride by using calcium lactate pre - rinse only 1 hour after the use of fluoride dentifrice . however , the effect of calcium pre - rinse was significant at both 1 and 12 hours after rinse in our study . in contrast , whitford et al . reported that calcium pre - rinse had a very little effect on the fluoride concentration of saliva . although there are some differences between our study and other studies , including differences in subject population and methodologies , the main difference may be the form of the applied fluoridated product . in fluoridated dentifrices , there is surfactant sodium lauryl sulfate ( sls ) with a strong affinity to bind with calcium and hence could limit the bio - availability of calcium through precipitation of ionic calcium and could affect the fluoride uptake . furthermore , it may be stated that rinsing the oral cavity with water after using fluoridated dentifrice could wash away some caf2 supplies before they have enough time to stabilize in the oral cavity . vogel et al . investigated the effect of calcium mouth wash prior using 228 ppm fluoride rinse . in agreement with the study performed by vogel et al . , we have shown that calcium rinse before fluoride rinse increases the 12 hour salivary fluoride content significantly compared with the fluoride rinse alone . our results are in line with vogel et al . , showing a positive effect of calcium mouth rinse in elevating the 12-hour salivary fluoride level . furthermore , we found that the amount of 12-hour salivary fluoride was larger than that found in vogel s study . there was a similar using instruction and calcium mouth rinse concentration in our study and the study conducted by vogel et al .. factors such as age disparity in the volunteers , study design , using mouthwashes prepared by different manufacturers , and different washout periods may be factors affecting the increases ; of which rinsing with different concentrations of fluoride solution may be the main factor . in vogel et al . it seems that rinsing with 900 ppm fluoride mouth wash in the present study could lead to a greater effect compared to vogel et al . study using 228 ppm fluoride mouth rinse on 12-hour post rinse salivary fluoride . however , compared to vogel et al . we did not find such an effect 1-hour after rinsing , and only the greater volume of rinsing solution could explain the difference between our and vogel et al studies . the soft tissue fluoride reservoirs seem to be a source of salivary fluoride after the application of topical fluoridated products . so considering the certain role of calcium - mediated fluoride supplies , the respective 6.25 and 7.42 fold increases in 1 and 12 hours fluoride concentrations found in our study compared with when the pre - rinse was not used may be associated with the increased formation of soft tissue calcium- mediated fluoride reservoirs as a result of using calcium pre - rinse before fluoride rinse . this suggests that a huge elevation in salivary fluoride produced by calcium pre - rinse may induce a greater cariostatic effect . one of the advantages of calcium pre - rinse before fluoride rinse is that the need to concentrate the fluoride amount of the used product to maximize the salivary fluoride is reduced . in addition , the taste of calcium fluoride is not bitter and is suitable for users . although following increased salivary fluoride concentration , the likelihood of formation of fluoride reservoirs in the plaque phase is improved , it should be kept in mind that the higher concentration of salivary fluoride after using both calcium and fluoride rinses found in our study , does not completely reflect the concentration of this ion at the surface of the enamel . it should also be emphasized that although children and adolescents are the major group of beneficiaries of preventive measures , adults also benefit . because adults are retaining their teeth longer than in previous decades , the impact of salivary fluoride on the teeth of adults has become more important . another reason for choosing adult population in our study was that we were able to exert interventions and control the exact time of sampling in this group . in addition , all these participants had similar conditions such as diet . the effect of gender has also been deleted . in our opinion inability to measure the calcium concentration was the limitation of our study , therefore an investigation in a cross - over manner , in which the salivary and plaque calcium and fluoride concentration is assessed is recommended . moreover , from the community - based point of view , although calcium fluoride is low price , determining the cost effectiveness of this pre - rinsing with before and after studies is suggested .

objective : calcium fluoride deposit during fluoride application . uptake and retention of fluoride by saliva depends generally on the concentration of calcium . in this study , the effect of calcium pre - rinse on salivary fluoride concentration after a 900 ppm fluoride mouthwash was investigated.materials and methods : this cross - over double - blind randomized clinical trial was conducted in a girls dormitory in zahedan university of medical sciences , southeast iran . in this study , 42 female dental students were chosen using simple randomization . during the first phase , 21 subjects ( group a ) used fluoride rinse ( f regimen ) and the remaining ( group b ) used calcium pre - rinse followed immediately by fluoride rinse ( ca + f regimen ) . in the second phase , participants rinsed using the mouthwashes not previously used . prior to each phase prophylaxis was performed and no fluoridated product was used during a two - week interval between the phases . salivary samples were taken immediately before ( baseline ) , 1 and 12 hours after rinsing . the salivary fluoride concentration was determined using fluoride sensitive electrode . repeated measures anova was used for statistical analysis and the significance level was set at p<0.05.results : there was significant difference between fluoride concentrations at different time points ( p < 0.001 ) . significant differences were observed when the different time points of two regimens were examined . in contrast to this , the baseline before using f regimen and the baseline before using ca + f regimen did not show any significance ( p= 0.070).conclusion : pre - rinsing with calcium before fluoride is recommended because of significant increases in salivary fluoride concentration .

alzheimer 's disease ( ad ) is the most common form of dementia in elderly people . estimates suggest that 10% of individuals over the age of 65 and almost half over the age of 85 have alzheimer 's dementia . as human life expectancy continues to rise , the total number of affected individuals is also expected to increase dramatically . ad is a multifactorial disease but its etiology and pathophysiology are still not fully understood . ad probably results from a complex interaction between aging , vascular risk factors , impaired status of micronutrients , and genetic factors . three genes have been identified as causative genes in familial ad : the amyloid precursor protein ( app ) , presenilin-1 and presenilin-2 . in addition , the apolipoprotein e ( apoe ) 4 allele is the only recognized genetic risk factor for familial as well as sporadic ad . although many studies have reported associations between genes involved in cholesterol metabolism and ad , the functional connection between the cholesterol pathway and ad pathology has not been clearly resolved . recently , apolipoprotein a1 ( apoa1 ) polymorphism was identified as a factor affecting brain cholesterol metabolism and angiogenesis , leading to an increased risk for ad . up to now , several snps have been identified in the apoa1 gene located on the long arm of chromosome 11 . among these , a common g / a substitution located at 75 bp upstream from the apoa1 transcription start site ( rs670 ) and a c / t and g / a base substitution at position + 83 bp ( rs5069 ) or + 84 bp ( rs1799837 ) were reported to differentially affect apoa1 expression . in view of this , vollbach et al . reported an increase in the risk of early - onset ad for rs670 a allele bearers , but did not find any impact of rs5069 and rs1799837 polymorphisms on risk of ad . in addition , in vitro , studies linked the amyloid- ( a ) aggregation to the reduction of apoa1 levels in the brain , hence promoting neurodegeneration . furthermore , apoa1 is associated with an earlier onset of neurofibrillary tangle formation and an increased neurofibrillary tangle load . in this case - control study , we investigated whether the 75 g / a polymorphism of the apoa1 gene may be responsible for susceptibility to ad in a sample of patients that was already genotyped for apoe , bleomycin hydrolase , and vascular endothelial growth factor ( vegf ) , and to assess its relationship with the severity of the disease as estimated by the mini - mental state examination ( mmse ) score . the patients , tunisian arab descendants who live in the center of tunisia , were consecutively evaluated at the department of neurology of sahloul university hospital between january 2005 and august 2008 . all participants underwent a complete clinical investigation , including medical history , neurological and neuropsychological examination , mmse , laboratory tests and neuroimaging which consisted of magnetic resonance imaging ( mri ) . our patients were assigned either to the ad or the control group according to clinical examination and brain imaging . mri has shown a great reduction in medial temporal lobe and hippocampal volume of patients with ad as compared to controls . the mmse for grading the cognitive state was used in a validated arabic version . after this assessment , 173 patients were classified as probable ad ( 99 females and 74 males ; mean age 75 1.87 years , n = 173 ) according to the criteria of the national institute of neurological and communicative disorders and stroke these patients were further classified according to their mmse scores as follows : mild ad ( mmse 24 ) , moderate ad ( mmse 1123 ) , and severe ad ( mmse 10 ) . the second group included 150 elderly subjects ( 79 females and 71 males ; mean age 71 1.78 years ) that were selected as controls ( mmse > 26 ) by experienced neurologists . these subjects were hospitalized for clinical suspicion of meningitis or polyneuropathy ( acute or chronic ) . in both cases , a lumbar puncture was clinically indicated . inclusion criteria were a normal renal or liver function ( creatinine < 120 mol / l , alt < 45 iu / l , ast < 40 exclusion criteria were the presence of an active neurological or psychiatric disease , memory complaints or other cognitive symptoms . the control subjects had a preserved general cognitive function and no family history of dementia . the institution 's ethics committee for studies in human subjects gave its approval for the study . a written informed consent to participate in this clinical research study was obtained from participants or from a relative ( legal guardian ) . demographic details for all subjects were recorded , including age , gender , age at onset , msse score , duration of dementia , and plasma lipid and lipoprotein levels ( table 1 ) . plasma levels of total cholesterol , triglycerides , and high - density lipoprotein cholesterol ( hdl - c ) were measured by standardized enzymatic procedures , and apoa1 was measured using a turbidimetric assay on a hitachi 912 analyzer . low - density lipoprotein cholesterol ( ldl - c ) was calculated according to friedewald 's formula . the csf was stored in polypropylene tubes at 80c and analyzed after the clinical follow - up of the study had been completed . csf t - tau and a42 levels were determined using a commercially available sandwich enzyme - linked immunoabsorbant assay ( innotest htau - ag , innotest -amyloid 42 ) from innogenetics . total genomic dna was isolated from peripheral blood leukocytes using genomic dna purification kit ( promega ) . apoa1 genotype analysis was performed by pcr restriction fragment length polymorphism analysis using the primer 5-agggacagagctgatccttgaactcttaag-3 , and 5-ttaggggacacctacccgtcaggaagacga-3. the 180-bp amplified fragment was restricted with the enzyme mspi , and the dna fragments were separated using 20% polyacrylamide gel electrophoresis . apoa1 genotype was determined by comparison with the combination of fragment sizes described by vollbach et al . . genotype and allele frequencies of apoa1 were compared between patients and controls using test . after adjusting for age , gender , and educational level , genotype and allele frequencies of apoa1 were compared between patients and controls using test . after adjusting for age , gender , and educational level , in total of 173 patients with ad and 150 healthy controls were included in this study . the two groups were matched for gender ( = 0.323 ; p = 0.11 ) and age ( = 2.15 ; p = 0.73 ) , with ad patients having a lower mmse score together with lower serum apoa1 , lower hdl - c levels , and higher triglyceride levels . differences remained significant even when we took into account other parameters , such as age and sex , as covariants . in the ad patients , no significant differences in apoa1 concentrations between patients with one or two 4 alleles and those without the allele were found ( data not shown ; p = 0.72 ) . our study demonstrated that apoa1 concentrations were highly correlated ( p < 0.001 ) with the severity of ad , as reflected by the patients mmse ( fig . this relationship was independent of all other parameters studied ( age , gender , and apoe genotypes ) . moreover , patients with fewer years of education appeared to have higher rates of ad ( or = 2.48 , 95% ci 1.754.79 ; p = 0.007 ; adjusted for age : or = 1.89 , 95% ci 1.153.1 ; p = 0.004 ) . table 2 depicts the genotype distribution of apoa1 in ad patients and in the control group . using the test , the distribution of the apoa1 75 g / a genotypes in all patients with ad and healthy controls did not significantly deviate from that expected by hardy - weinberg equilibrium . the frequencies of the gg , ga , and aa genotypes in the control group and among ad patients were 67.4 , 25.4 , and 7.2% and 61.3 , 32.3 , and 6.4% , respectively , in the apoa1 75 g / a snp . as shown in table 2 , there were no statistically significant differences in the ad group when compared to controls ( pearson 's test , p < 0.05 ) . according to the univariate logistic regression analysis , the 75 g / a allele of the apoa1 polymorphism was not associated with the risk of ad after adjusting for age , sex , and educational level ( 75 g / a , presence of a allele : or = 1.16 , 95% ci 0.781.73 ; p = 0.43 ) . despite the presence of the apoe 4 , the 75 g / a allele was not associated with ad after adjusting for age , sex , and educational level . the lack of an association observed could be linked to the low prevalence of the a allele . investigation of the effect of the apoa1 polymorphism on apoa1 concentrations and hdl - c levels revealed that hdl - c levels were lower in ad patients who were carriers of at least one a allele of the apoa1 75 g / a polymorphism than in carriers of the gg genotype ( f = 7.1 , d.f . similar differences across the apoa allele were seen with hdl - c within the control group . we did not find any effect of the apoa1 75 g / a polymorphism on the apoa1 level within the ad group or the control group associated with the absence or presence of the allele ( f = 0.341 , d.f . the a allele of apoa1 was associated with the csf a42 reduction ( f = 1.26 , d.f . there was a significant csf a42 reduction in the ad patients with at least one copy of the a allele for apoa1 75 g / a when compared with those ad patients without the allele [ 315 ( 270410 ) vs. 419 ( 330480 ) ; p = 0.033 ] . contrarily , there were no significant differences in csf t - tau protein levels within the ad group associated with the absence or presence of the allele ( table 3 ) . apoa1 , a major apolipoprotein constituent of hdls , is secreted into the bloodstream by the liver and intestine as a protein that is rapidly converted to mature apoa1 . different polymorphisms in apoa1 have been described , and influences on hdl and apoa1 plasma levels and on the risk of disorders such as coronary artery disease or ad have been detected . however , only few of these findings have been replicated , and it is unclear which polymorphism might act as the relevant functional one . according to a study by juo et al . , the a allele of the 75 g / a gene may affect expression of apoa1 , although it was not clear whether the observed effect was directly associated with the mutation or due to another mutant allele in linkage disequilibrium with the 75 g / a polymorphism . in this regard , while additional studies on a larger number of cases will be required to confirm and extend our findings , the present data suggest for the first time that this polymorphism has no influence on the expression of apoa1 . furthermore , this polymorphism was reported to be associated with changes in plasma hdl levels in particular in ad patients . hdl is the prominent lipoprotein in the human brain and is involved in the regulation of a protein metabolism and deposition in the brain . deficit in hdl - c could also affect memory through its influence on atherosclerotic disease and stroke or subclinical vascular injury not reflected in the covariates examined . other possible mechanisms linking low levels of hdl - c to neurodegenerative processes might involve its anti - inflammatory or antioxidant properties . in our current study , the subjects included in our study had a diet which was characterized by a low intake of meat , a high intake of vegetables and legumes , and no alcohol intake . none of the subjects were malnourished and the dietary habits of control subjects and patients were similar . interestingly , our results showed also that the apoa1 75 g / a polymorphism has a reducing effect on hdl - c levels in ad patients ( 0.14 mmol / l ) . these findings prompted us , therefore , to evaluate with a case - control study whether this polymorphic variation may have an impact on the susceptibility to ad in a tunisian population . reviewing previous reports , it seems evident that the apoa1 ( 75 g / a ) a allele frequency demonstrates heterogeneity around the word . in the present study , the 75 g / a variant was present at a frequency of 0.225 and 0.2 among ad and control subjects , respectively . this was comparable also to frequencies established for a french and italian population , but higher than the rates of 0.170.19 reported for a german population . although a previous study involving 500 healthy controls and 427 ad patients of caucasian origin ( uk and germany ) suggested an association between the rs670 a polymorphism and ad ( age at onset < 65 years ; or = 2.99 , 95% ci 1.824.93 ; p < 0.001 ) , we were unable to reproduce these results in our population sample . similar negative findings with respect to a direct association between potential genetic risk factor and disease have been reported previously . the failure to replicate association in our population it might be attributed to several factors , such as differences in the ethnic background and geographic characteristics of the studied populations . also , differences in the inclusion and exclusion criteria may influence the study results , especially if subjects affected by some chronic diseases are not excluded from studies investigating genes involved in cholesterol metabolism . in addition , the absence of a statistically significant effect of the apoa1 polymorphism on the risk of ad in our sample can be attributed to low power because our sample had < 80% power to detect an association with ad . finally , it is not possible to exclude the role played by genes that are in relation with the apoa1 gene . in this condition , it is possible that one or more of these genes are in linkage disequilibrium with the apoa1 gene in some populations but not in others , thus influencing the results of these association studies . the second point of our study was to assess the relationships between the presence of this polymorphism , the genotype found in both groups of patients , and the pathological csf markers of the disease . to our knowledge , the contribution of apoa1 in neurological disorders and in ad patients has been evaluated in only a few of the autopsied brains , and most in vivo studies have been performed on plasma total . in the present study , one very important association was observed between csf a42 levels and the 75 g / a polymorphism of apoa1 . a significant decrease was observed in the csf a42 levels among the ad patients with the 75 a allele of apoa1 . the 75 a allele of apoa1 effect sizes were similar when comparing csf a42 levels of ad patients and control subjects . on the other hand , there were no significant differences in csf t - tau levels between the ad subjects and the control group associated with the presence or absence of the 75 a allele of apoa1 . we propose that the increase in apoa1 transcription for the a allele may affect the solubility of a42 and/or its transport across the blood - brain barrier in ad . apoa1 has been shown to participate in the amylogenesis process by binding to a and to form amyloid - like fibrils in app transgenic mice . a second role of apoa1 with implications in the genesis of ad relates to neuron maintenance . apoa1 is one of the exchangeable apolipoproteins that are actively involved in the regeneration process of neuron cells occurring after injury . finally , the association between apoa1 and other proteins such as apoj and apoe could contribute to the pathogenesis of ad . other pathological mechanisms are possible and would need to be further evaluated in future ad studies . regarding prognostic parameters , we have analyzed the correlations between the apoa1 levels and clinical characteristics of dementia including mmse score in ad patients . studies in the elderly have shown that high levels of serum apoa1 and hdl - c are associated with low total mortality and enhanced longevity . our results suggest that the ad patients with higher serum apoa1 concentrations have less cognitive impairment . this supports earlier findings by merched et al . showing that higher serum apoa1 concentrations are associated with a significant improvement in cognitive performance . moreover , when patients were stratified according to their mmse score , ad patients with a lower score had significantly decreased apoa1 levels . this finding may highlight the occurrence of some factors that may decrease the level or affinity of unknown molecular factors that affect synthesis and secretion of apoa1 in an allele - specific manner . in summary , the present study does not support any impact of the apoa1 genetic polymorphism on ad in the tunisian population and confirmed the relationship between apoa1 levels and mmse score in ad patients . these results will help to clarify the role of apoa1 polymorphisms in the regulation of cholesterol metabolism .

backgroundapolipoprotein a1 ( apoa1 ) is the major apolipoprotein constituent of the high - density lipoprotein ( hdl ) and is involved in reverse cholesterol transport . variation in the apoa1 gene might influence the function of the protein and , thus , brain cholesterol metabolism , leading to an increased risk for alzheimer 's disease ( ad).aimin the current report , we investigated the role of the functional apoa1 polymorphism ( 75 g / a ) as a genetic risk factor for ad in a tunisian population.methods173 ad patients and 150 healthy controls were studied.resultsno association was found between this genetic variation in apoa1 gene and the risk of ad . the presence of the ( 75 g / a ) a allele appeared , however , to be associated with lower levels of cerebrospinal fluid a42 and hdl cholesterol levels in sera.conclusionour data support the observation that apoa1 polymorphism influences cholesterol metabolism and a42 deposition in the brain .

since reporting of first case of human immuno - deficiency virus ( hiv ) in 1980(1 ) and first ever occupationally exposed case in 1984,(2 ) risk of hiv transmission through occupational exposure ( percutaneous / mucocutaneous injuries / blood contact with non - intact skin ) is perceived as relatively low.(3 ) chances of accidental exposure are on rise due to increase in invasive procedures but due to inadequate surveillance , such exposures are under reported . health care workers ( hcws ) are exposed to blood / other body fluids with threat of acquiring infections ; commonest being hepatitis b ( 9 - 30% ) followed by hepatitis c ( 3 - 9% ) and hiv ( 0.03%).(45678910 ) globally 2.5% of hiv and 40% of hbv among hcw are attributed to occupational exposure with an overall incidence of occupational exposure to blood / body fluids among hcw as 32.3%.(5 ) arrival of hiv in clinical settings has focused everyone 's attention towards universal work precautions ( uwp ) . in resource constrained settings , where not all eligible people living with hiv / aids ( plha ) have access to anti retroviral treatment ( art ) , provision of post exposure prophylaxis ( pep ) means diversion of these drugs etc . which can be used for treatment.(3 ) in view of non - availability of any vaccine for hiv and hepatitis c , prevention of these two by adequate learning is most cost effective.(9 ) despite high risk of exposure , knowledge / understanding of hcws especially nursing staff about uwp and pep is not up to the mark.(11 ) hence present study was done as before and after study following a sensitization training aiming to : study baseline knowledge , impact evaluation of training in terms of gain ( if any ) andfind out core areas to improve the content / methodology of learning to make it more effective for future trainings . study baseline knowledge , impact evaluation of training in terms of gain ( if any ) and find out core areas to improve the content / methodology of learning to make it more effective for future trainings . this training was different from other such trainings because : it dealt only with those actively involved in patient care and covered only absolutely essential ( must know ) areas.questionnaire designed for evaluation segregated different domains of learning ( cognitive , affective and psychomotor ) . it dealt only with those actively involved in patient care and covered only absolutely essential ( must know ) areas . questionnaire designed for evaluation segregated different domains of learning ( cognitive , affective and psychomotor ) . total 85 nursing staff ( 22 sisters in charge and 63 staff nurses ) from a teaching hospital , underwent 1 day training in 3 batches during march 2013 focusing on uwp , pep and sensitization towards plha . trainers included technical expert from state aids control society , trained faculty from community medicine , ex medical officer at an art centre and representative from the network of positive people . pre training assessment was done ( just before training ) using self administered structured questionnaire followed by post training assessment ( immediately after training ) . same tool was used for both pre and post evaluation , however , participants had no knowledge that the same tool will be used for post evaluation as well . this questionnaire was developed by the faculty after extensive brainstorming and considering the contents of the training module . questionnaire was pilot tested on 5 trainee of first batch for its feasibility and based on that it was suitably modified . for the ease of participants , prior informed oral consent was obtained from all participants after disclosing the purpose and assuring full confidentiality . questionnaire originally contained 20 questions but one question was removed from analysis due to its ambiguous nature , therefore , total 19 questions from 3 domains of learning cognitive or knowledge based ( 12 ) , psychomotor or activity oriented ( 6 ) and affective or attitudinal ( 1 ) were included in the study . one mark was awarded for each correct response and 0 for every incorrect / unattended question . there was no dropout between pre and post training evaluations . ideally speaking evaluation of psychomotor learning can not be done through proforma and for that the participants need to be observed while they perform a particular task . but owing to the logistic limitations and feasibility , this has been done by asking questions . data was coded , entered in ms excel 2007 and analyzed ; statistical tests such as f test ; unpaired and paired t - test , z test were used to assess the significance of difference in the baseline learning of participants and the impact of training on learning . data was coded , entered in ms excel 2007 and analyzed ; statistical tests such as f test ; unpaired and paired t - test , z test were used to assess the significance of difference in the baseline learning of participants and the impact of training on learning . out of total 85 participants , 75 ( 88.2% ) were females ( 22 sisters in charge and 53 staff nurses ) and rest ( 10 ) were males . sister in charge ( si ) being senior had higher mean age ( 41 9.5 years ) than female ( 28 5.5 year ) and male ( 27 3.7 years ) staff nurses . being longer in job , sister in charge also had more work experience ( 16.8 8.7 years ) than female ( 5.7 4.1 years ) and male ( 5.1 3.5 years ) staff nurses . out of 85 participants , 48 ( 56.5% ) underwent similar type of training in the past ; proportion being more in case of female staff nurse ( 52.0% ) than si ( 39.6% ) and male staff nurses ( 8.3% ) . baseline level of learning in pre test assessment , baseline scores ( mean and standard deviation ) were calculated for participants based on their designation , previous training status and involvement in management of plha [ table 1 ] . assessment scores were around 10 and showed minor variations , slightly high in those who were staff nurses , received similar trainings in the past and involved with management of plha but when tested the differences everywhere were statistically insignificant ( p > 0.05 ) [ table 1 ] . baseline level of learning in pre training evaluation ( n = 85 ) post training assessment was done immediately after the training using the same tool . drop out was nil , all present in pre training assessment ( 85 ) also participated in post training assessment . mean score of participants increased from 10.6 2.7 ( pre training ) to 13.8 5.8 ( post training ) , gain was statistically significant ( p < 0.001 ) . when viewed separately , gain was consistent among all participants irrespective of their designation or status of having received / or not similar training in the past . gains as reflected by increase in scores , in all the categories were statistically significant ( p < 0.001 ) [ table 2 ] . impact evaluation through pre and post training scores ( n = 85 ) one of the objectives of the study was to segregate the gains of learning into cognitive , psychomotor and affective domains . total 19 questions asked , were from cognitive ( 12 ) , psychomotor / affective ( 7 ) domains . out of total scores obtained during pre and post evaluation , bulk was contributed by cognitive ( 6.9 and 9.3 ) followed by psychomotor ( 2.9 and 3.7 ) and affective ( 0.75 and 0.76 ) domains [ figure 1 ] . out of 12 questions in cognitive domains , on an average 58% participants answered a question correctly ; it rose to 77% during post evaluation . in psychomotor ( 6 ) it increased from 48% to 62% while in affective ( 1 ) the gain was minimal from 75% to 76% . gain was more in cognitive domain than in psychomotor and when tested ( paired t test ) , differences were statistically significant in both the cases ; p being less than 0.006 and 0.047 respectively . similar statistical interpretation was not done for affective domain as there was only one question . impact of training ( mean scores ) on various domains of learning ( n = 85 ) pre and post evaluation was undertaken to identify core areas of learning . based on the initial scores and gain or loss ( ? ) during post training evaluation , certain actions are recommended to make future trainings more relevant and effective [ table 3 ] . except in question about most common route of hiv transmission , consistent gain in cognitive domain was observed . highest gain ( 44.7% ) was observed for pep drug contraindicated during 1 trimester of pregnancy . similarly in psychomotor domain except in 1 question about practices increasing risk of needle stick injuries , gains were consistent but lesser than cognitive ( 3.5% to 27.1% ) action proposed based on these findings in case of cognitive domain was for further improvement . sessions should be objective based and framing of question for evaluation should be non ambiguous and appropriate to the target audience . for psychomotor learning , method should include more of demonstrations , group discussion and role play . actions proposed as per core area in terms of domains of learning ( n = 85 ) out of total 85 participants , 75 ( 88.2% ) were females ( 22 sisters in charge and 53 staff nurses ) and rest ( 10 ) were males . sister in charge ( si ) being senior had higher mean age ( 41 9.5 years ) than female ( 28 5.5 year ) and male ( 27 3.7 years ) staff nurses . being longer in job , sister in charge also had more work experience ( 16.8 8.7 years ) than female ( 5.7 4.1 years ) and male ( 5.1 3.5 years ) staff nurses . out of 85 participants , 48 ( 56.5% ) underwent similar type of training in the past ; proportion being more in case of female staff nurse ( 52.0% ) than si ( 39.6% ) and male staff nurses ( 8.3% ) . baseline level of learning in pre test assessment , baseline scores ( mean and standard deviation ) were calculated for participants based on their designation , previous training status and involvement in management of plha [ table 1 ] . assessment scores were around 10 and showed minor variations , slightly high in those who were staff nurses , received similar trainings in the past and involved with management of plha but when tested the differences everywhere were statistically insignificant ( p > 0.05 ) [ table 1 ] . drop out was nil , all present in pre training assessment ( 85 ) also participated in post training assessment . mean score of participants increased from 10.6 2.7 ( pre training ) to 13.8 5.8 ( post training ) , gain was statistically significant ( p < 0.001 ) . when viewed separately , gain was consistent among all participants irrespective of their designation or status of having received / or not similar training in the past . gains as reflected by increase in scores , in all the categories were statistically significant ( p < 0.001 ) [ table 2 ] . one of the objectives of the study was to segregate the gains of learning into cognitive , psychomotor and affective domains . total 19 questions asked , were from cognitive ( 12 ) , psychomotor / affective ( 7 ) domains . out of total scores obtained during pre and post evaluation , bulk was contributed by cognitive ( 6.9 and 9.3 ) followed by psychomotor ( 2.9 and 3.7 ) and affective ( 0.75 and 0.76 ) domains [ figure 1 ] . out of 12 questions in cognitive domains , on an average 58% participants answered a question correctly ; it rose to 77% during post evaluation . in psychomotor ( 6 ) it increased from 48% to 62% while in affective ( 1 ) the gain was minimal from 75% to 76% . gain was more in cognitive domain than in psychomotor and when tested ( paired t test ) , differences were statistically significant in both the cases ; p being less than 0.006 and 0.047 respectively . similar statistical interpretation was not done for affective domain as there was only one question . impact of training ( mean scores ) on various domains of learning ( n = 85 ) based on the initial scores and gain or loss ( ? ) during post training evaluation , certain actions are recommended to make future trainings more relevant and effective [ table 3 ] . except in question about most common route of hiv transmission , consistent gain in cognitive domain was observed . highest gain ( 44.7% ) was observed for pep drug contraindicated during 1 trimester of pregnancy . similarly in psychomotor domain except in 1 question about practices increasing risk of needle stick injuries , gains were consistent but lesser than cognitive ( 3.5% to 27.1% ) . action proposed based on these findings in case of cognitive domain was for further improvement . sessions should be objective based and framing of question for evaluation should be non ambiguous and appropriate to the target audience . for psychomotor learning , method should include more of demonstrations , group discussion and role play . actions proposed as per core area in terms of domains of learning ( n = 85 ) second key strategy of national aids control program ( nacp ) phase iv is comprehensive care and support by providing quality services through zero stigma and discrimination which essentially requires training hcp by giving right type of knowledge , skill and attitudes towards uwp , pep and removing stigma and discrimination towards plha . all 85 trainees in our study were heterogeneous in terms of age , gender , work experience , designation and status of having received such training earlier but had little difference in their baseline knowledge . in such type of trainings , it is difficult to assess the psychomotor and affective domains but we tried to assess certain cognitive aspects of these domains . learning in cognitive , affective and psychomotor domains provided in a focused training like this , in relation to uwp especially in context of hiv management in tertiary health care centre such information is essential for future planning of in - house training programs and also for improving quality of patient care(12 ) with focus on reducing stigma / discrimination against plha and preventing needle stick injuries . nursing staff sustain high burden of needle sticks injuries up to 60.6 percent.(81113 ) participants in this study were younger with mean age of 41 years ( sisters in charge ) and 27 - 28 years ( staff nurses ) , it was comparable to other studies done in india amongst hcw in jamnagar(10 ) and mysore(14 ) as well as abroad in egypt.(15 ) mean years of work experience in present study was much lower than in other studies.(1415 ) training young providers is cost effective as they are receptive to new learning and serve for longer duration . pre training scores were low and had little variation in different sub groups including those who received similar trainings in the past . in a training of different cadre of hcw from mysore also post evaluation scores for knowledge contents ranged between good to excellent but declined with passage of time.(14 ) training mainly covered three areas : basics of hiv / aids , uwp and pep and post - test scores improved remarkably in all the domains . surprisingly the knowledge level decreased in post training regarding the most common route of hiv infection . it happened so because in our training the two points of ( 1 ) commonest ( sexual ) and ( 2 ) strongest ( blood borne ) routes of acquiring hiv transmission were emphasized . somehow it confused participants and as a result post training scores decreased marginally ( from 60% to 58% ) . more than half of participants even before training were aware of basics of hiv , hepatitis b and c and also various aspects of uwp , pep and hepatitis b immunization . total 69.4% participants from present study ( post workshop ) knew regarding hepatitis b vaccination schedule ; less than 75.9% amongst laboratory technician in another study also from western india.(16 ) prior to this training , 60% were correctly aware of do's/ do nt of pep while safe practices regarding needle stick injuries were low ( 32.9% ) . knowledge and practice score of pep elsewhere was only 31.9.(10 ) the best practice identified in pre training assessment was that 78% of them were aware of using personal protective equipment ( ppe ) for delivery of hiv positive women as a uwp ; it increased further to 81% . areas which had low score during pre - evaluation and warrant more attention were steps of hand washing , needle recapping practices etc . though these topics are adequately covered in their basic courses . other areas requiring improvement were knowledge regarding pep drugs and disinfection procedures . in view of this such trainings must be done once in a year as suggested by suchitra and lakshmi(14 ) who demonstrated a progressive decline in the knowledge scores among different categories of hcw in absence of another similar training . learners are expected to improve learning in all 3 domains and trainings which are largely lecture based improve cognitive domain and when knowledge ( cognitive ) is truly perceived will lead to improved skill ( psychomotor ) and attitudinal change ( affective ) . changes in affective and psychomotor domain are the real challenges to both trainers and trainee and must be a priority area for any training.(16 ) it may be noted that any gain less than 100% in this training is unsatisfactory as all questions dealt with must know areas and with day to day working of participants . to provide quality care by nursing staff without stigma and discrimination ( for hiv ) on one hand and avoidance of injuries leading to blood born infections amongst them on the other side , such trainings are of immense value . trainings should have a proper mix of all domains and need to be evaluated to make them even more purposeful . evaluation was done immediately after the training hence the settings were appropriate for evaluation of cognitive learning but not for other domains ( psychomotor and affective ) . proforma based evaluation is ideal for cognitive learning but is not appropriate for learning in other two domains . cognitive learning is reduced in course of time so another evaluation after some time may give different results . evaluation was done immediately after the training hence the settings were appropriate for evaluation of cognitive learning but not for other domains ( psychomotor and affective ) . proforma based evaluation is ideal for cognitive learning but is not appropriate for learning in other two domains . cognitive learning is reduced in course of time so another evaluation after some time may give different results .

introduction : second key strategy of national aids control program ( nacp iv ) is comprehensive care and support by providing quality services through zero stigma and discrimination . quality of services can be improved by eliminating stigma and discrimination and making health care provider aware of associated occupational hazards . nursing staff play crucial role and are more at risk therefore their understanding , perception and skill must be assessed in different domains of learning to improve the contents and methodology of trainings.material and methods : total 85 nursing staff underwent 1 day training in 3 batches focusing on universal work precautions ( uwp ) , post exposure prophylaxis ( pep ) and sensitization of the participants towards plha ( people living with hiv / aids ) . their learning was evaluated under different domains ( cognitive , psychomotor and affective ) using structured questionnaire.results:in pretest evaluation scores showed minor and statistically not significant variations in terms of participant 's gender , age , designation work experience and status of having received any similar training in the past . impact of the training was visible as overall mean scores increased from 10.6 2.7 to 13.8 5.8 ; gain being statistically highly significant ( p value < 0.001 ) . gain was highest in cognitive ( from 58% to 77% ) followed by psychomotor ( from 48% to 62% ) and minimal in affective domain ( from 75% to 76%).conclusions : after undergoing the training , participants were benefitted more in cognitive domain than psychomotor and affective domain . acquired knowledge , skill and communication skill if evaluated as done in this study will improve the methodology of such trainings making them more effective .

as a service to our authors and readers , this journal provides supporting information supplied by the authors . such materials are peer reviewed and may be reorganized for online delivery , but are not copyedited or typeset . technical support issues arising from supporting information ( other than missing files ) should be addressed to the authors .

abstractinvestigations of ligandbinding kinetics to membrane proteins are hampered by their poor stability and low expression levels , which often translates into sensitivityrelated limitations impaired by low signaltonoise ratios . inspired by affinity capturing of watersoluble proteins , which utilizes water as the mobile phase , we demonstrate affinity capturing and local enrichment of membrane proteins by using a fluid lipid bilayer as the mobile phase . specific membraneprotein capturing and enrichment in a microfluidic channel was accomplished by immobilizing a synthesized trivalent nitrilotriacetic acid ( trisnta)biotin conjugate . a polymersupported lipid bilayer containing his6tagged secretase ( bace ) was subsequently laterally moved over the capture region by using a hydrodynamic flow . specific enrichment of his6bace in the ni2+ntamodified region of the substrate resulted in a stationary threefold increase in surface coverage , and an accompanied increase in ligandbinding response .

we analyzed the amino acid sequence of the receptor binding site of ha from the isolate a / jiangxi - donghu/346 - 1/2013 ( h10-jd346 ; global initiative on sharing avian influenza data [ gisaid , http://www.gisaid.org ] accession no . epi530526 ) from the first patient infected by influenza a(h10n8 ) virus . in addition , several human and avian influenza viruses ( sequences from gisaid or the national center for biotechnology information website ) and a recent harbor seal isolate ( 5 ) were compared with h10-jd346 ( table ) . we observed that residues involved in receptor binding for h10 subtype influenza viruses suggest avian - like receptor specificity . however , we identified 2 amino acids in avian and human h10 , t135 and s186 , that are common in circulating human influenza viruses and were associated with changes in receptor binding in other avian influenza a virus subtypes ( 6,7 ) . in accordance with this finding , vachieri et al . found substantial levels of binding of an avian h10 ha to sa2,6 that retained the ability to interact with sa2,3 ( 8) . * residues found in human h1 or h3 and in h10 hemagglutinin but not in other avian hemagglutinin sequences are shown in bold . given the role of receptor binding specificity of emerging influenza viruses , we analyzed the interaction of ha of the human h10-jd346 influenza a(h10n8 ) virus isolate in comparison with that of an avian h10n7 subtype virus . first , we used a solid - phase binding assay ( 9,10 ) and the following biotinylated glycans conjugated with a polyacrylamide ( paa ) support ( provided by the consortium of functional glycomics [ cfg ] ) : neu5ac2,6gal14glcnac-paa ( 6 sln - paa ) ; neu5ac26(gal14glcnac13)2-paa ( 6sdi - ln - paa ) ; neu5ac2,3gal14glcnac-paa ( 3 sln - paa ) ; neu5ac23(gal14glcnac13)2-paa ( 3sdi - ln - paa ) ; and neu5ac23(gal14glcnac-sp)3-paa ( 3stri - ln - paa ) . we also analyzed recombinant hexahistidine - tagged has ( 11 ) from h10-jd346 , an avian h10n7 subtype strain from north america ( a / mallard / interior alaska/10bm01929/2010 ; h10-mallard ) , a human h3n2 subtype seasonal influenza a virus ( a / panama/2007/1999 ; h3-p99 ) , and an h5n1 subtype avian influenza virus from a fatal human case ( a / vietnam/1203/2004 ; h5-viet ) . as expected , h3-p99 bound strongly to the sa2,6 tested , and h5 showed higher levels of binding to sa2,3 than to sa2,6 ( figure 1 , panel a ) . when we analyzed h10-mallard and h10-jd346 , we found a similar binding profile , which is consistent with the presence of similar amino acids affecting the receptor binding specificity ( table ) . although both h10 proteins had a prevalent avian - like binding profile , low levels of binding to sa2,6 were also observed . a ) binding of recombinant hemagglutinins to glycans in a solid - phase binding assay . ( human ) , h5-viet ( avian origin isolated from a human case ) , and h10-mallard ( avian ) viruses were included in the analysis for comparison and as controls . values at the top right of the dot plots indicate percentage of cells expressing matrix protein 2 ( m2 ) . fsc , forward - scattered light ; fitc , fluorescein isothiocyanate . to confirm this data , we used a flow cytometry based assay and the same synthetic glycans ( 9,10 ) . we infected mdck epithelial cells with h10-jd346 virus ( 6:2 re - assortant with the backbone of laboratory strain a / puerto rico/8/1934 [ pr8 ] , which was generated as described ) ( 9,10 ) ; h10-mallard ( wild - type ) ; human isolate h3-p99 ( wild - type ) ; and h5-viet 6:2 ( low pathogenicity reassortant with the backbone of pr8 ) ( 9,10 ) at a multiplicity of infection of 1 . cells were harvested 24-h postinfection and incubated with antibody against matrix protein 2 ( e10 ) , which was detected by using an antibody against igg ( alexa 647 antibody ; invitrogen , carlsbad , ca , usa ) as a control of infection and with the sialyl - glycans ( detected with streptavidin fluorescein isothiocyanate ; jackson laboratories , bar harbor , me , usa ) . we determined the percentage of infected cells in each sample and gated the infected population to determine the sa binding profile ( figure 1 , panel b ) . h3-p99 showed high levels of binding to sa2,6 and h5-viet bound more efficiently to sa2,3 than to sa2,6 , which is similar to observations with recombinant has in the solid - phase binding assay . h10-mallard and h10-jd346 showed similar binding profiles with preferential binding for sa2,3 and binding to sa2,6 slightly higher than that for the negative control . analysis of receptor binding of h10-jd346 and of h10-mallard with 2 independent assays indicated that the h10 subtype influenza virus interacts slightly with human - like receptors and maintains preferential binding to avian - like receptors . consequently , these data suggest that h10 subtype influenza virus might have the ability to interact with the upper human respiratory tract , which is rich in sa2,6 ( 3 ) . to test this hypothesis , we precomplexed h3-p99 and h10-jd346 with primary antibody ( mouse anti - his tag ) and secondary fluorescent antibody , then incubated the complex with 2 human tracheal samples ( 12 ) . as expected , recombinant h10-jd346 ha also interacted with respiratory epithelia ( figure 2 ) , which suggested that the virus might be able to attach and replicate in the human upper respiratory tract . however , the 6:2 reassortant virus h10-jd346 virus showed markedly decreased replication compared with that of an h3n2 subtype virus ( pr8 6:2 reassortant ) in a human lung epithelial cell line ( figure 3 ) . interaction of hemagglutinin ( ha ) of h3-p99 ( panels b and e ) and h10-jd346 ( panels c , f , and g ) isolates of influenza a(h10n8 ) viruses with human trachea . scale bars indicate 25 m . replication of influenza a(h10n8 ) h10-jd346 virus in human epithelial cells . a549 cells ( a human lung epithelial adenocarcinoma cell line ) were infected at a multiplicity of infection of 0.1 with the h10-jd346 virus ( 6:2 re - assortant with the backbone of pr8 ) and another 6:2 re - assortant virus expressing hemagglutinin and neuraminidase genes from a human influenza a(h3n2 ) virus ( a / wyoming/3/2003 ) . cells were incubated at 37c in dulbecco minimal essential medium containing 0.3% bovine albumin ( mp biomedicals , solon , oh , usa ) and 1 g / ml of tolylsulfonyl phenylalanyl chloromethyl ketone treated trypsin ( sigma , st . supernatants were collected at selected time points , and viral titers on mdck cells were determined by using a standard plaque assay . ha of novel influenza a(h10n8 ) virus interacts with sa2,3 and slightly with sa2,6 , at levels similar to that for an avian h10 subtype ha , and binds to cells in the human upper respiratory tract . variations in the experimental settings and protocols ( e.g. , concentration of ha or glycans used ) might account for these dissimilarities . an epidemic among seals caused by this virus subtype is currently ongoing in europe ( 5 ) . a study by beare and webster showed that 50% of volunteers experimentally infected with influenza a(h10n7 ) virus shed virus ( 15 ) , which our data suggests might be caused by initial attachment to the upper respiratory tract . immune responses were not detected in these volunteers , and mild , if any , symptoms developed , which indicated limited virus replication . the low incidence of h10 influenza virus indicates a limited pandemic potential of h10n7 and h10n8 viruses . therefore , further changes in receptor binding , as well as acquisition of genomic segments from other avian influenza virus strains through co - infection , would be required to increase fitness and transmissibility in mammals . isolate h10-jd346 amino acid sequence had a mixture of e and k in position 627 of basic polymerase protein 2 ; the k627 mutation is associated with mammal adaptation ( 1 ) . this finding highlights the need for an efficient surveillance network to track and identify possible changes , as well as extensive research to identify them and understand their functional consequences .

three cases of influenza a(h10n8 ) virus infection in humans have been reported ; 2 of these infected persons died . characterization of the receptor binding pattern of h10 hemagglutinin from avian and human isolates showed that both interact weakly with human - like receptors and maintain strong affinity for avian - like receptors .

about 200 years ac , galen first had differentiated a debilitating disease from rheumatoid arthritis , presumably ankylosing spondylitis ( as ) . later in 1961 , bernard conner described pathologic skeletal changes in as . as is a chronic inflammatory disease from the family of seronegative spondiloarthropathies ( i.e.,negative serum rheumatoid factor ) in which , mainly axial it may also exhibit extra articular manifestations with ophthalmic , cardiac , and renal involvement . prevalence of 0.1 - 1% of general population is reported , with male dominancy ( male to female ratio 1:3 ) . average age of diagnosis is around 23 - 28 years with a 5.3 - 11.4 years delay from the onset of symptoms . also , it is proposed that hormonal imbalance may have a crucial role to change the pro - and anti - inflammatory cytokines . hla - b27 positive rates are 8% , 40% , 50% , and 80% in healthy white , healthy african american , african american with as , and mediterranean asians with as , respectively . a common initial complaint is a radiating low back pain to the buttocks that is alleviated by nsaids and exercising . on examination , a key pathologic change is an ongoing inflammatory process at ligaments and tendons insertion sites with ultimate fibrosis and ossification , so called enthesis . progressively , along with ossification induction at fibrous annulus of vertebrae a bony bridge forms and fusion occurs ( bamboo spine ) . importantly , temporomandibular joint may be involved with consequent ligament ossification , bony erosions , condylar flattening , disk destruction , and reduced range of motion . although true ankylosis is rare and to date ten cases are reported , yet subjective symptoms and complaints are frequent and may be present in up to 60% of cases . reduced mouth opening , osteoporosis , possible atlantoaxial subluxation , and impaired immune system due to immunosuppressive medications may be challenging to any maxillofacial surgeon when he or she decides to perform even a simple extraction or biopsy from a discolored plaque within the oral cavity . we aimed to highlight especial concerns with emphasis on dentistry considerations for minor oral surgeries in as cases . a 39-year - old iranian male patient , a known case of as since 15 years ago , referred to our clinic for his impacted mandibular wisdom tooth . he took 25 mg indomethacin daily , calcium 1000 mg daily , metothrexate 2.5 mg 4 days a week , prednisolone 5 mg daily , and folic acid 1 mg daily . laboratory data revealed a positive hla - b27 , 1 hour esr = 24 and 2 hour esr = 50 , + + + crp and mild hypochromic rbcs . last bone densitometry was performed 10 years ago which was not significant regarding osteopenia or osteoporosis , though recent lateral neck radiography was suggestive of osteopenia of cervical vertebrae [ figure 1 ] . oral panogram ( opg ) revealed a left mandibular mesio - angular third molar [ figure 2 ] . disk space was reduced and the borders of glenoid fossa and condylar head were sclerotic , yet no erosion and osteophyte was evident [ figure 3 ] . lateral neck radiography revealed no fracture and subluxation of cervical vertebra impacted mandibular mesio - angular third molar right temporomandibular joint . note reduced space and sclerotic border of glenoid fossa and condylar head in oral examination , patient had class i angle occlusion . a lateral neck x - ray was taken prior to the operation to detect any possible luxation of fracture of the cervical vertebrae which was normal . he got anesthetized using total 4 carpules each containing 1.8 cc of 2% lidocaine with 1:100,000 epinephrine solution . patient had moderate limitation in cervical flexion and extension and a cushion was inserted behind his head to prevent subluxation or fracture of upper cervical vertebrae while the surgeon exerts unintentional heavy forces during the surgery . during a routine procedure , a great care was made to avoid any heavy forces and rapid movement of the jaws and neck with regards to antiseptic and low traumatizing maneuver . surgery was uneventful except for difficulty in accessing the site due to the limited range of mouth opening . the patient was discharged with prescriptions for oral analgesic and 400 mg cefixime for 7 days and 4 mg dexamethasone for injection . a case of as is presented with emphasis on orodental pre - and intraoperative concerns . our patient did not complaint about temporomandibular joint ( tmj ) problem and had normal occlusion of class i angle classification and canine rise anterior guidance . attention to the occlusion and teeth intercuspation is of a great interest . a new emerging theory of bidirectional cause - effect relationship between temporomandibular / cranio mandibular and pelvic systems is described . evaluating 100 patients with sa , weneberg in 1982 concluded that severity of stomatognathic symptoms was correlated with general subjective joint symptoms . various authorities believe that orodental complex stability dictates postural position and vice - versa is adversely affected by pelvic instability . investigated the effect of artificial dental occlusal interference in healthy individuals and figured out a significant hypomobility of upper cervical spine and sacroiliac joint . a combined orodental rehabilitation with orthodontic / prosthodontic and chiropractic cotreatment is promising to improve both tmj and pelvic pain and function . this simple radiography gives informative clues about cervical fusion , atlantoaxial subluxation , and relative bone density . in the case of suspicious findings , a neurologic consult and further radiologic examinations are recommended . protecting head in a slight flexion by cushion put behind the head and avoiding maneuver with extensive neck flexion and extension is critically important . another barrier to appropriate access into the oral cavity is limited mouth opening as a consequence of damaged tmj . a careful manual examination with further computed tomography imaging would provide the clinician to how extent the tmj is damaged secondary to as . simple x - rays and even ct and mri imaging remain intact early in the course of disease . joint fissure , pseudodilation , periarticular osteosclerosis , ligament ossification , or early ankylosis without predestruction may be evident in imaging . in addition , tissue samples may reveal vascular proliferation , leukocyte infiltration , or disk destruction , which is not contrasting pathologic features from other inflammatory diseases of tmj . moreover , clinician should be aware of increased risk of bleeding [ nonsteroidal anti inflammatory drug ( nsaids ) consumption ] , fracture , and infection ( corticosteroids and immunosuppressive medications ) . generally , treatments include medication , surgical manipulation and physical therapy . among medications , nsaids are prescribed more often . more specific biologics such as infliximab and anakinra that targets tnf and interleukin 1 receptor respectively may be used when previous medications are failed . other medications with various success and conflicting results are azathioprine , metothrexate , cyclophosphamide , cyclosporine , and topical and systemic corticosteroids . such medication put the patient at the risk of serious infection . a case of mandibular osteomyelitis following tooth extraction in a patient with as taking infliximab more recently , a bilateral alloplastic tmj replacement may be helpful in the case of ankylosis and severe disk destruction . antigenic mimicry between hla - b27 and klebsiella pneumonia raise concerns that individual tendency to express manifestations of as in heavily modulated by intestinal bacterial load , meanwhile toivanen et al . argued this possible microbial role in exciting immune and inflammatory cascades . it has been postulated that eliminating starch from daily diet as a prime nutrient for klebsiella may be promising , yet needs further confirmatory investigations . moreover , a 12-week trial of moxifloxacin conferred significant and sustained improvement in inflammatory signs of as . generally , local anethetics and conscious sedation are safe for patients with as , while general anesthesia is not recommended because of the following reasons : 1 cervical fusion prone this part of vertebrae to fracture and serious neurologic impairment . 2 osteopenia or osteoporosis resulting from either long standing disease or corticosteroid consumptions increases the risk of fracture . 3 limited mouth opening and calcified ligaments make the intubation difficult . hence , forceful intubation should be avoided to prevent luxation or fracture of cervical vertebrae . 4 stiff thoracic cage due to acromioclavicular and sternoclavicular joint damages decreases the efficacy of ventilation . up to 10% of patients have aortic regurgitation which needs endocarditis antibiotic prophylaxis prior to invasive intraoral procedures . an impaired renal function test should hazard the clinician to adjust certain antibiotics and analgesics . conclusively , prior to office oral surgeries in cases with as , a lateral neck radiography should be taken to ensure stability of cervical vertebrae . in addition , clinician should always remember the systemic consequences of as and specifically modify any surgical or nonsurgical remedies according to the concurrent direct or indirect comorbidities .

temporomandibular joint and the pelvic complex are bidirectionally related . ankylosing spondylitis ( as ) is a seronegative arthropathy with the key feature of bony fusion of lumbar vertebrae . a 39 year old known case of as was presented to private office for left lower impacted third molar surgical removal . previously , he was rejected to receive oral care for pulpectomy and extraction due to limited mouth opening . prior to the surgery , lateral neck radiography was obtained to exclude any subluxation of fracture of cervical vertebrae . neck was supported to insure neck stability during surgical forces . in addition , considering consumption of immunosuppressive medications including corticosteroids , procedure was performed with a great care , with attention to higher possibility of infection and fracture . access to the surgical site was not desirable , though surgery accomplished without any significant event and the patient discharged with routine analgesic and antibiotics recommendation . sometimes , impaired access to the oral cavity in patients with as leads to receive suboptimal or minimal orodental care . long list of dental implications in these patients may be simplified by considering of careful neck and jaw support , applying at least possible forces and great attention to the infection control rules . it is wised to be performed under patient and skilled hands .

a good prescription is rational , evidence based , clear , complete and improves the treatment outcome of the patient . while prescribing without an appropriate indication , correct dose , frequency , route of administration , schedule or duration of treatment and duplicate therapeutic agents and medication of potential drug drug interactions or adverse reactions are all forms of inappropriate prescribing . these tools are based on expert judgment or consensus of practitioners without any information on the psychometric properties of the instruments . these tools measure of quality of care in general or for specific disease , in specific population , overall use , specific areas of use , or specific drug or groups of drugs . an attempt to improve in prescribing practices begins with assessing all the aspects of prescription right from selection of the drug to complete prescribing instructions . the pqi has been claimed to be an ideal tool applicable to a broad variety of medications and clinical conditions and applicable in different settings and with limited data . this study was conducted to determine the quality of prescribing in patients of hypertension at primary and secondary health care facilities in gujarat state of india using the pqi tool and to assess the reliability of this tool . this observational cross sectional study was carried out from april 2012 to september 2012- at four primary health centers ( phc ) , two secondary health centers ( shc ) , one community health center and one civil hospital . approval from the institutional human ethics committee and permission of chief medical officer ( cmo ) of different health centers were obtained . each participant 's informed consent was obtained before collecting his / her data and any relevant information . patients of all ages suffering from hypertension with or without co - morbidities and attending the outpatient department ( opd ) of phc and shc for at least 3 months or more and willing to give consent were included in the study . data was collected for a period of four weeks ( three days / week ) at each facility . the quality of prescription was assessed with 22 criteria- indication , dosage , effectiveness , evidence - base , correct and practical administration , drug - drug interaction , drug - disease interaction , adverse drug reaction , unnecessary duplication , duration of therapy , cost minimization , use of generic name , selection from hospital drug list , compliance , medication name , legibility , prescriber name and information , patient information , diagnosis , requirement for drug therapy and patient 's improvement . if the prescription consisted of more than one drug , each drug was rated individually . similarly , if patients suffered from more than one disease state , each disease state was rated separately . if a drug was not indicated , criterion 1 was scored as 0 ( zero ) . subsequently , criterion 2 ( dosage ) , criterion 13 ( duration ) and criterion 14 ( cost minimization ) were all scored as 0. the pqi total score was obtained by summing up all the minimum scores for the 22 criteria for all drugs in a prescription . 43. prescription with the pqi total score of 31 was interpreted as poor quality , score 32 - 33 as medium quality and score 34 - 43 as high quality as described in pqi tool . to evaluate different items in the questionnaire standard references or publications the primary references were pqi manual , pharmaceutical / pharmacological texts or credible medical journals or established online websites . examples are a to z drug facts , uspdi , evidence based medical reviews ( ebmr ) , medline , pubmed , martindale 's complete drug reference , who essential drug list 2011 , national formulary of india 2011 and british national formulary ( bnf ) 2011 . for the cost of the therapy current issues of commercial sources like current index of medical specialities ( cims ) , monthly index of medical specialities ( mims ) and indian drug review ( idr ) were reviewed . mean and standard deviation ( sd ) were used to describe numerical and variables and frequency ( % ) was used for categorical variables . to check the normality of data kolmogrov - smimov test was applied . non parametric tests were applied due to skewed distribution of the data . to validate the pqi , internal consistency ( reliability ) was measured using item total correlation and cronbach 's . these two properties reflect the extent to which items correlate with the total score and how well items measure the same construct . minimal effects ( percentage of prescriptions with minimum possible score ) and ceiling effects ( percentage of prescriptions with maximum possible score ) were also assessed . factor analysis was performed to find out the reliability and validity of the pqi criteria . factor analysis use more than one criteria kaiser 's criteria ( eigenvalue > 1 rule ) and the scree test were used to assess the construct validity of the tool p < 0.05 was considered significant . patients of all ages suffering from hypertension with or without co - morbidities and attending the outpatient department ( opd ) of phc and shc for at least 3 months or more and willing to give consent were included in the study . data was collected for a period of four weeks ( three days / week ) at each facility . the quality of prescription was assessed with 22 criteria- indication , dosage , effectiveness , evidence - base , correct and practical administration , drug - drug interaction , drug - disease interaction , adverse drug reaction , unnecessary duplication , duration of therapy , cost minimization , use of generic name , selection from hospital drug list , compliance , medication name , legibility , prescriber name and information , patient information , diagnosis , requirement for drug therapy and patient 's improvement . if the prescription consisted of more than one drug , each drug was rated individually . similarly , if patients suffered from more than one disease state , each disease state was rated separately . if a drug was not indicated , criterion 1 was scored as 0 ( zero ) . subsequently , criterion 2 ( dosage ) , criterion 13 ( duration ) and criterion 14 ( cost minimization ) were all scored as 0. the pqi total score was obtained by summing up all the minimum scores for the 22 criteria for all drugs in a prescription . the possible maximum score of the pqi was 43. prescription with the pqi total score of 31 was interpreted as poor quality , score 32 - 33 as medium quality and score 34 - 43 as high quality as described in pqi tool . to evaluate different items in the questionnaire standard references or publications the primary references were pqi manual , pharmaceutical / pharmacological texts or credible medical journals or established online websites . examples are a to z drug facts , uspdi , evidence based medical reviews ( ebmr ) , medline , pubmed , martindale 's complete drug reference , who essential drug list 2011 , national formulary of india 2011 and british national formulary ( bnf ) 2011 . for the cost of the therapy current issues of commercial sources like current index of medical specialities ( cims ) , monthly index of medical specialities ( mims ) and indian drug review ( idr ) were reviewed . mean and standard deviation ( sd ) were used to describe numerical and variables and frequency ( % ) was used for categorical variables . to check the normality of data kolmogrov - smimov test was applied . non parametric tests were applied due to skewed distribution of the data . to validate the pqi , internal consistency ( reliability ) was measured using item total correlation and cronbach 's . these two properties reflect the extent to which items correlate with the total score and how well items measure the same construct . minimal effects ( percentage of prescriptions with minimum possible score ) and ceiling effects ( percentage of prescriptions with maximum possible score ) were also assessed . factor analysis was performed to find out the reliability and validity of the pqi criteria . factor analysis use more than one criteria kaiser 's criteria ( eigenvalue > 1 rule ) and the scree test were used to assess the construct validity of the tool p < 0.05 was considered significant . patients of all ages suffering from hypertension with or without co - morbidities and attending the outpatient department ( opd ) of phc and shc for at least 3 months or more and willing to give consent were included in the study . data was collected for a period of four weeks ( three days / week ) at each facility . the quality of prescription was assessed with 22 criteria- indication , dosage , effectiveness , evidence - base , correct and practical administration , drug - drug interaction , drug - disease interaction , adverse drug reaction , unnecessary duplication , duration of therapy , cost minimization , use of generic name , selection from hospital drug list , compliance , medication name , legibility , prescriber name and information , patient information , diagnosis , requirement for drug therapy and patient 's improvement . if the prescription consisted of more than one drug , each drug was rated individually . similarly , if patients suffered from more than one disease state , each disease state was rated separately . if a drug was not indicated , criterion 1 was scored as 0 ( zero ) . subsequently , criterion 2 ( dosage ) , criterion 13 ( duration ) and criterion 14 ( cost minimization ) were all scored as 0. the pqi total score was obtained by summing up all the minimum scores for the 22 criteria for all drugs in a prescription . the possible maximum score of the pqi was 43. prescription with the pqi total score of 31 was interpreted as poor quality , score 32 - 33 as medium quality and score 34 - 43 as high quality as described in pqi tool . to evaluate different items in the questionnaire standard references or publications the primary references were pqi manual , pharmaceutical / pharmacological texts or credible medical journals or established online websites . examples are a to z drug facts , uspdi , evidence based medical reviews ( ebmr ) , medline , pubmed , martindale 's complete drug reference , who essential drug list 2011 , national formulary of india 2011 and british national formulary ( bnf ) 2011 . for the cost of the therapy current issues of commercial sources like current index of medical specialities ( cims ) , monthly index of medical specialities ( mims ) and indian drug review ( idr ) were reviewed . mean and standard deviation ( sd ) were used to describe numerical and variables and frequency ( % ) was used for categorical variables . to check the normality of data kolmogrov - smimov test was applied . non parametric tests were applied due to skewed distribution of the data . to validate the pqi , internal consistency ( reliability ) was measured using item total correlation and cronbach 's . these two properties reflect the extent to which items correlate with the total score and how well items measure the same construct . minimal effects ( percentage of prescriptions with minimum possible score ) and ceiling effects ( percentage of prescriptions with maximum possible score ) were also assessed . factor analysis was performed to find out the reliability and validity of the pqi criteria . factor analysis use more than one criteria kaiser 's criteria ( eigenvalue > 1 rule ) and the scree test were used to assess the construct validity of the tool p < 0.05 was considered significant . a total of 73 patients received 73 prescriptions with 305 drugs . mean age of patients was 61.2 11 ( range 40 - 84 years ) with 30 ( 41% ) male patients . most ( 62% ) of the prescriptions were from shc and 28 ( 38% ) were from phc . the number of drugs in the prescriptions ranged from one to nine with the mean value of 4.2 1.96 . the most common conditions were hypertension 26 ( 35% ) , followed by hypertension with diabetes mellitus 13 ( 17% ) , bronchial asthma 10 ( 13% ) and other diseases 27 ( 36% ) like diabetes mellitus , joint disorders and gastric problem [ table 1 ] . demographic and clinical presentation details of patients included in study ( n=73 ) the mean pqi score was 26 11 . there were three ( 4.1% ) prescriptions with minimum score of 11 , where as two ( 2.7% ) prescriptions scored maximum 43 , indicating the absence of floor effects . table 2 shows the pqi mean scores for each pqi criterion . as criterion 7 , clinically significant drug - drug interactions was a constant value , it was neglected in the analysis . all showed skewed distribution as verified by using kolmogrov - smimov test ( for all p < 0.001 ) . criteria wise mean pqi scores ( n=73 ) exploratory principal components analysis of the pqi total scores revealed a six factor solution using the minimum eigenvalue criteria of 1 . scree plot showing the components of the prescription quality index score against eigen values in patients with hypertension the total pqi score was weakly correlated with age ( correlation coefficient r = 0.36 , p = 0.002 ) , negatively correlated with number of drugs in the prescriptions ( correlation coefficient r = 0.49 , p < 0.001 ) and not correlated with number of chronic diseases / conditions ( correlation coefficient r = 0.10 , p = 0.400 ) . of the different pqi criteria , pqi total scores were strongly correlated with drug indication and drug effectiveness , evidence base , correct directions , unnecessary duplication , duration of therapy and cost [ table 3 ] . the other criteria like drug dosage , practical direction , drug- disease / condition interactions , generic prescribing , medication 's name , requirement for drug therapy and patient 's improvement showed moderate correlations . there was weak correlation between the pqi total scores and the remaining criteria . pqi total score correlation with 22 criteria table 4 depicts the pqi score and quality of prescribing . the proportion to high and poor quality of prescription did not differ significantly between two facilities . however mean pqi score at phc and shc was 31.10 8.76 and 22.73 10.88 respectively , the difference being significant ( p < 0.05 ) . prescription quality index score and quality of prescribing at primary and secondary health care facilities a total of 73 patients received 73 prescriptions with 305 drugs . mean age of patients was 61.2 11 ( range 40 - 84 years ) with 30 ( 41% ) male patients . most ( 62% ) of the prescriptions were from shc and 28 ( 38% ) were from phc . the number of drugs in the prescriptions ranged from one to nine with the mean value of 4.2 1.96 . the most common conditions were hypertension 26 ( 35% ) , followed by hypertension with diabetes mellitus 13 ( 17% ) , bronchial asthma 10 ( 13% ) and other diseases 27 ( 36% ) like diabetes mellitus , joint disorders and gastric problem [ table 1 ] . demographic and clinical presentation details of patients included in study ( n=73 ) the mean pqi score was 26 11 . there were three ( 4.1% ) prescriptions with minimum score of 11 , where as two ( 2.7% ) prescriptions scored maximum 43 , indicating the absence of floor effects . table 2 shows the pqi mean scores for each pqi criterion . as criterion 7 , clinically significant drug - drug interactions was a constant value , it was neglected in the analysis . all showed skewed distribution as verified by using kolmogrov - smimov test ( for all p < 0.001 ) . criteria wise mean pqi scores ( n=73 ) exploratory principal components analysis of the pqi total scores revealed a six factor solution using the minimum eigenvalue criteria of 1 . scree plot showing the components of the prescription quality index score against eigen values in patients with hypertension the total pqi score was weakly correlated with age ( correlation coefficient r = 0.36 , p = 0.002 ) , negatively correlated with number of drugs in the prescriptions ( correlation coefficient r = 0.49 , p < 0.001 ) and not correlated with number of chronic diseases / conditions ( correlation coefficient r = 0.10 , p = 0.400 ) . of the different pqi criteria , pqi total scores were strongly correlated with drug indication and drug effectiveness , evidence base , correct directions , unnecessary duplication , duration of therapy and cost [ table 3 ] . the other criteria like drug dosage , practical direction , drug- disease / condition interactions , generic prescribing , medication 's name , requirement for drug therapy and patient 's improvement showed moderate correlations . there was weak correlation between the pqi total scores and the remaining criteria . pqi total score correlation with 22 criteria table 4 depicts the pqi score and quality of prescribing . the proportion to high and poor quality of prescription did not differ significantly between two facilities . however mean pqi score at phc and shc was 31.10 8.76 and 22.73 10.88 respectively , the difference being significant ( p < 0.05 ) . prescription quality index score and quality of prescribing at primary and secondary health care facilities a total of 73 patients received 73 prescriptions with 305 drugs . mean age of patients was 61.2 11 ( range 40 - 84 years ) with 30 ( 41% ) male patients . most ( 62% ) of the prescriptions were from shc and 28 ( 38% ) were from phc . the number of drugs in the prescriptions ranged from one to nine with the mean value of 4.2 1.96 . the most common conditions were hypertension 26 ( 35% ) , followed by hypertension with diabetes mellitus 13 ( 17% ) , bronchial asthma 10 ( 13% ) and other diseases 27 ( 36% ) like diabetes mellitus , joint disorders and gastric problem [ table 1 ] . demographic and clinical presentation details of patients included in study ( n=73 ) there were three ( 4.1% ) prescriptions with minimum score of 11 , where as two ( 2.7% ) prescriptions scored maximum 43 , indicating the absence of floor effects . table 2 shows the pqi mean scores for each pqi criterion . as criterion 7 , clinically significant drug - drug interactions was a constant value , it was neglected in the analysis . all showed skewed distribution as verified by using kolmogrov - smimov test ( for all p < 0.001 ) . criteria wise mean pqi scores ( n=73 ) exploratory principal components analysis of the pqi total scores revealed a six factor solution using the minimum eigenvalue criteria of 1 . scree plot showing the components of the prescription quality index score against eigen values in patients with hypertension the total pqi score was weakly correlated with age ( correlation coefficient r = 0.36 , p = 0.002 ) , negatively correlated with number of drugs in the prescriptions ( correlation coefficient r = 0.49 , p < 0.001 ) and not correlated with number of chronic diseases / conditions ( correlation coefficient r = 0.10 , p = 0.400 ) . of the different pqi criteria , pqi total scores were strongly correlated with drug indication and drug effectiveness , evidence base , correct directions , unnecessary duplication , duration of therapy and cost [ table 3 ] . the other criteria like drug dosage , practical direction , drug- disease / condition interactions , generic prescribing , medication 's name , requirement for drug therapy and patient 's improvement showed moderate correlations . there was weak correlation between the pqi total scores and the remaining criteria . pqi total score correlation with 22 criteria table 4 depicts the pqi score and quality of prescribing . the proportion to high and poor quality of prescription did not differ significantly between two facilities . however mean pqi score at phc and shc was 31.10 8.76 and 22.73 10.88 respectively , the difference being significant ( p < 0.05 ) . prescription quality index score and quality of prescribing at primary and secondary health care facilities this study was planned to evaluate the quality of prescribing for hypertension , a chronic condition , in outpatient setting of primary and secondary health care facilities in western part of india using pqi tool developed by hassan et al . , in 2010 . the pqi tool has been validated hence selected for assessment of prescribing quality in hypertension . there were three ( 4.1% ) patients , who received a minimum score of 11 , whereas two ( 2.7% ) patients received a maximal score of 43 , indicating the absence of floor effects and presence of ceiling effects . these finding differs from hassan et al . , who reported that the two criteria ( generic prescribing and diagnosis ) were normally distributed , while the other criteria displayed skewed distribution with the absence of floor or ceiling effects . often instruments that have been tested in the same population might not need further testing , but further psychometric testing is necessary if differences exist between the study population and the population sampled when the instrument was developed and tested . psychometric properties of tools used in the current study are necessary to report because they are specific to the sample of participants . in our study exploratory principal components analysis of the pqi total scores hassan et al . , reported an eight - factor solution using the minimum eigenvalue criteria of 1 . the value of cronbach 's for the entire 22 criteria was 0.71 compared to 0.60 in the previous study suggesting that the pqi tool is reliable in our setting also . there was significant difference in prescribing quality in terms of pqi score between phc and shc . at phc the quality of prescribing was better as evident by 57% high quality prescriptions with pqi score ranging from 34 - 43 . there could be certain factors that may affect the quality of prescribing like ; patients illness status including co morbidities , number of drugs prescribed and patients flow at health care center . at phc majority of patients moreover at phc only limited numbers of essential drugs are available along with only one physician compare to shc . hence , polypharmacy and variability in prescribing practices are less likely at phc as compared to shc thus reducing chances of irrationalities . there was an inverse correlation between number of drugs prescribed and quality of prescribing at both phc and shc . the higher the number of drugs prescribed in a prescription , the lower the prescription quality . this finding is consistent with the study by hassan et al . in a review of studies on polypharmacy and inappropriate drug use among older people , the frequency of inappropriate drug use was higher in study groups with polypharmacy ( 5 drugs ) , being 27%-56% , compared to groups without polypharmacy ( < 5 drugs ) , for which the prevalence of inappropriate drug use was 10%-23% . our study demonstrated a weak positive correlation of pqi total score with age and a lack of correlation with number of diseases / conditions which differ from the findings of hassan et al . this unexpected finding could be due to the fact that at both phc and shc patients with mild to moderate illness are treated and limited number of drugs are prescribed which are available as per the national health policy . moreover , majority of hypertensive patients attending the facilities were above 50 years of age and hence a wide range for age was not covered . the pqi total scores were strongly correlated with drug indication , drug effectiveness , and evidence based prescribing , correct directions , unnecessary duplication , duration of therapy and cost . there was moderate correlation for seven criteria and weak correlation for remaining eight . in the study by hassan et al . , the pqi total scores were strongly correlated with drug indication and drug dosage . there was moderate ( six criteria ) to weak ( 10 criteria ) correlation and no correlation between the pqi total scores and four criteria namely unnecessary duplication , formulary / essential drug , legibility , and adequate patient information . our study shows at least one of these- unnecessary duplication strongly correlated with pqi total score suggesting regional variation in the factors affecting pqi score and prescription quality . as expected , drug indication shows strong correlation with total pqi score and can have major impact on quality of prescribing . hassan et al . , developed and validated pqi retrospectively which may have retrospective bias . in this study data were collected prospectively for a fixed period with the advantages of completeness of data and proper sampling . we selected only one chronic condition so as to minimize disease / condition variation which is reflected in better internal consistency in form of higher value of cronbach 's . as compared to previous study . however the results are relevant for one disease and limited to primary and secondary health settings and hence the usefulness and acceptability can not be assumed for other settings . further studies with other diseases and other settings like tertiary care facility would be necessary before the strengths and limitations of pqi can be fully realized . majority of the prescriptions for hypertension in primary and secondary health care settings are of poor quality . the pqi is a comprehensive tool which is valid and reliable for measuring quality of prescribing in chronic disease like hypertension in indian settings . pqi can be used for assessment and comparison of quality of prescribing in different clinical settings at different health care levels .

objective : to determine the quality of prescribing in hypertension in primary and secondary health care settings using the prescription quality index ( pqi ) tool and to assess the reliability of this tool.materials and methods : an observational cross - sectional study was carried out for 6 months in order to assess quality of prescribing of antihypertensive drugs using prescription quality index ( pqi ) at four primary ( phc ) and two secondary ( shc ) health care facilities . patients attending these facilities for at least 3 months were included . complete medical history and prescriptions received were noted . total and criteria wise pqi scores were derived for each prescription . prescriptions were categorized as poor ( score of 31 ) , medium ( score 32 - 33 ) and high quality ( score 34 - 43 ) based on pqi total score . psychometric analysis using factor analysis was carried out to assess reliability and validity.results:total 73 hypertensive patients were included . mean age was 61.2 11 years with 35 ( 48% ) patients above 65 years of age . total pqi score was 26 11 . there was a significant difference in pqi score between phc and shc ( p < 0.05 ) out of 73 prescriptions , 43 ( 59% ) were of poor quality with pqi score < 31 . the value of cronbach 's for the entire 22 criteria of pqi was 0.71 suggesting good reliability of pqi tool in our setting.conclusions:based on pqi scores , quality of prescribing in hypertensive patients was poor , somewhat better in primary as compared to secondary health care facility . pqi is reliable for measuring prescribing quality in hypertension in indian set up .

a forty - nine - year - old woman was admitted to our orthopedic department for pain in the left knee that had lasted for two weeks . the patient 's medical history revealed that she had been admitted to another hospital for pain in the right shoulder five months ago . during admission to another hospital arthroscopic irrigation was performed twice and open debridement was carried out once in the right shoulder under the diagnosis of refractory septic shoulder . prolonged intravenous antibiotic treatment had been administrated for two months due to persistent fever , signs of infections in the right shoulder , and the fluctuation in the serologic test values including the white blood cell ( wbc ) count , erythrocyte sedimentation rate ( esr ) , and c - reactive protein ( crp ) ( table 1 ) . eventually , the fever had dropped and the pain in the right shoulder had been improved slightly . she had been discharged from that hospital after two months , but pain and effusion developed in the left knee 3 months later . during admission at our hospital , there were no fever and skin rash ( fig . 1 ) . the initial laboratory test revealed wbc counts , 30,220 cells / mm with a neutrophillic predominance ( 91.2% ) ; hemoglobin , 10.0 g / dl ; platelets , 381 k / mm ; esr , 81 mm / hr ; crp , 18.2 mg / dl ; aspartate aminotransferase ( ast ) , 30 u / l ; alanine amino transaminase ( alt ) , 22 u / l ; rheumatoid factor , < 10 iu / ml ; and negative human leukocyte antigen ( hla ) b-27 ( table 1 ) . 2 ) . mri of the left knee showed synovial hypertrophy and joint effusion , which led us to suspect low virulent infectious arthritis ( fig . the aspirated fluid from the knee joint was analyzed with the suspicion of septic knee . the analysis showed a wbc count of 52,000/mm , neutrophil of 94% , and negative crystal . thereafter , the symptoms of the left knee joint were improved , and the patient was discharged from our hospital . five weeks later , the patient presented to the emergency department with left knee joint pain , fever , and rash . at the second admission , body temperature continued to rise to 39. the pattern of fever was quotidian or double - quotidian , peaking in the late afternoon ( fig . a faint pink macular rash appeared on the abdomen , flanks , thighs , and arms . we found that the patient 's current symptoms were consistent with yamaguchi 's criteria for aosd ( table 2 ) . after a consultation with rheumatologists , we confirmed aosd and started the patient on intravenous prednisolone 60 mg per day for one week . oral administration of the same dose of prednisolone was used for the next two weeks after discharge . now , two years after the first admission at our hospital , the patient is still in remission . laboratory test revealed wbc counts , 8,600 cells / mm ; neutrophils percent , 54.1% ; esr , 2 mm / h ; crp , 0.23 mg / dl ; and ferritin , 53.9 ng / ml ( table 1 , fig . still4 ) in 1896 first recognized still 's disease in children characterized by the triad of quotidian fever , evanescent rash , and arthritis , which has become known as juvenile inflammatory arthritis . aosd was first described by bywaters5 ) in 1971 for adults who presented with symptoms indistinguishable from those of the classic childhood still 's disease . it requires compliance with yamaguchi 's criteria2 ) , which have a sensitivity of 96.2% and a specificity of 92.1% . minor criteria include sore throat , lymphadenopathy and/or splenomegaly , and liver dysfunction ( table 2 ) . more recently , a new set of classification criteria that shows a higher specificity and considers glycosylated ferritin has been proposed1,6 ) . our patient satisfied 4 major and 2 minor no exclusion diagnostic criteria of yamaguchi , and satisfied 4 major and 2 minor diagnostic criteria of fautrel according to the clinical manifestations1 ) . it evolves with daily spikes , frequently in the evening , for at least a week . the typical rash is often described as evanescent , salmon to pink colored , maculopapular lesion . it is mainly visible during fever spikes in the proximal limbs and trunk sparing the face8 ) . aosd is frequently misdiagnosed as a drug allergy to non - steroidal anti - inflammatory drugs ( nsaids ) or antibiotics prescribed for joint symptoms or fever . fever and rash were noted in our patient during admission at another hospital , but these clinical findings were interpreted as drug fever and eruption . unfortunately , there was no fever and rash during the first admission at our hospital , and aosd was not suspected at that time . at the second admission , these two typical symptoms of aosd led us to suspect aosd . the ankles , knees , and wrists are the most commonly involved joints , but the elbows , shoulders and hips have also been described1 ) . 2 ) . to our knowledge , there are few reports on the detailed data of joint fluid analysis in aosd . fautrel1,6 ) reported a synovial fluid aspiration of > 2,000 cells / mm in aosd . in this case , the synovial fluid analysis of the knee joint revealed a wbc count of 52,000 cells / mm with a neutrophillic predominance of 94% , suggesting septic arthritis . unfortunately , the spiking fever pattern , persistently elevated esr and crp , and joint fluid analysis continued to mislead orthopedic surgeons to suspect septic arthritis , which resulted in delayed initiation of appropriate aosd treatment . recently , ferritin has been included in diagnostic criteria reflecting its role in oxidative stress9 ) . overproduction of il-18 has been related to high serum ferritin levels , which indicate macrophage activation and are suggestive of aosd1 ) . ferritin levels represent disease activity and can be used to follow progression or response to the treatment1,6 ) . the high level of ferritin at the diagnosis was normalized after the clinical remission in this case ( fig . saturation of glycosylated ferritin mechanism abnormalities has been suggested more specific in asod diagnosis , particularly decreased clearance of nonglycosylated ferritin by histiocyte macrophage system9 ) . aosd can mimic autoimmune disease including rheumatoid arthritis , vasculitis especially polyarteritis nodosa and polymyositis1 ) . therefore , we tried to exclude autoimmune disease serologic factors including rheumatoid factor ( rf ) , human leukocyte antigen b-27 ( hla - b27 ) , antinuclear antibody ( ana ) that showed negative findings ( table 1 ) . nsaids , cortico steroids , and antirheumatic agents are the cornerstones of therapy for aosd . corticosteroids are usually required to induce clinical remission and the optimal dosage is relatively high ( equivalent to 0.5 to 1 mg / kg / d of prednisone ) . methotrexate appears to be the best choice to control the disease activity and allow for tapering of steroid use in patients with inadequate response to corticosteroids1 ) . novel agents such as anti - tnf drugs , interleukin blockade , and intravenous gammaglobulin have been tried in small stu dies with limited success3 ) . in our case , 60 mg of prednisolon was administrated for three weeks , and the clinical remission was rapidly achieved . then , the dosage was reduced over 3 months in a tapering manner to avoid relapse . the prognosis of aosd is usually good , but disseminated intravascular coagulation and multi - organ failure can occur when the diagnosis is delayed and the proper treatment is not performed10 ) . in conclusion , the chronic articular type of aosd may be mistaken for septic arthritis as shown in our case . we suggest that aosd should be considered as a diagnosis of exclusion to avoid misdiagnosis with septic arthritis .

we present a case of adult onset still 's disease ( aosd ) that was misdiagnosed as septic arthritis of the shoulder and knee . a forty - nine - year - old woman was admitted for pain in the left knee . the patient 's medical history showed that she had undergone arthroscopic irrigation twice and an open debridement under the diagnosis of septic shoulder at another hospital . the laboratory and joint fluid analysis findings led us to suspect septic knee . arthroscopic irrigation and antibiotics treatment were performed . at five weeks after discharge , she presented with pain in the same joint , fever , and rash . the symptoms were consistent with yamaguchi 's criteria for aosd . we started corticosteroid therapy , and clinical remission was achieved . in conclusion , we suggest that aosd should be considered as a diagnosis of exclusion to avoid misdiagnosis with septic arthritis .

iodine deficiency leads to a range of health consequences commonly considered as iodine deficiency disorders ( idds ) ( 1 , 2 ) . idd is deemed as one of the major public health problems in many parts of the world ( 1 , 2 , 3 ) . in particular , thyroid nodular abnormalities ( or , goiter ) constitute one of the main idds . indeed , it is estimated that over 90% of the cases with goiter are caused by iodine deficiency conditions ( 4 , 5 ) . on the other hand , benign tumors of the thyroid gland ( alias , thyroid adenoma ) consist mainly of follicular adenomas , which are described as cold , warm , or hot depending on their level of function ( 6 ) . benign thyroid disease is much more common in females ( 7 , 8) , and this fact has been suggested to lead to a higher rate of investigation and diagnosis of incidental papillary thyroid carcinoma ( 8) . it should be noted that the presence of benign thyroid nodules has been associated with an increased incidence of thyroid neoplasia ( 8) . nonetheless , there is no reported association between the presence of either hyperthyroid graves disease or autoimmune hypothyroidism and thyroid neoplasia ( 9 , 10 ) . the information about thyroid nodular abnormalities or benign tumors of the thyroid gland is scarce for transitional countries of the western balkans such albania and kosovo . as a matter of fact , to date , there are few scientific rigorous reports on this matter . in this framework , the aim of this study was to describe the demographic characteristics and disease patterns among patients with thyroid nodular abnormalities ( goiter ) and benign tumors of the thyroid gland in albania , a transitional country in south eastern europe . a cross - sectional study was conducted in albania covering the period 2004 - 2012 . all patients diagnosed with goiter and/or benign tumors of the thyroid gland who were hospitalized at the university hospital center mother teresa in tirana between 2004 and 2012 were included in this study . overall , for the period 2004 - 2012 ( inclusive ) there were 2204 hospitalized patients with the aforementioned diagnoses . binary logistic regression was used to compare the demographic characteristics between patients with benign tumors of the thyroid gland and those with thyroid nodular abnormalities ( goiter ) . unadjusted ( crude ) odds ratios ( ors ) , their respective 95% confidence intervals ( 95%cis ) and p - values were calculated . table 1 presents the distribution of demographic characteristics and disease patterns among patients with thyroid nodular abnormalities ( goiter ) . mean age in the overall sample of patients with goiter ( n=2204 ) was 46.412.6 years . females were somehow younger than males ( 46 years vs. 49 years , respectively ) . overall , 785 ( 35.6% ) of the patients were from tirana compared with 1419 ( 64.4% ) of the patients who were from other districts of albania . most of the patients ( about 59% ) were diagnosed during the period 2009 - 2012 . the mono - nodular goiter included 23% of the patients , the multi - nodular goiter 18% , whereas 59% of the patients exhibited other diagnoses of the thyroid gland . distribution of demographic characteristics and disease patterns among patients with thyroid nodular abnormalities ( goiter ) in albania , 2004 - 2012 . * mean values standard deviations . numbers and column percentages ( in parentheses ) . table 2 presents the distribution of demographic characteristics and disease patterns among patients with thyroid benign tumors . mean age in the overall sample of patients with benign tumors ( n=54 ) was 49.812.4 years . there were only 7 males ( 13% ) compared with 47 females ( 87% ) . overall , 21 ( 38.9% ) of the patients were from tirana compared with 33 ( 61.1% ) of the patients who were from other districts of albania . similar to the goiter , most of the patients with benign tumors ( about 61% ) were diagnosed over the period 2009 - 2012 . the toxic adenoma sinister included 39% of the patients with tumors , the toxic adenoma dexter included 44% , whereas 517% of the patients had other benign tumors of the thyroid gland . distribution of demographic characteristics and disease patterns among patients with thyroid benign tumors in albania , 2004 - 2012 . * mean values standard deviations . numbers and column percentages ( in parentheses ) . the comparison of demographic characteristics between patients with goiter and those with thyroid benign tumors is presented in table 3 . there was evidence of a borderline statistically significant difference between the two groups when age was treated as a numerical variable : patients with benign tumors were older than those with goiter ( or=1.02 , 95%ci=0.99 - 1.05 , p=0.093 ) . however , there was no evidence of a statistically significant difference between the two groups of the patients when age was introduced into the logistic models as a categorical term ( overall p=0.392 ) . furthermore , there were no significant gender differences ( or=0.53 , 95%ci=0.16 - 1.75 , p-0.299 ) . similarly , there were no significant differences in the place of residence between patients with benign tumors and those with goiter ( or=0.97 , 95%ci=0.46 - 1.39 , p=0.53 ) . comparison of demographic characteristics between patients with thyroid benign tumors and patients with thyroid nodular abnormalities ( goiter ) . * odds ratios ( ors ) : thyroid benign tumors vs. thyroid nodular abnormalities ( goiter ) . overall p - value and degrees of freedom ( in parentheses ) . our study informs about the epidemiology of goiter and benign tumors of the thyroid gland in albania , a post - communist country in the western balkans . overall , there were no statistically significant differences in the distribution of demographic characteristics ( age , gender and place of residence ) between patients with benign tumors of the thyroid gland and those with thyroid nodular abnormalities ( goiter ) . as shown previously , many regions of albania are currently in a transition phase from iodine deficiency to iodine sufficiency ( 11 , 12 ) . nevertheless , in order to achieve a successful elimination of idd in albania , there is a need to enlarge and expand all the activities for ensuring a sustainable consumption of intensified awareness activities at a population level and an appropriate monitoring and evaluation system , similar to the recommendations pertinent to other countries ( 3 ) . we included in our analysis all the hospitalized cases with goiter or benign tumors of the thyroid gland from 2004 to 2012 . our study population had a reasonable size and represented all the cases with these conditions in the albanian population . therefore , on the face of it , there was no evidence of selection bias in our study population . furthermore , the diagnosis criteria of goiter or benign tumors of the thyroid gland were stable over time . in addition , there seems to be no reason for differential recording of the demographic characteristics of our study participants for the entire period under investigation . our study provides useful evidence on the epidemiology of benign tumors of the thyroid gland and the thyroid nodular abnormalities ( goiter ) in the albanian population an under - researched country which is in the midst of a rapid process of political and socioeconomic transition . future studies in albania should assess the main determinants of thyroid gland disorders and compare them with findings pertinent to other similar populations .

aim : the aim of this study was to describe the demographic characteristics and disease patterns among patients with thyroid nodular abnormalities ( goiter ) and benign tumors of the thyroid gland in albania , a transitional country in south eastern europe.methods:our study included all patients diagnosed with goiter and/or benign tumors of the thyroid gland who were hospitalized at the university hospital center ( uhc ) mother teresa in tirana between 2004 and 2012 ( n=2258 ) . all patients underwent the same examination and interviewing procedures . demographic characteristics included gender , age , and place of residence . binary logistic regression was used to compare the demographic characteristics between patients with benign tumors of the thyroid gland and those with goiter.results:overall , there were 2204 patients with goiter and 54 patients with benign tumors of the thyroid gland hospitalized at uhc over the period 2004 - 2012 . there was no evidence of statistically significant differences in demographic characteristics ( age , gender , or place of residence ) between patients with benign tumors of the thyroid gland and those with goiter.conclusions:our study provides useful evidence on the epidemiology of benign tumors of the thyroid gland and the thyroid nodular abnormalities ( goiter ) in the albanian population . future studies in albania should assess the main determinants of thyroid gland disorders and compare them with findings pertinent to other similar populations .

cardiac disease during pregnancy has been shown to be associated with maternal and neonatal complications in developed countries despite the advancement in medical care.15 these complications often translate to high maternal and fetal / perinatal morbidity and mortality especially in undeveloped countries.6 various studies have shown the incidence of cardiac disease during pregnancy to be 0.1%4.0%.710 the pregnancy - related physiological changes of increased blood volume , heart rate , and cardiac output especially in the second half of pregnancy coupled with the stress of labor and the hemodynamic changes of the puerperium may aggravate an underlying cardiac disease in an otherwise clinically stable woman.11,12 pregnant women with cardiac disease may go into either right- or left - sided heart failure , which may be precipitated or intensified by a lengthy list of extra cardiac factors including pregnancy itself.13 in developed countries , congenital heart disease ( chd ) is the most common cause of cardiac disease , accounting for 89%;14 whereas rheumatic heart disease ( rhd ) constitutes the major cause in developing countries.15 in sub - saharan africa , there is now a double burden of poverty - related cardiac disease ( eg , rhd ) and chronic noncommunicable diseases ( eg , hypertension).16 furthermore , there has been a four - fold rise in maternal mortality in south africa over the past decade due , in part , to their poor health care system ; heart disease has been found to account for 41% of the indirect causes of maternal deaths.17 data of these nature are lacking in our setting in nigeria . this study , therefore , embarked on finding out the hospital - based incidence of heart failure during pregnancy and incriminated cardiac lesions , as well as maternal mortality and fetal / neonatal outcomes in a nigerian tertiary health facility . the study was a descriptive , retrospective review of case notes of all booked and unbooked pregnant women who delivered at ladoke akintola university of technology teaching hospital ( lth ) , osogbo , southwest nigeria within the 7-year period of january 2004 to december 2010 . all of the women who presented with cardiac decompensation during pregnancy were selected and information on demographic data , new york heart association ( nyha ) class , investigations , treatment , and maternal and fetal / neonatal outcomes was then retrieved from their case notes . investigation results retrieved from the case notes included twelve - lead resting electrocardiogram , echocardiogram , chest x - ray with shielded abdomen in a few of the patients , electrolytes , urea and creatinine , urinalysis , full blood count , hemoglobin genotype , and blood culture in those with sepsis . patients with hypertension who were not in heart failure , diabetic patients , and those with preeclampsia or eclampsia were excluded . only those with hypertensive heart disease were included , which included patients with hypertensive heart failure . statistical analysis was performed with spss statistics 17 ( spss inc , chicago , il , usa ) . the total number of obstetric cases during the 7-year period was 4523 ; of which , only ten reported cardiac decompensation , ie , an incidence of 2.2/1000 . table 1 shows the demographic and clinical data of the patients , the etiology of heart failure , and maternal mortality and fetal / neonatal outcome . seventy percent of the patients were aged 1824 years . the majority of the patients ( 80% ) presented in the second and third trimester . seventy percent of the patients had hypertensive heart failure with blood pressure ranging from 128/90 to 180/120 . this was a case of pulmonary stenosis with sepsis syndrome , and the neonatal outcome was early perinatal death . the two patients with hemoglobinopathy who presented with heart failure had a hemoglobin concentration of less than 4 in addition to dyspnea as stated by the nyha classification of the patients , the patients had other symptoms and signs of heart failure such as cough , bilateral pitting pedal edema , elevated jugular venous pressure , s3 gallop rhythm , and tender hepatomegaly . bibasal crepitations were present in 80% of the patients , 10% had widespread crepitations in both lung fields with occasional rhonchi , and the remaining 10% ( the only case of pulmonary stenosis ) had bronchovesicular breath sounds without crepitations . all of the patients except one , who discharged herself against medical advice , had spontaneous vertex delivery within a few days of presentation at the hospital . the results were as expected for patients with heart failure and the specific cardiac lesions shown in table 2 . the pulmonary stenosis was severe , as demonstrated by a pressure gradient of 96 mmhg across the pulmonary valve . the blood cultures of the patients with sepsis did not grow any organisms , which is not uncommon in the authors practice area as patients are likely to have been given antibiotics and other drugs before reporting to the hospital , hence empirical antibiotics were given . some investigations were not carried out due to financial constraints or due to a very short duration of stay in the hospital before the patient died ( as retrieved from the case notes ) . other treatments were individualized based on the underlying cardiac lesion responsible for the heart failure . intravenous hydralazine and oral -methyldopa were given as appropriate to those in hypertensive heart failure to control their blood pressure . digoxin was given to four of the patients with hypertensive heart failure who had poor systolic function on echocardiography . antibiotics and antimalarials were given to those who had clinical and objective laboratory evidence of infection and malaria , respectively . the incidence of heart failure during pregnancy was 2.2/1000 in this study . however , there is a lack of data on this subject , hence the reference to cardiac disease during pregnancy , in which incidences of 0.1%4.0% have been reported in other centers . in a study in sub - saharan africa , diao et al found that 72% of the pregnant women with heart disease presented with heart failure.18 it is also noteworthy that no cases of rhd as a cause of heart failure during pregnancy and only one case of chd , ie , pulmonary stenosis , were found in the current study . this may be due to the fact that both rhd and chd are uncommon , as shown in a recently concluded 8-year prospective echocardiographic evaluation of 2501 patients presenting in one of the authors teaching hospitals , located in the same state as lth.19 the prevalence of rhd and chd was 3.1% and 2.1% , respectively.19 at the federal medical center , abeokuta , southwest nigeria , an echocardiography study by ogah et al reported 3.7% cases of rhd out of the 1441 subjects studied.20 even in the nigerian savannah , where sani et al reported a relatively higher prevalence of 9.8% from echocardiography screening about 5 years ago , the prevalence of rhd was still much lower than that of south africa.21 also , the majority of patients with rhd and chd die in their childhood or as adolescents and never reach the reproductive age group when they can present with cardiac disease during pregnancy . the tertiary health care system lacks the appropriate facilities for open heart surgery to perform the needed corrections for these cardiac lesions , and treatment abroad is beyond the reach of most of these patients . rhd has been reported to be the most common cause of cardiac disease during pregnancy in resource poor countries.15 this is particularly so in south africa , with a high incidence of 36% reported for rhd in the heart of soweto study.16 nqayana et al reported rhd in 81% ( n = 77 ) of the 95 patients presenting with cardiac disease during pregnancy over a 1-year period at inkosi albert luthuli central hospital , durban , south africa.6 similarly , a 4-year audit of cardiac disease during pregnancy at pretoria academic hospital showed rhd as the etiology in 63.5% of the patients , while prosthetic valvular heart disease was 20.1% with also a possible etiology of rhd.11 there is now better control of communicable disease in nigeria as the health care delivery system is better equipped to tackle such problems . advocacy as well as continuous and intense health education are being used to fight communicable disease in nigeria . free health services are also being offered by most states and local governments across the country . all of these have resulted in a downward trend in the incidence / prevalence of cardiac diseases such as rhd and its underlying or associated infectious etiology . at lth , a grossly low prevalence of 0.002% and 0.004% for endomyocardial fibrosis in cardiac and medical patients , respectively , was recently reported compared to a prevalence of 10% that was obtained in the 1960s and 1970s in nigeria.22 endomyocardial fibrosis is another disease presumed to be indirectly linked with infectious agents . the majority of the patients ( 70% ) in the current study were aged 1824 years , an age that is the entry point into the reproductive years , ie , when most women are likely to be carrying their first pregnancy . this is in keeping with the reviews done in south africa where the majority ( over 50% ) of patients presenting were younger than 25 years.6,11 however , a canadian study reported the median age for presentation with cardiac disease during pregnancy to be 32 years.23 in another review of various studies pooled from 28 countries with over 60 hospitals , the median age was 30 years . the much lower age of presentation in africa may be due to the young age at marriage and early commencement of child bearing . the first pregnancy is fraught with a lot of danger as this may unearth or aggravate an underlying medical or cardiac disease in an otherwise clinically stable nulliparous woman . fifty percent of the patients in the current study were primigravidae , which further confirms that the first pregnancy more often reveals the underlying cardiac condition . however , it is worth mentioning that two studies from south africa reported a higher incidence of 53% and 65.6% respectively.6,11 the three neonatal / perinatal deaths occurred in the babies of women aged 1824 years who were also primigravidae , ie , the same groups in which the two maternal deaths occurred . other factors contributing to these high neonatal and maternal mortalities were failure to register for antenatal care until the point of presentation with heart failure during pregnancy and lack of prepregnancy screening to identify these cohorts of patients with subclinical cardiac disease . all of the patients were unbooked , which is also in keeping with a study revealing that there were more occurrences of maternal and fetal / perinatal morbidity and mortality in the unbooked primigravidae.24 a 10-year review of maternal mortality in enugu , nigeria also reported that unbooked patients had a mortality rate 48 times higher than booked patients.25 it is also not unexpected that all of the patients presented between the second and third trimester as this period coincides with the period of a physiological increase in blood volume during pregnancy when cardiorespiratory adaptations occur ; in cardiac disease patients , there are increased symptoms and cardiac decompensation.26 all the maternal and neonatal deaths occurred in the second trimester at the onset of these physiological changes ; if medical care was sought earlier , there could have been a better prognosis . the complication rate has been shown to be very low in pregnant women with pre - existing heart disease who received optimal antenatal care . moreover , the superimposed sepsis in these two patients with hemoglobinopathy could also have caused secondary cardiomyopathy due to multiorgan failure . both of them had severe anemia with hemoglobin concentration less than 5 g / dl . patients with an acute event associated with falling hemoglobin ( less than 5 g / dl ) can die suddenly from cardiovascular collapse.27 anemia can also cause high output heart failure . all of these conditions stated above would have culminated in the congestive cardiac failure with which these two patients presented . patients with hemoglobinopathy cope poorly with pregnancy for many reasons such as anemia , the different types of crisis associated with this disease , and the superimposed hemodynamic changes of pregnancy . this is not uncommon as severe anemia during pregnancy has been associated with increased risk of prematurity , spontaneous abortion , low birth weight , intrauterine growth retardation , and fetal death.27,28 hypertensive heart failure accounted for 70% of all the cases and six of the seven patients complied with their inhospital treatment and had favorable maternal and neonatal outcome , with one of them delivering twins . however , the seventh patient discharged herself against medical advice and was lost to follow - up . five of the seven patients had left ventricular hypertrophy ( table 2 ) . heart failure and left ventricular hypertrophy are recognized as the most typical cardiac complications of hypertension and feature prominently in the newly proposed clinical classification of hypertensive heart disease by the working group of the spanish society of cardiology.29 hypertensive heart disease has been defined as a constellation of abnormalities that includes left ventricular hypertrophy and systolic and diastolic dysfunction ; their clinical manifestations include arrhythmias and symptomatic heart failure.30 the prevalence of hypertension in nigeria continues to increase . its current prevalence in a semi - urban community in the same state ( osun state ) as lth is 36.6% ( using the seventh report of the joint national committee on prevention , detection , evaluation , and treatment of high blood pressure - based blood pressure threshold of 140/90 mmhg ) or 13.3% ( using a blood pressure threshold of 160/95 mmhg)31 compared to the previous crude national prevalence of 11.2% using the world health organization - based blood pressure threshold of 160/95 mmhg.32 hence , a corresponding increase is expected not only in the prevalence of hypertension during pregnancy but also that of hypertensive heart failure . two of the patients presented with acute pulmonary edema and another two had proteinuria ; however , they all responded favorably to treatment and had good neonatal and maternal outcome . only one case of chd was seen in the current study . she presented with rare pulmonary stenosis and right - sided heart failure and although she survived , she had a bad neonatal outcome ( early perinatal death ) delivering her baby within 2 days of admission . this patient had severe pulmonary stenosis ( table 2 ) and needed percutaneous valvuloplasty to relieve the obstruction , but there is no facility for this in nigeria . this procedure can be accommodated safely during pregnancy.33 all of the patients in the current study presented in nyha classes iii and iv in equal proportions . nyha iv is a very bad prognostic index , hence it is not surprising that all the maternal and neonatal deaths occurred in patients in this class . in a study in sub - saharan africa , maternal death was significantly associated with nyha functional class iii or iv ( p = 0.001).18 heart disease during pregnancy accounts for a 100-fold higher maternal mortality compared with normal pregnancy in london , uk . poor fetal outcome correlates closely with nyha class,34 hence women with heart failure in a poor functional class should be encouraged to avoid pregnancy . recently , the european registry on pregnancy and heart disease found that the majority of these patients go safely through pregnancy ; however , pregnancy outcomes were markedly worse in patients with cardiomyopathy and in developing countries.23 a limitation of this study is its retrospective nature , which did not allow for screening of all pregnant women for heart disease . hence , the cases of all those who presented with symptomatic heart failure for cardiac disease were reviewed . a community - based prospective study is encouraged to screen pregnant women for cardiac disease in order to have a clearer epidemiologic picture of this disease during pregnancy . this will serve as a baseline for planning towards the reduction / elimination of maternal mortality , which is one of the millennium development goals . data from this hospital - based review shows that heart failure during pregnancy in nigeria is uncommon . however , there is a lack of data from other health facilities in nigeria . all the patients in this study were unbooked for antenatal care in the authors center . the highest maternal and fetal / perinatal mortality occurred in primigravid women , which further emphasizes the importance of early booking for antenatal care as well as a complete cardiovascular evaluation during the first antenatal care visit .

purposeto determine the incidence of heart failure during pregnancy and incriminated cardiac lesions , as well as maternal and fetal outcomes in ladoke akintola university of technology teaching hospital ( lth ) , osogbo , southwest nigeria.methodsthis study was a retrospective , descriptive review of all cases of heart failure during pregnancy based on data retrieved from the medical records of lth over a 7-year period from january 2004 to december 2010 . analysis of these data was carried out using spss 17 . ethical clearance was obtained from the ethical committee of lth.resultsa total of 4523 patients delivered babies over the 7-year period , ten ( 2.2/1000 ) of which had cardiac decompensation . all patients were not registered at lth for antenatal care ( unbooked ) , with 70% of them aged 1824 years . fifty percent were primigravidae and the majority of them presented with symptoms in the second and third trimester . there were two cases of maternal deaths recorded and three cases of fetal / perinatal mortality . only one case of congenital heart disease ( pulmonary stenosis ) and no cases of rheumatic heart disease were found.conclusionthe data suggests that heart failure during pregnancy is uncommon in southwest nigeria . however , it occurs more often in young , unbooked primigravid women . efforts should be aimed at encouraging early booking for antenatal care and a full cardiovascular evaluation to prevent associated maternal and fetal / perinatal morbidity and mortality .

this study aimed to ascertain whether medical students would enter a closed area where there was a raging epidemic of an infectious disease with a high fatality rate , and includes reasons for the students entering or refusing to enter . participants included 50 second - year medical students . they were assigned to read a novel entitled 28 , written by youjeong jeong , and discuss it in groups . using their book reports , their decisions of whether or not to enter hwayang , the city from the novel , and the reasons for their decisions were analyzed ; we furthermore investigated the factors affecting their decisions . among the 50 respondents , 18 students ( 36% ) answered that they would enter , and the remaining 32 students ( 64% ) answered that they would not enter the zone . the reasons given for entering were responsibility ( 44% ) , sense of ethics ( 33% ) , social duty ( 17% ) , and sense of guilt ( 6% ) . the reasons the students provided for not entering were inefficiency ( 44% ) , worry regarding family ( 28% ) , needlessness of sacrifice ( 19% ) , and safety not ensured ( 9% ) . students who had four or fewer family members were more likely to enter hwayang than were students who had five or more family members ( odds ratio , 1.85 ) . students who had completed over 100 hours of volunteer work were more likely to enter hwayang than were students who had volunteered less than 100 hours ( odds ratio , 2.04 ) . owing to their responsibility as a doctor , 36% of medical students answered that they would enter an exclusion zone in an infected district with a high fatality rate . however , 64% answered they would not enter because of inefficiency . for the medical students it is still a question to enter or not to enter?

to examine the putative relationship between ptsd and osa , we determined the apnea hypopnea indices ( ahi ) , body mass index ( bmi ) , ptsd severity , and nightmare complaints in veterans with ptsd , veterans without ptsd , and healthy controls . twenty - three male veterans with ptsd were recruited through the outpatient clinic of the military mental healthcare , utrecht , the netherlands . ptsd patients with habitual benzodiazepine usage ( n=1 ) and substance abuse were excluded ( n=2 ) . patients who used benzodiazepines , alcohol , or drugs weekly or monthly were instructed to refrain from these substances on the day of the sleep recordings . twenty - four trauma controls ( tcs ; veterans without ptsd ) and 17 healthy controls ( hcs ; civilians or service members who were nave for deployment ) were recruited through advertisements in veteran - related magazines and newspapers . tcs were matched for age , year , and region of deployment with the ptsd group and were excluded when they had a clinician - administered ptsd scale ( caps ) score of 18 or higher . hcs were matched for age with the ptsd group and were excluded when reporting significant psychotrauma in the past according to the caps . all control subjects were medically healthy males without a history of psychiatric disorders and without sleep complaints . written consent was obtained from all participants , after a complete written and verbal description of the study . the study was approved by the institutional review board of the university medical centre of utrecht , the netherlands . all veterans were screened for psychiatric illness using the structured clinical interview for dsm iv axis i disorders [ severe combined immunodeficiency ( scid ) ] ( spitzer , williams , gibbon , & first , 1992 ) . the diagnosis of ptsd ( assessed with the scid ) was confirmed by the caps ( blake et al . , 1995 ) and , e.v . ) . only patients with a caps score above 50 were included . trauma controls were included if they met the a1 criterion for ptsd ( the person experienced , witnessed , or was confronted with an event or events that involved actual or threatened death or serious injury , or a threat to physical integrity of self or others ) but had a caps score below 18 and did not meet dsm iv criteria for ptsd or any other life time axis i disorder . subjects were screened for medical conditions by history taking and physical examination . as a high bmi psg recordings were obtained during one night at kempenhaeghe , the netherlands , with brainlab real time , including electrooculography for vertical and horizontal eye movements , electromyography ( chin , left and right m. tibialis anterior ) , electrocardiography , and electroencephalography ( f0-c0 , f3-c3 , p3-o1 , c4-a1 , o2-a2 ) , airflow at the nose ( nasal pressure ) , movement of the thorax and abdomen by inductance plethysmography , and arterial oxygen saturation at the index finger . sleep data were analyzed according to criteria of rechtschaffen and kales ( 1968 ) by an experienced sleep technician who was blinded to group identity . apneas and hypopneas were scored when an airflow reduction of 50%90% ( hypopnea ) or > 90% ( apnea ) was detected for at least 10 seconds , except when such airflow reductions occurred after arousals or during wake . an ahi>15 per hour is the cutoff for obstructive sleep apnea syndrome ( epstein et al . , 2009 ) . an ahi>10 is also considered clinically relevant and used as an exclusion criterion in sleep studies ( engdahl , eberly , hurwitz , mahowald , & blake , 2000 ; mellman , nolan , hebding , kulick - bell , & dominguez , 1997 ) . we compared both indices between groups . in comparisons of mean caps scores between ptsd patients with and without osa , we used the cutoff of ahi>10 . an anova was used to test group differences when variables were normally distributed . in other cases , a non - parametric mann correlations were analyzed with a pearson 's test and were controlled for age and bmi . twenty - three male veterans with ptsd were recruited through the outpatient clinic of the military mental healthcare , utrecht , the netherlands . ptsd patients with habitual benzodiazepine usage ( n=1 ) and substance abuse were excluded ( n=2 ) . patients who used benzodiazepines , alcohol , or drugs weekly or monthly were instructed to refrain from these substances on the day of the sleep recordings . twenty - four trauma controls ( tcs ; veterans without ptsd ) and 17 healthy controls ( hcs ; civilians or service members who were nave for deployment ) were recruited through advertisements in veteran - related magazines and newspapers . tcs were matched for age , year , and region of deployment with the ptsd group and were excluded when they had a clinician - administered ptsd scale ( caps ) score of 18 or higher . hcs were matched for age with the ptsd group and were excluded when reporting significant psychotrauma in the past according to the caps . all control subjects were medically healthy males without a history of psychiatric disorders and without sleep complaints . written consent was obtained from all participants , after a complete written and verbal description of the study . the study was approved by the institutional review board of the university medical centre of utrecht , the netherlands . all veterans were screened for psychiatric illness using the structured clinical interview for dsm iv axis i disorders [ severe combined immunodeficiency ( scid ) ] ( spitzer , williams , gibbon , & first , 1992 ) . the diagnosis of ptsd ( assessed with the scid ) was confirmed by the caps ( blake et al . , 1995 ) and after consensus by two clinicians ( svl . trauma controls were included if they met the a1 criterion for ptsd ( the person experienced , witnessed , or was confronted with an event or events that involved actual or threatened death or serious injury , or a threat to physical integrity of self or others ) but had a caps score below 18 and did not meet dsm iv criteria for ptsd or any other life time axis i disorder . subjects were screened for medical conditions by history taking and physical examination . as a high bmi is associated with ahi , weight and length were determined . psg recordings were obtained during one night at kempenhaeghe , the netherlands , with brainlab real time , including electrooculography for vertical and horizontal eye movements , electromyography ( chin , left and right m. tibialis anterior ) , electrocardiography , and electroencephalography ( f0-c0 , f3-c3 , p3-o1 , c4-a1 , o2-a2 ) , airflow at the nose ( nasal pressure ) , movement of the thorax and abdomen by inductance plethysmography , and arterial oxygen saturation at the index finger . sleep data were analyzed according to criteria of rechtschaffen and kales ( 1968 ) by an experienced sleep technician who was blinded to group identity . apneas and hypopneas were scored when an airflow reduction of 50%90% ( hypopnea ) or > 90% ( apnea ) was detected for at least 10 seconds , except when such airflow reductions occurred after arousals or during wake . an ahi>15 per hour is the cutoff for obstructive sleep apnea syndrome ( epstein et al . , 2009 ) . an ahi>10 is also considered clinically relevant and used as an exclusion criterion in sleep studies ( engdahl , eberly , hurwitz , mahowald , & blake , 2000 ; mellman , nolan , hebding , kulick - bell , & dominguez , 1997 ) . we compared both indices between groups . in comparisons of mean caps scores between ptsd patients with and without osa differences between the groups were tested in spss 17.0 . an anova was used to test group differences when variables were normally distributed . in other cases , a non - parametric mann correlations were analyzed with a pearson 's test and were controlled for age and bmi . ptsd patients ( n=20 ) , tcs ( n=24 ) , and hcs ( n=17 ) did not differ in age or alcohol intake per week . the mean caps score was 67.50 ( sd=11.01 ) in ptsd patients and 4.00 ( sd=5.12 ) in tcs . ptsd patients ( n=18 ) had a higher bmi than both tcs ( n=20 ) and hcs ( n=16 ) ( respectively , 27.86 ( sd=4.86 ) ; 24.64 ( sd=2.90 ) and 23.65 ( sd=2.42 ) , ( anova f ( 2,51)= 6.66 , p<0.01 ) . demographic characteristics notes : bmi , body mass index ; hc , healthy controls ; m , mean ; ptsd , posttraumatic stress disorder ; sd , standard deviation ; tc , trauma controls . ptsd > tc , ( p=0.036 ) ; ptsd > hc , ( p=0.006 ) ; tc = hc , ( p=1.0 ) . ptsd = tc , ( p=0.16 ) ; hc < ptsd , ( p<0.001 ) ; hc < tc , ( p<0.001 ) . the ahi was higher than 15 in 10% of the ptsd patients , 13% of the tcs , and 12% of the hcs ( =0.07 , df=2 , p= n.s . ) . twenty - nine percent of the ptsd patients , 21% of tcs , and 29% of hcs had an ahi > 10 per hour ( = 0.60 , df=2 , p = n.s . ) . the mean ahi was 6.79 ( sd=5.58 ) in ptsd patients , 7.18 ( sd=6.50 ) in tcs , and 5.68 ( 5.91 ) in hcs ( anova , f ( 2,58)=0.32 , p = n.s . ) . the patients with an ahi>10 ( n=6 ) exhibited significantly higher caps scores ( m=77 , sd=9 ) than patients without osa ( m=63 , sd=9 ) ( n=14 ) ( mann whitney utest : z= 2.36 , p<0.05 ) . with a partial correlation , controlling for age and bmi , a significant relation between the caps and ahi was found in ptsd patients ( pearson , r=0.46 , p<0.05 , df=14 ) . the three subscales ( b , c , d ) of the caps were not significantly related to the ahi in ptsd . however , the correlation between the d - subscale ( hyperarousal ) and ahi was at trend - level significance in ptsd patients ( pearson , r=0.36 , p=0.08 , df=14 ) . relationship between apnea hypopnea index and ptsd severity . notes : ahi , apnea hypopnea index ; caps , clinician - administered ptsd scale ; ptsd , posttraumatic stress disorder . the mean nightmare score was 3.33 ( sd=2.56 ) in patients with osa ( ahi>10 , n=6 ) and 3.21 ( sd=2.29 ) in patients without osa ( n=14 ) ( anova , f ( 1 , 19)=0.1 , p = n.s . ) . similarly , there was no relationship between b2 score of the caps and ahi , when corrected for bmi and age ( pearson 's test r=0.076 , p = n.s , df=14 ) . ptsd patients ( n=20 ) , tcs ( n=24 ) , and hcs ( n=17 ) did not differ in age or alcohol intake per week . the mean caps score was 67.50 ( sd=11.01 ) in ptsd patients and 4.00 ( sd=5.12 ) in tcs . ptsd patients ( n=18 ) had a higher bmi than both tcs ( n=20 ) and hcs ( n=16 ) ( respectively , 27.86 ( sd=4.86 ) ; 24.64 ( sd=2.90 ) and 23.65 ( sd=2.42 ) , ( anova f ( 2,51)= 6.66 , p<0.01 ) . demographic characteristics notes : bmi , body mass index ; hc , healthy controls ; m , mean ; ptsd , posttraumatic stress disorder ; sd , standard deviation ; tc , trauma controls . ptsd > tc , ( p=0.036 ) ; ptsd > hc , ( p=0.006 ) ; tc = hc , ( p=1.0 ) . ptsd = tc , ( p=0.16 ) ; hc < ptsd , ( p<0.001 ) ; hc < tc , ( p<0.001 ) . the ahi was higher than 15 in 10% of the ptsd patients , 13% of the tcs , and 12% of the hcs ( =0.07 , df=2 , p= n.s . ) . twenty - nine percent of the ptsd patients , 21% of tcs , and 29% of hcs had an ahi > 10 per hour ( = 0.60 , df=2 , p = n.s . ) . the mean ahi was 6.79 ( sd=5.58 ) in ptsd patients , 7.18 ( sd=6.50 ) in tcs , and 5.68 ( 5.91 ) in hcs ( anova , f ( 2,58)=0.32 , p = n.s . ) . the patients with an ahi>10 ( n=6 ) exhibited significantly higher caps scores ( m=77 , sd=9 ) than patients without osa ( m=63 , sd=9 ) ( n=14 ) ( mann whitney utest : z= 2.36 , p<0.05 ) . with a partial correlation , controlling for age and bmi , a significant relation between the caps and ahi was found in ptsd patients ( pearson , r=0.46 , p<0.05 , df=14 ) . the three subscales ( b , c , d ) of the caps were not significantly related to the ahi in ptsd . however , the correlation between the d - subscale ( hyperarousal ) and ahi was at trend - level significance in ptsd patients ( pearson , r=0.36 , p=0.08 , df=14 ) . relationship between apnea hypopnea index and ptsd severity . notes : ahi , apnea hypopnea index ; caps , clinician - administered ptsd scale ; ptsd , posttraumatic stress disorder . the mean nightmare score was 3.33 ( sd=2.56 ) in patients with osa ( ahi>10 , n=6 ) and 3.21 ( sd=2.29 ) in patients without osa ( n=14 ) ( anova , f ( 1 , 19)=0.1 , p = n.s . ) . similarly , there was no relationship between b2 score of the caps and ahi , when corrected for bmi and age ( pearson 's test r=0.076 , p = n.s , df=14 ) . our study shows that the occurrence of osa in ptsd patients was 10% and was not increased compared with tcs and hcs , despite a higher bmi of ptsd patients . furthermore , we found a relationship between ptsd severity and the ahi , whereas nightmare frequency was not related to the occurrence of apneas . several studies reported high indices of ahi in 69%91% of the ptsd patients ( krakow et al . , 2001b , 2002 , 2004 ; yesavage et al . , 2010 ) . in these studies , screening instruments for detecting osa may have been more sensitive than in our study , especially because some studies defined a cutoff of five events per hour . as none of the previous studies included a control group , it can not be concluded that the incidence of osa is elevated in ptsd . another explanation for the high incidence of osa in some previous studies is that the usage of benzodiazepines was not discontinued before sleep recordings , which increases the occurrence of osa ( dolly & block , 1982 ) . in our study , participants with regular benzodiazepine usage were excluded , and participants with habitual benzodiazepine usage refrained from sleep medication in the sleep laboratory . lastly , our study group consisted of middle - aged veterans , whereas other studies included predominantly female ptsd patients . the incidence of osa may be different in other populations with ptsd . our study underlines the importance of controlled studies to determine whether osa is more prevalent in ptsd than in matched controls . although controlled studies have not been published on this subject before , our results are in concordance with two sleep studies in ptsd patients , which excluded an equal amount of patients and controls due to osa ( breslau et al . in contrast , engdahl et al . ( 2000 ) reported that in a sample of elderly war veterans , more ptsd patients were excluded due to osa than controls . in our study , furthermore , ptsd patients with an ahi>10 exhibited significantly higher caps scores compared with ptsd patients without osa . this may be due to decreased concentration , depression , and irritability that are common complaints in osa ( saunamki & jehkonen , 2007 ) . also , previous studies have suggested a relationship between ptsd complaints and the occurrence of osa . in the study of engdahl et al . ( 2000 ) , four ptsd patients with osa improved on overall well - being after treatment with continuous positive airway pressure ( cpap ) . the relationship between remitted osa and improvement of ptsd severity was also found in an uncontrolled retrospective study on cpap treatment in ptsd patients ( krakow et al . , 2000 ) . this contrasts with a study in which breathing interruptions , as witnessed by bed partners , were related to nightmare frequency in ptsd patients ( de groen et al . , 1993 ) . reports from the bed partner are less reliable for detecting osa than polysomnography that was used in the current study . possibly , bed partners of patients with nightmares are more alert during the night and therefore better aware of breathing interruptions . therefore , breathing interruptions may be more frequently reported in patients with nightmares in the study of de groen et al . the incidence of osa in ptsd patients was 10% in our study ; however , this can not be generalized . furthermore , the power for detecting correlations between osa and symptom clusters of ptsd may have been too low . in summary , our results indicate that ptsd is not necessarily associated with the occurrence of osa , as some uncontrolled studies suggested . furthermore , osa was not related to sleep complaints , while patients with comorbid osa exhibited higher caps scores . larger controlled studies in different populations need to be performed to provide more reliable estimations of the incidence of osa in ptsd . as comorbid osa in ptsd patients may possibly lead to an increase in ptsd symptoms , the influence of osa , and treatment of osa , should be further explored , especially in those with refractory complaints to conventional therapeutic strategies . there is no conflict of interest in the present study for any of the authors .

backgroundobstructive sleep apnea ( osa ) may be highly prevalent in posttraumatic stress disorder ( ptsd ) and may exacerbate ptsd complaints.objectiveour objective was to determine whether the prevalence of osa was high in a sample of dutch veterans with ptsd as compared to age- and trauma - matched controls , and whether osa was associated with more severe ptsd complaints.methodswe determined the apnea hypopnea indices ( ahi ) with polysomnographic registrations in 20 veterans with ptsd , 24 veterans without ptsd , and 17 healthy controls . ptsd severity and nightmare complaints were assessed with the clinician - administered ptsd scale ( caps).resultsthe prevalence of an ahi>10 was 29% in ptsd , 21% in trauma controls , and 29% in healthy controls ( 2= 0.60 , df=2 , p = n.s . ) . the mean caps score in patients with osa ( n=6 ) was significantly higher than in patients without osa ( p<0.05 ) , while nightmare severity was similar in ptsd patients with osa as compared to ptsd patients without osa ( p = n.s . ) . furthermore , there was a significant correlation between ahi and caps score in ptsd patients ( r=0.46 , p<0.05 , df=14).conclusionsour results indicate that ptsd is not necessarily associated with a higher prevalence of osa . however , ptsd severity was related to osa , which may possibly mean that comorbid osa leads to an increase in ptsd complaints . however , future research should indicate whether osa exerts a negative influence on ptsd , and treatment of osa alleviates ptsd symptoms .

a 25-year - old male patient without significant personal or family medical history was admitted to the dermatology department suffering from primary syphilis . he was a heterosexual man and the infective sexual contact was approximately five weeks before hospitalization . he started the specific treatment with benzathine penicillin 2.400.000 iu followed by the discharge from the hospital , as he tolerated the first doses of penicillin very well , without jarish - herxheimer reaction following the initiation of the antibiotic . after ten days the patient returned to the emergency department having an altered general condition , low - grade fever , loss of appetite , vomiting , oliguria , generalized edema , and lumbar pain . during the medical examination we noticed pale skin , renal type generalized edema , dull pain radiating to the flanks , tender kidneys on palpation , and left side inguinal lymphadenopathy . the investigations revealed the following abnormalities : erythrocyte sedimentation rate 100 mm / h , fibrinogen 720 mg / dl , positive reactive c protein ; hypoproteinemia 5 g / dl ; hypercholesterolemia 371 mg / dl ; hyperlipidemia 1,168 mg / dl ; renal impairment : urea 64 mg / dl and creatinine 1.87 mg / dl ; hepatic cytolysis : aspartate transaminase 77 iu / l ; alanine transaminase 75 iu / l with increase of alkaline phosphatase 324 iu / l ; circulating immune complexes 42 iu / l . the urine examination showed proteinuria 12 g/24h , microscopic hematuria with dysmorphic red blood cells , and cylindruria hyaline cylinders . examination showed in the coronal sulcus presence of ulceration with indurated basis and satellite inguinal lymphadenopathy . the clinical examination was completed by the specific serological investigations that were intensely positive : vdrl++++ ( venereal disease research laboratory ) ( dilution 1/4 ) , positive rpr ( rapid plasma reagin ) , and tpha++++ ( treponema pallidum hemagglutination assay ) . the final and reviewed diagnosis was made : early secondary syphilis with the persistence of the primary chancre , associated with syphilitic glomerulonephritis with nephrotic syndrome and hepatic involvement . since the secondary stage of syphilis starts around ninth week after infection and as our patient had visceral involvement , although no exanthemas or enanthemas had been found clinically , we felt that this was an early stage of secondary syphilis and that the persistence of ulcus durum would be consistent with this stage . treatment with penicillin 2.400.000 iu / day was started with oral steroid therapy , prednisone 1 mg / kg / day , and correction of the hypoproteinemia ( human albumin perfusions ) and diuretics ( furosemide and spironolactone ) were initiated . after the first 10 days of treatment we noticed a favorable clinical progress : improvement of the general condition , the disappearance of the low - grade fever and of the edema , the normalization of urine volume , the remission of lymphadenopathy , and the epithelialization of the primary chancre . at the time of discharge from the hospital we noted proteinuria < 0.5 g/24h without hematuria , the acute renal impairment had disappeared , hepatic tests had settled , and that the specific syphilis serological tests were also improved , vdrl + + ( dilution1/2 ) and tpha + + + . after the patient was discharged from the hospital , he continued the treatment with benzathine penicillin 2.400.000 iu / week ( for two weeks ) and prednisone in reducing doses with regular monitoring of the urine and renal tests . at 2-month follow - up the proteinuria was absent . at 6-month follow - up vdrl was negative and tpha + + had improved , remaining positive . the serological and urine tests monitoring continued every three months in the first year and every six months in the second year . after two years tpha + + was still positive but vdrl and rpr remained negative . this rare case is interesting from the nephrologic point of view due to the rare systemic involvement of the kidneys during the syphilis infection , leading to the presentation of membranous glomerulonephritis . for dermatologists , it is important to keep in mind the possibility of early and multiple visceral involvement of syphilis that sometimes can be severe but with a rapid favorable evolution with supportive treatment .

we present an unusual case of syphilis that despite starting treatment with penicillin has evolved with renal complications . due to glomerulonephritis with nephrotic syndrome the case required shared care between the renal physician and dermatologist . doctors of different specialties need to keep in mind that early syphilis can have visceral involvement and patients might need prompt , specific therapeutic intervention .

since the discovery of tfiih in the early 1990s by the laboratory of jean - marc egly 54 , tfiih has been the object of extensive research , with studies ranging from structural analyses of the complex to in vitro and in vivo molecular and biochemical evaluations of its functions in transcription and dna repair . ten proteins organized in two subcomplexes form the tfiih complex . among these proteins , two dna helicases / atpases , one of which is also a dna translocase , a putative e3 ubiquitin ligase and a cyclin - dependent kinase have been identified 2 . however , most of the tfiih subunits are considered to be regulatory or structural components 3 . the inhibition of some of the tfiih enzymatic activities has been demonstrated to be effective in cancer treatment 20,41 . interestingly , recent advances in the solution of the tfiih complex organization increase the possibility of designing drugs that interfere with the functions of tfiih . thus , this review will describe recent discoveries on how tfiih operates in transcription and dna repair and how tfiih is becoming an important target for cancer therapy . tfiih 's subunits are organized into two sub - complexes : the cak and the core , which interact to form the holo - tfiih complex that is involved in transcription 1 . the cak contains the cyclin - dependent kinase cdk7 , cyclin h and mat1 subunits , which operate in cell cycle control 2,3 . the core is composed of xpb , a 3-5 dna helicase / atpase , which is also a dna translocase , xpd , a 5-3 dna helicase / atpase , p44 , a putative e3 ubiquitin ligase , and the structural subunits p62 , p52 , p34 and p8 4 . the core of tfiih plays a determinant role in nucleotide excision repair ( ner ) 5 . in addition , it has been suggested that xpd modulates the role of the cak in cell cycle control in an intermediary xpd - cak complex 6 ( fig . further , the xpg protein was demonstrated to interact with xpb , xpd and p62 and copurifies with the holo - tfiih , suggesting that it could be another component of tfiih 7 - 10 . on the other hand , the xpd subunit is also a component of the human mmxd complex , which is required for chromosome segregation and is not related to transcription or dna repair 11 . however , it is still unknown if the enzymatic activities of xpd helicase / atpase are necessary for the function of mmxd in chromosome segregation during mitosis . moreover , the possibility of other subunits of tfiih , besides xpd , being a part of other protein complexes still is open . several protein - protein interactions among the components of tfiih have been identified by different approaches . although the crystallographic structure of some subunits and the global architecture of tfiih has been determined using high - resolution cryo - electron microscopy 10,12,13 the interaction network in the 10-subunit complex has been recently described using chemical cross - linking combined with mass spectrophotometry and previous high - resolution electron microscopy data . this integrative analysis showed that the p34/p44 heterodimer represents a central " submodule " that connects the other core subunits . the vwa domains of p34 and p44 were shown to contact each other at multiple sites . furthermore , xpd and xpb contact each other and both interact with p44 , as well as with mat1 , which anchors cdk7 and cych 10 . in addition to the previously reported interactions between xpb and p52 and between p8 and p52 , this analysis shows that the p8/p52 heterodimer directly interacts with xpb and p8 does not contact xpd , as was previously suggested 5,10,14 . this detailed model of the tfiih architecture could be useful to search for drugs that affect the interface between the different subunits through in silico modeling approaches . there is a relationship between mutations in some of the tfiih subunits and three human syndromes associated with dna repair and transcriptional deficiencies . most of the tfiih - affected patients show mutations in the xpb and xpd subunits , which are linked to xeroderma pigmentosum ( xp ) , cockayne syndrome ( cs ) and trichothiodystrophy ( ttd ) 7 . however , the different mutations described in the p8 subunit in humans have only been related to ttd - a 5 . photosensitivity is a clinical feature among all these diseases , other manifestations are shared in a less extent and some others are syndrome - specific ( fig . 2 ) . for example , xp patients affected in xpd or xpb can develop skin cancer , but ttd patients with different mutations in the same genes are not cancer prone . on the other hand , anomalies in the hair , nails and skin are hallmarks in ttd patients . in agreement , recent studies demonstrated a correlation between skin defects and alterations in the levels of collagen types i and vi in the extracellular matrix ( ecm ) of primary dermal fibroblast and skin from ttd patients 15,16 . orioli and colleagues demonstrated the transcript down - regulation of the col6a1 gene ( which encodes for the collagen type vi alpha1 subunit ) in skin fibroblasts from xpd - affected ttd patients 16 . on the other hand , transcript overexpression and high protein levels of the active form of the matrix metalloproteinase 1 ( which degrades the interstitial collagen from the ecm ) and concomitant low levels of collagen type i were detected in primary dermal fibroblast and skin from several different tfiih - affected ttd patients , when compared with fibroblast from tfiih - affected xp patients or healthy normal donors 15 . in addition , differential alterations in the tfiih assembly at the rarb2 promoter , tfiih enzymatic activities and chromatin remodeling were revealed by the analysis of the transcriptional role of tfiih in several cell lines bearing mutations in xpb , xpd or p8 . interestingly the strongest defects were observed in cell lines carrying point mutations in the n - terminal domain of xpb found in ttd or xp / cs patients , while point mutations of the p8 show no effect on any of the steps analyzed 17 . strikingly , the study of the phenotypes of these patients in relation to the identification of the molecular nature of the mutations that they carry in these genes have been very useful to understand how tfiih works and reciprocally , to understand these syndromes . an enigmatic question that rises from the analysis of the manifestations in the patients afflicted in xpb , xpd and p8 is why these individuals only present very specific phenotypes even that tfiih is required for three fundamental cellular functions ? although we still do not have a conclusive answer for this question , we know that the described mutations from these patients are not null and only partially affect the tfiih functions , making these defects in tfiih compatible with life 4,18,19 . cell cycle . as mentioned before components of tfiih participates at least in three functions in the cell . the cak has a central role in the activities of several cdks that control cell cycle 2 . also it phosphorylates cdk2 to promote the entrance for s to g2 phases and cdk1 to conduct g2 to mitosis 3 ( fig . cak subunits as the case of the rest of tfiih are expressed constitutively during g1 in all cells , it is always active and seems to be very promiscuous in the phosphorylation of the cdks that control the cell cycle which are modulated by specific cyclins . therefore , the cak is more like a supported factor for the control of the cell cycle than a regulator . it will be interesting to use the new cdk7 inhibitor tzh1 20 , which is very specific to see how the cell cycle is affected when the catalytic activity of cdk7 is inhibited . ner removes helix - distorting dna lesions that include cyclobutane pyrimidine - pyrimidine dimers and pyrimidine - pyrimidone ( 6 - 4 ) photoproducts . two pathways recognize this type of dna damage : transcription coupled - ner ( tc - ner ) in the actively transcribed dna strands and global genome - ner ( gg - ner ) in the non - transcribed dna sequences . in tc - ner , the rna polymerase , which is stalled in the presence of a bulky lesion , recognizes the dna damage . in gg - ner , depending on the dna - damaging agent , the protein complex rad23b - centrin 2 or xpe recognizes the bulky dna lesion . in any case , the dna damage recognition step is followed by the recruitment of the ner machinery , including tfiih , which unwinds the dna by the atpase and helicase activities of xpb and xpd , respectively , the xpa and rpa proteins that stabilize the dna repair bubble , and the endonucleases xpf - ercc1 and xpg , which remove a segment of 23 - 27 nucleotides from the damaged dna strand , which is ultimately refilled by the dna replication machinery 21 - 23 ( fig . it was initially proposed that after tfiih recruitment , the cak subcomplex dissociates from the core in an xpa - dependent manner 24 . new data suggest that the holo - tfiih scans the dna through its xpb and xpd helicase / atpase activities , which are inhibited by bulky dna lesions . then , tfiih is stalled in the damaged dna region , followed by the ejection of cak from the core 25 . however , in vivo experiments are required to confirm this model . tfiih participates in transcription mediated by rna polymerases i and ii ; however , our understanding of the role of tfiih in rnapi transcription is still obscure . since the first report by grummt and elgy 's groups in 2002 , which demonstrated that tfiih is dispensable for the initiation of rnapi transcription but required for rrna elongation 26 , only a few studies about the role of tfiih in rnapi - mediated transcription have been published . for example , it has recently been reported that tfiih binds to rnapi after the initiation of transcription . in agreement , the atpase activity of xpb is required during rrna elongation , and cs - related mutations in xpb and xpd disturb the interaction between tfiih and rdna , which affects elongation but not transcription initiation 27,28 . in addition , it has been suggested that the ner - related proteins csb and csa form a complex with tfiih in the nucleolus , which is necessary for rdna transcription 29,30 . however , more extensive studies have been performed to elucidate the role of tfiih in rnapii transcription . during the pre - initiation complex ( pic ) while the enzymatic activities of xpd are dispensable for rnapii transcription , the atpase activity of xpb is required for the unwinding of 11 bp in the promoter during the formation of the open complex 32,33 . instead , xpb tracks the dna in a 5-3 direction and translocates the downstream dna into the cleft region of the rnapii , which generates the dna unwinding and allows the recognition of the transcription initiation start site in a process that requires the continuous hydrolysis of atp by xpb 33 . in addition , the current pic structure model shows that xpb binds downstream of the initiator site and contacts both dna strands in the promoter 13 . then , the function of xpb in transcription relies on its translocase activity , and this mechanism is a rate - limiting step in the initiation of transcription . the other major function of tfiih in rnapii transcription takes place through its kinase activity . the kinase module phosphorylates serines 5 and 7 ( s5 and s7 ) of the heptapeptide repeat ( consensus sequence : y1s2p3t4s5p6s7 ) in the ctd of the largest subunit of rnapii . it has been established that s5 phosphorylation is fundamental for transcription initiation and promoter clearance 35 . however , the in vitro inhibition of the kinase activity of cdk7 by the cdk7-specific inhibitor thz1 ( see ahead ) had no effect on transcription initiation and promoter realese , but preferentially affected the pausing of the rnapii after the synthesis of 30 - 50 nucleotides 36 . furthermore , the phosphorylation of s5 by cdk7 is important for the recruitment of the pausing factors , the negative elongation factor ( nelf ) and the drb - sensitive factor ( dsif ) , as well as the capping enzyme that guanylates the 5end of the nascent transcript , a process that requires pausing 37 . however , more recent in vivo experiments in budding yeast show that by using an engineered kin28 ( cdk7 in yeast ) that can be specifically and irreversible inhibited , affect promoter scape as well as rnapii elongation 38 . intriguingly , in the absence of s5 phosphorylation of the ctd , the rnapii is paused after the transcription initiation site 38 . then these recent reports , one in vitro 36 , and the other in vivo 38 using the budding yeast about the role of the cdk7 on rnap ii transcription initiation and elongation partially disagree . it will be relevant to perform similar experiments as the reported in yeast , but in human cells . on the other hand , it has been demonstrated that mutations in kin28 reduce the dissociation of the mediator from the pic , which affects the escape of the rnapii to initiate mrna elongation 39 . therefore , all of these new data and models on how tfiih operates in transcription in vitro must be integrated with the in vivo results . it is well established that cancer cells require high levels of transcription to survive and to maintain their malignant phenotype 40 . therefore , the components of the basal transcription machinery could be considered good targets to reduce global transcription , and they might have stronger effects in cancer cells when compared with non - cancerous cells ( reviewed in 39 ) . a very promising drug for the treatment of many cancer types is triptolide ( tpl ) . extracts from this plant have been used for centuries in traditional chinese medicine , and preclinical studies have shown high effectiveness against cancer due to its very strong anti - proliferative effect and apoptosis induction . tpl binds covalently to the atpase domain of xpb , inhibiting both rnapii transcription and ner 41 . although other tpl targets have been proposed , structural and biochemical data show that it is very specific for xpb , and intriguingly , the treatment of drosophila imaginal discs with tpl phenocopies the defects observed in different tfiih mutant subunits in the fly 41 - 43 . rna - seq and dna microarray analyses from tpl - treated cancerous cells have shown the down - regulation of nearly all the rnapii - dependent transcripts 44,45 ; however , comparative studies at this level between cancer cells and their progenitors are required . tpl is not highly permeable to the cell membrane , and it is hepatotoxic 46 . to overcome these inconveniences in cancer therapy , more permeable and potentially less toxic tpl derivatives have been developed , although it will be important to demonstrate that they are as effective as tpl to kill cancer cells 41 . based on structural analysis predictions , other drugs have been developed to specifically target the enzymatic functions of tfiih . for example , the antitumor drug bs-181 is a pyrazolo [ 1,5-a ] pyrimidine - derived compound that inhibits the phosphorylation of cdk7 targets , inducing cell cycle arrest and apoptosis 45 . more recently , it was shown that thz1 is a phenylaminopyrimidine with a cysteine reactive acrylamide moiety that covalently binds to the cysteine 312 located outside of the catalytic domain , making thz1 very specific for cdk7 20 , although it inhibits cdk12 at very high concentrations and after long incubation times 36 . approximately 1000 cancerous cell lines tested were very sensitive to nanomolar concentrations of thz1 , particularly t acute lymphoblastic leukemia cells 20 . intriguingly , gene - specific effects in transcription were observed in different cell lines after the thz1 treatment 20,47,48 . for example , the expression of runx1 , a transcription factor associated with leukemia and whose expression is modulated by a super - enhancer , was highly sensitive to thz1 20 ( fig . 3 ) . similarly , thz1 affects the expression of genes controlled by super - enhancers , particularly myc , as well as lineage - specific transcription factors required by the maintenance of the cancerous phenotype in lung cancer cells 47,49 ( fig . however , a new study showed a high potential for thz1 in the treatment of triple negative breast cancer ( tnbc ) tumors 50 . tnbc cells were substantially more sensitive to thz1 when compared to er / pr ( positive for the estrogen receptor ) tumor cells . interestingly , some sets of genes that encode for signal transduction and transcription factors related to breast cancer , such as tgf , stat , egfr , and wnt , among other genes , were affected ; these genes were named the achilles cluster of tnbc , and their expression is also regulated by super - enhancers 50 . therefore , it seems that genes modulated by super - enhancers , which are large regions of dna that accumulate large quantities of transcription factors 48 and are directly involved in the cancerous phenotype , may be more sensitive to thz1 20,47,49 ( fig . analog named thz2 is more stable than thz1 and has an improved effect on cdk7 inhibition 50 . another recently identified tfiih inhibitor is spironolactone ( sp ) , which induces the proteasome - mediated degradation of the xpb subunit and enhances the effect of platinum derivatives in cancer cells 51 . the effect of sp in tumor cells from different origins should be analyzed to determine whether it also preferentially kills malignant cells . twenty - five years after the discovery of tfiih , we have a more comprehensive view of the mechanisms of different functions of tfiih ; however , there are still many questions that must be answered . although we understand when the enzymatic activities of tfiih are required and the identities of some of their substrates , it is highly possible that other targets will be discovered . tfiih exhibits crosstalk with the mediator 52 which may be modulated by tfiih and vice versa ; however , this intercommunication is not clear . the role of the other subunits of the core that lack enzymatic activities may be modulators of tfiih activity , as p52 regulates the atpase activity of xpb . in addition , p38 and p62 have protein domains that suggest dynamic interactions with the other subunits of the core , and we believe that the complex is not static and exhibits strong internal dynamics . however , important questions remain ; for example : is p44 really a ubiquitin ligase , and if so , what are its targets ? is p8 a real stabilizer of the complex , or does it have a regulatory role in the xpb atpase activity ? is the cak subcomplex required for rdna transcription even if the rnapi lacks a ctd domain such as the one present in rnapii ? in addition , the fact that two promising drugs for the treatment of cancer exhibit target subunits of tfiih suggests that new small molecules may be found that inhibit tfiih but recognize other subunits besides xpb and cdk7 . furthermore , because we understand in detail the regions of each of the 10 subunits of tfiih that interact , it is possible to search for small molecules that interrupt the interface of these interactions and affect the assembly of tfiih and therefore , its functions ( fig . in fact , a new antibiotic that inhibits the interaction between a mediator subunit with a transcriptional activator and that preferentially kills a pathogen fungus has recently been identified 53 . a similar approach may be used to look for new inhibitors of tfiih . on the other hand , a challenging problem for the development and use of drugs that target nuclear factors is to increase the permeability of these compounds in the nucleus . the treatment with tpl or thz1 cause an important reduction in transcription in cancer cell lines , showing that an important amount of these molecules permeates the nuclear membrane 4,44,45 , however more precise experiments with animal models are needed . in addition , new methods to increase the efficiency to deliver new drugs to the nucleus still have to be developed . in conclusion , further studies of tfiih should explore how the complex works at high resolution in transcription and dna repair , how defects in tfiih affect development , and why it is an important target for cancer therapy .

the deregulation of gene expression is a characteristic of cancer cells , and malignant cells require very high levels of transcription to maintain their cancerous phenotype and survive . therefore , components of the basal transcription machinery may be considered as targets to preferentially kill cancerous cells . tfiih is a multisubunit basal transcription factor that also functions in nucleotide excision repair . the recent discoveries of some small molecules that interfere with tfiih and that preferentially kill cancer cells have increased researchers ' interest to elucidate the complex mechanisms by which tfiih operates . in this review , we summarize the knowledge generated during the 25 years of tfiih research , highlighting the recent advances in tfiih structural and mechanistic analyses that suggest the potential of tfiih as a target for cancer treatment .

recognition of the existence of the entity later described as thyroid - stimulating hormone ( tsh ) was first evident in the late 19th century . in the late 1960s and early 70s , academic immunoassays were developed and though initially cumbersome in use and somewhat insensitive , were quickly adopted as a diagnostic tool chiefly for determination of the hypothyroid state . from the mid 1980s to 1990s , steady developments in both convenience and sensitivity have so refined tsh assays that the concentrations of the hormone in subjects with normal thyroid function or with thyroid diseases are now readily quantifiable . with the introduction of the third generation of commercial tsh assays into clinical routine diagnosis , mu / l , allowing a clear - cut discrimination of the normal thyroid state from both hypothyroidism and hyperthyroidism . in the present paper , we address the current use of tsh as the dominant parameter in thyroid function testing , explain some major limitations of this approach , and attempt to suggest areas of possible improvement . the fact that tsh is a measure of regulatory control with widely varying set - points among individuals rather than an outcome variable with a tight uniform range has various consequences for the statistical interpretation of this parameter , which differs sharply from other laboratory values . this , in turn , has further diagnostic , therapeutic , and prognostic implications that will be discussed . improvements seem possible by respecting the regulatory individuality that is inherent in the parameter , as opposed to a population - based statistical use , and by advancing an understanding of the regulatory process and the interrelationship of tsh with circulating free thyroid hormones . based on the methodological advances in tsh determination , the parameter has progressively evolved from its early adoption as an adjunct to the measurement of thyroid hormones to an exclusive parameter in its own right and consequently now dominates thyroid function testing . they have attributed various roles to tsh measurement as a screening tool , a therapeutic target in thyroid hormone treatment , and a prognostic marker [ 512 ] . with current disease classification based on tsh , this has introduced the subclinical states of hyperthyroidism or hypothyroidism that are defined by an abnormal tsh value in the presence of ft4 and ft3 values that still lay within their respective reference limits . while this approach has been successful in many ways , it has also shifted the focus of tsh from its reactive and interactive role with thyroid hormones to an exclusive statistical parameter whose value is assumed to define the functional state of the subject . the present paper attempts to address some of the consequences of this paradigm shift and to assess some future perspectives for clinical decision - making . while most problems of tsh measurement have been successfully resolved from the point of view of assay development and the analytical goals have been well defined , important issues that relate to the clinical application of the method still remain unsettled . the assay performance does not resolve the problem that the immunological activity of tsh determined by the methods may not equate fully with its bioactivity . this is important to note , because the bioactivity of tsh is subject to some variation depending on the level of thyroid function . this is a result of changes in carbohydrate content of the tsh molecule that is effected by the shift in function from hypothyroidism to hyperthyroidism . clinically , however , a slight dissociation between immunological and biological activity appears of minor significance , and there are currently no alternatives available to the immunoassays for routine clinical purpose . this is less of a problem than the very basic question of what constitutes an agreed reference range . there has been a broad debate on the issue , particularly the setting of the upper reference limit , in which some authors argue for a wider reference range of approximately 0.3 to 4 mu / l and others advocate a more narrow interval with an upper limit of 2 it has also been pointed out that normal ranges and reference ranges are not necessarily to be considered as equivalent . importantly , tsh values are not normally distributed in a population , rather displaying a pattern of logarithmic normalisation and a skewed distribution . the latter findings have been questioned by arguing that if subjects with subtle thyroid disorders are included in the reference population , this may have distorted the observed normal distribution . however , even when disease - free reference collectives were used , the disagreements still remain [ 22 , 23 ] . solely for illustration of the problem , but not for the support of assay validation per se , we have depicted the distribution of log tsh values that were obtained in a sample of euthyroid subjects ( figure 1(a ) ) . the log transformation is generally required , because tsh values are not normally distributed ( figure 1(b ) ) . for comparison , the normal distribution that was randomly generated from the mean and standard deviation of the sample the issue arises from the apparent distortion observed at the upper region of the tsh spectrum that has been frequently described , but not convincingly explained [ 2123 ] . if one were to attribute the discrepancy to diseases such as unrecognized thyroid autoimmunity , a case could be made to adjust the spread of the normal distribution and consequently lower the upper reference limit . this is , however , not agreed nor is the reference interval [ 1625 ] . the seemingly simple question of the disputed reference interval has far - reaching ramifications , which have been shown for instance in a study by vlzke et al . . employing a reference range established in their own investigation , according to the manufacturer 's recommendation or as suggested by a us study , the authors reported a dramatic change in disease prevalence , from 7.7% to 24% in the case of diagnosed hypothyroidism and 0.8% to 3% for hyperthyroidism . this illustrates the grave consequences of the disagreement about tsh reference intervals that may result in clinical misclassification of a large proportion of patients . a way out of the dilemma posited above could be envisaged by prospectively correlating tsh measurements to clinical outcome measures . there have indeed been a number of studies that relate a tsh screening value to various future events such as cardiovascular disease , particularly atrial fibrillation , osteoporosis , psychiatric disorders , and mortality [ 2730 ] . however , while the statistical diagnostic approach may be appropriate on a large scale in a population study , it appears unsuitable for guiding clinical decisions in an individual patient . andersen and colleagues found the thyroid hormone concentrations in normal subjects to vary much less in an individual than in the population . given the magnitude of this variation of up to 50% , the distinction between a normal and pathological value can not rely on the population - defined reference , but has to account for the individual patient 's normal set point within the individual laboratory 's reference range . the high ratio of interindividual to intraindividual variability conflicts with any efforts to define a universally applicable clear cut - off and considerably limits the usefulness of the population - based reference values for clinical decision - making . the figure shows the distribution of log tsh in 150 euthyroid subjects that resembles the reference range in a population and , for comparison , the distribution that results when reducing the standard deviation by 50% , which equals the spread of a normal intraindividual distribution according to andersen et al . . the movement of the narrow bell - shaped curve within the broader bell curve reflects the uncertainty about true normality that is inherent in the application of a population - based tsh reference system . this uncertainty on an individual basis exceeds by far that of many other laboratory parameters . consequently , this makes the need for an individualised approach towards thyroid function testing more compelling than in other conditions of the subjects . another limiting factor is the significant fluctuation of the tsh levels over the course of time , which has been reported to occur in subclinical hypothyroidism . the tsh value has , therefore , to change by at least 30% to discriminate between a natural variation and a real progression . additional influences such as gender , age , or time of sampling are less pronounced . also , in predictive long - term studies that have relied on a single initial tsh value this may not be an integer of the thyroid function status over the whole time period , but subject to change , as the dysfunction could have worsened or improved since the measurement was obtained . conditions that directly alter or interfere with the reliability of thyroid test results such as severe nonthyroid illness , pregnancy , severe renal insufficiency , and pituitary disorders are another topic . the issue of thyroid hormone measurement in pregnancy has only recently been addressed by two updated guidelines issued by the american thyroid association in conjunction with the american society of clinical endocrinologists and independently by the endocrine society following one year earlier pregnancy - specific guidelines [ 5 , 36 , 37 ] . pregnancy exemplifies a choice between ft4 measurement and reliance on measuring total t4 ( tt4 ) , corrected for transport proteins , predominantly tbg . the new guidelines tend to favour tt4 measurement over ft4 methods , with one of them making this an explicit recommendation . ft4 immunoassay measurement has historically been perceived as inaccurate in pregnant women by many authors [ 5 , 36 , 37 ] . however , when scrutinized more closely , the assumption of a superiority of a tt4-tbg combination in pregnancy compared to ft4 , despite acknowledged limitations in assay validation , does not hold true . in pregnancy , a combination of tbg and tt4 confers a variation to the reference range that is by far greater , compared to direct ft4 measurement , and therefore less accurate in defining the normal range in this situation in a patient . spreads can be compared by the standardized variation ( sd / mean ) or the ratio of the 97.5 percentile to the 2.5 percentile of the range . in one study , when calculating the values on the basis of the generally accepted ranges for the parameters , the ratio was 3.0 in tt4 and only 2.4 in ft4 [ 38 , 39 ] . the smaller spread for ft4 suggests that the tt4 reference range is compromised by uncorrected tbg variation . since tbg values are higher in pregnancy , the effect of their variation has a greater impact in this condition , but it is equally true for the nonpregnant situation . hence , the choice here is between measurement of tt4 , which is clearly diagnostically inferior , or ft4 , which sometimes lacks careful validation among different manufacturers as a prerequisite to its adequate use . the general reliability of ft4 results obtained with the assays during pregnancy has , however , been verified by comparison with equilibrium dialysis id - lc / tandem ms candidate reference measurement . we would prefer an ft4 method applied with methodological rigor and careful attention to range setting and consider the novel recommendation to measure tt4 in pregnancy an ill - advised backward step , apart from practical considerations that most routine laboratory by now have wide experience with ft4 assays , but not tt4 . ft4 should be used in conjunction with tsh , and interpretation in pregnancy must be based on gestation time - specific reference intervals of the two parameters and with recognition of variability in assay performance [ 5 , 37 , 38 , 41 ] . a lack of availability and clinical experience currently limit the use of novel mass - spectrometric ( lc - ms / ms ) techniques [ 37 , 42 ] . though inconsistency of assay performance is a recognised obstacle to optimal diagnostic protocols , a full discussion of assay validation is beyond the scope of this paper [ 43 , 44 ] . although the limitations of the current use of tsh measurement have been well documented and subject to a number of excellent reviews , we generally lack suggestions as to how to improve clinical management strategies . obviously , a desirable aim would be to move from a population - based statistical perspective to a more personalised approach . while , to an extent , this seems to be what we aim at in good clinical practise when considering the whole picture including laboratory tests , clinical examination , and subjective well - being of the patient , it does not appear to be adequately reflected in current evidence - based guidelines . we conclude that advances in assay techniques have unduly promoted tsh measurement to its current role as an exclusive statistical estimate in its own right and the most important single parameter in thyroid function testing , thereby optimising both convenience and cost . however , the predominant use of tsh as a statistical parameter has some severe shortcomings that limit its clinical usefulness in a given patient . a revision may be needed to reconcile tsh measurement with the challenge of not only evidence - based but personalised medicine . from a physiological perspective , tsh is not an isolated player , but an integrated part in a complex system of thyroid homeostasis . thyroid homeostasis is maintained by the negative feedback that is given by the peripheral concentrations of the hormones ft4 and ft3 to regulatory centres in the hypothalamus and pituitary gland that govern thyroid hormone production via the adjusted release of a thyroid - stimulating hormone ( tsh ) into the circulation . a better understanding of thyroid hormone homeostasis including the role of tsh in the context may therefore aid in improving the diagnostic reliability of tsh measurement from both a methodological and clinical perspective . modern thyroid function testing has the danger of exploiting tsh feedback out of context and has replaced the endpoint - based definition ( measuring ft4 and ft3 ) by a tsh - centred protocol , as discussed above . this paradigm shift has made interpretation of test results seemingly easy . from a homeostatic perspective , however , dysfunctional states , such as hypothyroidism or hyperthyroidism present adaptive challenges to the homeostatic system that result in a complex and concerted pattern of actions to restore euthyroidism or at least ameliorate the situation . this approach sees tsh as an integral part of the homeostatic system rather than a separate or even dominant determinant . attempts have been made to adopt physiological insights into thyroid homeostasis for medical decision - making . some authors have developed fundamental mathematical models of thyroid homeostasis ; others have exploited the interplay of ft3 , ft4 , and tsh to reduce the wide spread of exclusive tsh measurements [ 4548 ] . earlier studies have shown that ft4 has a relatively more pronounced influence on pituitary tsh secretion than does ft3 . this is somewhat paradoxical , because ft3 is the more biologically active hormone of the two , and t4 only gains its activity following its deiodination , a process known as conversion and regulated by various deiodinases . the phenomenon has been explained by the specific properties of pituitary deiodinase type 2 which allows efficient conversion to continue with high ft4 concentrations at the central levels , whereas a downregulation of the enzyme occurs in peripheral tissues . the natural relationship between tsh and ft4 has been widely assumed to be both universal over the whole thyroid function spectrum and log linear [ 5053 ] . a recent study has challenged this widely held view of a single all - encompassing log linear correlation between tsh and ft4 . in this study , we demonstrated a more complex nonlinear interrelationship between the two parameters in a large clinical sample ( figure 3 ) . while there has been some criticism as to the retrospective study design , heterogeneous study population , and reliability of ft4 measurement , if the relationship is truly non - linear and noncontinuous , the system of thyroid hormone feedback control has to be reconsidered , because it is critical to the current role of tsh , for instance , when used as an exclusive therapeutic target establishing dose adequacy in patients treated with exogeneous l - t4 . taken together , the studies described have several implications for our understanding of both hypothalamic pituitary thyroid regulation and the clinical interpretation of tsh results . firstly , they suggest that a simple log linear correlation may not reliably represent the relationship between tsh and ft4 . secondly , they suggest that pituitary thyroid feedback control is not convincingly represented by an all - encompassing single process , but better characterised by a hierarchically structured type of control with distinct patterns of operative mechanisms that are unique to different functional states . this assumption is further supported when reviewing the literature on the molecular aspects of thyroid hormone regulation . earlier studies have shown the existence of isoforms of thyroid hormone receptors ( tr ) in different tissues . tr2 is exclusively expressed in the central nervous system including the pituitary and shows an up to 10-fold enhanced sensitivity to thyroid hormones [ 5759 ] . consequently , the pituitary is able to sensitively monitor small increases in t4 supply and to counteract t4 overproduction in advance of the occurrence of any effect on the peripheral tissues . basically , tsh dampens its own action in anticipation of its effect on t4 secretion via an ultrashort feedback loop , thereby also giving rise to a pulsatile secretory pattern [ 26 , 46 , 60 ] . the activities and contributions of various deiodinases controlling conversion of t3 from t4 have also been reported to differ in the hypothyroid and hyperthyroid state . it stimulates pituitary tsh secretion and , additionally , modulates its bioactivity [ 15 , 62 ] . studies with transgenic animals have demonstrated regulatory varying roles for both thyroid hormone feedback and trh [ 63 , 64 ] . the distinct mechanisms unravelled by the molecular studies are difficult to reconcile with the assumption of a single all - encompassing gradient of the relationship between tsh and ft4 , but would naturally explain a complex and hierarchical pattern of the regulation . it also implies that correlating a given tsh value and ft4 level may not be a simple and straightforward process , as previously thought . the promotion of tsh into a parameter of its own right , with a statistical distribution and correlation to clinical outcomes and targets , has on the one hand greatly facilitated thyroid function testing . on the other hand , it has failed to consider adequately the individual set points of the pituitary thyroid axis that are far more narrowly defined than the broad interindividual distribution of the parameter ( figure 2 ) . this failure may have consequences for clinical decision - making , in terms of not only misclassification of health and disease , as mentioned above , but also misjudging dose adequacy in thyroid hormone replacement . the latter is in particular need of being addressed because clinical studies in treated patients have invariably demonstrated a disturbingly high rate of patients that were dissatisfied with their mode of treatment [ 65 , 66 ] . questions such as of t4 monotherapy versus t3/t4 combination treatment , we believe , can not be assessed on statistical grounds alone , without a solid understanding of the underlying regulatory process . the therapeutic requirements may differ in different conditions or populations , and a slightly elevated tsh that is indicative of subclinical hypothyroidism per definition can not be used as a universal marker , because it has been reported to increase mortality in some populations , whereas it promoted longevity in others , particularly in the elderly [ 11 , 12 , 67 , 68 ] . a remedy may be to revisit the roots of tsh determination that has originated as a thyroid feedback regulator in thyroid homeostasis . while studies devoted exclusively to tsh abound in the literature , the interrelationship of thyroid parameters and their homeostatic roles have received scant attention [ 26 , 4655 , 6971 ] . even when both tsh and thyroid hormone measurements were available on a large scale , as was for instance the case in a recent study on cardiovascular mortality , their use was limited to the purpose of defining subclinical states of thyroid dysfunction , but did not include a broader and more detailed analysis of the interplay of the parameters on the outcome [ 11 , 72 ] . the latter approach seems more liable to advance our understanding and propel tsh measurement towards a more personalised approach of thyroid function testing . it does , however , require as a prerequisite a better understanding of thyroid hormone feedback regulation , which is currently lacking , but is evolving in new directions [ 26 , 54 , 55 ] . the new models allow for distinctly different adaptive homeostatic processes to be activated in either euthyroidism , hypothyroidism , or hyperthyroidism . each state is thereby defined as a qualitatively different entity with a distinct pattern of homeostatically operative mechanisms and equilibria . a dynamic tsh response that depends on the prevailing thyroid function state genetic variability may also play a role in shaping the relationship , for example , via deiodinase polymorphisms [ 70 , 71 ] . the complex nature of the ft4-tsh relationship requires more advanced algorithms to be established and clinically tested . a simplified tentative representation of the idea is shown in figure 4 , based on a fitted log linear model to the euthyroid sample . smaller pilot studies in clinical settings have indicated that a correlated calibration of tsh and ft4 or ft3 measurements outperforms the standard procedure in reducing the diagnostic spread [ 47 , 48 ] . jostel et al . have demonstrated that an ft4-adjusted tsh , termed tsh index by the authors and calculated according to the formula tshi = log tsh + 0.13 ft4 , facilitated the diagnosis of secondary hypothyroidism , providing an accurate estimate of the severity of tsh deficiency in hypopituitarism . meier et al . introduced a bivariate zonal representation for the normal ranges of thyroid function tests . the authors validated the method in 257 volunteers and demonstrated an improved diagnostic accuracy , based on tsh - ft3 zones , in borderline cases , compared to the uncorrelated standard approach using the normal distributions of tsh and ft3 . complex cybernetic models could also tie ft4 and tsh together in a more accurate manner , to establish regulation - based discriminatory cut - offs of the parameters and increase their diagnostic value , but these have not been broadly tested either [ 45 , 46 ] . in summary , correlative studies are few , compared to the vast literature on tsh . as a result , they have failed to gain broader acceptance and did not include more elaborate modelling . the availability of presumably more reliable assays for ft4 based on lc - ms / ms may be advantageous for the development of such ideas [ 42 , 53 , 73 ] . however , evaluating ft4 assays and comparing different methods by conflating sera encompassing the whole spectrum of thyroid function , as has been proposed by some authors [ 53 , 73 ] , is not supported in our view , given that the three physiological areas have their own responses and any necessarily arbitrary mixture of subjects must have a distorting influence on the results . despite some promising reports , there are no large trials currently available to reliably assess the clinical improvement introduced by the new methods , compared to existing technology . in this setting , tsh screening could still have an important role as a first line test , in order to sensitively detect abnormalities , but the therapeutic decision should be made more specifically by interpreting values in the context of the underlying conditions and homeostatic equilibria . a slightly elevated tsh in subclinical hypothyroidism may accompany the successful adaptive response in some patients , but signal a failed adaption in others . prognostic studies do not support an indiscriminate use of tsh as a therapeutic target [ 12 , 67 ] . elevated tsh in subclinical hypothyroidism has been implicated to signal an adverse prognostic outcome in large population studies , but has also been documented as a marker of longevity in a very aged population [ 11 , 12 , 67 ] . this discrepancy argues against the adoption of a simplistic universal use of tsh values that are slightly outside the reference range , but are also taken out of context to the individual or particular situation . while interesting statistical associations have been documented between tsh and various clinical outcomes , a deeper understanding at the physiological and regulatory level is required to put them into context and improve clinical decision - making . the current mainly statistically based use of tsh in thyroid function testing has some severe limitations , including the problem of nonexisting agreed reference limits , a lack of consideration of individual set points , and a prognostic heterogeneity in different populations . in the light of recent molecular and clinical evidence , revised and more refined modelling of the interrelations of tsh and thyroid hormones appears to be both a physiological requirement and a promising avenue towards an overdue reevaluation of tsh as an exclusive diagnostic standard and therapeutic target . based on studies on the ft4-tsh relationship including our own work and a review of the molecular mechanisms described in the literature we propose a complex non - linear model and hierarchical structure of the thyroid hormone tsh interaction . we promote the interpretation of tsh results in close correlation to the thyroid hormone milieu to reduce the uncertainty of interpretation . while a few smaller studies could demonstrate a conceptually higher accuracy , compared to the standard diagnostic procedure , a possible broader application of such concepts awaits further methodological and clinical evaluation .

advances in assay technology have promoted thyrotropin ( tsh ) measurements from participation in a multi - analyte assessment of thyroid function to a statistically defined screening parameter in its own right . while this approach has been successful in many ways , it has some grave limitations . this includes the basic question of what constitutes an agreed reference range and the fact that the population - based reference range by far exceeds the variation of the intraindividual set point . both problems result in a potential misdiagnosis of normal and pathological thyroid function in a substantial proportion of patients . from a physiological perspective , tsh plays an integrated role in thyroid homeostasis . few attempts have been made to adopt physiological insights into thyroid homeostasis for medical decision - making . some emerging novel findings question the widely assumed log - linear tsh - ft4 relationship over the entire thyroid function spectrum . this data favours more complex hierarchically structured models . with a better understanding of its role in thyroid homeostasis in thyroid health and disease , tsh can be revisited in the context of thyroid regulation . this , in turn , could help overcome some of the limitations arising from its isolated statistical use and offer new prospects towards a more personalised interpretation of thyroid test results .

chronic kidney disease ( ckd ) is a major cause of morbidity and mortality in mexico . it has been estimated that 8% of the mexican population has an estimated glomerular filtration rate ( egfr ) < 60/ml / min per 1.73 m. data from the mexican national health survey 2000 indicate that risk factors for ckd are disproportionally higher among the poor . they present high rates of physical and mental illness , substance abuse , and early mortality . the role of substance abuse , alcoholism , and homelessness in ckd and its risk factors has not been adequately evaluated . additionally , homeless persons are more likely to use acute hospital - based care , less likely to be aware of their illnesses , and less likely to comply with prescribed medications and therapy . little is known about the prevalence of ckd and its risk factors in this population . among 15,353 individuals identified with ckd stages 35 receiving regular ambulatory care in an urban community health - care network , an estimated 6% were homeless and 46% were unemployed , disabled , and/or receiving public assistance . hypertension and diabetes affected 46% and 22% of individuals , respectively ; the prevalence of alcoholism ( 8% ) , depression ( 16% ) , drug abuse ( 16% ) , and chronic viral diseases such as hcv ( 4% ) and hiv ( 3% ) were also notable . since 1998 , the fundacion hospitales civiles de guadalajara has used mobile units to provide health care for the poor in jalisco , with emphasis on disease prevention and early detection . in partnership with the jalisco institute for social welfare ( ijas ) , a state welfare agency , we screened homeless individuals in urban guadalajara for the presence of ckd and its risk factors . since september 2006 , staff from the hospitales civiles de guadalajara have used mobile units to establish temporary ckd screening stations in poor rural and urban communities in jalisco . in the present report participants were located at ijas ' unit of assistance for the homeless and three other locations in the jalisco state capital , guadalajara . the mobile unit included facilities for history taking , physical examination , phlebotomy , and laboratory equipment to perform on - site laboratory measurements . it was staffed by personnel that included one nurse , one social worker , one physician , and one laboratory technician , with the support of individuals receiving training in community medicine ( nursing or medical students and medical residents ) . briefly , data were collected prospectively by the staff of the screening programs using a standardized form . persons who were aware that they had kidney disease ' were not screened ; all others were eligible to participate . participants provided blood specimens used to measure serum creatinine and total cholesterol ; serum triglycerides and glucose were measured in those who had been fasting for at least 8 h before specimen collection . participants also provided urine specimens for dipstick urinalysis . trained experienced personnel working in well - lit and appropriate working conditions interpreted the results of urinalyses , which were considered to indicate proteinuria if they showed 1 + protein . participants were classified as having diabetes mellitus if they gave a history of diabetes , or had fasting blood glucose > 126 mg / dl . serum creatinine was used to determine the egfr using the modification of diet in renal diseases study equation ; participants were classified as having ckd based on the presence or absence of egfr < 60 ml / min per 1.73 m. participants ' body mass index was classified according to the current who scheme . homeless was defined as a person who has no income of his or her own to satisfy basic needs , and who does not have a place to live . alcohol and tobacco consumption , as well as substance abuse , was defined as their use at any time during the previous 12 months . findings were compared with those reported by the mexican national health survey and nutrition ( mnhsn ) 2006 and by the mexican national survey on addictions ( mnsa ) 2002 for the general population , and with our own reported data on ckd in poor communities in jalisco , mexico . t - tests and chi - squared tests ( as appropriate ) were used to perform comparisons between groups . the institutional review boards of the hospital civil de guadalajara and the university of alberta approved this study . 260 homeless individuals were screened ; they were predominantly male ( 74% vs. 49.7% vs. 29% , p=0.0001 ) when compared to the general mexican and poor jalisco populations , respectively . they were younger ( 50.7517.93 vs. 57.413.0 years , p=0.0001 ) than the high - risk population . only 5.8% of homeless patients knew they had diabetes , but 19% had fasting blood sugar > 126 mg / dl ; 3.5% of homeless patients knew they were hypertensive but 31% had systolic blood pressure 140 mm hg or diastolic blood pressure 90 mm hg , similar to the general population but lower than the poor jalisco population ( 31.0% vs. 62% , p=0.0001 ) . the prevalence of obesity among homeless participants was lower than in the general and poor jalisco populations ( 17.6% vs. 31% and 43% , respectively , p=0.0001 ) . ckd , as defined by egfr<60 ml / min per 1.73 m , was more prevalent among the homeless than in the poor jalisco population ( 22.4% vs. 15.8% , p=0.0001 ) ; 16.5% had stage 3 , 4.3% stage 4 , and 1.2% stage 5 ckd . homeless individuals with ckd were older ( 60.7914.86 vs. 47.5717.62 years , p=0001 ) and more diabetic ( 18.1 vs. 16.2 , p=0.03 ) than those without ckd . obesity ( 23.4% vs. 16.0% , p=0.27 ) and hypertension ( 34.5% vs. 30.3% , p=0.62 ) were more prevalent in persons with ckd , but these differences were not statistically significant . unfortunately , results of urinalysis are not reported because the majority ( 95% ) of individuals refused to submit a urine sample , arguing the risk of being tested for drugs . addictions were more prevalent among the homeless than in the general population ( 75.3% vs. 55.1% , p=0.0001 ) ( table 2 ) . homeless persons showed a lower prevalence of alcoholism ( 23.5% vs. 32.3% , p=0.002 ) than the general population , but tobacco smoking ( 34.6% vs. 21.5% , p=0.0001 ) and substance abuse ( 18% vs. 1.1% , p=0.0001 ) were more prevalent among the homeless . likewise , chronic viral infections such as hiv ( 4.5% vs. 0.3% , p=0.0001 ) and hcv ( 7.7% vs. 1.4% , p=0.0001 ) were also significantly higher among the homeless than in the general population . it is estimated that 8% of the adult mexican population has egfr < 60 ml / min per 1.73 m ( ref . ) and that the prevalence is as high as 15.8% among high - risk , poor populations . risk factors for ckd such as diabetes , hypertension , and obesity are highly prevalent in the mexican population . our results show a higher prevalence of ckd ( 22% ) among the homeless compared with the report by amato et al ( 8% ) , and our own data in poor urban and rural jalisco populations ( 15.8% ) . since the prevalence of traditional ckd risk factors like diabetes and hypertension among the homeless was lower than among the urban and rural poor populations , additional factors could explain this difference . first , the higher prevalence of chronic viral infections and substance abuse among the homeless could have played a role in the development of chronic glomerular disease ; however , the lack of urine samples to test for protein and sediment did not allow us to assess this possibility . second , as homeless individuals have limited access to health care , the presence of ckd risk factors may go unnoticed , increasing the risk of developing ckd . also , homeless persons are less likely to be aware of their illnesses , and to comply with prescribed medications and therapy . as shown in our study , the majority of people with documented diabetes and hypertension were unaware of these conditions , and none had health insurance . finally , homeless patients are more likely to present late in the course of ckd , which might lead to more rapid loss of kidney function . as shown in our study , 14 ( 5.5% ) of the screened individuals had ckd stages 4 and 5 and had not ever seen a nephrologist . although data were collected prospectively , they may not be generalizable to all homeless settings in other regions of mexico . second , participants who agreed to participate in screening delivered by the mobile clinic may not be representative of those who would participate in other types of screening programs . therefore , our results can not be used to draw conclusions about the overall prevalence of ckd in homeless individuals in mexico . third , although the refusal to provide urine samples did not allow us to test for protein and hematuria , our results suggest that screening using mobile units in the population studied leads to a relatively high detection rate for reduced egfr . fourth , the mdrd study equation has not been validated specifically in an unselected mexican population ; therefore , some participants may have been misclassified with respect to the presence or absence of egfr 60 ml / min per 1.73 m. finally , there is no information on the number of homeless people in mexico . in guadalajara , jalisco 's state capital , , the state government has been providing shelter and medical care to this population through the ijas 's unit of assistance to the homeless . our results indicate that more efforts need to be directed to assess the burden of ckd in this setting . in summary , ckd and its risk factors lack of awareness of having diabetes and hypertension is highly common in this population , as is the prevalence of chronic viral infections and substance abuse . consideration should be given to target this high - risk population in programs aimed to prevent ckd and its risk factors in mexico .

little is known about the prevalence of chronic kidney disease ( ckd ) among the homeless in mexico . the role of substance abuse , alcoholism , and homelessness in ckd has not been properly evaluated . we screened 260 homeless individuals in the state of jalisco , mexico , for the presence of ckd and its risk factors , and compared their characteristics with those from a separate cohort of poor jalisco residents and with a survey of the general mexican population . ckd was more prevalent among the homeless than among the poor jalisco population ( 22% vs. 15.8% , p=0.0001 ) ; 16.5% had stage 3 , 4.3% stage 4 , and 1.2% stage 5 . all were unaware of having ckd . only 5.8% knew they had diabetes , but 19% had fasting blood sugar > 126 mg / dl ; 3.5% knew they were hypertensive but 31% had systolic blood pressure 140 mm hg or diastolic blood pressure 90 mm hg . alcoholism was less common than in the poor jalisco population ( 23.5% vs. 32.3% , p=0.002 ) , but tobacco smoking ( 34.6% vs. 21.5% , p=0.0001 ) and substance abuse ( 18% vs. 1.1% , p=0.0001 ) were more prevalent among the homeless . likewise , chronic viral infections such as hiv ( 4.5% vs. 0.3% , p=0.0001 ) and hcv ( 7.7% vs. 1.4% , p=0.0001 ) were also significantly higher among the homeless than in the general population . in conclusion , ckd and its risk factors are highly prevalent among the homeless individuals in jalisco , mexico . lack of awareness of having diabetes and hypertension is highly common , as is substance abuse . programs aiming to prevent ckd and its risk factors in mexico should specifically target this high - risk population .

myocardial infarction , a leading cause of heart failure , precipitates dyssynchronous cardiac motion contributing to organ decompensation . crt , through biventricular pacing , has advanced the management of heart failure . despite overall benefit , a culprit underlying unfavorable response to crt is the infarction - provoked scarburden . to address refractory dyssynchrony , reparative strategies are increasingly considered . boosting the repair capacity of the human heart , through stem - cell based interventions , proof - of - concept studies offer initial evidence that transplantation of stem cells may salvage the infarcted myocardium and synchronize failing ventricles . translation of reparative resynchonization principles into practice will require optimization of the regenerative intervention and stratification of patients most likely to benefit . the relationship of injury , aberrant wall motion and responsiveness to intervention is yet to be delineated . establishing best practices is paramount in designing safe and effective protocols tailored to individual patients . by harnessing the potential of regenerative medicine , stem - cell biotherapy emerges as a potential means to restitute collapsed mechanics in the failing myocardium as a complement to standard of care . cardiac dyssynchrony , triggered by disruption in coordinated wall motion , contributes to organ failure and poor outcome . post - infarction , the inhomogeneity across infarcted versus non - infarcted regions generates an environment conducive to development of cardiac dyssynchrony . cardiac resynchronization therapy relies on biventricular pacing , and is integral in managing dyssynchronous heart failure . yet a nonviable myocardium is inadequately resynchronized by pacing , and dyssynchrony stands uncorrected . restoration of normative impact may require a tissue - reparative strategy . the notion of reparative resynchronization was recently formulated highlighting the prospect of stem - cell based structural and functional repair . preclinically , targeted implantation of stem cells into epicenters of cardiac dyssynchrony translates long term in tissue repair and resynchronization . clinically , in acute or chronic ischemic heart disease , patients appear to benefit from stem - cell therapy demonstrating on follow - up reduced dyssynchrony . stem - cell based resynchronization emerges as a biotherapeutic strategy to address primary defects in myocardial pathodynamics underlying heart failure post - infarction , meriting further exploration and validation . cardiac dyssynchrony , triggered by disruption in coordinated wall motion , contributes to organ failure and poor outcome . post - infarction , the inhomogeneity across infarcted versus non - infarcted regions generates an environment conducive to development of cardiac dyssynchrony . cardiac resynchronization therapy relies on biventricular pacing , and is integral in managing dyssynchronous heart failure . yet , the infarction - provoked scar may impede a favorable response to pacing regimens . a nonviable myocardium is inadequately resynchronized by pacing , and dyssynchrony stands uncorrected . the notion of reparative resynchronization was recently formulated highlighting the prospect of stem - cell based structural and functional repair . preclinically , targeted implantation of stem cells into epicenters of cardiac dyssynchrony translates long term in tissue repair and resynchronization . clinically , in acute or chronic ischemic heart disease , patients appear to benefit from stem - cell therapy demonstrating on follow - up reduced dyssynchrony . stem - cell based resynchronization emerges as a biotherapeutic strategy to address primary defects in myocardial pathodynamics underlying heart failure post - infarction , meriting further exploration and validation .

cardiac dyssynchrony refers to disparity in cardiac wall motion , a serious consequence of myocardial infarction associated with poor outcome . infarct - induced scar is refractory to device - based cardiac resynchronization therapy , which relies on viable tissue . leveraging the prospect of structural and functional regeneration , reparative resynchronization has emerged as a potentially achievable strategy . in proof - of - concept studies , stem - cell therapy eliminates contractile deficit originating from infarcted regions and secures long - term synchronization with tissue repair . limited clinical experience suggests benefit of cell interventions in acute and chronic ischemic heart disease as adjuvant to standard of care . a regenerative resynchronization option for dyssynchronous heart failure thus merits validation .

during march through october 2006 , samples from at least 100 patients from brunei diagnosed with hand , foot , and mouth disease or herpangina were received at the university malaya medical center , kuala lumpur , malaysia . ev71 was isolated from 34 patients ( including 2 who died of severe neurologic complications ) , and an additional 7 isolates were obtained from malaysian patients seen at the university malaya medical center during the outbreak period in brunei ( table 1 ) . adenovirus also was isolated from stool or rectal swabs of 4 patients , of whom 2 were coinfected with ev71 ; none had neurologic disease . enteroviral rna was extracted from cell cultures using qiaamp viral rna mini kit ( qiagen , hilden , germany ) , and reverse transcription pcr was performed to amplify the viral capsid protein ( vp1 ) gene at nt positions 31861 . the primers used were vp1f 5-caggctagcatgggagatagggtggcagatgtgatcgagagc-3 and vp1r 5-ggtggatcccaaagggtagtaatggcagtacgactagtgccggt-3. the 831-nt partial vp1 gene fragments were sequenced , and phylogenetic relations of the sequences were examined using selected enterovirus reference strains obtained from genbank ( table 2 ) . sequences were aligned and phylogenetic trees were drawn using the neighbor - joining method ( figure ) , as described ( 12 ) . the prototype coxsackievirus a16 ( coxa16-g10 ) was used as the outgroup virus for construction of the phylogenetic tree . * hfmd , hand , foot , and mouth disease ; na , not available ; ud , unpub . data . bootstrap values ( > 95% ) are shown as percentages derived from 1,000 samplings at the nodes of the tree . isolates from this study are indicated by * ( brunei ) and ( peninsular malaysia ) . the phylogenetic tree , drawn on the basis of the alignment of the vp1 gene sequences , showed 3 independent genogroups ( a , b , and c ) with the prototype brcr strain as the only member of genogroup a ( 11 ) . within each of genogroups b and c , 5 additional subgenogroups were identified , designated b1b5 and c1c5 ( 8,10 ) . although no definitions have been established , generally there is nucleotide variation of 16%20% between genogroups and differences of 6%12% between subgenogroups within each genogroup ( 5,11 ) . all brunei and malaysia isolates from 2006 clustered into subgenogroup b5 , except for 1 brunei isolate , which grouped to subgenogroup b4 . nucleotide sequences of the vp1 gene were highly similar ( 96%100% ) among all strains in subgenogroup b5 . all brunei b5 isolates were clustered in an independent lineage within subgenogroup b5 ( 99.9% bootstrap support ) , separate from the established sarawak and yamagata isolates from 2003 ( 8) . amino acid sequences were highly conserved among the brunei b5 isolates , with 99%100% similarity . no amino acid sequence changes were observed in the 2 isolates from patients who died . the continuing appearance of new ev71 subgenogroups in recent years in the asia - pacific region suggests that the virus is continuously evolving ( 5,8,9 ) . the annual rate of evolution is estimated at 1.35 10 substitutions per nucleotide , similar to poliovirus ( 11 ) . in some countries , outbreaks occur in a cyclical pattern every 3 years , predominantly caused by strains that are distinct from previous outbreaks ( 3,9 ) . these strains often have been detected in other countries in the region in years preceding the outbreak . in some ev71 outbreaks , other enteroviruses cocirculate , particularly coxsackievirus a16 or ev71 from a different subgenogroup ( 3,8,10 ) . on the basis of the samples received in the study , apart from the single isolate from subgenogroup b4 , no other enteroviruses were isolated , although 2 patients also had adenovirus . occasional ev71 and adenovirus co - infection has been reported ( 13 ) , also without association with severe disease . the low sequence diversity and predominance of the brunei b5 isolates in this outbreak suggest recent introduction and subsequent rapid spread , without the concurrent spread of other genogroups , subgenogroups , or enteroviruses . other than its northern coastline , brunei is surrounded entirely by the east malaysian state of sarawak . in 2006 , thus , temporally and geographically , the brunei and sarawak outbreaks were related , raising the possibility that the same strains were involved . sarawak had experienced ev71 outbreaks every 3 years ( 1997 , 2000 , and 2003 ) , caused by subgenogroups b3 , b4 , and b5 , respectively ( 3 ) . however , no sequence results from the sarawak 2006 outbreak are available for comparison . all subgenogroup b5 isolates reported seem to have diverged from an ancestral strain related to strain 5511/sin/00 ( genbank accession no . subsequently , subgenogroup b5 emerged in japan ( 8) and sarawak ( 3 ) in 2003 , before appearing in peninsular malaysia and brunei in 2006 . the source of the brunei outbreak remains unclear , and it may not be one of these countries where subgenogroup b5 has already been reported . however , ev71 subgenogroup b5 clearly continues to diverge , and further subgenogroups are likely to arise . in summary , the first reported major outbreak of ev71 in brunei was caused by strains from subgenogroup b5 that were distinct from other reported b5 isolates , suggesting a recent introduction from an as - yet - unidentified source . hence , continued molecular surveillance of ev71 in asia is required to further our understanding of factors influencing the evolution of the virus and its association with emergence of outbreaks in the region .

enterovirus 71 ( ev71 ) outbreaks occur periodically in the asia - pacific region . in 2006 , brunei reported its first major outbreak of ev71 infections , associated with fatalities from neurologic complications . isolated ev71 strains formed a distinct lineage with low diversity within subgenogroup b5 , suggesting recent introduction and rapid spread within brunei .

glioblastoma ( astrocytomas , who grade iv ) is the most aggressive primary brain tumor . with an incidence of 3.5 per 100,000 people per year glioblastomas can either present themselves as primary glioblastomas ( 95% ) , which manifest de novo and lack precursor tumors , or secondary glioblastomas . surgery is the initial intervention when a patient has been diagnosed with a brain tumor . this is needed to obtain a histological diagnosis and reduces the space - occupying effect of the tumor . however , in glioblastoma , surgery is of limited therapeutic value , as complete resection is impossible due to the extensive invasive , and migratory behavior of glioblastoma cells . the understanding of molecular alterations in signaling pathways and the consequent pathology in glioblastoma has greatly increased in the last years due to the availability of new techniques , such as genome - wide sequencing . one of the pathways that are frequently affected in glioblastoma includes channels involved in transport of sodium , potassium , and calcium ions . the present paper provides an overview of the current evidence of the involvement of these ion channels in glioblastoma in terms of gliomagenesis , glioma progression , and their effect on prognosis . because of the progression of lower - grade glioma to glioblastoma , the involvement of ion channels in high - grade glioma is discussed as well . finally , the application of these insights is discussed in the light of future prospects for experimental and clinical practice . a survey of the coding sequence of 20,661 genes in glioblastoma genomes has implicated many new gene alterations . of the 555 genes involved in potassium , sodium , chloride , calcium and other ion transport , 55 mutations were detected to affect 90% of the glioblastoma samples studied . ion channels are thought to facilitate progression through cell cycle checkpoints and thereby are required for cell proliferation . for example , progression through the g1/s checkpoint is correlated with increased potassium k channel activity and momentary hyperpolarization . to illustrate this , iberiotoxin , a pharmacological inhibitor of big conductance k channels , arrests glioma cells in s phase of the cell cycle . on the other hand , transient depolarization facilitated by cl channels it is for these reasons that uncontrolled ion channel activity can contribute to oncogenesis . as stated before , the prognosis of glioblastoma is abysmal due to its invasive migration , which renders surgical resection ineffective . they influence shape and volume of cancer cells by affecting ion and water transport over the plasma membrane . ion channels thereby facilitate invasive migration through the sinuous extracellular space of brain tissue [ 813 ] ( figure 1 ) . in addition , ion channels may be functionally involved in proliferation [ 7 , 14 , 15 ] . it is for these reasons that ion channels may contribute to the malignant behavior of glioblastoma cells . ca - activated k channels facilitate outwardly rectifying potassium currents and respond to ca concentrations . increases in the intracellular [ ca ] shift the voltage dependence of ca - activated k channels to more negative potentials . one of these channels , big conductance k channels or bk channels , is widely expressed in excitable and non - excitable cells . specific overexpression of bk channels has been observed in biopsies of patients with malignant gliomas , compared with nonmalignant human cortical tissues . lastly , bk currents in glioma cells are more sensitive to intracellular [ ca ] compared to bk channels in healthy glial cells [ 17 , 18 ] . bk channels can express a variety of electrophysiological properties , which is due to alternative splicing of their -subunits . the increased sensitivity to intracellular [ ca ] is found in a novel splice isoform of hslo , the gene that encodes the -subunits . in addition , glioma most likely only expresses this new isoform , as the classical bk channel has not been found in gliomas yet . these findings led to the term glioma bk ( gbk ) channel ( figure 1 ) . gbk channels have been suggested as a candidate channel for providing the electrochemical driving force for ion movement needed for the release of cytoplasmic water and cell shrinkage which in turn facilitates the extensive migrating behavior of glioblastoma cells . first of all , the effect of menthol was studied , an agonist of transient receptor potential melastatin 8 ( tprm8 ) ion channels , which increases intracellular [ ca ] , which in turn activates gbk channels . in addition , administration of paxilline and tetraethylammonium , both gbk channel inhibitors , inhibited migration [ 11 , 12 ] . these findings make a role of gbk channels in the migration of glioblastoma cells probable . however , the effect of gbk channel knockdown has yet to be investigated , leaving room for doubt . in contrast to the better studied role that gbk channels have in glioblastoma cell invasive migration , there is discussion whether or not gbk channels contribute to proliferation . glioblastoma cells were exposed to pharmacological inhibitors of gbk channels , such as iberiotoxin , paxilline , tetraethylammonium , and penitrem a. after 3 to 5 days , growth inhibition and even tumor shrinkage were observed in vitro [ 7 , 14 , 15 ] . in contrast , more recent literature contradicts these findings and suggests that gbk channels are not required for proliferation or even have antitumorigenic properties . it has been found that pharmacological inhibitors suppress glioblastoma cell growth at concentrations far higher than concentrations that were sufficient to inhibit gbk channel activity . low concentrations that were sufficient to inhibit these channels did not affect glioblastoma cell growth in vitro . in addition , downregulation of gbk channels using gene - specific sirnas reduced k current densities , but caused no changes in proliferation . inositol 1,4,5-triphosphate receptors ( ip3rs ) may provide ca for gbk channels ( figure 1 ) . these receptors are localized close to and are linked with gbk channels in dedicated plasma membrane domains called lipid rafts . disruption of these lipid rafts with methyl--cyclodextrin disturbs the connection between gbk channels and ca . this disturbance was restored by inclusion of ca in the pipette solution during the whole cell patch - clamp experiments . this suggests that the disturbance was not caused by destruction or calcium desensitization of the gbk channels . glioma cells both in vitro and in situ are characterized by depolarized resting membrane potentials of about 20 to 40 mv . this contrasts the very negative resting membrane ( 80 to 90 mv ) and large inwardly rectifying k currents that characterize normal glial cells . these findings have led to the assumption that glioma cells express a decreased density of inwardly rectifying k channels ( kir ) compared to normal brain tissue . however , western blot analysis of d54 glioblastoma cell lines showed only slightly lowered expression of kir2.1 , normal expression of kir4.1 , and increased expression of kir2.3 and kir3.1 as compared to normal astrocytes , while electrophysiological recording found no kir current . immunostaining of kir2.3 and kir4.1 predominantly labeled the nucleus of glioblastoma cells ( figure 1 ) , while expression in normal astrocytes was diffuse over the plasma membrane . the intracellular localization of kir channels may explain why glioblastoma cells express a depolarized resting membrane potential and decreased inwardly rectifying k current . kir channels in glial cells are specifically known for two functions : buffering of extracellular k and establishment of a very negative resting potential . glial cells perform k uptake from the extracellular space and redistribute k ions toward areas where the extracellular [ k ] is lower . this k buffering by glial cells is essential for neuronal homeostasis , as elevated extracellular [ k ] would depolarize neurons , preventing them from firing action potentials . kir channels in healthy glial cells seem to be fitted very well for this task , as they have a large open probability at resting potential . this means that at resting potential , a relatively high number of kir channels are open . in addition , with increasing extracellular [ k ] their conductance increases as well , which makes them perfectly suited for the task of correcting an excess of k in the extracellular space . mislocalization of kir channels in glioblastoma cells ( figure 1 ) renders these cells insufficient for these tasks , resulting in accumulation of k in the extracellular space . this accumulation occurs in concurrence with epileptic seizures , although the underlying mechanism is not entirely clear . peritumoral epileptic seizures are often seen in glioblastoma patients , perhaps facilitated by mislocalization of kir channels . on the other hand , it is likely that very few to no neurons survive around glioblastoma cells due to their invasive behavior . these arguments , supported by the excitotoxic properties of high glutamate concentrations to neurons , render high glutamate release a more logical suspect of causing epileptical seizures than high [ k ] in the extracellular space . on the other hand , mislocalized kir channels can contribute indirectly to epileptic seizures as they fail in their function of establishing a very negative resting potential . at the depolarized resting potentials of 20 to 40 mv that characterize glioma cells , the na gradient across the plasma membrane is diminished . as a consequence , na - dependent glutamate transporters become inactive , increasing the extracellular glutamate concentration and thereby possibly causing epileptic seizures . other candidate channels possibly responsible for the depolarized resting membrane potential in glioblastoma cells are the ether go - go 1 ( eag1 ) and ether go - go related 1 ( erg1 ) channels . depolarized resting membrane potential allows large hyperpolarizations , which provide a driving force for ca entry . ca is necessary for cell - cycle progression . in this way , eag1 and erg1 channels can contribute to gliomagenesis . several studies have described expression levels of heag1 and herg1 in glioblastoma , which encodes eag1 and erg1 channels , respectively . however , the results are contradictory . patt et al . reported low expression of heag1 and herg1 in 5 glioblastoma samples compared to healthy brain tissue . in contrast , masi et al . found elevated expression of herg1 in 26 glioblastoma samples , supporting the hypothesis above . the observation by masi et al . is supported by other literature , reporting increased erg1 mrna expression , elevated protein levels and high densities of erg1 channels in other tumors , such as colorectal cancer , endometrial adenocarcinoma , and myeloid leukemia . erg1 activity has also been reported to be correlated with induction of vascular endothelial growth factor ( vegf ) secretion , thereby contributing to angiogenesis . besides the gbk channel discussed earlier , the clc-3 chloride channel is another important candidate channel to facilitate migrating behavior of glioblastoma cells . clc-3 channel expression was , together with that of clc-2 and clc-5 , indeed high in glioblastoma cell lines and biopsy tissue compared to healthy glial cells . whole cell patch - clamp recordings in combination with channel - specific antisense oligonucleotides showed that clc-3 channels facilitated outwardly rectifying current . on the other hand , clc-2 channels facilitated inwardly rectifying currents . as a result of the relative overexpression of clc-3 as compared to clc-2 , the outwardly rectifying current may prevail over the inwardly rectifying current . as a consequence the glioblastoma cell depolarizes , which is needed to pass the g2/m checkpoint in the cell cycle . in addition , the overexpression of both channels equips glioblastoma cells with an improved ability to transport cl . this may facilitate rapid changes in cell size and shape as glioblastoma cells invade through sinuous extracellular brain spaces . inhibition of clc-3 channels using chlorotoxin indeed markedly but not completely inhibited glioblastoma cell invasion in vitro . the same effect was accomplished using clc-3 sirna knockdown . in addition , the nonspecific clc - blocker 5-nitro-2-(3-phenylpropylamino ) benzoic acid ( nppb ) completely inhibited glioblastoma cell invasion . limitations of this study include the possibility that the glioblastoma cell was overdosed with nppb and invasion was stopped by cytotoxic levels of nppb . secondly , nppb has also been reported to be a ca - activated k - channel inhibitor . clc-3 is regulated through phosphorylation via ca / calmodulin - dependent protein kinase ii ( camkii ) . camkii was infused intracellularly to d54 glioblastoma cells via a patch - clamp pipette , increasing cl currents 3-fold . in addition , administration of autocamtide-2 , a camkii - specific inhibitor , inhibited this current . to confirm the relation between clc-3 and camkii , clc-3 was shown to be knocked down after camkii modulation of cl currents interestingly , inhibition of camkii in clc-3-expressing cells reduced glioblastoma cell invasion to the same extent as direct inhibition of clc-3 . these findings suggest that camkii is a molecular link between intracellular [ ca ] changes and clc-3 conductance required for cell movement during invasive migration in glioblastoma . oscillatory changes in intracellular [ ca ] that correlate with cell invasion and migration have been observed . it has been hypothesized that these changes in intracellular [ ca ] activate clc-3 channels through camkii . glioblastoma cells express ca permeable alpha - amino-3-hydroxy-5-methyl-4-isoxazolepropionate ( ampa ) glutamate receptors ( figure 1 ) . these glutamate receptors have become ca permeable due to the lack of the glur2 subunit as they have been assembled entirely of glur1 and/or glur4 subunits . ampa receptors containing glur2 subunits show little ca permeability , while those lacking glur2 subunits exhibit high ca permeability due to a deformed pore with an aberrant size and polarity . adenovirus - mediated transfer of the glur2 cdna decreased intracellular [ ca ] , inhibited cell migration and induced apoptosis . however , overexpression of ca permeable ampa receptors increased migration and proliferation of glioblastoma cells in vitro . these findings implicate ca - permeable ampa receptors in proliferation , migration and invasion of glioblastoma . it can be hypothesized that this is due to increased intracellular [ ca ] , which in turn facilitates increased activity of gbk and clc-3 channels . the same theory applies to a study in which inhibition of ip3r subtype 3 ( ip3r3 ) was achieved using caffeine . in addition , an increase of mean survival was observed after caffeine was administered to a mouse xenograft model of glioblastoma . this is approximately the same concentration in people that drink two to five cups of coffee a day . . it would be interesting to investigate whether large cohort studies can associate coffee consumption with a lower incidence of glioblastoma or prolonged survival . however , such information is not available yet . with a yearly glioblastoma incidence of 3.5 per 100,000 people , study sizes the effect of caffeine on the survival of glioblastoma mouse models is interesting as caffeine is regarded as not classifiable as to its carcinogenicity to humans by the who , meaning that there is contradictory evidence about its carcinogenic hazard . the ca - permeable transient receptor potential canonical channel protein 6 ( trpc6 ) has been implicated in glioma proliferation . trpc6 is overexpressed in human glioma cells , and inhibition suppressed intracellular [ ca ] and cell growth and induced cell cycle arrest at the g2/m phase . in mouse models with xenografted human tumors , inhibition of trpc6 reduced tumor volume and increased mean survival . in contrast to mutations found in potassium and calcium ion channels , sodium channel mutations correlated with shorter survival in a univariate analysis . the authors reported that all samples with idh1 mutations did not have any sodium channel mutations . . this may be due to the small sample size of the study ( 21 patients ) . mutations in idh1 have been identified to be associated with a specific subgroup of glioblastoma patients who are younger and have a prolonged survival [ 4 , 40 ] . after correction for idh1 , the difference in survival between patients with mutated and unmutated sodium channels dropped to nonsignificant levels . further research is needed to investigate the association between mutations in idh1 and sodium channels and whether the effect of sodium channel mutations on survival is independent of idh1 mutation status . furthermore , among the patients with mutations in sodium channels , the mutations were scattered over the different genes . all 14 sodium channel genes were mutated only once among the 21 patients except for scn9a , which was mutated twice . in addition , of the 12 patients with sodium channel mutations , only 2 had mutations in more than one gene . this is supported by the fact that of the 14 studied genes , 12 genes were from the scn or slc subset classes with 5 and 7 genes , respectively . a similar scattering among the studied genes and clustering in gene families was observed in potassium and calcium channel mutation analyses . these findings are supported by the fact that the antiproliferative effect in cancer of cardiac glycosides is well known [ 41 , 42 ] . the underlying mechanism of these side effects has not been clarified yet , although inhibition of sodium channels in brain tissue could be the cause of this . another study observed an inward , amiloride - sensitive na current in glioblastoma cell lines and tumor samples . currently , brain na channels ( bnacs ) are the only amiloride - sensitive na channels identified in the brain . finally , the effect of psalmotoxin 1 , an inhibitor of cation currents mediated by acid - sensing ion channels , was studied using the whole - cell patch - clamp technique . this toxin inhibited na currents in glioblastoma cell lines and human glioblastoma samples , but not in normal human astrocytes . since this effect can only be measured using electrophysiological experiments , the diagnostic value seems low . however , if the na current facilitated by acid - sensing ion channels proves essential for glioblastoma cells in vivo , inhibition of psalmotoxin may serve as a possible future therapy . given the important role that gbk and clc-3 channels are thought to have in glioma invasion and migration , these channels may render a promising therapeutic target to render glioblastoma less aggressive . however , even if in vivo inhibition of gbk and clc-3 channels can inhibit glioblastoma invasion and migration , these future therapies probably have to be administered at an early stage in order to make a difference in the treatability by resection and radiotherapy . taken the central role of intracellular [ ca ] in clc-3 and gbk channel activity into account , influencing glioblastoma ca homeostasis may be a target of future therapies . this can be accomplished by inhibition of ca - permeable ampa receptors , for example by adenovirus - mediated transfer of glur2 cdna . however , the carcinogenic hazard of caffeine is not clear yet . on the other hand , ca coupling to clc-3 and gbk channels can be disturbed by inhibiting camkii or lipid rafts , respectively . in addition , inhibition of trpc6 has shown promising results both in vitro and in vivo in mouse models . the finding that glioma cells ' depolarized resting membrane potential and their inability to maintain k , na and glutamate homeostasis are caused by mislocalization of kir channels suggests that these channels function at a crossroads of cellular homeostasis and basic electrophysiological functions in glioma cells . correction of this mislocalization could therefore serve as a possible therapeutic target . however , the underlying mechanism of this mislocalization is currently unknown , making therapy uncertain in the near future . recently , the antiproliferative effect of cardiac glycosides on glioblastoma cell growth in vitro was studied . however , concentrations that provide an anticancer effect are high and induce severe cardiovascular side effects . chemical modification is needed to increase affinity for tumor sodium channels and decrease affinity for cardiac sodium channels . furthermore , it exacerbates radiation - induced cell - cycle perturbation , thereby inducing apoptosis and radiosensitization in glioblastoma cells . these capabilities render it a possible useful therapy to treat glioblastomas , especially combined with radiotherapy or other chemotherapeutic agents . the combination of classical cytotoxic , apoptotic , radiosensitization and antiangiogenic effects with inhibition of gbk channels is promising . furthermore , tetrandrines ' large arsenal of possible therapeutic targets in gliomas may impede to find an optimal dosage . the blood - brain tumor barrier is an important hurdle to overcome in glioblastoma treatment . temozolomide , a chemotherapeutic agent that was discussed earlier , is currently , together with radiotherapy , the golden standard in glioblastoma treatment . however , temozolomide crosses the blood - brain tumor barrier insufficiently to have a significant impact on patient survival . the same accounts for trastuzumab , which may be especially effective in a distinct glioblastoma subgroup ( neural , as discussed by verhaak et al . therefore , both drugs were coinfused with minoxidil sulfate , an atp - sensitive potassium channel ( katp ) activator . in mice , the underlying mechanism is not completely understood , but it involves formation of brain vascular endothelial transcytotic vesicles to facilitate absorption of the drug . currently , most research in the field of ion channels in glioma is conducted on glioma cell lines . however , several experiments have shown that established glioblastoma cell lines resemble glioblastomas in patients very poorly when compared at the level of dna alterations or gene expression profiles . with this in mind , results from experiments conducted with cell lines should always be put into the right context . in vitro studies in human glioblastoma samples or in vivo studies in animal xenograft models remain needed . at this moment , we have increased our understanding of the molecular mechanisms involving ion channels underlying the invasive migration of glioblastoma . however , in contrast to many other forms of cancer and considering the genetic research in glioblastoma , consequences for treatment are lagging behind . under the shadow of the large and extensive research on genetic alterations and its effects on therapy responses in glioblastoma , our current understanding of ion channels in glioblastoma will most probably lead to drugs that can be given concomitantly with chemotherapeutic agents to increase their effectivity , such as the discussed coinfusion with minoxidil sulfate . in addition , the current knowledge of the involvement of bk channels , clc-3 channels and intracellular [ ca ] homeostasis in glioblastoma invasion and migration would justify the first steps in drug development targeting these aspects .

glioblastoma is the most common primary brain tumor with the most dismal prognosis . it is characterized by extensive invasion , migration , and angiogenesis . median survival is only 15 months due to this behavior , rendering focal surgical resection ineffective and adequate radiotherapy impossible . at this moment , several ion channels have been implicated in glioblastoma proliferation , migration , and invasion . this paper summarizes studies on potassium , sodium , chloride , and calcium channels of glioblastoma . it provides an up - to - date overview of the literature that could ultimately lead to new therapeutic targets .

acute interstitial pneumonia ( aip ) is an idiopathic lung disease characterized by rapidly progressive respiratory failure occurring in patients without pre - existing systemic or lung diseases with diffuse alveolar damage histologically ( 1 , 2 ) . since the term " acute interstitial pneumonia " was first introduced in 1986 ( 3 , 4 ) , some reported case reviews of aip ( 4 - 8 ) , with only 2 pediatric case reports ( 3 , 8) . this is a case report of a 3-yr - old girl diagnosed as having aip from autopsy , whose two other siblings showed the similar radiological findings . this is the first case report of aip in three children from the same family ; one of them was histologically confirmed , another was clinically and radiologically quite similar , and the other was radiologically suspected as having aip . a 3-yr - old previously healthy girl presented with progressive dyspnea and chest discomfort . over the preceding 1 week , she had been admitted to a local general hospital for a sudden onset of dyspnea followed by 3 weeks of upper respiratory symptoms , mild rhinorrhea and dry cough without fever . her 2-yr - old brother showed the same clinical symptoms presented at the same time ; however , she did not have any other known familial history of certain disease . there was no evidence of systemic infection , immune suppression , exposure to toxic agents , pre - existing lung disease , or collagen - vascular disease . on physical examination she showed tachypnea ( respiratory rate 48/min ) and chest wall retraction , and was requiring 5 l oxygen with face mask . there were bilateral ground - glass opacification on simple chest radiograph and also bilateral ground - glass attenuation with diffuse alveolar consolidation on chest high - resolution computed tomography ( hrct ) ( fig . arterial blood gas analysis gave ph 7.40 , pao2 88 mmhg , paco2 46 mmhg , sao2 96% ( 5 l / min of oxygen with face mask ) , and the white blood cell count was 9,330/l with 78% neutrophils . c - reactive protein was negative , and other chemistry results were all within normal limits . viral investigations including respiratory syncytial virus , adenovirus , influenza , parainfluenza , cytomegalovirus , ebstein - barr virus , herpes simplex virus , and evaluation for mycoplasma pneumoniae showed negative results . rheumatoid factor and anti - nuclear antibody were both negative . under a presumptive diagnosis of interstitial lung disease , intravenous antibiotics and dexamethasone were administered . despite these she presented with severe dyspnea and chest discomfort with pneumomediastinum and subcutaneous emphysema on chest radiograph . pneumomediastinum was aggravated and resulted in pulmonary hemorrhage . because of ongoing hypoxemia and decreased mentality , endotracheal intubation was performed at 13th hospital day . the patient died on the 14th day of admission after four times of cardiac arrest . the histopathologic findings on autopsy of the lungs revealed diffusely thickened alveolar septal interstitium by uniform , organizing loose fibrosis and foci of hyaline membranes as well as prominent interstitial and alveolar edema with focal hyperplasia of type ii pneumocytes , which were indicative of organizing diffuse alveolar damage ( dad ) and episodes of acute lung injuries ( fig . her 2-yr - old brother showed a same clinical course with diffuse bilateral ground - glass opacities on his hrct and also died after 4 weeks of intensive care due to respiratory failure aggravated by pneumothorax and subcutaneous emphysema . it was unable to undergo any follow - up hrct , lung biopsy , or bronchoalveolar lavage because of his critical condition . their 8-yr - old sister had no symptoms but underwent hrct for screening , which showed a mild degree of bilateral ground - glass opacities . her pulmonary function test ( pft ) revealed patterns of restrictive lung disease . however , her follow - up hrct and pft showed improvement after five weeks of oral steroid administration . in 1944 , hamman and rich initially described four previously healthy patients with fatal fulminant lung disease that , on autopsy , was characterized as extensive pulmonary fibrosis ( 8) . in 1986 , katzenstein and coworkers introduced the term " aip " to describe eight patients characterized by idiopathic interstitial lung disease causing a rapid onset of respiratory failure , which was distinguished from other chronic forms of interstitial pneumonia ( 3 ) . since then , some reports have reviewed the cases of aip ( 4 - 8 ) , but among them , there were only 2 pediatric cases reports ( 4 , 8) showing a much lower incidence then in adult . clinical manifestation of aip usually begins with prodromal ' flu - like ' upper respiratory infection symptoms , followed by rapid progression of dyspnea and respiratory failure that requires mechanical ventilation . in our case , the patient presented the same clinical course as in the previously reviewed cases ; beginning with mild cough and rhinorrhea , which was aggravated into respiratory failure requiring mechanical ventilation . most of the cases reported as aip had extensive bilateral air - space opacification with sparing of costophrenic angles on their chest radiograph . as aip moves from exudative to organizing stage , the radiograph shows less consolidation and presents a ground - glass appearance with irregular linear opacities ( 7 ) . the most common ct findings in aip patients are diffuse ground - glass attenuation with a mosaic pattern and consolidation ( often in the dependent regions of the lungs ) ( 2 ) . in the early exudative phase , the lung shows areas of ground - glass attenuation that are most often bilateral and patchy , with areas of focal sparing of lung lobules giving a geographic appearance . the later , organizing stage of aip is associated with distortion of bronchovascular bundles and traction bronchiectasis and cysts . in our case , there was bilateral diffuse consolidation of lungs with peripheral sparing zones on chest radiograph , and chest hrct showed diffuse ground - glass opacities and consolidations with sparing zones in the peripheral portion of each lobe , suggesting the early exudative phase of aip . this study was performed at the beginning of the patient 's respiratory difficulty , but follow - up hrct was not performed due to the patients critical condition . even though we could not undergo another follow - up hrct , her chest radiograph showed an increase of bilateral haziness and findings of spontaneous pneumomediastinum and subcutaneous emphysema with bronchiectatic changes , suggesting a progression into the late organizing phase . her 2-yr - old brother also showed same findings on chest ct , which was aggravated into bronchiectatic changes and pneumomediastinum on his chest radiograph . their 8-yr - old sister who did not have any symptoms only showed a mild degree of bilateral ground - glass opacities without progression to bronchiectactic changes of lung parenchyma . the histologic findings of aip include the features of acute and/or organizing phases of dad . the exudative phase shows edema , hyaline membranes , and interstitial acute inflammation ( 7 ) . in the organizing phase , organizing fibrin , loose organizing fibrosis within alveolar lumens with incorporation within alveolar septa , and type ii pneumocyte hyperplasia are seen ( 2 ) . in this case , the patient underwent autopsy and histologic finings showed hyaline membrane with interstitial edema and proliferation of interstitial fibroblasts suggesting the presence of both acute exudative and late organizing phases . treatment of aip is usually supportive and initially consists of oxygen supplement and noninvasive mechanical ventilation , but mechanical ventilation with positive - end - expiratory pressure is required in most patients . patients are often treated with corticosteroids , which may improve the outcome as in patients with adult respiratory distress syndrome ( ards ) ( 1 ) . treatment with newer agents such as surfactant , anti - cytokine antibodies , and inhaled nitric oxide traditionally used for ards , might be beneficial but are largely untested ( 3 ) . however , we did not use any newer agents other than corticosteroids in this case . even though corticosteroid was not effective in two patients who died of aip , it was effective in their asymptomatic older sister who had an incidental finding of ground - glass opacities on chest ct . her chest ct and pft findings were improved after administration of oral steroid agent . despite occurring in previously healthy persons , aip is associated with a poor prognosis ( 5 ) . according to a review of patient characteristics in the published series of aip by bouros et al . in 2000 , the mean 6-month mortality of patients with aip was 78% ( range , 60 - 100% ) ( 1 ) . olson et al . reported a 41% survival rate from 29 patients ( 1 ) , two other small published series , total 2 of 13 patients survived ( 3 , 9 ) . the prevalence of aip in childhood is rare , and only two cases of aip have been previously reported ; one of them survived after intravenous antibiotics and corticosteroid treatment ( 8) , and the other died on 40th day of admission ( 3 ) . in this case , the patient showed the same clinical course and radiologic , histologic findings as the previously reported aip cases in adults . notably , two other siblings , her 2-yr - old brother and 8-yr - old sister , also showed the similar radiologic findings indicative of aip , even though they had some different degrees of symptoms and destruction of lung parenchyma . considering the coincidence in three children however , we did not perform any genetic studies such as surfactant protein b and c. on the other hand , we could not exclude the possibility of an infectious origin , although the studies for infection were all negative . in summary , this rare case of aip in children gave us a chance to review the clinical course , radiologic and pathologic findings of aip in children , which showed no significant difference from those of adult cases in the literature ( 1 , 2 , 7 , 10 ) . furthermore , we first experienced three different phases of aip in one family : one clinically , radiologically , and histoloically confirmed aip ; another clinically and radiologically highly suspected as having aip ; and the other only radioloically suspected as having aip .

acute interstitial pneumonia ( aip ) is a rapidly progressive condition of unknown cause that occurs in a previously healthy individual and produces the histologic findings of diffuse alveolar damage . since the term aip was first introduced in 1986 , there have been very few case reports of aip in children . here we present a case of aip in a 3-yr - old girl whose other two siblings showed similar radiologic findings . the patient was confirmed to have aip from autopsy showing histological findings of diffuse alveolar damage and proliferation of fibroblasts . her 3-yr - old brother was also clinically and radiologically highly suspected as having aip , and the other asymptomatic 8-yr - old sister was radiologically suspected as having aip .

they have significant effect on the synthesis , mobilization , and metabolism of lipids and lipoproteins . dyslipidemia is a common metabolic abnormality in patients with thyroid disease , in either the overt or the subclinical forms of the disease . it has been known that overt hypothyroidism is associated with premature coronary heart disease and one of the components of this assumed to be a deteriorated metabolism of atherogenic lipoproteins . lipoprotein(a ) ( lp(a ) ) is a very large protein molecule wrapped around , and linked by a disulphide bond to , a ldl - like particle . there is a strong relationship with lp(a ) and coronary heart disease , independent of the standard vascular risk factors . autoimmune thyroiditis ( hashimoto thyroiditis ) is a very common disorder and it is the main reason for hypothyroidism . there are considerable sufficient data between the overt hypothyroidism , dyslipidemia , and coronary heart disease , although there are conflicting reports on whether subclinical hypothyroidism or euthyroid autoimmune thyroid disease has any influence on the lipoprotein metabolism . recently it was reported that thyroid autoimmunity may be an important mechanism for the occurrence of atherosclerosis and it is well known that lp(a ) is one of the main risk factors for the atherosclerosis . the aim of this study was to investigate the relationship of lipid parameters , lp(a ) levels , and thyroid hormones in hashimoto thyroiditis patients . one hundred and fifty - four premenopausal female hashimoto patients with a mean age of 37.19 7.98 sd years , followed up and treated in our outpatient clinic between july 2013 and october 2013 , were enrolled in this study . forty - eight patients had overt hypothyroidism ( age : 35.79 7.29 sd years ) , fifty patients had subclinical hypothyroidism ( age : 36.8 8.19 sd years ) , and fifty - six patients were euthyroid ( 36.3 8.11 sd years ) . the control group consisted of 50 healthy volunteers with a mean age of 35.42 7.64 sd years . the diagnosis of overt hypothyroidism ( oh ) was based on clinical findings , low serum free thyroxine ( ft4 ) levels , and high serum thyroid stimulating hormone ( tsh ) concentrations . subclinical hypothyroidism ( sh ) was established in terms of tsh levels 4.2 miu / ml and normal ft4 levels . euthyroid hashimoto ( eh ) was established as normal ft4 and tsh levels with only positive thyroid autoantibodies . patients and controls with diabetes mellitus , current and ex - smokers , obesity ( body mass index ( bmi ) > 30 kg / m ) , liver disease and systemic illness , excessive alcohol consumption , and a known family history of primary hyperlipidemia were excluded from the study . none of the subjects were receiving treatment with estroprogestin therapy , diuretics , blockers or lipid lowering drugs , or other medications that might alter serum lipid parameters and thyroid functions . none of the patients were receiving thyroid treatment and lipid level determinations were done on initial presentation , before the treatment . the simple index to determine insulin resistance [ i.e. , homeostasis model assessment ( homa - r ) > or = 2.5 ] was used , and subjects who were determined to be positive for insulin resistance according to this index were also excluded . the study was approved by local ethical committee . written informed consent was obtained from all the subjects . chemiluminescence immunoassay was done to assess tsh ( normal 0.4 to 4.2 miu / ml ) , free thyroxine ( normal : 0.93 and 1.7 ng / dl ) , free triiodotironin ( normal : 2.54.3 ng / ml ) , and serum autoantibodies against thyroglobulin ( tgab ) ( normal : 0115 iu / ml ) and thyroid peroxidase ( tpoab ) ( normal : 034 iu / ml eclia ( modular analytics e170 ; roche diagnostics ) ) . the measurements of total cholesterol ( total - c ) ( normal : 130200 mg / dl ) , high density lipoprotein ( hdl - c ) ( normal : > 50 mg / dl ) , low density lipoprotein ( ldl - c ) ( normal : 70130 mg / dl ) , and triglyceride ( tg ) ( normal : 60150 mg / dl ) levels were determined by enzymatic methods . lipoprotein(a ) ( normal 030 mg / dl ) was measured in turbidimetric method by spectrophotometry ( crony , jooly 100 ) . continuous data were expressed as the mean sd and median and interquartile ranges , when appropriate . one - way anova , mann - whitney u , and kruskal wallis tests were used to compare the parametric and nonparametric data of the groups . the demographic data and the laboratory results of the entire study group are summarized in table 1 . . however bmi was found higher in oh group than eh and controls as expected . tsh levels were higher in oh group than the other groups ( p < 0.0001 ) . sh patients also have higher tsh levels than the eh and control groups ( p < 0.0001 and p < 0.0001 ) . tsh levels were in normal limits in both control group and eh group ; eh patients have slightly higher tsh values than the control group ; however no statistical difference was found ( p = 0.05 ) ( table 2 ) . ft3 and ft4 levels were in normal limits in both eh and control groups and no difference was found in these parameters ( p = 0.13 and p = 0.08 , resp . ) between two groups . however , sh patients had lower ft4 and ft3 levels compared to eh ( p < 0.0001 and p = 0.002 , resp . ) and control group ( p < 0.0001 and p < 0.0001 ) . ft3 and tf4 levels were significantly lower in oh group than the other groups ( p < 0.0001 and p < total cholesterol , ldl - c , and tg levels were higher in total hashimoto groups than the control group ( p < 0.0001 in each ) . oh group has higher total - c , ldl - c , and tg levels than eh and control group as expected ( p < 0.0001 ) . oh patients also had higher total - c ( p = 0.004 ) , tg ( p = 0.01 ) , and ldl levels ( p = 0.008 ) compared to sh group . sh group had higher total - c ( p < 0.0001 ) , ldl - c ( p < 0.0001 ) , and tg levels ( p = 0.001 ) than the control group ( table 3 ) . sh group also had higher total - c ( p = 0.02 ) levels than the eh group ; however ldl - c ( p = 0.08 ) and tg levels ( p = 0.16 ) were similar to the eh group ( table 4 ) . on the other hand eh group has higher total - c ( p = 0.04 ) and ldl - c ( p = 0.01 ) levels but similar tg ( p = 0.05 ) levels to the control group . lp(a ) levels were higher in total hashimoto group than the control group ( p = 0.005 ) . oh patients had significantly higher lp(a ) levels compared to control group ( p < 0.0001 ) ; also patients with excess lp(a ) were more common in oh than the control group ( p < 0.0001 ) . oh patients have similar lp(a ) levels to sh patients ( p = 0.39 ) and eh group ( p = 0.15 ) ; however , lp(a ) excess was more common in oh than the eh ( p = 0.01 ) group . although lp(a ) levels were not different between oh and sh ( p = 0.86 ) group , excess lp(a ) was also similar ( p = 0.32 ) . on the other hand sh group has similar lp(a ) levels ( p = 0.86 ) to eh group and the control group ( p = 0.07 ) . in sh group excess lp(a ) however , sh group has more lp(a ) excess than the control group ( p = 0.001 ) . moreover eh patients also have similar lp(a ) levels to control group ( p = 0.08 ) , but in eh group excess lp(a ) was more common than in the control group ( p = 0.03 ) . lp(a ) was positively correlated with total - c ( p < 0.0001 , r = 0.41 ) , ldl - c ( p < 0.0001 , r = 0.42 ) , tg ( p = 0.001 , r = 0.22 ) , and tsh ( p = 0.003 , r = 0.20 ) and also negatively correlated with ft4 ( p = 0.003 , r = 0.20 ) . tsh was positively correlated with total - c ( p < 0.0001 , r = 0.40 ) , ldl - c ( p < 0.0001 , r = 0.38 ) , and tg ( p = 0.005 , r = 0.19 ) . ft4 was negatively correlated with total - c ( p < 0.0001 , r = 0.38 ) , ldl - c ( p < 0.0001 , p = 0.38 ) , and tg ( p = 0.007 r = 0.18 ) . however , ft3 was negatively correlated with total - c ( p < 0.0001 , r = 0.29 ) and ldl - c ( p = 0.0001 , r = 0.29 ) , but no correlation was found with tg ( p = 0.138 ) and lp(a ) ( p = 0.058 ) . there was no correlation between lp(a ) levels and thyroid autoantibodies ( ( p = 0.054 , r = 0.19 ) for anti - tpo and for ( p = 0.09 , r = 0.23 ) anti - tg ) this cross - sectional study shows increased total - c and ldl - c , tg and lp(a ) levels in hashimoto cohort compared with controls . lp(a ) was increased only in oh patients , although hyperlipoprotein(a)emia was more frequent in even euthyroid hashimoto patients . hashimoto 's thyroiditis ( chronic autoimmune thyroiditis ) is the most common cause of hypothyroidism in iodine - sufficient areas of the world . thyroid failure is seen in up to 10 percent of the population and its prevalence increases with age . in hypothyroidism major cardiovascular changes occur . decreased cardiovascular output and cardiac contractibility , increased peripheral vascular resistance , and reduced heart rate result in cardiovascular dysfunction . there are also significant changes in modifiable atherosclerotic risk factors such as dyslipidemia [ 8 , 9 ] . this is due to decreased ldl receptors ' activity , resulting in decreased catabolism of ldl and idl . moreover , a decrease in lipoprotein lipase ( lpl ) activity is found in overt hypothyroidism which decreases the catabolism of tg rich lipoproteins ; therefore oh patients showed to have increased tg levels [ 1 , 11 , 12 ] . in our cohort oh patients had increased total - c , ldl - c , and tg levels compared to controls , in accordance with the literature . also in sh patients reported to have increased total - c and ldl - c [ 1315 ] . in addition some studies have shown that , in sh , dyslipidemia may also be accompanied with increased tg levels [ 16 , 17 ] . in our study , total - c , ldl - c , and tg levels were higher in the sh than in the control group . interestingly , in our cohort eh patients also have increased ldl - c , total - c , and tg levels compared to the control group . tsh levels in our eh patients were not different from the control group . however , most of eh patients ' ( 35 of 56 patients ; 62% ) tsh values were in high - normal range ( 24 ng / ml ) . it has been recently reported that tsh levels in the upper limits of the reference range , in patients with coronary heart disease , had adverse effect on lipid profile . reported increased total - c and ldl - c levels in subjects with high - normal tsh levels but with positive antithyroid antibodies . also in a prospective population based study it has been shown that high tsh levels within the reference range may be associated with adverse serum lipids . tsh levels may covary with blood pressure and lipid levels among people with apparently normal thyroid function . similarly a recent large cohort study showed that tsh in the upper limit of the reference range ( above 2.5 also recently reported studies showed that autoimmunity may have some effect on dyslipidemia independent of the thyroid function . in our cohort , the increased total - c and ldl - c levels in eh patients imply that autoimmunity may have some adverse effect on lipid profile independent of the tsh value . lp(a ) is a form of ldl - c in which lp(a ) and apob are covalently bound by a disulphide bridge ; it may be particularly atherogenic and thrombogenic . several studies have pointed out that high lp(a ) levels are associated with atherosclerotic disease , including myocardial infarction [ 23 , 24 ] . it was shown that lp(a ) levels are increased in patients with oh and decrease after lt-4 treatment . however , most studies to date have not found significantly elevated lp(a ) levels in patients with sh and have not demonstrated any effect of lt-4 treatment on serum lp(a ) concentrations [ 2527 ] . it has been reported that euthyroid males and postmenopausal females with thyroid autoimmunity present with increased lp(a ) , implying the role of thyroid autoimmunity in the lp(a ) metabolism . in our study lp(a ) was increased in oh group , although lp(a ) levels were similar in sh , eh , and even in control group . however , lp(a ) excess , which we defined as lp(a ) > 30 mg / dl , was more frequent in oh group compared to other groups . moreover the interesting point in this study , lp(a ) excess , was also more frequent in sc and even eh than the control group . according to this finding , we may speculate that autoimmunity may have an influence on the lp(a ) metabolism , even with the normal tsh levels . in conclusion , this study shows that , in hashimoto thyroiditis even in normal tsh values , dyslipidemia may occur and increased total - c , tg , ldl - c , and lp(a ) excess may occur , which are the potential risk factors for atherosclerosis , considering the fact that these patients should be closely followed up in terms of cardiovascular events .

objective . the risk of atherosclerotic heart disease is increased in autoimmune thyroiditis , although the reason is not clear . lipoprotein(a ) ( lp(a ) ) excess has been identified as a powerful predictor of premature atherosclerotic vascular diseases . the aim of this study is to investigate the relationship between lp(a ) levels and thyroid hormones in hashimoto patients . method . 154 premenopausal female hashimoto patients ( 48 patients with overthypothyroid ( oh ) , 50 patients with subclinical hypothyroid ( sh ) , and 56 patients with euthyroid hashimoto to ( eh ) ) were enrolled in this study . the control group consists of 50 age matched volunteers . in every group , thyroid function tests and lipid parameters with lp(a ) were measured . lp(a ) excess was defined as lp(a ) > 30 mg / dl . results . total - c , ldl - c , tg , and lp(a ) levels were increased in hashimoto group . total - c , ldl - c , and tg levels were higher in sh group than in the control group . total - c and ldl - c levels were also higher in eh group compared to controls . lp(a ) levels were similar in sh and eh groups with controls . however , excess lp(a ) was more common in subclinical hypothyroid and euthyroid hashimoto group than in the control group . conclusion . the total - c and ldl - c levels and excess lp(a ) were higher even in euthyroid hashimoto patients . thyroid autoimmunity may have some effect on lp(a ) and lipid metabolism .

the transitionmetal complexes of heterotopic phosphanylthiolato ligands have been widely studied because of their applicability in some interesting reactions,1 such as salkylation / sdealkylations,2 , 3 carbothiolations,3 reductions,4 copolymerizations,5 or carbonylations.6 these complexes also have relevance in desulfurization technologies7 and in understanding the biological pathways of certain sulfurcontaining metalloproteins.8 for all these applications , the stereochemistry of these complexes has particular importance , as different stereoisomers could present different behavior in a given process.9 among all phosphanylthiolato ligands , we are particularly interested in 2phosphanylalkylthiolato ligands because they can support a resolved chiral carbon in the chelate chain.10 , 11 for group 10 metals ( m = ni , pd , and pt ) , the more abundant 2phosphanylalkylthiolato complexes are the bischelates , [ m(ligand p , s)2 ] , and the chlorocomplexes , [ mcl(sligand p , s)]2 or [ mcl(ligand p , s)(pr3 ) ] . taking as a model the 2(diphenylphosphanyl)ethanethiol ( hdppet ) derivatives , [ ni(dppet)2 ] shows a transp , p arrangement , both in solution and in the solid state.12 the same preferred stereochemistry was proposed for other nickel bischelates.10c , 12 , 13 for [ pd(dppet)2 ] , a transp , p geometry in solution was proposed by comparison with the bis[2(dimethylphosphanyl)ethanethiolato ] complex which shows characteristic virtual couplings for the methyl groups in the h and c{h } nmr spectra.14 the solidstate structure of [ pd(dppet)2 ] is unknown , but a transp , p arrangement is supported by the stereochemistry observed in other bischelates with chainsubstituted ligands.10a10b , 11a contrasting with [ pd(dppet)2 ] , some of these complexes show an equilibrium between the two geometric isomers ( cis / trans ) in solution.10a , 11a , 13 also the crystal structure of [ pt(dppet)2 ] ( 1 ) is unknown , and both cis 11a and trans 10b geometries in solid state were observed for other platinum bis[phosphanylalkylthiolato ] complexes . in solution , a cisp , p stereochemistry was suggested for 1 because of the absence of nmr virtual couplings in some platinum bis[(2methylphosphanyl)ethanethiolato ] analogues,13 , 14 and by the large value of the j ppt coupling constant.14 however , as we showed previously , the j ppt criterion is not always infallible.10b in keeping with the chlorocomplexes , nickel has preference for the binuclear complex [ nicl(sch2ch2pph2 p , s)]2,15 also observed for other phosphanylalkylthiolato ligands , both in solution and in solid state.10c , 11a mononuclear [ pdcl(dppet p , s)(pph3 ) ] proved to be stable in solution . no loss of pph3 takes place , and no dimeric palladium complexes were ever detected.6 this complex shows in solution an equilibrium between the two geometric isomers strongly displaced to the transp , p arrangement , but crystallization yields only the major stereoisomer . when an alkyl substituent is introduced in the chelate chain , as in the case of 1(diphenylphosphanyl)butyl2thiolato derivative , dissociation of pph3 and formation of the dimeric chlorocomplex , [ pdcl(sligand p , s)]2 , was described.11a for platinum , only the mononuclear cis[ptcl(dppet p , s)(pph3 ) ] was reported.16 as part of a project on the analysis of the ligandbased stereoelectronic effects that are determinant in the coordination conformations of phosphanylthiolato ligands around the metal,6 , 10 , 11 , 12 we now report new preparation methods , and the solid state structure , for bischelate 1 and for the unusual trinuclear complex [ ptcl(sch2ch2pph2 p , s)]3 ( 2 ) . complex 1 was first prepared in moderate yield ( 52 % ) from the reaction of k2ptcl4 and hdppet in the presence of net3 as a base.14 the potential problems related to the use of the base,10a together with the low yield of 1 with this method , prompted us to explore the direct , basefree , procedure . thus , reaction of k2ptcl4 with 2 equivalents of hdppet in a mixture of methanol / water cleanly afforded bischelate 1 , which was isolated in 92 % yield ( scheme 1 ) . alternatively , 1 can be also obtained by oxidative addition of the phosphanylthiol to pt(pph3)4 and subsequent reductive elimination of hydrogen . in this case , bischelate 1 was isolated in 70 % yield ( scheme 1 ) . according to the p{h } nmr spectrum , bischelate 1 exists as a single geometric isomer in solution , with a j ppt coupling constant of 2810.9 hz which suggest a cisp , p arrangement.14 the cis geometry of bischelate 1 in solid state was confirmed by the xray diffraction ( xrd ) crystal structure . reagents and conditions : a ) hdppet / meoh , k2ptcl4/h2o , 30 min , rt , 92 % ; b ) hdppet ( neat ) , pt(pph3)4/ch2cl2 , 30 min , rt , 70 % . the xrd study was carried out on a crystal of 1 obtained from dichloromethane hexane . selected bond lengths and bond angles are listed in the caption of figure 1 . the crystal structure reveals a mononuclear squareplanar complex with c2 symmetry and the platinum atom placed on the rotation axis ( figure 1 ) . crystal data for 1 and 2 ortep ( oak ridge thermal ellipsoid plot ) figure ( 50 % ) of complex 1 , h atoms are omitted for the sake of clarity ; selected distances ( ) and angles ( ) : ptp 2.2705(6 ) , pts 2.3233(6 ) , ppts 86.45(2 ) , pptp 104.98(3 ) , spts 82.14(3 ) , ppts 168.56(2 ) . symmetry transformation used to generate equivalent atoms : x , y , 1/2 z . the pts bond length is similar to those detected in other cis16 and transbis(phosphanylthiolato)15 complexes of platinum(ii ) , but the ptp is shorter than those observed in the trans geometries . the large pptp angle , nearly 105 , results from the cis orientation of the bulky pph2 groups that compress the spts angle to about 82 . the chelate angle , is in the order of those observed for mononuclear platinum(ii ) complexes with the pph2 group of a chelated dppet ligand cis to a pph3.16 the observed structural cis preference can be interpreted , in simple terms , on the basis of the antisymbiosis rule stating that two soft ligands in mutual trans positions have a destabilizing effect on each other when attached to a soft metal ion.17 to shed light into this preference for the cis conformation and get more detailed information , we envisaged density functional theory ( dft ) calculations . for our study m06/tzvp//m06/svp calculations on complex 1 reveal a favorable energy difference of only 1.3 kcal mol for the cis isomer . this small difference can be the result of a low antisymbiotic effect ( thiolates and phosphines are both soft bases ; for example , hardness of ch3s and pph2ch3 are 61.8 and 65.9 kcal mol , respectively ) and the steric interactions that favor the trans isomer . when the thermal and entropic effects are not introduced , the energetic preference for the cis arrangement increases to 3.7 kcal mol , which brings the computational results into much better agreement with experimental observations , and reveals a possible overestimation by our calculations of the entropic stabilization of the trans isomer as compared to the cis one . the large dipole moment of the cis isomer provides larger solvation energy in comparison with the nonpolar trans isomer.18 the chemical potential for the cis isomer of complex 1 is 70.5 kcal mol whereas it is 66.2 kcal mol for the trans conformation.19 in agreement with the maximum hardness principle,20 the chemical hardness of the cis conformation ( 41.5 kcal mol ) is somewhat higher than that of the trans conformation ( 41.3 kcal mol).21 given the low energy difference between both isomers , we investigated the reaction pathway to get complex 1 from pt(pph3)4 ( see figure 2 ) in the cis and trans conformations to discern whether kinetic effects are responsible for the formation of exclusively the cis isomer . formation of the cis isomer requires the generation of complex v in figure 2 . the sequential dissociation of phosphine groups is not energy demanding , provided that at least two based phosphorous ligands remain bonded to platinum , either in the form of triphenylphosphines or phosphanylthiol ligands . indeed the bisphosphine structure is isoenergetic with the bishdppet structure ( compare complexes iii and vii ) . this result concurs with the experimental fact that in the presence of a high concentration of hdppet with respect to the pt(pph3)4 precursor , the pph3 groups are easily substituted . in any case the coordination of the phosphanylthiolato does not occur through the thiolate moiety , but through the phosphine group . take for instance the coordination of the second molecule of hdppet to species viii , from which formation of complex x with the phosphine coordinated to pt is 20.0 kcal mol more stable than the same complex coordinated through the thiol group . once complex v is formed , the next dissociation of a phosphine ligand is not feasible without the oxidative addition of the sh bond of the hdppet ligand into the pt center to form complex ix . actually without removing the phosphine ligand , from complex v , this insertion takes places through a barrier of 11.5 kcal mol . from ix , bearing the excess of hdppet , the exchange of pph3 by hdppet is favored by 1.6 kcal mol , to form complex x. the final step that leads to complex 1 cis from species x takes places through a concerted transition state that involves a second oxidative addition and the reductive release of a hydrogen molecule in a process that requires 25.9 kcal mol . the rate determining step ( rds ) for the formation of 1 cis corresponds to this last x to 1 cis transformation . reaction pathways of the conversion of pt(pph3)4 to complex 1 ( red : the values of the transition states , relative gibbs energies in kcal mol ) . first , it might be generated directly from the cis conformation , that is , complex 1 cis , however the barrier to isomerize to the trans conformation is 37.1 kcal mol . second , complex v can also evolve to vii through successive exchange of phosphines by hdppet ligands . two consecutive sh oxidative additions followed by the reductive release of a hydrogen molecule in complex vii produce complex 1 trans in a process that has to surmount a gibbs energy barrier of 26.8 kcal mol . the xii to 1 trans process is the rds for the formation of complex 1 trans . this means that kinetically , the cis conformation is favored over the trans species by 0.9 kcal mol . a final pathway to form complex 1 trans could be the isomerization of complex viii to its trans conformation xi , that is , the rotation of the hydride by 90. this transformation requires surpassing a barrier of 33.0 kcal mol with respect to i , being the trans isomer 6.4 kcal mol higher in energy . our results show that formation of complex 1 cis is both thermodynamically and kinetically favored as compared to complex 1 trans formation . in both cases , the rds corresponds to the last step of the process that involves coordination of the phosphanylthiolato ligand and release of a h2 molecule . to further evaluate the preference for the cis isomer for complex 1 , its phenyl groups were substituted by either methyl or tertbutyl ( tbu ) groups , and then the trans isomer was found to be lower in gibbs energy by 0.8 and 15.2 kcal mol , respectively . these energy values reveal that highly sterically demanding groups like tbu impedes the formation of the cis conformation , and the comparison between methyl and phenyl substituents indicates a major preference of the cis for the latter substituent because of the stacking between its aryl groups . the structural deformation due to the substituents on the phosphorous is translated into the increase of the pptp angle , by 0.4 and 12.0 with methyl and tbutyl groups , respectively ( see figure 3 ) . optimized cis conformation of a ) [ pt(dppet)2 ] ( 1 ) , b ) [ pt(dmpet)2 ] , and c ) [ pt(dtbpet)2 ] ( selected distances ( ) and angles ( ) ) . to explore the possibility to obtain the dinuclear complex [ ptcl(sch2ch2pph2 p , s)]2 , similar to those observed for nickel15 and palladium,10a the basefree reaction of [ ptcl2(cod ) ] ( cod=1,5cyclooctadiene ) with 1 equivalent of hdppet in dichloromethane was performed , affording a quite insoluble material . according to the p{h } nmr spectrum , this solid is formed mainly by two products in a 2/1 ratio . the minor component shows a singlet with a chemical displacement and a j ppt coupling constant similar to those observed for the bischelate complex 1 . the major constituent of the mixture also shows a singlet , but at higher fields and with larger j ppt coupling constant . slow evaporation of the nmr solutions of this mixture produces a microcrystal ( 332 m ) which was studied by xrd . crystal data for the structure obtained , complex 2 , are given in table 1 . selected bond lengths and bond angles are listed in the caption of figure 4 . ortep figure ( 50 % ) of complex 2 , h atoms are omitted for the sake of clarity ; selected distances ( ) and angles ( ) : pt1p3 2.246(2 ) , pt1s3 2.283(2 ) , pt1cl1 2.340(2 ) , pt1s1 2.3651(19 ) , pt2p1 2.225(2 ) , pt2s1 2.2648(19 ) , pt2cl2 2.3345(19 ) , pt2s2 2.358(2 ) , pt3p2 2.248(2 ) , pt3s2 2.266(2 ) , pt3cl3 2.328(2 ) , pt3s3 2.401(2 ) , p3pt1s3 87.67(8 ) , s1pt1s3 95.33(7 ) , pt1s1pt2 109.66(8 ) , p1pt2s1 88.09(7 ) , s1pt2s2 83.73(7 ) , pt2s2pt3 105.20(9 ) , p2pt3s2 86.98(8 ) , s2pt3s3 89.54(7 ) , pt1s3pt3 111.25(8 ) . the crystal structure reveals a sulfurbridging edgesharing cyclic trinuclear complex with squareplanar coordination geometry around the platinum atoms ( figure 4 ) . related structures were found for aminoalkylthiolato , [ ptbr(sch2ch2nme2 n , s)]3,22 phosphanylarylthiolato , [ pti(sc6h42pph2 p , s)]3 23 and [ pti{sc6h42p(1,1biphenyl) p , s}]3 , 24 and arsanylarylthiolato ligands , [ pti(sc6h42pas2 as , s)]3,25 but complex 2 is , to our knowledge , the first example with phosphanylalkylthiolato ligand . the ciscl , p arrangement is in disagreement with the antisymbiosis rule,17 but the ciss , s geometry is necessary to build the sixmembered pt3s3 cycle . this cycle adopts a skewboat conformation ( figure 5 ) with each bridging sulfur atom showing one shorter and one longer pts bond ( figure 4 ) . similar unsymmetrical bridging sulfurs were observed in related compounds.23 , 24 the spts angles are smaller than ptspt ones because of the restriction imposed by the metal squareplanar coordination . two of the three fivemembered chelate cycles adopt a conformation with both phenyl radicals of the pph2 group in a pseudo equatorial position . the third chelate cycle shows a conformation which locates one of the phenyl groups in axial position ( figure 6 ) . on the face of the pt3s3 cycle where this phenyl is placed , there is no other group that generates steric repulsions , resulting in the most favorable situation . the squareplanar geometry around platinum is somewhat distorted with a chelate angle slightly reduced from the idealized value of 90. quite similar distortions from the idealized geometry are also observed in other platinum(ii ) complexes with chelated dppet ligands.16 , 26 the intramolecular ptpt distances are greater than 3.65 suggesting no metal metal covalent interactions . ortep figure ( 50 % ) of the pt3s3 cycle with the platinum squareplanar coordination sphere of complex 2 . selected distances and angles ortep figure ( 50 % ) of the pt3s3 cycle with the platinum squareplanar coordination sphere of complex 2 . concerning the mechanism of the reaction , as we have observed in this work , the p{h } nmr of the reaction mixture of one equivalent of the phosphanylarylthioarsine phassc6h42pph2 with [ pti2(cod ) ] shows initially the existence of a mixture of the bischelate and a second complex with chemical displacement at lower frequencies and larger j ppt coupling constant . the second compound resulted to be the trinuclear [ pti(sc6h42pph2 p , s)]3.23 this parallelism , and the crystal structure obtained , allow us to assign the major component of our reaction mixture to complex 2 . regarding the reaction pathway , formation of the bischelate complex 1 has been postulated as the kinetically favored process , elapsing through a mononuclear intermediate ( scheme 2).23 the subsequent reaction of 1 with the mononuclear intermediate and unconverted starting product ( path a ) can generate a trinuclear intermediate that should isomerize to the final thermodynamic product 2 . this pathway is similar to that proposed for the formation of [ pti(sc6h42pph2 p , s)]3 , in which the trinuclear intermediate was identified , and the kinetic product , the bischelate , is totally transformed into the ultimate trinuclear complex.23 in present work , the trinuclear intermediate has not been detected , and no interconversion between complexes 1 and 2 was observed , pointing to a quick association of the mononuclear intermediate to give trinuclear complex 2 ( pathway b in scheme 2 ) . to understand the trinuclear structural preference for complex 2 , dft calculations were carried for this complex and for the hypothetical binuclear intermediate [ ptcl(sch2ch2pph2 p , s)]2 , as well as for any moiety able to link complexes 1 and 2 . first , the structural results on complex 2 showed good agreement between the experimental and theoretical data . the standard deviation for the bond distances is 0.053 and that for the angles is 1.3 ,27 , 28 thus providing confidence in the reliability of the chosen method to reproduce geometries of the studied complexes . furthermore , although there is the experimental insight that both mononuclear and trinuclear species are diamagnetic , we performed calculations for neutral closedshell singlet groundstate structures , but we also checked how far was the lowestlying excited triplet state . in all cases , the triplet state presented a higher energy ( the difference between these two states for 1 is 31.9 kcal mol ) , indicating that the singlet states are the most favored . figures 7 and 8 map the paths b and a that drive [ ptcl2(cod ) ] to 2 and 1 , respectively . the first step ( a to b in figure 7 ) involves the dissociation of the neutral cod ligand together with the coordination of a hdppet ligand this new squareplanar intermediate b might be in competition with the cationic moiety where the leaving group was a chloride instead of the cod . anyway chloride substitution is endergonic by 6.4 kcal mol , and , therefore , cod release is much more favorable . the next proton transfer from the thiol group to the chloride and release of hcl molecule requires 23.5 kcal mol and drives to a somewhat unstable intermediate d that trimerizes easily to complex 2 . the formation of this trinuclear complex from complex d is found to be barrierless and quite exergonic ( 39.4 kcal mol ) . thus this result shows that pathway b involves relatively lowenergydemanding steps , and it is thermodynamically favored . reaction pathway of the conversion of [ ptcl2(cod ) ] to complex 2 ( red lines display the transition states , in blue is the corresponding profile with hdmpet ligand , gibbs energies relative to 3 [ ptcl2(cod)]+3 hdmpet ligands ( in kcal mol ) . reaction pathway of the conversion of intermediate d to complex 1 ( red lines display the transition states , in blue is the corresponding profile with hdmpet ligand , gibbs energies relative to 3 [ ptcl2(cod)]+3 hdmpet ligands ( in kcal mol ) . alternatively , instead of the trinuclear interaction , intermediate d can interact with a new hddpet substrate molecule to yield complex e ( figure 8) . this complex can easily be transformed into f after overcoming a barrier of 8.5 kcal mol . final release of an hcl molecule yields 1 cis complex in a process that is 21.4 kcal mol endergonic . on the other hand , from species d , the trans conformation of 1 might be also feasible , overcoming a barrier 17.0 kcal mol . our results show that once complex d is generated , formation of 2 is kinetically and thermodynamically more favorable than obtaining any of the mononuclear species 1 . this result is in agreement with the principle of maximum hardness since the chemical hardness for complex 2 is 7.8 kcal mol higher than that of complex 1 cis . although the process to get the dimeric structures , including either two chloride or sulfur bridges is barrierless , thermodynamically it is 30.2 kcal mol less favorable than the formation of the trinuclear structure . on the other hand , the other trinuclear structure proposed as an intermediate in path a ( scheme 2 ) was also investigated , but located to be 6.6 kcal mol higher in energy than 2 . despite its rather high stability , its formation requires the formation of complex 1 first , which is ruled out according to the mechanism proposed in figure 8 . the substitution of the phenyl groups by methyl or tertbutyl groups on the phosphorous atoms did not change any qualitative trend , and quantitatively all barriers were nearly identical . thermodinamically , the energy released with respect to the precursor [ ptcl2(cod ) ] in the formation of 2 is higher when the phenyl groups in the phosphines are substituted by methyl ( 13.2 kcal mol ) or tertbutyl ( 8.7 kcal mol ) groups . this confirms that the nature of phosphine substituents is not determining the feasibility of the formation of trinuclear species . the transition metal complexes of heterotopic phosphanylthiolato ligands are important for their use in many interesting reactions . in this work , bischelate complex [ pt(sch2ch2pph2, p , s)2 ] ( 1 ) has been obtained in good yields by direct basefree substitution reaction of the corresponding thiol with k2ptcl4 or by oxidative addition of the thiol to pt(pph3)4 . the xrd studies of this complex 1 shows a cisp , p arrangement in agreement with the antisymbiosis rule . density functional theory ( dft ) calculations on 1 indicate that the cis geometry is preferred over the trans one for both thermodynamic and kinetic reasons . the rate determining step for the formation of complex 1 is the final step , which involves an oxidative addition of the sh bond of a phosphanylthiol ligand into the pt center and the reductive release of a hydrogen molecule . direct basefree reaction of [ ptcl2(cod ) ] with one equivalent of the thiol produces the trinuclear complex [ ptcl(sch2ch2pph2 p , s)]3 ( 2 ) with squareplanar coordination geometry around the platinum atoms and a pt3s3 cycle in skewboat conformation . our dft calculations show that formation of the trinuclear structure occurs through clpt(dppet ) complex d. once this rather unstable intermediate is formed , the formation of the trinuclear structure is a barrierless and quite exergonic process . on the contrary , formation of the mononuclear and dinuclear species involves nonnegligible energy barriers and leads to thermodynamically less stable products . general remarks : the complexes were synthesized using standard schlenk techniques under n2 atmosphere . the solvents were dried by standard methods and distilled and deoxygenated before use . the c , h , and s analyses were carried out using a carlo erba microanalyser ( lakewood , usa ) . h nmr spectra were recorded at 200 mhz on a bruker dpx200 spectrometer ( billerica , usa ) . p{h } nmr spectra were recorded on the same instrument operating at 81.0 mhz . chemical shifts are relative to external 85 % h3po4 , and downfield values are reported as positive . [ pt{sch2ch2pph2 p , s } 2 ] ( 1 ) . method 1 : hdppet ( 30 mg , 0.12 mmol ) in meoh ( 2 ml ) was added to a solution of k2ptcl4 ( 24.7 mg , 0.06 mmol ) in deionized h2o ( 3 ml ) . the mixture was allowed to react for 30 min at rt , the solvent is evaporated in vacuo down to 0.5 ml , and et2o ( 1 ml ) is slowly added to precipitate an intense yellow microcrystalline solid . the product is separated by filtration , washed with et2o , and dried under a current of n2 yielding complex 1 ( 24 mg , 92 % ) . method 2 : neat hdppet ( 112 mg , 0.44 mmol ) was added to a solution of pt(pph3)4 ( 285 mg , 0.22 mmol ) in ch2cl2 ( 8 ml ) . the mixture is allowed to react for 30 min at rt , and hexane ( 1 ml ) is slowly added to precipitate 1 ( 105 mg , 70 % ) . completely dry complex 1 is stable in air , slightly soluble in ch2cl2 and insoluble in chcl3 , etoh , meoh , toluene , et2o , and hexane . h nmr ( 200 mhz , cd2cl2 , tms ) : =2.52 ( m , 4 h , aliphatics ) , 78 ppm ( m , 10 h , aromatics ) . p{h } nmr ( 81 mhz , cd2cl2 , h3po4 ) : =61.70 ppm ( s , j ppt=2810.9 hz ) . the low solubility of 1 precluded the observation of a goodquality c nmr spectrum . calcd for c28h28p2pts2 ( 685,7 ) : c 49.05 , h 4.12 , s 9.35 ; found c 49.29 , h 4.30 , s 9.65 . [ ptcl(sch2ch2pph2 p , s ) ] 3 ( 2 ) : neat hdppet ( 123 mg , 0.50 mmol ) was added to a solution of [ ptcl2(cod ) ] ( 236.5 mg , 0.50 mmol ) in ch2cl2 ( 8 ml ) . the mixture was allowed to react for 1 h at rt , the solvent was evaporated in vacuo down to 3 ml , and et2o ( 5 ml ) was slowly added to give a yellow precipitate . the product was separated by filtration , washed with et2o , and dried under a current of n2 , yielding a solid ( 189.7 mg ) practically insoluble in ch2cl2 , and insoluble in chcl3 , et2o , and hexane . p{h } nmr ( 81 mhz , cd2cl2 , h3po4 ) : major product =45.27 ppm ( s , j ppt = ca . 3343 hz ) , minor product =62.18 ppm ( s , j ppt = ca measured crystals were prepared under inert conditions immersed in perfluoropolyether as protecting oil for manipulation . crystal data are presented in table 1 , and selected distances and angles in the captions of figure 1 and 4 . data collection : crystal structure determinations for 1 and 2 were carried out using a siemens p4 diffractometer ( munich , germany ) equipped with an smart 1000 ccd area detector , a mac science co. rotating anode with mok radiation , a graphite monochromator , and a siemens lowtemperature device ( t=120 c ) . programs used : data collection smart,29 data reduction saint,30 and absorption correction sadabs.31 structure solution and refinement : crystal structure solution was achieved using direct methods as implemented in shelxtl32 and visualized using the program xp . missing atoms were subsequently located from difference fourier synthesis and added to the atom list . leastsquares refinement on f using all measured intensities was carried out using the program shelx93 . comments on the structures : compound 1 crystallizes with a half molecule in the asymmetric unit showing c2 symmetry . four of the benzenes rest linked to the phosphorous atoms are disordered in two orientations with an approximate ratio of 60:40 . although the triclinic crystal used for the structure determination of 2 was of extremely small dimensions ( 332 m ) , an excellent dataset could be collected . all the dft calculations were performed at the generalized gradient approximation ( gga ) level with the gaussian09 set of programs,33 using the m06 functional of truhlar.34 the electronic configuration of the molecular systems was described with the standard splitvalence basis set with a polarization function of ahlrichs and coworkers for h , c , n , p , s , and cl ( svp keyword in gaussian).35 for pt we used the quasirelativistic stuttgart / dresden effective core potential , with an associated valence basis set ( standard sdd keywords in gaussian09).36 the geometry optimizations were carried out without symmetry constraints , and the characterization of the stationary points was performed by analytical frequency calculations . these frequencies were used to calculated unscaled zeropoint energies ( zpes ) as well as thermal corrections and entropy effects at 298 k and 1 atm by using the standard statisticalmechanics relationships for an ideal gas . energies were obtained via single point calculations on the m06optimized geometries with triple zeta valence plus polarization ( tzvp keyword in gaussian ) using the m06 functional as well.30 in these singlepoint energy calculations , h , c , n , p , s , and cl were described using the tzvp basis set , while for pt , the sdd basis set was employed . on top of the m06/tzvp / m06/svp energies , we added the zpes , thermal corrections obtained at the m06/svp level . in addition , to calculate the reported gibbs energies , we included solvent effects of a ch2cl2 solution estimated with the polarizable continuous solvation model pcm implemented in gaussian09.37 the chemical potential is a measure of the tendency of the electrons to escape from the system . it is calculated from the partial derivative of the electronic energy with respect to the total number of electrons . the hardness , , is a measure of the resistance of a chemical species to change its electronic configuration , and it is defined as the secondorder partial derivative of the total electronic energy with respect to the total number of electrons . using a finite difference approximation and the koopmans theorem , one obtains the expressions we have used for the calculation of the chemical potential and the hardness:(1)=lumo+homo2 , ( 2)=lumo - homo2 , where lumo and homo are the energies of the low unoccupied molecular orbital ( lumo ) and the high occupied molecular orbital ( homo ) , respectively . general remarks : the complexes were synthesized using standard schlenk techniques under n2 atmosphere . the solvents were dried by standard methods and distilled and deoxygenated before use . the c , h , and s analyses were carried out using a carlo erba microanalyser ( lakewood , usa ) . h nmr spectra were recorded at 200 mhz on a bruker dpx200 spectrometer ( billerica , usa ) . p{h } nmr spectra were recorded on the same instrument operating at 81.0 mhz . chemical shifts are relative to external 85 % h3po4 , and downfield values are reported as positive . [ pt{sch2ch2pph2 p , s } 2 ] ( 1 ) . method 1 : hdppet ( 30 mg , 0.12 mmol ) in meoh ( 2 ml ) was added to a solution of k2ptcl4 ( 24.7 mg , 0.06 mmol ) in deionized h2o ( 3 ml ) . the mixture was allowed to react for 30 min at rt , the solvent is evaporated in vacuo down to 0.5 ml , and et2o ( 1 ml ) is slowly added to precipitate an intense yellow microcrystalline solid . the product is separated by filtration , washed with et2o , and dried under a current of n2 yielding complex 1 ( 24 mg , 92 % ) . method 2 : neat hdppet ( 112 mg , 0.44 mmol ) was added to a solution of pt(pph3)4 ( 285 mg , 0.22 mmol ) in ch2cl2 ( 8 ml ) . the mixture is allowed to react for 30 min at rt , and hexane ( 1 ml ) is slowly added to precipitate 1 ( 105 mg , 70 % ) . completely dry complex 1 is stable in air , slightly soluble in ch2cl2 and insoluble in chcl3 , etoh , meoh , toluene , et2o , and hexane . h nmr ( 200 mhz , cd2cl2 , tms ) : =2.52 ( m , 4 h , aliphatics ) , 78 ppm ( m , 10 h , aromatics ) . p{h } nmr ( 81 mhz , cd2cl2 , h3po4 ) : =61.70 ppm ( s , j ppt=2810.9 hz ) . the low solubility of 1 precluded the observation of a goodquality c nmr spectrum . calcd for c28h28p2pts2 ( 685,7 ) : c 49.05 , h 4.12 , s 9.35 ; found c 49.29 , h 4.30 , s 9.65 . [ ptcl(sch2ch2pph2 p , s ) ] 3 ( 2 ) : neat hdppet ( 123 mg , 0.50 mmol ) was added to a solution of [ ptcl2(cod ) ] ( 236.5 mg , 0.50 mmol ) in ch2cl2 ( 8 ml ) . the mixture was allowed to react for 1 h at rt , the solvent was evaporated in vacuo down to 3 ml , and et2o ( 5 ml ) was slowly added to give a yellow precipitate . the product was separated by filtration , washed with et2o , and dried under a current of n2 , yielding a solid ( 189.7 mg ) practically insoluble in ch2cl2 , and insoluble in chcl3 , et2o , and hexane . p{h } nmr ( 81 mhz , cd2cl2 , h3po4 ) : major product =45.27 ppm ( s , j ppt = ca . 3343 hz ) , minor product =62.18 ppm ( s , j ppt = ca measured crystals were prepared under inert conditions immersed in perfluoropolyether as protecting oil for manipulation . crystal data are presented in table 1 , and selected distances and angles in the captions of figure 1 and 4 . data collection : crystal structure determinations for 1 and 2 were carried out using a siemens p4 diffractometer ( munich , germany ) equipped with an smart 1000 ccd area detector , a mac science co. rotating anode with mok radiation , a graphite monochromator , and a siemens lowtemperature device ( t=120 c ) . programs used : data collection smart,29 data reduction saint,30 and absorption correction sadabs.31 structure solution and refinement : crystal structure solution was achieved using direct methods as implemented in shelxtl32 and visualized using the program xp . missing atoms were subsequently located from difference fourier synthesis and added to the atom list . leastsquares refinement on f using all measured intensities was carried out using the program shelx93 . comments on the structures : compound 1 crystallizes with a half molecule in the asymmetric unit showing c2 symmetry . four of the benzenes rest linked to the phosphorous atoms are disordered in two orientations with an approximate ratio of 60:40 . although the triclinic crystal used for the structure determination of 2 was of extremely small dimensions ( 332 m ) , an excellent dataset could be collected . all the dft calculations were performed at the generalized gradient approximation ( gga ) level with the gaussian09 set of programs,33 using the m06 functional of truhlar.34 the electronic configuration of the molecular systems was described with the standard splitvalence basis set with a polarization function of ahlrichs and coworkers for h , c , n , p , s , and cl ( svp keyword in gaussian).35 for pt we used the quasirelativistic stuttgart / dresden effective core potential , with an associated valence basis set ( standard sdd keywords in gaussian09).36 the geometry optimizations were carried out without symmetry constraints , and the characterization of the stationary points was performed by analytical frequency calculations . these frequencies were used to calculated unscaled zeropoint energies ( zpes ) as well as thermal corrections and entropy effects at 298 k and 1 atm by using the standard statisticalmechanics relationships for an ideal gas . energies were obtained via single point calculations on the m06optimized geometries with triple zeta valence plus polarization ( tzvp keyword in gaussian ) using the m06 functional as well.30 in these singlepoint energy calculations , h , c , n , p , s , and cl were described using the tzvp basis set , while for pt , the sdd basis set was employed . on top of the m06/tzvp / m06/svp energies in addition , to calculate the reported gibbs energies , we included solvent effects of a ch2cl2 solution estimated with the polarizable continuous solvation model pcm implemented in gaussian09.37 the chemical potential is a measure of the tendency of the electrons to escape from the system . it is calculated from the partial derivative of the electronic energy with respect to the total number of electrons . the hardness , , is a measure of the resistance of a chemical species to change its electronic configuration , and it is defined as the secondorder partial derivative of the total electronic energy with respect to the total number of electrons . using a finite difference approximation and the koopmans theorem , one obtains the expressions we have used for the calculation of the chemical potential and the hardness:(1)=lumo+homo2 , ( 2)=lumo - homo2 , where lumo and homo are the energies of the low unoccupied molecular orbital ( lumo ) and the high occupied molecular orbital ( homo ) , respectively . as a service to our authors and readers , this journal provides supporting information supplied by the authors . such materials are peer reviewed and may be reorganized for online delivery , but are not copyedited or typeset . technical support issues arising from supporting information ( other than missing files ) should be addressed to the authors .

abstractthe transitionmetal complexes of heterotopic phosphanylthiolato ligands are useful in various reactions which depend on the stereochemistry of the complexes . bischelate complex [ pt(sch2ch2pph22 p , s)2 ] ( 1 ) was obtained in good yields by direct basefree substitution reaction of the corresponding phosphanylthiol ( hsch2ch2pph2 ) with k2ptcl4 or by oxidative addition of the same phosphanylthiol to pt(pph3)4 . in agreement with the antisymbiosis rule , complex 1 shows a cisp , p arrangement in solid state crystallizing in the monoclinic system ( c2/c ) . density functional theory ( dft ) calculations on 1 reveal the right characteristics for the preferred cisp , p arrangement , rationalizing its formation . direct basefree reaction of [ ptcl2(1,5cyclooctadiene ) ] with one equivalent of the same phosphanylthiol produce the trinuclear complex [ ptcl(sch2ch2pph22 p , s)]3 ( 2 ) instead of the binuclear structure common in palladium and nickel derivatives . crystals of 2 are triclinic ( p 1 ) showing a sulfurbridging edgesharing cyclic trinuclear complex with squareplanar coordination geometry around the platinum atoms and a pt3s3 cycle in skewboat conformation . this preference for the trinuclear structure was rationalized mechanistically and through conceptual dft .

fifty - seven newly hatched male chickens ( samvirke kylling norway , ross 308 ) from the same hatching farm were used in this experiment conducted at the norwegian university of life sciences . animal treatment and animal facilities all complied with the guide for the care and use of laboratory animals ( 15 ) . all animals were cared for according to norwegian laws and regulations for experiments with live animals ( the animal protection act of december 20th , 1974 , and the animal protection ordinance concerning experiments with animals of january 15th , 1996 ) . the chickens were randomly assigned into one of four dietary 22 day treatments . during the first 10 days each group of 14 to 15 animals were kept in deep littered pens ; 75 cm150 cm . at day 10 they were weighed and individually placed in wire - floored metabolism cages up until day 22 . the room temperature was maintained at 32c from days 03 , then gradually reduced by 0.5c per day until day 22 . they were exposed to 23 h light and 1 h dark photoperiod days 07 , the next 2 weeks they were exposed to 24 h dark ; the dark periods were between 1721 h and 0004 h. the chickens had free access to feed and water . water troughs and wire - floors were cleaned daily , with small possibility of coprophagy . none of the birds were sick or died during the feeding period . at day 22 the chickens were weighed , killed by carbon dioxide narcosis and dissected immediately after death . organs and limbs were packed in aluminum foil , frozen in liquid nitrogen and stored at 20c before being analyzed . rapeseed oil was purchased from afb , askim , norway and contained 60% oleic acid , 20% linoleic acid and 10% alpha linolenic acid . rendered animal fat ( raf ) was obtained locally and contained fat from ruminants ( about 70% ) and pigs ( about 30% ) . the composition of raf was ( by weight ) : 26% palmitic acid , 18% stearic acid , 36% oleic acid and 8% linoleic acid . fully hydrogenated soybean oil ( hso ) , refined to remove k1 and ineffective dihydrophylloquinone together with trans - fatty acids , were purchased from aak ( aarhus - karlshamn ) sweden ab . the level of k1 in hso was less than 10% of the original amount in untreated soybean oil . all four feeds were wheat based and composed according to guidelines adjusted to the requirements of chickens ( table 1 ) . the feeds were manufactured at fortek , aas , norway , with a matrix type 2.5 mm46 mm at a rate of 600 they had the same basic composition with regard to protein , carbohydrates , minerals and vitamins except vitamin k. all diets contained lipid in the form of oils and solid fats . the control ( ctr ) feed group contained vitamin k1 from rapeseed oil and soy bean oil ; mk-4 from raf and added k3 . the experimental feeds contained natural levels of k1 and mk-4 from raf , fully hso or a mixture of animal rendered fat and fully hso ( mix ) . the experimental diets contained 2% natural soybean oil to provide a small supplement of k1 ( table 1 ) . the experimental feeds had mk-4 levels from 20 to 50% of the k1 level . composition of the experimental feeds including levels of vitamin k notes : all feeds contained monocalcium phosphate 2% ; ground limestone 1.85% ; nacl 0.25% ; dl - methionine 0.4% , l - lysine 0.3% ; l - threonine 0.1% ; choline chloride 0.13% and mgo 6.5710% . vitamin and mineral mixture provided the following per kg feed : retinyl acetate , 2.7 mg ; cholecalsiferol , 0.07 mg ; dl - alpha tocopheryl acetate , 38 mg ; pyridoxine , 3.4 mg ; riboflavin , 9 mg ; ca - pantothenate , 12.5 mg ; biotin , 0.19 mg ; thiamine , 1.9 mg ; niacin , 37.5 mg ; cobalamine , 0.02 mg ; folic acid , 1.5 mg ; choline chloride , 500 mg ; manganese , 75 mg ; zinc , 75 mg ; iron , 95 mg ; cupper , 10 mg ; iodine , 0.6 mg ; selenium , 0.43 mg . vitamin k in liver , pancreas and feeds were analyzed by hplc using a c-18 reversed phase column and fluorometric detection after postcolumn electrochemical reduction according to thijssen et al . bending resistance was tested in a ta - xt2 texture analyzer from stable micro systems , godalming , surrey , uk ( www.stablemicrosystems.com ) . probe velocity was at 0.1 mm / s , and the distance between the supports was 32.5 mm . load - versus - time curves were generated and analyzed by means of texture expert exceed v2.64 software . bending resistance was calculated from the initial linear segment of the graphs and expressed as n / mm . statistical calculations ( linear regression ) on the effect of the four dietary treatments were performed by spss 15.0 ibm spss , statistical analyses software ( http://www.spss.com/ ) , using comparative means by one - way anova and bonferroni test for assumption of equal variances . fifty - seven newly hatched male chickens ( samvirke kylling norway , ross 308 ) from the same hatching farm were used in this experiment conducted at the norwegian university of life sciences . animal treatment and animal facilities all complied with the guide for the care and use of laboratory animals ( 15 ) . all animals were cared for according to norwegian laws and regulations for experiments with live animals ( the animal protection act of december 20th , 1974 , and the animal protection ordinance concerning experiments with animals of january 15th , 1996 ) . the chickens were randomly assigned into one of four dietary 22 day treatments . during the first 10 days each group of 14 to 15 animals were kept in deep littered pens ; 75 cm150 cm . at day 10 they were weighed and individually placed in wire - floored metabolism cages up until day 22 . the room temperature was maintained at 32c from days 03 , then gradually reduced by 0.5c per day until day 22 . they were exposed to 23 h light and 1 h dark photoperiod days 07 , the next 2 weeks they were exposed to 24 h dark ; the dark periods were between 1721 h and 0004 h. the chickens had free access to feed and water . water troughs and wire - floors were cleaned daily , with small possibility of coprophagy . at day 22 the chickens were weighed , killed by carbon dioxide narcosis and dissected immediately after death . organs and limbs were packed in aluminum foil , frozen in liquid nitrogen and stored at 20c before being analyzed . rapeseed oil was purchased from afb , askim , norway and contained 60% oleic acid , 20% linoleic acid and 10% alpha linolenic acid . rendered animal fat ( raf ) was obtained locally and contained fat from ruminants ( about 70% ) and pigs ( about 30% ) . the composition of raf was ( by weight ) : 26% palmitic acid , 18% stearic acid , 36% oleic acid and 8% linoleic acid . fully hydrogenated soybean oil ( hso ) , refined to remove k1 and ineffective dihydrophylloquinone together with trans - fatty acids , were purchased from aak ( aarhus - karlshamn ) sweden ab . the level of k1 in hso was less than 10% of the original amount in untreated soybean oil . all four feeds were wheat based and composed according to guidelines adjusted to the requirements of chickens ( table 1 ) . the feeds were manufactured at fortek , aas , norway , with a matrix type 2.5 mm46 mm at a rate of 600 kg / h . they had the same basic composition with regard to protein , carbohydrates , minerals and vitamins except vitamin k. all diets contained lipid in the form of oils and solid fats . the control ( ctr ) feed group contained vitamin k1 from rapeseed oil and soy bean oil ; mk-4 from raf and added k3 . the experimental feeds contained natural levels of k1 and mk-4 from raf , fully hso or a mixture of animal rendered fat and fully hso ( mix ) . the experimental diets contained 2% natural soybean oil to provide a small supplement of k1 ( table 1 ) . the experimental feeds had mk-4 levels from 20 to 50% of the k1 level . composition of the experimental feeds including levels of vitamin k notes : all feeds contained monocalcium phosphate 2% ; ground limestone 1.85% ; nacl 0.25% ; dl - methionine 0.4% , l - lysine 0.3% ; l - threonine 0.1% ; choline chloride 0.13% and mgo 6.5710% . vitamin and mineral mixture provided the following per kg feed : retinyl acetate , 2.7 mg ; cholecalsiferol , 0.07 mg ; dl - alpha tocopheryl acetate , 38 mg ; pyridoxine , 3.4 mg ; riboflavin , 9 mg ; ca - pantothenate , 12.5 mg ; biotin , 0.19 mg ; thiamine , 1.9 mg ; niacin , 37.5 mg ; cobalamine , 0.02 mg ; folic acid , 1.5 mg ; choline chloride , 500 mg ; manganese , 75 mg ; zinc , 75 mg ; iron , 95 mg ; cupper , 10 mg ; iodine , 0.6 mg ; selenium , 0.43 mg . vitamin k in liver , pancreas and feeds were analyzed by hplc using a c-18 reversed phase column and fluorometric detection after postcolumn electrochemical reduction according to thijssen et al . was tested in a ta - xt2 texture analyzer from stable micro systems , godalming , surrey , uk ( www.stablemicrosystems.com ) . probe velocity was at 0.1 mm / s , and the distance between the supports was 32.5 mm . load - versus - time curves were generated and analyzed by means of texture expert exceed v2.64 software . bending resistance was calculated from the initial linear segment of the graphs and expressed as n / mm . statistical calculations ( linear regression ) on the effect of the four dietary treatments were performed by spss 15.0 ibm spss , statistical analyses software ( http://www.spss.com/ ) , using comparative means by one - way anova and bonferroni test for assumption of equal variances . weight at day 11 and 22 showed that the chickens in the experimental groups ate slightly more and the raf and hso group grew significantly faster than the mix and ctr groups indicating a satisfactory nutritional status ( table 2 ) . information on feed and weight of the chicken from day 11 to day 22 notes : values are means and sd . means with different letters within the same row are significantly different at the 5% level . total amount of mk-4 eaten by the chicken was significantly different , being highest in the ctr group and lowest in the hso group , while for k1 no difference between experimental group but significantly higher in the control group ( table 2 ) . pancreas had higher vitamin k concentration than liver ( table 3 ) . in liver , mk-4 was the most abundant vitamer , while in pancreas mk-4o was the main vitamer . the association between the amounts of mk-4 consumed and mk-4 in liver was statistically significant . levels of vitamin k in liver and pancreas and femur bending resistance notes : values are means and sd . means with different letters within the same row are significantly different at the 5% level . the concentration of total mk-4 and mk-4o in pancreas as well as in liver is associated with mk-4 consumed . the bending resistance of the femur was slightly higher in the experimental groups than in the control group , with no difference between the experimental groups ( table 3 ) . weight at day 11 and 22 showed that the chickens in the experimental groups ate slightly more and the raf and hso group grew significantly faster than the mix and ctr groups indicating a satisfactory nutritional status ( table 2 ) . information on feed and weight of the chicken from day 11 to day 22 notes : values are means and sd . means with different letters within the same row are significantly different at the 5% level . total amount of mk-4 eaten by the chicken was significantly different , being highest in the ctr group and lowest in the hso group , while for k1 no difference between experimental group but significantly higher in the control group ( table 2 ) . pancreas had higher vitamin k concentration than liver ( table 3 ) . in liver , mk-4 was the most abundant vitamer , while in pancreas mk-4o was the main vitamer . the association between the amounts of mk-4 consumed and mk-4 in liver was statistically significant . levels of vitamin k in liver and pancreas and femur bending resistance notes : values are means and sd . means with different letters within the same row are significantly different at the 5% level . the concentration of total mk-4 and mk-4o in pancreas as well as in liver is associated with mk-4 consumed . the bending resistance of the femur was slightly higher in the experimental groups than in the control group , with no difference between the experimental groups ( table 3 ) . our experimental model seems to suggest that conversion of k1 to mk-4 did not take place in the presence of adequate levels of mk-4 in the feed , not even in the feed group with the lowest level of mk-4 ( hso ) . in the test groups recently , a specific enzyme that converts k1 to mk-4 has been discovered and described ( 10 ) . the production capacity of this enzyme has not been compared with or distinguished from the menadione prenylation system ( 5 ) , so published evidence is as yet insufficient for a full quantitative picture of the various sources and pathways of synthesis in normally fed animals . liver and pancreas appears to use mk-4 in different ways ; in liver 1/3 of mk-4 is converted to mk-4o while in pancreas almost all is as mk-4o . the chickens were in good health with good bone resistance without supplements of k3 in the feed but at least a natural content of 23 ng mk-4/g feed .

objectivethe aim of this study was to determine the biological effects of natural dietary intake of vitamin k as phylloquinone ( k1 ) and menaquinone-4 ( mk-4 ) and a control diet also containing menadione ( k3 ) on levels of k1 and total mk-4 ( menaquinone-4 ) and menaquinone-4 - 2,3-epoxide ( mk-4o ) ) in liver and pancreas , and on femur bending resistance in a fast - growing animal model.designchickens were fed four wheat - based diets from day 11 to day 22 after hatching . the diets contained different combinations of fat sources : rapeseed oil , animal rendered fat , soybean oil and hydrogenated soybean oil . concentration of k1 in the three experimental diets was 120 ng / g whereas mk-4 levels were 23 , 52 and 63 ng / g respectively . the control diet contained 157 ng k1/g , 75 ng mk-4/g and 2.250 ng k3/g.resultsgrowth rates and femur strength confirmed adequate supply of nutrients and vitamin k in the test groups . there were no significant differences in femur bending resistance among the test groups , but these were higher than the control . k1 , mk-4 and mk-4o were found in liver . in pancreas , mainly mk-4o was found with small amounts of mk-4 , but none had content of k1 . in the test groups the hepatic levels of mk-4 and mk-4o reflected the dietary intake of mk-4.conclusionthe chickens were in good health with good bone resistance without supplements of k3 in the feed , but at least a natural content of 23 ng mk-4/g feed . liver and pancreas appears to use mk-4 in different ways .

the cdna microarray method has been developed recently and has been successfully applied to genomewide analysis of gene expression stimulated by hormones and/or chemicals ( inoue and pennie 2002 ; watanabe and iguchi 2003 ) . knowledge of the patterns in the expression of estrogen - responsive genes is essential to understanding the action mechanism of estrogenic chemicals on mouse reproductive organs . a large number of genes affected by estrogen were selected from the mouse ( moggs et al . 2002a , 2002b , 2003a ) and rat uterus ( daston and naciff 2005 ) . for most of the selected genes , their expression was not altered following e2 treatment in er- knockout mice , thus confirming the dependency of these genes on er-. activation of these genes suggests a basis for the marked uterotrophic effect observed several days following estrogen administration . characteristic gene expression patterns were observed for each environmental estrogenic chemical , and these patterns were distinct from that of e2 , thereby suggesting specific mechanisms of action for endocrine disruption that could be different from that induced by endogenous estrogen ( daston and naciff 2005 ; watanabe et al . 2004a ) . physiological estrogens ( e2 ) , nonphysiological estrogens ( des ) , and dioxin have distinct effects on uterine gene expression ( watanabe et al . 2003b , 2004b ) . in the liver , however , np and dioxin activated another set of genes that were distinct from estrogen - responsive genes ( watanabe et al . thus , these results suggest that only a small number of genes are directly involved in the uterotrophic effects of estrogen treatment , and np has effects very similar to those of e2 on gene expression in uterus but not in hepatic tissue . tissue - specific effects , therefore , should be considered in order to elucidate the distinct effects of various edcs . extensive studies on contaminant - exposed and reference populations of american alligator ( alligator mississippiensis ) have revealed altered steroidogenesis , abnormal circulating hormone levels , hepatic transformation of androgen and endocrine organ morphology in juvenile alligators living in polluted environments , and a number of contaminants in eggs , serum , and body tissues ( guillette and iguchi 2003 ) . affinity of some compounds is relatively high for alligator ers , and many compounds can displace e2 from the er ( guillette et al . 2002 ) in all species of crocodilians , sex is determined not by a genetic mechanism alone but also by the temperature at which the egg is incubated . in the alligator , the thermosensitive period ( tsp ) for sex determination is the 7- to 10-day window within stages 2124 of development ( lang and andrews 1994 ) . treating embryos with estrogen during the tsp produces female offspring even at male incubation temperatures . . however , the mechanisms of estrogen action on sex determination in the alligator are still uncertain . furthermore , studies of contaminant - exposed alligators have shown alterations in steroid action ( guillette and iguchi 2003 ; guillette et al . 1994 ) . whether these abnormalities are caused , in part , by alterations in steroid receptor expression the cdna encoding the ers and the progesterone receptors ( pr ) was isolated ( katsu et al . 2004 ) . the er- amino acid sequence is similar to that of chicken er- ( 91% ) . the er- sequence of the nile crocodile is quite similar to that of the american alligator . the turtle er- sequence is closer to that of alligators than to that of the chicken ( katsu et al . several thousand expressed sequence tags ( ests ) from the cdna library of adult alligators and those of the gonads of embryos incubated at temperatures that produce all males or all females have been sequenced and clustered . we are currently establishing an alligator microarray for the study of the molecular mechanism of sex determination and of the chemical effects on sex determination and the toxic effects of chemicals . exogenous chemicals that can interfere with the thyroid hormone axis could pose a significant hazard to human and wildlife health ( colborn 2002 ; zoeller 2003 ) . amphibians represent a suitable model for monitoring reproductive performance , advanced development including metamorphosis , and sexual maturation ( kloas 2002 ) . the influence of np , bpa , and e2 on developing xenopus laevis embryos was analyzed . embryos were exposed to these agents between 3 and 96 hr postfertilization ( p.f . ) . short body length , microcephaly , flexure , edema , and abnormal gut coiling were induced by 4.4 mg / l np or bpa or by 2.7 mg / l e2 at 96 hr p.f . interestingly , the stages of embryos sensitive to bpa and np were different ; bpa affected earlier stages , whereas np affected later stages ( sone et al . bpa interferes with the assembly of microtubules ( metzler and pfeiffer 1995 ) and causes mitotic arrest and aberrant spindles ( ochi 1999 ) . these bpa actions may affect the susceptibility of embryos , especially at the earliest stages . insensitivity of x. laevis embryos to bpa after 12 hr p.f . may reflect the weak in vitro activity of bpa relative to np or e2 ( nishikawa et al . transcriptional levels of aromatase and er genes increased from stage 56 in x. laevis ( miyashita et al . 2000 ) , although er mrna was detected at stage 8 ( nishimura et al . 1997 ) . considering the ability of estrogen treatment to induce ectopic expression of the er ligand binding domain of fused mrna ( kolm and sive 1995 ) , it is possible that genes under the regulation of the estrogen er pathway are inactive at the developmental stages tested but are capable of transcriptional activation in the presence of an exogenous ligand . to establish a model system for studying the effects of edcs on marine fish , we examined the effects of e2 on the early development of fundulus heteroclitus . e2 ( 2.72 g / l ) reduced hatching and survival rates , and induced malformations with incomplete ossification of bones and 100% females ( urushitani et al . 2002 ) . to clarify the mechanisms contributing to these developmental effects of exogenous estrogen , we cloned fundulus er- ( fher- ) , which shared 81% identity with medaka ( oryzias latipes ) er- . a receptor binding assay using the fher- ligand - binding domain showed that alkylphenols bind to fher- 50 times more efficiently than to human er- ( urushitani et al . we characterized the estrogenicity of 4-methylbenzylidene , camphor , octylmethoxycinnamate , and propyl paraben ( n - propyl - p - hydroxybenzoate ) using medaka vitellogenin ( vtg ) plasma concentration , vtg , and choriogenin mrna expressions ( inui et al . we are currently establishing a medaka microarray containing known genes related to steroidogenesis , sex development , degradation of chemicals , and estrogen - responsive genes . the occurrence of intersexuality has been reported in wild roach ( rutilus rutilus ) ( jobling et al . 1998 ) , gudgeon ( gobio gobio ) ( van aerle et al . 2001 ) , and flounder ( platichthys flesus ) ( allen et al . 1999 ) in the united kingdom and in flounder ( pleuronectes yokohamae ) in japan ( hashimoto et al . endocrine disruption of roach is thought to be caused by estrogenic agents in sewage effluents . in intersex roach , sexual maturation , 2002a , 2002b ) . to understand the molecular mechanisms of intersex in roach that are induced by substances in sewage effluents , we have cloned genes of er- , er- , ( androgen receptor ( ar ) , pr , aromatase brain type , aromatase gonad type , dmrt-1 , and other genes related to steroidogenesis . we are now establishing a roach microarray system . a number of studies have documented endocrine disruption derived from estrogenic responses caused by exposure to pesticides ( wester 1991 ) , surfactants ( white et al . induction of secondary sex characteristics such as malelike coloration in female guppy ( poecilia reticulata ) , development of malelike gonopodium , and altered reproductive behavior in female mosquitofish ( gambusia affinisi ) have been reported following exposure to pulp mill effluent ( drysdale and bortone 1989 ; howell et al . these data indicate the existence of contaminants with androgenic activity , which mimic or block endogenous androgen by interacting with the receptor in the aquatic organisms ( durhan et al . however , compared with our knowledge of estrogenic environmental chemicals , the substances and mechanisms of androgenic action remain unclear ( gray et al . recent studies with wild fathead minnows ( pimephales promelas ) have suggested the presence of potent androgenic substances in feedlot effluent ( orlando et al . together with other wastewater contaminants , feedlot effluent has become a major ecological health concern . trenbolone acetate , an androgenic and anabolic steroid , is a potent agonist of ar , and it has been used extensively as a growth promoter for beef cattle in the united states . we have cloned mosquitofish ( gambusia affinis affinis ) ar- and ar- , and studied the effects of 17-trenbolone ( tb ) , a hydoxylated active compound of trenbolone acetate , on adult and newborn mosquitofish . tb induced masculinization of the anal fin , accompanied by a transient up - regulation of ar- and ar- in adult females . tb also induced differentiation of the anal fin into the gonopodium in fry at 0.310 g / l and stimulated precocious spermatogenesis in males and the formation of ovotestis in females at 110 g / l ( sone et al . small freshwater fish used widely for toxicology research include the japanese medaka , the fathead minnow , and the zebrafish . to date , very little has been done to apply genomics technologies to ecological risk assessment of aquatic species such as fish . current genome sequencing efforts for several fish models such as zebrafish , medaka , and fathead minnow make these fish potential candidates for large - scale efforts to incorporate genomics technologies in an effort to understand the mechanistic toxicity pathways for environmental stressors ( miracle and ankley 2005 ) . in addition , genome sequencings are under way in other species such as european flounder , sheepshead minnow ( cyprinodon variegates ) , large mouth bass ( micropterus salmoides ) , rainbow trout ( onchorhynchus mykis ) , and the three - spined stickleback ( gusterosteus aculeatus aculeatus ) . therefore , it is likely that the dynamic picture of various biological systems will be understood in the near future . in contrast to the relatively large effort to examine the estrogenic / antiestrogenic and androgenic / antiandrogenic action of various environmental chemicals in vertebrates , there has been relatively little research on the tremendous array of invertebrates that inhabit fresh and marine water environments . detailed information concerning the effects and mechanisms of action of industrial chemicals in invertebrates has been obtained from only a few invertebrate species , although invertebrates represent more than 95% of the known species in the animal kingdom ( defur et al . the masculinizing effects , known as imposex and characterized by development of a vas deferens and a penis in females , of organotin compounds , such as tributyltin ( tbt ) , on snails have been found in about 150 species of mollusks ( gibbs and bryan 1986 ; horiguchi et al . the mechanism by which tbt induces imposex in marine snails is still unknown , although tbt has been shown to inhibit aromatase activity ( bettin et al . pg / l , an environmentally relevant concentration , for 4 weeks induced imposex in rockshells ( thais clavigera ) ; however , injection of the aromatase inhibitor , fadrozole , alone or in combination with testosterone ( t ) did not induce imposex ( horiguchi t , katsu y , ohta y , iguchi t , unpublished data ) . aromatization of [ h]-t to [ h]-e2 was encountered in the rockshell gonad extract ( katsu y , horiguchi t , iguchi t , unpublished data ) . these results suggest that neither inhibition of aromatase by tbt nor androgen action by tbt is the principal cause of imposex in rockshells . cells trans - fected with a rockshell er - like sequence showed ligand - independent reporter gene activation ( katsu y , horiguchi t , iguchi t , unpublished data ) , which suggests that the rockshell er - like sequence has a specific unknown function in the rockshell , but it is unlikely that it acts like vertebrate er . in the freshwater snail , marisa cornuarietis , bpa and octylphenol ( op ) at concentrations as low as 1 g / l induced development of an additional vagina , enlargement of the accessory pallial sex glands , and enhancement of oocyte production . in the marine prosobranch , nucella lapillus , the same concentrations of bpa and op reduced the length of the penis and the size of the prostate gland ( oehlmann et al . such results suggest that these snails have a functional er and , thus , that estrogenic chemicals could have a negative impact on these snails . rxr , one of the nuclear receptors , from humans and from xenopus has been activated by tbt in reporter gene assay systems ( grun f , watanabe h , zamanian z , maeda l , arima k , chubacha r , et al . , unpublished data ) . tbt and 9-cis retinoic acid have been shown to activate the rockshell rxr , and 9-cis retinoic acid has been shown to induce imposex in the rockshell ( nishikawa et al . these results suggest that future research to examine the mechanism of action of edcs in invertebrates needs to focus on other nuclear hormone receptors distinct from the er and the ar . reproductive , acute , or chronic toxicity tests on daphnids have been used widely for aquatic toxicology . conflicting results on the molting frequency of daphnia magna following exposure to estrogenic chemicals have been reported ( caspers 1998 ) . a xenoestrogen - induced reduction in the molting frequency of d. magna ( niederlehner et al . 1998 ; zou and fingerman 1997 ) could not be confirmed for bpa ( tatarazako et al . we found that styrene dimers and trimers , leached from disposable polystyrene cups , reduced the number of offspring in ceriodaphnia dubia . styrenes ( 0.041.7 g / l ) , ecdysones ( 0.11.08 g / l ) , and juvenile hormone agonists ( 1.05 g / l ) reduced fertility , whereas e2 and bpa had no effect on the reproduction of c. dubia . np ( 280 g / l ) influenced daphnids via membrane damage ( tatarazako et al . we have cloned a full - length sequence of an ecdysone receptor from d. magna and established an ecdysone reporter gene assay ( watanabe et al . we and others have revealed that exposure of adult daphnids to juvenile hormones and their analogs induces parthenogenetically reproducing d. magna to produce male neonates ( olmstead and leblanc 2002 , 2003 ; tatarazako et al . 2003 ) . ten juvenoids [ pyriproxyfen , fenoxycarb , methylfarnesoate , juvenile hormone i ( jh i ) , jh ii , jh iii , methoprene , kinoprene , hydroprene , and epofenonane ] have induced male neonate production ( oda et al . in addition , daphnids are susceptible to the male sex determining effect of juvenoids during early oogenesis ( olmstead and leblanc 2002 ; tatarazako et al . although there was a wide range of sensitivity to fenoxycarb ( 0.69.3 g / l ) , the production of male neonates in all four species ( moina macrocopa , moina micrura , c. dubia , and c. reticulata ) demonstrates that this phenomenon is a common response to juvenoids ( oda et al . these findings suggest that juvenile hormone agonists , including some insecticides , affect the chemical signaling responsible for inducing the production of male offspring . we constructed a cdna library of d. magna and characterized the ests of over 7,000 clones ( watanabe et al . 2005 ) . to understand the molecular functional mechanism of juvenile hormone agonists in the induction of male offspring , we are currently analyzing juvenile hormone binding protein and establishing a micoroarray system for d. magna . much of the literature to date on the edc issue focuses on steroid hormone receptor mediated toxicity . therefore , information on gene and protein expression mediated by hormone receptors is essential for understanding chemical effects . species differences with respect to the interaction of various chemicals with ers and with regard to the metabolism of chemicals have been observed . therefore , we are currently cloning receptors of various steroid hormones , and steroid and xenobiotic receptors ( sxr ) , from various animal species , including alligator , quail , and various fish species , in order to find species that are sensitive to edcs . we are also focusing on orphan nuclear receptors that may provide new insights into the mechanisms of chemical action , as shown with rxr activation by tbt in gastropods and even in xenopus and mice . analyses of transgenerational effects of xenobiotic agents are also required in order to estimate and confront potential dangers to human and wildlife populations . there are also species differences in the response of er and sxr to chemicals , in degradation of chemicals , in critical sensitive windows , and in development . to clarify the adverse effects of chemicals , we need to understand the timing of gene expression ( critical developmental window ) , the amount of gene expression ( amount of chemicals ) in specific organs , the degradation ability of chemicals , and the normal range of various biomarkers in each species . by the application of omic technologies ( genomics , transcriptomics , proteomics , and metabolomics ) in the study of edcs , we will understand the detailed mechanisms of action of chemicals in the future . in this review , we have focused primarily on receptor - mediated gene expression ; however , it is critical to broaden the spectrum of hormonal disruption in the hypo - thalamic pituitary end gland axes , and to include the ability of animals to cope with stress or chemical communication ( propper 2005 ) . further basic biological understanding of comparative molecular endocrinology , genomics , and toxicology in animal species is essential in order to be able to apply omics technologies to the study of wildlife species .

chemicals released into the environment potentially disrupt the endocrine system in wild animals and humans . developing organisms are particularly sensitive to estrogenic chemicals . exposure to estrogens or estrogenic chemicals during critical periods of development induces persistent changes in both reproductive and nonreproductive organs , including persistent molecular alterations . estrogen - responsive genes and critical developmental windows of various animal species , therefore , need to be identified for investigators to understand the molecular basis of estrogenic activity during embryonic development . for investigators to understand molecular mechanisms of toxicity in various species , toxicogenomics / ecotoxicogenomics , defined as the integration of genomics ( transcriptomics , proteomics , metabolomics ) into toxicology and ecotoxicology , need to be established as powerful tools for research . as the initial step toward using genomics to examine endocrine - disrupting chemicals , estrogen receptors and other steroid hormone receptors have been cloned in various species , including reptiles , amphibians , and fish , and alterations in the expression of these genes in response to chemicals were investigated . we are identifying estrogen - responsive genes in mouse reproductive tracts using cdna microarrays and trying to establish microarray systems in the american alligator , roach , medaka , and water fleas ( daphnia magna ) . it is too early to define common estrogen - responsive genes in various animal species ; however , toxicogenomics and ectotoxicogenomics provide powerful tools to help us understand the molecular mechanism of chemical toxicities in various animal species .

as per world population project the proportion of elderly is going to increase from current 7% to 11% in 2025 and about 20% in 2050 with an estimated number to be 315 million . depression is the most common psychiatric disorder among the elderly which can manifest as major depression or as minor depression characterized by a collection of depressive symptoms . the prevalence of depression in elderly in india is rising as reported by many community as well as hospital based studies which vary from 6% to 50% . this study was carried out to find out the prevalence and associated socio - demographic variables of depression among elderly ( 60 years ) in the out patient department ( opd ) registration area of a tertiary care hospital in north - east delhi . this cross - sectional study was conducted among elderly subjects visiting the guru teg bahadur hospital , an approximately 1200 + bedded tertiary care hospital situated in the north east district of delhi . taking the prevalence of depression among elderly ( 60 years ) to be 40% , permissible relative error as 10% and an expected non - response rate of 10% , the sample size was calculated to be 660 . subjects were selected by convenience sampling . those seriously ill or not able to fill the questionnaire were excluded from the study . the objectives of the study and the right to withdraw at any time were explained to the participants and and verbal consent was taken . the first part comprised of socio - demographic information covering a diverse set of parameters namely age , sex , marital status , education , caregivers , employment status , financial dependence and the type of family system the subject was currently residing in . the second part was a prevalidated hindi version of the geriatric depression scale ( gds - h ) was used . depression was considered present when the score on the gds-15 was 5 points or more . univariate statistical comparison of variables was done between the depressed and non - depressed group . a stepwise multiple logistic regression analysis was applied to determine independent predictors of depression in the elderly subjects . the data collection instrument consisted of two parts . the first part comprised of socio - demographic information covering a diverse set of parameters namely age , sex , marital status , education , caregivers , employment status , financial dependence and the type of family system the subject was currently residing in . the second part was a prevalidated hindi version of the geriatric depression scale ( gds - h ) was used . depression was considered present when the score on the gds-15 was 5 points or more . univariate statistical comparison of variables was done between the depressed and non - depressed group . a stepwise multiple logistic regression analysis was applied to determine independent predictors of depression in the elderly subjects . seven hundred forty potential subjects were approached in a consecutive manner with the request for participation in the study . six hundred and ninety subjects agreed to participate , giving a response rate of 93.24% , the majority ( 86% ) of the non - responders being females . twelve subjects did not complete the interview due to lack of time . in the end 678 subjects majority of the study subjects were in the age group of 60 - 65 years with a mean age of 65.13 ( 4.92 ) years . a large proportion ( 64.7% ) of the elderly was either unemployed or retired and very few ( 2.3% ) were living alone . out of 678 study subjects 61.4% ( 95% ci : 57.6 - 65.1% ) were screened positive for depression . table 2 shows the percentage of depressed subjects according to various socio - demographic variables and univariate comparison of socio - demographic variables between the depressed and non - depressed groups . frequency of gds-15 items in the study subjects ( n=678 ) , rank - ordered univariate analysis of various socio - demographic variables associated with depression in the study subjects the variables like age , gender , marital status , education , current employment status , per capita income , pattern of financial support , any chronic health problem and presence or absence of caregiver were subjected to multiple logistic regression analysis . multiple logistic regression analysis showed that higher age , low educational status , financial dependence and having any chronic health problems were significantly independent predictors of depression in our study subjects . the mental health of the older population is usually a neglected domain in our country . as such , the older persons are forced to spend their last years of life with a very poor quality of life . our study reported a high ( 61.4% ) prevalence of depression among the study subjects . previous indian community - based data are limited and widely disparate , most likely reflecting non - uniform methodology . similarly a rural community based study in ballabgarh in northern india revealed the prevalence of depression among population aged 55 and above to be 40% . this comparatively higher prevalence of depression in present study may be due to the fact that , it is a hospital based study and the sample consisted of patients in the opd registration area . it is known that people with co - morbid conditions are more likely to suffer from depression . increase in age in the later life is significantly associated with an increased risk of depression . old age is associated with various physical disabilities which lead to dependency on others for daily activities , which may be a reason for depression in elderly . , a low level of education was directly associated with depression in the elderly subjects . the educated elderly can easily adjust with the situation as compared to illiterates and therefore are at a lesser risk for depression . elderly dependent on children , pension , charity or other family members for financial support were at higher risk ( aor=1.75 , 95% ci=1.10 - 2.81 ) for depression than those who were self - dependent . lower income and financial dependency on others for fulfillment of daily needs as well as health care expenses of a person in late life produces depressive symptoms which substantiate the findings from other authors . this study shows that presence of any chronic health problem increases the risk of depression by 1.43 times ( 95% ci=1.01 - 2.02 ) . this corroborates with the findings of previous studies that many chronic somatic diseases like pain , diabetes , hypertension , respiratory diseases etc . absence of care giver was found to be strongly associated with depression in elderly ( aor=5.68 , 95% ci=1.85 - 17.40 ) . previous studies and reviews have also mentioned that negligence by the family members , lack of affection and care at the later stage of life is the most important factor for depression among elderly . though females were having higher prevalence of depression , the association was not statistically significant , which is in contrast to several other studies and reviews that have shown a significant relationship of female sex with the depression . studies have shown that the psychometric properties of the gds are weaker when used on people with cognitive impairment . since this was a hospital based study and the study subjects were patients coming to the hospital generalizability of our results may be restricted . studies have shown that the psychometric properties of the gds are weaker when used on people with cognitive impairment . screening for people with cognitive impairment was not done in our study . since this was a hospital based study and the study subjects were patients coming to the hospital generalizability of our results may be restricted . the burden of depression among elderly patients is quite high and hence the risk factors found in this study should merit attention by the consulting physician .

background : depression is the most common geriatric psychiatric disorder . other than organic , socio - demographic factors , have been found to play an important role in mental health . in this study we evaluated the association of some socio - demographic factors with geriatric depressionmethods : a cross - sectional study was carried out in the out patient department registration area of a tertiary care teaching hospital in delhi . questionnaire based interviews were conducted among the elderly people visiting the hospital . a 15-item geriatric depression scale - hindi was used to assess depression.results:six hundred and seventy eight subjects were interviewed . the age of the subjects ranged from 65 to 85 years . about three - fourth of the study population were males . about 61.4% scored positive for depression . multiple logistic regression analysis revealed that the following were significant ( p<0.05 ) independent predictors of depression : higher age , low educational status , financial dependence and presence of any chronic health problem.conclusions:the present study found that the prevalence of depression among the study subjects was high . also the independent risk factors found in this study need to be targeted in formulating mental health policy for geriatrics .

functional community ambulation requires an ability to perform cognitive tasks while walking and an ability to adapt to extrinsic environmental factors that increase the complexity of mobility , such as obstacle avoidance ( e.g. , curbs ) and time - critical tasks ( e.g. , crossing the street within the time constraints imposed by traffic signals ) . a reduced capacity for dual - task walking may limit community mobility . research has shown that healthy older adults experience significant decrements in gait speed when cognitive tasks are performed while walking , a phenomenon referred to as dual - task interference or cognitive - motor interference . a limitation of the existing research on dual - task interference in aging is that it has focused predominantly on dual - task performance during unobstructed walking at preferred gait speed . therefore , the effect of dual - task interference on gait and cognitive performance during more attention - demanding gait tasks remains largely unknown . furthermore , because slowing down during unobstructed walking in the gait laboratory is inconsequential for successful completion of the motor task , individuals may place more importance on performing the cognitive task . indeed , healthy young and older adults appear to place greater priority on the secondary ( nongait ) task in many dual - task situations [ 4 , 5 ] . it seems reasonable to assume that when gait task complexity increases and there is a greater potential threat to stability , individuals would place more importance on completing the gait task safely . bock et al . examined the dual - task costs of performing cognitive and gait tasks of varying difficulty in both young and older adults . the authors concluded that in dual - task conditions , older adults were at greater risk for falls than young adults . however , the effect of task difficulty on dual - task interference was not explicitly analyzed and remains unclear . numerous studies have examined dual - task effects on gait during obstacle avoidance in older adults [ 615 ] , but none have directly compared the dual - task effects during obstacle negotiation to those during unobstructed walking . recently examined the effects of walking task difficulty ( usual walking versus narrow - based walking ) on dual - task performance in young adults . they found that walking task difficulty affected walking performance but not cognitive performance . because this study included only dual - task conditions with specific instructions to focus primarily on either the cognitive task or the gait task , it is not known what effect task difficulty has on a person 's default prioritization ; that is , the way in which the person chooses to allocate his attention in the absence of explicit instruction . moreover , the study included only young adults , so age - related differences in the effects of task difficulty on dual - task interference are not currently known . the purpose of this study was to determine the effect of gait and cognitive task difficulty on dual - task interference in healthy young adults and older adults . we hypothesized that as the difficulty of the gait task increased , attention to gait would increase , resulting in smaller dual - task effects relative to simple walking ( unobstructed at self - selected speed ) . we focus on gait speed as the measure of gait performance in dual - task conditions , since meta - analysis results show that cognitive - motor interference effects across a range of cognitive tasks are prominent in gait speed . furthermore , because research has shown that dual - task effects on gait vary according to the type of cognitive task , we explore our hypothesis in two different cognitive - motor dual - task combinations . twenty young adults ( mean age 21.7 years , range 2027 ) and 15 older adults ( mean age 72.1 years , range 6684 ) were recruited through advertisements at northeastern university and local senior centers . to be included , participants had to be 1830 years or older than 65 years , be able to walk independently in the community for at least 50 meters , have intact cognition according to the mini - mental state exam ( score > 23 ) , and have normal or corrected - to - normal hearing and vision . participants were excluded if they had a history of neurological disorders , any orthopedic conditions affecting gait , reported more than 2 falls in the past year , had an acute hospital stay within the last 3 months , or had a lower extremity amputation . demographic information was collected for each participant , including age , gender , and education . cognitive abilities of the participants were characterized using the mini - mental state exam , digit substitution test , stroop color - word interference test , comprehensive trail making tests , and the activities - specific balance confidence ( abc ) scale . functional mobility was assessed using the timed up and go test ( tug ) . each participant performed three gait tasks and two different cognitive tasks in isolation ( single - task conditions ) and each gait task in combination with each of the cognitive tasks ( dual - task conditions ) . the cognitive tasks were the auditory stroop and the clock task . in the auditory stroop task , participants heard the words high and low spoken in either a high pitch ( 360 hz ) or a low pitch ( 180 hz ) . the participants were instructed to indicate the pitch of the word they heard ( ignoring the actual word presented ) by responding verbally high or the participants heard a time ( e.g. , one - twenty - five ) and were required to determine whether the two hands of the clock at the given time were in the same half ( left / right ) or opposite halves . yes ; if the hands were in opposite halves , the participants were asked to respond no . there were no clock - task stimuli in which one of the hands was exactly on the twelve or six ( e.g. , one - thirty ) . for each task , the participants completed at least two practice blocks of 30 trials while sitting . single - task performance in each cognitive task was recorded in sitting and was always performed immediately before the dual - task conditions . both the stroop and clock tasks were produced using directrt ( empirisoft , new york , ny , usa ) . the stimuli were delivered through wireless headphones and participant responses were recorded through a wireless microphone ( logitech , newark , ca ) . for both cognitive tasks , we measured reaction time ( in milliseconds ) and accuracy ( percent of correct responses ) . our assumption was that the clock task was more difficult because it required greater cognitive processing . the three gait tasks were walking at self - selected speed ( ss ) , walking at fastest comfortable speed ( fc ) , and walking at fastest comfortable speed while stepping over an obstacle ( ob ) . a critical assumption was that walking at fastest comfortable speed was more attention - demanding than walking at preferred ( self - selected ) speed , and that walking fast and stepping over an obstacle further increased the demands of the task . all gait tasks involved participants walking across a 6.1-meter platinum gaitrite walkway , which contains pressure activated sensors . the participants started and finished each pass 2 meters beyond the end of the walkway so that only steady state gait data were captured . participants completed 6 passes of the walkway for each condition and the average of the 6 passes was used for analysis . in the ob condition , a 15 cm high hurdle was placed at the 4.5 m mark of the gaitrite walkway . the order of the three gait tasks was randomized , but was performed in the same order for the single - task and the two dual - task ( stroop , clock ) blocks . block order ( single , stroop , clock ) was also randomized across participants . to analyze the effect of task difficulty on dual - task interference , we calculated the dual - task effect ( dte ) on both gait speed and cognitive task performance ( reaction time and accuracy ) . dual - task effects on gait speed ( dteg ) and clock and stroop - task accuracy ( dteacc ) were calculated as follows : ( 1)dte=(dual tasksingle task)single task100% . whereas a decrease in gait speed and accuracy represent performance decrement , an increase in reaction time ( i.e. , slower response ) represents performance decline , therefore dte on reaction time ( dtert ) thus , for each variable , negative values for dte indicate that performance deteriorated under dual - task conditions ( i.e. , dual - task cost ) , and positive values represent an improvement in the dual - task condition relative to single - task performance ( i.e. , dual - task benefit ) . the young and older adults were compared on profile measures using independent t - tests . to verify whether the clock task required greater cognitive processing than the stroop task , we conducted paired t - tests on mean reaction times for the two tasks in the single - task ( sitting ) condition for each group . to determine whether participants increased their ss gait speed as instructed in the fc and ob conditions , we analyzed changes in gait speed across conditions with a 3 gait task ( ss , fc , ob ) 3 cognitive task ( single , stroop , clock ) anova for each group . tukey 's post hoc tests were used as needed . to analyze the effects of gait and cognitive task difficulty on dual - task interference , we applied a 3 gait task ( ss , fc , ob ) 2 cognitive task ( stroop , clock ) 2 group ( young , older ) repeated measures ancova with education ( years ) as covariate to each dependent variable ( dteg , dtert , dteacc ) . significant three - way interactions were followed up with two - way analyses and post hoc tests as needed . the partial eta squared ( p ) is presented as a measure of effect size for each repeated measures ancova . by convention , 0.01 indicates a small effect size , 0.06 is moderate , and 0.14 represents a large effect . due to technical issues three older adults and one young adult were missing gait data from one or more of the gait tasks . listwise deletion meant that these subjects were excluded from the analyses for gait variables , resulting in minor variations in degrees of freedom . all analyses were performed using spss 18.0 ( spss inc . , chicago , il , usa ) . the young and older adults did not differ in global cognition assessed using the mmse , but there were significant differences in specific cognitive domains , including executive function , inhibition of habitual response , and speed of processing ( table 1 ) . the older adults also had significantly lower balance self - efficacy and took longer to complete the tug . however , the differences between the groups on the cognitive and mobility measures were not considered clinically meaningful , since the older adults performed within normal limits for their age [ 21 , 27 , 28 ] . on average , the young adults had more years of education than the older adults ( table 1 ) . the mean reaction time while sitting ( single - task ) for the clock task ( young adults m = 1403 ms , sd = 271 ; older adults m = 1889 ms , sd = 433 ) was significantly longer than that for the stroop task ( young adults m = 805 ms , sd = 109 ; older adults m = 956 ms , sd = 216 ) for both young adults , t(19 ) = 10.5 , p < .001 , d = 2.9 , and older adults , t(14 ) = 9.5 , p < .001 , d = 2.7 . thus , consistent with our assumption , the clock task required greater cognitive processing than the stroop task . in both tasks , the mean gait speeds for young and older adults in each condition and each gait task are shown in table 2 . participants significantly increased their walking speed when instructed to walk at their fastest comfortable speed . among young adults , there were no significant differences in average gait speed between fc and ob for single - task or dual - task walking ( table 2 ) . however , for older adults , average gait speed in ob was significantly slower than fc ( table 2 ) . table 2 also illustrates that there were significant declines in gait speed during the stroop and clock tasks relative to single - task walking in both groups during the obstacle condition . both groups had a significant reduction in fc walking speed for the clock task but not the stroop task . in the ss condition , the older adults reduced their gait speed during stroop but not clock task . young adults had no significant change in gait speed in either dual - task in ss . these findings are corroborated by the significant gait task cognitive task group interaction effect on dteg , f(2,56 ) = 3.17 , p = .050 , p = .10 . follow up two - way ancovas revealed that the three - way interaction occurred because the cognitive task group interaction was significant for the fc gait task ( p < .001 ; p = .39 ) , but not for ss ( p = .794 ; p < .01 ) or ob ( p = .376 ; p = .03 ) ( figure 1 ) . specifically , in fc , the dual - task cost ( negative dte ) on gait speed for the older adults during the clock task was significantly greater than that of young adults , and was also greater than dteg during the stroop task for either group ( figure 1 ) . in ss and ob , there was no effect of cognitive task on dteg for either group , although figure 1 shows a tendency for a larger dual - task cost in the clock task in ob among older adults . young adults had mean accuracy of 99% ( sd 0.01 ) in the stroop task and 97.2% ( sd 0.1 ) in the clock task . older adults , on average , were significantly less accurate than young adults ( p < .001 ) , with lower mean accuracy in the clock task ( m = 83.6% , sd = 0.2 ) than the stroop task ( m = 93.1% , sd = 0.1 ) ( p = .045 ) . mean values for dtert and dteacc for each gait task and cognitive task are presented in table 3 . after adjusting for education , there were no significant main effects or interaction effects in the gait task cognitive task group ancova on dtert or dteacc . as illustrated by the wide confidence intervals in table 3 , there was large variability in the dual - task effects on both reaction time and accuracy for the stroop and clock tasks . education was significantly related to dteacc in the ob condition ( r = .38 , p = .026 ) ; lower levels of education were weakly associated with larger dual - task costs in accuracy on the clock task during obstacle crossing . before adjusting for education , the three - way interaction on dteacc was significant due to a gait task cognitive task interaction for older adults but not young adults : dual - task cost on accuracy was significantly greater in the clock task during ob than in any other task among older adults ; the effect was not significant after adjusting for education . the purpose of this study was to determine the effect of gait and cognitive task difficulty on dual - task interference in aging . an important finding was that young adults were able to maintain fast walking speed in the obstructed condition with or without a simultaneous cognitive task , whereas older adults could not maintain fast walking speed in the obstructed condition even when no additional cognitive task was required . however , fast - obstacle walking speeds for older adults were still significantly faster than self - selected gait speed during single - task and stroop task , but not in the clock task . in other words , although older adults reduced their gait speed in the fast - obstructed condition relative to fast - unobstructed walking , they were still able to walk faster than their preferred speed , except when they had to perform the clock task while stepping over the obstacle . this suggests that among older adults the attentional demands of performing a difficult cognitive task interfere with the attention processing requirements of negotiating an obstacle . indeed , obstacle negotiation requires attention to spatial characteristics of gait in order to adjust strides and avoid hitting the obstacle . it is likely that the older adults slowed down as an adaptive safety strategy to avoid making motor errors when stepping over the obstacle , and that this effect was exaggerated when the added cognitive task demanded greater attentional resources . consistent with previous research , older adults demonstrated a significant dual - task decline in gait speed during the stroop task whereas young adults did not . young adults , however , experienced a significant dual - task decline in gait speed during the stroop task in the fast - obstacle condition . this finding suggests that in more attention - demanding gait tasks such as obstacle avoidance , a relatively simple cognitive task can impact gait speed , even in healthy young adults . whereas the stroop task affected walking speed in the fast - obstructed condition but not the fast - unobstructed condition , the clock task significantly reduced gait speed in both fast - obstructed and fast - unobstructed walking conditions . thus , more difficult cognitive tasks may amplify dual - task interference in gait speed in easier gait tasks . the three - way interaction on dteg corroborates the findings for gait speed and provides evidence for differential effects of gait and cognitive task difficulty on cognitive - motor interference during walking between young and older adults . we hypothesized that increasing the attentional demands of gait would reduce the dual - task costs on gait speed due to increased allocation of attentional resources required for the gait task . in contrast to our hypothesis , there was a tendency for dual - task effects on gait speed to increase with increasing gait task difficulty , although this was only significant for the older adults in the clock task in the fc condition ( see figure 1 ) . it is possible that because we did not instruct the participants where to prioritize their attention during the dual - task conditions , they chose to slow down to optimize safety and/or to maintain performance on the cognitive task . the large variability in the dual - task effects however , especially for cognitive task performance , implies that participants used a range of strategies to perform the dual - tasks . future research should concentrate on identifying whether personal characteristics influence how individuals spontaneously allocate their attention during gait - related dual - task situations and whether particular subgroups of older adults are vulnerable to the effects of task difficulty . an important finding from this study was the effect that controlling for education had on the dual - task interference effects on cognition . analysis of the unadjusted means showed that the dual - task cost on accuracy in the clock task was significantly greater during obstacle avoidance than in any of the other gait conditions , but only for older adults . however , after controlling for between - group differences in education , the cognitive task by gait task interaction for older adults was no longer significant . the lack of significant interaction effects for cognitive variables after controlling for education suggests that education may play an important role in counteracting dual - task costs on cognitive task performance , especially accuracy . it may be that more education leads to fewer errors in cognitive processing during dual - task walking , regardless of the difficulty of the gait or cognitive task . that is , greater education may increase cognitive reserve and thereby reduce susceptibility to dual - task interference . the idea that education contributes to cognitive reserve , and that increased cognitive reserve can limit clinical expression of cognitive changes is supported by strong evidence from the field of dementia research [ 29 , 30 ] . although we tried to simulate the challenges of real - world walking demands by adding elements of speed and obstacle negotiation to our gait tasks , a limitation of this study is that the research was still conducted in a quiet research laboratory . thus , it remains unknown how real - world environmental factors ( e.g. , noise , distraction ) affect dual - task interference . furthermore , we assumed a hierarchical increase in gait task difficulty between walking at self - selected speed , walking at fastest comfortable speed , and walking fast while stepping over an obstacle . however , we did not ask the participants of their perceptions of the tasks . finally , the findings from this study may be limited in their generalizability due to the small sample size and the predominance of women in the sample . thus , the findings should be viewed as preliminary ; investigations involving larger , more representative samples are needed to examine the interactions between age group , gait task difficulty , and cognitive task difficulty on cognitive - motor interference . in the future , manipulating the timing of the onset of the stimulus in the obstacle negotiation path may provide more insight into the interactions between attentional processing associated with obstacle avoidance and the attention processing of an additional cognitive task . in conclusion , the results of this study suggest that obstacle negotiation at fast walking speed , such as when stepping up a curb to avoid traffic , is highly attention - demanding for older adults and significantly compromises the ability to maintain walking speed . this study provides evidence that gait task difficulty influences dual - task effects on gait speed , especially in older adults . moreover , the effects of gait task difficulty on dual - task interference appear to be influenced by the difficulty of the cognitive task . education and/or cognitive reserve may be an important factor influencing cognitive - motor interference , especially in terms of performance of the cognitive task .

although gait - related dual - task interference in aging is well established , the effect of gait and cognitive task difficulty on dual - task interference is poorly understood . the purpose of this study was to examine the effect of gait and cognitive task difficulty on cognitive - motor interference in aging . fifteen older adults ( 72.1 years , sd 5.2 ) and 20 young adults ( 21.7 years , sd 1.6 ) performed three walking tasks of varying difficulty ( self - selected speed , fast speed , and fast speed with obstacle crossing ) under single- and dual - task conditions . the cognitive tasks were the auditory stroop task and the clock task . there was a significant group gait task cognitive task interaction for the dual - task effect on gait speed . after adjusting for education , there were no significant effects of gait or cognitive task difficulty on the dual - task effects on cognitive task performance . the results of this study provide evidence that gait task difficulty influences dual - task effects on gait speed , especially in older adults . moreover , the effects of gait task difficulty on dual - task interference appear to be influenced by the difficulty of the cognitive task . education is an important factor influencing cognitive - motor interference effects on cognition , but not gait .

therefore , an antiangiogenic strategy is promising for malignant gliomas [ 1 , 2 ] . in this review , i focus on some molecular therapeutic targets for glioma angiogenesis : ( 1 ) angiogenic factors , ( 2 ) hypoxia , ( 3 ) glioma - derived endothelial cells , and ( 4 ) resistance to antiangiogenic therapy . the problem of how to treat patients who fail to respond to antiangiogenic therapy remains a challenge , and the mechanisms of resistance are being studied . the potential mechanisms by which tumor cells can evade antiangiogenic therapy include upregulation of non - vegf - mediated pathways of angiogenesis , recruitment of bone marrow - derived cells , increased pericyte coverage , and increased use of preexistent vasculature by invasion . vegf is predominantly located in the perinecrotic area , which is referred to as the pseudopallisading area and appears to be hypoxic . by contrast , there are few vegf positive cells in low - grade astrocytomas and no vegf positive cells in the normal brain . we initially demonstrated increased expression of vegf in malignant glioma tissues , with both elisa ( figure 2 ) and immunohistochemistry . we also demonstrated high vegf protein concentrations in the cyst fluid from glioma , but vegf was not detectable in the serum . vegf - related angiogenic factors have been also clearly demonstrated in glioma tissues by rt - pcr and immunohistochemistry . tissue factor is highly expressed in malignant gliomas associated with vegf expression ( figure 3 ) . also , osteopontin and v3 integrin , which are also induced by vegf in endothelium , are predominantly expressed in tumor endothelium . another angiogenic factor , thymidine phosphorylase , is also only expressed in malignant gliomas , but not in low - grade glioma or normal brain ( figure 4 ) . endogenous angiogenesis inhibitors are important molecules in the delicate balance of angiogenic potential in tumors . the soluble form of the vegf receptor 1 ( sflt-1 ) is a measurable , potent , and specific vegf inhibitor . a vegf / sflt-1 ratio greater than 1 is a worse prognostic factor in glioblastomas ( figure 5 ) . the significance of the vegf / sflt-1 ratio as a prognostic factor is greater than for the vegf concentration alone , suggesting that the angiogenic balance between angiogenic factor and its inhibitor is important in tumor angiogenesis . experimentally , transfection of human glioma cells with sflt-1 demonstrated low expression of vegf mrna compared to transfection with an empty vector . the tumor growth of these sflt-1 transfectants was inhibited , but the inhibitory activity was limited . another endogenous angiogenic inhibitor , thrombospondin1 ( tsp1 ) , was introduced into human u87 glioma cells by transfection ( figure 6 ) . the glioma growth of the tsp1 transfectant was significantly inhibited compared to those of parent and vector - alone transfectants ( figure 7 ) . these clinical and experimental data support the importance of angiogenic balance as a key factor in antiangiogenic therapy . this is likely because these endogenous angiogenesis inhibitors are upregulated in malignant gliomas , as a consequence of the upregulation of angiogenic factors . the general growth factor receptor inhibitor , suramin , was investigated for its antiangiogenic action . suramin inhibited physiologic angiogenesis in a dose - dependent manner , based on the chorioallantoic membrane ( cam ) assay ( table 1 ) . suramin inhibited the bfgf - induced endothelial expression of urokinase - type plasminogen - activator ( upa ) using gelatin zymogram ( figure 8) . upa is closely related to the initiating step of angiogenesis , degradation of the extracellular matrix . using a rat intracranial c6 glioma model , all of these data suggest that suramin can inhibit physiological and tumor angiogenesis at multiple levels . recently , the anti - vegf antibody , bavacizumab , has been used in the treatment of glioblastoma . the growth inhibitory effect is dramatic , especially when determined with mri enhancement and mri perfusion study . interestingly , acnu ( 1-(4-amino-2-methyl-5-pyrimidinyl)-methyl-3-(2-cholroethyl)-3-nitrosourea hydrochloride ) chemotherapeutic agents resulted in upregulation of vegf mrna in glioma cells ( figure 10 ) . a similar effect on upregulation of vegf has been demonstrated by irradiation of glioma cells . thus , the combination of vegf antagonism , that is , vegf antibody in the initial glioma therapy , is a reasonable strategy in acnu chemotherapy and in radiation therapy ( figure 11 ) . the vegf antibody is attractive for attacking tumor stem cells , as a new strategy to combat glioblastomas , because the vegf antibody could inhibit maintenance of glioma stem cells by destroying glioma vascular niche [ 13 , 14 ] , in contrast to the effects of radiation or other chemotherapeutics . congruent with the results obtained in orthotropic mouse models of gbm , four recent clinical studies have implicated proinvasive adaptation in humans , as observed by mri , in a subset of gbm patients who developed multifocal or diffuse recurrence of the tumor during a course of anti - vegf therapy with bevacizumab , as in our case [ 1517 ] . one of the mechanisms of resistance to angiogenic treatment is the presence of hypoxic regions in glioma tissues . hypoxia - inducible factor 1 ( hif1 ) is induced by hypoxia and is upstream of vegf mrna expression . immunohistochemical expression of hif-1 clearly correlated with the degree of glioma malignancies and predicted survival among patients with malignant gliomas ( figure 13 ) and the degree of necrosis on mri ( data not shown ) . downregulation of hif-1 in glioma cells using sirna resulted in growth inhibition and an angiosuppressive effect on glioma growth ( unpublished data ) . we demonstrated that sn38 , the active metabolite of cpt11 , exhibited an antiangiogenic effect ( figure 14 ) . sn38 inhibited hif-1 and vegf mrna and protein expression of glioma cells in a dose- and time - dependent manner . metronomic cpt11 treatment of gliomas exhibited growth inhibitory effects without systemic toxicity , that is , through comparison of body weight loss that was not observed by conventional cpt11 treatment . tumor tissues treated with metronomic cpt11 exhibited decreased expression of hif-1 protein and pimonidazole expression , which were indicative of areas of hypoxia by immunohistochemistry ( figure 15 ) . a recent advance in glioma chemotherapy temozolomide is a powerful chemotherapeutic agent that prolongs overall survival of initial glioblastoma by up to 2.5 months . more recently , the feasibility of bevacizumab with radiation therapy and temozolomide in newly diagnosed high - grade gliomas has been reported [ 22 , 23 ] . interestingly , temozolomide has an inhibitory effect on hif-1 expression and endothelial cell tube formation . the metronomic temozolomide treatment is reasonable and clinical results have been demonstrated [ 25 , 26 ] . many studies focusing on tumor angiogenesis and endothelial biology are based on established normal cells lines that is , human umbilical vein endothelial cells ( huvecs ) . whether or not tumor endothelial cells and normal endothelial cells are genetically and functionally identical remains controversial . comparisons between tumor - derived and normal ecs have been made for a variety of systemic tumors . they have shown that tumor endothelium exhibits a phenotype of activated ecs , as reflected in the high expression of angiogenic molecules , that is , vegfr , the angiopoietin receptor tie2 , and the adhesion molecules icam-1 , e - selectin , and cd44 . in recent publications , researchers have suggested that the tumor - associated ecs derived from gbm tissues have different phenotypic and functional properties compared to normal ecs [ 28 , 29 ] ; these differences may result in less effective antiangiogenic therapy if the target molecules are only expressed in normal blood vessels . moreover , these publications have not mentioned the potential for interactions between tumor cells and tumor - derived endothelial cells . we isolated tumor endothelial cells from human glioblastoma samples using flow cytometry , cultured them , and analyzed the genetic differences between these cell types and huvec regarding the mrna and protein expression of angiogenic factors and chemokines . glioblastoma - derived endothelial cells ( gbmecs ) exhibited high expression of vegf , sdf-1 , and cxcr7 mrna compared to huvec , and gbmecs exhibited no expression of cxcr4 mrna ( figure 16 , unpublished data ) . we are now investigating functional differences between gbmecs and heuvec as well as the interaction between gbmecs and glioma cells using a coculture system . to obtain successful results with antiangiogenic therapy , c6 glioma cells ( 5 10 cells ) were stereotactically implanted into the brain . after 7 days , epcs ( 3 10 cells ) that were harvested from umbilical cord blood were intravenously injected via the tail vein . seven days after the epc injection , the rats were sacrificed and the c6 gliomas in the brain were fixed and stained with cd31 . the vessel length is significantly longer than epcs in an uninjected tumor ( figure 17 ) . fluoroscopy demonstrated that gfp - labeled epcs localized along with lectin - labeled tumor vessels ( figure 18 ) . this result suggests that epc could induce homing to the glioma vasculature and that this characteristic of tumor vasculature homing is useful when considering epcs as drug delivery tools . if the epcs contain angiogenesis inhibitors , the angiogenesis inhibitor is automatically delivered to the tumor vasculature . to date , this new strategy has not been published . finally , the question remains , what are the current possible target molecules for glioma angiogenesis ? norden et al . reported some molecules other than vegf . among them , delta - like 4 ( dll4 ) remains promising , because the mechanisms of angiosuppression are quite different to those of vegf and the role of dll4 is reciprocal to vegf [ 32 , 33 ] . remarkably , dll4 and vegf are the only known genes for which loss of a single allele results in embryonic lethality due to failure to form a functional vasculature . dll4 is exclusively expressed by endothelial cells ; therefore , this ligand is a potential therapeutic target . although blocking dll4 appears to promote angiogenesis , the neovasculature is functionally abnormal and it can not support tumor cell survival . preclinical studies have shown that blockade of dll4 was effective in inhibiting the growth of tumors that are resistant to vegf inhibition . whereas most of current antiangiogenesis approaches act through the reduction or elimination of tumor blood vessels , dll4 blockade results in the formation of a nonfunctional vasculature that is unable to support tumor growth . this paradoxical strategy for targeting tumors will be the focus of intense research for years ahead . furthermore , the expression of recombinant toxic proteins that specifically target tumor endothelium appears to be promising . fusion proteins directed against urokinase - type plasminogen - activator receptor ( upar ) may be appropriate for targeting endothelial cells in the tumor vasculature compared with normal endothelium , as upar may be preferentially expressed in proliferating endothelium . the efficacy of protein dtat13 that was synthesized to target upar on the neovasculature and upar- and interleukin-13-expressing glioblastoma cells has been demonstrated on glioma growth in vitro and in vivo . anti - angiogenesis therapy for malignant gliomas is promising by not only inhibiting angiogenesis but also through alteration of the tumor microenvironment , that is , the tumor vascular niche . moreover , various combinations of strategies including the development of new molecular targets have been investigated . overcoming resistance to antiangiogenic therapy with minimal side effects

due to the prominent angiogenesis that occurs in malignant glioma , antiangiogenic therapy has been attempted . there have been several molecular targets that are specific to malignant gliomas , as well as more broadly in systemic cancers . in this review , i will focus on some topics related to molecular therapeutic targets for glioma angiogenesis . first , important angiogenic factors that could be considered molecular targets are vegf , vegf - induced proteins on endothelial cells , tissue factor , osteopontin , v3 integrin , and thymidine phosphorylase as well as endogenous inhibitors , soluble flt1 , and thrombospondin 1 . second , hypoxic areas are also decreased by metronomic cpt11 treatment as well as temozolomide . third , glioma - derived endothelial cells that are genetically and functionally distinct from normal endothelial cells should be targeted , for example , with sdf-1 and cxcr7 chemokine . fourth , endothelial progenitor cells ( epcs ) likely contribute towards glioma angiogenesis in the brain and could be useful as a drug delivery tool . finally , blockade of delta - like 4 ( dll4 ) results in a nonfunctioning vasculature and could be another important target distinct from vegf .

during recent years , there has been growing interest in using data mining methods in gene mapping , motivated by the lack of success of the more traditional approaches for complex diseases , and also by the intriguing possibility of simultaneous detection of multiple loci . although a wide spectrum of computational approaches is used for data mining , they tend to share certain attractive characteristics for genetic association analysis . first , the methods are usually computationally efficient and scale to high numbers of markers and individuals , such as those expected in the near future in genome - wide association scans . obviously , this efficiency comes with a price : the models considered tend to be simpler than those usually used in statistical genetics . secondly , data mining methods are often aimed at exploration or discovery -- for example , by generating plausible models ( or hypotheses ) for further analysis rather than considering one given model in great detail . this aim coincides with a general trend in data analysis to move from hypothesis - driven- to hypothesis - generating research . thirdly , data mining methods typically handle discrete data and use symbolic structures , giving results and explanations that may be easier to understand and utilise for users but are less suitable for statistical analysis . ' data mining ' is often loosely defined as ' non - trivial extraction of implicit , previously unknown and potentially useful information from data ' . for this review of data mining methods for linkage disequilibrium ( ld ) mapping , the authors have chosen , at their own discretion , methods which reflect the three above - mentioned characteristics . the data mining approaches of this review can be roughly categorised into three groups : ( 1 ) classification methods that directly aim to find markers and other features that help to predict the disease status ; ( 2 ) clustering techniques for finding subgroups of subjects , based on their genotypic and phenotypic similarity , and analysis of their disease association ; and ( 3 ) methods based on the discovery of typical haplotypes ( or haplotype patterns ) and analysis of their associations with the disease ( table 1 ) . main classes of data mining approaches to gene mapping , characterised by three criteria : 1 ) descriptive methods primarily aim to recognise the ancestral , shared chromosomal segments identical by descent , whereas predictive methods directly associate with the disease status 2 ) some approaches try to partition the set of subjects into homgeneous groups , some emphasise local similarities in haplotypes , and some are compromises between these extremes . in addition to gene mapping , data mining approaches have been applied to related areas , such as disease - susceptibility gene identification using literature databases . some of the methods are available as software , for these a web page or e - mail address is provided . classification methods aim at finding rules or regularities that predict the value of a target variable from the independent variables . when applied to gene mapping , the goal is to find markers or haplotypes ( and potentially other variables ) that together are good predictors of the phenotype and then , more as a side - effect , predict a disease - susceptibility gene to be close to these markers . regression analysis is a well - known prediction method for quantitative traits ; this review focuses on classification methods for categorical traits . recursive partitioning ( rp ) methods ( also known as decision / classification / regression trees ) have been used for this purpose -- for example by young and ge and cook et al . rp produces a tree which can be described as a series of carefully crafted questions about the attributes of the test record , where each question splits the data into two parts and the next question is always conditional on the previous one(s ) . the gene finding method is , consequently , conditional : once a split is made based upon a single gene ( or marker or haplotype ) , then the subsequent analysis is conditional on the results of that split -- which is a very natural assumption for genetic effects . young and ge present a successful application of rp , carried out with helixtreehttp://www.goldenhelix.com on simulated clinical trial data , where the aim is to find ( out of 80 genetic polymorphisms ) those markers that have the highest impact on the efficacy and safety of a blood pressure medication . symbolic discriminant analysis ( sda ) was utilised in integrated analysis of multiple data types ( genetic markers , genomic and proteomic data ) in a review by reif et al . in 2004 . sda is a supervised pattern - mining approach that carries out variable selection and model selection simultaneously and automatically . sda builds discriminate functions from a list of mathematical operators ( eg + , - , x,/ ) and explanatory variables that can distinguish between disease classes in the data . in an integrative analysis of simulated multiple - type data , the authors showed that , in particular , when the aetiology of the disease is complex , the integrated analysis can be highly advantageous . the sda approach implemented by reif et al association rules have been applied to genetic problems -- for example , by rova et al . in a candidate gene analysis for bronchopulmonary dysplasia in newborns , where a number of non - genetic risk factors had also been measured and best combinations of covariates and genetic markers were sought . association rules describe co - occurrences of sets of features and can be computed very efficiently . in this case , the presence of two different , but sometimes co - occurring , syndromes were set as targets and the significance of association of conjunctions of several genetic and non - genetic risk factors to either syndrome was measured from the association rules . two separate polymorphisms were proposed to have a phenotypic effect via separate molecular mechanisms . although the implementation used by this group is not available , a general purpose apriori algorithm for finding association rules is given by agrawal et al . the dice algorithm identifies a subset of genetic and non - genetic covariates that are , either individually or in combination , associated with a phenotype . the relationship between the phenotype and the covariates is modelled using a logistic , linear or cox regression model . the algorithm explores , by means of a forward procedure , a set of competing models and selects the most parsimonious and informative approximating model(s ) that minimise(s ) the information criterion . thus , the method combines the advantages of regressive approaches in terms of modelling and interpretation of effects with those of data exploration tools . it should be well suited to detecting interactions between genetic and non - genetic factors within the framework of association studies . multifactor dimensionality reduction ( mdr ) is a non - parametric approach to detecting and characterising non - linear interactions among discrete genetic and environmental attributes . multilocus genotypes are pooled into highrisk and low - risk groups , reducing the numbers of genotype predictors . the reduced - dimension variable is used to classify and predict disease status through cross - validation and permutation testing . mdr has been shown to be capable of revealing significant high - order interactions in real datasets http://www.epistasis.org/mdr.html . support vector machine ( svm ) is an algorithm that attempts to find a linear separator ( hyperplane ) between the data points of two classes in multidimensional space . used svm to predict the age at diagnosis of multiple myeloma , based on 3,000 single nucleotide polymorphisms ( snps ) genotyped in 40 young age - at - onset and 40 old age - at - onset patients . although the authors do not refer to their method as being ld mapping , their search for best predictor snps for the trait is based on the hypothesis that if there is a genetic factor to the trait , then a snp in the haplotype block ( ie in strong ld ) containing that gene will be discovered . in fact , the trained svm produced a model with a reasonable accuracy ( 71 per cent by cross - validation ) , but the model was not easily interpretable : it consisted of 150 snps . a general - purpose svm algorithm , svm , clustering aims to locate relatively homogeneous subgroups in the given data . in the context of ld mapping , clustering of study subjects has been suggested as an approach for finding subgroups of individuals who potentially share genetic factors . such clustering can be based on haplotypes of the individuals , or on their phenotypes . after successful clustering , it should be easier to locate the genetic factors within the clusters , improving statistical power ; however , power may be reduced if the effective sample size decreases . a crucial factor here seems to be that genetically motivated similarity measures are used , based on haplotype sharing between individuals . ' length measure ' -- the length spanned by the longest continuous interval of matching alleles -- is one typical option -- and ' count measure ' -- the number of alleles in common in a window -- is another . with such measures , the association of clusters to the phenotype can then be measured -- for example , using the statistic , and the disease gene can be predicted to be where the best cluster shows similarity of haplotypes . use hierarchical clustering to produce approximations of genealogical trees and map genes based on these trees . the method has been coded in the cladhc algorithm , available as a linux executable , with accompanying documentation , on request from http://amorris@well.ox.ac.uk . molitor et al . perform fine mapping by spatial clustering of haplotypes based on a similarity metric that measures the length of the shared region and by estimating the risk that each haplotype ' cluster ' has for the trait . a good example of a slightly different approach to ld mapping , also based on measuring haplotype similarities but not on clustering , is given by tzeng et al . they investigated the hypothesis that the average similarity between case haplotypes tends to be higher than between control haplotypes . under this assumption , disease - susceptibility genes can be localised directly by measuring the statistical significance of haplotype similarity in the cases without explicit clustering or goodness of fit tests , such as . the authors concluded that similarity measures are actually more powerful than goodness of fit tests when the mutation occurs on a common haplotype , but that goodness of fit tests are superior for rare haplotypes . haplotype similarity and clustering were proposed as exploratory haplotype analysis methods by toivonen et al . the other major variant of the clustering theme is to cluster subjects by their phenotypes , rather than haplotypes . again , the aim is to find ( phenotypic ) subgroups that potentially have more homogeneous genetic aetiologies , but now utilising rich phenotypic datasets , where they exist . different phenotypic measurements can have very different ranges and distributions , and these have to be handled to avoid unintended bias . wilcox and others used multiple correspondence analysis ( mca ) , a non - parametric analogue of principal component analysis , to produce a reduced number of dimensions in which clustering was then performed . they subsequently used linkage analysis for mapping ; there do not appear to be any publications on phenotype clustering for ld mapping , even though the approach should be equally feasible there . the most popular data mining method applied to gene mapping has been the discovery of typical haplotypes ( or haplotype patterns ) and analysis of their associations with the disease . in simple terms the goal is firstly to discover sites and haplotypes potentially identical by descent , and then to test their disease associations . haplotype pattern mining ( hpm ) was the first such method http://www.cs.helsinki.fi / group / genetics/. the algorithm finds all haplotype fragments ( patterns ) of arbitrary length -- possibly up to some limit and possibly with gaps -- that show statistical association with the disease . the set of associated fragments is used as a whole to evaluate association across the chromosomal area studied . the area that shows the most significantly elevated number of patterns is the most likely for a disease - susceptibility locus . the significance of the finding is evaluated by permutation tests , where both marker - wise nominal significances -- as well as a corrected significance for the best finding -- are computed . the hpm method is fast , especially with respect to the number of markers , and it is sensitive to small genetic effects . the results are rough , however , and more elaborate ( and computationally more expensive ) statistical models are expected to predict the disease mutation locale better than hpm . in conclusion , hpm seems to work excellently as the first - stage analysis tool of genome - wide association and has been successfully applied in various circumstances -- for example , for asthma - related traits , glucocorticoid sensitivity and familial glioma . variants of hpm include a method for finding two ( interacting ) loci at the same time and qhpm for analysis of quantitative traits . f - hpm developed by zhang et al . is a further development of hpm , in which the strength of association is tested in pedigrees using the quantitative pedigree disequilibrium test . the tree disequilibrium test ( treedt ; http://www.cs.helsinki.fi/group/genetics/ ) is a more elaborate attempt to model the unknown coalescence , rather than just haplotyping fragments potentially identical by descent . treedt constructs , at each locus , trees that approximate the genealogy of the haplotypes at that locus , much like the method of durrant et al . these trees can be obtained efficiently using known algorithms for strings , making the method computationally fast . after trees are built for all locations , a disequilibrium test is performed on each of them to test if there is a small set of subtrees with relatively high proportions of disease - associated chromosomes , suggesting shared genetic history for those and a likely disease - gene location . again treedt is fast and has been shown to be relatively accurate , especially when allelic heterogeneity is present in a disease locus . notably , the methods presented here are mostly intended for exploratory analysis and not so much for final stages of identifying a causative variant in genotype data . the user 's expertise and insight play a key role : they are needed in choosing the methods and parameter values and are crucial in interpreting the results . also , there is no universally optimal method for all purposes ; it can be useful to try several different approaches for the same problem . as pointed out by hoh and ott , what is most needed for future large - scale genetic and genomic data analysis are ' methods for discovering sets of susceptibility genes and environmental factors , as well as systematic verifications of the gene - environment - disease network ' . according to the present review , there already exist a number of data mining approaches to gene mapping or identification purposes ( table 1 ) ; however , they are still rather scattered , consisting of somewhat solitary attempts to use different machine - learning or data mining approaches . classification methods are typically strong in modelling interactions , unlike most other approaches in this review . several of the classification methods produce a set of interacting loci that best predict the phenotype . however , a straightforward application of classification methods to large numbers of markers has a potential risk picking up randomly associated markers . approaches based on haplotype sharing , such as most of the reviewed clustering and pattern discovery methods , explicitly aim to reduce this problem by considering loci that are more likely to be identical by descent . of course , combinations are possible ; for instance , all frequent haplotype patterns could first be found and a classifier used to choose a subset of those and to model the interactions of their loci . in the more distant future , one might expect to gain most from integrated large - scale analyses : data mining of high - throughput snp data for ld mapping combined with phenotype subgroup analysis ; expression analysis results -- information about co - regulated enzymes in normal and trait - carrying individuals -- integrated with the information on known metabolic pathways ; and linking of the new experimental information to existing public data by mining literature and biological databases .

data mining methods are gaining more interest as potential tools in mapping and identification of complex disease loci . the methods are well suited to large numbers of genetic marker loci produced by high - throughput laboratory analyses , but also might be useful for clarifying the phenotype definitions prior to more traditional mapping analyses . here , the current data mining - based methods for linkage disequilibrium mapping and phenotype analyses are reviewed .

a young female patient visited the department of ophthalmology in our hospital with a chief complaint of decreased visual acuity 4 hours following a blunt trauma to the eye . we checked the visual acuity without correction as well as the corrected visual acuity and then performed manifest refraction , cycloplegic refraction , and a - scan ultrasonography . ultrasound biomicroscopy ( ubm ) examination was performed 4 times on each section that was divided by a 90 degree interval in a normal eye , and 12 times on each section that was divided by a 30 degree interval in a traumatized eye ( ubm model 480 , humphrey instrument ind . , san leandro , ca ) at the 4 week time point and the 3 month time point after the trauma . the thickness of the ciliary body was measured with an imaginary line that was vertical to the corneal endothelium and passed through the scleral spur ( black arrows in fig . 1 , 2 , 3 ) . refractive power was measured with a topcon kr-8100 autorefractor and the cycloplegic refraction was performed under the maximal dilated state after dropping a cycloplegic agent ( cyclopentolate ) . examination for the anterior chamber angle was performed with a goldmann four mirror lens to find whether cyclodialysis exists or not . after cycloplegic refraction , ultrasound examination was performed 7 times with the humphrey a - scan system 835 . we also measured the anterior to posterior diameter of the lens , the depth of the anterior chamber , and the axial length . intraocular pressure was measured 3 times with a non - contact tonometer , topcon ct-80 and reported as a mean value . the patient was a 16-year - old female , who was beaten with clenched fists by other adlescents 4 hours before her visit to our hospital . the naked visual acuity was 1.0 in the right eye and 0.15 in the left eye . the intraocular pressure was 11 mmhg in the right eye and 15 mmhg in the left eye . we found that the intraocular pressure in the left eye was relatively high within a normal range . we could not perform accurate refraction because of the severely painful periorbital swelling of the left eye at the time of her admission . in a slit - lamp examination , we found left corneal epithelial defects and an anterior chamber reaction with inflammatory cells ( + 1 ) without hyphema . the peripheral retina was edematous , but the macula was normal when the patient was examined by a fundus examination . a few months before the trauma , the patient 's naked visual acuities had been 1.0 in both eyes on a visual acuity test that had been performed at her school . furthermore , she had never experienced discomfort due to the difference between her bilateral visual acuities . the naked visual acuities were 1.0 in the right eye and 0.3 in the left eye . the right and left eye intraocular pressures were similar , with the right eye measuring 12 mmhg and the left eye measuring 11 mmhg . the manifest refraction was + 0.25 d ( d : diopter ) sph=-0.25 d cyl 160a in the right eye and -6.00 d sph=-0.50 d cyl 150a in the left eye . the cycloplegic refraction was + 0.25 d sph= -0.25 d cyl 160a in the right eye and -3.75 d sph= -0.25 d cyl 160a in the left eye . the fundus examination revealed that the retinal edema was decreased . when measured by ultrasonography , we found that the depths of the anterior chamber were 3.48 mm in the right eye , 3.28 mm in the left eye , and the depth of a traumatic eye ( left ) was shallower than the depth of the non - traumatized eye ( right ) by approximately 0.2 mm . the thicknesses of both lenses were 3.43 mm in the right eye , 3.82 mm in the left eye , which was 0.39 mm or thicker in the traumatized eye . the axial lengths were similar with 23.92 mm in the right eye and 23.87 mm in the left eye . in the left eye , the naked visual acuity was 0.4 , the intraocular pressure was 13 mmhg , and the refraction result was -4.25 d sph= -0.50 d cyl 160a . in the cycloplegic refraction of the left eye , the result was -3.25 d sph= -0.25 d cyl 160a . the difference between the results of the menifest and cycloplegic refractions got smaller . when we performed a fundus examination of the left eye , we found that retinal edemas had disappeared and were otherwise normal . an ultrasonographic examination of the left eye revealed that the depth of the anterior chamber was 3.34 mm , the thickness of the lens was 3.74 mm , and the axial length was 23.85 mm . one month after the trauma , we examined the left eye and found that the naked visual acuity was 0.5 , the intraocular pressure was 13 mmhg , and the refraction result was -3.00 d sph = -0.50 d cyl 170a . when we performed a cycloplegic refraction of the left eye , the result was -2.75 d sph= -0.50 d cyl 160a . an ultrasonographic examination of the left eye revealed that the depth of anterior chamber was 3.39 mm , the thickness of the lens was 3.63 mm , and the axial length was 23.92 mm . ultrasonographic examinations of anterior segments in both eyes were performed due to continuous myopia , and we evaluated the differences . though both anterior chamber angles were open , when we compared the thickness of the left ciliary body of about 1.73 mm with the 1.47 mm thickness in the right eye , we found edema and diffuse thickening of the ciliary body ( white arrow ) in the left eye ( fig . 1 , 2 ) . in the left eye , the naked visual acuity was 0.7 , the intraocular pressure was 13 mmhg , and the result of refraction was -1.75 d sph= -0.25 d cyl 180a . the corrected visual acuity was 1.0 . the depth of the anterior chamber was 3.44 mm , the thickness of the lens was 3.51 mm , and the axial length was 23.88 mm . three months after the trauma , the naked visual acuity of the left eye was 0.8 , the intraocular pressure was 12 mmhg , and the refraction result was -0.25 d sph= -0.25 d cyl 170a . the result of cycloplegic refraction of the left eye was -0.25 d sph= -0.25 d cyl 170a . the ultrasonographic examination of the left eye showed that the depth of anterior chamber was 3.46 mm , the thickness of the lens was 3.49 mm , and the axial length was 23.89 mm . finally , an ultrasonographic examination of the anterior segment of the left eye showed that the degree of edema of the ciliary body was diminished to 1.40 mm ( fig . the naked visual acuities were 1.0 in the right eye and 0.3 in the left eye . the right and left eye intraocular pressures were similar , with the right eye measuring 12 mmhg and the left eye measuring 11 mmhg . the manifest refraction was + 0.25 d ( d : diopter ) sph=-0.25 d cyl 160a in the right eye and -6.00 d sph=-0.50 d cyl 150a in the left eye . the cycloplegic refraction was + 0.25 d sph= -0.25 d cyl 160a in the right eye and -3.75 d sph= -0.25 d cyl 160a in the left eye . the fundus examination revealed that the retinal edema was decreased . when measured by ultrasonography , we found that the depths of the anterior chamber were 3.48 mm in the right eye , 3.28 mm in the left eye , and the depth of a traumatic eye ( left ) was shallower than the depth of the non - traumatized eye ( right ) by approximately 0.2 mm . the thicknesses of both lenses were 3.43 mm in the right eye , 3.82 mm in the left eye , which was 0.39 mm or thicker in the traumatized eye . the axial lengths were similar with 23.92 mm in the right eye and 23.87 mm in the left eye . in the left eye , the naked visual acuity was 0.4 , the intraocular pressure was 13 mmhg , and the refraction result was -4.25 d sph= -0.50 d cyl 160a . in addition , the corrected visual acuity was 0.8 . in the cycloplegic refraction of the left eye , the result was -3.25 d sph= -0.25 d cyl 160a . the difference between the results of the menifest and cycloplegic refractions got smaller . when we performed a fundus examination of the left eye , we found that retinal edemas had disappeared and were otherwise normal . an ultrasonographic examination of the left eye revealed that the depth of the anterior chamber was 3.34 mm , the thickness of the lens was 3.74 mm , and the axial length was 23.85 mm . one month after the trauma , we examined the left eye and found that the naked visual acuity was 0.5 , the intraocular pressure was 13 mmhg , and the refraction result was -3.00 d sph = -0.50 d cyl 170a . when we performed a cycloplegic refraction of the left eye , the result was -2.75 d sph= -0.50 d cyl 160a . an ultrasonographic examination of the left eye revealed that the depth of anterior chamber was 3.39 mm , the thickness of the lens was 3.63 mm , and the axial length was 23.92 mm . ultrasonographic examinations of anterior segments in both eyes were performed due to continuous myopia , and we evaluated the differences . though both anterior chamber angles were open , when we compared the thickness of the left ciliary body of about 1.73 mm with the 1.47 mm thickness in the right eye , we found edema and diffuse thickening of the ciliary body ( white arrow ) in the left eye ( fig . 1 , 2 ) . in the left eye , the naked visual acuity was 0.7 , the intraocular pressure was 13 mmhg , and the result of refraction was -1.75 d sph= -0.25 d cyl 180a . the corrected visual acuity was 1.0 . the result of cycloplegic refraction of the left eye was -1.50 d sph= -0.75 d cyl 170a . in an ultrasonographic examination of the left eye , the depth of the anterior chamber was 3.44 mm , the thickness of the lens was 3.51 mm , and the axial length was 23.88 mm . three months after the trauma , the naked visual acuity of the left eye was 0.8 , the intraocular pressure was 12 mmhg , and the refraction result was -0.25 d sph= -0.25 d cyl 170a . the result of cycloplegic refraction of the left eye was -0.25 d sph= -0.25 d cyl 170a . the ultrasonographic examination of the left eye showed that the depth of anterior chamber was 3.46 mm , the thickness of the lens was 3.49 mm , and the axial length was 23.89 mm . finally , an ultrasonographic examination of the anterior segment of the left eye showed that the degree of edema of the ciliary body was diminished to 1.40 mm ( fig . myopic changes following a blunt trauma have been reported by a number of authors . in these reports , moreover , the myopic changes were diminished and normalized within approximately one month.1 - 4,6 in our case , we report that the traumatized eye showed a myopia of -6.00 diopters immediately after the trauma and that the myopia had recovered to -0.25 diopters 3 months after the trauma . ciliary spasm and attenuation of the ciliary zonule1 have previously been mentioned as the causes of the change in the refractive power . we studied the menifest and cycloplegic refractive powers in our patient for the three months during recovery . we found that the difference between the menifest and cycloplegic refractive power changed during this period . indeed , we found that the difference between menifest and cycloplegic refractive power was about 2.25 diopters at the first examination upon admission , and this was reduced to 0.25 diopters when the patient was examined one month after the trauma . this difference in refractive power decreased even more until it was finally the same in the latter two months of the 3-month study period . as the myopia was reduced with a cycloplegic agent , we thought that ciliary spasm was one cause of the myopic change . our data shows that ciliary spasms almost disappeared and thus were normalized within one month ( table 1 ) . the reported causes of myopic change include a change in the axial length , anterior shifting of the lens - iris plane , and decrease in the depth of the anterior chamber . one report found that all of these causes induced an occurrence of acute angle closure glaucoma.3 another report found that myopic change could occur due to anterior shifting of the lens - iris plane and decrease the depth of the anterior chamber.6 in fact , we found that the depth of the anterior chamber in a traumatized eye right after a trauma was 3.28 mm , which was shallower than the anterior chamber of a non - traumatized eye by 0.2 mm . furthermore , the depth of the anterior chamber in a traumatized eye increased by a depth of 3.46 mm , which was similar to the depth in the opposed eye . thus anterior shifting of the lens - iris plane and a decrease in the depth of the anterior chamber appears to influence the occurrence of myopia , though the influence of these factors was tiny ( table 2 ) . however , we could exclude that the myopic change was not due to the difference between both axial lengths because the difference between the axial length of the traumatized and non - traumatized eyes was not so large ( table 2 ) . moreover , we found no glaucomatic manifestation related to the decrease in the depth of the anterior chamber because the intraocular pressure was within a normal range . previous reports have found that the increase in anterior to posterior diameter of the lens led to a myopic change . additional work found that the ciliary edema without anterior shifting of the lens - iris plane4 is related to the increase in anterior to posterior diameter of the lens . in our case , the thickness of the lens in the traumatized eye was 3.82 mm immediately after the trauma , which was thicker than the lens of the non - traumatized eye by 0.41 mm . the thickness became thinner over a 3-month period with a final measurement of 3.49 mm , which was as thin as the lens of the eye without trauma ( table 2 ) . in a ubm examination one month after the trauma when the ciliary spasm had almost disappeared , we found edema of the ciliary body in the traumatized eye . ultrasonographic examination of the anterior segment of the left eye three months following the trauma found that the degree of edema of the ciliary body was diminishing . this implies that the change in the lens thickness as well as the edema of the ciliary body can indicate myopic change following a trauma ( fig . 1 , 2 , 3 ) . a few drugs can cause transient myopia without uveal effusion.7 in these cases , a hypersensitivity reaction is thought to trigger the edema of the ciliary body.8 the ciliary edema following a trauma could be caused by the synaptic ends of sympathetic nervous system that are present on the vascular walls in the ciliary body . thus , an increase in the vascular permeability related to the sympathetic paralysis following a trauma could be related to the ciliary edema.9 finally , unstable changes in intraocular pressures such as low intraocular pressure with cyclodialysis and a transient increase in intraocular pressure after the closure of a ciliary dissociation frequently follow most blunt eye traumas.10 - 15 in our case , intraocular pressure was found to be within a normal range , with no hyphema . in putting these results together , the mechanism of changes in the refractive power after a trauma includes the ciliary spasm , a decrease in the depth of the anterior chamber caused by the anterior shifting of the lens - iris plane , an increase in the anterior to posterior lens diameter , and ciliary edema . among those mechanisms , considering an acute decrease in the difference between manifest refractive power and cycloplegic refractive powers for a 1-monthd period , we knowledge that myopia due to the ciliary spasm continues for one month or so and that myopia by other mechanisms continues through a 3 - 3-month period with a slow recovery . in conclusion , the change in refractive power after a trauma is related to the ciliary spasm , a decrease in the depth of the anterior chamber caused by the anterior shifting of the lens - iris plane , an increase in the anterior to posterior lens diameter , and ciliary edema . thus , ubm of the anterior segment and ultrasonographic examination of the traumatized eye are helpful for the diagnosis and confirmation of those changes .

purposeto determine the pathogenesis of transient myopia after blunt eye trauma.methodsin one patient , the refraction of both eyes ( the left eye was injured , but the right eye was not ) was measured with an autorefractometer . the cycloplegic refraction was measured at the early stage of trauma and again 3 months after the blunt eye injury . the angle and depth of the anterior chamber , the ciliary body , and the choroids were examined by ultrasound biomicroscopy ( ubm ) over 3 months . the depth of the anterior chamber , the thickness of the lens , and the axial length were measured by a - scan ultrasonography in both eyes . during the 3 months after the injury , we made comparisons between the menifest and the cycloplegic refractions , the depths of anterior chambers , the thickness of the lenses , the axial lengths , and the ubm - determined appearances of the angles and depths of the anterior chambers , the ciliary bodies , and the choroids in both eyes.resultswe suspect that the depth reduction in the anterior chamber , the increase in anterior to posterior lens diameter , and the edema in the ciliary body are all related to the change in the refractive power following the blunt trauma.conclusionsultrasound biomicroscopy ( ubm ) and ultrasonography of the anterior segment in the eye may be helpful to diagnose and confirm changes in the refractive power that occur after trauma .

zygomycetes are well known for zygospore formation in sexual reproduction but sporangiospores in asexual reproduction . although monotypic with coenocytic thallic growth , it speciates by the possession of two types of columellae , which are spherical and pyriform ( ending with a truncate base ) , and two types of sporangiophores , upright and circinate from which it derives its name . m. circinelloides ( syn : m. racemosus ) exhibits dimorphism as it converts to multipolar budding yeast - like cells in co2 atmosphere . an additional growth form , thallic conidia formation , like the arthric conidia of the nature of geotrichum candidum , was shown by mcintyre et al . when this fungus was grown in minimal vogels medium the formation of thallic conidia by m. circinelloides was confirmed by lbberhsen et al . who found that such conidia were multinucleate . however , mcintyre and his colleagues showed in their study that thallic conidia formation was as a result of extreme sensitivity to oxygen . m. circinelloides is useful candidate for research as it has been shown to have high potential for application industrially , either in the production of enzymes or recombinant proteins . thus , the need was elicited for an understanding of its physiological processes for evolution of specific morphologies , since form of growth is a process parameter in any industrial set - up . in response to this advice , omoifo and awalemhen studied the growth of this organism in well - defined minimal medium and found that the microorganism exhibited a plurality of structures . during the transformation process induced forms included transient forms , which differ markedly in shape and structure , evolved into the correct spatial relationships relative to one another , as well as persistent structures . so we have had for m. circinelloides induced asexual structures such as holoblastic , holothallic , and thallic conidia and yeast cells , each of which is proliferate . it was shown in the study of omoifo and awalemhen that during the growth process , intermedial ionic communication occurred and this appeared to correlate with the occurrence of specific morphologies . it was further shown that a sigmoid growth pattern was described in the 1.0 g / l k0.10 g / l na level , and to a lesser extent in 1.0 g / l k0.20 g / l na supplemented broth in which terminal budding yeast cells predominated . in this dimorphic switch , it is pertinent to ask how one form directionally organizes to yield the next transient form , or whether the directional assembly of morphogenetic sequences is spontaneous or controlled . in an attempt to throw some light on this phenomenon of dimorphic switch from the filamentous form , in this study we vary one elemental component of the medium we are developing for yeast induction , and using m. circinelloides as test organism we found that protoplasts were copiously generated at optimum k level , but h release intensity from intracellular medium appeared to have significant effect on the generation of protoplasts , which subsequently led to the nonpersistent yeast morphology . the collection of samples of soil and decayed fruits of soursop , annona muricata l. , from which the organism , m. circinelloides tieghem , was first isolated was reported in a previous study . it was maintained as glucose - yeast extract - peptone ( gyp : 10 : 03 : 5 inoculum was obtained by pouring sterile deionized distilled water over aerobic growth and a sterile glass rod gently passed over the surface so as to dislodge the spores . the suspension was poured into centrifuge tubes and spores washed by centrifuging at 5000 rpm for 7 min at 25c in an mse 18 centrifuge . the wash was decanted ; sediment resuspended and further washed with two changes of sterile deionized distilled water . 1/4000 ) and was adjusted to 1 m spores per ml in sterile deionized distilled water , with the aid of a tally counter . all the reagents for the synthetic culture medium were obtained from bdh laboratory supplies ( poole , uk ) . media were prepared per litre of glucose , 10.0 g ; ( nh4)2so4 , 5.0 g ; mgso42h2o , 2.0 g ; feso47h2o , 0.10 g ; nacl , 0.10 g ; mncl2 , 0.065 g ; cuso47h2o , 0.06 g ; znso45h2o , 0.06 g. media were prepared in 5000 ml beakers . weights of buffer components 0.2 m na2hpo4 , 0.1 m citrate were obtained using h54ar mettler balance and added to the beaker . since the effect of k was to be tested , each of the duplicate flasks was incorporated with the various concentrations of kh2po4 : 0.0 , 0.50 , 0.70 , 0.90 , 1.00 , and 1.10 g / l . the ph was adjusted to 4.5 with 2 n naoh or 1 n hcl , using a cole - parmer ph tester model 59000 , in the 5000 ml beakers before dispensing into an 80 ml of broth in each of the duplicate 250 ml erlenmeyer flasks for each test . the solution in each flask was made up to 100 ml with glass distilled deionized water and sterilized at 121c for 15 min . a 1 ml of spore suspension was drawn and inoculated into each broth flask using a 0.5 ml rubber suctioned pipette in a laminar flow chamber , model crc , hb-60 - 180 . the inoculum flask was shaken at each operation so as to keep the spores in suspension . each culture flask was then shaken for 30 seconds and thereafter incubated at 20c in a preset cooled gallenkamp incubator . at 24 h interval the flasks were shaken ; 10 ml of broth was withdrawn with presterilized pipette , one for each culture medium , and deposited into factory - sterilized plastic sample tubes , prelabeled for each experiment . the culture flasks were returned for further incubation and samples kept at 18c until analysis . solid cultures were prepared in glucose - yeast extract - peptone agar ( gypa : 10.00.35.020 absorbance was determined using the grating spectrophotometer ce 303 ( cecil instruments , cambridge , uk ) . for ph determination , the culture suspensions were centrifuged at 5000 rpm for 7 min . , 25c ( mse 18 ) . the clear media were each decanted and ph determined using ph meter 7020 ( electronic industries ltd ) . microscopic examination was done after staining slide preparations with lactophenol - in - cotton blue . micrographs were obtained with a leitz wetzlar ortholux microscope ( germany ) attached with an ernst leitz camera . the h release profile of m. circinelloides as affected by k conc . was shown in figures 1(a)1(f ) . at all levels of k but the ph soon decreased below the initial value after 24 h , reaching a minimum level after 72 h of growth . the upward trend in recorded ph after inflexion was again broken as it reversed after 96 h and remained so till termination of the experiments . g / l k , where the 2nd phase point of inflexion did not occur , that the ph profile assumed a 2-phase construct ( figure 1(e ) ) . the maximum ph differential occurred at this point of inflexion , that is , at 72 h after inoculation . similar consideration yielded optimum values at inflexion points in ph profiles for the other k levels , where increase in acidity meant addition of h to the bulk medium . figure 2 showed the intensity of h release from the intracellular medium at inflexion points , 72 h after inoculation , in relation to variation in k concentration . it was optimal at 0.00 and 1.00 g / l k but least at 0.70 g / l k , although the medium became more acidic than the commencement ph level , at termination of experiments . growth profiles of m. circinelloides , as affected by variation in k concentrations , were shown in figure 3 . time - course study in control experiments gave more or less steady rise in od reading but sigmoid growth pattern was not described ( figure 3(a ) ) . variation occurred in the growth profiles at the different k levels , but quite like the control experiments , none assumed sigmoid growth pattern ( figures 3(b)3(f ) ) . the log transformed od reading was maximal after 48 h , in the 0.5 g / l and 1.10 g/ l broths , and thereafter fell to a level bellow that , or at par with the control tests , which was , in turn , less than those determined for the 0.7 and 0.9 final od determination in the control tests was however higher than the final value obtained at 1.0 g / l k. when a plot of the specific growth rates at the different k levels was obtained , it was found to be similar at k 0.00 , 0.50 , 0.70 g / l k and thereafter shot to a new high level at 1.10 a conspicuous feature in this study was the diversity of reproductive structures that arose from sporangiospores of m. circinelloides in submerged cultures . morphological structures were recognized on the basis of delimiting septal formation or conidial ontogeny and conidial persistence . the nonpersistents remained as discrete units or , on budding by blastic action , soon released the daughter bud . four types of persistent conidia were induced in the non - k incorporated media ( control ) . these included ( 1 ) conidiogenous apparatus which consisted of numerous chains of globose and subglobose conidia concurrently originating from the outer wall of a double - walled vesicle , an apical enlargement of the conidiophore ( figure 5 ) , similar to aspergillus head group but without the phialides , and here derived from olive - green and thick - walled septate hypha notched at the point of septation , figure 6 ; ( 2 ) thallic conidia consisting of chains of rectangular to subglobose arthric formation after determinate thallic growth , figures 7 and 8 ; ( 3 ) short or long chains of holothallic conidia arising from thallic conidiogenous structure , figure 9 ; ( 4 ) holoblastic conidia , having blastic conidium ontogeny where all wall layers of the conidiogenous cell participatorily gave rise to short or long chains , figure 9 ; individual globose / subglobose cells also abound the medium ( figure 9 ) . although the aforementioned conidia were induced at 0.50 g / l k supplementation , they were more preponderant in the control experiments . g / l k supplemented medium ( figure 10 ) . in the 0.7 g / l k medium , induced were holoblastic conidia , septate and double - walled thallic growth , thallic conidia , olive - green and septate thallic growth with conidiogenous vesicular head group , germlines , that is , growth sphere with short or extended germ tube , but more preponderant were granular units ( figure 11 ) , which appeared larger in sizes in contrast to those observed in the 0.5 g / l k supplemented medium , and a few terminal budding yeast cells , which were present in varying shapes and sizes . also present were septate and olive - green thallic growth with vesicular conidiogenous head group , holothallic , and holoblasic conidia ; with further increase in k ( 0.9 g / l ) supplementation , these conidia became fewer in number and there was a surfeit of granular unit - turned protoplasts as the units were now bounded by regular tender membrane but they could be globose or rod shaped ( figure 12 ) . also present were a few yeasts apparently just emerging , far less of which were terminal buddings . there was corresponding decrease in the occurrence of thallic conidia with increase in k level . g / l k supplemented medium , the protoplasts , now with conspicuous internal dimensions and singular binding membrane , had become larger in sizes ( figure 13 ) . a few nascent / emergent yeast cells were observed , but preponderant were well - formed matured terminal budding yeast cells ( figure 14 ) . holoblastic conidia and septate and olive - green hyphae , with vesicular conidiogenous head group , were also present ( figure 15 ) . conspicuous globose to short - rod protoplasts were also induced in the 1.10 gg / l k medium ( figure 16 ) . they were however not as numerous as it was in the preceding level of kconcentration . the holoblastic conidia ( figures 16 and 17 ) and holothallic conidia ( figure 17 ) assumed more robust form at this level of k medium . also present were germlines , double - walled thallic ( septate ) growth , septate and olive - green filament with vesicular conidiogenous apparatus , and nascent / emergent yeast cells , which appeared as rods and ellipsoids . figure 18 illustrated the various types of morphological forms of m. circinelloides as affected by k supplementation , observed in this study . that m. circinelloides is multifaceted has been proved with its conversion to multipolar budding yeast - like cells under co2 pressure or on induction with phenethyl alcohol , as well as thallic conidial production in vogels medium [ 4 , 5 ] . the latter developmental line is also expressed by other species of mucor , as bartnicki - garcia and nickerson showed similar conidia ontogeny for m. rouxii ( m. indicus ) , a morphological pattern exhibition said to be equivalent to ascomycetous fungi imperfecti . in the present study , m. circinelloides showed greater diversity of reproductive structures , representing different affinities of hyphomycetous pleomorphism . for beside thallic conidia , other structural forms induced in our synthetic broth include holothallic , holoblastic , septate mycelia conidiogenous apparatus with concurrent catenate conidia and terminal budding yeast cells , which is a characteristic of the saccharomycetoideae . it is pertinent to note that yeast cells were not induced in our chemically defined medium unless k was incorporated . a model for the induction of terminal budding the model details an assemblage of cryptic forms sequentially generated until the yeast morphology is attained . the cytoplasm of growth spheres converts from apparent consistency to individualized , highly visible granular units . the occurrence of granular units in growth spheres has been previously recorded for m. rouxii . such spheroid with its cytoplasmic granular units , within a perhaps plastic wall , could be likened to tumours . , neoplasm has also been observed in hyphal compartments and conidia in synthetic broth [ 6 , 13 , 15 , 16 ] . when spheroidal wall lyse , hyphal wall rupture , or conidium bursts as a result of internal pressure , the neoplastic units released acquire individual life in the growth milieu [ 6 , 13 ] . in the present study , neoplasts were not observed in the non - k medium but were generated and coexisted with divergent persistent asexual structures in the 0.5 the conversion of individual neoplasts to protoplasts has been observed [ 6 , 13 , 15 ] . it was found to be a prelogarithmic growth event that occurred in an anisotropic growth environment [ 15 , 16 ] , which permitted intermedial ionic circulation . thus , conversion of growth spheres to neoplasts and subsequently protoplasts was enhanced at 1.0 g / l k : 0.1 g / l na when the momentum of chemical potential became more favourable , in contrast to 0.9 g / l k : 0.1 g / l na or 1.10 g / l k : 0.1 g / l na . in the present study , with further volume changes as occurred in the 0.9 g / l k broth , the units acquired internal dimensions , thus becoming globose or rod - shaped protoplasts . this coincided with the rise in magnitude of the h release intensity in contrast to the near nil level recorded in the preceding k - supplemented broth . but value of the h release intensity for the control broth was also maximal . what this indicated was that optimum and high level h release intensity as seen , respectively , in the control and 0.5 g / l k experiments did not cause the generation of neoplasts ; instead , it was k that triggered it . however , after neoplasm formation , increase in its ( h release intensity ) magnitude led to the conversion of neoplasts to protoplasts [ 6 , 13 , 16 ] . in the present study , this g / l k level , when the h release intensity was optimum and the protoplasts acquired more vigour , relative to that generated in the preceding 0.9 k broths . although persistent asexual structures recorded above were scantily present , neoplasts , protoplasts , and yeast cells were the predominant morphologies induced at 1.0 g / l k supplementation . some nascent yeasts occurred as was also observed in the preceding k supplementation or at the 1.10 g / l k - level , but the matured yeasts were more robust at 1.0 g / l k level and these became polar or bipolar budding . that the bulk media initially tended toward alkalinity in k supplemented broths but subsequently decreased , becoming more acidic , possibly meant that there was initial influx of h and oh into the intracellular medium in order to mobilize metabolic activities in response to osmotic transport mechanisms . perhaps , when this reached a state of neutrality in a carrier facilitated transport process , h were then extruded from the intracellular medium , against a concentration gradient , the bulk medium as in the present study , being buffered at acidic level . g / l k - supplemented broth where protoplasts showed more vigour and yeast cells , more robustness but were also most preponderant in comparison with the other levels , the h release intensity profile assumed a two - phase construct . the point of inflection in the ph profile also marked the lowest point ( value ) in the growth profile . significantly , that was the commencement of encounter with emergent yeast cells [ 1517 ] . as seen in the present study , it also marked the inherent conversion of the evolved protoplasts into nascent yeasts . thus , there was a congruence of h profile and progression leading to yeast form emergence , a process thought to be inherently stimulated at the point by the influx of h into the intracellular medium . it is significant to note that in a carbon substrate medium , this would necessarily entail h - substrate symport [ 18 , 19 ] , an event that could be made possible through transmembrane ph gradient [ 15 , 16 ] . that the h release intensity at point of inflexion in the ph profile in the control test was similar to that at 1.0 g / l k - mediated medium indicated that similar transport mechanism occurred in both types of media . yet , only thallic expression occurred in the control broth . this was not unexpected as c. l. slayman and c. w. slayman showed that the filamentous microorganism , neurospora crassa , permitted h - substrate symport through its biomembrane , meaning the organism also permitted a transmembrane ph gradient in an anisotropic growth environment . but while neoplastic units , protoplasts , and yeast cells , except thallic growth , were completely absent in the control tests , they predominated in the 1.0 g / l k - mediated broth . they were also present in the other k - level mediated broths , although to a lesser extent . this further showed that k was of absolute necessity in the stimulation of formation of neoplasm , which subsequently led to protoplast generation in this transformative process , a confirmation of an earlier finding where k was found to be highly associated with na during the morphogenetic transformation to terminal budding yeast . in the phase 2 of the ph profile during the growth of m. circinelloides , the upward trend in the bulk medium ph was not sustained , except in the 1.0 but the complex metabolic activities that could arise from the multiple morphologies in these media were perhaps attributable . , there was consequent decrease in , as well as atrophying of , holoblastic conidia , holothallic conida , thallic conidia , and the olive - green and septate mycelia with vesicular conidial chains . however , the reverse was true at the highest level of k tested . since optical density measures the light absorbance capacity , the more thallic and blastic structures , ( obviously larger in size and mass than neoplasts , protoplasts , and unicellular cells ) , that were in the medium , the greater the light absorbance value , which would consequently be reflected in the higher specific growth rate . the 1.10 g / l k medium had the highest growth rate while the 1.0 g / l k medium the least . this agreed with the experimental observation where the greater structural diversity , and robustness of persistent forms , occurred at 1.10 g / l k , but neoplastic units , protoplasts , and nonpersistent yeast cells were the predominant morphologies induced at 1.0 this level of k supplementation well nigh formed critical concentration with the broth composition of 0.10 g / l na , which permitted the maximum na influx rate essential for exponential growth of induced yeast cells of m. circinelloides . it has been argued that a transmembrane ph gradient is the platform for transport mechanisms during sporangiospore - yeast transformation [ 8 , 9 , 13 , 15 , 16 ] . in the present study , that there was h extrusion from the intracellular medium of the growing microorganism , m. circinelloides , also tended to anchor on the transport process being set up across the biomembrane since buffering at acidic level created slightly excess h on the outside of the membrane , and a deficit of h on the inner side [ 2124 ] . it was within such buffered medium that initially facilitated diffusion and , subsequently , perhaps vectoral h extrusion , seen in the h release intensity , occurred . g / l k. but as has been pointed out , yeast cells did not occur in the latter broth . since k is exchanged for h [ 2528 ] , then ionic circulation was an inherent activity in this generative process ; this has already been proved with k - na interaction , where at na efflux there was simultaneous k influx at the prelogarithmic growth phase . therefore , the m. circinelloides spheroid and protoplast membranes were thought to be equipped with membrane - bound proton pumps which generated the electrochemical proton gradient across the membrane . the energy sequestered from this proton flow would be used to drive energy - requiring reactions . for instance , the enzyme atp synthase could then synthesize atp from adp and inorganic phosphate . as in bacterial electrochemical proton gradient , the atp generated could drive many transport processes , which would include the entry and exit of these ions . such harnessed energy could also be used for carrying out biosyntheses and lytic activities as well as other selected biosynthetic activities that occur intracellularly which could be triggered for directional physiology culminating in specific morphology . if we assume that this process occurred during the cultivation of m. circinelloides , then this was the mitchellian proton pump . g / l k where there was a preponderance of protoplasts and terminal budding yeast cells . figure 19 illustrated the possible transport mechanisms that occurred during the transformation process of sporangiospores of m. circinelloides to yeast cells . perhaps , part of the energy sequestered in this process was used for lytic activities on the spheroidal envelop by inherently induced lysozymes . after lyses of cell wall and the destruction of plasma membrane of growth spheres , granular cytoplasmic contents as neoplastic units were released into the medium . the orange - coloured granules did not take up the stain of trypan blue - in lactophenol , as has been previously observed [ 1517 ] , indicating that they were not protoplasmic in nature . that the units increased in sizes becoming coarse and at this stage took up the stain , and subsequently assuming a regular form , globose , subglobose , or short rods , indicated that they had become protoplasmic [ 13 , 1517 ] . the increase in the bulk medium ph at ph - profile phase 2 suggested that intermedial ionic communication and hence chemiosmotic processes as occurs in all biomembranes continued with h influx into the intracellular medium . hence , with full complement of the proton motive force , this ensured h substrate symport as has been demonstrated for escherichia coli [ 18 , 19 ] and metschnikowia reukaufii which , respectively , transport lactose and glucose into the intracellular medium in a 1 : 1 stoichiometric relationship . since glucose was the only preformed organic source incorporated into the broth used in the cultivation of m. circinelloides in this study , then it was transported into the intracellular medium of the protoplasts , beginning early or from inflexion point , then onward in the second phase of the ph profile where it could be utilized for sundry biochemical activities , including the fundamental construction of cytoskeletal structures , thus leading to cell wall biogenesis , hence impacting the yeast form and , subsequently , asexual reproduction , that is , daughter bud formation . a possibility for exponential growth , as occurs with saccharomyces cerevisiae describing sigmoid pattern , could thereafter ensue . the description of sigmoid growth pattern by induced terminal budding yeasts of m. circinelloides has been demonstrated in several studies . but in such studies other incorporated medial components became critical , including myoinositol and uracil [ 6 , 8 , 9 ] . it has already been demonstrated for another zygomycete , which is rhizopus stolonifer , in a study in which ca was found to play significant role in terminal budding yeast expression [ 32 , 33 ] .

mucor circinelloides aerobically exhibits coenocytic thallic growth habit with straight and circinate sporangiophores which culminate in globose or pyriform columellae enclosed within sporangial walls . it undergoes dimorphic switch with its conversion to multipolar budding yeast - like cells or thallic conidia . this paper confirms the induction of plurality of reproductive structures of the pleomorphic microorganism in minimal medium . furthermore , construction of ph differentials at inflection points in the biphasic profiles during sporangiospore - yeast transformation indicated the intensity of h+ release from intracellular medium of the growing microorganism in a study conducted with k+ levels ( 0.0 , 0.5 , 0.7 , 0.9 , 1.0,1.10 g / l)-mediated broths . optimum proton release was at 0.00 and 1.0 g / l k+-supplemented broths , but specific growth rate was least in the latter . it also coincided with a preponderance of neoplastic units , protoplasts , and terminal budding yeast cells . on either side of this k+ level , variation in morphologies , including neoplasts , protoplasts , septate hyphae , thallic , holothallic , and holoblastic conidia , was greater , although olive - green septate hyphae with vesicular conidiogenous apparatus occurred at all k+ levels tested . this study suggested that following the establishment of transmembrane ph gradient across protoplast membrane , operation of mitchellian proton pump was further promoted , thus leading to active transport mechanism , a prelude to yeast morphology induction .

epidermal nevi are hamartomatous proliferations of the epithelium , including keratinocytes , sebocytes , pilosebaceous units , eccrine glands , or apocrine glands . verrucous epidermal nevi ( ven ) are non - inflammatory keratinocytic hamartomas composed of keratinocytes . vens are characterized by linearly arranged , closely set , gray - brown to black verrucous papules . the term systematized denotes many linear lesions limited to one side of the body or having a bilateral symmetrical distribution . the histological changes of ven are variable hyperkeratosis , acanthosis and papillomatosis . apart from this usual picture there are some rarer histological patterns including epidermolytic hyperkeratosis . epidermal nevi of the epidermolytic type are rare and represent mosaic expression of epidermolytic hyperkeratosis also known as linear or nevoid bullous ichthyosiform erythroderma ( bie ) . we hereby report a case of extensive bilaterally symmetrical systematized epidermal nevus occurring along the lines of blaschko and showing epidermolytic hyperkeratosis on histology in a 3-year - old boy for the rarity of the entity . a 3-year - old boy , the only child of a non - consanguineous parentage , presented with widespread warty eruption all over the body including the genitalia but sparing the scalp , face and palms and soles . the eruption began when the child was 3 weeks of age with lesions appearing first symmetrically over anterior thigh , and then over the axillae , and within a period of about 6 months progressed to attain the present distribution . examination showed multiple , bilaterally symmetrical , verrucous plaques along the lines of blaschko extensively involving the trunk and extremities [ figure 1 ] . the linear plaques ran transversely over the trunk and longitudinally over the limbs [ figures 2 and 3 ] . focal epidermolytic hyperkeratosis was evident in the form of perinuclear vacuolization of keratinocytes of the upper epidermis with coarse keratohyaline granules [ figure 4 ] . based on the characteristic clinical and histopathological features , a diagnosis of bilateral , systematized epidermolytic verrucous epidermal nevus was made . bilaterally symmetrical verrucous plaques along the lines of blaschko symmetrical , linear verrucous plaques along the lines of blaschko over the buttock and back of thighs transversely arranged , bilaterally symmetrical linear verrucous plaques over the back histopathology showing massive hyperkeratosis and focal granular degeneration of the epidermis . epidermal nevi of all types are considered an expression of genetic mosaicism arising from somatic mutation in the affected skin but sparing the unaffected skin . the most common pattern of keratinizing epidermal nevi is verrucous epidermal nevus presenting as verrucous , serpiginous plaque following the lines of blaschko . bilaterally symmetrical involvement is also called ichthyosis hystrix . while there are many histologic variants of the epidermal nevus , most cases demonstrate variable degrees of hyperkeratosis , acanthosis , and papillomatosis . rare histological variants include epidermolytic hyperkeratosis and variants resembling acrokeratosis verruciformis , verruca vulgaris , darier disease , porokeratosis , seborrheic keratosis or psoriasis . identical histology of epidermolytic ven and bie results from a clone of cells expressing a mutation in one of the bie genes krt 1 and krt 10 in the former . bie , a rare autosomal dominant disorder , presenting as severe blisters and erythroderma at birth which usually subsides as the child grows and is replaced by appearance of thick , dark , hyperkeratotic skin especially on joints , apposed skin , scalp and neck for the rest of life . by analogy with bie , patients of epidermolytic ven are expected to be blistered at birth but they do not show such tendency , which was also evident in our case . epidermolytic ven occurs sporadically and is not heritable , but a parent with such nevus may have gonadal mutation as well and can produce offspring with classical bie . although ven may be associated with cerebral and other internal manifestations in the form of epidermal nevus syndrome , epidermolytic variety is not associated with extracutaneous abnormalities as in our case as keratin genes are expressed only in the epithelia . the clinical differentials of systematized epidermolytic ven include non - epidermolytic ven , verrucous stage of incontinentia pigmenti , ichthyosis bullosa of siemens , and ichthyosis hystrix of curth and macklin . incontinentia pigmenti produces systematized lesions along the lines of blaschko and characteristically evolves through four clinical stages ( bullous , verrucous , hyperpigmentation , and hypopigmentation ) and exhibits eosinophilic spongiosis on histology . ichthyosis bullosa of siemens is caused by mutation of keratin 2 gene and may show mild phenotype of bie . ichthyosis hystrix of curth macklin may show systematized rigid spiky hyperkeratosis and its histopathology exhibits non - specific features of hyperkeratosis , acanthosis , and papillomatosis without epidermolysis . epidermolytic hyperkeratosis ( ehk ) refers to the combination of compact hyperkeratosis , perinuclear vacuolization of keratinocytes of the upper layers of epidermis , and coarse keratohyalin granules . these changes may occur incidentally in a large number of acquired benign and malignant conditions . however , only two congenital conditions besides bie may show these changes : ichthyosis bullosa of siemens and epidermolytic palmoplantar keratoderma of vorner . associated bacterial overgrowth can be treated with antibacterial soaps and when necessary , oral antibiotics . topical agents have a limited role and various agents had been used to decrease the hyperkeratosis . these include preparations containing salicylic acid , lactic acid , retinoic acid , 5-fluorouracil , calcipotriol and calcitriol . oral and topical retinoids have also been shown to improve patients with ehk although retinoids may promote desquamation and exacerbate blistering . continuous - wave carbon dioxide laser vaporization has been used with benefit for extensive ven . we reported a case of extensive , bilaterally symmetrical , systematized verrucous epidermal nevus of epidermolytic variety .

verrucous epidermal nevi are congenital , noninflammatory cutaneous hamartomas composed of keratinocytes . they follow the lines of blaschko and show hyperkeratosis without cellular atypia . the routine histology shows variable amount of hyperkeratosis , acanthosis and papillomatosis and rarely epidermolytic hyperkeratosis . we saw a 3-year - old boy with bilaterally symmetrical , systematized verrucous plaques along the lines of blaschko extensively involving the trunk and extremities but sparing the face and palmoplantar skin . histopathology showed features of epidermal nevi with prominent epidermolytic hyperkeratosis . we report here the case for the rarity of this entity .

a rapid decrease in serum calcium levels occurs after successful removal of one or more hyperactive parathyroid gland(s ) in patients with primary hyperparathyroidism . this decrease in serum calcium levels is usually mild and transient ( < 4 days ) . prolonged hypocalcemia after parathyroidectomy may be due to intentional or accidental removal of all parathyroid glands , devascularization or trauma to residual parathyroid glands , long - term suppression of residual nonpathological parathyroid glands , or hungry bone syndrome . hungry bone syndrome is a condition characterized by rapid , profound , and prolonged ( > 4 days ) hypocalcemia associated with hypophosphatemia and hypomagnesemia which follows successful parathyroidectomy in patients with severe primary hyperparathyroidism . this condition occurs due to the greatly increased skeletal utilization of calcium in the postoperative period . older age , larger weight of the parathyroid adenomas , radiological evidence of bone disease , and vitamin d deficiency are associated with increased prevalence of hungry bone syndrome . among the biochemical parameters , higher preoperative serum calcium level , parathyroid hormone ( pth ) level , and alkaline phosphatase levels in contrast to rest of the world , hungry bone syndrome is a common complication of surgery for primary hyperparathyroidism in india and is observed in 2487% of patients . this is probably because of severe hyperparathyroidism due to late diagnosis and/or concomitant vitamin d deficiency . in recent years , parathyroid surgery has undergone a paradigm shift and most patients are discharged 2448 h following surgery . occurrence of hungry bone syndrome leading to severe hypocalcemia in the postoperative period often increases the duration of hospital stay . hence , it is important for both the treating endocrinologist and the operating endocrine surgeon to recognize the patients at risk for hungry bone syndrome and implement some measures to prevent or decrease the severity of hungry bone syndrome in these patients . there are varying reports on the use and efficacy of bisphosphonates in the prevention of hungry bone syndrome . few studies have documented the benefit of bisphosphonates in preventing hungry bone syndrome after surgery for primary hyperparathyroidism , whereas although rarely , some also report worsening of postoperative hypocalcemia with preoperative bisphosphonate therapy . hence , we have analyzed the efficacy of zoledronic acid to prevent hungry bone syndrome in our patients with primary hyperparathyroidism . a written informed consent was obtained from each participant and study approval was obtained by the institutional ethics committee . a total of 19 patients were operated for primary hyperparathyroidism at our institute between january 2013 and june 2015 . between january 2013 and december 2013 , eight patients underwent surgery for primary hyperparathyroidism , but they did not receive preoperative bisphosphonates . between january 2014 and june 2015 , 11 patients underwent surgery for primary hyperparathyroidism and received zoledronic acid 4 mg , 2448 h preoperatively . all patients with primary hyperparathyroidism have undergone baseline serum calcium , phosphorus , alkaline phosphatase , creatinine , albumin , urinary calcium - to - creatinine ratio , skeletal radiographs , and ultrasound neck and sestamibi scintigraphy . computerized tomography of the neck was performed in four patients where there were discordant results between ultrasound neck and sestamibi parathyroid scintigraphy . postoperatively , all patients were tested for serum calcium and serum phosphorus levels at 6 h and 24 h , every day till discharge and then every 12 weekly till normalization of serum calcium and serum phosphorus . all patients with symptomatic hypocalcemia were managed initially with intravenous calcium followed by high doses oral calcium and calcitriol . continuous variables between the two groups were analyzed using independent t - test and categorical variables were analyzed using fisher 's exact test . continuous variables between the two groups were analyzed using independent t - test and categorical variables were analyzed using fisher 's exact test . among the 19 patients with primary hyperparathyroidism , 15 patients had single parathyroid adenoma , one had parathyroid carcinoma , one had triple adenoma ( hyperparathyroidism - jaw tumor syndrome ) , two had double adenoma , and one had hyperplasia of all four glands ( multiple endocrine neoplasia-1 ) . the ultrasound neck and sestamibi scintigraphy were concordant in all patients with single adenoma and the one patient with parathyroid carcinoma . preoperative and postoperative characteristics of the two groups with and without preoperative zoledronic acid therapy are summarized in table 1 . there was no significant difference between the two groups with respect to age , gender , duration of symptoms , preoperative serum calcium level , phosphorus level , pth level , and alkaline phosphatase level . even the presence of radiological evidence of hyperparathyroid bone disease also did not differ between the groups . three out of the eight patients who did not receive preoperative zoledronic acid therapy had hungry bone syndrome , whereas none in the zoledronic acid group had hungry bone syndrome . the prevalence of hungry bone syndrome tended to be lower in the zoledronic acid group ( p = 0.058 ) . the need for intravenous calcium and duration of postoperative hospital stay were significantly lesser in the zoledronic acid group . comparison of baseline parameters and prevalence of hungry bone syndrome between the two groups with and without zoledronic acid therapy our study demonstrates that preoperative zoledronic acid therapy significantly reduces the need for intravenous calcium and duration of postoperative hospital stay . although the difference between the prevalence of hungry bone syndrome between the two groups was not statistically significant , it tended to be lower in the zoledronic acid group . lack of this statistical difference is most likely due to a small number of participants in the study . few case reports initially demonstrated that preoperative treatment with pamidronate or alendronate ameliorates hungry bone syndrome in severe , prolonged primary hyperparathyroidism . the first comparative study was reported by lee et al . in this study , despite the similar baseline serum calcium , pth , and alkaline phosphatase levels between the two groups , none of the patients who received preoperative oral clodronate 4001600 mg / day or intravenous pamidronate 60 mg / day developed hungry bone syndrome compared nine of 17 patients who did not receive bisphosphonates . the efficacy of bisphosphonates in preventing hungry bone syndrome was also supported by other retrospective studies . in a study by malabu and founda including 46 patients with severe bone disease , who were treated with intravenous zoledronate preoperatively where the rate of hungry bone syndrome of only 4% . another retrospective study by frana et al . including six patients with radiological features of osteitis fibrosa cystica , who were preoperatively treated with bisphosphonates ( oral alendronate 2030 mg / day for 46 weeks or 25 a single dose of pamidronate 90 mg or ibandronate 150 mg intravenously ) , reported that none of the patients needed postoperative intravenous calcium supplementation . however , bisphosphonate therapy may not be completely effective in preventing hungry bone syndrome in all participants as reported by few authors . third , vitamin d deficiency which is a well - known risk factor for hungry bone syndrome is not studied . fourth , benefits of preoperative zoledronic acid to reduce the rates of hungry bone syndrome in our study group may be due to a larger proportion of severe hyperparathyroidism having radiological evidence of primary hyperparathyroidism ; hence , these benefits may not be applicable to patients with mild primary hyperparathyroidism . preoperative intravenous zoledronic acid significantly reduces the need for intravenous calcium therapy and duration of postoperative hospital stay and seems a promising option to reduce the rate of hungry bone syndrome in patients with primary hyperparathyroidism .

background : hungry bone syndrome is a common complication of surgery for primary hyperparathyroidism in india which often leads to prolonged hospitalization . there are varying reports on the use and efficacy of bisphosphonates in the prevention of hungry bone syndrome.methods:we retrospectively analyzed the effect of preoperative bisphosphonate therapy on rates of hungry bone syndrome in our patients with primary hyperparathyroidism . a total of 19 patients underwent surgery for primary hyperparathyroidism at our institute between january 2013 and june 2015 among whom eight did not receive preoperative bisphosphonates and 11 received intravenous zoledronic acid 4 mg , 2448 h preoperatively.results:there was no significant difference between the two groups with respect to age , gender , duration of symptoms , preoperative serum calcium , phosphorus , parathyroid hormone , alkaline phosphatase , and the presence of radiological evidence of hyperparathyroid bone disease also did not differ between the groups . three out of the eight patients who did not receive preoperative zoledronic acid therapy had hungry bone syndrome but none in the zoledronic acid group . the prevalence of hungry bone syndrome tended to be lower in the zoledronic acid group ( p = 0.058 ) . the need for intravenous calcium and duration of postoperative hospital stay were significantly lesser in the zoledronic acid group.conclusion:preoperative intravenous zoledronic acid significantly reduces the need for intravenous calcium therapy and duration of postoperative hospital stay and seems a promising option to reduce the rate of hungry bone syndrome in patients with primary hyperparathyroidism .

for decades , residuals of several compounds of anthropogenic origin have entered the aquatic systems , such as heavy metals , pesticides made from a range of nonnatural compounds , and other synthetic organic compounds . among these , the organophosphate insecticides have been widely used in the latter years , because of their higher level of biodegradability compared with their predecessors , the organochlorinated pesticides . therefore , it is important to understand the occurrence of pesticides in aquatic ecosystems and their potential impact . marine bivalves like mussels are extensively used as biological indicators with the aim of quantifying the potential effects of xenobiotics , as filter feeders are able to accumulate a wide range of xenobiotics in their tissues . one way to quantify the possible effects is through biomarkers which have proved a useful tool for assessing the deleterious effects of pesticides in water bodies . one of these biomarkers is the quantification of the inhibition of the enzyme activity acetylcholinesterase ( ache ) . acetylcholine ( ach ) is considered a neuroexcitatory neurotransmitter and is involved in neuromuscular stimulation and locomotion . this neurotransmitter is regulated by ache , which is rendered inactive by hydrolysis into choline and acetate . the ache is located in neuromuscular junctions and in bivalves , and prosobranch mollusks in particular have high levels of ache activity in the hemolymph . the organophosphate pesticides ( ops ) are extremely neurotoxic and proved to be effective inhibitors of ache activity . op pesticides generated in mussels a hyperactivity syndrome in the nerve cells , resulting in a cell disruption product of oxidative stress and inflammation . the inhibition of ache activity has been used as a specific biomarker for the presence of organophosphorus compounds [ 811 ] . another biomarker used to assess stress is the quantification of oxygen - nitrogen ratio ( o : n ) , which indicates the physiological state of the organism in this case exposed to xenobiotic [ 12 , 13 ] . this biomarker is the result of the quantification division of oxygen uptake ( which is reflected in the metabolic proportions of the bivalves ) and the quantification of ammonia excretion ( which is indicated in the use of metabolic resources such as lipids and carbohydrates ) . this division of both biomarkers ( oxygen uptake / ammonia - n excretion ) generates an index which shows the metabolic changes in the organisms and the amount of energy available in them during periods of stress produced by pesticide contamination . a. ater ( ribbed mussel ) is a commercially important , sessile species , which is long - lived and a filter - feeder bivalve . this bivalve presents a continuous gamete release over the year , their spawn being related to food availability . ribbed mussel has a wide latitudinal distribution in the eastern south pacific ( 20 to 56 ls ) , that is , callao in peru to the strait of magallanes in chile . this study responds to the need to identify native species off the coast of the eastern south pacific that can be used in environmental monitoring programs and to assess the feasibility of implementing the integrated use of biomarkers ( ache activity and o : n ratio ) to determine the presence of possible deleterious effects of chlorpyrifos - type organophosphate pesticides . the trademark name of the chlorpyrifos organophosphate insecticide used in this study was lorsban 4e by dow agrosciences chile s.a . the insecticide composition is active ingredient : 48% of chlorpyrifos and registered emulsifiers : 52% . juvenile specimens of ribbed mussel were collected ( 49.92 4.7 mm long and 16.6 4.18 g. of mass ) from a low intervention area in the coliumo bay ( 3650 s 7255 w ) . then , they were taken to the lenga coast lab ( 3645 s 7310 w ) where it continued the acclimatization in aquariums of 500 l for seven days ( 151c ; 33 1 ups ; 8.1 5.5 mg l dissolved oxygen ; ph 8.2 0.2 , 14 : 10 photoperiod , microalgae mixed cropping food ) . in this period of acclimatization , ribbed mussels showed exposed gills and no observed valvar closing during this period . preliminary assays were carried out ( i.e. lc5096 hours ) with the pesticide over the ribbed mussel . firstly , work was carried out in a wide range of concentrations between 0 ( control ) and 1000 g l ( six concentrations ) and then between 0 ( control ) and 50 g l ( five concentrations ) . the assays were static type . for selection of the tissue for the enzymatic study , gills and hemolymph samples were extracted from the organism control group . for an enzymatic study , the gills were macerated in a homogenizer wisestir hs-30e to 60 hz for 10 seconds , in 1 : 1 ( grams of tissue / buffer ) with phosphate buffer + triton 100 ( ph 7.4 ; 0.2 m ) under cold conditions . the homogenized sample was centrifuged at 10.000 g , 4c in a eppendorf 5804 r for 20 minutes , and the supernatant was used to measure the enzymatic activity . to avoid lethal damage to the bivalve , the hemolymph extraction was performed by perforating one side of the anterior abductor muscle and the hemolymph was extracted with a 1 ml ( 26 g 1/2 ) tuberculin syringe . then it was placed in a 1.5 ml eppendorf and centrifuged at 9000 g 4c for a period of 10 minutes . to measure the enzymatic activity in both cases , 40 l of supernatant was used in a uv mini-1240 shimadzu spectrophotometer by the ellman method . in chronic toxicity assays , tested chlorpyrifos concentrations were 0 ( control ) 0.20 , 0.40 , 0.80 , and 1.61 g l , and the exposition time was 21 days . for each concentration of chlorpyrifos reexchanges of the test solution were carried out every 48 hours , adding 6 ml of a microalgae - mixed cropping food every time . measurements of valvar closing were performed frequently in all tested concentrations during the 21 days of exposition . each measurement was performed in triplicate , and the results were expressed in ache activity ( mol acetylthiocholine minml hemolymph ) . quantitation of proteins in the gill homogenized was measured by the bradford method using 5 l of the homogenized sample before being centrifuged . the determination of oxygen uptake was performed by respirometry in individual chambers of 200 ml at the end of the experiment , determining the concentration of dissolved oxygen through the modified winkler method . ammonia excretion was assessed by extracting 5 ml of seawater from the individual chambers through the bower method . the results of o : n ratio were obtained by dividing individually the oxygen uptake of each ribbed mussel by the ammonia excretion results . the calculation of the sublethal concentrations was carried out through the spearman karber statistical packet . in the acute toxicity assays , during 96 hours , juvenile ribbed mussels were exposed under concentrations between 0 and 1000 g l of lorsban 4e organophosphate insecticide , observing over 100 g l a 90% of mortality . however , in lower concentrations that is , 0 and 50 g l a level of mortality , that is , 50 and 70% , was observed . the lc 5096 hours value was estimated at 16 g l of lorsban 4e . the ache enzyme activity in the gill tissue of a ribbed mussel showed a value of average activity estimated at 61.74 15.26 ( mol acetylthiocholine ( actc ) minmg protein ) , and in hemolymph it was at about 140.75 31.54 ( mol acetylthiocholine ( actc ) minml hemolymph ) . thus , it was decided to work with hemolymph due to its higher ache activity . in the sublethal toxicity assays , after 21 days of exposure , the analyzed concentrations of lorsban 4e , that is , 0.201.61 g this was observed in a significant inhibition of the ache enzyme on each tested concentration , in relation to the individuals from the control group ( p = 0.00007 ) . nevertheless , there were no major differences between the tested concentrations , that is , 0.21.61 g l ( p = 0.832 ) ; ( figure 1 ) . the oxygen consumption did not show significant differences between the tested concentrations ( i.e. , 0.2 and 1.61 g l ) and the control organisms ( p = 0.6838 ) , during 21 days of exposure to the pesticide ( figure 2 ) . the ammonia excretion in individuals with concentrations between 0.80 and 1.61 g l of pesticide showed average values of 0.12 0.040 and 0.17 0.057 ( mg gh ) . these were considerably different when compared with the lower tested concentrations 0.20 and 0.40 g l and the control group p = 0.0001 . it shows a tendency to an increase in the ammonia excretion for concentrations higher than 0.40 g lof lorsban 4e ( figure 3 ) . the o : n ratio in concentrations of 0.80 and 1.61 g lof the pesticide displayed significant differences , between the lower concentrations and the control group , p = 0.0001 ( figure 4 ) . however , it is observed in mussels that there is a decrease in the o : n ratio where the lorsban 4e concentration increases in the assay , especially in the concentrations of 0.80 and 1.61 individuals in laboratory conditions ( control ) did not show valvar closing during the 21 days of exposure . the same behaviour was observed in individuals exposed to concentrations between 0.20 and 0.40 g l , the bivalves had their valve closed most of the time during the experiment ( i.e. , 0.80 and 1.61 g l of organophosphate pesticide ) , with closing percentages between 90 and 100% , respectively . the valvar closing , in the present study , was the defence mechanism shown by the ribbed mussel individuals . this would help in reducing the individual 's exposure to the pesticide . during most of the research , valvar closing was observed in pesticide concentrations higher than 0.8 g l. the opposite occurred in lower concentrations of pesticide tested where individuals did not show a different behaviour from the control , that is , exposed gills . this could explain the lower degree of inhibition of ache enzyme activity in pesticide concentrations of 0.8 g l as a significant difference was not found in the case of the 0.2 g l concentration , that is , 25 and 33% , respectively ( figure 1 ) . on the type of tissue and the species analyzed by bocquen et al . for instance , when working with bivalves , they identified the higher ache enzyme activity in the mytilus edulis gills and in the crassostrea gigas oyster mantle . also , they point out that in general the bivalves show the higher ache enzyme activity in the gills and the abductor muscle . in this study a. ater showed higher ache enzyme activity in the hemolymph extracted from the abductor muscle . moreira et al . proposed the invertebrate hemolymph as suitable biological material to be used in environmental monitoring programs , which corresponds to what was observed in this study . moreover , it also allows a nondestructive determining of parameters such as the ache enzyme activity in the valve . in this study , biochemically , in all exposed individuals the ache enzyme activity was considerably inhibited in the control group individuals , observing that the highest tested concentration , that is , 1.6 g l reduced the ache enzyme activity by 39% ( figure 1 ) . when working on the enzyme activity in the freshwater mytilidae 's abductor muscle , concludes that percentages of inhibition higher than 30% of the ache enzyme activity would indicate an overexposure of bivalves to organophosphate insecticides . in this study , the lower tested concentrations that is , 0.4 and 0.8 g l reached inhibition percentages of the enzyme in relation to the control , that is , 24% and 25% , respectively . although these values are lower than the ones estimated by moulton et al . , they are close to the overexposure value of 30% . the comparison is done among individuals from the same phylogenetic branch , but living in different environments , that is , freshwater and sea water , thus it is important to highlight their similar sensibilities towards the chlorpyrifos organophosphate insecticide . the oxygen consumption of ribbed mussel in the assay concentrations of insecticide , that is , 0.2 and 1.61 g l in 21 days , did not show a defined response , which is similar to results obtained by michaelidis et al . it is claimed that factors such as inanition , temperature , salinity , and/or pollutants would influence the nitrogen excretion in the metabolism of organisms . in this study , an increase of ammonia excretion observed in juvenile ribbed mussel exposed to concentrations of 0.8 and 1.61 g l of insecticide would be accompanied by an increase in the protein usage as a substrate during the oxidative metabolism . similar results were observed by el - shenawy , in the bivalve ruditapes decussates exposed to heavy metals . according to mayzaud and conover , this would indicate that the oxidative metabolism of juvenile ribbed mussel organisms exposed to these concentrations may use more proteins than lipids as substrate ( similar quantities of proteins and lipids provide values in the o : n ratio between 50 and 60 ) . moreover , they indicate that the catabolism of pure protein would be related to values between 3 and 16 . in this study , the higher tested concentration of 1,61 g lof lorsban 4e showed an average value of 14.8 4.09 in the o : n ratio ; thus , it is inferred that individuals exposed to high concentrations of pesticides would use only protein as an essential source of amino acids . however , they conclude that values under 10 in the o : n ratio are deleterious for the organism , from which it follows that the chlorpyrifos concentration 1.61 g l tested in this study ( with values close to 10 in the o : n ratio ) would have induced biochemical and physiological alterations on the organisms . ribbed mussel is a species sensitive to the presence of low concentrations of organophosphate pesticide ( lorsban 4e ) in the environment . it shows a significant response of inhibition of ache activity which then promotes an increase in ammonia excretion . therefore , this kind of mussel could be recommended for use as a biomarker in mussel watch programmes in the pacific southwest .

the effect of residual concentrations of organophosphate pesticide chlorpyrifos ( lorsban 4e ) on the activity of the acetylcholinesterase enzyme and oxygen : nitrogen ratio in the mussel aulacomya ater was analyzed . toxicity tests show a sensitivity to the pesticide in the bivalve estimated at 16 g l1 ( lc5096 hours ) . concentrations between 0.2 and 1.61 g l1 were able to inhibit significantly the ache activity , and concentrations between 0.8 and 1.61 g l1 stimulate ammonia excretion and decrease oxygen : ammonia - n ( o : n ) ratio , with respect to the control group . a. ater proved to be a species sensitive to pesticide exposure and easy to handle in lab conditions . thus , it is recommended as a bioindicator for use in programs of environmental alertness in the eastern south pacific coastal zone .

age - related white matter lesions ( wml ) mainly affect information processing speed and executive function and entail an increased risk for cognitive decline and disability . in a meta - analytic study , high hazard ratios were also reported for incident stroke ( 3.3 ) and dementia ( 1.9 ) , but results from studies on wml association to dementia subtypes are inconclusive [ 46 ] . the prevalence of wml increases with age , and in a population study , 51% of randomly selected healthy subjects aged 4448 had wml . for the age range 6064 , all had wml , and 49% of these had at least one large ( > 12 mm ) wml region . in magnetic resonance ( mr ) imaging , white matter hypointensities in t1 weighted images , and white matter hyperintensities in t2 weighted and flair images are regarded as visualizations of wml . the conditions for demarcation of wml are enhanced in flair images due to suppression of the signal from free fluid . in contrast to t2 and t1 weighted images , this suppression causes fluid filled cavities in flair images to be hypointensive and excluded from wml by the intensity definition . however , the intensity suppression in the flair sequence entails incident imaging artifacts in the border region between wml and free fluid , for example , in the periventricular region . wml visible in mr imaging reflect demyelinization , axonal loss , gliosis , or edema . it is customary to use ct or mr imaging of wml among the diagnostic criteria for subcortical vascular dementia , for example , in erkinjuntti et al . . however , standardization of wml estimation is needed in order to establish uniform diagnostic criteria in clinical practice . visual rating is simple and fast and therefore an important candidate method for standardized clinical use . there are several visual rating methods for wml research purposes [ 11 , 12 ] . among these , the fazekas visual rating [ 13 , 14 ] is frequently used in research , and it has been shown to have good reliability compared to two other rating scales , but the results on its correlation to volumetrical assessment diverge . for example , the fazekas visual rating has shown the highest and lowest correlation to volumetrical assessment compared to other visual rating scales . manual volumetrical assessments have shown higher reliability than visual rating scales [ 11 , 15 ] and would be valuable in clinical settings if made less labour intensive . in gouw , visual rating of wml and wml volumetry had similar correlations to neuropsychological performance , but in garrett et al . , a correlation to neuropsychological performance was only found using wml volumetry and not in visual wml rating . several segmentation and thresholding techniques have been used to manually assess wml volume in the literature , but one of the few techniques with a methodological description is reported in gurol et al . . freesurfer is one of these methods , and it contains automatic assessment of neuroanatomical subregions as well as wml hypointensity volumes . freesurfer has been frequently used for neuroanatomical subregional volumetry and has been shown to be comparable in accuracy to manual labeling for many tasks [ 22 , 23 ] and to perform well compared to other automated segmentation tools . however , few publications have reported freesurfer wml volumes at all , and only one study reports intermethod reliability figures . one study found that total wml was significant for ad versus controls , and another found that total wml predicted functional decline almost as well as the best predicting regional wml regions . reliability analysis is the first step in assessing the accuracy of a wml method , and the often reported excellent or near excellent reliability may be a reason why methodological issues about reliability have not always been given enough attention . the aim of the present study was to compare three types of assessment methods of total wml in a clinical sample in order to examine different aspects of their reliability and to determine features in need of further methodological development . the manual mricron wml volumetry method was included on the basis of a presumed superiority in accuracy . freesurfer wml volumetry was included because of the automatic assessment of wml as well as the need for further validation because of the common use of the method . in the gothenburg mild cognitive impairment ( mci ) study , subjects between 40 and 86 years of age ( mean 65.6 , sd 7.7 years ) with subjective or objective cognitive impairment were recruited from the memory clinic at the sahlgrenska university hospital . exclusion criteria were acute somatic disease , severe psychiatric disorder , pseudodementia , and substance abuse or confusion caused by drugs . controls were recruited from other medical studies and senior citizen organizations , and baseline exclusion criteria were subjective or objective signs of cognitive disorder . the study was approved by the ethics committee of the university of gothenburg , and the subjects gave their informed consent to participate in the study . the study subjects were biannually assessed and classified according to the global deterioration scale ( gds ) . mci subjects remaining in the gds 2 to gds 3 range at followup were classified as mci stable , while mci subjects receiving a gds 4 ( mild dementia ) or higher classification at followup were classified as twenty eight controls , 69 mci stable , 9 mci converting , and 46 dementia subjects were included in the present study . wml was measured on the first 1.5 t mr imaging acquisitions in the study , between the years 2005 and 2007 . axial t2 weighted images were used for the fazekas rating , coronal flair images were manually segmented in the mricron software , and coronal t1 weighted images were analyzed with the freesurfer package ( stable release version 4.0.5 ) . in table 1 , the scan parameters used in the study are presented . all raters and operators were blinded for header data like identity and cognitive status of the subject . this study report was outlined to be in accordance with the guidelines for reliability studies in kottner et al . . periventricular wml and deep wml were not rated separately , in accordance with the recommendations by fazekas et al . , but only three grades were used as in inzitari et al . in contrast to the original four - graded fazekas scale , and in the present study , grade 1 also included possible absence of wml . for each subject , the slice with the largest wml occurrence visible was used to determine the wml load as belonging to one of three grades . the assessments were performed independently by two raters ( j. berge and j. eldblom ) who compared the images with the template images in axial orientation of the different grades of wml given by . the raters j. berge and j. eldblom had substantial knowledge of neuroanatomy and went through limited training in visual rating before entering the study assessment . cerebral wml segmentation and intensity thresholding were performed on 1.5 t coronal 5 mm flair images using the mricron software with a modification ( see later ) of the method used in gurol et al . . the segmentation method involves an initial rough manual demarcation of wml , separating them from noncerebral regions and septum pellucidum , as in holland et al . , within the same intensity span , followed by an intensity threshold set to separate wml from adjacent tissue types . in the gothenburg mci cohort , artifactual image intensity differences between slices and between series ( using the same flair sequence ) were common . no automatic intensity normalization between patients was done , but in order to consistently analyze each patient 's series in similar intensity settings , the mricron grayscale mapping was used on a window setting containing all brain tissue in a certain slice ( containing the quadrigeminal plate ) . due to intensity inhomogeneities , the manual volumetry method adapted from gurol et al . required a modification towards a more wml - specific manual segmentation , where the contour of the wml was demarcated quite closely . one rater ( e. olsson ) demarcated 152 subjects , while a second rater ( j. berge ) independently demarcated 27 randomly selected subjects for the determination of interrater reliability . the rater e. olsson has longstanding experience in mri segmentation , and the rater j. berge went through substantial training in the manual wml volumetrical method before entering the study assessment . hypointensity volumetrics determined as wml were estimated by an operator ( n. klasson ) running the freesurfer analysis ( stable release version 4.0.5 ) . freesurfer is a highly automatic image analysis suite and is available for download online ( http://surfer.nmr.mgh.harvard.edu/ ) . freesurfer uses a probabilistic atlas generated from manually segmented mr scans to execute the segmentation . the probabilistic information has been mapped into talairach space so that each location therein contains specific probabilities for each tissue type . given a specific location and tissue type , the probabilities are given as ( 1 ) a gaussian intensity distribution , ( 2 ) probability of occurrence , and ( 3 ) probability of neighboring tissue types . during segmentation , a number of processes take place including motion correction and intensity normalization , removal of nonbrain tissue , talairach registration , and labeling of voxels into tissue types . an initial labeling takes place where each voxel is assigned its most probable tissue type . an iterative algorithm then uses the found tissue probabilities to calculate new probabilities for the voxel labels . manual edits were done by the operator ( n. klasson ) to reduce inaccuracies in white and grey matter classification . the distribution of wml volumes in the gothenburg mci study was right skewed , and normality could not be assumed , not even after log transformation . the reliability analyses comprised spearman correlation , intraclass correlation ( icc ) ( with two - way mixed , absolute agreement and single measurements model ) , and kendall 's tau . differences in reliability between the highest wml tertile and the lower tertiles were tested with fischer 's r to z transformation . for differences between raters and methods , the study characteristics for the controls , mci stable , and dementia groups are presented in table 2 . dementia patients had significantly lower mmse scores than all other groups , had significantly lower education than stable mci , and were significantly older than stable mci . all three wml assessment methods detected significant associations between wml estimate and age ( fazekas 0.385 , manual mricron 0.334 , automatic freesurfer 0.524 ) . regarding interrater reliability , the spearman rho coefficient was 0.89 with regard to the modified fazekas visual rating scale and 0.60 regarding the manual mricron wml volumetry . the rho value was 0.65 for the intermethod correlation between freesurfer automatic wml volumetry and manual wml volumetry ( table 3 ) . no significant systematic differences between raters were found for fazekas visual rating or for mricron manual volumetry in the wilcoxon matched pairs test ( details not shown ) , but the freesurfer automatic volumetry differed significantly from the manual mricron volumetry . almost all freesurfer volumes were lower than the corresponding manual mricron volume ( figure 1 ) . in order to evaluate reliabilities in the dense and the sparse parts of the data distribution ( figure 2 ) , respectively for the aggregated lower two tertiles , the fazekas interrater reliability ( spearman 's rho ) measured 0.65 , and for the upper wml tertile 0.92 , this difference was significant . the manual mricron interrater reliability was nonsignificant for the lower two tertiles ( which make up about 10 percent of the whole volume range ) but significant for the upper wml tertile with an interrater reliability of 0.94 . for the anterior part of the brain taken separately , there was still no significant reliability for the lower aggregated wml tertiles , but it was significant for the posterior part with a rho value of 0.56 . for the intermethod reliability between the manual mricron volumetry and the automatic freesurfer volumetry , the rho value was also lower , 0.38 in the lower aggregated tertiles , than in the upper tertiles , 0.74 . for icc values , the reason why we do not report them in the text is stated in section 4 . figure 3(a ) shows the bland - altman ( ba ) plots of absolute volume interrater differences in the manual mricron method , demonstrating increasing differences with higher volumes . however , the variation in rater differences was larger in the assessments of the lowest range of the wml volumes embracing about 80% of the subjects . when comparing the difference as a percentage of the mean measures of each subject ( figure 3(b ) ) , the variation was even more pronounced with regard to the lowest part of the wml volumes , while there was no clear indication of an increase in rater differences with larger volumes . the intermethod ba plots ( figure 1 ) for the manual mricron volumetry and automatic freesurfer volumetry showed a similar pattern as the interrater ba plots , with a pronounced variation for low wml volumes in figure 1(b ) . it is common to evaluate reliability in wml research with intraclass correlation ( icc ) with excellent results , for example , in gao et al . and smith et al . however , it is misleading to use such an analysis in a data structure where the distribution is skewed , with very sparse data points in the upper third of the volume range . while showing an excellent reliability for the whole sample , like previous studies , the icc in the lower aggregated tertiles for the manual method was nonsignificant ( table 3 ) . the density of low - burden wml ( figure 2 ) probably represents a very common clinical distribution , and reliability analysis must under these conditions be performed and interpreted with caution . the finding in the present study of lower reliability in the fazekas rating with lower wml burden is congruent with the finding by wardlaw et al . where cohorts with lower wml burden showed lower reliability . the higher reliability for high wml burden has been considered as a ceiling effect , but there might as well be floor effects in visual rating . presumed ceiling and floor effects do not disqualify visual rating as a candidate for clinical use , but such effects would in general lower the usefulness for wml research , for example , the possibility to find valid correlations with psychometrics . the nonsignificant spearman correlation in the aggregated lower tertiles between manual mricron volumetry raters could possibly be due to the high density of data affecting the rank order of the ratings . it is unclear if the high spearman correlation for high - burden wml implies an overestimation of the reliability due to the sparse data density ( leading to less error with ranked data ) or if there really was a higher reliability as the ba plot of fractional differences seems to imply ( figure 3(b ) ) . in our opinion , the low reliability in low - burden wml is most probably not due to the combination of high density of data and the nature of the spearman correlation . rather , it may be a real rater- and intermethod variation as is visible in the ba plots which seem to indicate an increased variation in the lowest quarter of the volume range . the higher rater variation in low wml may in turn be due to difficulties in the handling of intensity distortion affecting the thresholding step in the manual volumetry . intensity inhomogeneities in mr images and variation in grayscale level between scan series result in inconsistent classifications of hyperintensities that in turn introduce measurement errors in the manual wml assessment . in order to assess wml volumes as accurately as possible under conditions with varying intensity levels through the image slices of a subject , a methodology was chosen where the thresholding was adjusted as a compromise to best fit the visible wml volume through all image slices of a subject 's brain . since the localization and extent of wml vary , the accuracy of the thresholding can be expected to be decreased by these intensity distortions . a particular shift in grayscale level was observed in the anterior part of all flair image series ( figure 4 ) , which may be due to gradient eddy currents or cross talk between 2d flair slices [ 34 , 35 ] . the unreliability for low wml seems to emanate mainly from the anterior half of the image data , and the intensity shift in the anterior part may well be a reason for more complex considerations in the thresholding of low wml burden cases . for higher wml volumes , the thresholding step in general only affects the amount of wml selected , but for lower volumes , the thresholding more often affected the presence or absence of wml in a slice , which means a more straightforward thresholding with higher volumes . in short , increased complexity in the thresholding may be the main cause of an increased rater variation for low wml volumes . the freesurfer suite includes intensity normalization steps which to some extent will limit intensity distortion , but that also may extinguish some of the hypointensities . further , the t1 mr sequence used for the freesurfer volumetry does in general have lower wml definition and somewhat smaller areas of wml hypointensities compared to the hyperintensities in the flair sequence . a visual inspection of the t1 weighted images and the freesurfer segmentations confirmed that the substantial deviations between the volumetrical methods in the detection of wml in various locations may mainly be due to the lower definition in the t1 weighted images . the freesurfer segmentation often omitted large amounts of deep wml seen in the flair images ( figure 5 ) . on few occasions , occasionally , freesurfer detected more wml in the periventricular region than visible in the t1 weighted images . compared to wml seen in flair images , the amount of wml found by freesurfer still was lower even in the periventricular regions . the t1 mri images in figures 5 and 6 are examples showing that the noise level makes the detection of punctate wml a difficult task , nevertheless freesurfer detects several punctate wml patches in this region . the single punctate wml patch in the flair slice in figure 6 is hardly visible in the t1 slice , and it is conceivable that no punctuate wml patch in this location is detected in freesurfer . in some cases , freesurfer detected small punctate wml not detected in the manual volumetry ( figure 6(b ) ) , but occasionally , it detected less punctate wml than the manual volumetry ( figure 6(c ) ) . however , a more accurate punctate wml detection may be a disadvantage in dementia research since punctate wml often originate from perivascular spaces and have been found to have low progression . in short , the freesurfer volumetry generally detects less wml , which is likely due to a combination of the method , the characteristics of wml , and the visibility of wml in t1 weighted images and leads to larger differences between the methods when measuring larger wml volumes ( figure 1 ) . wml progression generally begins in the periventricular region and subsequently expands radially to more peripheral locations . the skewness of the distribution of wml , with a low fraction of high - burden wml subjects also in the dementia part of the sample , can be expected to exist also for clinical samples in general . the statistical atlas used in freesurfer was generated from a small sample ( http://surfer.nmr.mgh.harvard.edu/fswiki/buckner40testing ) , where high - burden wml cases might be rare or lacking . an atlas generated with a low frequency of high - burden exposure may contribute to the freesurfer inability to find deep wml . the fazekas rating was performed by comparing the largest wml aggregation to the templates , and no metrical measurements were used which possibly affected the classification of the subjects close to the fazekas definitions of the metrical borders . the visual rating in three grades differs from the design in other studies , which limits the comparability of results . it is not feasible to use a zero grade wml in t2 images with any accuracy , and in a later control of the flair images , it was ascertained that no subjects with complete absence of wml were present in the study . in visual rating , the flair sequence can be expected to be advantageous compared to the t2 sequence due to the signal suppression of free fluid in flair images . however , the flair sequence in this study had coronal orientation and 5 mm slice thickness , which made it unsuitable to use with the axial template images . the basal ganglia nuclei in flair images often had no clear intensity separation from white matter , which may have contributed to an inaccurate volume assessment in this region . the hyperintensities along the ventricular lining in the basal ganglia region were included in the manually assessed wml , which may be unsuitable and possibly confound the differentiation , primarily in patients with low wml volumes . the different scan sequences used in the different methods confound the methodological comparison ; for example , only the flair sequence does to some extent show separate intensity ranges for fluid filled cavities and wml . by contrast , in t1 and t2 sequences , fluid - filled cavities have intensities in the same range as wml . the moderate interrater correlation for the manual volumetry could possibly be a consequence of intensity distortions in the flair images . although steps were taken in the thresholding methodology to minimize the impact of intensity distortions , sample tests of wml volume using different thresholdings unveiled considerable variation in measurements . the flair sequence had obvious intensity inhomogeneities , and no automatic intensity normalization was performed which may limit the possibilities to interpret the present findings further . reliability analysis showed acceptable overall results but with lower reliability for all methods in the lower aggregated tertiles . despite excellent overall reliability for manual volumetry hence , the results of intraclass correlation in wml samples , that is , commonly skewed , might be misleading , and reliability analysis of wml methods should be considered with caution . optimized mr imaging , postscan intensity standardization and normalization are quite likely among the most important factors to consider for more accurate measurements of wml . freesurfer comprised lower volumes than the manual method , probably due to the t1 sequence it uses , and was not able to detect punctuate wml in a consistent manner . a medically oriented follow - up paper focusing on the predictive power of the different wml measurements is being prepared . in another study , we intend to refine the visual comparison between the methods , using a larger sample of subjects and coregistration of images from different scan series . finally , our long - term goal is an improved manual method that excludes thresholding but includes an adequate intensity normalization .

age - related white matter lesions ( wml ) are a risk factor for stroke , cognitive decline , and dementia . different requirements are imposed on methods for the assessment of wml in clinical settings and for research purposes , but reliability analysis is of major importance . in this study , wml assessment with three different methods was evaluated . in the gothenburg mild cognitive impairment study , mri scans from 152 participants were used to assess wml with the fazekas visual rating scale on t2 images , a manual volumetric method on flair images , and freesurfer volumetry on t1 images . reliability was acceptable for all three methods . for low wml volumes ( 2/3 of the patients ) , reliability was overall lower and nonsignificant for the manual volumetric method . unreliability in the assessment of patients with low wml with manual volumetry may mainly be due to intensity variation in the flair sequence used ; hence , intensity standardization and normalization methods must be used for more accurate assessments . the freesurfer segmentations resulted in smaller wml volumes than the volumes acquired with the manual method and showed deviations from visible hypointensities in the t1 images , which quite likely reduces validity .

our institution has a database of angioscopic analysis at the beginning of introducing this technology . by using this system , data from 67 patients with coronary artery disease ( cad ) who were observed by an angioscopic evaluation for multivessel cad between september 2000 and july 2007 were retrospectively analyzed in this study . patients were diagnosed as having stable angina pectoris if they had a positive stress test for myocardial ischemia and no change in the frequency , duration , or intensity of clinical symptoms within 4 weeks , including various combinations of chest , upper extremity , jaw , or epigastric discomfort or atypical symptoms ( e.g. , dyspnea or diaphoresis ) . unstable angina pectoris was defined as new - onset severe angina , accelerated angina , or rest angina . patients who did not have any of the above clinical symptoms were diagnosed as having silent myocardial ischemia . patients diagnosed as having acute or recent ( within 1 month from onset ) myocardial infarction during this period were excluded . based on the guidelines of the japan society for the study of obesity , obesity was defined as a bmi of 25 kg / m . blood samples were obtained from the antecubital vein in the fasting state and before each angioscopy procedure . the baseline diagnosis of glucose metabolism was based on the ada guidelines ( 5 ) . diabetes was defined as a fasting plasma glucose ( fpg ) concentration of 126 mg / dl , self - reported clinician - diagnosed diabetes or an hba1c level of 6.5% ( national glycohemoglobin standardization program ) . prediabetes was defined as an fpg concentration of 100125 mg / dl or an hba1c level of 5.76.4% . nondiabetes was defined as an fpg concentration of < 100 mg / dl and an hba1c level of 5.6% . the value of hba1c ( japan diabetes society + 0.4% ) was estimated as a national glycohemoglobin standardization program equivalent value calculated using the appropriate formula ( 14 ) . the medical ethics committee at nippon medical school chiba - hokusoh hospital approved this study protocol , and written informed consent was obtained from all patients before the catheterization procedures . coronary arteries with proximal tortuosity , sharp angle , calcification , or ostial stenosis were not performed because of the expected difficulty in acquiring angioscopic images for the entire vessel . before observation the light power was adjusted to avoid reflection and obtain images with adequate brightness for determination of the plaque color . during angioscopic observations , an assistant adjusted the light power to maintain a constant brightness level on the target plaque . angioscopic images and fluoroscopy during the angioscopic observations were recorded simultaneously on videotape for later analysis . the yellow grade was classified semiquantitatively according to the surface color as : 0 , white ; 1 , light yellow ; 2 , yellow ; and 3 , intense yellow . the number of yellow plaques ( nyps ) was determined for each vessel observed and averaged per vessel . the existence of myps was defined as nyps 2 in at least one observed vessel . a ruptured plaque was considered to be a wall irregularity , including a tear , flap , or ulceration on the plaque surface . a thrombus was defined as a coalescent red superficial or protruding mass adhering to the vessel surface , but clearly a separate structure that remained after flushing with ringer lactate . no angiographic stenosis was observed in the right coronary artery ( a ) , whereas an intramural red thrombus was observed at the proximal site ( b ) , and three yellow plaques were identified on angioscopy ( b d ) . the yellow intensity of these plaques was defined as grades 1 , 2 , and 1 , respectively . significant stenosis was not observed in the left circumflex artery ( e ) , whereas two yellow plaques were defined as grades 1 and 2 , respectively ( f and g ) . a 50% stenosis and a 90% stenosis were identified on angiography in the middle part of the left ascending artery ( h ) . according to angioscopic findings , both these lesions were evaluated as grade 3 yellow plaques ( i and j ) . in this case , the average nyp was 2.33 ( seven yellow plaques in three vessels ) , and the myg was 3 . all statistical analyses were performed using the spss software ( version 11.0.1 ; spss inc . , categorical variables are presented as frequencies , and these were compared using the pearson test . continuous quantitative data were presented as mean values sd . all variables were evaluated with anova and the least significant difference statistical methods . univariate logistic regression analysis was used to determine the clinical predictors ( age , sex , other coronary risk factors , clinical presentation , medication , and laboratory data ) for myps . prediabetes and diabetes were categorized in each group as a reference of the nondiabetic group . three values of prediabetes , diabetes , and ldl cholesterol ( ldl - c ) that achieved significant levels ( p < 0.05 ) in a univariate logistic regression analysis were tested for their independent association with myps in a multivariate logistic regression model . all differences were evaluated at the 95% level of significance ( p < 0.05 ) . our institution has a database of angioscopic analysis at the beginning of introducing this technology . by using this system , data from 67 patients with coronary artery disease ( cad ) who were observed by an angioscopic evaluation for multivessel cad between september 2000 and july 2007 were retrospectively analyzed in this study . patients were diagnosed as having stable angina pectoris if they had a positive stress test for myocardial ischemia and no change in the frequency , duration , or intensity of clinical symptoms within 4 weeks , including various combinations of chest , upper extremity , jaw , or epigastric discomfort or atypical symptoms ( e.g. , dyspnea or diaphoresis ) . unstable angina pectoris was defined as new - onset severe angina , accelerated angina , or rest angina . patients who did not have any of the above clinical symptoms were diagnosed as having silent myocardial ischemia . patients diagnosed as having acute or recent ( within 1 month from onset ) myocardial infarction during this period were excluded . based on the guidelines of the japan society for the study of obesity , obesity was defined as a bmi of 25 kg / m . blood samples were obtained from the antecubital vein in the fasting state and before each angioscopy procedure . the baseline diagnosis of glucose metabolism was based on the ada guidelines ( 5 ) . diabetes was defined as a fasting plasma glucose ( fpg ) concentration of 126 mg / dl , self - reported clinician - diagnosed diabetes or an hba1c level of 6.5% ( national glycohemoglobin standardization program ) . prediabetes was defined as an fpg concentration of 100125 mg / dl or an hba1c level of 5.76.4% . nondiabetes was defined as an fpg concentration of < 100 mg / dl and an hba1c level of 5.6% . the value of hba1c ( japan diabetes society + 0.4% ) was estimated as a national glycohemoglobin standardization program equivalent value calculated using the appropriate formula ( 14 ) . the medical ethics committee at nippon medical school chiba - hokusoh hospital approved this study protocol , and written informed consent was obtained from all patients before the catheterization procedures . the coronary angioscopic procedure has been reported previously ( 611 ) . coronary arteries with proximal tortuosity , sharp angle , calcification , or ostial stenosis were not performed because of the expected difficulty in acquiring angioscopic images for the entire vessel . before observation the light power was adjusted to avoid reflection and obtain images with adequate brightness for determination of the plaque color . during angioscopic observations , an assistant adjusted the light power to maintain a constant brightness level on the target plaque . angioscopic images and fluoroscopy during the angioscopic observations were recorded simultaneously on videotape for later analysis . the yellow grade was classified semiquantitatively according to the surface color as : 0 , white ; 1 , light yellow ; 2 , yellow ; and 3 , intense yellow . the number of yellow plaques ( nyps ) was determined for each vessel observed and averaged per vessel . the existence of myps was defined as nyps 2 in at least one observed vessel . a ruptured plaque was considered to be a wall irregularity , including a tear , flap , or ulceration on the plaque surface . a thrombus was defined as a coalescent red superficial or protruding mass adhering to the vessel surface , but clearly a separate structure that remained after flushing with ringer lactate . no angiographic stenosis was observed in the right coronary artery ( a ) , whereas an intramural red thrombus was observed at the proximal site ( b ) , and three yellow plaques were identified on angioscopy ( b d ) . the yellow intensity of these plaques was defined as grades 1 , 2 , and 1 , respectively . significant stenosis was not observed in the left circumflex artery ( e ) , whereas two yellow plaques were defined as grades 1 and 2 , respectively ( f and g ) . a 50% stenosis and a 90% stenosis were identified on angiography in the middle part of the left ascending artery ( h ) . according to angioscopic findings , both these lesions were evaluated as grade 3 yellow plaques ( i and j ) . in this case , the average nyp was 2.33 ( seven yellow plaques in three vessels ) , and the myg was 3 . all statistical analyses were performed using the spss software ( version 11.0.1 ; spss inc . , chicago , il ) . categorical variables are presented as frequencies , and these were compared using the pearson test . continuous quantitative data were presented as mean values sd . all variables were evaluated with anova and the least significant difference statistical methods . univariate logistic regression analysis was used to determine the clinical predictors ( age , sex , other coronary risk factors , clinical presentation , medication , and laboratory data ) for myps . prediabetes and diabetes were categorized in each group as a reference of the nondiabetic group . three values of prediabetes , diabetes , and ldl cholesterol ( ldl - c ) that achieved significant levels ( p < 0.05 ) in a univariate logistic regression analysis were tested for their independent association with myps in a multivariate logistic regression model . all differences were evaluated at the 95% level of significance ( p < 0.05 ) . nondiabetes was diagnosed in 16 patients ( 24% ) , prediabetes in 28 patients ( 42% ) , and diabetes in 23 patients ( 34% ) . in the diabetic group , 2 patients ( 9% ) were taking insulin and 14 ( 61% ) oral hypoglycemic agents , whereas 7 patients ( 30% ) were on diet therapy alone . most parameters did not differ between the groups , the exceptions being serum fpg , hba1c , and c - reactive protein ( crp ) levels . mean levels of fpg and hba1c were higher in patients with prediabetes and diabetes than in nondiabetic patients ( 92 5 vs. 102 9 vs. 138 36 mg / dl , p < 0.001 ; 5.2 0.3 vs. 5.7 0.4 vs. 7.4 1.3% , p < 0.001 ; respectively ) . crp levels were higher in the diabetic group than in the prediabetes and nondiabetic groups ( 0.14 0.17 vs. 0.13 0.10 vs. 0.30 0.32 mg / dl ; p = 0.012 ) . statins were prescribed equally in 63% of patients with nondiabetes , 64% of patients with prediabetes , and 70% of patients with diabetes ( p = 0.90 ) . as a result , mean levels of ldl - c were similar among the three groups ( 121 28 vs. 124 28 vs. 111 33 mg / dl ; p = 0.28 ) . patient characteristics and angioscopic findings the angioscopic characteristics of the 67 patients at baseline are also shown in table 1 . total yellow plaque number and yellow intensity differed significantly among the three groups ( p < 0.01 and p = 0.04 , respectively ) . no significant differences were observed in the frequency of plaque rupture and thrombus ( p = 0.89 and p = 0.50 , respectively ) . myps were less prevalent in the nondiabetic group than in the prediabetes and diabetic groups ( 31 vs. 64 vs. 74% , respectively ; p = 0.023 ) . both average nyps per vessel and the maximum yellow grade ( myg ) per coronary artery are shown in fig . these values also showed significant differences between the nondiabetes and the other two groups ( 0.80 0.64 vs. 1.45 0.81 vs. 1.63 0.99 , p = 0.011 ; and 1.44 1.03 vs. 2.00 0.86 vs. 2.30 0.70 , p = 0.047 ; respectively ) . more specifically , the nyp in the prediabetic group was greater than that in the nondiabetic group ( p = 0.017 ) , whereas it was similar to that in the diabetic group ( p = 0.44 ) . similarly , the myg in the prediabetic group was greater than that in the nondiabetic group ( p = 0.040 ) , whereas it was similar to that in the diabetic group ( p = 0.21 ) . univariate logistic regression analysis ( table 2 ) showed that prediabetic , diabetic , and ldl - c levels were significantly associated with an increased risk of myps ( p = 0.039 , p = 0.011 , and p = 0.022 , respectively ) . these three variables were not attenuated in multivariate analysis ( prediabetes : odds ratio [ or ] 4.13 [ 95% ci 1.0117.0 ] , p = 0.049 ; diabetes : or 10.8 [ 95% ci 2.0955.6 ] , p = 0.005 ; and ldl - c : or 1.03 [ 95% ci 1.011.05 ] , p = 0.006 ) . comparisons of angioscopic parameters among the three groups . the average nyp per vessel ( a ) and the average myg per coronary artery ( b ) . coronary arteries in patients with prediabetes and diabetes had significantly more yellow plaques ( 0.80 0.64 vs. 1.45 0.81 vs. 1.63 0.99 ; p = 0.011 ) and a significantly higher myg ( 1.44 1.03 vs. 2.00 0.86 vs. 2.30 0.70 ; p = 0.047 ) than those in patients without diabetes . nondiabetes was diagnosed in 16 patients ( 24% ) , prediabetes in 28 patients ( 42% ) , and diabetes in 23 patients ( 34% ) . in the diabetic group , 2 patients ( 9% ) were taking insulin and 14 ( 61% ) oral hypoglycemic agents , whereas 7 patients ( 30% ) were on diet therapy alone . most parameters did not differ between the groups , the exceptions being serum fpg , hba1c , and c - reactive protein ( crp ) levels . mean levels of fpg and hba1c were higher in patients with prediabetes and diabetes than in nondiabetic patients ( 92 5 vs. 102 9 vs. 138 36 mg / dl , p < 0.001 ; 5.2 0.3 vs. 5.7 0.4 vs. 7.4 1.3% , p < 0.001 ; respectively ) . crp levels were higher in the diabetic group than in the prediabetes and nondiabetic groups ( 0.14 0.17 vs. 0.13 0.10 vs. 0.30 0.32 mg / dl ; p = 0.012 ) . statins were prescribed equally in 63% of patients with nondiabetes , 64% of patients with prediabetes , and 70% of patients with diabetes ( p = 0.90 ) . as a result , mean levels of ldl - c were similar among the three groups ( 121 28 vs. 124 28 vs. 111 33 mg / dl ; p = 0.28 ) . the angioscopic characteristics of the 67 patients at baseline are also shown in table 1 . total yellow plaque number and yellow intensity differed significantly among the three groups ( p < 0.01 and p = 0.04 , respectively ) . no significant differences were observed in the frequency of plaque rupture and thrombus ( p = 0.89 and p = 0.50 , respectively ) . myps were less prevalent in the nondiabetic group than in the prediabetes and diabetic groups ( 31 vs. 64 vs. 74% , respectively ; p = 0.023 ) . both average nyps per vessel and the maximum yellow grade ( myg ) per coronary artery are shown in fig . these values also showed significant differences between the nondiabetes and the other two groups ( 0.80 0.64 vs. 1.45 0.81 vs. 1.63 0.99 , p = 0.011 ; and 1.44 1.03 vs. 2.00 0.86 vs. 2.30 0.70 , p = 0.047 ; respectively ) . more specifically , the nyp in the prediabetic group was greater than that in the nondiabetic group ( p = 0.017 ) , whereas it was similar to that in the diabetic group ( p = 0.44 ) . similarly , the myg in the prediabetic group was greater than that in the nondiabetic group ( p = 0.040 ) , whereas it was similar to that in the diabetic group ( p = 0.21 ) . univariate logistic regression analysis ( table 2 ) showed that prediabetic , diabetic , and ldl - c levels were significantly associated with an increased risk of myps ( p = 0.039 , p = 0.011 , and p = 0.022 , respectively ) . these three variables were not attenuated in multivariate analysis ( prediabetes : odds ratio [ or ] 4.13 [ 95% ci 1.0117.0 ] , p = 0.049 ; diabetes : or 10.8 [ 95% ci 2.0955.6 ] , p = 0.005 ; and ldl - c : or 1.03 [ 95% ci 1.011.05 ] , p = 0.006 ) . comparisons of angioscopic parameters among the three groups . the average nyp per vessel ( a ) and the average myg per coronary artery ( b ) . coronary arteries in patients with prediabetes and diabetes had significantly more yellow plaques ( 0.80 0.64 vs. 1.45 0.81 vs. 1.63 0.99 ; p = 0.011 ) and a significantly higher myg ( 1.44 1.03 vs. 2.00 0.86 vs. 2.30 0.70 ; p = 0.047 ) than those in patients without diabetes . the current study revealed that the average nyp and myg in prediabetic patients were greater than in those in nondiabetic patients , but similar to those in diabetic patients . prediabetes and diabetes were significantly associated with the occurrence of myps inside the coronary arteries . these findings suggest that even prediabetic status is a sign that coronary atherosclerosis has already progressed to a degree similar to that seen in patients with diabetes and may entail an increased risk of cad . in general , patients with diabetes have accelerated coronary atherosclerosis , which aggravates the prognosis because of the high risk of a cardiovascular event ( 1,2 ) . prediabetic patients who subsequently develop diabetes are also considered to be high - risk subjects in terms of their cardiovascular mortality ( 3,4 ) . diabetes , hyperglycemia including prediabetes , free fatty acids , and insulin resistance provoke molecular mechanisms that alter the function and structure of blood vessels ( 1517 ) . these conditions affect vasoconstriction and inflammation and thereby promote coronary atherosclerosis starting in prediabetic status ( 18,19 ) . several investigations using coronary imaging modalities have already elucidated the specific features of advanced coronary atherosclerosis in patients with diabetes ( 2023 ) . in contrast , data concerning the relationship between prediabetes and the degree of coronary atherosclerosis using coronary imaging are limited . a clinical coronary angiography trial showed that coronary atherosclerosis developed not only in patients with diabetes but also in those with igt ( 24 ) . another intravascular ultrasound study showed that patients with abnormal glucose regulation exhibited abundant lipid - rich plaques in their coronary lesions ( 25 ) . postmortem pathological analysis has revealed that the main cause of acs is plaque rupture following thrombus formation ; a plaque that is prone to rupture is characterized by having an abundant necrotic core beneath a thin fibrous cap ( 26 ) . in the human coronary artery , the plaques in acs culprit lesions have been angioscopically identified as yellow ( 68 ) . the relationship between fibrous cap thickness and yellow plaque intensity was investigated using multimodality coronary imaging in vivo ( 10,11 ) . a fibrous cap thickness of < 110 m ( as determined by optical coherence tomography ) was considered as borderline ; this determined whether the plaque color on coronary angioscopy was white or yellow ( considered as a vulnerable plaque ) , and degree of yellow intensity was negatively correlated with the thickness of fibrous cap ( 10 ) . thus , the total nyps represents the proliferation of coronary atherosclerosis overall , whereas the intensity of the yellow color reflects the plaque vulnerability . because the average nyp and myg were equivalent in both prediabetic and diabetic patients , patients with an early stage of glucose metabolism disorder may be likely to have advanced coronary atherosclerosis and be vulnerable to cardiovascular events . a pivotal prospective angioscopic investigation reported that the existence of myps ( nyps per vessel of 2 ) predicted future cardiac events ( 12 ) . in our study , prediabetes , diabetes , and ldl - c were significant predictive factors for the existence of myps . serum ldl - c concentration is known to affect the plaque component and volume ( 27,28 ) . lipid - lowering statin therapy has been found to reduce the intensity of the yellow plaque color , whereas the regression of the yellow intensity was positively correlated with the decrease in ldl - c on the basis of an angioscopic investigation ( 9 ) . consequently , patients with high values of ldl - c are likely to show many yellow plaques on angioscopy . notably , not only diabetes but also prediabetes was a significant factor in the prediction of myps . the findings of a meta - analysis of randomized trials that enrolled a total of 23,152 patients with igt and ifg are interesting ( 29 ) . this study divided the population into two groups : aggressive medical treatment to prevent the progression of diabetes and no treatment . although the medical treatment group showed a significant reduction in future diabetes rates , the all - cause and cardiovascular mortalities were not reduced in comparison with controls . this result may be explained by our finding of equal atherosclerotic proliferation in the prediabetic and diabetic groups . first , data comprise a retrospective analysis of patients in whom whole images of multivessel coronary arteries by angioscopy can be obtained . second , the findings are from a single center and derived from a relatively small number of patients despite long - term study duration . third , patients with ostial stenosis , proximally tortuous coronary arteries , or calcified lesions were excluded because of the difficulty in acquiring angioscopic images . therefore , some selection bias is inevitable . last , we were not able to determine any significant differences in the rates of all - cause death , myocardial death , and myocardial infarction among the three groups ( data not shown ) . because the event rates in all groups were quite low , it was not possible to examine the statistical significance in such a small sample . in summary , the present angioscopic study indicates that the degree of coronary atherosclerosis is equivalent in patients with prediabetes and diabetes and that the former set of patients are therefore likely to be more vulnerable than individuals with normal glucose metabolism . further clinical investigations will be required to create a basis for risk stratification and prevention of future cardiac events in patients with an early stage of glucose metabolism disorder . first , data comprise a retrospective analysis of patients in whom whole images of multivessel coronary arteries by angioscopy can be obtained . second , the findings are from a single center and derived from a relatively small number of patients despite long - term study duration . third , patients with ostial stenosis , proximally tortuous coronary arteries , or calcified lesions were excluded because of the difficulty in acquiring angioscopic images . last , we were not able to determine any significant differences in the rates of all - cause death , myocardial death , and myocardial infarction among the three groups ( data not shown ) . because the event rates in all groups were quite low , it was not possible to examine the statistical significance in such a small sample . in summary , the present angioscopic study indicates that the degree of coronary atherosclerosis is equivalent in patients with prediabetes and diabetes and that the former set of patients are therefore likely to be more vulnerable than individuals with normal glucose metabolism . further clinical investigations will be required to create a basis for risk stratification and prevention of future cardiac events in patients with an early stage of glucose metabolism disorder .

objectiveto determine if prediabetes is associated with atherosclerosis of coronary arteries , we evaluated the degree of coronary atherosclerosis in nondiabetic , prediabetic , and diabetic patients by using coronary angioscopy to identify plaque vulnerability based on yellow color intensity.research design and methodssixty - seven patients with coronary artery disease ( cad ) underwent angioscopic observation of multiple main - trunk coronary arteries . according to the american diabetes association guidelines , patients were divided into nondiabetic ( n = 16 ) , prediabetic ( n = 28 ) , and diabetic ( n = 23 ) groups . plaque color grade was defined as 1 ( light yellow ) , 2 ( yellow ) , or 3 ( intense yellow ) based on angioscopic findings . the number of yellow plaques ( nyps ) per vessel and maximum yellow grade ( myg ) were compared among the groups.resultsmean nyp and myg differed significantly between the groups ( p = 0.01 and p = 0.047 , respectively ) . these indexes were higher in prediabetic than in nondiabetic patients ( p = 0.02 and p = 0.04 , respectively ) , but similar in prediabetic and diabetic patients ( p = 0.44 and p = 0.21 , respectively ) . diabetes and prediabetes were independent predictors of multiple yellow plaques ( nyps 2 ) in multivariate logistic regression analysis ( odds ratio [ or ] 10.8 [ 95% ci 2.0955.6 ] , p = 0.005 ; and or 4.13 [ 95% ci 1.0117.0 ] , p = 0.049 , respectively).conclusionscoronary atherosclerosis and plaque vulnerability were more advanced in prediabetic than in nondiabetic patients and comparable between prediabetic and diabetic patients . slight or mild disorders in glucose metabolism , such as prediabetes , could be a risk factor for cad , as is diabetes itself .

elderly patients represent an ever - growing subgroup of the us population , with an estimated 36 million americans 65 years of age.1 as blood pressure ( bp ) tends to increase with age , hypertension is exceedingly common in the elderly with an estimated prevalence of 67% for adults aged 60 or older,2 and in adults aged 55 to 65 , the lifetime risk of developing hypertension is estimated to be 90%.3 compared to younger adults , older adults are more likely to be aware of a diagnosis of hypertension and receive treatment for it . older patients , however , are less likely to achieve bp control once treated , and this may be due to a variety of reasons including resistant hypertension,4 adherence patterns to treatment regimens , different bp goals for elderly patients used by different physicians , and lengthy and complex hypertension guidelines leading to therapeutic inertia . hypertension is associated with considerable morbidity and an increased risk of cardiovascular disease ( cvd ) , stroke , decreased quality of life , and mortality in the elderly.58 despite the almost universal prevalence of hypertension in the elderly , this population represents a unique subgroup of patients with hypertension due to the fact that there are relatively few clinical trials that have been conducted in the elderly . historically , most clinical hypertension trials excluded elderly patients . clinical trials have also not specifically addressed the risk of adverse events with treatment , which are particularly important in this population and include issues related to drug interactions and side effects of antihypertensive medications , such as orthostatic hypotension in the setting of autonomic dysregulation . this review will focus on the mechanisms and patterns of bp change with age as well as discuss results from published clinical trials in the elderly and how they differ from clinical practice guidelines in attempt to recommend a goal bp for this population . cvd is the most common cause of death in elderly adults and age - related changes to the vasculature play a major role in vulnerability to cvd . arterial aging ( eg , arteriosclerosis ) leads to consequences of isolated systolic hypertension ( ish ) , diastolic heart failure , and small vessel disease in the brain and other organs . ish , defined as systolic bp ( sbp ) greater than or equal to 140 mmhg with diastolic bp ( dbp ) less than 90 mmhg , accounts for 87% of hypertension cases in older adults;9 and elevated sbp is more strongly associated with cardiovascular ( cv ) risk than dbp in the elderly.10 data from the national health and nutrition education survey ( nhanes ) iii demonstrate a progressive rise in sbp with age , yet dbp typically peaks in the sixth decade of life and falls thereafter ( figure 1),11 resulting in ish coupled with a widened pulse pressure . structural and functional alterations occur in the vasculature in response to normal aging , which provide an understanding for this pattern of change in bp in the elderly ( table 1 ) . these alterations are most prominent in the proximal aorta and are underestimated by brachial sphygmomanometer cuff pressure . fracture of elastic lamellae causes dilation and stiffening of blood vessels , a condition previously referred to as senile arteriosclerosis . increased arterial stiffness , due to increased intima - media thickness and collagen accumulation produced by invading vascular smooth muscle cells ( vsmcs ) , results in an increase in aortic pulse wave velocity and thus , early return of the reflected pressure wave and elevation in systolic pressure.12 decreased elasticity of the aorta also results in greater peripheral runoff during systole.12 therefore , with less blood in the aorta during diastole , dbp falls . animal studies suggest that angiotensin ii plays an integral role in vascular aging,13,14 which may be related to increased oxidative stress.15 angiotensin ii signaling , including calpain-1 and matrix metalloproteinase type ii ( mmp2 ) activation , has been linked to an age - associated increase in migration capacity of vsmcs . infusion of angiotensin ii into rats leads to carotid media thickening and intima infiltration by vsmcs , which resembles the arterial remodeling of aging.14 furthermore , chronic administration of angiotensin converting enzyme ( ace ) inhibitors or angiotensin ii type-1 receptor blockers ( arbs ) to rats confers cardiovascular protection and reduces the vascular effects of aging.16 in addition to the aforementioned structural changes to the vasculature , aging is associated with functional changes , such as increased sympathetic activity.17 baroreceptor sensitivity to changes in bp decreases with age , resulting in higher levels of catecholamines accompanied by vasoconstriction.18 while findings from animal models may shed an interesting light on vascular aging in humans , studies in humans are needed to investigate a potential role for specific anti - aging therapies . exercise exerts numerous beneficial effects and is considered vasoprotective , likely , at least in part , via improving endothelial function and reducing inflammation.12,19 though studies support the role of oxidative stress in the pathogenesis of hypertension and cvd , trials of antioxidants ( eg , vitamins c and e ) , while promising in animals,20,21 have largely been disappointing in terms of reducing major cv endpoints in humans.2224 however , these vitamins have only weak antioxidant properties . on the other hand , perhaps some of the benefit derived from ace inhibitors , arbs , and calcium channel blockers ( ccbs ) is mediated by their ability to improve endothelial function and reduce oxidative stress.2528 alterations in the vasculature are accompanied by a cascade of changes in cardiac structure and function that occur with age and contribute to cv morbidity and mortality . elevated systolic pressure increases left ventricular load , which results in left ventricular hypertrophy ( lvh ) . myocardial oxygen demand is increased due to lvh yet oxygen supply is decreased due to shorter duration of diastole , lower diastolic pressure , and coronary atherosclerosis . this supply demand mismatch may predispose to ischemia , which contributes to a vicious cycle of impaired relaxation , shorter diastole , and further decrease in oxygen supply . in addition , impaired relaxation is accompanied by incomplete left ventricular filling as well as increased left atrial and pulmonary pressure , which are features of diastolic heart failure the most common form of heart failure in the elderly . observational data demonstrate a consistent relationship between the degree of elevation in sbp and risk of cvd and stroke.7,8,10,29 this relationship does not prove that treating bp to lower target levels results in fewer events ; and over - aggressive treatment of bp may actually lead to hypoperfusion of vital organs . in fact , for a given level of sbp , risk of death increases for each decrement in dbp ( figure 2).30 these contrasting relationships add another layer of complexity to treatment of bp in elderly patients , especially considering the general trend of ish coupled with a decrease in dbp in the presence of decreased arterial compliance . however , many other studies demonstrate a j - shaped association between bp and cv outcomes ; ie , increased risk at both low and high bp ( figure 3),3134 which may contribute to the tempered enthusiasm of some physicians for the treatment of bp in the elderly . these findings have been replicated in multiple population - based cohorts ; and while the association between low bp and worse outcomes may be partially explained by overall health status or presence of comorbid conditions,35 some studies demonstrate persistence of this association even after controlling for comorbidities.3638 the combination of low sbp and dbp may represent a distinct group of patients with certain comorbidities ( such as heart failure ) or may be indicative of poorer overall health that was not fully adjusted for in statistical models . in a population - based study performed in a swedish cohort of the very elderly,39 participants were stratified into four groups of sbp ( 120 mmhg , 121140 mmhg , 141160 mmhg , or > 160 mmhg ) . single bp measurements were taken at baseline , and comorbidity and medication data were collected only at baseline . consistent with other studies , sbp was found to be more strongly associated with mortality than dbp . in multivariable - adjusted models , the highest risk of death was associated with sbp 120 mmhg . furthermore , a u - shaped mortality curve was seen with the nadir of risk being associated with the two sbp categories representing the range 121160 mmhg , with these two categories demonstrating similar risk . when the coefficients from the final regression model were used to derive a u - curve for mortality risk , the minimum point of the curve corresponded to sbp of 164 mmhg . though it has been suggested that the low bp - higher mortality association manifests only close to death , the investigators performed a sensitivity analysis that excluded deaths within the first year of follow - up ; and this analysis revealed that the association persisted , demonstrating robustness of their findings . another population - based observational study that was performed at four centers in the united states revealed complex relationships between the modifying effects of sex and age on the association between bp and mortality.40 this study followed 12,802 participants aged 65 years or older , 1,088 of whom were 85 years or older . the investigators assessed whether the association between bp and 6-year mortality differed by age category ( < 85 or 85 years ) and sex . subjects in the older age group were more likely to be hospitalized in the previous year , be dependent in activities of daily living , and have a body mass index < 22 kg / m . in models adjusted for a number of demographic and comorbid conditions , there was a statistically significant 4% increased hazard of death in men in the < 85 year old group but an 8% decreased hazard of death in men in the 85 year old group for each 10 mmhg increase in sbp . hazard of death increased for each 10 mmhg increase in sbp in women in the younger age group but no difference was seen in the 85 year old group . u - shaped curves of risk showed that the lowest risk of death corresponded to sbp of 134 mmhg and 182 mmhg for the younger and older men , respectively . the results of these and other studies suggest that the optimal bp in very elderly patients may be higher than previously thought . results from observational studies must be interpreted with caution as they may not be able to fully adjust for greater comorbidity burden , do not prove cause - and - effect relationships , and should not replace well - conducted clinical trials . finally , in a meta - analysis of seven randomized controlled trials ( rcts ) , five of which were performed in the elderly , this j - curve phenomenon was seen in both the active treatment and placebo groups.41 despite a recommended goal bp of < 140/90 mmhg in the seventh report of the joint national committee on prevention , detection , evaluation , and treatment of high blood pressure ( jnc vii),42 there is little evidence to support this recommendation for elderly patients . in fact , prior to the studies described below , elderly patients were either excluded from randomized trials or were recruited in too few numbers to ascertain outcome data . furthermore , a bp goal higher than 140/90 mmhg was targeted in randomized controlled trials ( rcts ) in elderly patients , which is acknowledged in the recent set of guidelines put forth by the european society of hypertension ( esh ) and european society of cardiology ( esc).43 of note , given the high overall burden of cardiovascular events in the elderly , even modest reductions in relative risk with treatment of hypertension likely represents important reductions in absolute risk . as in younger patients , lifestyle modifications including exercise,44 dietary sodium restriction,45 limiting alcohol consumption , and weight loss if appropriate have been shown to reduce bp in elderly patients with hypertension and thus , should be recommended to elderly patients . the landmark hypertension trials involving elderly patients are described in table 2 . in order to formulate our recommendations , we selected rcts for inclusion in this review if the cohorts were comprised of patients either exclusively 60 years of age or if patients 60 years of age represented the majority of the cohort . the first doubleblind rct to study antihypertensive drug treatment in the elderly was conducted in 1972.46 the european working party on high blood pressure in the elderly ( ewphe ) trial recruited patients over the age of 60 years with sbp 160239 mmhg and dbp 90119 mmhg . eight hundred forty patients were randomized to active treatment with diuretics ( hydrochlorothiazide plus triamterene ) or placebo . diuretic doses could be increased or methyldopa added in the treatment group if necessary . mean age of the study participants was 72 years . mean bp at randomization was 183/101 mmhg and 182/101 mmhg in the active treatment and placebo groups , respectively . the study s major findings were a non - significant reduction in all - cause mortality , non - significant reduction in stroke mortality , and a significant 27% reduction in cv mortality ( p=0.037 ) in the active treatment group . the systolic hypertension in the elderly program ( shep ) trial randomized patients 60 years or older with ish to active treatment with chlorthalidone or placebo.47 goal bp for the active treatment group was sbp < 160 mmhg and decrease from baseline sbp of 20 mmhg . atenolol could be added in the active treatment group if bp goal was not achieved . , bp was 143/68 mmhg versus 155/72 mmhg in the active treatment and placebo groups , respectively . active treatment was associated with a 36% reduction in the primary endpoint ( ie , fatal or nonfatal stroke ) , which was statistically significant ( p=0.0003 ) . further , cumulative incidence curves for stroke began to noticeably diverge after approximately 1-year . in a stratified analysis by age category ( 6069 years , 7079 years , 80 years or older ) , the incidence rate of stroke was lower in the active treatment group in all strata . active treatment was also associated with significant reductions in cv events as well as non - significant reductions in all - cause mortality and cv mortality . in a post hoc analysis of the shep trial that investigated various levels of in - trial bp on risk of stroke , participants with sbp < 150 mmhg experienced a 38% reduction in stroke incidence compared to those with sbp 150 mmhg , while those with sbp < 140 mmhg had a 22% risk reduction that was not statistically significant.48 these findings not only suggest that bp reduction in the elderly is effective but also that there may be a moderate bp threshold below which there is no additional benefit . the swedish trial in old patients with hypertension ( stop - hypertension-1 ) trial was a double - blind rct in a swedish cohort of hypertensive patients aged 7084 years.49 entry criteria included sbp 180 mmhg and dbp 90 mmhg or dbp 105 mmhg regardless of sbp . those randomized to the active treatment group received one of four regimens : atenolol , pindolol , metoprolol , or hydrochlorothiazide plus amiloride , as these were the most widely used medications in sweden at the time . beta - blocker could be added to diuretic and vice versa if needed for further bp control . after an average follow - up of 25 months , active treatment reduced the rate of composite endpoint ( stroke and cv events ) by 40% and mortality by 43% , both statistically significant . the results of this study were published at a time when newer antihypertensive medications were becoming available , which led the stop investigators to conduct a subsequent rct that studied these newer agents in a larger cohort of elderly hypertensive patients in sweden . in the stop - hypertension-2 trial,50 6,614 patients were randomized to one of three arms : conventional treatment , ccb , or ace inhibitor . , if bp was not controlled to a target < 160/95 mmhg , medications from other treatment arms could be added . after a mean follow - up of 60.3 months , bp reduction was similar among the groups , and almost half of patients were taking more than one antihypertensive medication at the last study visit . there was no significant difference in risk of the primary composite endpoint of fatal stroke , fatal mi , and other fatal cvd among the three groups . this study highlights an important feature of trials that compare medications between treatment groups in that patients may receive additional medications used in other treatment arms , which has the potential to bias results toward the null . similarly , the benefits ascribed to a particular drug class may derive instead from a combination of drugs . the systolic hypertension in europe ( syst - eur ) and systolic hypertension in china ( syst - china ) trials were two additional double - blind rcts performed in europe and the people s republic of china , respectively.51,52 in both trials , active treatment group consisted of the dihydropyridine ccb nitrendipine with possible addition of ace inhibitor and/or thiazide diuretic to achieve sbp < 150 mmhg and reduction of 20 mmhg from baseline . in the syst - eur trial , active treatment reduced mean bp from 174/86 mmhg to 151/79 mmhg and significantly reduced the rate of stroke and cardiac endpoints . there was no reduction in all - cause mortality . in the syst - china trial , active treatment had a slightly less potent effect on bp reduction compared to that in the latter trial and active treatment was associated with a 38% reduction in stroke , 37% reduction in cv endpoints , and 39% reduction in all - cause mortality , all of which were statistically significant . the medical research council ( mrc)-2 trial was a singleblind rct that enrolled patients in the united kingdom aged 6574 years.53 eligible subjects with sbp 160209 mmhg and dbp < 115 mmhg were assigned to one of three groups : beta - blocker ( atenolol ) , diuretic ( hydrochlorothiazide plus amiloride ) , or placebo and were randomized in a 1:1:2 ratio , respectively . each subject s target bp for the trial was determined by bp during a run - in period . for those whose sbp was < 180 mmhg during the run - in period , target sbp was 150 mmhg ; and for sbp of 180 mmhg during the run - in period , target sbp was 160 mmhg . if target bp was not achieved during the trial , the subject received the other active drug in addition to the drug allocated by randomization . additional antihypertensive medications were used if further bp control was needed despite this two - drug regimen . participants were followed for a mean of 5.8 years . at 2 years , bp reduction was similar in the beta - blocker and diuretic arms . compared with the diuretic arm , more patients in the beta - blocker arm required additional medication to achieve target bp ( 52% versus 38% at 5 years ) , and more patients in the beta - blocker arm discontinued the drug due to either side effects or inadequate control . when the two active treatment groups were combined and compared with placebo , active treatment was associated with statistically significant 25% reduction in the rate of fatal or nonfatal stroke . also , the number of cv events was significantly reduced in the combined treatment arms ( p=0.03 ) . there was a trend toward fewer deaths in the treatment arms , which did not reach statistical significance . interestingly , the investigators detected a significant test of interaction between smoking status and treatment group for stroke events and cv events , such that the beneficial effect on stroke and cv event reduction in the treatment groups was confined to nonsmokers , though these findings should be interpreted with caution as they stem from a post hoc analysis . when diuretic was compared to placebo in multivariable models , diuretic was associated with a statistically significant reduced risk of stroke ( p=0.04 ) , cv event ( p=0.0005 ) , cv death ( p=0.03 ) , and a trend toward decreased all - cause mortality ( not significant ) . furthermore , the benefit of diuretic compared to beta - blocker persisted after adjustment for change in bp from baseline , suggesting that the protective effects conferred by diuretic therapy are independent of changes in bp . the findings of this study are consistent with those of previous studies described above , supporting the treatment of elevated bp in elderly patients to reduce the risk of stroke and other important endpoints ; and the results of the mrc-2 trial favor the use of diuretics as opposed to beta - blockers . subsequent studies have also demonstrated that beta - blocker based antihypertensive regimens are inferior to other regimens and therefore should not be used as first - line agents , especially in the elderly.54,55 one such study , the losartan intervention for endpoint reduction in hypertension ( life ) study,55 was a double - blind randomized trial that compared a losartan - based regimen to an atenolol - based regimen in patients aged 5580 years with hypertension and lvh . after a mean follow - up of 4.7 years and similar bp reductions in the two groups , the group randomized to losartan had a 40% reduction in risk of stroke ( p=0.02 ) . the potential advantage of diuretics was demonstrated in the antihypertensive and lipid - lowering treatment to prevent heart attack trial ( allhat).56 this large , double - blind rct compared the three treatment arms of chlorthalidone , lisinopril , and amlodipine in subjects aged 55 years or older ( more than half were 65 years or older ) with hypertension plus at least one additional cvd risk factor . when compared with chlorthalidone , the amlodipine group had a higher rate of heart failure , and the lisinopril group had higher rates of cvd , stroke , and heart failure all statistically significant secondary endpoints . however , the purported superiority of a diuretic - based regimen has been questioned . in allhat , there was no difference among the groups in the study s primary endpoint or all - cause mortality . furthermore , sbp in the chlorthalidone group was controlled to a slightly but significantly lower level than the other groups , which likely explains at least some of the benefit appreciated in the chlorthalidone group . however , in a subsequent rct that compared ace inhibitor to diuretic therapy in elderly australian patients with hypertension , similar bp reduction was achieved at 5 years ( 26/12 mmhg in both groups ) ; and there was a trend toward reduced risk of the primary outcome of cardiovascular events or all - cause mortality in the ace inhibitor group , which was close to reaching statistical significance ( hazard ratio 0.89 , 95% confidence interval [ ci ] 0.791.00 , p=0.05).57 diuretic therapy in combination with ace inhibitor was found to be inferior to a combination of dihydropyridine ccb and ace inhibitor in the avoiding cardiovascular events through combination therapy in patients living with systolic hypertension ( accomplish ) trial.58 this double - blind rct randomized 11,506 hypertensive patients at high risk for cv events , approximately two - thirds of whom were 65 years of age . baseline bp was similar between groups and after a mean follow - up of 3 years , bp was lowered to 132/73 mmhg in the amlodipine / benazepril arm versus 133/74 mmhg in the hydrochlorothiazide / benazepril arm , a small difference in bp between groups that was statistically significant ( p<0.001 ) . risk of the primary outcome of death from cv causes and cv events was reduced in the amlodipine / benazepril arm ( hazard ratio 0.8 , p<0.001 ) . in the studies described above , a relatively small proportion of the study cohorts were comprised of patients older than 80 years . in 1999 , gueyffier et al for the individual data analysis of antihypertensive intervention ( indana ) group collected data from the subgroup of patients 80 years of age included in rcts and published their results in a meta - analysis.59 a pooled total of 1,670 study participants from seven trials , ranging from 7 to 650 subjects from each trial , were included in the analysis . of these study participants , 76% were women , and a small proportion were smokers , diabetic , or had a history of stroke or myocardial infarction ( mi ) . compared to placebo , drug treatment was associated with a 34% reduction in risk of fatal or nonfatal stroke ( 95% ci 48%92% , p=0.014 ) . there was no association between treatment group and mortality but a non - significant 6% increased mortality in the drug treatment group . following publication of this meta - analysis of subgroups , almost a decade passed before results of a trial that specifically enrolled very elderly patients was published . the hypertension in the very elderly trial ( hyvet ) was a double - blind rct that randomized 3,845 patients who were 80 years of age or older with persistent sbp 160199 mmhg to either the diuretic indapamide or placebo.60 initially , the study protocol also required elevated dbp as an entry criterion , but the protocol was later amended in order to allow for recruitment of patients with ish . target bp was 150/80 mmhg ; and ace inhibitor was added in the treatment group if necessary to achieve this goal bp . subjects had a mean age 83.6 years and were followed for a median of 1.8 years . at 2 years , bp had fallen by 15/7 mmhg and 30/13 mmhg in the placebo and active treatment groups , respectively . the target bp was achieved in only 48.0% of the active treatment group but also in 19.9% of the placebo group ( p<0.001 ) . active treatment was associated with 30% reduction in the primary endpoint , fatal or nonfatal stroke , which was close to reaching statistical significance ( p=0.06 ) . however , secondary endpoints that did reach statistical significance were a 21% reduction in rate of death from any cause ( p=0.02 ) , 64% reduction in rate of heart failure ( p<0.001 ) , and a 34% reduction in rate of any cv event ( p<0.001 ) in the active treatment group compared to placebo . the study found that the number of patients needed to be treated for 2 years to prevent one stroke was 94 , which may even be an overestimate given that the patients enrolled in the study tended to be healthier than patients of similar age in the general population . furthermore , roughly half of patients in the active treatment group achieved the target bp , thus underestimating the full effect of treatment . the hyvet study highlighted the benefits of lowering bp in the very elderly , even to a modest target of 150/80 mmhg . the valsartan in elderly isolated systolic hypertension ( valish ) study was an rct designed to compare the effect of strict sbp control ( < 140 mmhg ) versus moderate control ( 140 mmhg and < 150 mmhg ) on cv morbidity and mortality in elderly japanese patients with ish.61 this study included 3,260 participants aged 70 to 84 years . valsartan was administered to all patients as the first antihypertensive medication with a dose increase in the first 2 months or addition of an alternate agent ( except other arbs ) if needed to achieve the target bp as assigned by randomization . after 3 years of follow - up , mean bps in the strict control and moderate control groups were 137/75 mmhg and 142/77 mmhg , respectively ( p<0.001 ) . the mean number of antihypertensive medications used was the same across groups , but those in the strict control group were on a higher dose of valsartan . the primary endpoint of the study was a composite of sudden death , fatal or nonfatal stroke , fatal or nonfatal mi , death due to heart failure , other cv death , unplanned hospitalization for cvd , and renal dysfunction . the strict control group had a slightly reduced rate of the composite endpoint compared to the moderate control group : 10.6 events per 1,000 patient - years versus 12.0 events per 1,000 patient - years , which was not statistically significant ( hazard ratio 0.89 , 95% ci 0.601.31 , p=0.38 ) . furthermore , there were no differences between groups for each individual component of the composite endpoint . the valish study , however , was vastly underpowered due to an underestimation of event rate in this relatively healthy study population but confirmed the findings from a similar study in elderly japanese patients that demonstrated no difference in primary endpoint between strict bp control ( sbp < 140 mmhg ) and moderate control ( sbp 140 mmhg and < 160 mmhg ) groups.62 given the available evidence , sbp reduction to a goal < 150 mmhg may be sufficient to reduce cv risk . of note , the benefits of bp - lowering tend to be underestimated by the results of the aforementioned studies due to some patients in the placebo group ( eg , approximately one - third in the shep trial ) taking antihypertensive medication during the trial as stipulated in the study protocol for severely elevated bp coupled with an intention - to - treat analysis . cvd is the most common cause of death in elderly adults and age - related changes to the vasculature play a major role in vulnerability to cvd . arterial aging ( eg , arteriosclerosis ) leads to consequences of isolated systolic hypertension ( ish ) , diastolic heart failure , and small vessel disease in the brain and other organs . ish , defined as systolic bp ( sbp ) greater than or equal to 140 mmhg with diastolic bp ( dbp ) less than 90 mmhg , accounts for 87% of hypertension cases in older adults;9 and elevated sbp is more strongly associated with cardiovascular ( cv ) risk than dbp in the elderly.10 data from the national health and nutrition education survey ( nhanes ) iii demonstrate a progressive rise in sbp with age , yet dbp typically peaks in the sixth decade of life and falls thereafter ( figure 1),11 resulting in ish coupled with a widened pulse pressure . structural and functional alterations occur in the vasculature in response to normal aging , which provide an understanding for this pattern of change in bp in the elderly ( table 1 ) . these alterations are most prominent in the proximal aorta and are underestimated by brachial sphygmomanometer cuff pressure . fracture of elastic lamellae causes dilation and stiffening of blood vessels , a condition previously referred to as senile arteriosclerosis . increased arterial stiffness , due to increased intima - media thickness and collagen accumulation produced by invading vascular smooth muscle cells ( vsmcs ) , results in an increase in aortic pulse wave velocity and thus , early return of the reflected pressure wave and elevation in systolic pressure.12 decreased elasticity of the aorta also results in greater peripheral runoff during systole.12 therefore , with less blood in the aorta during diastole , dbp falls . animal studies suggest that angiotensin ii plays an integral role in vascular aging,13,14 which may be related to increased oxidative stress.15 angiotensin ii signaling , including calpain-1 and matrix metalloproteinase type ii ( mmp2 ) activation , has been linked to an age - associated increase in migration capacity of vsmcs . infusion of angiotensin ii into rats leads to carotid media thickening and intima infiltration by vsmcs , which resembles the arterial remodeling of aging.14 furthermore , chronic administration of angiotensin converting enzyme ( ace ) inhibitors or angiotensin ii type-1 receptor blockers ( arbs ) to rats confers cardiovascular protection and reduces the vascular effects of aging.16 in addition to the aforementioned structural changes to the vasculature , aging is associated with functional changes , such as increased sympathetic activity.17 baroreceptor sensitivity to changes in bp decreases with age , resulting in higher levels of catecholamines accompanied by vasoconstriction.18 while findings from animal models may shed an interesting light on vascular aging in humans , studies in humans are needed to investigate a potential role for specific anti - aging therapies . exercise exerts numerous beneficial effects and is considered vasoprotective , likely , at least in part , via improving endothelial function and reducing inflammation.12,19 though studies support the role of oxidative stress in the pathogenesis of hypertension and cvd , trials of antioxidants ( eg , vitamins c and e ) , while promising in animals,20,21 have largely been disappointing in terms of reducing major cv endpoints in humans.2224 however , these vitamins have only weak antioxidant properties . on the other hand , perhaps some of the benefit derived from ace inhibitors , arbs , and calcium channel blockers ( ccbs ) is mediated by their ability to improve endothelial function and reduce oxidative stress.2528 alterations in the vasculature are accompanied by a cascade of changes in cardiac structure and function that occur with age and contribute to cv morbidity and mortality . elevated systolic pressure increases left ventricular load , which results in left ventricular hypertrophy ( lvh ) . myocardial oxygen demand is increased due to lvh yet oxygen supply is decreased due to shorter duration of diastole , lower diastolic pressure , and coronary atherosclerosis . this supply demand mismatch may predispose to ischemia , which contributes to a vicious cycle of impaired relaxation , shorter diastole , and further decrease in oxygen supply . in addition , impaired relaxation is accompanied by incomplete left ventricular filling as well as increased left atrial and pulmonary pressure , which are features of diastolic heart failure the most common form of heart failure in the elderly . observational data demonstrate a consistent relationship between the degree of elevation in sbp and risk of cvd and stroke.7,8,10,29 this relationship does not prove that treating bp to lower target levels results in fewer events ; and over - aggressive treatment of bp may actually lead to hypoperfusion of vital organs . in fact , for a given level of sbp , risk of death increases for each decrement in dbp ( figure 2).30 these contrasting relationships add another layer of complexity to treatment of bp in elderly patients , especially considering the general trend of ish coupled with a decrease in dbp in the presence of decreased arterial compliance . however , many other studies demonstrate a j - shaped association between bp and cv outcomes ; ie , increased risk at both low and high bp ( figure 3),3134 which may contribute to the tempered enthusiasm of some physicians for the treatment of bp in the elderly . these findings have been replicated in multiple population - based cohorts ; and while the association between low bp and worse outcomes may be partially explained by overall health status or presence of comorbid conditions,35 some studies demonstrate persistence of this association even after controlling for comorbidities.3638 the combination of low sbp and dbp may represent a distinct group of patients with certain comorbidities ( such as heart failure ) or may be indicative of poorer overall health that was not fully adjusted for in statistical models . in a population - based study performed in a swedish cohort of the very elderly,39 participants were stratified into four groups of sbp ( 120 mmhg , 121140 mmhg , 141160 mmhg , or > 160 mmhg ) . single bp measurements were taken at baseline , and comorbidity and medication data were collected only at baseline . consistent with other studies , sbp was found to be more strongly associated with mortality than dbp . in multivariable - adjusted models , the highest risk of death was associated with sbp 120 mmhg . furthermore , a u - shaped mortality curve was seen with the nadir of risk being associated with the two sbp categories representing the range 121160 mmhg , with these two categories demonstrating similar risk . when the coefficients from the final regression model were used to derive a u - curve for mortality risk , the minimum point of the curve corresponded to sbp of 164 mmhg . though it has been suggested that the low bp - higher mortality association manifests only close to death , the investigators performed a sensitivity analysis that excluded deaths within the first year of follow - up ; and this analysis revealed that the association persisted , demonstrating robustness of their findings . another population - based observational study that was performed at four centers in the united states revealed complex relationships between the modifying effects of sex and age on the association between bp and mortality.40 this study followed 12,802 participants aged 65 years or older , 1,088 of whom were 85 years or older . the investigators assessed whether the association between bp and 6-year mortality differed by age category ( < 85 or 85 years ) and sex . subjects in the older age group were more likely to be hospitalized in the previous year , be dependent in activities of daily living , and have a body mass index < 22 kg / m . in models adjusted for a number of demographic and comorbid conditions , there was a statistically significant 4% increased hazard of death in men in the < 85 year old group but an 8% decreased hazard of death in men in the 85 year old group for each 10 mmhg increase in sbp . hazard of death increased for each 10 mmhg increase in sbp in women in the younger age group but no difference was seen in the 85 year old group . u - shaped curves of risk showed that the lowest risk of death corresponded to sbp of 134 mmhg and 182 mmhg for the younger and older men , respectively . the results of these and other studies suggest that the optimal bp in very elderly patients may be higher than previously thought . results from observational studies must be interpreted with caution as they may not be able to fully adjust for greater comorbidity burden , do not prove cause - and - effect relationships , and should not replace well - conducted clinical trials . finally , in a meta - analysis of seven randomized controlled trials ( rcts ) , five of which were performed in the elderly , this j - curve phenomenon was seen in both the active treatment and placebo groups.41 despite a recommended goal bp of < 140/90 mmhg in the seventh report of the joint national committee on prevention , detection , evaluation , and treatment of high blood pressure ( jnc vii),42 there is little evidence to support this recommendation for elderly patients . in fact , prior to the studies described below , elderly patients were either excluded from randomized trials or were recruited in too few numbers to ascertain outcome data . furthermore , a bp goal higher than 140/90 mmhg was targeted in randomized controlled trials ( rcts ) in elderly patients , which is acknowledged in the recent set of guidelines put forth by the european society of hypertension ( esh ) and european society of cardiology ( esc).43 of note , given the high overall burden of cardiovascular events in the elderly , even modest reductions in relative risk with treatment of hypertension likely represents important reductions in absolute risk . as in younger patients , lifestyle modifications including exercise,44 dietary sodium restriction,45 limiting alcohol consumption , and weight loss if appropriate have been shown to reduce bp in elderly patients with hypertension and thus , should be recommended to elderly patients . the landmark hypertension trials involving elderly patients are described in table 2 . in order to formulate our recommendations , we selected rcts for inclusion in this review if the cohorts were comprised of patients either exclusively 60 years of age or if patients 60 years of age represented the majority of the cohort . the first doubleblind rct to study antihypertensive drug treatment in the elderly was conducted in 1972.46 the european working party on high blood pressure in the elderly ( ewphe ) trial recruited patients over the age of 60 years with sbp 160239 mmhg and dbp 90119 mmhg . eight hundred forty patients were randomized to active treatment with diuretics ( hydrochlorothiazide plus triamterene ) or placebo . mean bp at randomization was 183/101 mmhg and 182/101 mmhg in the active treatment and placebo groups , respectively . the study s major findings were a non - significant reduction in all - cause mortality , non - significant reduction in stroke mortality , and a significant 27% reduction in cv mortality ( p=0.037 ) in the active treatment group . the systolic hypertension in the elderly program ( shep ) trial randomized patients 60 years or older with ish to active treatment with chlorthalidone or placebo.47 goal bp for the active treatment group was sbp < 160 mmhg and decrease from baseline sbp of 20 mmhg . atenolol could be added in the active treatment group if bp goal was not achieved . , bp was 143/68 mmhg versus 155/72 mmhg in the active treatment and placebo groups , respectively . active treatment was associated with a 36% reduction in the primary endpoint ( ie , fatal or nonfatal stroke ) , which was statistically significant ( p=0.0003 ) . further , cumulative incidence curves for stroke began to noticeably diverge after approximately 1-year . in a stratified analysis by age category ( 6069 years , 7079 years , 80 years or older ) , the incidence rate of stroke was lower in the active treatment group in all strata . active treatment was also associated with significant reductions in cv events as well as non - significant reductions in all - cause mortality and cv mortality . in a post hoc analysis of the shep trial that investigated various levels of in - trial bp on risk of stroke , participants with sbp < 150 mmhg experienced a 38% reduction in stroke incidence compared to those with sbp 150 mmhg , while those with sbp < 140 mmhg had a 22% risk reduction that was not statistically significant.48 these findings not only suggest that bp reduction in the elderly is effective but also that there may be a moderate bp threshold below which there is no additional benefit . the swedish trial in old patients with hypertension ( stop - hypertension-1 ) trial was a double - blind rct in a swedish cohort of hypertensive patients aged 7084 years.49 entry criteria included sbp 180 mmhg and dbp 90 mmhg or dbp 105 mmhg regardless of sbp . those randomized to the active treatment group received one of four regimens : atenolol , pindolol , metoprolol , or hydrochlorothiazide plus amiloride , as these were the most widely used medications in sweden at the time . beta - blocker could be added to diuretic and vice versa if needed for further bp control . after an average follow - up of 25 months , active treatment reduced the rate of composite endpoint ( stroke and cv events ) by 40% and mortality by 43% , both statistically significant . the results of this study were published at a time when newer antihypertensive medications were becoming available , which led the stop investigators to conduct a subsequent rct that studied these newer agents in a larger cohort of elderly hypertensive patients in sweden . in the stop - hypertension-2 trial,50 6,614 patients were randomized to one of three arms : conventional treatment , ccb , or ace inhibitor . conventional treatment consisted of beta - blockers and/or diuretics . after 2 months , if bp was not controlled to a target < 160/95 mmhg , medications from other treatment arms could be added . after a mean follow - up of 60.3 months , bp reduction was similar among the groups , and almost half of patients were taking more than one antihypertensive medication at the last study visit . there was no significant difference in risk of the primary composite endpoint of fatal stroke , fatal mi , and other fatal cvd among the three groups . this study highlights an important feature of trials that compare medications between treatment groups in that patients may receive additional medications used in other treatment arms , which has the potential to bias results toward the null . similarly , the benefits ascribed to a particular drug class may derive instead from a combination of drugs . the systolic hypertension in europe ( syst - eur ) and systolic hypertension in china ( syst - china ) trials were two additional double - blind rcts performed in europe and the people s republic of china , respectively.51,52 in both trials , active treatment group consisted of the dihydropyridine ccb nitrendipine with possible addition of ace inhibitor and/or thiazide diuretic to achieve sbp < 150 mmhg and reduction of 20 mmhg from baseline . in the syst - eur trial , active treatment reduced mean bp from 174/86 mmhg to 151/79 mmhg and significantly reduced the rate of stroke and cardiac endpoints . there was no reduction in all - cause mortality . in the syst - china trial , active treatment had a slightly less potent effect on bp reduction compared to that in the latter trial and active treatment was associated with a 38% reduction in stroke , 37% reduction in cv endpoints , and 39% reduction in all - cause mortality , all of which were statistically significant . the medical research council ( mrc)-2 trial was a singleblind rct that enrolled patients in the united kingdom aged 6574 years.53 eligible subjects with sbp 160209 mmhg and dbp < 115 mmhg were assigned to one of three groups : beta - blocker ( atenolol ) , diuretic ( hydrochlorothiazide plus amiloride ) , or placebo and were randomized in a 1:1:2 ratio , respectively . each subject s target bp for the trial was determined by bp during a run - in period . for those whose sbp was < 180 mmhg during the run - in period , target sbp was 150 mmhg ; and for sbp of 180 mmhg during the run - in period , target sbp was 160 mmhg . if target bp was not achieved during the trial , the subject received the other active drug in addition to the drug allocated by randomization . additional antihypertensive medications were used if further bp control was needed despite this two - drug regimen . , bp reduction was similar in the beta - blocker and diuretic arms . compared with the diuretic arm , more patients in the beta - blocker arm required additional medication to achieve target bp ( 52% versus 38% at 5 years ) , and more patients in the beta - blocker arm discontinued the drug due to either side effects or inadequate control . when the two active treatment groups were combined and compared with placebo , active treatment was associated with statistically significant 25% reduction in the rate of fatal or nonfatal stroke . also , the number of cv events was significantly reduced in the combined treatment arms ( p=0.03 ) . there was a trend toward fewer deaths in the treatment arms , which did not reach statistical significance . interestingly , the investigators detected a significant test of interaction between smoking status and treatment group for stroke events and cv events , such that the beneficial effect on stroke and cv event reduction in the treatment groups was confined to nonsmokers , though these findings should be interpreted with caution as they stem from a post hoc analysis . when diuretic was compared to placebo in multivariable models , diuretic was associated with a statistically significant reduced risk of stroke ( p=0.04 ) , cv event ( p=0.0005 ) , cv death ( p=0.03 ) , and a trend toward decreased all - cause mortality ( not significant ) . atenolol did not reduce the risk of these outcomes . furthermore , the benefit of diuretic compared to beta - blocker persisted after adjustment for change in bp from baseline , suggesting that the protective effects conferred by diuretic therapy are independent of changes in bp . the findings of this study are consistent with those of previous studies described above , supporting the treatment of elevated bp in elderly patients to reduce the risk of stroke and other important endpoints ; and the results of the mrc-2 trial favor the use of diuretics as opposed to beta - blockers . subsequent studies have also demonstrated that beta - blocker based antihypertensive regimens are inferior to other regimens and therefore should not be used as first - line agents , especially in the elderly.54,55 one such study , the losartan intervention for endpoint reduction in hypertension ( life ) study,55 was a double - blind randomized trial that compared a losartan - based regimen to an atenolol - based regimen in patients aged 5580 years with hypertension and lvh . after a mean follow - up of 4.7 years and similar bp reductions in the two groups , the group randomized to losartan had a 40% reduction in risk of stroke ( p=0.02 ) . the potential advantage of diuretics was demonstrated in the antihypertensive and lipid - lowering treatment to prevent heart attack trial ( allhat).56 this large , double - blind rct compared the three treatment arms of chlorthalidone , lisinopril , and amlodipine in subjects aged 55 years or older ( more than half were 65 years or older ) with hypertension plus at least one additional cvd risk factor . when compared with chlorthalidone , the amlodipine group had a higher rate of heart failure , and the lisinopril group had higher rates of cvd , stroke , and heart failure all statistically significant secondary endpoints . however , the purported superiority of a diuretic - based regimen has been questioned . in allhat , there was no difference among the groups in the study s primary endpoint or all - cause mortality . furthermore , sbp in the chlorthalidone group was controlled to a slightly but significantly lower level than the other groups , which likely explains at least some of the benefit appreciated in the chlorthalidone group . however , in a subsequent rct that compared ace inhibitor to diuretic therapy in elderly australian patients with hypertension , similar bp reduction was achieved at 5 years ( 26/12 mmhg in both groups ) ; and there was a trend toward reduced risk of the primary outcome of cardiovascular events or all - cause mortality in the ace inhibitor group , which was close to reaching statistical significance ( hazard ratio 0.89 , 95% confidence interval [ ci ] 0.791.00 , p=0.05).57 diuretic therapy in combination with ace inhibitor was found to be inferior to a combination of dihydropyridine ccb and ace inhibitor in the avoiding cardiovascular events through combination therapy in patients living with systolic hypertension ( accomplish ) trial.58 this double - blind rct randomized 11,506 hypertensive patients at high risk for cv events , approximately two - thirds of whom were 65 years of age . baseline bp was similar between groups and after a mean follow - up of 3 years , bp was lowered to 132/73 mmhg in the amlodipine / benazepril arm versus 133/74 mmhg in the hydrochlorothiazide / benazepril arm , a small difference in bp between groups that was statistically significant ( p<0.001 ) . risk of the primary outcome of death from cv causes and cv events was reduced in the amlodipine / benazepril arm ( hazard ratio 0.8 , p<0.001 ) . in the studies described above , a relatively small proportion of the study cohorts were comprised of patients older than 80 years . in 1999 , gueyffier et al for the individual data analysis of antihypertensive intervention ( indana ) group collected data from the subgroup of patients 80 years of age included in rcts and published their results in a meta - analysis.59 a pooled total of 1,670 study participants from seven trials , ranging from 7 to 650 subjects from each trial , were included in the analysis . of these study participants , 76% were women , and a small proportion were smokers , diabetic , or had a history of stroke or myocardial infarction ( mi ) . compared to placebo , drug treatment was associated with a 34% reduction in risk of fatal or nonfatal stroke ( 95% ci 48%92% , p=0.014 ) . there was no association between treatment group and mortality but a non - significant 6% increased mortality in the drug treatment group . following publication of this meta - analysis of subgroups , almost a decade passed before results of a trial that specifically enrolled very elderly patients was published . the hypertension in the very elderly trial ( hyvet ) was a double - blind rct that randomized 3,845 patients who were 80 years of age or older with persistent sbp 160199 mmhg to either the diuretic indapamide or placebo.60 initially , the study protocol also required elevated dbp as an entry criterion , but the protocol was later amended in order to allow for recruitment of patients with ish . target bp was 150/80 mmhg ; and ace inhibitor was added in the treatment group if necessary to achieve this goal bp . subjects had a mean age 83.6 years and were followed for a median of 1.8 years . at 2 years , bp had fallen by 15/7 mmhg and 30/13 mmhg in the placebo and active treatment groups , respectively . the target bp was achieved in only 48.0% of the active treatment group but also in 19.9% of the placebo group ( p<0.001 ) . active treatment was associated with 30% reduction in the primary endpoint , fatal or nonfatal stroke , which was close to reaching statistical significance ( p=0.06 ) . however , secondary endpoints that did reach statistical significance were a 21% reduction in rate of death from any cause ( p=0.02 ) , 64% reduction in rate of heart failure ( p<0.001 ) , and a 34% reduction in rate of any cv event ( p<0.001 ) in the active treatment group compared to placebo . the study found that the number of patients needed to be treated for 2 years to prevent one stroke was 94 , which may even be an overestimate given that the patients enrolled in the study tended to be healthier than patients of similar age in the general population . furthermore , roughly half of patients in the active treatment group achieved the target bp , thus underestimating the full effect of treatment . the hyvet study highlighted the benefits of lowering bp in the very elderly , even to a modest target of 150/80 mmhg . the valsartan in elderly isolated systolic hypertension ( valish ) study was an rct designed to compare the effect of strict sbp control ( < 140 mmhg ) versus moderate control ( 140 mmhg and < 150 mmhg ) on cv morbidity and mortality in elderly japanese patients with ish.61 this study included 3,260 participants aged 70 to 84 years . valsartan was administered to all patients as the first antihypertensive medication with a dose increase in the first 2 months or addition of an alternate agent ( except other arbs ) if needed to achieve the target bp as assigned by randomization . after 3 years of follow - up , mean bps in the strict control and moderate control groups were 137/75 mmhg and 142/77 mmhg , respectively ( p<0.001 ) . the mean number of antihypertensive medications used was the same across groups , but those in the strict control group were on a higher dose of valsartan . the primary endpoint of the study was a composite of sudden death , fatal or nonfatal stroke , fatal or nonfatal mi , death due to heart failure , other cv death , unplanned hospitalization for cvd , and renal dysfunction . the strict control group had a slightly reduced rate of the composite endpoint compared to the moderate control group : 10.6 events per 1,000 patient - years versus 12.0 events per 1,000 patient - years , which was not statistically significant ( hazard ratio 0.89 , 95% ci 0.601.31 , p=0.38 ) . furthermore , there were no differences between groups for each individual component of the composite endpoint . the valish study , however , was vastly underpowered due to an underestimation of event rate in this relatively healthy study population but confirmed the findings from a similar study in elderly japanese patients that demonstrated no difference in primary endpoint between strict bp control ( sbp < 140 mmhg ) and moderate control ( sbp 140 mmhg and < 160 mmhg ) groups.62 given the available evidence , sbp reduction to a goal < 150 mmhg may be sufficient to reduce cv risk . of note , the benefits of bp - lowering tend to be underestimated by the results of the aforementioned studies due to some patients in the placebo group ( eg , approximately one - third in the shep trial ) taking antihypertensive medication during the trial as stipulated in the study protocol for severely elevated bp coupled with an intention - to - treat analysis . the treatment of hypertension in elderly patients is challenging due to risk of orthostatic hypotension , drug drug interactions , adverse drug reactions , coexisting medical conditions , or barriers to adherence ( including memory loss or drug cost ) . in addition , the risk of brain hypoperfusion via over - aggressive bp reduction is exacerbated by impaired cerebrovascular autoregulatory ability in elderly hypertensive patients.63 lifestyle modifications should be recommended to all patients with hypertension . prior to initiating drug therapy , it may be necessary to confirm a diagnosis of hypertension with ambulatory bp monitoring due to an increased prevalence of white - coat effect in the elderly.64 this temporary increase in autonomic activity has a greater effect on raising sbp than dbp and thus can mimic ish . furthermore , home bp has the added value of being a better predictor of cv morbidity and mortality than office bp.65 in addition , bp should be checked in supine , seated , and standing positions to assess for orthostatic changes . bp reduction is probably more important than the use of a particular agent to accomplish bp reduction.66 therefore , we recommend considering the individual patient s clinical history and comorbid conditions upon selection of an anti - hypertensive medication ( table 3 ) . given conflicting data regarding the superiority of a particular drug class , we recommend that use of thiazide diuretics , dihydropyridine ccbs , or ace inhibitors / arbs are all reasonable options as first - line therapy . patients should be started on the lowest dose as the elderly are highly susceptible to volume contraction and electrolyte disturbances . combination therapy using diuretic plus ace inhibitor , arb , or potassium - sparing diuretic can be utilized to mitigate hypokalemia . unless indicated for another medical condition ( eg , prior mi , heart failure , or arrhythmia ) , use of beta blockers should be minimized or avoided . finally , use of the centrally - acting alpha-2 adrenergic agonist clonidine should be avoided due to an unfavorable side effect profile . as sbp increases almost linearly with age and the dbp declines as a manifestation of age - related increased arterial stiffness , most elderly patients have predominantly systolic hypertension ; and in elderly patients , elevated sbp is a stronger predictor of cardiovascular risk than dbp . therefore , treatment goals should probably be focused on sbp readings , as suggested in the jnc vii guidelines . the american college of cardiology foundation / american heart association ( accf / aha ) 2011 guidelines on hypertension management in the elderly recommend an sbp goal < 140 mmhg for most patients less than 80 years of age , and for patients 80 years old , a goal of 140145 mmhg is acceptable.67 the jnc vii guidelines , which are from 2003 and are in the process of being updated , had recommended an sbp goal of < 140 mmhg for all patients without comorbidities and lacked any specific sbp goals for the elderly . the 2013 esh / esc guidelines recommend an sbp goal of 140150 mmhg in patients greater than 80 years old . in ft patients less than 80 years old , an sbp less than 140 mmhg can be considered ; and in the fragile elderly population , sbp goals should be adapted to individual tolerability.43 table 4 contrasts our recommendations with those of other recent guidelines ; and the level of evidence supporting these recommendations varies . given the available evidence summarized in detail above , we recommend an sbp target of < 140 mmhg for patients less than 80 years of age ( which is largely opinion - based but consistent with recommendations by major guideline committees ) and an sbp target of 140150 mmhg in patients older than 80 years of age . the latter level of bp both approximates the mean bp achieved in the active treatment arm of rcts and avoids the risk of hypoperfusion . furthermore , the results of studies in very elderly japanese patients did not demonstrate a benefit from more aggressive bp control . in addition to providing cv benefit , sbp in the 135150 mmhg range seems to be protective in reducing the rate of cognitive decline compared with sbp < 135 or > 150 mmhg.68 at this time , there is insufficient evidence to suggest different bp targets for elderly patients with diabetes mellitus or chronic kidney disease . our simplified yet evidence - based recommendations may serve to minimize physician related barriers to treatment success and reduce the morbidity associated with hypertension in the elderly .

hypertension is common in the elderly , and isolated systolic hypertension is responsible for the majority of hypertension in this population . hypertension in the elderly can be attributed to numerous structural and functional changes to the vasculature that develop with advancing age . increased systolic blood pressure is associated with adverse outcomes , including stroke , cardiovascular disease , and death . some studies demonstrate an inverse relationship between cardiovascular outcomes and diastolic blood pressure whereas other studies show a j - shaped or u - shaped association between blood pressure and outcomes . the complex j - shaped association coupled with the unique characteristics of elderly patients have led to much debate and confusion regarding the treatment of hypertension in this population . clinical trials indicate a benefit to therapy in older adults , and there appears to be no age threshold above which antihypertensive therapy should be withheld . treatment of hypertension in elderly patients is further complicated by increased susceptibility to brain hypoperfusion with orthostatic hypotension as well as the risk of drug drug interactions . we recommend a systolic blood pressure goal of < 140 mmhg in patients less than 80 years of age and a systolic blood pressure goal of 140150 mmhg in patients 80 years of age or older . reduction of blood pressure is probably more important than the specific agent used and initiation of drug therapy with an angiotensin converting enzyme inhibitor , angiotensin receptor blocker , calcium channel blocker , or diuretic are all reasonable options , and the decision should be individualized based on underlying comorbidities .

1 ) . most chimpanzee ascs adopt a fibroblast - like phenotype in vitro ( fig . 1 ) , consistent with previous reports of human ascs ( zuk et al . 2001 ) and with the human ascs profiled in this study ( fig . when grown to confluence , the chimpanzee ascs migrate on top of one another and appear to exhibit lower levels of contact inhibition than the human ascs ( fig . 2 ) . decreased contact inhibition has been noted in other stem cell populations , such as embryonic stem cells ( burdon et al . interestingly , small lipid droplets are present in some of the chimpanzee ascs but were not seen in any of the human stromal cells profiled in this study ( fig . ( a ) fluorescence image depicting the nucleus ( blue : dapi ) and the actin filaments ( red : phalloidin ) . ( c ) brightfield image depicting the nucleus ( blue : mayer s hematoxylin ) and lipid droplets ( red : oil red o ) . the bottom panel contains brightfield images depicting the nucleus ( blue : mayer s hematoxylin ) and lipid droplets ( red : oil red o ) . ( a ) fluorescence image depicting the nucleus ( blue : dapi ) and the actin filaments ( red : phalloidin ) . ( c ) brightfield image depicting the nucleus ( blue : mayer s hematoxylin ) and lipid droplets ( red : oil red o ) . the bottom panel contains brightfield images depicting the nucleus ( blue : mayer s hematoxylin ) and lipid droplets ( red : oil red o ) . no lipid droplets were seen in any of the human asc lines . to uncover fundamental properties of the chimpanzee asc transcriptome , rna extracted from the confluent chimpanzee stromal cells ( figs . approximately 48 million reads were mapped ( 94% of the total ) to the pantro3 chimpanzee genome assembly . the highest expressed genes in chimpanzee asc overwhelmingly encode extracellular matrix ( ecm ) components ( fig . this makes sense , as cells of the connective tissue produce , organize , and degrade the ecm . in turn , the ecm provides organization , strength , and signaling mechanisms for cells of the connective tissue . the dominance of ecm gene expression we observe in chimpanzee ascs is consistent with a previous study of human ascs ( katz et al . we also observed that the 10 highest expressed genes in chimpanzee were represented within the top 14 highest expressed genes in humans ( fig . it is not surprising that genes encoding collagen , the most abundant family of proteins in mammals and primary source of strength and structure in the ecm , represent five of the top ten highest expressed genes ( fig . highlighted genes have fpkm 100 and the connections that contain a complete ecm - ligand and receptor pair are shown in bold . highlighted genes have fpkm 100 and the connections that contain a complete ecm - ligand and receptor pair are shown in bold . we next sought to determine what is unique about the collection of highest expressed chimpanzee asc genes ( fragments per kilobase of transcript per million counted reads [ fpkm ] 100 , n = 614 ) . using database for annotation , visualization and integrated discovery ( david ) receptor interaction kegg pathway as the most enriched pathway when compared with all asc - expressed genes ( p = 2.9e10 , corrected p = 4.1e8 ) and the second most when compared with all of the genes in the genome ( p = 4.4e11 , corrected p = 3.1e9 ) ( huang et al . receptor interaction pathway is the relationship between structural proteins , including collagen , and / integrins ( fig . integrins are responsible for mediating a physical and chemical connection between the internal asc cytoskeleton ( actin shown in fig this connection is necessary for a variety of critical cell behaviors including proliferation , migration , adhesion , differentiation , and apoptosis ( alberts et al . the particular / heterodimer dictates which ecm ligand(s ) the integrin interacts with ( fig . , four complete integrin pairings were represented among the highest expressed chimpanzee genes : fibronectin-51 , fibronectin-v1 , osteopontin-v1 , and osteopontin-55 ( fig . 3a ) , binds to other ecm proteins , including collagens ( alberts et al . 2008 ) . as cells of the connective tissue , much of the structure and function of ascs a hallmark of stem cells is pluripotency , the ability to differentiate into cell types of the three germ layers . although the ability of ascs to self - renew and differentiate into ectodermal lineages in vivo has not been definitively established ( cawthorn et al . 2012 ) , these cells can be used to investigate many different cell types in culture . we successfully differentiated clint s ascs into mature adipocytes in vitro using a cocktail of adipocyte differentiation media . 4a ) , a marker of mature adipocytes , here visualized by oil red o staining . although this result does not confirm pluripotency for chimpanzee ascs , it does demonstrate their ability to differentiate into mesodermal lineages . ( a ) brightfield image of adipocytes after 14 days of differentiation depicting the nucleus ( blue : mayer s hematoxylin ) and lipid droplets ( red : oil red o ) . ( b ) schematic of asc differentiation into adipocytes , modified from cawthorn et al . ( c ) relative age of cell lines in this study measured by passage number and estimated population doubling level ( epdl ) . ( a ) brightfield image of adipocytes after 14 days of differentiation depicting the nucleus ( blue : mayer s hematoxylin ) and lipid droplets ( red : oil red o ) . ( b ) schematic of asc differentiation into adipocytes , modified from cawthorn et al . ( c ) relative age of cell lines in this study measured by passage number and estimated population doubling level ( epdl ) . ascs and preadipocytes ( a slightly more differentiated state ) are members of the white adipose tissue expansion continuum and share many of the same cell surface markers ( fig . as mentioned earlier , clint s ascs show evidence of lipid accumulations that were not detected in the human cells we profiled ( fig . these lipid droplets are substantially smaller then those found in clint s differentiated adipocytes ( fig . three possibilities may explain the presence of lipid droplets in chimpanzee but not human ascs : 1 ) the chimpanzee cells are further differentiated than the human cells , 2 ) an artifact was introduced during collection prior to receipt of the cell lines , or 3 ) these lipids represent a species - specific difference in ascs . to investigate the differentiation state of these cell lines , we examined the expression of two transcriptional regulators that mark committed preadipocytes in white adipose tissue , ppar and zfp467 ( cawthorn et al . we found that ppar is expressed at higher level in chimpanzee ascs ( false discovery rate [ fdr]-adjusted p = 0.0316 , log2 fold change = 1.43 ) , whereas zfp467 is not expressed in either chimpanzee or human ascs . the significantly higher expression levels of ppar in chimpanzee ascs indicates that perhaps this population of cells is more differentiated than human ascs . it is also consistent with the small lipid droplets present in the chimpanzee ascs , as this transcription factor regulates lipid processing ( neve et al . however , the absence of zfp467 expression in both species suggests that the story is more complicated . we also examined a third gene , mmp3 , that encodes a metalloprotease produced by committed preadipocytes ( cawthorn et al . this gene is expressed at much higher levels in human than chimpanzee ascs and shows the second greatest fold difference between the two species genome - wide ( fdr - adjusted p = 5e09 , log2 fold change = 7.51 ) . based on these three incongruent expression markers for a limited selection of differentiation markers , it remains unclear where specifically the chimpanzee and human cells lie on the white adipose tissue expansion continuum ( fig . additional information about the degree of differentiation comes from the estimated population doubling level and passage number , which act as a proxy for cell age . these are relevant , as the length of time ascs are in culture changes their immunophenotypes ( mitchell et al . 2006 ) , increases senescence ( gruber et al . 2012 ) , and is inversely related to their pluripotency ( katz et al . 2005 ; wall et al . no substantial species differences in passage number or estimated population doubling level distinguish the cells used in this study ( fig . 4c ) , suggesting that these factors are unlikely to account for the phenotypic difference between species . finally , a species - specific collection bias is also improbable , as the ascs were collected from at least three different institutions and harvested by different investigators . despite widely known differences in asc processing strategies , several groups have commented on the consistency in immunophenotype and molecular profiles of ascs across studies ( katz et al . 2005 ; gimble et al . 2007 ) . therefore , it is unlikely that the approach employed by the scientists and veterinarians who harvested clint s cells was so radically different that they induced a phenotypic change in the asc line . several differences have been documented in adipose tissue derived mesenchymal stem cells from humans and the nonhuman primate macaca mulatta . ( 2006 ) found that human ascs retained their adipogenic potential longer than those from macaque . although these results do not directly speak to differences in lipid droplet formation between human and chimpanzee ascs ( no droplets were detected in any of the undifferentiated macaque ascs ) , they do demonstrate that phenotypic differences exist in ascs among primate species ( izadpanah et al . the lipid droplet difference in ascs reported in the current study could be indicative of biological differences between humans and chimpanzee ascs ( fig . 2 ) , but without more chimpanzee adult stem cell resources , the nature of these differences remains unclear . in order to find genes that are differentially regulated between human and chimpanzee , we next compared clint s asc transcriptome with three human asc transcriptomes . the human asc samples yielded on average 44 million reads mapped to hg19 ( 95% of total reads ) . based on these reads and the chimpanzee reads discussed earlier , we were able to compare 10,021 orthologous genes between species . as expected , the three human ascs are more similar in expression to each other than any of them are to the chimpanzee asc , with the major axis in a mds plot clearly separating the species and explaining 69.12% of the distance between samples ( fig . next , we sought to determine which genes distinguish clint s ascs from the human asc samples . at a 5% fdr ( benjamini and hochberg 1995 ) , 679 genes are expressed at significantly higher levels in chimpanzee ascs ( fig . 5b , red ) and 486 genes are expressed at significantly higher levels in human ascs ( fig . ( a ) multidimensional scaling plot of euclidean distances among the four transcriptomes investigated in this study . ( b ) ma - plot where each dot represents a gene and those that are significantly differentially expressed at a fdr - adjusted p < 0.05 are red ( up in chimpanzee ) or blue ( up in human ) . visualizing the normalized asc transcriptomes . ( a ) multidimensional scaling plot of euclidean distances among the four transcriptomes investigated in this study . ( b ) ma - plot where each dot represents a gene and those that are significantly differentially expressed at a fdr - adjusted p < 0.05 are red ( up in chimpanzee ) or blue ( up in human ) . to uncover functional differences between chimpanzee and human ascs , we interrogated the red ( chimpanzee higher ) and blue ( human higher ) genes in figure 5b using the panther tools database ( mi et al . 2005 ) . these standard categorical enrichments include gene ontology ( go ) biological processes , go molecular functions , and panther protein classes . chimpanzee ascs have higher expression for genes involved in immunity ( dark red ) and protein processing ( light red ) , whereas human ascs have higher expression for genes involved in the cell cycle ( dark blue ) and dna processing ( light blue ) ( fig . strikingly , every one of the broader highlighted categories is distributed perfectly onto either the human or chimpanzee branch ( for instance , all six cell cycle subcategories are enriched on the human branch ) . the most significant enrichments for the chimpanzee are processes involved in the development and functioning of the immune system , which responds to potential invasive or internal threats ( fig . a previous study also found that ascs are enriched for immune - related expression when compared with other stem cells populations ( jansen et al . another complementary category that is enriched in the chimpanzee and significantly depauperate in humans is cytokine activity ( fig . the chemokines , one class of cytokines , elicit homing behavior in bone marrow stem cells by sensing tissue injury and migrating to the site of damage ( shyu et al . 2006 ) . higher expression of genes involved in immunity and cytokine activity is consistent with anecdotal evidence that both captive and wild chimpanzees have faster epidermal wound healing abilities compared with humans ( hedlund et al . these results provide a glimpse into the molecular differences underlying the human and chimpanzee condition . the queried genes include those significantly higher in the chimpanzee ascs ( red in fig . these were assessed against the background set of all significant asc genes in this study . shown are the top five most significantly enriched categories for both human and chimpanzee ; italicized categories are not statistically significant for the species they are enriched in . the sign next to the nominal p value indicates whether the category is enriched ( + ) or depauperate ( ) for the given species . ( a ) go biological process enrichments , ( b ) go molecular function enrichments , and ( c ) panther protein class enrichments . the queried genes include those significantly higher in the chimpanzee ascs ( red in fig . these were assessed against the background set of all significant asc genes in this study . shown are the top five most significantly enriched categories for both human and chimpanzee ; italicized categories are not statistically significant for the species they are enriched in . the sign next to the nominal p value indicates whether the category is enriched ( + ) or depauperate ( ) for the given species . ( a ) go biological process enrichments , ( b ) go molecular function enrichments , and ( c ) panther protein class enrichments . recently , the national research council ( national academy of sciences , usa ) reaffirmed the important role of comparative genomic research involving chimpanzees , highlighting numerous insights that have and will likely continue to come from these data ( altevogt et al . this report set forth two criteria for research involving chimpanzees : 1 ) the studies provide otherwise unattainable insight and 2 ) all experiments are performed on acquiescent animals in a manner that minimizes distress the majority of comparative genomic research that would use chimpanzee adult stem cells not only meets both of these criteria but also offers the opportunity to significantly expand the number of available approaches for fruitful inquiry . moving forward , the use of adult stem cells from chimpanzees can complement existing data on the in vivo state of an evolutionarily relevant tissue by providing access to a single cell type from that tissue , where experiments can be carried out in a controlled ex vivo setting . combined in vivo and ex vivo comparative functional genomic analyses can provide a unique perspective with the potential to uncover novel results that would not otherwise be accessible . moving forward , adult stem cells promise to transform comparative primate genomics . here , we profiled just one type of adult stem cell , the asc . the primary nature of ascs makes them especially attractive for experimental and medical applications ( gimble et al . primary cells are the closest representative of a cell type , as they have been taken directly from the living organism and have not been genetically transformed or reprogrammed . another type of adult stem cell , the induced pluripotent stem cell ( ipsc ) , offers different advantages for comparative functional studies . ( 2012 ) recently commented on the potential of ipscs for evolutionary genomics approaches , and indeed they may be the most promising source of adult stem cells from chimpanzees . there are established methods for dedifferentiating fibroblasts into ipscs , and several companies have developed kits specifically for this purpose ( takahashi et al . importantly , a large catalog of chimpanzee fibroblast lines is currently available : the coriell institute alone has 50 , whereas just one chimpanzee asc line exists to our knowledge . the available chimpanzee fibroblasts are derived from both sexes , providing a window into the effects of biological variation , something the current study was unable to examine . in addition , ipscs can be passaged many times , providing a steady supply of material . in contrast , ascs can only be cultured for a few passages before their ability to differentiate is diminished ( wall et al . 2007 ) . obtaining the amount of cells one needs for a complete analysis with ascs is difficult when working with the chimpanzee , an endangered animal with minimal body fat . this limitation makes follow - up experiments a challenge when relatively large numbers of cells are needed , as in dnase - seq experiments ( shibata et al . the toolkit of experimental manipulations available for ex vivo studies is vast and includes physiological and hormonal challenges , targeted gene knock - downs , co - culturing multiple cells , and a variety of environmental manipulations . responses to these experiments can be assayed through numerous cellular phenotypes , including proliferation and apoptosis rates , migration ability , cell size and shape , organelle content , import and export of specific compounds , and detailed metabolic profiles . to date , only a tiny fraction of the vast array of informative experimental manipulations and phenotypic assays that are possible using culture systems has been exploited . 6 ) include eliciting an immune response by challenging cells with immunomodulating chemokines and carrying out classic in vitro scratch migration assays . these experiments could provide molecular insights into the presumed wound healing differences between human and chimpanzees ( hedlund et al . fish and wildlife service ( 2012 ) as threatened in captivity and endangered in the wild , whereas the international union for conservation of nature considers them as endangered with a declining population ( oates et al . the idea that cells can be used in this manner is becoming more widely recognized as the utility of frozen zoos is gaining credibility ( ben - nun et al . 2011 ) . 2011 ) created ipsc from two highly endangered species , the northern white rhinoceros and the drill monkey . the authors expressed the hope that these resources could facilitate the reintroduction of genetic material into the population in the future a prospect that seems increasingly practical with the development of methods for reprogramming adult stem cells into haploid spermatogenic cells ( equizabal et al . , a recent study found that an endangered primate population contained considerable genetic variation , which could be capitalized on for conservation efforts ( perry et al . an important opportunity in primate comparative genomics is using adult stem cells to carry out controlled experiments aimed at investigating molecular differences between humans and our closest living relatives . in vivo approaches based on tissue samples have proved valuable and will continue to provide useful information . however , the ability to work with cell culture systems provides opportunities for functional studies that are otherwise impossible for practical or ethical reasons . these ex vivo approaches provide a powerful complementary set of experimental tools that will likely become an increasingly important component of primate evolutionary genomics . adult male ascs from two different species are investigated in this study : one chimpanzee ( s008396 from the coriell institute for biomedical research ) and three humans ( ag19304 and ag20471 from the coriell institute for biomedical research and l040903 from zen - bio ) . the stromal cells were recovered from cryofreeze in mesenpro rs medium ( invitrogen 12746 - 012 ) supplemented with 200 mm l - glutamine ( invitrogen 25030 - 081 ) and 1% penicillin - streptomycin solution ( invitrogen 15140 - 122 ) . these cells were allowed to expand to 70% confluency and then were removed using tryple ( invitrogen 12604 - 021 ) and plated at 40,625 cells / cm in 6-well plates ( corningstar 3516 ) . ascs were cultured for 2448 h until confluent and were then differentiated into adipocytes using zenbio s adipocyte differentiation medium ( dm-2-prf ) and adipocyte maintenance medium ( am-1-prf ) supplemented with 250 m of linoleic acid ( sigma l9530 ) following the differentiation and maintenance protocol ( zbm0001.03 ) . stromal cells were collected at confluency and rna isolated using qiazol ( qiagen 79306 ) followed by mirneasy mini extraction kit ( qiagen 217004 ) , followed by dnase i treatment . rna quality was verified using the agilent bioanalyzer 2100 ( minimum rin = 10 ) . illumina truseq sbs libraries were constructed with 1 g of rna and put through cluster generation . we used 50 bp , paired - end illumina hiseq sequencing , with all four libraries multiplexed in one lane . sequencing took place at duke institute for genome sciences & policy s genome sequencing & analysis core resource . the casava - trimmed reads were mapped to hg19 and pantro3 with tophat v1.4.1 using default settings ( trapnell et al . the mapped reads were counted with htseq - count 0.5.1p1 using the settings union and strandedness ( http://www-huber.embl.de/users/anders/htseq/doc/count.html , last accessed october 18 , 2013 ) . gene models for each species were constructed using primate exon orthology database version 2 ( http://giladlab.uchicago.edu/orthoexon/ , last accessed october 18 , 2013 ) . these models were further filtered using the ensembl database ( http://useast.ensembl.org/index.html , last accessed october 18 , 2013 ) . to remove genes with unclear homologies , we eliminated human chimpanzee homology types one2many and many2many as well as the ribosomal families rpl , rps mrpl , and mrps . we also removed genes where the original chromosome assignment did not match the ensembl chromosome assignment and where multiple ensembl gene ids were assigned to the same hgnc gene name ( http://www.genenames.org , last accessed october 18 , 2013 ) . genes with less then five counts per 10 million fragments were removed from every library . counts were normalized by estimating the tagwise dispersion , and significance was calculated used the program edger 1.6.0 ( robinson et al . these data are available from the investigators upon request in any standard configuration ( .bam files , raw counts , normalized counts , etc . ) . to interrogate the highly expressed chimpanzee asc genes ( fpkm 100 , n = 614 ) , we used david v6.7 kegg pathway tool ( huang et al . both the 10,021 asc genes in this study as well as the entire genome were assessed . when comparing the chimpanzee and human transcriptomes , categorical gene enrichments were calculated with the panther tools gene expression data analysis feature using the compare gene lists function ( http://www.pantherdb.org/tools/ , last accessed october 18 , 2013 ) . the queried genes are those expressed at a significantly higher level in the chimpanzee asc and those expressed at a significantly higher level in the human asc at an fdr - adjusted p < 0.05 . these were assessed against the background set of all significant asc - expressed genes in this study . for the florescence imagining , 22 22 mm glass coverslips were coated with fnc mix ( athenaes ) , and cells were plated at 5,263 cells / cm in 6-well plates . cells were cultured for 24 h , fixed for 10 min with 4% paraformaldehyde ( electron microscopy sciences ) , washed with 1 phosphate - buffered saline ( pbs ) , and stained with tritc - phalloidin ( sigma ) and dapi ( sigma ) , washed with 1 pbs and mounted on slides . the florescence and black and white images were taken with the zeiss axio observer a1 inverted stand microscope with a zeiss hbo arc lamp and power supply using a hamamatsu orca er digital camera in the light microscopy core facility at duke university . asc and adipocytes were stained for lipid content using the oil red o stain kit and protocol ( scytek ork-1 ) and imaged prior to confluence and on day 14 of differentiation . the color images were taken with a leica dm irb microscope using a zeiss axiocam icc1 digital camera . adult male ascs from two different species are investigated in this study : one chimpanzee ( s008396 from the coriell institute for biomedical research ) and three humans ( ag19304 and ag20471 from the coriell institute for biomedical research and l040903 from zen - bio ) . the stromal cells were recovered from cryofreeze in mesenpro rs medium ( invitrogen 12746 - 012 ) supplemented with 200 mm l - glutamine ( invitrogen 25030 - 081 ) and 1% penicillin - streptomycin solution ( invitrogen 15140 - 122 ) . these cells were allowed to expand to 70% confluency and then were removed using tryple ( invitrogen 12604 - 021 ) and plated at 40,625 cells / cm in 6-well plates ( corningstar 3516 ) . ascs were cultured for 2448 h until confluent and were then differentiated into adipocytes using zenbio s adipocyte differentiation medium ( dm-2-prf ) and adipocyte maintenance medium ( am-1-prf ) supplemented with 250 m of linoleic acid ( sigma l9530 ) following the differentiation and maintenance protocol ( zbm0001.03 ) . stromal cells were collected at confluency and rna isolated using qiazol ( qiagen 79306 ) followed by mirneasy mini extraction kit ( qiagen 217004 ) , followed by dnase i treatment . rna quality was verified using the agilent bioanalyzer 2100 ( minimum rin = 10 ) . illumina truseq sbs libraries were constructed with 1 g of rna and put through cluster generation . we used 50 bp , paired - end illumina hiseq sequencing , with all four libraries multiplexed in one lane . sequencing took place at duke institute for genome sciences & policy s genome sequencing & analysis core resource . the casava - trimmed reads were mapped to hg19 and pantro3 with tophat v1.4.1 using default settings ( trapnell et al . the mapped reads were counted with htseq - count 0.5.1p1 using the settings union and strandedness ( http://www-huber.embl.de/users/anders/htseq/doc/count.html , last accessed october 18 , 2013 ) . gene models for each species were constructed using primate exon orthology database version 2 ( http://giladlab.uchicago.edu/orthoexon/ , last accessed october 18 , 2013 ) . these models were further filtered using the ensembl database ( http://useast.ensembl.org/index.html , last accessed october 18 , 2013 ) . to remove genes with unclear homologies , we eliminated human chimpanzee homology types one2many and many2many as well as the ribosomal families rpl , rps mrpl , and mrps . we also removed genes where the original chromosome assignment did not match the ensembl chromosome assignment and where multiple ensembl gene ids were assigned to the same hgnc gene name ( http://www.genenames.org , last accessed october 18 , 2013 ) . genes with less then five counts per 10 million fragments were removed from every library . counts were normalized by estimating the tagwise dispersion , and significance was calculated used the program edger 1.6.0 ( robinson et al . these data are available from the investigators upon request in any standard configuration ( .bam files , raw counts , normalized counts , etc . ) . to interrogate the highly expressed chimpanzee asc genes ( fpkm 100 , n = 614 ) , we used david v6.7 kegg pathway tool ( huang et al . both the 10,021 asc genes in this study as well as the entire genome were assessed . when comparing the chimpanzee and human transcriptomes , categorical gene enrichments were calculated with the panther tools gene expression data analysis feature using the compare gene lists function ( http://www.pantherdb.org/tools/ , last accessed october 18 , 2013 ) . the queried genes are those expressed at a significantly higher level in the chimpanzee asc and those expressed at a significantly higher level in the human asc at an fdr - adjusted p < 0.05 . these were assessed against the background set of all significant asc - expressed genes in this study . for the florescence imagining , 22 22 mm glass coverslips were coated with fnc mix ( athenaes ) , and cells were plated at 5,263 cells / cm in 6-well plates . cells were cultured for 24 h , fixed for 10 min with 4% paraformaldehyde ( electron microscopy sciences ) , washed with 1 phosphate - buffered saline ( pbs ) , and stained with tritc - phalloidin ( sigma ) and dapi ( sigma ) , washed with 1 pbs and mounted on slides . the florescence and black and white images were taken with the zeiss axio observer a1 inverted stand microscope with a zeiss hbo arc lamp and power supply using a hamamatsu orca er digital camera in the light microscopy core facility at duke university . asc and adipocytes were stained for lipid content using the oil red o stain kit and protocol ( scytek ork-1 ) and imaged prior to confluence and on day 14 of differentiation . the color images were taken with a leica dm irb microscope using a zeiss axiocam icc1 digital camera .

comparisons between humans and chimpanzees are essential for understanding traits unique to each species . however , linking important phenotypic differences to underlying molecular changes is often challenging . the ability to generate , differentiate , and profile adult stem cells provides a powerful but underutilized opportunity to investigate the molecular basis for trait differences between species within specific cell types and in a controlled environment . here , we characterize adipose stromal cells ( ascs ) from clint , the chimpanzee whose genome was first sequenced . using imaging and rna - seq , we compare the chimpanzee ascs with three comparable human cell lines . consistent with previous studies on ascs in humans , the chimpanzee cells have fibroblast - like morphology and express genes encoding components of the extracellular matrix at high levels . differentially expressed genes are enriched for distinct functional classes between species : immunity and protein processing are higher in chimpanzees , whereas cell cycle and dna processing are higher in humans . although hesitant to draw definitive conclusions from these data given the limited sample size , we wish to stress the opportunities that adult stem cells offer for studying primate evolution . in particular , adult stem cells provide a powerful means to investigate the profound disease susceptibilities unique to humans and a promising tool for conservation efforts with nonhuman primates . by allowing for experimental perturbations in relevant cell types , adult stem cells promise to complement classic comparative primate genomics based on in vivo sampling .

malnutrition is a state of deficiency , imbalance or excess of energy , protein and other nutrients having adverse effects on the form or function of the body and clinical outcome ( 1 ) . elderly residents in nursing homes are at an increased risk of malnutrition due to a variety of factors including sensory loss , chewing and swallowing problems , a decrease in or loss of appetite , mobility restrictions , cognitive impairment , depressed mood and acute or chronic diseases demanding the use of multiple medications ( 2 ) . as a vicious cycle this inadequate dietary intake and malnutrition contributes not only to the progression of already existing chronic diseases such as cvd , osteoporosis or mental disorders but can also predispose the subject to various acute health problems such as infection or dehydration ( 3 ) . moreover , patients with dementia often suffer from malnutrition , decreasing their functional capabilities even further ( 4 ) . among demented elderly , early in the course of the disease , impaired cognition negatively affects the amount of food intake ( 5 , 6 ) . with advanced dementia behavioral disturbances such as aversive eating behavior , restlessness and depression as stated , malnutrition , low body mass index ( bmi ) and unintentional weight loss are risk factors for mortality and have a negative influence on the functional status and psychosocial well - being of the elderly population ( 810 ) . the research of otero ub et al . in brazil investigating the mortality associated with malnutrition among the elderly shed light to the importance of this matter and the crucial need to pay more attention to this population and intervene whenever necessary ( 11 ) . the prevalence of malnutrition reported in the residents of the nursing homes has a wide range among different populations . one reason might be the lack of extended researches regarding nutritional deficiencies in nursing homes . another reason might be the fact that malnutrition in this vulnerable population can easily be neglected by the nurses and other staff ( 12 ) . in sweden , one - third of the elderly residents living in some kind of nursing homes were malnourished ( 13 ) . about this problem , iran is of no exception . several investigations regarding nutritional status in nursing homes in iran have demonstrated the same results , that malnutrition is a serious problem in nursing homes , demanding special attention . although , iran still has a relatively young population , the proportion of elderly is projected to double in less than 20 years and population ageing is expected to be experienced in our country , therefore it is important to consider and address the needs and concerns of this group , which might have direct impacts on their well - being and quality of life . in isfahan , 56% of women and 58% of men had bmis of less than 20 . the main reasons were inadequate nutrient consumption , anorexia induced mental disorder and poor quality of food ( 14 ) . study in 7 private nursing homes of tehran showed insufficiency in the amount of nutrients such as calcium , iron , zinc , riboflavin , folate and vitamin b12 among the elderly residents , and also energy shortage was found in 47% of the total study population ( 15 ) . the aim of this study was to gather information on nutritional status and its associated risk factors in elderly residents of nhs in tehran , iran . through a stratified random sampling from 44 public and private nursing homes in tehran , 17 nursing homes were selected and 263 elderly residents were chosen as the study population . the inclusion criteria comprised of three main factors : being aged 60 years or older , living in a nursing home in tehran , signing an informed consent about participating in the survey . exclusion criteria included : being expired during the study , disapproving with participation in the study . data on the subjects demographic characteristics and nutritional and health status were gathered during 2010 to 2012 . demographic characteristics included gender , educational level , marital status , birth place , previous job , number of children , the number of visits per month , who visited elderly the most in a month , things brought for elderly , exposure to sunlight , the way elderly spent his / her time in the nursing home , smoking status , supplementation use by elderly , being on a special diet , chronic diseases such as blood pressure , renal or digestive problems and coronary heart disease , dental health , sleeping hours during day or night , satisfaction with the food quality , food consumption status , satisfaction with the personnel . to assess the risk of malnutrition in the subjects we used the mini nutritional assessment ( mna ) tool . it was developed to evaluate the risk of malnutrition in the elderly residents of nursing homes , hospitals and home care programs ; since it included the physical and mental aspects of health and life ( 16 ) . the mna has been an extensively used method to identify risk of malnutrition in the elderly ( 17 , 18 ) . using this scoring system allowed us to screen the elderly with an adequate nutritional status , elderly at risk of malnutrition and those who are malnourished . this method is a simple , low cost and non - invasive method that can be utilized at bedside . the mna questionnaire consists of anthropometric and global indicators including information on eating patterns and self - perception of health in elderly such as reduced food intake , weight loss of more than 3 kilograms , mobility , bed- or chair - bound , psychological stress , neuro - psychological problems , body mass index , inability to live independently , taking more than 3 prescription drugs , having skin ulcers or pressure sores , number of full meals eaten per day , the amount of high - protein foods consumed per day , consumption of fruits and vegetables , the amount of liquids drank per day , inability and difficulty in self - feeding , self - perception of nutritional status , self - perception of health status , mid - arm circumference of less than 21 centimetres and calf circumference of less than 31 centimetres ( 17 ) . moreover , it is very important that ( mna ) detects risk of malnutrition at a time which albumin levels and bmi are still normal ( 19 ) . in the original mna version , bmi ( body mass index ) in weight / height the mna score used in our survey consists of four parts : anthropometric measurements , general status , dietary information and subjective assessment ( 17 ) . a score of less than 17 out of a maximum of 30 is regarded as an indication of malnutrition , 17 to 23.5 indicates a risk for malnutrition and scores greater than 23.5 indicates that the person is well nourished ( 17 ) . standing height , mid arm circumference ( mac ) and calf circumference ( ccs ) measured with a plastic tape measure at the widest part of the undressed calf . mid arm circumference ( mac ) was measured at the midpoint of the relaxed , non - dominant arm between the tip of the acromion and the olecranon process ( 20 ) . in elderly unable to stand in a straight upright position , demispan formula was used to estimate the actual height . this method is recommended by the mini nutritional assessment tool , and requires no specialized equipment . demispan was measured as the distance from the middle of the sternal notch to the tip of the middle finger ( preferably the left arm ) with the arms of the elderly in a horizontal position and in line with his or her shoulders . then the height of the person can be calculated via the following formulas ( 21 ) : females : height in cm=1.35demispan ( cm)+60.1 males : height in cm=1.40demispan ( cm)+57.8 we entered the data in to spss ( 17.0 ) and analyzed it with this software and stata ( 11.0 ) . univariate and then multivariate ordinal polytomous regression were employed to investigate the association between the malnutrition and its risk factors . as the nursing homes formed cluster in our sampling scheme , complex sample survey ( svy ) ordinal regression analysis was performed in stata to account for data structure . in final model p - value of less than 0.05 was considered as significant . we entered the data in to spss ( 17.0 ) and analyzed it with this software and stata ( 11.0 ) . univariate and then multivariate ordinal polytomous regression were employed to investigate the association between the malnutrition and its risk factors . as the nursing homes formed cluster in our sampling scheme , complex sample survey ( svy ) ordinal regression analysis was performed in stata to account for data structure . in final model p - value of less than 0.05 was considered as significant . two hundred sixty three elderly from seventeen nursing homes in tehran , iran participated in this study during 2010 to 2012 , consisting of 54.8% female and 45.2% male . the mean ( sd ) age of study population was 75.9 ( 8.5 ) years , of which 44.5% were aged 60 to 74 years old . demographic characteristics of the study population according to nutritional status svy ordinal regression only 20.9% of the subjects were well nourished . of the rest , 68.8% were at risk of malnutrition and 10.3% were categorized as malnourished . significant risk of malnutrition or malnourishment was found among the following sub groups : females ( 73.1% ) , non - smokers ( 81.2% ) , those who were dissatisfied with quality of food ( 92.6% ) or nursing home s personnel ( 94.1% ) , subjects who ate half or less than half of their food ( 97.7% ) , those who were sleeping less than 6 hours ( 87.7% ) , elderly with less than 2 hours exposure to sunlight ( 81.5% ) and diabetic subjects ( 86.4% ) ( p<0.05 ; table 1 and 2 ) . food intake , satisfaction with the personnel and food quality , depression status , and hours of sleep according to nutrition status svy ordinal regression . according to univariate analysis on data , the probability of being at risk for malnutrition or malnourishment showed to be weakly higher ( p=0.06 ) in elderly with no teeth or no good prosthesis ( 83.6% ) , subjects who did not watch tv or listen to radio ( p=0.08 ; 83.9% ) and those who said their prayers ( p=0.06 ; 91.9% ) . a significantly better nutritional status ( p=0.008 ) was found among elderly who studied in their free time , however , those who used to speak or rest or pray or walked with other friends or helped them did not show a significant difference in nutritional status compared to others ( p>0.05 ; table 3 ) . free time activity and the amount of sun light exposure of the study population according to nutrition status svy ordinal regression to find the independent risk factors of malnutrition , the variables with p - values of less than 0.10 were analyzed by a multivariate svy ordinal logistic regression model , performing a backward elimination procedure . the result of this analysis is depicted in table 4 , showing that eating half or less than half of the food had an odds ratio ( or ) of 8.0 with 95% confidence interval ( ci ) 3.717.7 , and not having any teeth or a good prosthesis had an risk of 1.7 ( 95% ci : 1.12.7 ) in increasing the risk of malnutrition . also , the diabetic subjects were significantly more prone to develop malnutrition ( or=1.6 ; 95% ci : 1.12.4 ) . as opposed to praying risk was 1.8 ( 95% ci : 1.22.6 ) and studying in free time showed a protective effect on the level of the subject s malnutrition status . although , smoking seemed to have a protective effect against developing higher levels of malnutrition , the smokers of more than 20 pack - year had odds ratio of 0.8 ( 95% ci : 0.50.9 ) in being at risk of malnourishment . malnutrition is associated with significantly increased morbidity and mortality in independently living elderly , as well as the residents of nursing homes and hospitalized patients ( 22 ) . the primary purpose of this study was to determine the prevalence of different grades of malnutrition and related independent risk factors in elderly residents of nursing homes in tehran , iran . our study demonstrated that more than 50% of the subjects suffer from different grades of malnutrition , which is a common problem among elderly residents of nursing homes in tehran . according to mna , nearly 42.9% of the elderly were well nourished , 66.4% of male and 70.8% of female subjects were at risk of malnutrition ( 1723.5 points ) , and 19.9% of the studied residents were malnourished ( < 17 points ) . analysis showed that the amount of food consumption had an odds ratio of 8.0 ( 3.717.7 ) , and having teeth or good prosthesis , an or of 1.7 ( 1.12.7 ) in increasing the grade of malnutrition . diabetes had an or of 1.6 ( 1.12.4 ) , smoking an or of 0.2 ( 0.10.5 ) , studying in their free time an or of 0.4 ( 0.20.9 ) and praying in their free time an or of 1.8 ( 1.22.6 ) ( table 3 ) . in multiple ordinal logistic regression analysis , several independent risk factors such as the amount of food consumption , having good teeth or prosthesis , diabetes , smoking status , studying or praying in free time were related to malnutrition . the results of our study , regarding the prevalence of malnutrition and its patient - related risk factors , are different from those of previous surveys . our results showed that 55 ( 42.9% ) subjects were well nourished and from the 181 ( 68.82% ) subjects at risk of malnutrition , only 27 ( 10.27% ) were malnourished , while several other researches demonstrated that in different nursing homes the proportion of the elderly population suffering from malnutrition varied from 15 to 71 percent and about 40 to 60 percent of the subjects at risk of malnutrition ( 2326 ) . therefore , it is of utmost importance to take measures to prevent the subjects at risk of malnutrition to actually become malnourished by for example improving their food quality and nutritional status . in this survey , the results of multivariate analysis showed a correlation between malnutrition and the amount of food consumption , which was directly affected by the oral health of the elderly ( p < 0.0001 ) ( table 2 ) . the elderly wearing protective dentures compared to those who were edentulous but did not use dentures were less prone to malnutrition ( 27 ) . it is important to pay special attention to this matter : how does tooth loss or having bad prosthesis affect dietary intake of an elderly ? although the link between various nutrients deficiencies and systematic diseases has been established , but relatively little survey has been conducted investigating the relation between oral condition and nutrition ( 28 ) . in three large studies in the united states and europe , a study assessed the association between disease - related nutrients and foods with the number of teeth , and showed that edentulous participants compared to subjects with more or equal to 25 teeth , consumed fewer vegetables , less carotene and fiber , and consumed more cholesterol , saturated fat and calories in their diets ( 29 ) . the results regarding the amount of food consumed and the status of teeth and prosthesis in current survey was similar to a survey , among community dwelling elderly in italy ( aged 7075 years ) . they showed a close relation between dental status and food intake . it was identified that the use of dentures can help improve both nutrient intake of the elderly and the quality of their life ( 30 ) . people with fewer than optimal number of teeth , or without dentures may face problems caused by avoiding certain foods ( 31 ) . elderly without dentures were found to avoid eating , had difficulty in chewing and majority of them changed their meal composition and method of cooking to facilitate chewing ( 32 ) . results regarding the amount of sunlight exposure showed that the more sunlight an elderly is exposed to ( 0.12 hr to 4.17.5 hr ) , the lower the grade of malnutrition ; that was similar to another research investigating under - nutrition in nursing homes ( 33 ) . the researchers pointed out some common nutritional deficiencies among residents of the nursing homes such as vitamin d , vitamin b12 , and zinc as well as dehydration . to prevent vitamin d deficiency , the staff simply needed to encourage their residents to get more sunlight exposure . as for the vitamin b12 deficiency basic injections or inhalations of vitamin b12 could have increased the level of this vitamin to its normal range . just like the other two , zinc also could have been replaced to prevent health problems due to its deficiency ( 33 ) . finally , not knowing when they are thirsty , elderly are prone to the common problem of dehydration that can easily be prevented by the nurses and other staff of the nursing home by making " fluid rounds " to make sure that patients are consistently hydrated ( 34 ) . chevalier s et al demonstrated that malnutrition can compromise the functional status of the elderly subject leading to their vulnerability that may have a negative effect on their nutrition ( 35 , 36 ) . possible explanation might be the effect of smoking on the gastrointestinal movements , preventing the elderly from developing constipation , thus helping them to consume more food . the results might also be explained by the antalgic effects of smoking , which can enhance their food consumption by improving the mood of the elderly . these results paved the way for future studies to inspect the possible explanations of this matter . there were some limitations in this study regarding the time keeping of the subjects activities . recording this information needed much more human resources than the current manpower in hand , so the results might lack some degree of accuracy . also keeping track of the amount of food brought for the subjects by their siblings was another problem in data gathering . when adjusted for confounders , a decrease to less than half of the food consumed by the elderly subjects was directly associated with worsening their nutritional status . moreover , having no teeth health or good prosthesis , diabetes and praying in the free time were found as other independent risk factors while studying in free time had a protective effect . these findings were predictable except for the protective effect of smoking on deterioration of nutritional status . the implementation of this project has been approved by the medical ethics committee of tehran university of medical sciences . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors .

background : malnutrition and dehydration are two most common types of ailments residents of nursing homes ( nh ) prone to . it is very important to assess these problems because they can predispose the residents to severe illnesses . the aim of this study was to gather information on nutritional status and its associated risk factors in elderly residents of nhs in tehran , iran.methods : from 16 nhs in tehran , 263 residents were randomly selected . data were collected via questionnaires , including demographic characteristics , past medical history , present health problems and daily routines . the mna questionnaire was used to gather information regarding their nutritional status.results : the present study showed that 10.3% of the elderly residents in nursing homes were malnourished . 66.4% of males and 70.8% of females were at risk of malnutrition . multivariate analysis showed that after adjusting for confounders the following elderly - related factors were the independent risk factors of malnutrition : consuming half or less than of the food ( or=8.0 , 95%ci=3.717.7 ) , having no teeth or good prosthesis ( or=1.7 , 95%ci=1.12.7 ) , diabetes ( or=1.6 , 95%ci=1.12.4 ) , smoking ( or=0.6 , 95%ci=0.31.2 ) , studying ( or=0.4 95%ci=0.20.9 ) and praying in their free time ( or=1.8 95%ci=1.22.6).conclusion : the subjects health - related factors and their free - time activities and nutritional behavior are the most important factors associated with poor nutrition among elderly residents of nhs ; however , further investigation is needed to clarify the role of other factors in maintaining a suitable nutritional plan for them .

fluorescent pseudomonas spp . are able to colonize highly dynamic environments such as soil , water , plants , as well as animals , including humans . this wide adaptability is associated with their resourceful metabolic potential and their ability to control gene expression via regulatory elements highly represented in their large genomes . for example , the opportunistic human pathogen pseudomonas aeruginosa is a notorious member of this genus and is extensively studied for its ability to cause chronic human opportunistic infections in immunocompromised patients . in addition to human pathogens , also important plant pathogens are present in this group of bacteria ; pseudomonas syringae is an important model of plant pathogenic bacteria since its pathovars can infect many different plants ( c.f . plant - growth - promoting fluorescent pseudomonads are also studied for their ability to colonize plant - related niches , like the rhizosphere ( e.g. , p. fluorescens , p. putida , and p. chlororaphis ) , where they can act as plant beneficial bacteria either by antagonizing plant deleterious microorganisms or by directly influencing plant disease resistance and growth . bacteria often possess a regulatory system , known as quorum sensing ( qs ) , to modulate gene expression as a function of their cell density ( for reviews see [ 3 , 4 ] ) . in gram negative bacteria , the most common qs system is regulated by the n - acyl homoserine lactone signaling molecules ( ahls ) . studies of the mechanisms and role of qs in several pseudomonas spp . indicated that the most common signal molecules used are in fact ahls . these signals were first described in the marine bioluminescent bacterium vibrio fischeri in which qs regulates light production ( reviewed by ) . the model n - ahl qs system consists of two proteins belonging to the luxi and luxr families , respectively , [ 4 , 7 ] . ahls are synthesized from s - adenosyl methionine , which provides the homoserine lactone moiety , and acyl carrier protein , which provides the fatty acyl moiety . after synthesis , the signal can move freely across the bacterial membranes and accumulates both intra- and extracellularly in proportion to cell density . above a critical threshold concentration or cell density , ahls interact directly with the luxr - family protein , which in most cases results in the formation of homodimers . these complexes can then bind at specific sequences called lux - boxes that are located in the promoter region of target qs - regulated genes , affecting their expression . many important phenotypes are regulated by ahl qs and qs has been suggested as a possible target to control bacterial colonization . qs regulates phenotypes related to both pathogenesis ( virulence associated factors like toxins , motility , secreted enzymes , and biofilm - related genes / proteins ) and to beneficial effects in plant growth promoting rhizobacteria ( pgpr ) ( e.g. , production of antibiotic and antifungal compounds and induction of systemic resistance in the plant [ 1013 ] ) . ahl qs is particularly interesting in the pseudomonads due to the presence , diversity , and complexity of regulatory circuits present in various species . in the case of p. aeruginosa , ahl qs seems conserved and ubiquitous , being composed of a complex hierarchy of two luxi / r pairs and a series of regulators [ 5 , 14 ] . in fact , it has been estimated that quorum sensing regulates up to 3% of p. aeruginosa genes . on the other hand , most strains of p. fluorescens and p. putida do not possess an ahl qs system [ 15 , 16 ] . in this study , we performed an in - depth systematic study on the chromosomal arrangement and synteny of ahl qs systems in pseudomonads in order to determine the commonalities and differences that may exist between pseudomonads and other bacteria . previous studies concentrated either on the presence or absence of ahl qs genes in bacteria , or on the regulatory design principles of selected qs systems [ 18 , 19 ] . here , we present a survey of ahl - driven qs circuits in pseudomonads and compare the chromosomal arrangements with those found in other bacterial genomes . we used the sequence data of 1346 full bacterial proteomes found at the ncbi bacterial genome repository as well as published qs operon sequences from ncbi genbank ( data last accessed on june 12 , 2011 ) . draft genome sequences were excluded from the analysis because of the uncertain annotations we found in some of them . the search included standard bioinformatics methodologies and manual curation ( see supplementary materials available online at doi : 10.5402/2012/484176 ) . we started our search for luxr sensor / regulators , luxi ahl synthases , rsal , and rsam repressor homologues in complete bacterial genomes and included only a set of selected examples of pseudomonas data from incomplete genomes ( tables 1 and 2 ) . for luxr , luxi , rsal , and rsam we use the symbols r , i , l , and m , respectively , and refer to them as qs genes . solo r genes as well as other lonely occurrences of qs genes were not considered . this cautious approach of manual curation was adopted because we were primarily interested in the genomic arrangements and not so much in finding hitherto unannotated genes in the complete genomes . still we found a few unannotated genes that were accepted on the condition that they were in one of the previously observed topological arrangements . from a total of over 4.3 million genes analyzed , we found 624 r genes ( 29 unannotated ) , 269 i genes ( 12 unannotated ) , 39 l genes ( 11 unannotated ) , and 36 m genes ( 36 unannotated ) . out of the 1346 complete genomes , 143 were found to contain qs genes in the vicinity of other qs genes ( i.e. , within a distance of 3000 nt ) . we do not consider our analysis as comprehensive because , among other things , it was based on the reading frames given in the genome annotations , and we left rhizobia and agrobacterium species out of the survey because the arrangement of their qs genes is different from pseudomonas . we found a few conflicts with respect to the gene functions assigned in the genome annotations but not in pseudomonas . we found two major types of topological arrangements that we term ri and rxi , respectively , ( tables 1 and 2 ) . in ri , the two genes are vicinal while in rxi there is at least one additional gene between the two luxi and luxr family genes . there are 3 possible variations , namely tandem ( unidirectional ) , convergent , divergent . all of these are found in proteobacteria , pseudomonas does not seem to contain the divergent topology which can , however , be found in other gamma proteobacteria . in these topologies all the 8 possible arrangements are found in proteobacteria , however , only 3 in pseudomonas where the x gene is most frequently l ( rsal , found in p. aeruginosa , p. putida , and p. fuscovaginae species ) . m is much more frequently found in burkholderia , the only pseudomonas to contain m is p. fuscovaginae , which is at the same time , the only pseudomonad found so far to contain both l and m genes . both the l and the m genes have their canonical topologies which are shown in the table separately , denoted as rli ( l1 ) and rmi ( m1 ) , respectively however , some burkholderia species contain an additional copy of m , which is in a non - canonical arrangement , either because there are one to five additional genes betweem r and m ( m2 topology , found in b. pseudomallei 1106a , b. pseudomallei 1710b , b. pseudomallei 668 , b. pseudomallei k96243 , b. thailandensis e264 ) , or because the otherwise constitutive r gene is missing in the immediate vicinity of the mi tandem ( m3 topology , b. ambipharia ammd , and mc40 - 6 ) . on the other hand , p. fluorescens ncimb 10586 contains a gene coding for an enzyme , mupx in the x position . in pseudomonas , the genes in the x position are predominantly negative regulators of the qs response . rsal ( l ) was shown to belong to the tetrahelical superclass of h - t - h proteins . members of this family are widespread repressors in bacteria and bind to dna as dimers . we found that homologues of rsal frequently occur outside qs circuits in various bacterial genomes ( data not shown ) . in p. fuscovaginae , rsal binds to dna next to the lux box and prevents expression of the r gene . in contrast , rsam ( m ) is a protein of unknown structure that seems to occur only in the context of qs circuits . finally , mupx of p. fluorescens ncimb10586 is an amidase - hydrolase that was shown to degrade the ahl signal produced by the same species thereby decreasing the qs response . two topologies , r2 and l1 , contain overlaps at the proximal ends of convergent genes . such overlaps are not uncommon in tightly coregulated gene circuits of bacteria , for instance restriction modification systems . the r2 type of arrangements in p. syringae contain overlapping r and i genes ( 2-to 68 nt ) while p. fluorescens genomes do not . in the l1 type qs circuits of p. aeruginosa , the overlaps are 10 nt while in p. fuscovaginae the overlap is 20 nt . on the contrary , the l1 circuits of p. putida are not overlapping , though the open reading frames of r and l are only 4 nt apart . tsai and winans noted that the overlapping r2-like arrangement is common to qs circuits in which r proteins are able to fold , dimerize , bind dna , and regulate transcription in the absence of ahls ; moreover , these proteins are antagonized by their cognate ahls . the same authors also argued that the expression of one member of a convergent and overlapping gene pair might be antagonized by the expression of the other member , either via rna polymerase collisions or by hybridization of the two complementary mrnas . the most conspicuous feature of the various circuit topologies is the potential negative regulatory effect of r on i which , as mentioned above , goes in parallel with the well known positive regulatory effect . in other words , r seems both to activate and to inhibit the i genes in a number of cases . in rxi circuits , r activates an x gene that decreases the effect of i. in the r2 circuits , the negative effect follows from the overlap between the convergently transcribed r and i genes . regulatory circuits in which an element can both activate and inhibit another element are termed incoherent feed forward loops or iffls [ 41 , 42 ] . in contrast to simple feed forward arrangements , iffls can exhibit a number of complex behavior patterns ( for a review see ) . perhaps the most important of these is the stabilization of the output signals : while simple feed forward circuits have no inherent limits on their output , iffl networks have bounded output which ensures robustness against fluctuations in the input signal levels . most often , qs regulatory circuits are simply referred to as autoinduction loops which , at least in theory , should increase their output without limits . the examples shown in this survey suggest that a stabilizing , negative regulatory pathway is present in many qs systems . it was found experimentally that deletion of rsal or rsam leads to a dramatic increase in ahl production , but the resulting mutants are less virulent than the wild type , which shows , on the other hand , that the negative regulatory path may in fact be a crucial stabilizing element within the qs circuits . finally , we mention that the chromosomal arrangements found in qs genes seem more varied than expected so the search for common regulatory principles remains an important task for future research .

pseudomonas spp . are able to colonize a large variety of environments due to their wide adaptability which is also associated with an n - acyl homoserine lactone ( ahl ) gene regulation mechanism called quorum sensing ( qs ) . in this article we present a systematic overview of the genomic arrangement patterns of quorum sensing genes found in pseudomonas and compare the topologies with those found in other bacterial genomes . we find that the topological arrangement of qs genes is more variable than previously thought but there are a few unifying features that occur in many of the topological arrangements . we hypothesize that the negative regulators of qs that are often found between the canonical luxr/ and luxi - family genes may be crucial for stabilizing the output of qs circuits .

the most famous and common definition of the bad news has been presented as any news that adversely and seriously affects an individual s view of his or her future . a physician is expected to be able to disclose bad news and be responsible for patients request in this regard . how the bad news is given to the patients most physicians do not have previous experience in talking to patients about death or end - stage diseases and are required almost daily to give unwelcome news without being properly prepared for such instances ( 2 ) . delivering bad news people with different cultural backgrounds may show different attitudes toward disclosing bad news . in north america and europe , most physicians express the diagnosis obviously , but in south and east europe and china , some patients are excluded from receiving information about their disease ( 5 , 6 ) . the purpose of this investigation was to explore the patients preferences and attitudes toward being informed about the bad news . this cross - sectional study was done on patients admitted to imam khomeini hospital , sari , iran , from september 2014 to february 2015 . before beginning the project , questionnaire and the aim of study the study protocol was confirmed by ethical committee of mazandaran university of medical sciences and researchers adhered to helsinki declaration during the study period . the studied population consisted of all patients above the age of 18 who were admitted with definite diagnosis of a malignant or chronic disease . exclusion criteria were refusing participation , disability to talk and communicate , and presence of cognitive disorders . the sample size was estimated to be 102 persons considering d = 0.1 , z = 1.96 , and p = 0.5 ( 7 ) . a valid ( cronbach s alpha coefficient was 0.88 ) and reliable questionnaire consisting of demographic data and 30 questions was used for data gathering ( table1 ) . 138 patients participated in this study and 130 patients completed the questionnaire and returned it ( 61.5% male ) . 93 patients ( 71.5% ) were married , 18 ( 13.84% ) widowed , 12 ( 9.23% ) single , and 7 ( 5.8% ) divorced . among the patients , 67 ( 51.53% ) had cancer , 21 ( 16.15% ) end - stage renal disease ( esrd ) , 18 ( 13.84% ) hepatic cirrhosis , 17 ( 13 . 07% ) chronic obstructive pulmonary disease ( copd ) and 7 ( 5.38% ) had other chronic diseases . in this study , 90.76% of patients believed they should be informed about their ongoing medical condition and receive the unwelcome news . similarly , in other studies done in china and australia , 83% and 77% of patients , respectively , believed they should be completely aware of their medical condition ( 8 , 9 ) . in our study , 56.15% of the patients were eager to be accompanied by someone while receiving bad news . furthermore , 45.38% of our participants preferred receiving bad news from their families while only 15.38% wanted to hear it from their second degree relatives or friends . studies in japan showed that 78% of patients prefer to share the bad news with their families ( 1 ) . in australia , 57% of patients liked to have their families beside them while unwelcome news is disclosed ( 9 ) . in contrast , some other studies showed that many patients prefer not to tell their families about having cancer ( 8) . it was revealed that 81% of american patients like to be alone while receiving bad news ( 10 ) . this study also showed that families have a helpful and supportive role at the time of unwelcome news disclosure and they can help patients accept the situation ( 7 ) . moreover , our patients generally deemed a highly experienced rendering specialist to be the best person to break the bad news to them and they did not accept other medical staff or medical students for this purpose . this result is similar to findings of researches done in australia and portugal , which showed that only 13% and 0% agreed to receiving bad news from nurses or hospital staff , respectively ( 5 , 9 ) . similar to our findings , most studies showed that the treating physician is the best person to convey unwelcome messages ( 5 , 11 ) . a proper doctor - patient relationship in breaking bad news can enhance patient s compliance in treatment and stress management ( 12 , 13 ) . many studies showed that doctors did not have enough self - confidence and skill for breaking unwelcome news and were unable to handle patients reactions and emotions ( 14 , 15 ) . in this survey , 50.76% of patients believed that doctors needed education about bad news disclosure , which shows the necessity of skill achievement for doctors and medical students regarding this issue . therefore , it is highly recommended to make a plan and educate doctors for becoming skillful in communicating with patients especially for giving bad news and handling their different reactions toward the news . this study demonstrated that 83.07% and 80.76% of patients did not want to receive bad news in hospital corridors and emergency room , respectively . also , 52.30% of them emphasized that this should be done in a private retired room . in a study by alrukban et al . 68% of people believed it was necessary to convey unwelcome messages in a private place ( 16 ) . the participants of our study stated that they needed psychological and religious consultations after receiving unwelcome messages and physicians should pay attention to their religious and emotional conditions in this situation . few studies have been done regarding this point ( 19 , 20 ) . in our study , 75.38% of patients affirmed that they should be thoroughly informed about their disease and the majority of them desired to know the cause , progress and prognosis of their disease . knowing life expectancy was crucial for cancer patients . participants of all the studies done in asia and western countries declared that it is their right to know all details of their diseases ( 5 , 10 , 16 ) . breaking bad news to patients demands more consideration for cultural and personal status of patients and it should be done by the treating specialist privately . it is recommended to design a standard questionnaire considering numerous factors cultural status of the area and status of medical services to achieve more accurate results . based on the results of the present study , most participants believed that the most experienced and skillful physician should inform them completely regarding their medical condition while considering patients psychological status . at the same time they declared that , it is best to hear bad news in a calm and suitable place and time rather than emergency department or hospital corridors during teaching rounds . all authors passed four criteria for authorship contribution based on recommendations of the international committee of medical journal editors .

introduction : delivering bad news is a stressful moment for both physicians and patients . the purpose of this investigation was to explore the patients preferences and attitudes toward being informed about the bad news . methods : this cross - sectional study was done on patients admitted to imam khomeini hospital , sari , iran , from september 2014 to february 2015 . patient attitude regarding breaking bad news was evaluated using a reliable and valid questionnaire . results : 130 patients were evaluated ( 61.5% male , mean age = 46.21 12.1 years ) . 118 ( 90.76% ) participants believed that the patient himself / herself should be informed about the disease s condition . 120 ( 92.30% ) preferred to hear the news from a skillful physician and 105 ( 80.76% ) believed that emergency department is not a proper place for breaking bad news . conclusion : based on the results of the present study , most participants believed that the most experienced and skillful physician should inform them completely regarding their medical condition . at the same time they declared that , it is best to hear bad news in a calm and suitable place and time rather than emergency department or hospital corridors during teaching rounds .

the incidence of duodenal injuries is 11.226% due to blunt trauma.[14 ] on an average , one to four other abdominal organ injuries are associated with duodenal trauma , which makes an isolated injury a rarity . the anatomical location of the duodenum makes diagnosis and treatment of isolated duodenal injury a difficult task . due to its rarity and subtle clinical features , we describe two patients with isolated blunt duodenal injuries and highlight some problems and principles in the management of duodenal injury . he was initially managed in two private hospitals where he underwent a laparotomy and duodenorrhaphy for traumatic duodenal perforation 30 hours after injury . on the 6 postoperative day ( pod ) , he was referred to our hospital with high - grade fever , altered mental status , abdominal distension and bilious discharge from the laparotomy wound . after adequate resuscitation and stabilization , the patient was taken up for re - laparotomy . the peritoneal cavity was filled with bilious fluid and there was crepitus along the paraduodenal and paracolic area . the previous repair was seen intact on the anterior wall of the second part of the duodenum . on mobilization ( kocherization ) of the duodenum , another perforation of size 1.5 cm the perforation was repaired in two layers and a triple tube decompression , i.e. tube gastrostomy , reverse tube duodenostomy and a feeding jejunostomy , was performed [ figure 1 ] . an abdominal drain was placed in the paraduodenal area and a polypropylene mesh laparostomy was done . graphical representation of the triple tube decompression technique ( case 1 ) ( a = tube gastrostomy , b = retrograde tube duodenostomy , c = feeding jejunostomy , p1 = site of the perforation on the anterior wall of the duodenum , p2 = site of the perforation on the posterior wall of the duodenum ) a contrast study on pod 15 showed normal passage of contrast into the jejunum , with no leak from the injury site . though he had one episode of fever , he was finally discharged on pod 88 in a stable condition . he attended the emergency department in a stable condition , and after primary assessment , the attending physician discharged him . the patient returned to the emergency department with abdominal pain and vomiting 24 hours after discharge . on examination , he was conscious , afebrile , with pulse rate 110/min and a blood pressure of 90/60 mm hg . u / l ) ; total leukocyte count was 11,000/mm ( reference range 400011,000/mm ) . contrast - enhanced computed tomography scan of abdomen with intravenous and oral contrast media revealed free gas in the retroperitoneum , extravasation of contrast and free fluid in the abdomen . there was bile staining and crepitus in the paraduodenal area and nearly 200 ml of dirty fluid in the right paracolic gutter . there was a perforation in the second part of the duodenum involving more than 50% of the circumference [ figure 2 ] . a tube gastrostomy , reverse tube duodenostomy through the proximal jejunum , and a feeding jejunostomy and polypropylene mesh laparostomy were performed . photograph showing the traumatic perforation on second part of duodenum ( a ) , gall bladder ( b ) . please note the extensive bilious staining and pus flakes all around in the retroperitoneum we performed a polypropylene mesh laparostomy in both the patients , since a safe definitive closure of the abdominal wall was not feasible due to tension and a primary closure could have resulted in the development of an abdominal compartment syndrome . instead , a transparent low - cost plastic sheath ( unprinted side of a sterile urine collection bag ) was placed between the abdominal wall and the exposed viscera . an appropriate size of a plain polypropylene mesh was then sutured to the linea alba to cover the abdominal contents without tension . after 48 hours , the plastic sheath was gradually removed through the caudal end of the laparostomy . as the abdominal distension decreased , the polypropylene mesh was divided in the midline and gradually trimmed over several days . each time the mesh was trimmed , the cut edges of the mesh were re - sutured with 1 - 0 polypropylene suture to maintain the continuity of the mesh . he was initially managed in two private hospitals where he underwent a laparotomy and duodenorrhaphy for traumatic duodenal perforation 30 hours after injury . on the 6 postoperative day ( pod ) , he was referred to our hospital with high - grade fever , altered mental status , abdominal distension and bilious discharge from the laparotomy wound . after adequate resuscitation and stabilization , the patient was taken up for re - laparotomy . the peritoneal cavity was filled with bilious fluid and there was crepitus along the paraduodenal and paracolic area . the previous repair was seen intact on the anterior wall of the second part of the duodenum . on mobilization ( kocherization ) of the duodenum , another perforation of size 1.5 cm the perforation was repaired in two layers and a triple tube decompression , i.e. tube gastrostomy , reverse tube duodenostomy and a feeding jejunostomy , was performed [ figure 1 ] . an abdominal drain was placed in the paraduodenal area and a polypropylene mesh laparostomy was done . graphical representation of the triple tube decompression technique ( case 1 ) ( a = tube gastrostomy , b = retrograde tube duodenostomy , c = feeding jejunostomy , p1 = site of the perforation on the anterior wall of the duodenum , p2 = site of the perforation on the posterior wall of the duodenum ) a contrast study on pod 15 showed normal passage of contrast into the jejunum , with no leak from the injury site . though he had one episode of fever , he was finally discharged on pod 88 in a stable condition . he attended the emergency department in a stable condition , and after primary assessment , the attending physician discharged him . the patient returned to the emergency department with abdominal pain and vomiting 24 hours after discharge . on examination , he was conscious , afebrile , with pulse rate 110/min and a blood pressure of 90/60 mm hg . u / l ( reference range 95 u / l ) ; total leukocyte count was 11,000/mm ( reference range 400011,000/mm ) . contrast - enhanced computed tomography scan of abdomen with intravenous and oral contrast media revealed free gas in the retroperitoneum , extravasation of contrast and free fluid in the abdomen . there was bile staining and crepitus in the paraduodenal area and nearly 200 ml of dirty fluid in the right paracolic gutter . there was a perforation in the second part of the duodenum involving more than 50% of the circumference [ figure 2 ] . a tube gastrostomy , reverse tube duodenostomy through the proximal jejunum , and a feeding jejunostomy and polypropylene mesh laparostomy were performed . photograph showing the traumatic perforation on second part of duodenum ( a ) , gall bladder ( b ) . we performed a polypropylene mesh laparostomy in both the patients , since a safe definitive closure of the abdominal wall was not feasible due to tension and a primary closure could have resulted in the development of an abdominal compartment syndrome . instead , a transparent low - cost plastic sheath ( unprinted side of a sterile urine collection bag ) was placed between the abdominal wall and the exposed viscera . an appropriate size of a plain polypropylene mesh was then sutured to the linea alba to cover the abdominal contents without tension . after 48 hours , the plastic sheath was gradually removed through the caudal end of the laparostomy . as the abdominal distension decreased , the polypropylene mesh was divided in the midline and gradually trimmed over several days . each time the mesh was trimmed , the cut edges of the mesh were re - sutured with 1 - 0 polypropylene suture to maintain the continuity of the mesh . here , we have described two patients with duodenal perforation following blunt abdominal trauma . in both the patients , the diagnosis was delayed . in the first patient , diagnosis of blunt duodenal injury is often delayed unless a very high index of suspicion is kept during initial assessment and tertiary survey after resuscitation and stabilization of patients . the mechanism of injury ( acceleration and deceleration impact ) , upper abdominal tenderness with tachycardia , raised temperature and vomiting should warrant further evaluation . contrast - enhanced computed tomographic scan of the abdomen with oral and intravenous contrast media is highly sensitive to detect small amounts of retroperitoneal air , paraduodenal hematoma or extravasated contrast from the duodenum . occasionally , contrast - enhanced computed tomographic scan may also be negative when performed early or may suggest subtle findings like small amount of unexplained fluid or unusual bowel morphology due to paraduodenal hematoma.[57 ] there are several options to deal with duodenal injury , which range from simple repair like primary closure ( duodenorrhaphy ) to more complex procedures like resection and anastomosis , duodenal diverticulation , pyloric exclusion , pancreaticoduodenectomy . however , no single method of repair completely eliminates the possibility of a duodenal fistula . most of the duodenal injuries are adequately managed with primary closure ( duodenorrhaphy ) in one or two layers or by resection and anastomosis . this was evident in both of our cases . in both the patients , damage control surgery in the form of polypropylene mesh laparostomy after duodenorrhaphy , tube gastrostomy , reverse tube duodenostomy and a feeding jejunostomy was performed . salvage procedures like quick damage control with delayed definitive surgery , foley catheter duodenostomy , duodenal decompression by quadruple tube technique are sparingly reported . both of our patients were effectively managed by simple repair and duodenal decompression by triple tube technique . simple repair followed by duodenal decompression with triple tube technique was originally described by stone and fabian . this triple tube technique comprises a tube gastrostomy for decompressing the stomach , a reverse tube duodenostomy for duodenal decompression and an antegrade tube jejunostomy for enteral feeding [ figure 1 ] . for reverse tube duodenostomy , the tube is passed through the proximal jejunum and guided into the second part of duodenum . this triple tube technique is rapid , needs only basic surgical experience , and provides a portal for early enteral feeding obviating the need for intravenous hyperalimentation . thus , it is a cost - effective option with least morbidity for managing these severely injured sick patients . in our first case , the injury on the posterior wall of the duodenum was missed at the time of the first laparotomy . the obvious perforation on the anterior wall probably prevented the operating surgeon from proper mobilization ( kocherization ) of the duodenum . in the second patient , the index of suspicion for severe internal injury was low in view of absence of clinical signs , hence the patient was discharged . mobilization of the duodenum is known to reveal significant injury even in the absence of apparent signs of trauma on it . recently , zeli et al . reported a case of complete transection of the duodenum at two places , one just beyond the pylorus and the other between the second and third part of duodenum . this report , as well as our first case , highlights the possibility of duodenal injury occurring at multiple sites . we strongly suggest that in all major blunt trauma cases , even in the presence of obvious perforation on the duodenum , the duodenum should always be mobilized and evaluated for additional injury . another option to manage such patients could have been a controlled duodenal fistula following peritoneal lavage . however , we preferred triple tube decompression as the feeding jejunostomy associated with the procedure helps in early enteral feeding , thereby avoiding the need for more expensive total parenteral nutrition ( tpn ) with its attendant complications . it also facilitates drainage of infectious material , permits visual control of the underlying viscera , facilitates wound care , simplifies repeated exploration if required , and hastens healing by secondary intention . isolated duodenal injury following blunt abdominal trauma is rare ; therefore , most general surgeons have a low index of suspicion and may not be experienced in handling such problems . these two cases highlight the difficulties that can be encountered during diagnosis and management of blunt abdominal trauma with isolated duodenal injury . the diagnosis depends on a high index of suspicion not only during the initial clinical evaluation but also during trauma related laparotomies . when diagnosed late , especially when the patient 's general condition is severely compromised , simple duodenorrhaphy with duodenal decompression by triple tube technique may be a good selection because the procedure is simple , rapid , and provides a portal for early enteral feeding

duodenal perforation following blunt abdominal trauma is an extremely rare and often overlooked injury leading to increased mortality and morbidity . we report two cases of isolated duodenal injury following blunt abdominal trauma and highlight the challenges associated with their management . in both these patients , the diagnosis of the duodenal injuries was delayed , leading to prolonged hospital stay . the first patient had two perforations , one on the anterior and the other on the posterior wall of the duodenum , of which the posterior perforation was missed at initial laparotomy . in the other patient , the duodenal injury was missed during the initial assessment in the emergency department . he returned to the emergency department 24 hours after discharge with abdominal pain and vomiting . during trauma related laparotomy , complete kocherization ( mobilization ) of the duodenum must be mandatory , even in the presence of obvious injury on its anterior wall . we emphasize on keeping the management protocol simple by a triple tube decompression , i.e. duodenorrhaphy ( simple closure ) , tube gastrostomy , reverse tube duodenostomy and a feeding jejunostomy .

falls in adults pose a major health concern , are a well - known public health problem,1 and are the main cause of injury , hospitalization , disability , poor quality of life , depression , and mortality in older adults.2,3 about 30%40% of adults in the usa report falling at least once per year,4 but less than half discuss their falls with their health care provider.5 one of the most common biological risk factors for falls is sarcopenia , which is observed in knee osteoarthritis ( oa).6 knee oa is an important risk factor for falls , particularly in women.7 in the usa , about 40% of adults with knee oa reported their health as poor or fair , and more than 50% of those with knee oa reported falling in the previous year.8 as the number of older adults increases , it is expected that the prevalence of falls and knee oa will increase.8,9 in 2010 , the overall rate of falls and fall - related injury was 43 per 1,000 population.9 an estimated 42.7 million americans ( 15% of the population ) had knee oa in 1995 , and , because of the increasing average age of the population , this figure is projected to rise to 59.4 million ( 18.2% ) by 2020.10 because of this growing epidemic , it is important to understand and monitor the impact of falls and knee oa on physical and mental health . one health outcome of particular interest in patients with falls and knee oa is health - related quality of life ( hrqol).11 assessment of hrqol has received considerable attention in recent decades.12 a key reason for serial measurement of hrqol is to reflect the changes that occur in an individual s health state in response to disease progression , various therapies , and recovery.12 there are a variety of generic and knee - specific instruments available to assess hrqol in people with oa.13 the knee injury and osteoarthritis outcome score ( koos ) is a knee - specific instrument , while the short form-12 ( sf-12 ) is a generic measure developed to assess hrqol in persons who have had falls during the previous 12 months . the objective of this study was to examine the relationship between self - reported falls , doctor - diagnosed knee oa , and hrqol using both disease - specific and generic measures . we selected the koos - qol subscale as a disease - specific measure and the sf-12 as a generic measure because they are widely used to assess hrqol and have been validated for the subpopulation of patients with self - reported falls and doctor - diagnosed knee oa . the osteoarthritis initiative is a publicly and privately funded , ongoing , longitudinal multicenter study of the onset and progression of knee oa.14 adults aged 4579 years at enrollment who had or were at high risk of knee oa were recruited between february 2004 and may 2006 from four clinical sites in the usa , ie , baltimore , md ; pittsburgh , pa ; pawtucket , ri ; and columbus , oh . details regarding the osteoarthritis initiative , including study overview , objectives , collaboration worldwide , funding , resources , visit schedule , and assessments are described elsewhere.15 the study protocol was approved by the institutional review board at the center coordinating the osteoarthritis initiative at the university of california , san francisco , ca , usa.14 the data used for the present study were obtained from the study documentation and data publically available in the online osteoarthritis initiative database.14 the specific dataset used was version 0.2.2 ( n=4,796 , november 2008 ) . we considered three subpopulations according to self - reported history of falling and doctor - diagnosed knee oa status as follows : those had neither a self - reported history of falling nor doctor - diagnosed knee oa ; those who had either a self - reported history of falling or doctor - diagnosed knee oa ; and those who had both a self - reported history of falling and doctor - diagnosed knee oa . subjects were included if they were aged 4579 years , regardless of sex or ethnicity ( figure 1 ) . we excluded individuals who did not know , were not sure , or refused to answer ( < 6.5% of the 4,312 respondents)14 from the analysis ( figure 1 ) . history of self - reported falling and doctor - diagnosed knee oa had been assessed using the following questions : have you fallen and landed on the floor or ground in the past 12 months?16 and has the doctor said you have osteoarthritis / degenerative arthritis of the knee?17 respondents were defined as having neither a self - reported history of falling nor knee oa if they had answered no to both the above questions , and to have either a self - reported history of falling or knee oa if they answered no to only one of the above questions . hrqol was assessed using both disease - specific and generic measures.18 the koos - qol18 was used as the knee - specific measure and the sf-1219 as the generic measure . the koos consists of five subscales , ie , pain , other symptoms , ability to perform activities of daily living , function in sports and recreation . the koos - qol subscale was used in this study and consists of four items , ie , knee problems , knee activity , knee troubles , and knee difficulty . each subscale score ranges from 0 ( no problems ) to 4 ( extreme problems ) , and was calculated as the sum of the above four items . the scores are transformed using a 0100 scale , with zero representing extreme problems and 100 representing no problems.20 responses of do nt know and refused were treated as missing data . the sf-12 scale , a shorter version of the sf-36 scale , uses 12 questions to measure the following eight dimensions of health : physical function , role limitations related to physical problems , pain , general health perception , vitality , social functioning , role limitations due to emotional problems , and mental health . these dimensions can be categorized into a physical component scale ( pcs ) and a mental component scale ( mcs ) . these health concepts are described by norm - based scores , with a mean of 50 in the general population and higher scores indicating better heath.21 the demographic and socioeconomic variables included were age ( years ) , race ( white versus non - white ) , sex ( female versus male ) , education ( high school / less versus some college / graduation ) , marital status ( married versus unmarried ) , employment ( employed versus unemployed ) , annual income ( < us$50,000 versus us$50,000 ) , household composition ( single versus living with others ) , smoking status ( never versus current ) , and weekly alcoholic consumption ( never versus current ) . validated general health measures of comorbidity and depression ( high versus low ) were used . the carlson cormorbidity index was used to measure comorbidity.19 a score 16 on the center for epidemiological studies depression scale was taken to indicate severe depressive symptoms.22 the sample characteristics were described using the mean and standard deviation for continuous variables and the frequency ( number and percentage ) for categoric variables . we used analysis of variance for continuous covariates and the chi - square test for categoric covariates to examine differences in sample characteristics and covariates according to self - reported history of falling and doctor - diagnosed knee oa status . multiple regression analyses were used to examine the relationship between falls and knee oa status on the koos - qol and sf-12 ( pcs and mcs ) . model 1 examined the unadjusted relationship between falls and knee oa status on the koos - qol and sf-12 ( pcs and mcs ) . model 2 investigated whether the relationship between falls and knee oa status on the koos - qol and sf-12 ( pcs and mcs ) was affected by sociodemographic , lifestyle , and clinical characteristics ( ie , sex , race , education , marital status , employment , household composition , annual income , health care coverage , smoking status , alcohol consumption , comorbidity , and depressive symptoms ) . the data used for the present study were obtained from the study documentation and data publically available in the online osteoarthritis initiative database.14 the specific dataset used was version 0.2.2 ( n=4,796 , november 2008 ) . we considered three subpopulations according to self - reported history of falling and doctor - diagnosed knee oa status as follows : those had neither a self - reported history of falling nor doctor - diagnosed knee oa ; those who had either a self - reported history of falling or doctor - diagnosed knee oa ; and those who had both a self - reported history of falling and doctor - diagnosed knee oa . subjects were included if they were aged 4579 years , regardless of sex or ethnicity ( figure 1 ) . we excluded individuals who did not know , were not sure , or refused to answer ( < 6.5% of the 4,312 respondents)14 from the analysis ( figure 1 ) . history of self - reported falling and doctor - diagnosed knee oa had been assessed using the following questions : have you fallen and landed on the floor or ground in the past 12 months?16 and has the doctor said you have osteoarthritis / degenerative arthritis of the knee?17 respondents were defined as having neither a self - reported history of falling nor knee oa if they had answered no to both the above questions , and to have either a self - reported history of falling or knee oa if they answered no to only one of the above questions . hrqol was assessed using both disease - specific and generic measures.18 the koos - qol18 was used as the knee - specific measure and the sf-1219 as the generic measure . the koos consists of five subscales , ie , pain , other symptoms , ability to perform activities of daily living , function in sports and recreation . the koos - qol subscale was used in this study and consists of four items , ie , knee problems , knee activity , knee troubles , and knee difficulty . each subscale score ranges from 0 ( no problems ) to 4 ( extreme problems ) , and was calculated as the sum of the above four items . the scores are transformed using a 0100 scale , with zero representing extreme problems and 100 representing no problems.20 responses of do nt know and refused were treated as missing data . the sf-12 scale , a shorter version of the sf-36 scale , uses 12 questions to measure the following eight dimensions of health : physical function , role limitations related to physical problems , pain , general health perception , vitality , social functioning , role limitations due to emotional problems , and mental health . these dimensions can be categorized into a physical component scale ( pcs ) and a mental component scale ( mcs ) . these health concepts are described by norm - based scores , with a mean of 50 in the general population and higher scores indicating better heath.21 the demographic and socioeconomic variables included were age ( years ) , race ( white versus non - white ) , sex ( female versus male ) , education ( high school / less versus some college / graduation ) , marital status ( married versus unmarried ) , employment ( employed versus unemployed ) , annual income ( < us$50,000 versus us$50,000 ) , household composition ( single versus living with others ) , smoking status ( never versus current ) , and weekly alcoholic consumption ( never versus current ) . validated general health measures of comorbidity and depression ( high versus low ) were used . the carlson cormorbidity index was used to measure comorbidity.19 a score 16 on the center for epidemiological studies depression scale was taken to indicate severe depressive symptoms.22 the sample characteristics were described using the mean and standard deviation for continuous variables and the frequency ( number and percentage ) for categoric variables . we used analysis of variance for continuous covariates and the chi - square test for categoric covariates to examine differences in sample characteristics and covariates according to self - reported history of falling and doctor - diagnosed knee oa status . multiple regression analyses were used to examine the relationship between falls and knee oa status on the koos - qol and sf-12 ( pcs and mcs ) . model 1 examined the unadjusted relationship between falls and knee oa status on the koos - qol and sf-12 ( pcs and mcs ) . model 2 investigated whether the relationship between falls and knee oa status on the koos - qol and sf-12 ( pcs and mcs ) was affected by sociodemographic , lifestyle , and clinical characteristics ( ie , sex , race , education , marital status , employment , household composition , annual income , health care coverage , smoking status , alcohol consumption , comorbidity , and depressive symptoms ) . of the 4,484 participants , 2,297 ( 51.23% ) had neither a self - reported history of falling nor doctor - diagnosed knee oa , 1,815 ( 40.48% ) had either a history of falling or knee oa , and 372 ( 8.30% ) had both a history of falling and knee oa ( table 1 ) . those who had both a history of falling and knee oa were significantly more likely to be women , have a lower income , report more depressive symptoms , partake in less physical activity , and have a lower hrqol score than the other two groups . table 2 shows the regression analysis for self - reported history of falling and doctor - diagnosed knee oa status according to the koos - qol . in model 1 ( unadjusted ) , either a history of falling or knee oa was significantly associated with koos - qol score ( = 19.7 , standard error 1.35 , p<0.0001 ) compared with no history of falling or knee oa . having both a history of falling and knee oa was more strongly associated with koos - qol score ( = 39.5 , standard error 2.38 , p<0.0001 ) compared with neither a history of falling or knee oa and either a history of falling or knee oa ( table 2 ) . in model 2 , when sociodemographic , lifestyle , and clinical characteristics ( sex , race , education , marital status , employment , household composition , annual income , health care coverage , smoking status , alcohol consumption , comorbidity , and depressive symptoms ) were added , the negative association with koos - qol score was statistically significant ( = 18.5 , standard error 1.29 , p<0.0001 ) in persons with either a history of falling or knee oa compared with persons who had no history of falling or knee oa . having both a history of falling and knee oa was more strongly associated with koos - qol score ( = 34.4 , standard error 2.27 , p<0.0001 ) compared with no history of falling or knee oa and compared with either a history of falling or knee oa . other variables significantly associated with koos - qol scores in model 2 were age , sex , race , education , employment , income , smoking , depression , and comorbidity ( see table 2 ) . the regression analysis of history of falling and doctor - diagnosed knee oa status on the pcs and mcs of the sf-12 is shown in tables 3 and 4 , respectively . in model 1 ( unadjusted ) , either a history of falling or knee oa were significantly associated with pcs and mcs scores ( = 6.1 , standard error 0.55 , p<0.0001 , and = 1.1 , standard error 0.50 , p=0.030 , respectively ) than neither a history of falling nor knee oa . having both a history of falling and knee oa was more strongly associated with pcs and mcs scores ( = 11.4 , standard error 0.98 , p<0.0001 , and = 4.20 , standard error 0.88 , p<0.0001 , respectively ) than neither a history of falling nor knee oa or either a history of falling or knee oa ( see tables 3 and 4 ) . in model 2 , when sociodemographic , lifestyle , and clinical characteristics ( sex , race , education , marital status , employment , household composition , annual income , health care coverage , smoking status , alcohol consumption , comorbidity , and depressive symptoms ) were added , there was a statistically significant negative relationship with pcs score ( = 5.56 , standard error 0.50 , p<0.0001 ) in persons with either a history of falling or knee oa compared with persons who had no history of falling or knee oa . having both a history of falling and knee oa was more strongly associated with pcs score ( = 9.44 , standard error 0.90 , p<0.0001 ) compared with no history of falling or knee oa and compared with either a history of falling or knee oa ( see table 3 ) . however , no statistically significant relationship was found with mcs score ( see table 4 ) . other variables that were significantly associated with pcs scores in model 2 were race , education , employment , income , smoking status , alcohol consumption , depression , and comorbidity ( see table 3 ) . variables significantly associated with mcs scores in model 2 were age , race , marital status , income , smoking , and depression ( see table 4 ) . the aim of the current study was to examine the relationship between self - reported history of falling , doctor - diagnosed knee oa , and hrqol . we found that self - reported history of falling and doctor - diagnosed knee oa were significantly associated with poorer quality of life according to the koos - qol subscale and the pcs of the sf-12 , after controlling for all covariates . we used both disease - specific ( koos - qol subscale ) and generic ( sf-12 ) hrqol measures to capture different aspects of the health status of the study population.23 although a history of falling and knee oa were associated with poorer hrqol , the pcs domain of the sf-12 and the qol domain of the koos - qol subscale showed significantly lower score in persons with both conditions ( fall and knee oa ) compared with persons who had no history of falling or knee oa and persons with either a history of falling or knee oa . the lower scores on the pcs and hrqol domains indicate a significant determinant worthy of further evaluation over a longer follow - up duration . we had expected to find low psc scores on the sf-12 and on the koos - qol subscale when investigating how a history of falling and having knee oa affects these constructs at baseline . according to our data , individuals who had experienced falls and had knee oa showed lower mcs scores even after adjustment for sociodemographic , lifestyle , and clinical characteristics , compared to persons who had no history of falling or knee oa and persons with either a history of falling or knee oa . previous research has identified adverse effects of falling and knee oa across different dimensions of hrqol , including mental health.24 for example , chen et al25 found that persons with a history of falling and knee oa had more comorbid mental health conditions and were at greater risk of anxiety and depression than those with neither a history of falling nor knee oa . our findings support the call for continued research on interventions that address self - reported fall and doctor diagnosed knee oa to improve hrqol.26 we can reduce falls by providing effective falls prevention programs for adults in our communities . the centers for disease control and prevention has reviewed and identified community - based fall prevention interventions with strong scientific evidence of effectiveness.27 research has shown that arthritis conditions , including knee oa , have vast impact on quality of life.28 our study also confirms that having both conditions ( fall and knee oa ) are significantly associated with poorer hrqol compared with persons who had no history of falling or knee oa and persons with either a history of falling or knee oa . the presence of knee oa has been shown to be a risk factor for falls.29 it makes sense that the presence of knee oa has the greatest impact on fall risk , and functional ability ( eg , gait , ability to rise from a chair ) shows direct associations with fall frequency.30 consistent with our findings , sturnieks et al found an increased risk of falls in adults with knee oa relative to a sample of healthy adults.31 our study has several strengths . to our knowledge , it is the first to examine hrqol in relation to self - reported falls and doctor - diagnosed knee oa . our data were obtained from the large publicly available osteoarthritis initiative database and we used well established and validated measurements of hrqol , ie , the sf-12 and the koos - qol subscale . examining the effects of falls on hrqol outcomes is unique and contributes to a broader understanding of falls prevention in older adults.27 the limitations of this study include its cross - sectional design , which prevents comparison of data over time . further , the self - reported nature of the key variables , ie , self - reported falling and doctor - diagnosed knee oa , and fall data being limited to a 12-month period limits the generalizability of the current findings . self - reported doctor - diagnosed knee oa was not verified clinically or radiologically , except for cases where the doctor had confirmed the diagnosis , which introduces a degree of bias and makes it impossible to draw a reasonable conclusion . even with adjusting for confounding between groups , there are still likely to be many unmeasured confounders in this type of analysis . a better understanding of the relationship between falls , knee oa , and hrqol is necessary to develop effective prevention and treatment programs.32 for example , if future longitudinal research confirms that persons with falls and knee oa have worse hrqol compared with persons who neither had experienced fall nor knee oa and either had experienced fall or knee oa , attention can be devoted to the types of educational and training materials that could assist them in reducing their risk of falling and knee oa . this particularly important for persons who had both a history of falling and knee oa , some of whom will required information in a bilingual format.33,34 we found that persons who had experienced falls and had knee oa experienced poorer hrqol than those had no history of falling or knee oa and either a history of falling or knee oa . falls and knee oa were significantly associated with both a lower koos - qol subscale score and a lower pcs score on the sf-12 , even after adjusting for sociodemographic , lifestyle , and clinical factors . future population - based longitudinal research is necessary in order to examine how hrqol changes over time . this research is particularly important in underserved groups , such as those who are at high risk of falling and have knee oa .

backgroundthe purpose of this study was to examine the relationship between self - reported falls , doctor - diagnosed knee osteoarthritis ( oa ) , and health - related quality of life ( hrqol ) . we hypothesized that falls and knee oa would be associated with poor hrqol on both disease - specific and generic measures.methodsthis cross - sectional study used data from the publicly available osteoarthritis initiative data sets . a total of 4,484 subjects aged 4579 years at baseline were divided into three subpopulations : those who had neither a history of falling nor doctor - diagnosed knee oa ; those who had either a self - reported history of falling or doctor - diagnosed knee oa ; and those who had both a self - reported history of falling and doctor - diagnosed knee oa . hrqol was assessed using both disease - specific and generic measures . multiple regression analyses were used to examine the relationship between self - reported falls , doctor - diagnosed knee oa , and hrqol assessed using the knee injury and osteoarthritis outcome score - quality of life ( koos - qol ) subscale and two short form-12 ( sf-12 ) summary scales . the models were adjusted for participant sociodemographic , lifestyle , and clinical characteristics.resultsfalls and knee oa were significantly associated with lower scores on the koos - qol ( = 34.4 , standard error 2.27 , p0.0001 ) and on the physical component scale of the sf-12 ( = 9.44 , standard error 0.90 , p<0.0001 ) . no significant relationship was found with the mental component scale score when adjusted for sociodemographic , lifestyle , and clinical characteristics.conclusionwhen compared with those having neither a self - reported history of falling nor doctor - diagnosed knee oa and those with a self - reported history of falling or doctor - diagnosed knee oa , persons with both conditions ( falls and knee oa ) had significantly lower koos - qol and physical component scale scores after adjusting for sociodemographic , lifestyle , and clinical characteristics . future research should assess potential mediating factors in an effort to improve hrqol in persons with knee oa who are at high risk of falling .

in the recent few years , due to epidemiological and clinical studies , new risk factors in pathogenesis of atherosclerosis and cardiovascular disease have been found . cardiac remodeling is an adaptive response to the myocardial infarction heart damage and attempt to work in the new hemodynamic conditions . postinfarction cardiac remodeling was defined as a complex of pathological lesions , which take the place at the cellular , tissue and organ level , lead to an increase of left ventricular volume , shape and the mass of the heart muscle ( 1 , 2 ) . there are many initiation factors involved in the process of cardiac remodeling , such as mechanical load , inflammation , neuroendocrine system stimulation ( especially renin - angiotensin - aldosterone ) ( 2,3 ) . interactions between these factors , through the receptor pathways , lead genes expression in cardiomyocyte . also age , gender and race play an important role in the pathogenesis of cardiac hypertrophy . in framingham study electrocardiographic features characteristic for hypertrophy were found in approximately 1% of younger persons ( < 30 years ) and around 12% in older subjects ( > 70 years ) . left ventricular hypertrophy was diagnosed in 1,3% of younger males ( 29 - 44 years of age ) with systolic pressure 120 mmhg and in 5,9% in the older ones ( 55 - 62 years of age ) . however , a group of males in the same age ranges but with systolic blood pressure > 200 mmhg demonstrated cardiac hypertrophy , accordingly in 33,3 % and 47,1% ( 2 ) . cardiac muscle hypertrophy accordingly to the law of laplace , means the increase of ventrical volume that results in the higher tension of the heart s wall . there are few types of cardiomyopathies such as hypertrophic cardiomyopathy , dilated cardiomyopathy ( congestive ) , restrictive cardiomyopathy and arrhythmogenic right ventricular cardiomyopathy ( 5 ) . hypertrophic cardiomyopathy ( hcm ) is defined as left ventricular ( lv ) hypertrophy that is not associated with lv dilation and that occurs in the absence of another systemic or cardiac disease capable of producing wall thickening ( e.g. , systemic hypertension , aortic valve stenosis ) . clinical diagnosis is customarily made with 2-dimensional echocardiography ( or alternatively with cardiac magnetic resonance imaging ) by detection of otherwise unexplained lv wall thickening , usually in the presence of a small lv cavity , after suspicion is raised by the clinical profile or as a part of family screening ( 5 ) . dilated cardiomyopathy ( congestive ) is the most common type of cardiomyopathy , characterized by dilated lesions , enlargement of the whole heart with hypertrophy of the heart muscle . there are many causes which lead to dilated cardiomyopathy , such as viruses ( cox , hiv , hsv ) , bacteria ( mycobacterium tuberculosis ) , neuromuscular diseases , endocrine disorders ( hypothyroidism , hyperthyroidism , hypoparathyroidism ) ( 6 ) . in central africa , the most common form of rcm is endomyocardial fibrosis caused by hypereosinophilic syndrome . arrythmogenic right ventricular cardiomyopathy ( arvc ) is an uncommon form of heart muscle disease ( aproximately 1:5000 ) . arvc involves predominantly the right ventricle with progressive loss of myocytes and fatty or fibrofatty tissue replacement , resulting in segmental or global abnormalities . in addition , evidence of lv involvement with fibrofatty replacement , chamber enlargement , and myocarditis is reported in up to 75% of patients . arvc / d has a broad clinical spectrum , usually presenting clinically with ventricular tachyarrhythmias ( eg , monomorphic ventricular tachycardia ) . a recognized cause of sudden cardiac death in the young . diagnosis often requires a high index of suspicion , frequently triggered by presentation with arrhythmias , syncope , or cardiac arrest , as well as global or segmental chamber dilatation or wall motion abnormalities ( 7 ) . cardiomyopathies are diagnosed based on medical history of patient ( symptoms and family history ) , physical examination , results of echocardiogram and in some situations additionally ecg or chest - x - ray results . according to accf / aha guidelines comprehensive tte and doppler studies should be performed in the initial evaluation of all patients with suspected hcm , as well as during follow - up , particularly when there is a change in cardiovascular symptoms or an event . echocardiographic studies are essential for establishing the diagnosis and the nature and extent of hypertrophy , defining prognosis , and guiding management ( 2011 accf / aha guideline for the diagnosis and treatment of hypertrophic cardiomyopathy ) ( 8) . cardiac magnetic resonance ( cmr ) imaging is indicated in patients with suspected hcm when echocardiography is inconclusive for diagnosis . there have been significant advances in cmr in recent years , and most centers now have access to this advanced imaging technique . compared with other noninvasive cardiac imaging modalities , cmr provides superior spatial resolution with sharp contrast between blood and myocardium , as well as complete tomographic imaging of the entire lv myocardium and therefore the opportunity to more accurately characterize the presence , distribution , and extent of lv hypertrophy in hcm . because of the technical complexity of cmr imaging , data from the published literature are only generalizable if imaging is performed with high technical quality by experienced operators and interpreted by well - trained and experienced readers ( 2011 accf / aha guideline for the diagnosis and treatment of hypertrophic cardiomyopathy ) ( 8) . currently used non - invasive diagnostic methods , therefore , it would be good to perform further analysis of new potential markers suggested by some researchers . many molecular and cellular changes are involved in heart muscle disorders , such as : activation of different signaling pathways , switch of fetal gene program of myocardium , apoptosis . all the mentioned events contribute in some way in a consequent change / alteration in the contraction , ion homeostasis and expression of growth factors , chemokines and hormones ( 9 ) . also the increase of the extracellular matrix components expression , adhesion molecules , proteins , integrin receptors are important in the evolution of heart failure process ( 10 , 11 , 12 ) . one of such potential biomarkers is osteopontin ( op ) that has been found for the first time in bone tissue ( 13 ) . it is synthesized by a variety of tissues , as : fibroblasts , osteoblasts , some bone marrow cells , immune cells ( macrophages , neutrophils , dendritic cells , t and b cells ) ( 14 ) . osteopontin has a chemotactic activity important in the cell recruitment to the inflammatory site : acts as an adhesion protein and mediates the cell activation and cytokines production , beside the apoptosis regulation ( 15 ) . op is released in the form of immobilized extracellular matrix molecule or as a soluble form . for its characteristic has been suggested that op is involved in the communication between the extracellular matrix and cardiomyocytes ( 16 ) . op mediates cardiac fibrosis probably by the cell adhesion and proliferation and is upregulated in left ventricular hypertrophy where it is stimulated by angiotensin ii ( 17 ) . early studies have shown that op can be upregulated also in patients with cvd ( 17 ) . in patients with significantly altered systolic function and nyha class i and ii symptoms , only moderate increases of op have been shown whereas in patients with nyha class iii and iv marked increases of op have been found . it suggests , that op may be a possible biomarker for the advanced heart failure . moreover , osteopontin showed to be an independent predictor of 4-year death , and gave more information of the risk evaluation in patients with heart failure ( 18 ) . the st-2 receptor is a novel biomarker of cardiac stress with adverse cardiac remodeling and tissue fibrosis that occurs in response to myocardial infarction , heart failure or acute coronary syndrome ( 19 ) . st-2l receptor ( a transmembrane form ) is a kind of toll - like receptor superfamily and its pathophysiological role is not clearly understood yet ( 20 ) . interleukin-33 ( il-33 ) has been identified as a functional ligand of st-2 and involved in the functions of several tissues and the complex il-33/st-2 has cardioprotective functions by inducing th1-to - th2 switch and by il-5 synthesis stimulation , which increases the level of oxldl antibodies ( 21 , 22 , 23 ) . the cardioprotective effect starts when the il-33 binds the st2 receptor and the complex plays a similar role to b - type natriuretic peptide ( bnp ) by protecting the heart from harmful cardiomyocyte hypertrophy ( 24 ) . increased concentrations of sst2 ( soluble form ) in patients 1 day after acute myocardial infarction has been found ( 25 ) . however , it has been shown that high base concentrations of sst2 predict heart failure and mortality in patients with acute myocardial infarction at 30 days ( 26 ) . the combination of st2 and bnp significantly increase the stratification s risk ( 27 ) . in conclusion , it has been proven , that patients with known cvd and increased sst2 level , have higher mortality rates at 1 year after episode . rehman et al , examined a group of 346 patients with acute heart failure and assessed st2 concentration . st2 values were correlated with severity of heart failure ( p<0,001 ) , left ventricular ejection fraction ( r = -0.134 ; p = 0.014 ) , b - type natriuretic peptide ( r = 0.293 ; p < 0.001 ) , amino terminal b - type natriuretic peptide ( r = 0.413 ; p < 0.001 ) , and c - reactive protein ( r = 0.429 ; p < 0.001 ) . in a multivariable cox model containing established clinical and biochemical predictors ( including natriuretic peptides ) , st2 remained a predictor of mortality ( hazard ratio : 2.04 , 95% cl : 1.30 to 3.24 , p = 0.003 ) , and was equally predictive in patients with hf and preserved or impaired systolic function ( 28 ) . osteoprotegerin ( opg ) is a member of the tumor necrosis factor ( tnf ) receptor superfamily which plays many important roles : in bone remodeling , in pathogenetic mechanisms of bone malignancies and mineral metabolism disorders . there are evidences , that opg can promote cell survival by the inhibition of tnf related apoptosis inducing ligand ( trail ) ( 29 ) . opg acts as a soluble decoy receptor activator of nuclear factor kappab ligand ( rankl or opg ligand ) and shows homologies with other tnf receptor members . rankl has an central role in the osteoclast functions and bone remodeling , also in immune cell cross - talks , dendritic cells survival , lymph node organogenesis and vascular biology ( 30 ) . arterial calcification is characteristic of arterial atherosclerosis and is associated with the ami s occurrence . opg is associated with a higher left ventricular mass and reduced left ventricular systolic function , suggesting that the opg activation play an important role in initial phase of left ventricular hypertrophy and dysfunction . furthermore , opg has been linked with atrial fibrillation in general population but the association with the outcomes in patients with stable chronic heart failure are still unknown . higher opg levels were found in older females with severe heart failure ( 29 , 32 ) . moreover , opg and body mass index are inversely related . higher levels of circulating opg are associated with higher serum creatinine concentration and lower glomerular filtration rate ( impaired renal function ) . increased opg concentrations are connected with a higher systolic blood pressure , higher heart rate , and higher risk of diabetes mellitus and chronic obstructive pulmonary disease . it has been found that increased concentrations of opg may be associated with higher concentration of bnp and hscrp . in subjects with chronic heart failure opg is an independent predictor of mortality from all causes ( 32 ) . neopterin is a low molecular weight , stable compound , produced mostly by macrophages from gtp . gtpch induces gtp conversion to 7,8-dihydroneopterin triphosphate and in the next step to neopterin ( 33 ) . in cardiovascular diseases such as unstable angina , myocardial infarction or heart failure , number of lymphocytes published results show positive correlation between higher activity of monocytes and neopterin concentration ( 34 ) . in atherosclerosis , it affects activation and migration of macrophages into the artery wall . also , positive correlation between neopterin concentration and severity of illness has been observed . results of experiments performed by van haelst et al , showed that higher neopterin concentration is a better indicator of mi without q - wave elevation than initial ecg . in the group of patients with mi , neopterin values were significantly higher , depending on duration of cardiac incident and pharmacotherapy ( 35 ) . we have to note the fact , that there were no correlations between neopterin , c - reactive protein or creatine phosphokinases ( 36 ) . hennig et al investigated role of inflammatory biomarkers and neopterin for prediction of right ventricular failure in group of 40 patients after left ventricular assist device . patients were divided into two groups -i ( without postoperative right ventricular failure ) and- ii ( with defined right ventricular failure after implantation ) . level of neopterin and nt - probnp were significantly lower in group i 10.5 vs. 20.7 ng / ml , p = 0.018 , and 6322 vs. 17174 pg / ml , p = 0.032 , respectively ( 37 ) . the family include three structurally - related peptides , named urocortin 1 ( ucn-1 ) , urocortin 2 ( ucn-2 ) , and urocortin 3 ( ucn-3 ) ( 38 ) . the mechanism of action of these peptides is mediated through the binding to g - coupled protein receptors crf - r1 and crf - r2 . however , only crf - r2 is specific for the heart ventricles and circulation system . earlier data suggested that the urocortins are involved in modulating cardiovascular function and mediating cardiovascular responses to stress ( 39 ) . nishikimi et al observed significantly higher concentration of urocortin 1 in a rat model with left ventricular hypertrophy ( lvh ) . moreover , it has been shown that experimental application of ucn-1 , ucn-2 and ucn 3 in congestive heart failure may have advantages on cardiac function ( 40 ) . advantegous effects of the urocortins on cardiac function are mediated by the intracellular ca2 + ions administration . growth differentiation factor ( gdf ) 15 is a member of the transforming growth factor ( tgf- ) superfamily , which has an important role in inflammation , apoptosis , cell proliferation and differentiation during some injury or disease s process ( 41 ) . the mrna of gdf 15 is mostly presented in the liver cells in high quantities , and the expression is upregulated during injuries in some organs as lungs , heart , kidney and liver . the myocardial expression of that factor is hyper - regulated by the stress but , in physiological conditions it is weakly expressed ( 42 , 43 ) . it is important to predict the mortality and heart failure in patients after acute myocardial infarction combining those results with the informations obtained from new york class association ( nyha ) , left ventricular ejection fraction ( lvef ) and n - terminal - pro - b - type natriuretic peptide ( nt pro - bnp ) levels ( 44 ) . tgf- is a locally generated growth factor which stimulates the fibroblast proliferation and extracellular matrix ( ecm ) production , especially collagen and fibronectin , reducing degradation of those elements . tgf- has been shown to be significantly increased not only during cardiac hypertrophy but also after mi , leading to structural remodeling and heart failure ( 42 , 43 , 44 , 45 , 46 ) . however , the inducted expression of tgf- , as well as the exogenous supplementation , may protect cardiomyocytes against ischemia - reperfusion injuries , by the inhibition of tnf- and prevention of reactive oxygen species ( ros ) accumulation ( 47 ) . the gdf 15 expression is induced very quickly by il-1 , tnf- and in macrophages , limiting in that way the inflammation and macrophages activation ( 48 , 49 , 50 ) . in the cell culture , recombinant gdf-15 has shown to have a protective role for cardiomyocytes from ischemic injuries ( 51 , 52 , 53 ) . these studies may bring to the development of a novel therapies which can be used in treatment of the heart failure . human urotensin - ii is a circle peptide , synthesized from preprohormone after the enzymatic proteolysis . at first , this peptide was isolated from a spinal cord of osteichthyes and it was called a neurohormone . concentration of urotensin - ii is significantly higher in patients with hypertension , congestive heart failure , diabetes mellitus . urotensin shows numerous effects in circulation system , dependent on the type of vascular placenta and their condition . urotensin acts indirectly through the specific receptor ( gpr14 ) , bound with the effector system . concentration of gpr 14 receptors within vascular wall is higher in patients with congestive heart failure , caused by myocardial infarction . it leads to the hypertrophy and fibrosis of the heart muscle . under these conditions , u - ii induces mrna transcription for procollagen type i and iii . urotensin shows positive inotropic mechanism of action , accordingly to the vascular wall tension and blood pressure ( 55 ) . previously used diagnostic methods for assessing cardiac remodeling / cardiac hypertrophy , do not provide the answers to all clinical questions . new , specific and sensitive biomarkers emerged , which can be implement to routine diagnostic of cardiomyopathy , however they still need further investigations .

cardiomyopathies are diagnosed based on medical history of patient ( symptoms and family history ) , physical examination , results of echocardiogram and in some situations additionally ecg or chest - x - ray results . currently used non - invasive diagnostic methods , could be complemented by biochemical tests . in this review some emerging potential biomarkers such as : osteopontin , st-2 receptor , osteoprotegerin , neopterin , urocortins , growth differentiation factor 15 and urotensin ii are described . in current article human and non human investigations have been reviewed , since rat is most commonly used model in experimental cardiology and gives important foundations to clinical knowledge .

asymptomatic infections are frequent in europe , as borrelia - specific antibodies have been observed in 525% of healthy subjects [ 1 , 2 , 3 , 4 ] . the primary stage is characterized by erythema migrans and can be followed by dissemination of disease , which mainly affects the joints , heart or nervous system [ 4 , 5 , 6 ] , within weeks to months . neuroborreliosis of the central nervous system ( cns ) is rare , and differentiation from other disorders of the cns with concomitant seropositivity for b. burgdorferi can be difficult . herein , we report a case with positive b. burgdorferi serology and 4 episodes of severe cns manifestations with full recovery each time after sufficient antibiotic treatment . we illustrate the diagnostic steps and procedures which were valuable for posing the differential diagnosis in this unusual case , taking into account current state - of - the - art procedures for the diagnosis of lyme borreliosis . a 31-year - old woman presented with a 2-day history of rapidly progressing hypoesthesia of the body below the neck , tetraparesis , gait ataxia , brainstem symptoms , and urinary retention . fifteen years earlier , in 1996 , she had suffered from a mild paraparesis with hypoesthesia of both legs , which remitted completely after treatment with an oral antibiotic and glucocorticoids . details were not remembered and neither cerebrospinal fluid ( csf ) analysis nor mri scans had been performed . the second episode occurred 3 years later , in 1999 , with acute urinary retention and a mild - to - moderate sensomotoric deficit below dermatome t6 . transcranial magnetic motor evoked potentials ( mep ) and somatosensory evoked potentials ( ssep ) were altered . cerebral and spinal mri scans were normal , but csf analysis showed a lymphocytic pleocytosis of 260 leukocytes/l , and a highly elevated b. burgdorferi csf / serum igg antibody index ( ai ) of 8.0 ( normal < 2.0 ) , leading to the diagnosis of neuroborreliosis with transverse myelitis . the patient was subsequently treated intravenously for 14 days with ceftriaxone 2 g / day and prednisolone 80 mg / day and recovered completely . control csf analysis showed a regression of the pleocytosis to 30 leukocytes/l and a reestablishment of the blood - brain barrier ( bbb ) function with an albumin csf / serum quotient of 3.6 compared to 12.8 before treatment . during the third episode in 2008 , the patient developed neck pain , a mild gait ataxia , and paresthesia of both legs . cerebral and spinal mri scans , mep and ssep were normal , but csf analysis revealed 293 leukocytes/l with a positive b. burgdorferi igm ( eia and western blot ) in serum but not in csf . the ai was reported to be normal . treatment consisted of intravenous ceftriaxone 2 g / day , which was later switched to oral doxycycline 100 mg bid and notably no corticosteroids . the patient made a complete clinical recovery , and csf reanalysis after treatment showed a reduction of the pleocytosis to 15 leukocytes/l . the only other remarkable prior condition was an x - type histiocytosis with a strictly dermal manifestation diagnosed in 1982 , which completely remitted and had not caused any further manifestation since treatment with methotrexate and purinethol . notably , the patient did not recall a tick bite or erythema migrans at any time . on admission in march 2011 , the patient presented with a sustained gaze - evoked nystagmus to the left and an incomplete abducens nerve paralysis . the patient was not able to stand or walk , but showed moderate ataxia of all limbs . sensory testing revealed sensory deficits below dermatome c4 , with impaired discrimination of sharp and dull , and essentially no sense of vibration , temperature and position . a spinal mri scan revealed extensive signal alterations especially in the cervical , but also in the thoracic spinal cord . some of these lesions comprised 2 or more segments and involved large parts of the cord 's cross section ( fig . 1a , b ) , in combination with moderate swelling at the cervical level and a faint enhancement after intravenous gadolinium administration ( not shown ) . csf analysis revealed a predominantly lymphocytic pleocytosis of 136 leukocytes/l ; dysfunction of the blood - csf barrier , with an elevated csf / serum albumin quotient of 18.8 ; and an elevated total csf protein of 126 mg / dl . there were no oligoclonal bands , but a reiber diagram suggested intrathecal synthesis of igm ( igm quotient 11.96 , igm index 0.64 ) but not igg ( igg quotient 12.78 , igg index 0.68 ) . measles , rubella , and zoster ais ( mrz reaction < 1.3 ) were negative . csf / serum ais of 52.6 and 18.8 were highly positive for b. burgdorferi igm and igg , respectively , with a b. burgdorferi - specific igm concentration of 18.9 u / ml and an igg concentration of 1.3 u / ml in csf . western blotting was positive in csf and serum for p41- and ospc - specific igm and igg at day 1 , and revealed an additional positive osp17-igm band in serum at days 7 and 17 ( fig . quantitative real - time pcrs amplifying the ospa gene and the p41 gene of b. burgdorferi sensu lato were negative in csf . serology for mycoplasma pneumoniae was positive in serum ( immunohistochemical assay , 1:320 ; enzyme immunoassay , borderline positive ) but not in csf . a pcr for 16s ribosomal dna was positive , and the amplicon was cloned and sequenced but revealed no mycoplasma - specific sequences . four months after the episode , serological controls revealed a non - significant rise in m. pneumoniae titer in serum ( immunohistochemical assay 1:640 ) , with persistent negative results in csf . aquaporin-4 antibodies were negative , as were antinuclear antibodies , antineutrophil cytoplasmic antibodies , anti - dna antibodies , anti - extractable nuclear antigens , hiv- , treponema- , hepatitis b and c serology , and pcr of hsv , cmv , vzv and ebv in the csf . the evoked potentials gave evidence of an affection of the central pyramidal tract and a demyelinating affection of the somatosensory afferents in both legs , while visual and acoustic evoked potentials were normal . the patient was treated with intravenous ceftriaxone 2 g / day , acyclovir 3 750 mg / day and methylprednisolone 1 g / day . the patient 's clinical status ameliorated rapidly ; she started to walk again after 1 week and was out of bed most of the day after 3 weeks . csf analysis after 7 days of treatment revealed a reduction of leukocytes to 26/l along with a reduction of the total protein to 33 mg / dl and a reconstitution of the blood - csf barrier . cytological examination of all 3 spinal csf samples showed lymphocytic pleocytosis but no lymphoblasts or other atypical cells . the csf / serum ai decreased after 7 days of treatment to 34.1 for igm and 12.7 for igg , and after a further 10 days to 17.4 for igm and 15.6 for igg . ais were negative for borrelia - specific igg and further decreased for igm ( igg negative in serum and csf , igm ai 6.5 ) after 4 months . the levels of cxcl13 were only slightly elevated in csf and did not rise in the course of the current episode ( 35 pg / ml at onset , 4.2 pg / ml after 7 days , 4.5 pg / ml after another 10 days and 4.5 pg / ml after 4 months ) , which argues against acute neuroborreliosis during this episode . on admission in march 2011 , the patient presented with a sustained gaze - evoked nystagmus to the left and an incomplete abducens nerve paralysis . the patient was not able to stand or walk , but showed moderate ataxia of all limbs . sensory testing revealed sensory deficits below dermatome c4 , with impaired discrimination of sharp and dull , and essentially no sense of vibration , temperature and position . a spinal mri scan revealed extensive signal alterations especially in the cervical , but also in the thoracic spinal cord . some of these lesions comprised 2 or more segments and involved large parts of the cord 's cross section ( fig . 1a , b ) , in combination with moderate swelling at the cervical level and a faint enhancement after intravenous gadolinium administration ( not shown ) . csf analysis revealed a predominantly lymphocytic pleocytosis of 136 leukocytes/l ; dysfunction of the blood - csf barrier , with an elevated csf / serum albumin quotient of 18.8 ; and an elevated total csf protein of 126 mg / dl . there were no oligoclonal bands , but a reiber diagram suggested intrathecal synthesis of igm ( igm quotient 11.96 , igm index 0.64 ) but not igg ( igg quotient 12.78 , igg index 0.68 ) . measles , rubella , and zoster ais ( mrz reaction < 1.3 ) were negative . csf / serum ais of 52.6 and 18.8 were highly positive for b. burgdorferi igm and igg , respectively , with a b. burgdorferi - specific igm concentration of 18.9 u / ml and an igg concentration of 1.3 u / ml in csf . western blotting was positive in csf and serum for p41- and ospc - specific igm and igg at day 1 , and revealed an additional positive osp17-igm band in serum at days 7 and 17 ( fig . quantitative real - time pcrs amplifying the ospa gene and the p41 gene of b. burgdorferi sensu lato were negative in csf . serology for mycoplasma pneumoniae was positive in serum ( immunohistochemical assay , 1:320 ; enzyme immunoassay , borderline positive ) but not in csf . a pcr for 16s ribosomal dna was positive , and the amplicon was cloned and sequenced but revealed no mycoplasma - specific sequences . four months after the episode , serological controls revealed a non - significant rise in m. pneumoniae titer in serum ( immunohistochemical assay 1:640 ) , with persistent negative results in csf . aquaporin-4 antibodies were negative , as were antinuclear antibodies , antineutrophil cytoplasmic antibodies , anti - dna antibodies , anti - extractable nuclear antigens , hiv- , treponema- , hepatitis b and c serology , and pcr of hsv , cmv , vzv and ebv in the csf . the evoked potentials gave evidence of an affection of the central pyramidal tract and a demyelinating affection of the somatosensory afferents in both legs , while visual and acoustic evoked potentials were normal . the patient was treated with intravenous ceftriaxone 2 g / day , acyclovir 3 750 mg / day and methylprednisolone 1 g / day . the patient 's clinical status ameliorated rapidly ; she started to walk again after 1 week and was out of bed most of the day after 3 weeks . csf analysis after 7 days of treatment revealed a reduction of leukocytes to 26/l along with a reduction of the total protein to 33 mg / dl and a reconstitution of the blood - csf barrier . cytological examination of all 3 spinal csf samples showed lymphocytic pleocytosis but no lymphoblasts or other atypical cells . the csf / serum ai decreased after 7 days of treatment to 34.1 for igm and 12.7 for igg , and after a further 10 days to 17.4 for igm and 15.6 for igg . ais were negative for borrelia - specific igg and further decreased for igm ( igg negative in serum and csf , igm ai 6.5 ) after 4 months . the levels of cxcl13 were only slightly elevated in csf and did not rise in the course of the current episode ( 35 pg / ml at onset , 4.2 pg / ml after 7 days , 4.5 pg / ml after another 10 days and 4.5 pg / ml after 4 months ) , which argues against acute neuroborreliosis during this episode . the differential diagnostic for the relapsing spinal syndromes of our patient comprises spinal lymphoma , a spinal manifestation of x - type histiocytosis , neuromyelitis optica , multiple sclerosis ( ms ) or a systemic autoimmune disease . as our patient presented with only spinal and brainstem symptoms and no supratentorial lesions were detectable in mri , the diagnostic criteria for ms were not fulfilled . the long asymptomatic course between relapses , the absence of atypical cells in csf , the positive response to antibiotic treatment ( even without corticosteroids in 2008 ) and the serological findings argue against lymphoma . a relapse of x - type histiocytosis after 14 years without symptoms seems very improbable as the microscopic analysis of csf revealed no evidence of histiocytes , and myelitis as a manifestation of histiocytosis is an extremely rare event , even though it has been previously reported . the severe pleocytosis and damage to the bbb argue against neuromyelitis optica , ms or vasculitis especially since the visual system was unaffected and aquaporin-4 antibodies , oligoclonal bands , mrz reaction , supratentorial mri and the laboratory screening for vasculitis were negative . the fact that a positive b. burgdorferi csf / serum ai was found in 3 out of 4 episodes and that csf pleocytosis and clinical symptoms ameliorated in response to antibiotic treatment seems to suggest recurrent episodes of neuroborreliosis . however , recurrent episodes of borreliosis and even more so neuroborreliosis after sufficient antibiotic treatment such as in this case , are very uncommon . if relapses occur , they are attributed to reinfections or relapses after inadequate antibiotic therapy . moreover , it needs to be considered that the patient did not recall any previous tick bite or erythema migrans nor does she belong to a part of the population with an increased risk for repeated tick bites . further , it remains unclear why the ai was negative during the third episode while all other signs and symptoms were similar . all 4 episodes manifested with a spinal syndrome despite the fact that b. burgdorferi myelitis represents less than 5% of cases with neuroborreliosis in larger studies [ 9 , 10 , 11 ] . positive csf / serum igg ai can be found after a successfully treated and no longer active neuroborreliosis . but we would expect continuously positive predominantly igg ais in the case of ai persistence after an acute infection or during a persisting or remitting infection involving the cns . however , this was not the case during the episode in 2008 when the ai was normal or in the current episode when ais returned to normal 3 months after the start of the episode . increasing ais are not specific for an acute borreliosis as they can also be the result of an unspecific stimulation of the immune system , e.g. by an autoimmune manifestation or a yet unidentified infection in our patient . ais are calculated as the ratio of specific to total immunoglobulins in csf divided by the ratio of specific to total immunoglobulins in serum . it is therefore possible that low concentrations of total immunoglobulins in csf give rise to positive ais at rather low specific concentrations in csf , like the borrelia - specific igg concentration of 1.3 u / ml observed in our patient . in line with this , therefore , further parameters were needed to resolve the diagnostic dilemma in this case . real - time pcr - based results for b. burgdorferi in csf are often negative , as are cultures , even in the case of active neuroborreliosis ; however , positive results can serve to ascertain the diagnosis . the level of cxcl13 in csf is a very sensitive parameter for neuroborreliosis and can be of great help , especially in complex cases like ours [ 12 , 13 ] . in several studies using the same ready - made elisa from r&d systems as in our patient , untreated neuroborreliosis could be differentiated from other neurological disorders with a high sensitivity of above 90% using cutoff values of cxcl13 concentrations in csf of 250 pg / ml , 100 pg / ml or 142 pg / ml . in a prospective trial , where a self - made elisa with different binding properties was used , a sensitivity of 94.1% and a specificity of 96.1% were obtained with a cutoff of 1,229 pg / ml , and sensitivity even reached 100% at a cutoff of 697 pg / ml . an important finding of this large trial was that the cxcl13 concentration in csf could discriminate neuroborreliosis from ms . the cxcl13 levels found in ms were only moderately elevated , like in our case . a reanalysis of the data of this prospective study revealed a negative predictive value of 99% for acute untreated neuroborreliosis ( a. plate , pers . this large body of evidence clearly indicates a good negative predictive value for the cxcl13 concentration of 35 pg / ml observed in our patient . thus , the recurrence of episodes despite sufficient antibiotic therapy and the fact that she did not recall a tick bite or erythema migrans and did not belong to a risk group for repeated tick bites strongly argue against acute neuroborreliosis as the cause of our patient 's current episode . instead , it seems most probable that our patient had suffered from neuroborreliosis in the past , e.g. when she had her first episodes of neurological symptoms in 1996 and/or 1999 , which was effectively treated and cured back then . we interpret the subsequent episodes in 2008 and 2011 as post - infectious autoimmune - mediated transverse myelitis triggered by the preceding neuroborreliosis . immune responses specific against cns proteins or myelin have been reported in csf of neuroborreliosis patients [ 17 , 18 , 19 , 20 , 21 , 22 ] , and post - infectious autoimmune mechanisms following lyme borreliosis have been discussed for arthritis and autoimmune polyneuropathy [ 23 , 24 ] . so an autoimmune mechanism caused by molecular mimicry seems a plausible explanation for the relapsing events of myelitis observed in our patient . the fact that she recovered in 2008 even without steroid treatment does not argue against an autoimmune transverse myelitis , as these disorders are also known to show spontaneous remissions , albeit with a slower recovery than with steroid treatment . also , the fact that we did not observe more bands in the b. burgdorferi western blot in csf and serum argues against a persistent and relapsing neuroborreliosis , in which we would expect more bands , particularly igg . the findings are in line with our assumption that our patient had contact with b. burgdorferi before , possibly even neuroborreliosis during one of the first episodes . thus , the bands detectable in csf and serum during the fourth episode would have been caused by a persistence of specific b cells , which are stimulated in the context of the presumed autoimmune event . taken together , our case highlights the diagnostic challenges that may occur in patients with inflammatory lesions of the spinal cord and/or positive b. burgdorferi serology .

we report the case of a 31-year - old woman with 4 episodes of myelitis with pleocytosis , a positive borrelia burgdorferi serology with positive antibody indices , and full recovery each time after antibiotic and steroid treatment , suggesting neuroborreliosis . we nevertheless believe that recurrent neuroborreliosis is improbable based on the levels of the chemokine cxcl13 in cerebrospinal fluid and favor the diagnosis of post - infectious autoimmune - mediated transverse myelitis possibly triggered by an initial neuroborreliosis as the cause of the relapses observed in our patient . we demonstrate the diagnostic steps and procedures which were important in the differential diagnosis of this unusual and challenging case .

acne vulgaris is a chronic inflammatory disorder of the pilosebaceous unit that affects almost all individuals during adolescence , being moderate to severe in 1520% of cases . underlying aetiological factors include increased sebum production , propionibacterium acnes colonisation , follicular hyperkeratosis and inflammation . scarring is one of the most enduring sequelae of acne and it is associated with profound psychosocial morbidity . in patients with active acne , up to 95% of individuals are reported to demonstrate some degree of facial scarring , with delayed treatment and severity of acne associated with the extent and severity of scarring . acne scarring has previously been categorised into increased tissue formation ( including hypertrophic and keloid scars ) and loss of tissue ( including the entities of ice pick , rolling and boxcar scars ) , with each subcategory of scar requiring nuanced therapeutic approaches . amongst adolescents with acne vulgaris , we have empirically observed a subphenotype of scarring following acne vulgaris , comprising multiple non - scaling skin - coloured soft fibrous papules , all 24 mm in diameter , distributed typically over the nasal skin and the chin . we aimed to further characterise these soft papular acne scars of the nose and chin , which are phenotypically distinct from the previously described subtypes of acne scarring . initially , a series of patients with papular acne scars of the nose and chin were identified in a cosmetic dermatology clinic . to establish the prevalence and characteristics of these papular scars in the acne population , we prospectively evaluated 100 consecutive patients attending our tertiary referral acne isotretinoin clinic , in whom patients are all judged to have acne for which isotretinoin is indicated . typically , patients are referred to this clinic in view of disease recalcitrant to topical therapy and systemic antibiotics or who have evidence of scarring . we subsequently analysed a further 49 patients with acne attending general dermatology clinic to see whether the prevalence of soft papular scars of the nose and chin may be different in this group of patients . initially , 14 cases of papular scarring were identified in a cosmetic dermatology clinic , to which patients attend for improvement of their acne scarring . soft papular scars affected the nose in ten cases [ figure 1a and b ] , the chin in four cases [ figure 2a and b ] and both sites in one case . of the 14 patients , 2 were female . histological examination of a representative lesion from one patient showed fibrous scarring together with a few ectatic blood vessels and mild chronic inflammation [ figure 3 ] . we estimated that these papules were being seen in 1015% of the patients with acne scarring attending the cosmetic dermatology clinic . ( a and b ) representative examples of papular acne scars of the nose ( a and b ) representative examples of papular acne scars of the chin histology of representative lesion on nose showing superficial dermal fibrosis , mild vascular ectasia and perivascular chronic inflammation ( h and e , 10 ) of the 100 consecutive patients attending the tertiary referral acne isotretinoin clinic ( median age : 22 years , range : 1462 years , 40% male ) , soft papular scars of the nose and chin were noted in two patients ( 2% ) . both were male , aged 23 ; one of whom had additional boxcar scars and the other had both boxcar and ice pick scars . baseline characteristics of the 49 patients with acne attending the general dermatology clinic showed a median age of 23 years ( range : 1448 years ) , 15 ( 31% ) were male , median age of acne onset was 15 , 21 ( 43% ) had evidence of other acne scar variants , 31 ( 63% ) had active acne and 39 ( 80% ) were receiving or had received isotretinoin therapy . of these patients , a 24-year - old female had soft papular scars over the chin and boxcar scars over the cheeks and a 19-year - old male also had soft papular scars on the nose , with no evidence of scarring elsewhere . to our knowledge , this is the first series of patients described and characterised with soft papular acne scars of the nose and chin . there appears to be a distinct male proclivity and anatomical predilection for the nose and chin . one study of 185 patients in the uk suggests that up to 95% of patients with active acne have evidence of facial scarring . a larger study of 973 patients suggested that 55% of patients have clinically relevant scarring on the face , 14% scarring on the chest and 24% scarring on the back . the proportion of patients with scarring in our clinic appears to be lower ( 43% ) than previously reported , in part attributable to different populations being sampled , who may be referred to our clinic at an earlier stage , and perhaps owing to the subjective nature of scar assessment . papular scars as a distinct entity have been reported recently , but without description of individual patients , epidemiology or concurrent clinical features . our findings are in keeping with the previous authors description of papular scars occurring most commonly on the nose and chin . furthermore , we suggest that soft papular scars may occur more commonly in males and more frequently in individuals with other demonstrable acne scars . previous descriptions of predominantly truncal papular acne scars ( on the back ) are now more commonly recognised as elastolytic scars and are clinically and histologically distinct to the entity we are describing . we hypothesise that pathogenesis of soft papular acne scars of the nose and chin is related to mismatch in the ratio of matrix metalloproteases ( mmps ) to tissue inhibitors of mmps produced by fibroblasts and keratinocytes during the scarring process that follows resolution of inflammatory acne . we acknowledge the difficulty in extrapolating epidemiological details of papular acne scars of the nose and chin from the cases we report , and that our data are partly dependent on our subjective judgement . while biopsy of all patients with papular scars is academically desirable , we feel that this may not always be in the clinical interest of our patients . in addition , insufficient time has elapsed to provide useful longitudinal data relating to the prognosis and effectiveness of treatment modalities for these scars . we also acknowledge that patients referred to secondary or tertiary care dermatology clinics and those seeking treatment for acne scarring typically would have had acne recalcitrant to topical therapies or systemic antibiotics , so they may represent a more severe subgroup of patients . furthermore , the patients reported are not representative of the global population of acne patients , as patients who are being seen depends upon those patients who actively seek treatment , the likelihood of primary care physicians to refer rather than a true cross - population sample . we have reported the first series of patients with papular acne scars of the nose and chin and proposed that this under - recognised stratum of acne scarring should be added to categorisation schemes . future work should include corroborative investigation of epidemiology and pathophysiology and evaluation of the most effective treatment modalities . we have identified 18 new patients with popular acne scars of the nose and chin and propose that this new category should be added to acne scarring classification schemes . future work should be directed at corroborating the epidemiology of such lesions and describing effective treatment modalities .

background : scarring following acne vulgaris is common and can be of profound psychosocial consequence.aims and objectives : we have clinically noted a variant of acne scarring , overlooked by previous categorisation schemes , which we have denominated as papular acne scars of the nose and chin . we sought to characterise these novel entities further.materials and methods : initially , we identified 14 patients with papular acne scars of the nose and chin in a cosmetic dermatology clinic , of whom two were female and rest were male . we then prospectively evaluated 100 consecutive patients attending our tertiary referral acne isotretinoin clinic and 49 patients attending a general dermatology clinic.results:amongst 149 patients , from a general dermatology and tertiary acne clinic , soft papular scars were noted in four patients , distributed on the nose and chin . three of the four patients were male , three patients had additional acne scars and the median age was 23.5.conclusions:we have identified 18 patients with papular acne scars of the nose and chin and propose that this new category should be added to acne scarring classification schemes . future work should be directed at corroborating the epidemiology of such lesions and describing effective treatment modalities .

acute poisoning in children is still an important public health problem and represents a frequent cause of admission in emergency units . the incidence of childhood poisoning in various studies ranges from 0.33% to 7.6% [ 1 , 2 ] . poisoning is most commonly observed at 15 years of age and these children constitute 80% of all poisoning cases [ 3 , 4 ] . in the first year of life , the main causes of poisoning are medications given by parents . at 23 years of age , house cleaning products cause most cases of poisoning , at 35 years of age , the medications kept in the cupboard or left open are the main causes of poisoning , and at school age and during adolescence , medications used for committing suicide are the main cause of poisoning . the mortality rate due to poisoning is 35%[1 , 2 , 4 ] . the pattern and main risks of acute poisoning change with time according to age , and they differ from country to country . thus epidemiological surveillance specific for each country is necessary to determine the extent and characteristics of the problem , according to which related preventive measures can be taken . the purpose of this study was to describe the epidemiology , pattern , duration and the results of treatment of poisoned patients who were admitted to a pediatric referral hospital . the present retrospective study describes the epidemiology of a pediatric population with accidental and suicidal poisonings admitted to the pediatric emergency department of eskisehir osmangazi university hospital , which is a tertiary hospital in central anatolia providing health care for at least 4 cities , during the year 2009 . all pediatric patients under 17 years of age presenting to the emergency department from january to december 2009 were investigated retrospectively . data were obtained by individual examination of the files , transferred to standard forms and submitted to statistical analysis . the age and sex of the patients , duration between ingestion of poison and admission to hospital , manner of poisoning , poison agents , and duration of hospitalization are evaluated . in statistical evaluation , chi square , pearson correlation analysis and variance analysis were employed in the analysis of the data . complete clinical data were obtainable only for 281 patients . the poisoned patients represented 2.31% ( 281/12150 ) of overall emergency unit visits during the year 2009 . the patients consisted of 136 ( 48.4% ) boys and 145 ( 51.6% ) girls . one hundred and thirty eight children , forming 49.1% of all patients , were under four years of age . ninety nine patients were over 10 years of age ( 35.2% of all patients ) . according to age groups , in the poisoned patients under 4 years of age , male to female ratio was significantly higher when compared with the other age groups ( =21.6 , p<0.001 ) . seventy two cases of poisoning occurred as suicide attempts and 73.6% ( n=50 ) of those patients were girls . the age of 97.2% ( n=70 ) of patients attempting suicide was over 9 years . one case was poisoned due to overdose of chloral hydarte used for sedation during magnetic resonance imaging and the other case by pseudoephedrine overdose . manner of poisoning according to age groups the most common route of poisoning was the ingestion of poison in 243 ( 86.5% ) patients . poisoning occurred mostly in winter and peak ( 12.8% ) of poisoning was observed in january . 1 ) . monthly distribution of acute poisoning of all cases referred to emergency unit 70.8% arrived within the first two hours and 95.7% in the first six hours following poisoning . parents of only 95 ( 33.3% ) children were aware that their children were poisoned because they had been witnesses of the event . nausea and vomiting was the most common complaint of cases at presentation to hospital ( 42.3% , n=119 ) , followed by unconsciousness ( 18.1% , n=51 ) . after stabilization of patient 's condition a detailed history was obtained . if parents stated that the child had been poisoned , medical treatment was initiated immediately . if the child had no poisoning history , or signs and symptoms of other diseases were present , toxicological studies were undertaken including blood and urine panels . drugs were the most common agents causing poisoning ( 48.4% , n=136 ) , followed by ingestion of corrosive substances ( 23.1% , n=65 ) , carbon monoxide ( co ) intoxication ( 12.5% , n=35 ) , hydrocarbons ( 5.7% , n=16 ) , insecticides ( 3.9% , n=11 ) , plants ( 3.9% n=11 ) and alcohol ( 2.5% , n=7 ) . among poisonings caused by drugs 38.9% ( n=53 ) of cases were due to multiple medications . methylphenidate ( 17.6% n=24 ) and analgesics ( 14.7% , n=20 ) were other common medications ( table 2 ) . poisoning caused by corrosive substances was more common in children under 4 years of age ( 72.3% , n=47 ) than in other age groups . agents causing poisoning in most of cases , treatment was non - specific , including general decontamination and supportive - symptomatic therapy . identification and documentation of epidemiological aspects and other variables in childhood poisoning are of great importance for treatment plan and determination of proper preventive measures . eskisehir osmangazi university hospital is the biggest referral hospital for children in central anatolia , turkey . the percentage of pediatric emergency service admission for poisoning was 0.28% to 0.66%[67 ] . according to these findings andiran and sarikayalar found that in 489 poisoning cases poisonings < 10 years of age were more frequent in males whereas poisonings > 10 years of age were more common in females . in several studies , it has been reported that 51.4%73.3% of all poisoning cases observed in turkey involved children < 5 years of age [ 4 , 5 , 8 , 9 ] . the present study showed that approximately half of the patients were less than four years old . in this age group , males were predominant . ozdogan et al found that the highest incidence of poisoning was in age group 13 months to 4 years . in this age group , putting small foreign objects like drugs into mouth by children can cause poisoning . as in the literature , our research revealed that the most common ( 86.5% ) route of poisoning was the ingestion of poison ; drugs are the most common agent of poisoning in all ages . medications are the most common poisonous agent in children [ 15 ] . in our study 48.4% of all poisonings were due to drugs . methylphenidate , one of the first treatment modalities used in attention deficit hyperactivity disorder , was the second common cause of drug related poisonings . this might be related with relatively high prevalence of attention deficit hyperactivity disorder , with an estimated rate of 3% to 6% of school - aged children . with increasing therapeutic use of methylphenidate , the potential exists for an associated increase in its adverse effects and poisoning . according to our best knowledge this is the first report in which methylphenidate is found to be the second common drug responsible for poisoning in children . carbon monoxide intoxication was found in 12.5% of all cases . carbon monoxide ( co ) poisoning is one of the most common causes of morbidity and mortality due to poisoning in turkey and all over the world . the frequency of co poisoning has been reported between 3.613.2% among childhood poisonings and between 58.275% among fatal childhood poisonings . the major sources of co are faulty furnaces , inadequate ventilation of heating sources , and exposure to engine exhaust gases . mild clinical signs and symptoms associated with co poisoning are headache , dizziness , weakness , lethargy , and myalgia ; however , severe signs and symptoms such as blurred vision , syncope , convulsion , coma , cardiopulmonary arrest and death can also accompany co poisoning . because of these various signs and symptoms , blood gas analysis must be performed in every child presented with unconsciousness . we retrospectively searched the emergency unit admissions during a year and found that most admissions were in january . we speculate that during winter children spent much more time in closed places where drugs are accessible . in general , it was reported that the incidence of adolescent suicides in turkey was between 5.1% and 16.3% [ 4 , 8 ] . suicide is not only a problem in developing countries but more in developed countries . in usa , suicide is the third most common cause of death in adolescents . it can also be associated with the strict forbiddance of suicide by islam , the religious practice of the majority of our population . in turkey , the present study showed that 73.3% of all poisonings were accidental and only 25.6% occurred as suicide attempt . gastric lavage was performed in 41.2% of the patients in this study , although 70.8% of all cases came to emergency unit within the first two hours . hyperbaric oxygen was given to 12 children poisoned with co who had carboxyl hemoglobin levels over 25% . . the mortality rate due to acute poisoning ranges from 7.6% to 0.4% in literature[1 , 2 , 4 ] . this relatively good prognosis might be attributed to the fact that 95.7% of our cases visited emergency unit within 2 to 6 hours following poisoning . so , it is possible that not all medical data have been recorded into the files of patients in emergency unit . the patients consisted of 136 ( 48.4% ) boys and 145 ( 51.6% ) girls . one hundred and thirty eight children , forming 49.1% of all patients , were under four years of age . ninety nine patients were over 10 years of age ( 35.2% of all patients ) . according to age groups , in the poisoned patients under 4 years of age , male to female ratio was significantly higher when compared with the other age groups ( =21.6 , p<0.001 ) . seventy two cases of poisoning occurred as suicide attempts and 73.6% ( n=50 ) of those patients were girls . the age of 97.2% ( n=70 ) of patients attempting suicide was over 9 years . one case was poisoned due to overdose of chloral hydarte used for sedation during magnetic resonance imaging and the other case by pseudoephedrine overdose . the most common route of poisoning was the ingestion of poison in 243 ( 86.5% ) patients . poisoning occurred mostly in winter and peak ( 12.8% ) of poisoning was observed in january . of all cases referred to emergency unit 70.8% arrived within the first two hours and 95.7% in the first six hours following poisoning . parents of only 95 ( 33.3% ) children were aware that their children were poisoned because they had been witnesses of the event . nausea and vomiting was the most common complaint of cases at presentation to hospital ( 42.3% , n=119 ) , followed by unconsciousness ( 18.1% , n=51 ) . after stabilization of patient 's condition a detailed history was obtained . if parents stated that the child had been poisoned , medical treatment was initiated immediately . if the child had no poisoning history , or signs and symptoms of other diseases were present , toxicological studies were undertaken including blood and urine panels . drugs were the most common agents causing poisoning ( 48.4% , n=136 ) , followed by ingestion of corrosive substances ( 23.1% , n=65 ) , carbon monoxide ( co ) intoxication ( 12.5% , n=35 ) , hydrocarbons ( 5.7% , n=16 ) , insecticides ( 3.9% , n=11 ) , plants ( 3.9% n=11 ) and alcohol ( 2.5% , n=7 ) . among poisonings caused by drugs 38.9% ( n=53 ) of cases were due to multiple medications . methylphenidate ( 17.6% n=24 ) and analgesics ( 14.7% , n=20 ) were other common medications ( table 2 ) . poisoning caused by corrosive substances was more common in children under 4 years of age ( 72.3% , n=47 ) than in other age groups . in most of cases , treatment was non - specific , including general decontamination and supportive - symptomatic therapy . acute poisoning is one of the important causes of emergency unit admissions . identification and documentation of epidemiological aspects and other variables in childhood poisoning eskisehir osmangazi university hospital is the biggest referral hospital for children in central anatolia , turkey . the percentage of pediatric emergency service admission for poisoning was 0.28% to 0.66%[67 ] . according to these findings andiran and sarikayalar found that in 489 poisoning cases poisonings < 10 years of age were more frequent in males whereas poisonings > 10 years of age were more common in females . in several studies , it has been reported that 51.4%73.3% of all poisoning cases observed in turkey involved children < 5 years of age [ 4 , 5 , 8 , 9 ] . the present study showed that approximately half of the patients were less than four years old . in this age group , males were predominant . ozdogan et al found that the highest incidence of poisoning was in age group 13 months to 4 years . in this age group , putting small foreign objects like drugs into mouth by children can cause poisoning . as in the literature , our research revealed that the most common ( 86.5% ) route of poisoning was the ingestion of poison ; drugs are the most common agent of poisoning in all ages . medications are the most common poisonous agent in children [ 15 ] . in our study 48.4% of all poisonings were due to drugs . methylphenidate , one of the first treatment modalities used in attention deficit hyperactivity disorder , was the second common cause of drug related poisonings . this might be related with relatively high prevalence of attention deficit hyperactivity disorder , with an estimated rate of 3% to 6% of school - aged children . with increasing therapeutic use of methylphenidate , the potential exists for an associated increase in its adverse effects and poisoning . according to our best knowledge this is the first report in which methylphenidate is found to be the second common drug responsible for poisoning in children . carbon monoxide ( co ) poisoning is one of the most common causes of morbidity and mortality due to poisoning in turkey and all over the world . the frequency of co poisoning has been reported between 3.613.2% among childhood poisonings and between 58.275% among fatal childhood poisonings . the major sources of co are faulty furnaces , inadequate ventilation of heating sources , and exposure to engine exhaust gases . mild clinical signs and symptoms associated with co poisoning are headache , dizziness , weakness , lethargy , and myalgia ; however , severe signs and symptoms such as blurred vision , syncope , convulsion , coma , cardiopulmonary arrest and death can also accompany co poisoning . because of these various signs and symptoms , blood gas analysis must be performed in every child presented with unconsciousness . we retrospectively searched the emergency unit admissions during a year and found that most admissions were in january . we speculate that during winter children spent much more time in closed places where drugs are accessible . in general , it was reported that the incidence of adolescent suicides in turkey was between 5.1% and 16.3% [ 4 , 8 ] . suicide is not only a problem in developing countries but more in developed countries . in usa it can also be associated with the strict forbiddance of suicide by islam , the religious practice of the majority of our population . in turkey , the present study showed that 73.3% of all poisonings were accidental and only 25.6% occurred as suicide attempt . gastric lavage was performed in 41.2% of the patients in this study , although 70.8% of all cases came to emergency unit within the first two hours . hyperbaric oxygen was given to 12 children poisoned with co who had carboxyl hemoglobin levels over 25% . . the mortality rate due to acute poisoning ranges from 7.6% to 0.4% in literature[1 , 2 , 4 ] . this relatively good prognosis might be attributed to the fact that 95.7% of our cases visited emergency unit within 2 to 6 hours following poisoning . so , it is possible that not all medical data have been recorded into the files of patients in emergency unit . preventable accidental poisonings are still a significant cause of morbidity among children in developing countries . drugs and corrosive agents are the most frequent agents causing poisoning .

objectiveacute poisoning in children is still an important public health problem and represents a frequent cause of admission in emergency units . the epidemiological surveillance specific for each country is necessary to determine the extent and characteristics of the problem , according to which related preventive measures can be taken.methodsthe present retrospective study describes the epidemiology of accidental and suicidal poisonings in a pediatric population admitted to the pediatric emergency department of eskisehir osmangazi university hospital during the year 2009.findingstwo hundred eighteen children were reffered to the emergency department due to acute poisoning . 48.4% of patients were boys and 51.6% were girls . the majority of cases were due to accidental poisoning ( 73.3% of all patients ) . drugs were the most common agent causing the poisoning ( 48.3% ) , followed by ingestion of corrosive substance ( 23.1% ) and carbon monoxide ( co ) intoxication ( 12.5% ) . tricyclic antidepressant was the most common drug ( 11.7% ) . methylphenidate poisoning , the second common drug . 262 patients were discharged from hospital within 48 hours.conclusionpreventable accidental poisonings are still a significant cause of morbidity among children in developing countries . drugs and corrosive agents are the most frequent agents causing poisoning .

the most common location for this tumour is distal femur , followed by proximal tibia and distal radius ( the third most common location ) . we report an unusual case of gct of capitate in a 20 year female patient . a 20 year old female patient presented with history of pain in the left wrist of 6 months duration . she was diagnosed to be having gct of capitate which was successfully treated with curettage , phenol ablation and bone grafting . at the end of 1 year , patient was symptom free and near normal range of movements and with no evidence of recurrence . this case report emphasizes the rarity of the lesion with only few cases reported in literature . giant cell tumours are one of the commonest benign tumours of the bone , constituting approximately 5% of all primary bone tumours . they typically occur in patients 20 to 40 years old , and there is a slight female predominance [ 1 - 2 ] . occurrence in the hand , however , particularly in the carpal bones , is rare . we report a rare case of gct of capitate in a 21 year old female patient . a 20 year old female student , presented with the history of pain in the left wrist of 6 months duration . on examination there was fullness and tenderness present over the dorsum of the wrist with painful palmarflexion and dorsiflexion of the wrist . there was decrease in terminal 10 range of motion of the wrist joint compared to normal wrist . radiograph of the left wrist posteroanterior and lateral view showed a lytic lesion in the capitate bone with thinned out cortex ( fig . 1 ) . computed tomography ( ct scan ) of the wrist revealed a non expansile lytic lesion in the left capitate . there was no evidence of other carpal bone or joint involvement ( fig 2 ) . differential diagnosis at the end of imaging study included aneurismal bone cyst ( abc ) , giant cell tumour ( gct ) and enchondroma . plain radiograph of wrist showing lytic lesion in capitate ct scan wrist showing lytic lesion in capitate patient underwent incisional biopsy of the left capitate through a dorsal approach ( fig . 3 ) . histopathological examination of the specimen showed multinucleated osteoclast like giant cells and spindle cells stroma with plumpy nuclei consistent with the gct ( fig . one week later the lesion was curetted , followed by phenol ablation and cancellous bone grafting from the patient s iliac crest . intra operative picture showing cavity in capitate after extended curettage of the lesion histopathalogical photomicrograph showing multinucleated giant cell ( arrow ) patient was followed up clinically and radiologically at regular intervals of 6 weeks , 3 months , 6 months and 1 year . at the end of 1 year follow up , patient was symptom free and near normal range of movements and with no evidence of recurrence ( fig . giant cell tumours usually are solitary lesions however , 1% to 2% may be multicentric . occurrence in the hand , however , particularly in the carpal bones is rare , with a number of reports describing cases in the scaphoid , capitate [ 4 , 5 ] , lunate , hamate [ 7 - 9 ] and trapezium averill et al reviewed 28 giant cell tumours in the hand . howard and lassen reported a single case of giant cell tumour of the capitate and reported finding only five additional cases of giant cell tumour of the carpal bones in the literature . radiographically , giant cell tumours in the carpal bones resemble other lytic lesions of bone . the radiologic differential diagnosis of solitary lesions includes aneurysmal bone cyst , enchondroma , giant cell reparative granuloma , brown tumour of hyperparathyroidism , post - traumatic cyst , primary malignant bone tumors such as chondrosarcomas , osteosarcomas and metastasis [ 15 - 17 ] . of these , brown tumour is the easiest to rule out in the absence of other changes of hyperparathyroidism . in a younger individual giant cell reparative granuloma are very similar to the solid variant of aneurysmal bone cysts and may be considered non neoplastic and reactive . these appear similar on histologically and even the treatment of curretae and bone grafting is recommended for both the entities [ 18 - 20 ] . some studies have noted that gct of hand is more frequently seen in younger individuals as in our case also another difference between hand gct and gct in other parts of the body is its centra location as oppose to eccentric location in other bones . this is probably related to the small volume in the hand bones where the lesion might begin eccentrically but by the time it is diagnosed , it is occupying a more central position in the bone . gct of hand skeleton is more aggressive than other locations and is mostly multifocal [ 15 , 20 ] . as these are rare tumors , there is no standard protocol for treatment of these lesions . all kinds of procedures like intralesional , marginal or wide resection are reported for treatment of these lesions . uses of adjuvents like cryotherapy and phenol ablation are reported to be useful . a high recurrence rates upto 87% was reported after curettage and bone grafting , however this may just indicate difficulty in complete curettage of the lesions in small bones and may not be an indicator of aggressiveness of these tumors . we believe with proper curettage and use of adjuvant these lesions can be treated with minimal complication and good functional results . gct of the capitate is a rare lesion , however proper diagnosis and management yields good results . this case report emphasizes the rarity of the lesion with only few cases reported in literature . gct of small bones like capitate when treated with extended curettage ( use of adjuvants ) and bone grafting leads to good healing of the lesion .

introduction : giant cell tumors ( gct ) of bone are not uncommon . the most common location for this tumour is distal femur , followed by proximal tibia and distal radius ( the third most common location ) . gct of small bone is a rare presentation . occurrences in the hand , however , particularly in the carpal bones are rare . we report an unusual case of gct of capitate in a 20 year female patient.case presentation : a 20 year old female patient presented with history of pain in the left wrist of 6 months duration . she was diagnosed to be having gct of capitate which was successfully treated with curettage , phenol ablation and bone grafting . at the end of 1 year , patient was symptom free and near normal range of movements and with no evidence of recurrence.conclusion:giant cell tumors usually are solitary lesions . occurrence in the hand , particularly in the carpal bones is rare . this case report emphasizes the rarity of the lesion with only few cases reported in literature .

to reduce the risk for importation and subsequent spread of arboviruses in taiwan , active ( e.g. , fever screening at airports and expanded screening for contact with confirmed cases ) and passive ( e.g. , clinician- or hospital - based ) surveillance systems were implemented by the central and local health departments . serum samples from persons with suspected cases were submitted to the taiwan centers for disease control ( taipei , taiwan ) for confirmation of arboviral infection . because symptoms of different arboviral infections might be similar , we performed multiplex real - time reverse transcription pcr ( rt - pcr ) with flavivirus consensus primers , alphavirus consensus primers , and virus - specific primers and chikv and dengue virus igm and igg elisas for samples collected from all persons with suspected arboviral infections ( 6,7 ) . chikv infection was confirmed by detection of chikv rna , isolation of chikv , seroconversion , or > 4-fold increase in igm or igg titers against chikv in paired serum samples ( 8) . an imported case of chikungunya was defined as disease in an infected patient who had been traveling abroad > 2 weeks before onset of illness . a total of 78 laboratory - confirmed chikungunya patients who satisfied the definition of an imported case were identified during 20062014 . among these patients , 6 persons had suspected chikv infections and 4 had suspected chikv and dengue virus infections . we determined frequencies of imported chikungunya cases by year and country of origin ( table 1 ) . the most frequently reported countries of origin were indonesia , the philippines , and malaysia . * values in parentheses indicate number of east / central / south african genotypes , asian genotypes , and unidentified chikungunya virus strains , respectively , identified in each country per year . we found no clear seasonal difference in importation frequency among chikungunya cases ( technical appendix figure ) . most ( 57/78 , 73% ) cases were identified by screening for fever at airports , and 86% ( 67/78 ) were reported < 7 days of illness onset . main purposes of travel were business trips of foreign workers , tourism , and family visits ( table 2 ) . nucleotide sequences of complete structural protein genes c - e3-e2 - 6k - e1 ( capsid envelope6k ) of 56 imported chikv strains were analyzed . a phylogenetic tree was generated by using the maximal - likelihood method and a general time - reversible model in mega version 6 ( http://www.megasoftware.net/ ) ( 9 ) . the ecsa genotype was the most common genotype of imported chikv strains before 2010 ; strains with this genotype were mainly from bangladesh , malaysia , india , and thailand . the asian genotype was the most common genotype after 2011 ; strains with this genotype were mainly from indonesia , the philippines , and singapore ( table 1 ) . a phylogenetic tree of asian genotype strains was constructed ( figure , panel a ) . phylogenetic analysis of chikungunya virus ( chikv ) isolates from imported cases of chikungunya in taiwan , 20062014 . trees show genetic relationships of the east / central / south african genotype ( a ) and asian genotype ( b ) of chikv isolates ; clusters are shown in panel b. trees were generated by using nucleotide sequences ( 3,747 bp ) of complete structural protein genes c - e3-e2 - 6k - e1 ( capsid envelope6k ) of chikv strains . viruses are identified by virus / country / strain / year of isolation / genbank accession no . fj807886fj807895 , fj807898 , fj807899 , eu192142 , eu192143 , hm067743 , hm067744 , and ku561427ku561466 . analysis was performed by using mega version 6 software ( http://www.megasoftware.net/ ) and the maximal - likelihood method ( general time - reversible model ) . these data suggest that strains from indonesia have shifted from cluster 1 to cluster 3 in recent years . a phylogenetic tree of chikv strains with the ecsa genotype was constructed ( figure , panel b ) . a total of 18 imported chikv strains from india and southeast asia also had the ecsa genotype . all of these strains were grouped together and are closely related to strains from islands in the indian ocean . although most isolates from indonesia had the asian genotype , there were 6 e1226v variants imported from indonesia during 20092010 that had the ecsa genotype . relevant amino acid changes in complete structural proteins of imported chikv strains are shown in the technical appendix table . a total of 78 imported chikungunya cases were identified in taiwan during 20062014 . with the exception of 1 imported chikungunya case from guatemala , the location of these countries reflects the frequency of air travel between taiwan and these countries and might also reflect the frequency and intensity of chikungunya outbreaks in these countries during the same period . chikv has caused major outbreaks in southern and southeast asia since late 2005 ( 1014 ) . our results are consistent with the ecsa genotype being prevalent in singapore , indonesia , malaysia and thailand during 2006 2010 . we found that the e1 - 226v variants of the ecsa genotype were imported from indonesia in 2009 ( 15 ) . our data are concordant with the chikungunya epidemic status in southeast asia , including indonesia and the philippines , in recent years ( 12,13 ) . however , the low number of imported chikungunya cases in taiwan does not allow for a meaningful statistical analysis . because symptoms of many arboviral infections are similar , surveillance strategies in taiwan for different arboviruses are also similar . most of the confirmed chikungunya cases were initially reported as suspected dengue cases , which indicates that it is necessary to perform diagnostic tests for chikungunya and dengue in suspected cases . during 20062014 , a total of 36,150 suspected cases of arboviral infections were initially screened for chikv by rt - pcr and igm / igg elisa ( using the first blood sample ) . most case - patients were in the acute phase of the disease . among the remaining suspected case - patients , results suggested that the positive rate for chikv ( 78/36,150 , 0.22% ) was low among persons with suspected cases of arboviral infection . , this testing could lead to a lower rate of laboratory - confirmed chikungunya cases because there was limited serologic testing completed for paired serum samples . in addition , the population not captured ( e.g. , those with subclinical or nonacute infections ) could result in an underestimation of the number of imported chikungunya cases . to prevent spread of arbovirus diseases , well - organized integrated disease and vector surveillance systems must be properly implemented and executed . detection of imported chikungunya cases by active and passive surveillance at an early stage is needed to implement early response activities and reduce risk for local transmission .

we identified 78 imported chikungunya cases in taiwan during 20062014 . sixty - six ( 84.6% ) cases were initially suspected to be dengue , which indicates the necessity for laboratory diagnostics in differentiation between dengue and chikungunya . results also emphasize the need for active surveillance of febrile illness at points of entry .

estrogens are critical in the physiology of the female reproductive system , the maintenance of bone density , and cardiovascular health [ 1 , 2 ] . estrogen receptors are classified into two isoforms , er and er , both of which are members of the nuclear receptor superfamily of ligand - modulated transcription factors [ 3 , 4 ] . when the natural ligand estradiol or other ligands bind to er , complex signaling networks lead to a conformational change , specifically in the activation function ( af)-2 helix ( h12 ) , allowing estradiol to bind to chromatin ; this , in turn , activates or inhibits responsive genes [ 5 , 6 ] . er and er are the targets of pharmaceutical agents used to fight cancers of the reproductive organs , for example , prostate , uterine , and breast cancer [ 6 , 7 ] . these pharmaceutical agents are divided into three distinct categories : ( i ) receptor agonists such as 17-estradiol , the estrogen receptor 's natural ligand ; ( ii ) antiestrogens , such as the compound ici 164,384 [ 5 , 8 ] ; and ( iii ) raloxifene ( arylbenzothiophene ) [ 5 , 9 ] and tamoxifen , both of which act as agonists as well as antagonists . raloxifene ( compound 25 in table 1 ) is a selective estrogen receptor modulator ( serm ) providing a safer alternative to estrogen because it is an er antagonist in mammary tissue and the uterus and also mimics the agonist effects of estrogen on bone and in the cardiovascular system . food and drug administration ( fda ) recently approved raloxifene for the treatment of osteoporosis , and it is also being tested as a preventive drug against breast cancer and coronary heart disease [ 5 , 9 ] . because drug resistance and serious side effects , such as venous thromboembolism and fatal stroke , have been reported , there is a crucial need for new therapeutic agents . two major strategies to achieve this are indirect ligand - based and direct receptor - based approaches , both of which could provide a deeper understanding of the structure - activity associations , thereby enabling the development of new compounds with increased activity and selectivity profiles for specific therapeutic targets . support vector machine ( svm ) is a statistic approach developed for classification and regression . when this tool is applied to the regression , it is commonly called support vector regression for clarity . because of its prominent prediction and generalization capability , it is widely adopted in various fields . lately it has been applied to qsar field in evaluating physicochemical parameters such as solubility , lipophilicity , polarity , and steric properties and further predicting affinity [ 1418 ] . the linear regression model seeks a linear combination for input variables x = ( x 1 , x 2 , , x d ) that best fits the target variable t. the model can be formulated as t = y + = w 0 + w 1 x 1 + w 2 x 2 + +w d x d + , where variable y is the predicted value and is the prediction error . , w d are associated with x 1 , x 2 , , x d , and the parameter w 0 imposes an offset on the model . a number of models capable of predicting the inhibitory activity of 68 raloxifene derivatives were constructed . 3d - qsar models , adopting the widely used approaches comfa [ 20 , 21 ] and comsia , provide spatially specific pharmacophoric features for future synthesis . 2d - qsar models on the base of physicochemical descriptors selected by svr and lr methods were also performed to seek an alternative approach in relating structural features to affinity between er and the raloxifene derivatives . in all , this information provides clear guidelines for the synthesis of additional compounds accelerating combinatory chemistry in the development of new drugs . this study considered 68 compounds of raloxifene derivatives in a core of aryl - benzothiophene . structural information and bioactivity associated with mcf-7 cells are listed in table 1 . in 3d - qsar modeling , 56 compounds formed a training set and 10 compounds formed a test set to externally examine the models . compounds 9 and 37 , both with estimated ic50 = 1000 nm , were removed because they were always outliers in the training or test set , and retaining them made the models unacceptably unstable . it is likely that their exact ic50 values lie somewhere between 600 and 1000 nm . the test set compounds and compounds not included in modeling are marked in table 1 . in svr and lr modeling , all 68 compounds were included to choose descriptors for model construction . gasteiger - hckel charge assignment and a tripos force field were used to prepare the structure of the compound . the geometry of each arylbenzothiophene derivative was minimized using the simplex algorithm followed by the powell algorithm to an energy convergence criterion of 0.05 kcal / mol . the alignment of compounds is an essential step in determining the structure - activity relationship because the maximized overlap of pharmacophoric features responsible for producing a biological response greatly increases the correlation between structure and activity . a ligand - based approach was adopted in this study , in which each compound in its energetically minimized geometry was aligned according to the core structure , as illustrated in figure 1(a ) . it is notable that the 68 compounds were aligned in 3d space such that most of structural features common to all of the compounds had the same cartesian coordinates . this study used molecular modeling software sybyl 8.1 ( tripos international , st louis , mo ) for the comfa and comsia models . two comfa descriptors , steric ( lennard - jones 6 - 12 potential ) and electrostatic ( columbic potential ) field energies , were calculated using an sp3 carbon atom carrying a + 1.0 charge set at default parameters , to serve as a probe atom . in addition to steric and electrostatic fields , comsia also considers hydrophobic and hydrogen bond donor / acceptor interaction . these five similarity indices were calculated using a gaussian - type distance - dependent function using a default attenuation factor of 0.3 . both comfa and comsia use pic50 as the target variable in partial least squares ( pls ) regression to derive 3d - qsar models . the predictive value of the model was evaluated by calculating the leave - one - out cross - validated ( loocv ) coefficients , q , using the following equation : ( 1)q2=1(y(ypredyactual)2yyactualy)2 , where y pred is predicted affinity ( calculated by model ) , y actual is actual affinity ( obtained by experiment ) , and y is mean actual affinity . the term (y the number of components giving the lowest press value determines the optimum number of component ( onc ) to generate the final pls regression model . the conventional coefficient , or the non - cross - validated correlation coefficient , r , was subsequently calculated to characterize the statistics of the built model . in general , a q > 0.5 is an indication of internal predictability [ 25 , 26 ] , whereas an r > 0.5 indicates that the constructed model is fairly good and interpretative [ 26 , 27 ] . all chemical structures were generated using sybyl 8.1 software package , whereas molecular topological indices were generated using material studio ( accelrys , san diego , ca ) . overall , material studio produced 231 descriptors , including fast descriptors of e state keys , molecular connectivity indices , spatial descriptors , and jurs descriptors . the feature selection method for choosing proper descriptors is composed of feature ranking and sequential feature addition or deletion . the objective formula is given as follows : ( 2)t=arg maxtf{1|t|fitc(fi , t)w 2|t|(|t|1)fi , fjt , fifjc(fi , fj ) } , where t denotes any feature subset , t represents the optimal feature subset , c(x , y ) denotes the correlation function between variables x and y , and f denotes the universal set consisting of all available features , f = { f 1 , f 2 , , f d}. the value of w is a weight that can be adjusted to represent the relative importance of these two terms . since solving t is an optimization problem , it will inevitably involve a combinatorial search . if an exhaustive search is applied , o(2 ) cases should be examined . in order to avoid an exhaustive search , we followed the idea of peng et al . and adopted a sequential and greedy search approach . we defined the ranking score of an unselected feature f i as ( 3)s(fi)=c(fi , y)1|ts|fjtsc(fj , fi ) , where t s denotes the selected feature subset and y denotes the target value . after the feature ranking is obtained , the rmse ( root mean square error ) i(yi - ti)2/n was tested by cross - validation in a sequential forward manner . the next step is to locate where the minimal rmse takes place , say k , and select the top k ranking features . subsequently , a sequential feature deletion and a sequential feature addition procedure were applied for m rounds . finally , assuming not too many features are kept , the reserved features are subject to an exhaustive search and export the top r feature subsets . the independent variable is x and target variable is y. the round number is m for sequential feature deletion and addition procedure , and r is for the top ranking feature subsets . the top r ranking feature subsets from the reserved feature set t s. step 1 . apply a sequential search approach to determine the feature ranking . for i = 1 to m do step 3.1 . apply a sequential feature deletion process to the selected features and determine which features are to be removed . apply a sequential feature addition process to append unselected features to the selected features and determine which features are to be added . assume the reserved feature set to be t s. apply an exhaustive search to the reserved features and export the top r ranking feature subsets among t s. we used the partial least squares regression method with the leave - one - out cross - validation procedure to determine the optimum number for the principal components . in the two models created , the leave - one - out cross - validated correlation coefficients ( q ) all reached the criterion q 0.5 , and all statistics with the conventional , non - cross - validated correlation coefficients were greater than 0.8 . in the comfa model , the contributions of steric and electrostatic fields were similar . because the hydrophobic interaction did not significantly contribute to the comsia model , we removed the hydrophobic descriptor to improve statistical analysis . the predicted and actual pic50 values for training set compounds are plotted in figures 2(a ) and 2(b ) , for comfa and comsia , respectively . to validate our models , we predicted the pic50 for compounds in each corresponding test set ( also shown in figures 2(a ) and 2(b ) ) . most of the absolute residual values , particularly for the training set data points , were less than 1 logarithm unit . the original data set contains 68 instances , each of which consists of one pic50 value and 231 descriptors ( features ) . since our goal is to use the descriptors to predict the pic50 value , it is reasonable to involve descriptors that are highly correlated with the pic50 value . any descriptor that has very few distinct values is regarded as invariant to the pic50 value and thus would not facilitate the prediction . the checking method is to calculate the median absolute deviation ( mad ) , which is given by med(abs(x med(x ) ) ) , where med and abs denote median and absolute operators , respectively . consequently , only 111 descriptors are employed for the subsequent processing . before performing the regression process , a normalization procedure is applied to the reserved descriptors , that is , xi=(xi - x-)/x , where x- and x represent mean and standard deviation for the descriptor x , respectively . we applied the feature selection procedure with m = 1 on the data set . during the feature selection process , the linear regression was used to evaluate rmse . because only 11 descriptors are left for the exhaustive search , we set r = 2 1 to let the program export all combinations . the intercorrelations between the selected 11 features , as well as the intercorrelations between each feature and pic50 , are listed in table 3 . figure 3(a ) is a superimposed image of two steric fields generated using comfa and comsia on mcf-7 cell inhibition . both steric models indicate that the regions around c2 and c3 are steric - favorable . this explains why the activity of compound 55 ( ic50 = 0.8 nm ) , the 1-naphthyl of which is in contact with the green contour , was 100 times higher than that of compound 66 ( ic50 = 80 nm ) , the 2-naphthyl of which is not in contact with the green contour but in contact with a steric - unfavorable region in yellow . likewise , compound 59 ( ic50 = 3 nm and an isopropyl group to replace the phenyl ring ) was more potent than compound 64 ( ic50 = 20 nm and a smaller ethyl group to replace the phenyl ring ) ; compound 24 ( ic50 = 2.5 nm ) was more active than compound 34 ( ic50 = 100 nm , with a phenyl group on c4 and being in contact with the yellow steric - unfavorable contour ) . near c6 this tiny green contour explains why compound 4 ( ic50 = 20 nm , with an ethynyl group on c6 ) was more active than compound 8 ( ic50 = 300 nm , with a methyl group on c6 ) . figure 3(b ) shows two electrostatic fields generated by comfa and comsia . although the two electrostatic models were not identical , there was no conflict . in comsia an electronegativity favorable red contour surrounds the phenyl moiety , indicating that a heteroatom with a partial negative charge would have a positive effect on inhibitory activity . this explains why compounds 27 ( ic50 = 1 nm , with a chlorine ) and 28 ( ic50 = 2.3 nm , with a fluorine ) are more active than compound 33 ( ic50 = 50 nm , with a methyl group ) . in the vicinity of the comsia 's red contour , a blue contour was observed in comfa . together these two contours suggest that a hydroxyl group attached to c4 increases activity . both comfa and comsia show a contour favorable to a negative charge near c6 and a contour favorable to a positive charge farther away , indicating that a hydroxyl group herein would increase activity . the activities of compounds 25 ( ic50 = 0.2 nm , with a hydroxyl group ) , 4 ( ic50 = 20 nm , with an ethynyl group ) , and 8 ( ic50 = 300 nm , with a methyl group ) , differing in the substituent on c6 , varied according to this electrostatic feature . preferences of hydrogen bond donors and acceptors are presented in figures 3(c ) and 3(d ) , respectively . a number of hydrogen bond donor favorable / unfavorable contours are in the vicinity of c6 ( figure 3(c ) ) . the activity of compound 25 ( ic50 = 0.2 nm ) , whose hydroxyl hydrogen atom is in contact with one cyan contour , is higher than that of compound 8 ( ic50 = 300 nm ) , with a methyl group on c6 . accordingly , compound 28 ( ic50 = 2.3 nm , with a fluorine on c4 ) is more potent than compound 33 ( ic50 = 50 nm , with a methyl group on c4 ) , and compound 7 ( ic50 = 250 nm , with a methoxy group on c6 ) is slightly more active than compound 8 ( ic50 = 300 nm , with a methyl group on c6 ) . meanwhile , the characteristic of favoring hydrogen bond acceptors near c4 and c6 confirms the red electronegative contours in figure 3(b ) . in figure 4 , we superimposed comsia fields onto the activity site of er ( pdb code : 1err ) to reveal the correlation between the observed fields and er 's amino acids involved in the binding of modulators . the raloxifene structure used in our 3d - qsar modeling was obtained by energy minimization and therefore was slightly different from the er bound that one retrieved from pdb ( 1err ) . the rmsd between the two raloxifene structures is 0.66 , with a minor deviation caused by the orientation of the long chain extended from c3 . since the contour maps in comfa and comsia models are about the phenyl and benzothiophene moieties , projecting the contour maps onto the er binding cavity for discussion is proper . as shown in figure 4(a ) , the green , steric favorable contour matches the empty area around leu525 and leu428 , whereas the yellow , steric unfavorable contour corresponds to the corner surrounded by residues of his524 , ile424 , and met421 . in figure 4(b ) , the negative and positive charge favorable contours on c6 point toward the positively charged guanidinio of arg394 and negatively charged carboxylic group of glu353 , respectively . moreover , the blue contour above the phenyl ring moiety is related to the c4 red contour . that is , a reduction in phenyl ring electronegativity caused by the electron - withdrawing heteroatom adjacent to c4 benefits the interaction of the inhibitor and er. consequently , the resulting positive charge of the phenyl ring increases the interaction between the inhibitor and met421 sulfur atom , carrying a partial negative charge . such electrostatic attractions help discriminate the binding of the inhibitor to er from er , as pointed out earlier in salum 's comfa model in ligand binding selectivity over er and er . er and er isoforms share an overall 58% sequence identity in binding domain , particularly their ligand - binding cavities , which differ by only two amino acids of highly conserved characteristics leu384 and met421 on er and met336 and ile373 on er. met421 in er and ile373 on er are highly involved in the accommodation of ligands , and are regarded as pivotal in the process of selectivity [ 32 , 33 ] . figure 4(c ) shows that the contour near c6 favorable to the hydrogen bond donor points toward the carboxylic oxygen atoms of glu353 . in figure 4(d ) , the contour favorable to the hydrogen bond acceptor on c6 points toward the guanidinio hydrogen atoms of arg394 and a contour favorable to the hydrogen bond acceptor on c4 points toward his524 amide hydrogen . in all , the hydroxyl groups located on c4 and c6 in conjunction with the residues of glu353 , arg394 , and his524 were demonstrated to form a stable hydrogen bonding network . for the previously mentioned selected 11 features , totally 2047 cases were to be examined . we applied the linear regression and leave - one - out cross validation ( loocv ) techniques to evaluate all the 2047 cases . the upper part of table 4 gives the top 10 feature subsets , including formulas and the corresponding loocv rmses , based on lr . it is shown that the best rmse is 0.7364 , which is associated with eight features . to compromise between the model complexity and prediction capability , we adopted the 7th lr model equation , which consists of six features and whose rmse is 0.7484 , to demonstrate the prediction of pic50 listed in lr column , table 1 . figure 2(c ) plots the actual pic50 values against the predicted values based on this model equation . in addition to the linear regression ( lr ) , we also applied the linear support vector regression ( svr ) [ 34 , 35 ] to all 2047 feature subsets . the top 15 feature subsets , including formulas and the corresponding loocv rmses , are listed in the lower part of table 4 . the model equation with the lowest rmse = 0.7104 , we adopted the 4th svr model equation , with five features and rmse = 0.7273 , to demonstrate the prediction of pic50 listed in svr column , table 1 . figure 2(d ) plots the actual pic50 values against the predicted values according to this equation . comparison between the results of lr and svr suggests that svr is superior to lr . models equations derived from lr and svm approaches indicate that a number of features consistently provide contributions in determining the target variable . variables x 6 , x 7 , x 9 , and x 11 appear in all the derived equations in both svm and lr models , whereas variables x 3 and x 4 appear in most of the derived equations . meanwhile , variables x 6 , x 9 , and x 11 are quite stable in being positively correlated to the target variable , while x 3 , x 4 , and x 7 are negatively correlated to the target variable . variable x 6 represents the molecular shadow area projected on zx plane ; variable x 7 represents the shadow area fraction on yz plane . these two descriptors are found in accordance with comfa and comsia steric fields shown in figure 3(a ) , where the cartesian coordinate frame is specified . the positive sign of x 6 coefficients in the derived equations suggests that an increase in molecular shadow area on zx plane enhances inhibitory activity , and this is in agreement with figure 3(a ) 's green , steric - favorable contours . that is , along the y - axis point - of - view , the shadow area on yz plane can be extended by adding bulky groups in contact with the green contours . compound 55 ( ic50 = 0.8 nm ) with 1-naphthyl modification is a good example . variable x 7 , the shadow area fraction on yz plane , is negatively correlated to inhibitory activity and can be correlated to the yellow steric - unfavorable contour in figure 3(a ) . that is , an elongated side chain attached on c4 would increase the shadow area projected on yz plane ( which can be seen with a view point along the x - axis ) and reduce the activity . variables x 9 , the dipole moment about the z - axis , and x 11 , a jurs descriptor that is associated with relative positive charge surface area , are both positively correlated to the activity . analysis on dipole moment about z - axis shows that compounds with positive values possess higher activity , which implies that the activity can be boosted by positive charges distributed on compound surface . together , features x 9 and x 11 suggest that the positive electrostatic potential benefits the inhibitory activity . these findings could be related to the electronegativity of the gate of er binding pocket ( figure 5 ) in which an inhibitor with a partial positive charge enters more easily . the electrostatic potential shown in figure 5 our results have shown that the hydroxyl groups on both c6 and c4 are irreplaceable , due to the strong hydrogen bonding network linking to glu353 and arg394 on c6 side and to his524 on c4 side . accordingly , compounds 25 ( raloxifene ) , 26 , 45 , and 55 , possessing two hydroxyl groups at c4 and c6 sites , have satisfactory ic50 values . earlier results from the literature showed that in cases of e1 ( estrone ) , e2 ( 17-estradiol ) , and e3 ( estriol ) replacing the hydroxyl groups with methoxy eliminated the affinity toward both er subtypes [ 3638 ] . likewise , compounds 7 , 20 , 21 , 22 , and 23 with a methoxy group on c6 held poor ic50 values because of disruption to the hydrogen bond network and steric disfavor . comparison of rmses among different feature combinations suggests that if all 231 features are adopted for regression , the rmses are not good . on the other hand , if the appropriate feature selection method is used , the performance gets improved . from the results , we can see that most of the rmses obtained by svr outperform those of the lr . this may be attributed to the well - selected features and prominent prediction capability of svr , because the selected features are not specialized to the evaluation method . in summary , if the subsets of only 5 features are considered , the best rmse of svr is 0.7273 . in the present study models built on different methods accordingly , the clues derived from contour analysis can be used for further design work based on arylbenzothiophene and for screening large chemical databases for compounds with potential er activity .

human estrogen receptor ( er ) isoforms , er and er , have long been an important focus in the field of biology . to better understand the structural features associated with the binding of er ligands to er and modulate their function , several qsar models , including comfa , comsia , svr , and lr methods , have been employed to predict the inhibitory activity of 68 raloxifene derivatives . in the svr and lr modeling , 11 descriptors were selected through feature ranking and sequential feature addition / deletion to generate equations to predict the inhibitory activity toward er. among four descriptors that constantly appear in various generated equations , two agree with comfa and comsia steric fields and another two can be correlated to a calculated electrostatic potential of er.

cervical insufficiency is one of the leading causes of perinatal infant morbidity and mortality , with an incidence of 0.11.0% of all pregnancies . it is characterized by painless dilation of the cervix , usually followed by bulging and premature rupture of membranes , which leads to miscarriage or preterm birth . the diagnosis is challenging because of the absence of clear diagnostic criteria , and it is generally made retrospectively , based on obstetric history . the american college of obstetrics and gynecology ( acog ) currently recommends the placement of cerclage in patients with a current singleton pregnancy , prior spontaneous preterm birth at fewer than 34 weeks ' gestation , and short cervical length ( less than 25 mm ) before 24 weeks ' gestation . the traditional procedure is transvaginal ; however , a transabdominal approach is preferred in selected cases , such as in patients in whom transvaginal cerclage failed and resulted in second - trimester pregnancy loss or in those with scarred , physically disabled , or absent cervix . the success rate of abdominal cerclage is reported to be 8590% in the literature ; however , when performed as an open procedure , it is associated with higher morbidity than the vaginal approach . laparoscopic abdominal cerclage during pregnancy has been shown to be advantageous over laparotomy when comparing success rates and recognizing the well - known benefits of minimally invasive surgery , such as decreased blood loss , shorter hospital stay , decreased pain , and faster recovery time . robot - assisted abdominal cerclage is a relatively new minimally invasive technique that facilitates less invasive procedures when compared to the open approach , and it has the advantages of 3-dimensional visualization and endowristed instrumentation when compared to traditional laparoscopy . since the da vinci surgical system ( intuitive surgical , sunnyvale , california , usa ) was approved by the u. s. food and drug administration ( fda ) for gynecologic procedures in 2005 , there have been only a few robotic abdominal cerclages performed during pregnancy ; the first was reported in 2008 . the objective of our case series and review of the literature was to evaluate the safety , efficacy , and feasibility of the robot - assisted abdominal cerclage procedure during pregnancy . the study was approved by the university of texas medical branch institutional review board ethics committee , and formal informed consent was obtained from all patients . we conducted a retrospective study , including 6 cases from 2 institutions ( the university of texas medical branch , galveston , texas , and yale school of medicine , new haven , connecticut ) , evaluating the safety and efficacy of robot - assisted abdominal cerclage during pregnancy and obstetric outcomes after the procedure . patients were referred to the obstetrics and gynecology departments of the 2 institutions from january 2010 to march 2016 and were offered the procedure if abdominal cerclage was indicated per acog guidelines . all options , risks , benefits , and outcomes were discussed with each patient ; informed consent was obtained ; and a thorough physical examination was performed before the procedure . fetal viability and gestational age were confirmed with pelvic ultrasonography . all patients who underwent robot - assisted abdominal cerclage while pregnant during the study period were included in the analysis . we conducted a systematic literature search of the following databases : pubmed , embase , ovid medline , web of science , and cochrane systematic reviews . the following medical subject heading ( mesh ) terms , keywords , and their combinations were used : data extracted from the studies included study design , number of patients , and surgical and obstetric outcomes . articles regarding robotic cerclage in nonpregnant patients and traditional laparoscopic cerclage were excluded , and only robotic procedures during pregnancy were included . the primary outcome measure was defined as delivery of a viable infant at 34 weeks ' gestational age or more . secondary outcome measures were gestational age at delivery , preterm labor , premature rupture of membranes , neonatal survival after the procedure , failed abdominal cerclage , and surgical complications . failure was defined as second trimester or any perioperative pregnancy loss within 2 weeks of the procedure . we conducted a retrospective study , including 6 cases from 2 institutions ( the university of texas medical branch , galveston , texas , and yale school of medicine , new haven , connecticut ) , evaluating the safety and efficacy of robot - assisted abdominal cerclage during pregnancy and obstetric outcomes after the procedure . patients were referred to the obstetrics and gynecology departments of the 2 institutions from january 2010 to march 2016 and were offered the procedure if abdominal cerclage was indicated per acog guidelines . all options , risks , benefits , and outcomes were discussed with each patient ; informed consent was obtained ; and a thorough physical examination was performed before the procedure . fetal viability and gestational age were confirmed with pelvic ultrasonography . all patients who underwent robot - assisted abdominal cerclage while pregnant during the study period were included in the analysis . we conducted a systematic literature search of the following databases : pubmed , embase , ovid medline , web of science , and cochrane systematic reviews . the following medical subject heading ( mesh ) terms , keywords , and their combinations were used : robotic , cervical cerclage , and cervicoisthmic cerclage . we collected data from all robot - assisted abdominal cerclage procedures during pregnancy . data extracted from the studies included study design , number of patients , and surgical and obstetric outcomes . articles regarding robotic cerclage in nonpregnant patients and traditional laparoscopic cerclage were excluded , and only robotic procedures during pregnancy were included . the primary outcome measure was defined as delivery of a viable infant at 34 weeks ' gestational age or more . secondary outcome measures were gestational age at delivery , preterm labor , premature rupture of membranes , neonatal survival after the procedure , failed abdominal cerclage , and surgical complications . failure was defined as second trimester or any perioperative pregnancy loss within 2 weeks of the procedure . we conducted a systematic literature search of the following databases : pubmed , embase , ovid medline , web of science , and cochrane systematic reviews . the following medical subject heading ( mesh ) terms , keywords , and their combinations were used : robotic , cervical cerclage , and cervicoisthmic cerclage . we collected data from all robot - assisted abdominal cerclage procedures during pregnancy . data extracted from the studies included study design , number of patients , and surgical and obstetric outcomes . articles regarding robotic cerclage in nonpregnant patients and traditional laparoscopic cerclage were excluded , and only robotic procedures during pregnancy were included . the primary outcome measure was defined as delivery of a viable infant at 34 weeks ' gestational age or more . secondary outcome measures were gestational age at delivery , preterm labor , premature rupture of membranes , neonatal survival after the procedure , failed abdominal cerclage , and surgical complications . failure was defined as second trimester or any perioperative pregnancy loss within 2 weeks of the procedure . the median age was 34 y ( range , 2837 ) at the time of the procedure . in 5 cases , the indication for transabdominal cerclage was failed vaginal cerclage in a previous pregnancy ; in the remaining case , a scarred and shortened cervix was the indication , caused by a cervical laceration in a dilatation and curettage . median operating time was 159.5 minutes ( range , 124204 ) and median estimated blood loss ( ebl ) was 25 ml ( range , 1025 ml ) . none of the surgeries was converted to laparotomy , and all patients were discharged on postoperative day 1 . one patient went into preterm labor at 22 weeks and underwent cerclage removal via minilaparotomy . the patient was found to have a 1-cm uterine rupture close to the right uterine artery under the cerclage suture . the cerclage suture was removed , and the rupture site was repaired without the need for a hysterectomy . the patient gave birth vaginally to a 500-g female infant 3 h after the procedure . the clinical characteristics of the patients as well as the operative and obstetric outcomes are summarized in table 1 . patient characteristics and surgical and obstetric outcomes of 27 reports in the initial search , 8 were included . median gestational age at the time of the procedure and delivery was 12 weeks ( range , 1015 ) and 37 weeks ( range , 3339 ) , respectively . the characteristics of the patients and the surgical and obstetric outcomes are summarized in table 2 . the median age was 34 y ( range , 2837 ) at the time of the procedure . in 5 cases , the indication for transabdominal cerclage was failed vaginal cerclage in a previous pregnancy ; in the remaining case , a scarred and shortened cervix was the indication , caused by a cervical laceration in a dilatation and curettage . median operating time was 159.5 minutes ( range , 124204 ) and median estimated blood loss ( ebl ) was 25 ml ( range , 1025 ml ) . none of the surgeries was converted to laparotomy , and all patients were discharged on postoperative day 1 . one patient went into preterm labor at 22 weeks and underwent cerclage removal via minilaparotomy . the patient was found to have a 1-cm uterine rupture close to the right uterine artery under the cerclage suture . the cerclage suture was removed , and the rupture site was repaired without the need for a hysterectomy . the patient gave birth vaginally to a 500-g female infant 3 h after the procedure . the clinical characteristics of the patients as well as the operative and obstetric outcomes are summarized in table 1 . all were either case reports or case series . in total , 16 patients underwent robot - assisted abdominal cerclage during pregnancy . median gestational age at the time of the procedure and delivery was 12 weeks ( range , 1015 ) and 37 weeks ( range , 3339 ) , respectively . the characteristics of the patients and the surgical and obstetric outcomes are summarized in table 2 . to the best of our knowledge , this is the first systematic review of robot - assisted abdominal cerclage during pregnancy . since robotics technology is relatively new , the published reports in the literature are limited to case reports and case series . however , the safety and efficacy of conventional laparoscopy has been reported to have success rates comparable to those of the open technique . in the systematic review by tulandi et al , the rates of third - trimester delivery and live birth via laparoscopy during pregnancy were found to be 70% and 70100% , respectively , whereas these rates were 77.4% and 85.2100% via laparotomy . in the report by burger et al the fetal survival rate ( defined as the total number of liveborn infants who survived the first 6 weeks after delivery divided by the total number of all pregnancies ) after laparoscopic cerclage during pregnancy was 80.9% , whereas it was 88.4% in the open surgery group , which was not significantly different . the rate of fetal loss was 11.5% in the laparoscopy group ( n = 26 ) and all were during the second trimester . the rate of delivery at 34 weeks of gestation was 88% , and mean gestational age at delivery was 34.4 weeks . the rate of conversion to laparotomy was 4.4% ; however , the reasons for conversion were not mentioned in the study . our systematic review showed slightly improved outcomes via the robotic route regarding gestational age at delivery ( median , 37 weeks ) , and the rates of live birth ( 90% ) , and third - trimester delivery ( 90% ) when compared to the aforementioned success rates of the laparoscopic approach . however , as mentioned previously , these rates reflect only the outcomes of case reports and small case series . randomized trials are needed to compare the 2 minimally invasive options to make definitive conclusions . the outcome that attracted attention is that the reported procedure times are longer with the robotic approach than with laparoscopy . the largest case series of robotic cerclage during pregnancy , reported by foster et al , included 7 cases for which median procedure time was reported to be 157 minutes , which was similar to the median operative time of 159.5 minutes of our case series . cho et al reported a mean operative time of 55 minutes in their case series of 20 laparoscopies , which was similar to the reported mean procedure time of 52 minutes in the case series reported by shin et al . the longer operative time for the robotic procedure may be related to incomplete learning curves and additional docking time for the robot , which may be improved with surgeon experience and application of efficiency strategies in the operating room . the longer procedure time will increase the costs of the robotic procedure at this time . however , appropriate cost comparison studies should be designed in the setting of completed surgeon learning curves before definitive conclusions are drawn . most articles in the literature report some challenges during the procedure for both the laparoscopic and robotic routes , such as difficulty accessing the lower uterine segment because of a soft and enlarged uterus , difficulty maneuvering because of lack of a uterine manipulator , and enhanced vascularization during pregnancy , which raises a concern for severe hemorrhage . to overcome these challenges , various surgical techniques were described , and some technological tools have been implemented in robotics , which may make the robotic system more beneficial over conventional laparoscopy . the tilepro multi - input , display feature of the da vinci surgical system provides simultaneous display of real - time ultrasonography and the operative field , enabling the surgeon to identify the borders of the cervix and the location of the internal cervical ostium . this feature allows the surgeon to pass the needle more precisely through the correct surgical plane while avoiding the lower uterine segment and membranes . needleless surgical technique , during which a needleless mersilene tape ( ethicon , somerville , new jersey , usa ) is passed through a peritoneal window medial to the uterine vessels . in another recent report , zeybek et al described the concomitant use of indocyanine green ( icg ) dye with a near - infrared camera system . icg is commonly used as a contrast agent to assess microvascular circulation and organ vascularization with excellent tolerability . the near - infrared camera system is a recent innovation that was integrated into the da vinci si surgical system in 2010 . the combination of both creates 2 relatively opposite ( low / high ) contrasts , which enables identification of high contrast ( icg ) on a relatively low - contrast ( near - infrared light ) background . the authors concluded that the technique may be beneficial in overcoming the obstacles of visualization of the vascular anatomy . an early report described manual manipulation with an assistant 's fingers , and gibbs et al recently reported use of a vaginal fornices delineator , the koh cup ( cooper surgical , inc , trumbull , connecticut , usa ) , to aid in manipulation and improve cervix visualization during a robot - assisted abdominal cerclage . the koh cup was first introduced in the mid-1990s by the gynecologic surgeon charles koh and has been used since that time to facilitate total laparoscopic hysterectomy . gibbs et al used it as a manipulator during a cerclage procedure by assembling the tips of 2-ring forceps clamps along the base of the koh cup , which encircles the cervix without disruption of the cervical canal . although it also includes a systematic review of the literature , the included articles are only case reports and case series . . however , our case series and reports to date suggest that robot - assisted abdominal cerclage during pregnancy is safe and effective . we conclude that robot - assisted abdominal cerclage is feasible during pregnancy and the implemented technological advancements in robotics ( the tilepro near - infrared camera system ) may be beneficial in overcoming the obstacles of visualization during the procedure .

background and objectives : cervical insufficiency is a difficult condition to diagnose and can lead to preterm birth , miscarriage , or perinatal infant morbidity and mortality . we conducted this retrospective case study and literature review to evaluate the safety and efficacy of robot - assisted abdominal cerclage during pregnancy.methods:we conducted a case series and a systematic review that included patients who underwent robot - assisted abdominal cerclage during pregnancy from january 2010 through march 2016.results:six patients met the criteria for the case series . median age was 34 years ( range , 2837 ) at the time of the procedure . in 5 cases , the indication for transabdominal cerclage was a failed vaginal cerclage in a previous pregnancy , whereas a scarred and shortened cervix caused by a previous dilatation and curettage induced cervical laceration was the indication in the remaining case . median operating time was 159.5 minutes ( range , 124204 ) , and median estimated blood loss was 25 ml ( range , 1025 ) . no surgeries were converted to laparotomies ; all patients were discharged on postoperative day 1 . the median gestational age at delivery was 37.5 weeks ( range , 2239 ) . five patients delivered between 36 and 39 weeks . no patients had chorioamnionitis or preterm premature rupture of membranes . one patient went into preterm labor at 22 weeks , and the cerclage was removed via minilaparotomy . eight articles met the criteria for systematic review . sixteen patients underwent robot - assisted abdominal cerclage during pregnancy . median age was 31.5 years ( range , 2537 ) . the major indication in most articles was previous failed transvaginal cerclage . the median gestational ages at time of procedure and delivery were 12 weeks ( range , 1015 ) and 37 weeks ( range , 3339 ) , respectively.conclusion:robot-assisted abdominal cerclage is safe and effective during pregnancy .

saudi arabia is the second biggest arab country , with a surface area of 2,150 thousand sq km , and a population of 25.5 million , about 7 million of whom are non - saudis.[14 ] it is the leading muslim country , as two of the most holy sites for muslims ( makkah and madina ) where millions come to worship and work every year , are located here . compared to other countries in the eastern mediterranean region , it has one of the highest gross national incomes per capita and expenditure on health ( usd 22,300 and 6.4% ( as percentage of gross domestic product ( gdp ) ) , respectively . despite this relatively high expenditure on health ( 5% of gdp ) , most of the facilities in the healthcare system remain largely concentrated in the three main and most densely populated cities , namely : riyadh , the political capital with18% of the ministry of health ( moh ) hospitals and 18% of the primary health care centers ( phccs ) for 6.2 million people ; jeddah and makah with 9% of the moh hospitals and 7.5% of the phccs for a population of 4.9 million ; and the eastern region , including dammam and qasim , which has 15% of the moh hospitals , and 13.4% of the phccs for a population of 3.4 million . the development of the healthcare system in saudi arabia began in 1925 , when a public health department was established by a royal decree . the first school of nursing was opened in 1926 , followed by the school of heath and emergencies in 1927 . in 1951 , the ministry of health was established . since then , the health services have expanded immensely . from 1970 to 1980 , the health services were predominantly curative . however , the concept of primary health care ( phc ) became popular in the early 1980s ; when the world health organization ( who ) slogan health for all ( hfa ) gained recognition . by a ministerial decree in 1980 , the establishment of health centers was initiated . currently , the ministry of health has 1848 phc centers and 200 hospitals under its jurisdiction . there is growing international literature that discusses the ethical issues relating to healthcare systems in industrialized countries , although these generally deal with specific specialities or a given group of patients . a leading study done by jm breslin and colleagues identified the top ethical challenges that patients and their families in the healthcare system in toronto , canada , face . a modified delphi study was conducted and the top ten ethical challenges that canadians confronted within their healthcare were identified . the top three challenges in their study were : ( 1 ) disagreement between patients / families and healthcare professionals about treatment decisions ; ( 2 ) waiting lists ; and ( 3 ) access to needed resources for the aged , the chronically ill , and the mentally ill , respectively . likewise , other studies were carried out to identify the national ethical problems related to the healthcare system , the clinical situations doctors and nurses perceive as ethical problems , and to describe the ethical issues deemed as highly important to oncology nurses . the conclusions reached by these studies reflected the ethical issues close to those revealed by the canadian study as frequently encountered , such as problems in the healthcare reform process , professional interactions , and doctor - patient relationships . the top three priority ethical issues for oncology nurses were assisted suicide , end - of - life decisions , and pain management . however , the literature relating to medical / clinical ethics in saudi arabia remains limited in terms of volume and scope . most of these studies focus on the islamic perspective of some clinical practices such as organ donation , do - not - resuscitate ( dnr ) orders , and end - of - life issues , or other issues like patient satisfaction . a study that is worthy of note was conducted by kalid bin saeed , to compare the views of physician executives and clinicians on ethical issues in saudi arabian hospitals and the contributory factors leading to the presence of these ethical issues . however , the ethical issues that confront the saudi healthcare system and public were not adequately studied , nor was there any attempt to collate and prioritize them . this study is aimed at defining , collating , and ranking the major ethical challenges encountered in the healthcare system in saudi arabia , as perceived by the healthcare providers and the public . it also proposes an approach to the management of these ethical issues in line with other international studies , especially the canadian study by breslin and colleagues . the study area included the three main saudi cities of riyadh , jeddah , and dammam , as well as other smaller cities ( taif ( west ) and tabuk ( north ) ) . the study population included : members of the ethics committees in the major health institutions ( hospitals ) , who taught or had experience in medical ethics and medical administration , and academic staff from 10 hospitals in the selected areas [ table 1 ] . out of 110 participants , 90 replied in the study period , giving a response rate of 82% ; and 83 ( 75.5% ) provided their professional and contact information . the participants were male and female clinicians and medical doctors , 46 ( 55% ) and 12 ( 15% ) , respectively ; medical doctors in public health and community medicine 12 ( 14% ) ; eight ( 10% ) non - medical hospital staff ; and five ( 6% ) pharmacists and other paramedical technicians . hospitals included from each city and the sample size in each participants from military hospitals were civilian staff without rank in the armed forces . the justification for the use of a panel of clinicians and ethics committee members rather than community members was that it was expected that they would provide a better insight into the overall ethical challenges than community members , because of their work . , 110 participants were asked to write down a list of what they perceived as the top 10 medical ethical challenges to health care . they were asked to rank the items from that list again as the top 10 ethical issues facing healthcare providers and return them to the researchers . in the third round , after ranking the obtained ethical issues from all participants responses , the list was sent again to the participants to indicate their agreement or otherwise to the ranking . if they did not agree with what they were sent , the re - ranked responses were returned by the participants to the research team . on receipt of the participants re - ranked forms , a meeting of experts of a select group of health professionals was held , to choose the top 10 medical ethical problems facing the saudi population from the medical health professionals point of view . at the experts meeting , an open session was held to : ( 1 ) unify the definitions of the problems ; ( 2 ) select the top 10 ethical problems ; and ( 3 ) re - rank these problems using a scale that depended on the following four items : ( 1 ) size of the problem ; ( 2 ) seriousness of the problem ; ( 3 ) feasibility of solving it ; and ( 4 ) status of public awareness of it . each one of these items was put on a scale of one ( + ; the lowest score ) to 4 ( + s ) , the highest score . later , the experts were put into two groups and each group was given a list of the ranked items and asked to rank the top 10 ethical problems facing the saudi care providers . at the end of these sessions , the top 10 ethical problems that the saudi providers faced were formulated and approved . 110 participants were asked to write down a list of what they perceived as the top 10 medical ethical challenges to health care . they were asked to rank the items from that list again as the top 10 ethical issues facing healthcare providers and return them to the researchers . in the third round , after ranking the obtained ethical issues from all participants responses , the list was sent again to the participants to indicate their agreement or otherwise to the ranking . if they did not agree with what they were sent , the re - ranked responses were returned by the participants to the research team . on receipt of the participants re - ranked forms , a meeting of experts of a select group of health professionals was held , to choose the top 10 medical ethical problems facing the saudi population from the medical health professionals point of view . at the experts meeting , an open session was held to : ( 1 ) unify the definitions of the problems ; ( 2 ) select the top 10 ethical problems ; and ( 3 ) re - rank these problems using a scale that depended on the following four items : ( 1 ) size of the problem ; ( 2 ) seriousness of the problem ; ( 3 ) feasibility of solving it ; and ( 4 ) status of public awareness of it . each one of these items was put on a scale of one ( + ; the lowest score ) to 4 ( + s ) , the highest score . later , the experts were put into two groups and each group was given a list of the ranked items and asked to rank the top 10 ethical problems facing the saudi care providers . at the end of these sessions , the top 10 ethical problems that the saudi providers faced were formulated and approved . out of 110 participants , 90 replied in the study period giving a response rate of 82% . following the first round , 32 ethical issues were identified , the top three of which were : patients rights ( 55 ; 61% ) , confidentiality of patients information ( 41 ; 46% ) , and medical negligence / error ( 31 ; 34% ) . the least important were : language barrier , private sections in public hospitals , and nursing practices ( 2 , 2 , and 1% , respectively ) . patients rights , patient confidentiality , and medical negligence / error were ranked the highest of the ethical issues . the third round and the meeting of the panel of participants resulted in the underlisted top 10 medical ethics problems facing the saudi population , from the participants point of view [ table 2 ] . the presence of a centralized healthcare system in a culturally diverse population and healthcare providers may give rise to a set of ethical issues . for example , the ethical issues related to patients waiting time for medical attention , lack of comprehension resulting from cultural differences , the language barrier between the healthcare providers and the patients , and issues relating to eligibility to health care . for instance , saudi patients in many peripheral areas have to travel to one of the main cities to seek healthcare . therefore , the introduction of an organized approach to handle these ethical issues , among others , is needed . in addition to the results of rankings [ table 2 ] , the panel members comments during the meeting were taken as the basis for this discussion . the highest ranked medical ethical challenge within the public in the healthcare system was the issue of patients rights , whereas , in the canadian study , the first priority was the disagreement between patients / families and healthcare professionals on decisions of treatment . good treatment ; give consent for any medical intervention ; confidentiality of his / her medical information ; and the right to refuse treatment against medical advice . since it is only a document that guides , the onus has been on the main hospitals to develop their patients bill of rights . unfortunately , this is still in the process of being formulated , finalized , and endorsed . the second highest ranked ethical challenge facing the public in the healthcare system is equity of access to resources . the equity of distribution of health resources is a major issue in the saudi healthcare system , as most of the resources are primarily in the main cities . besides , there are inequities even within the cities and among saudis and non - saudis . few exceptions are made for patients with some serious diseases , such as , tuberculosis and dengue fever , who should have access to free management , regardless of their legal status . this is an issue that needs to be addressed , for it is unlikely that an illegal resident would dare seeking medical treatment in a governmental hospital . bin saeed also draws attention to the more sensitive issue of , favoring patients based on their race or gender , which is considered an important ethical issue by 83.6% of the clinicians in his study . the health resources are mainly distributed in favor of the specialist hospitals , that is , secondary and tertiary institutions , leaving the primary care and preventive care centers at a disadvantage . in the canadian study , this issue was ranked the third most important because it was found that a major part of the funds was directed toward acute , live saving care , while long - term , rehabilitation , and mental healthcare were grossly underfunded . the third highest ranked ethical challenge facing the saudi healthcare system was confidentiality of patient information . the panel underscored the importance of this issue , which had to be given serious attention . there are no clear policies on the management of patient information , specifically the medical records , in many hospitals . this includes decisions on sharing any information about the patient without the proper consent of the patient . unlike patients rights , not much effort is being made to develop policies on information security . this was also a finding made by kahlid bin saeed , who indicated that 80% of the clinicians in his study had stated that patient confidentiality was a major ethical issue in their hospitals . the most probable reason is that patients are unlikely to know that their confidential information has been shared , and therefore , are less likely to file a complaint against the treating doctor or the hospital . with an increasing number of patients suing their treating doctors in saudi arabia , the main hospitals have taken preventive measures , including the development of certain policies that mandate a physician to take an insurance policy against medical errors before registration in the saudi council for health specialties . the fourth ranked ethical challenge was patient safety ; this comprised their physical , emotional , and social safety . this issue was not considered one of the top 10 ethical challenges in the canadian health care . the problem could be linked to the previous one , in that , a physician 's feeling of insecurity made any potential source of doctor despite the danger to themselves the moral responsibility of the doctors to look after their patients safety , remains paramount . included were , the relationship between the healthcare team and the pharmaceutical , medical equipment , and companies that traded in medical supplies , especially during the conduct of research in which patients were participants . it also included ethical issues relating to privatization and doctors practicing in both public and private hospitals . no sustained effort has been made to formulate a clear policy on the conflict of interests within the main hospitals where the study took place . the sixth ranked ethical challenge facing the public in saudi arabia was the ethics of privatization . according to the panel members , this item comprised many important issues , especially as health insurance was going to be made obligatory in the next few years . the panel members also drew attention to the fact that some physicians worked in the private sector during their official working hours , when they were supposed to be at their posts in government hospitals . this necessarily affected the time they had to devote to their patients in governmental sectors . besides , their patients were sometimes advised to go to the private hospitals for their follow - up in order to avoid a long waiting list . other issues relating to the private sector included the concern that doctors were inclined to request more investigations for patients than was necessary , as also the problem of exorbitant fees charged by some private facilities . moreover , employment by some private facilities of poorly trained health professionals , could affect patient safety . this issue was not considered an important ethical issue in the canadian study , because of the nature of the canadian health system , which depended almost exclusively on public funds . the seventh challenge facing the public in saudi arabia was informed consent : there was a lengthy discussion on this matter for many reasons . the patient / family members tended to sign the form for informed consent hurriedly without carefully reading a document with many difficult medical expressions , which neither the patient nor his / her family member could comprehend . as many of the personnel working in the saudi health sector are foreign , and therefore , unable to speak arabic well , communication with a patient and / or his / her family member , who had to sign the consent form , became a problem . it is estimated that saudi nurses represent only 22% of the total working force of nurses in the country . the next ethical challenge in healthcare in saudi arabia is , how to deal with the opposite sex , that is , when male doctors have to examine female patients and vice versa . as the practices of the saudi community are based on islamic ethics and rules , this is a sensitive problem , especially when a male healthcare provider has to deal with a female patient . it is worth mentioning that this is permitted in islam only under special circumstances , for example , when no competent female doctor is available for a male doctor to examine a female patient . the ninth ethical challenge facing the public in saudi arabia was the matter of the beginning and end of life . this sensitive issue discussed by the panel has created much controversy between family members and the medical team . it has become more complicated because of the large amount of money used to purchase sophisticated equipment and supplies , which consequently have raised the expectations of patients and their families for a better quality of life as well as a longer life . although mentioned in the canadian study discussion , it was not one of their major ethical problems . the tenth ethical challenge facing the public in saudi arabia was : the ethics health care team . this refers to ethical issues relating to disagreements , disputes , or even conflicts among the healthcare team members . the problems vary according to the attitudes of physicians and their colleagues toward one another and other professionals . this situation gets complicated because of the lack of clearly defined job descriptions , which lead to disputes or even conflicts within the health facility . apart from the top ten ethical issues , other important issues were raised , although not listed . these related to the language barrier and relations within the healthcare team , islamic medicine , and ethics of muslim doctors . the last issue is important in saudi arabia , which is a symbol of the modern islamic state . discussions revealed differences between the historical islamic practice of medicine and western teaching , which most of the saudi doctors had undergone . moreover , the differences between the ethical and practice standards in the western hospitals where they were trained and what was obtained in this country aggravated this divergence . the major 10 ethical issues as perceived by the participants were : ( 1 ) patients rights , ( 2 ) equity of resource distribution , ( 3 ) confidentiality of patients , ( 4 ) patient safety , ( 5 ) conflict of interests , ( 6 ) ethics of privatization , ( 7 ) informed consent , ( 8) dealing with the opposite sex , ( 9 ) beginning and end of life , and ( 10 ) healthcare team ethics . however , this list was not exhaustive . the results of this study were intended for comparison with those of the canadian study . differences were indeed expected because of the differences in culture and healthcare systems of saudi arabia and canada . unlike the canadian study , this study included the opinions of administrators and legal representatives . although many of the challenges listed by the participants have received significant public and specialized attention worldwide , very little attention has been given to these top challenges in saudi arabia . the higher authorities in the health delivery system hierarchy have to initiate more in - depth discussions on the ethical issues , in order to ultimately bring about changes in policies , particularly on resource allocation . although a code of ethics need not lay down rules that are set in stone , it can provide guidance to deal with ethical issues as they arise . the top ethical issues reflected the national and cultural peculiarities of the saudi population and health system . however , one can reasonably assume that the issues discussed will be applicable to other countries of the region that share the arabic - islamic moral values . differences will , however , remain , as there will be issues that arise from different health delivery systems . the results were intended for comparison with those of the canadian study by breslin and colleagues . the main limitation relates to the ability to generalize the results within or outside saudi arabia . first , the study did not include the smaller underserved rural hospitals that could have revealed another set of ethical issues , although the issue of equity in access to resources was listed among the top five issues . second , although the study tried to involve non - clinicians , the dominance of saudi male clinicians in the selected sample could have given the results and conclusions a clinical bias . this also partly explains why no ethical issues dealing with paramedical staff and their relationship with doctors were mentioned . as the delphi process was not stratified , the peculiarities of the different settings were blurred . for instance , in this methodology , regional and gender differences and those related to the type of the health facility were indistinct . in addition , it appeared that there was no definite consensus on the meaning of some terms used . finally , there was also the fact that communication with the participants of the study was basically electronically supported by some phone calls and faxes . moreover , the modified delphi model , presented the possibility of some members dominating the discussions in the face - to - face expert meeting . the results were intended for comparison with those of the canadian study by breslin and colleagues . the main limitation relates to the ability to generalize the results within or outside saudi arabia . first , the study did not include the smaller underserved rural hospitals that could have revealed another set of ethical issues , although the issue of equity in access to resources was listed among the top five issues . second , although the study tried to involve non - clinicians , the dominance of saudi male clinicians in the selected sample could have given the results and conclusions a clinical bias . this also partly explains why no ethical issues dealing with paramedical staff and their relationship with doctors were mentioned . as the delphi process was not stratified , the peculiarities of the different settings were blurred . for instance , in this methodology , regional and gender differences and those related to the type of the health facility were indistinct . in addition , it appeared that there was no definite consensus on the meaning of some terms used . finally , there was also the fact that communication with the participants of the study was basically electronically supported by some phone calls and faxes . moreover , the modified delphi model , presented the possibility of some members dominating the discussions in the face - to - face expert meeting .

background : despite the relatively high expenditure on healthcare in saudi arabia , its health system remains highly centralized in the main cities with its primary focus on secondary and tertiary care rather than primary care . this has led to numerous ethical challenges for the healthcare providers . this article reports the results of a study conducted with a panel of practitioners , and non - clinicians , in saudi arabia , in order to identify the top ten ethical challenges for healthcare providers , patients , and their families.materials and methods : the study design was a cross - sectional , descriptive , and qualitative one . the participants were asked the question : what top ten ethical challenges are saudis likely to face in health care ? the participants were asked to rank the top ten ethical challenges throughout a modified delphi process , using a ranking scale . a consensus was reached after three rounds of questions and an experts meeting.results:the major 10 ethical issues , as perceived by the participants in order of their importance , were : ( 1 ) patients rights , ( 2 ) equity of resources , ( 3 ) confidentiality of the patients , ( 4 ) patient safety , ( 5 ) conflict of interests , ( 6 ) ethics of privatization , ( 7 ) informed consent , ( 8) dealing with the opposite sex , ( 9 ) beginning and end of life , and ( 10 ) healthcare team ethics.conclusion:although many of the challenges listed by the participants have received significant public and specialized attention worldwide , scant attention has been paid to these top challenges in saudi arabia . we propose several possible steps to help address these key challenges .

estabelecer os limites superiores para mudanas em vef1 , capacidade vital lenta ( cvl ) , cvf e capacidade inspiratria ( ci ) aps o uso de placebo em pacientes com obstruo ao fluxo areo . cento e dois adultos com obstruo ao fluxo areo ( vef1 = 62 19% do previsto ) foram includos neste estudo . todos os participantes realizaram manobras de cvl e cvf antes e depois do uso de spray de placebo . as mudanas em vef1 , cvl , cvf e ci foram expressas em valores absolutos , porcentagem de variao em relao aos valores basais e porcentagem dos valores previstos , e foram calculados os ic95% e os percentis 95 . a anlise fatorial foi realizada a fim de determinar como essas alteraes se agrupavam . considerando os ic95% e percentis 95 e aps o arredondamento dos valores , obtivemos os seguintes limites superiores para resposta significante : vef1 = 0,20 l , cvf = 0,20 l , cvl = 0,25 l e ci = 0,30 l ( em valores absolutos ) ; vef1 = 12% , cvf = 7% , cvl = 10% e ci = 15% ( em porcentagem de variao em relao aos valores basais ) e vef1 = 7% , cvf = 6% , cvl = 7% e ci = 12% ( em porcentagem dos valores previstos ) . em pacientes com obstruo ao fluxo areo , a ci apresenta maior variabilidade do que a cvf e a cvl . para a ci , valores maiores que 0,30 l e 15% de variao em relao ao valor basal devem ser considerados significantes . para cvf , valores maiores que 0,20l e 7% de variao em relao ao valor basal so significantes . alternativamente , alteraes de mais de 0,20 l e 7% do previsto no vef1 e na cvf devem ser consideradas significantes . na anlise fatorial , os parmetros espiromtricos se agruparam em trs dimenses , expressando mudanas no fluxo , volume e hiperinsuflao dinmica . in patients with airflow obstruction , changes in spirometric values after bronchodilator use are indicative of reversibility if they exceed the natural variability . on the basis of two landmark studies , first the american thoracic society ( ats ) and later the ats / european respiratory society ( ers ) issued statements in which they recommended that an absolute change of 200 ml and a relative change of 12% from baseline values be used in order to classify bronchodilator response as significant . those values have also been reported as being indicative of significant changes in fvc after bronchodilator use , being widely used . changes occurring after bronchodilator use can also be expressed in terms of the percentage of predicted values . in two studies , fev1 values higher than 6.0% were recommended . in one of those studies , an fvc value of 6.0% was recommended . the relief of dyspnea and the increase in exercise performance after bronchodilator use in patients with airflow obstruction are due to a reduction in lung hyperinflation , as evidenced by increased inspiratory capacity ( ic ) , increased vital capacity , or both . to our knowledge , a small , single - center study is the only study in which the limits of variation in ic after placebo administration were evaluated . although studies have suggested a cut - off point for ic based on a relevant increase in exercise performance , it remains to be shown whether such values exceed the normal variability . changes in spirometric parameters after bronchodilator use can express variations in flow , volume , or both . the objective of the present study was to establish the upper limits for changes in slow vital capacity ( svc ) and fvc after placebo administration in a large sample of patients with airflow obstruction , as well as to determine how those parameters clustered on factor analysis . the present study was conducted in a referral pulmonary function laboratory in the city of so paulo , brazil . all of the patients who were found to have obstructive disease were asked to return to the laboratory for further spirometry after having discontinued the use of short- and long - acting 2 agonists ( for 12 h and for 24 h , respectively ) and of short- and long - acting theophylline preparations ( for 24 h and for 48 h , respectively ) . all of the study participants gave written informed consent , and the study protocol was approved by the local research ethics committee . a total of 102 adults with airflow obstruction ( asthma , copd , or both ) performed svc maneuvers and , subsequently , fvc maneuvers . airflow obstruction was characterized by an fev1/fvc ratio below the 5th percentile of the predicted value . the spirometric tests were performed with a sensormedics spirometer ( vmax229d ; sensormedics , yorba linda , ca , usa ) , which was calibrated daily . all svc and fvc measurements were performed in accordance with the ats / ers criteria , svc being assessed during an expiratory maneuver . the difference between the highest svc value and the second highest svc value was < 0.150 l. for svc , the largest value obtained from at least three acceptable maneuvers was recorded . for ic , the difference between the largest ic value and the second largest ic value was < 0.100 l. for ic , the values derived from the largest svc were reported . the reference values for forced spirometry and ic were those reported in studies conducted in brazil . within 15 min after the administration of four sprays of placebo , all tests were repeated in the same order , and the same acceptability and reproducibility criteria were applied . general data are expressed as mean sd . the spirometric changes occurring after placebo administration are expressed as follows : absolute ( post - baseline ) values ; percentage of change from baseline values ( post - baseline 100/baseline ) ; and percentage of predicted values ( post - baseline 100/predicted ) . the distribution of absolute changes induced by placebo was tested for normality by the kolmogorov - smirnov test and the shapiro - wilk test , as well as by analysis of normality plots , the skewness coefficient , the kurtosis coefficient , extreme values , and outliers being assessed . outliers were not excluded from the analysis . although the variations in svc and ic showed normal distribution , the variations in fev1 and fvc did not . the correlations of the different expressions of spirometric changes after placebo administration with anthropometric variables were determined by spearman 's test . a two - tailed t - test was used for between - group comparisons . for factor analysis , factors with an eigenvalue > 1 on principal component analysis were included in varimax rotation . for the final model , a scree plot was employed for factor selection , and three factors were retained . the next step was to construct a new factor matrix in order to examine the weight assigned to each variable per factor . all statistical analyses were performed with the ibm spss statistics software package , version 17.0 ( ibm corporation , armonk , ny , usa ) . the clinical and spirometric data before the administration of placebo are shown in table 1 . females predominated , as did patients with a diagnosis of asthma . in 17 , 35 , and 50 of the patients , respectively , fev1 was 40% of the predicted value , 40 - 59% of the predicted value , and 60% of the predicted value . table 1clinical data and pulmonary function test results before the administration of placebo in 102 patients with airflow obstruction.variableresultgender male , n39 female , n63age ( years ) , mean sd55 11smoking status nonsmoker , n50 former smoker , n42 current smoker , n10diagnosis copd , n34 asthma , n64 copd and asthma , n4fev1/fvc% ( % of predicted ) mean sd56 12vc ( % of predicted ) , mean sd89 17fvc ( % of predicted ) , mean sd88 17fev1 ( % of predicted ) , mean sd62 19ic ( % of predicted ) , mean sd83 18ic : inspiratory capacity : inspiratory capacity there were differences between asthma and copd patients in terms of the baseline percentage of predicted fev1 ( fev1% ) . in the 64 patients with asthma , fev1% was 65.3 18.5 , compared with 54.1 19.8 in the 34 copd patients ( t = 2.78 ; p = 0.006 ) . however , the absolute variation in fev1 after the administration of placebo was similar between the two groups of patients : 0.043 0.122 ml in the patients with asthma and 0.009 0.133 ml in those with copd ( t = 1.29 ; p = 0.20 ) . there were no differences between males and females in terms of the absolute changes in fev1 ( 0.045 0.147 ml vs. 0.043 0.147 ml ; t = 1.50 ; p = 0.124 ) . on one - sample analysis , there was no evidence of any learning effect , the mean changes after the administration of placebo being nonsignificantly different from zero . table 2 shows the means , 95% cis , and 95th percentiles for svc , ic , fvc , and fev1 after the administration of placebo , in terms of absolute values , percentage of change from baseline values , and percentage of predicted values . after rounding the values derived from these two methods , we obtained significant values for changes in the spirometric parameters under study ( table 3 ) . table 2mean variations , 95% cis , and 95th percentiles for the absolute values , percentage of change from baseline values , and percentage of predicted values for spirometric parameters after placebo administration.parameter absolute% of change from baseline% of predictedmean95% ci95th percentilemean95% ci95th percentilemean95% ci95th percentilesvc 0.0300.2370.2220.8909.57.50.9207.46.0ic0.0060.2830.3170.03414.115.40.11411.212.5fvc0.0120.1980.2270.2837.36.50.2136.35.6fev1 0.0200.1920.1590.79612.312.70.5497.37.4svc : slow vital capacity;ic : inspiratory capacity : slow vital capacity ; : inspiratory capacity table 3significant variations for absolute values , percentage of change from baseline values , and percentage of predicted values for spirometric parameters after placebo administration.variationabsolute% of change from baseline% of predictedsvc0.25107ic0.301512fvc0.2076fev1 0.20127svc : slow vital capacityic : inspiratory capacity : slow vital capacity : inspiratory capacity spearman 's test revealed no significant correlation between changes in the spirometric parameters and their initial values ( data not shown ) . similarly , there were no correlations between changes in the spirometric parameters and age or between changes in the spirometric parameters and height . significant correlations were found between changes in fev1 and changes in fvc ( rs = 0.62 ; p < 0.001 ) , between changes in svc and changes in fvc ( rs = 0.40 ; p < 0.001 ) , and between changes in scv and changes in ic ( rs = 0.22 ; p = 0.017 ) . by factor analysis , three factors were selected from the scree plot , explaining 92.5% of the total variance of changes after the administration of placebo . the first factor included changes in fev1 and fvc , the second factor included changes in svc and fvc , and the third factor included changes in ic only ( table 4 ) . table 4rotated component matrix for variations in spirometric parameters after placebo administration.parametercomponent123fev1 0.935fvc0.8660.304svc0.976ic0.994svc : slow vital capacityic : inspiratory capacity : slow vital capacity : inspiratory capacity in the present study , we propose upper limits for random short - term variations in parameters assessed by svc and fvc maneuvers in a sample of patients with airflow obstruction . the variations in fev1 were found to be the same as those found in previous studies . however , values for variations in fvc , when expressed as percentage of change from baseline values , were lower . this is the first study to derive values for changes in svc and ic from a large sample . regarding the use of bronchodilators in a pulmonary function laboratory setting , some questions remain : what are the most appropriate parameters to express bronchodilator response?what is the best way to express the changes occurring after medication use?what is the threshold that correlates with clinically significant outcomes ? what are the most appropriate parameters to express bronchodilator response ? what is the best way to express the changes occurring after medication use ? what is the threshold that correlates with clinically significant outcomes ? because it has the greatest sensitivity , the lowest variability , and the best reproducibility , fev1 is the most widely used spirometric parameter . the ats and the ers proposed fev1 and fvc increases of at least 0.20 l and of 12% of change from baseline values on the basis of two studies . one of those studies evaluated the changes occurring after the administration of placebo in 40 patients . the 95% ci for fev1 was 0.18 l when expressed in absolute values and 12.3% when expressed as percentage of change from baseline values . in the present study , these values were 0.19 l and 12.3% , respectively , and , when derived from the 95th percentile , 0.16 and 12.7% . in patients with low fev1 values , the change in fev1 after bronchodilator use commonly exceeds the limit of 12% of change from the baseline value . therefore , it has been suggested that absolute and relative changes should be considered when evaluating the bronchodilator response . in the same study , the upper limits for fvc were 0.34 l ( absolute value ) and 14.9% ( percentage of change from the baseline value ) . in the present study , the fvc values derived from the 95% ci were 0.20 l and 7.3% , whereas those derived from the 95th percentile were 0.23 l and 6.5% . after rounding these values , we propose that the upper limits be set at 0.20 l and 7% . the ats and the ats / ers have stated that the variations in fvc should be the same as those in fev1 , probably on the basis of the expected short - term variability in fev1 and fvc in spirometric maneuvers . although the upper limit for absolute changes in fvc found in the present study is similar to those suggested by the ats , the values for the percentage of change from baseline values are much lower . this will increase the sensitivity of fvc for detecting changes in lung function in a pulmonary function laboratory setting . in another study , 150 patients with obstructive disease underwent two spirometric tests , 20 minutes apart . the increases in fev1 and fvc required in order to exclude a random variation by 95% ci were 0.16 l and 0.33 l , respectively . in a more recent study , fev1 and fvc variations were evaluated after the administration of placebo in 98 patients with copd . the upper limit was found to be 0.18 l for fev1 and 0.28 l for fvc . the most common ways of expressing the bronchodilator response are absolute changes , percentage of change from baseline values , and percentage of predicted values . measurements based on predicted values have the best reproducibility and are the least dependent on baseline values . the values derived in the present study suggest that increases 7% in the predicted fvc and fev1 values exceed the natural variability and can therefore be considered significant . for the sake of the reproducibility of the maneuvers , we believe that changes 0.20 l should also be present in order to characterize a significant response to bronchodilator use . the bronchodilator response evaluated by fev1 has few , if any , clinical implications for copd . the lack of response in a laboratory setting does not translate to a lack of clinical response to bronchodilators or inhaled corticosteroids , as evaluated by short - term relief of dyspnea , long - term relief of dyspnea , improved quality of life , improved exercise capacity , and changes in fev1 . two types of studies have been used in order to derive cut - off points intended to characterize a significant bronchodilator response . post - bronchodilator variations can be considered significant if they exceed those observed in individuals without lung disease or if they exceed the spontaneous variation observed after the administration of placebo in patients with airflow limitation , such as those investigated in the present study . in individuals without lung disease , fev1 increases by less than 10% after bronchodilator use . this cut - off point has been used for distinguishing between asthma and copd patients in some studies . however , this limit can be exceeded in some patients with copd , especially if a combination of beta - agonists and anticholinergic agents is used . airway obstruction leads to progressive air trapping during exhalation , as well as leading to hyperinflation . these changes result in reduced resting ic , increased work of breathing , and lower exercise tolerance . dynamic hyperinflation has been shown to be an independent predictor of decreased daily physical activity and mortality due to respiratory failure in patients with copd . it is possible that patients with copd who do not show a significant response to bronchodilators as assessed by flow ( fev1 ) will show a significant lung volume response as assessed by increased svc and ic . increased ic has been associated with decreased hyperinflation and improved exercise tolerance . many studies involving different classes of bronchodilators have shown associations among increased ic , improved exercise tolerance , and reduced dyspnea in copd patients . however , changes in ic after placebo administration are poorly characterized . in a study involving 26 patients with asthma or copd , the proposed limit for ic changes after placebo administration was a 9% increase from baseline values or 220 ml . in two studies , an increase of more than 0.3 l in ic was associated with a significant improvement in exercise tolerance in patients with copd . in the present study , ic increases of more than 15% in relation to the baseline values , of more than 12% in the predicted values , and of 0.3 l were found to constitute the upper limit for ic after the administration of placebo , values that are similar to those found in those studies . for svc , increases of more than 0.25 l , of more than 10% in relation to baseline values , or of more than 7% in the predicted values can be considered significant . when post - bronchodilator changes in fev1 are proportional to the post - bronchodilator changes in fvc , they can reflect lung volume recruitment and should be considered volume responses . although fev1 and fvc are volume measurements , post - bronchodilator variations in these measurements can reflect increased expiratory flow . an isolated post - bronchodilator variation in fev1 probably reflects bronchial dilation primarily of the central airways , whereas an isolated post - bronchodilator variation in fvc is indicative of bronchial dilation primarily of the peripheral airways . patients with more severe airflow obstruction commonly show an isolated fvc response , which reflects the emptying of very slow lung compartments . therefore , fev1 and fvc both also reflect changes in flow , albeit in different segments of the tracheobronchial tree . it is therefore not surprising that we found a correlation between fev1 changes and fvc changes in the present study , those changes having shared a common factor ( factor 1 ) on factor analysis . in addition , fvc correlated and clustered with svc on factor analysis ( factor 2 ) . interestingly , our factor analysis showed no association between variations in ic and variations in svc , although a significant but weak correlation was found between those two variables . in patients with lung hyperinflation , a reduction in rv is expected after the use of a bronchodilator , reflected by an increase in svc . however , studies including unselected patients have found a poor but significant correlation between variations in rv and variations in svc . it is known that tlc can decrease after bronchodilator use , and this interferes with the abovementioned correlation . the changes in svc after bronchodilator use are inferior to the variation in ic in predicting exercise capacity improvement in copd patients . the real operational limit for volume expansion in air flow during exercise is ic rather than svc . although fvc also increases with the reduction in rv after bronchodilator use , fvc is inferior to svc because it is influenced by thoracic gas compression during forced expiration ( as is fev1 ) . one of the possible limitations of the present study is the inclusion of a large proportion of female asthma patients with mild airflow obstruction . however , there were no differences between the patients with asthma and those with copd in terms of the variations in the parameters studied , and there were no correlations between fev1% and the variation in fev1 after the administration of placebo . in conclusion , we established cut - off points for changes in parameters derived from svc and fvc maneuvers performed after the administration of placebo in a large sample of patients with airflow obstruction . on factor analysis , these parameters clustered into three dimensions , expressing changes in flows , volumes , and dynamic hyperinflation .

objective : to establish the upper limits for changes in fev1 , slow vital capacity ( svc ) , fvc , and inspiratory capacity ( ic ) after placebo administration in patients with airflow obstruction . methods : one hundred and two adults with airflow obstruction ( fev1 = 62 19% of predicted ) were included in the study . all of the participants performed svc and fvc maneuvers before and after the administration of placebo spray . the changes in fev1 , svc , fvc , and ic were expressed as absolute values , percentage of change from baseline values , and percentage of predicted values , 95% cis and 95th percentiles being calculated . factor analysis was performed in order to determine how those changes clustered . results : considering the 95% cis and 95th percentiles and after rounding the values , we found that the upper limits for a significant response were as follows : fev1 = 0.20 l , fvc = 0.20 l , svc = 0.25 l , and ic = 0.30 l ( expressed as absolute values ) ; fev1 = 12% , fvc = 7% , svc = 10% , and ic = 15% ( expressed as percentage of change from baseline values ) ; and fev1 = 7% , fvc = 6% , svc = 7% , and ic = 12% ( expressed as percentage of predicted values ) . conclusions : in patients with airflow obstruction , ic varies more widely than do fvc and svc . for ic , values greater than 0.30 l and 15% of change from the baseline value can be considered significant . for fvc , values greater than 0.20 l and 7% of change from the baseline value are significant . alternatively , changes exceeding 0.20 l and 7% of the predicted value can be considered significant for fev1 and fvc . on factor analysis , spirometric parameters clustered into three dimensions , expressing changes in flows , volumes , and dynamic hyperinflation .

rosacea is a common , progressive , chronic , and in many cases cyclic , inflammatory skin disorder that presents with a variety of clinical manifestations that are primarily localized to the central face . rosacea affects up to 10% of the us population and occurs most commonly in adults between 30 and 60 years of age and in fair - skinned individuals of celtic and northern european heritage [ 1 , 2 ] . the disorder is divided into four main subtypes based upon groupings of primary and secondary features : ( 1 ) erythematotelangiectatic ( centrofacial redness ) ; ( 2 ) papulopustular ( acne - like inflammatory papules and pustules ) ; ( 3 ) phymatous ( marked skin thickening and distortion of facial contours , more often in men ) , and ( 4 ) ocular rosacea ( eye redness , pruritus , or irritation ) . granulomatous rosacea is a variant of rosacea ( yellow - brown or pink papules ) . the cause of rosacea is unclear , and many hypotheses have been proposed based upon the numerous contributing factors and triggers that lead to flare ups of rosacea , including sun exposure , extreme temperature , spicy food , alcohol , stress , topical irritation , and drugs ( vasodilators , nicotinic acid ) . multiple lines of evidence in recent years have led many experts to believe that rosacea is primarily caused and exacerbated by an overactive inflammatory immune response . it has been hypothesized that excessive upregulation of inflammatory mediators and/or dysregulation of innate immune function may underlie the diverse range of rosacea signs and symptoms including vasodilation , redness , angiogenesis , edema , and the formation of papules and pustules [ 4 , 5 , 6 ] . in this model , environmental stressors ( ultraviolet light radiation , heat , cold , spicy food , and alcohol ) , microbes , and certain types of bacteria stimulate an innate immune system signaling cascade leading to the overproduction and activation of cytokines , chemokines , antimicrobial peptides ( cathelicidins ) , and other proinflammatory mediators that result in tissue destruction and infiltration by inflammatory cells such as neutrophils and lymphocytes . this excessive , uncontrolled inflammatory response is believed to be responsible for the clinical manifestations of rosacea , and many researchers suggest that targeting and controlling excess inflammation should be the goal for new rosacea therapeutics in development [ 4 , 6 , 7 , 8 ] . regardless of the etiology , the consequent redness and inflammation of the face in rosacea is difficult for the patient , does not respond particularly well to treatment , and is frustrating for both physician and patient . topical and oral medications used to treat rosacea have equivocal clinical efficacy , and there is a recognized need for more effective , safe , and well - tolerated long - term treatment options . compounds that alleviate or control excessive inflammation in the skin are likely to provide relief from many of the symptoms of rosacea , and many rosacea sufferers are beginning to experiment with new , non - prescription treatments with unproven safety or efficacy . briefly put , there are no current effective ways for a patient with rosacea to reliably improve the appearance of their skin . anatabine is a minor alkaloid found in plants of the solanaceae family , including peppers , tomatoes , potatoes , eggplant , and tobacco , that is being investigated as a modulator of systemic inflammation . researchers have shown that anatabine exhibits anti - inflammatory effects in a number of in vivo and in vitro studies . in a transgenic model of alzheimer 's disease , anatabine administration resulted in the downregulation of the proinflammatory molecule amyloid due to reduced activation of nuclear factor b ( nf-b)-dependent pathways , and anatabine significantly lowered plasma levels of the inflammatory marker c - reactive protein in these animals . anatabine has also been shown to block the production of proinflammatory cytokines such as il-1 , il-6 , and tnf- in the blood and tissues of mice injected with lipopolysaccharide by blocking the activation of the transcription factors nf-b and stat3 . investigated the effects of anatabine in a mouse model of autoimmune thyroiditis and found that anatabine significantly reduced several markers of systemic inflammation . although the precise mechanism underlying the diverse immunomodulatory effects of anatabine is unclear , a topical cream containing anatabine may provide anti - inflammatory benefits when applied to the skin by interfering with proinflammatory signaling pathways . the purpose of this open - label case series study was to examine the safety , tolerability , and effects of a facial cream containing anatabine in patients with mild to moderate rosacea , principally to determine if it could improve the appearance of the skin . this case series was conducted at a private dermatology clinic located in bradenton , fla . , patients interested in taking part in this case series provided written informed consent , which included consent to use facial photographs for scientific presentation or publication , before any study - related procedures took place . each patient was treated as clinically indicated , and patient confidentiality was protected . on day 1 , patients came to the clinic for baseline assessment , had photographs taken , and received instructions for using the anatabine cream . for the duration of the 30-day study period patients rated 6 components of their baseline skin appearance and rosacea symptoms ( overall skin appearance ; appearance of rosacea ; redness / blotchiness ; skin tone and color ; blemishes , and dryness / flakiness ) on a 4-point scale from 0 ( absent ) to + 3 ( severe ) by filling out the patient global assessment ( patga ) , and the physician rated the cardinal signs of rosacea using the physician 's global assessment ( phyga ) , as described by wilkin et al . . clinic staff called patients approximately 2 weeks after day 1 to ask about their experience using the cream . patients returned to the clinic approximately 30 days after day 1 for final assessments and photographs . at this visit , patients and the physician rated the effectiveness of the cream by filling out the patient efficacy assessment ( patea ) and the physician 's efficacy assessment ( phyea ) , respectively . the patea and phyea each consisted of a 5-point rating scale from 1 ( worse ) to + 3 ( cleared up ) . all patients were questioned for any adverse events , side effects , or complaints they experienced during the 30-day treatment period . a total of 10 acne rosacea patients ( 7 women , 3 men ; mean age 69.0 8.58 years ; age range 5181 years ; all caucasian ) took part in this case series . at baseline , all study patients self - reported the overall appearance of rosacea to be either mild ( 1 of 10 , 10% ) or moderate ( 9 of 10 , 90% ) on the patga . redness and blotchiness were reported as mild for 5 ( 50% ) of the patients and moderate for the remaining 5 ( 50% ) patients ( fig . the physician assessed that all of the patients had either subtype 1 ( erythematotelangiectatic ) or subtype 2 ( papulopustular ) rosacea , or a combination of the two ( table 1 ) . the majority of patients ( 8 of 10 , 80% ) had moderate subtype 1 rosacea . other results from the phyga indicated that , for all patients , flushing was mild ( 4 of 10 , 40% ) or moderate ( 6 of 10 , 60% ) ; erythema was mild ( 2 of 10 , 20% ) or moderate ( 8 of 10 , 80% ) ; papules and pustules were absent ( 4 of 10 , 40% ) , mild ( 3 of 10 , 30% ) , or moderate ( 3 of 10 , 30% ) , and telangiectasia was moderate ( 9 of 10 , 90% ) or severe ( 1 of 10 , 10% ) . secondary features of rosacea were noted to be absent in these patients . at the end of the 30-day period , rosacea improvement was noted in 7 of the 10 ( 70% ) patients ; no improvement was observed in 2 ( 20% ) patients , and worsening occurred in 1 ( 10% ) patient ( fig . five ( 50% ) patients reported rosacea improvement , 4 ( 40% ) patients reported no improvement , and 1 ( 10% ) patient reported worsening of their skin ( fig . representative before and after photographs showing marked improvement in overall rosacea appearance for 2 patients following 30 days of anatabine cream use are shown in figure 3 . in the present open - label case series study , twice daily application of a topical facial cream containing the minor alkaloid anatabine was shown to improve the appearance of the skin in patients with mild to moderate rosacea . as rated by the physician , skin appearance improved in 70% of the patients , and 50% of the patients self - reported an improvement following 30 days of topical application . there were no complications or adverse events reported by any of the patients in the case series , indicating that the investigative product was safe and very well tolerated . anatabine has been shown in multiple in vitro and in vivo models of excessive inflammation to attenuate the production of proinflammatory mediators through a reduction in the activation of the transcription factors nf-b and stat3 [ 9 , 10 , 11 , 13 ] . research has shown that nf-b is involved in the upregulation of the antimicrobial peptides ( cathelicidins ) and other proinflammatory mediators believed to be involved in the progression and severity of rosacea [ 14 , 15 ] . . showed that the topical rosacea treatment azelaic acid inhibited ultraviolet light - induced activation and translocation of nf-b and reduced the production of proinflammatory cytokines in human keratinocytes . therefore , anatabine may provide anti - inflammatory benefits when applied topically by interfering with nf-b activation , or through inhibition of some other related proinflammatory signaling mechanism ( fig . an important consideration when evaluating a topically applied product containing a plant - based compound for a condition characterized by sensitive skin such as rosacea is its risk of inducing contact dermatitis [ 17 , 18 ] . anatabine is an alkaloid found in a wide range of solanaceae family plants , including many commonly consumed food staples such as tomatoes and potatoes , but to date , there have been no published reports of any hypersensitivity or allergic reactions directly attributed to the ingestion of or skin exposure to anatabine . results from this case series suggest that contact dermatitis was not an issue for the patients using the anatabine cream ; however , future studies of the cream in larger populations of patients should further evaluate this possibility . most patients in this case series had moderate erythematotelangiectatic rosacea , which is characterized by persistent flushing and redness , and may include stinging , burning , and swelling . these particular signs and symptoms of rosacea could be due to excessive , uncontrolled inflammation in the skin , and thus may respond particularly well to treatment with a topical anatabine preparation . it is uncertain if other subtypes of rosacea , particularly those involving papules and pustules and/or tissue / vascular damage , would respond as favorably . further studies focusing on the effects of an anatabine - based cream on other subtypes of rosacea would provide more insight into the actions of this compound . it must be noted that interpretation of the results of this case series is limited due to the small sample size and lack of a control group . the primary objectives of this case series were to determine if twice daily application of the anatabine cream was safe and if it would improve the appearance of the skin in a small sample of patients primarily suffering from persistent erythema due to rosacea . both objectives were met , although there was some disparity in the perceived effectiveness of the cream between the patients and the physician , as indicated by the patea and the phyea assessment scores . the physician rated a greater degree of improvement ( i.e. 1 or 2 points ) than the patient in 6 of 10 cases , whereas only 1 patient 's self - reported rating of improvement was greater than the physician 's rating . this difference in perceived outcome could be due to the fact that patients saw themselves every day and might not have noticed changes happening over time , whereas the physician saw them once at baseline , and then again after 30 days . other studies of rosacea treatments have resulted in a similar phenomenon in which investigator ratings of success or improvement were typically of a greater magnitude or frequency than study subjects ratings , although not necessarily statistically different [ 19 , 20 , 21 , 22 ] . a possible solution to reduce or eliminate this type of rating disparity between observer and self - reported measures would be the use of before and after photographs for comparison purposes for both physician and patient use . in conclusion , results from this open - label case series show that daily application of a topical facial cream containing the minor alkaloid anatabine is safe and well tolerated and can reduce the signs and symptoms of mild to moderate rosacea . improving the appearance of the skin by reducing persistent erythema , and possibly other signs and symptoms of rosacea , could lead to an overall increase in the quality of life for those dealing with this chronic disease . a larger , double - blind , vehicle - controlled trial of the anatabine facial cream in subjects with mild to moderate rosacea appears to be warranted . s.h.w . received no funding for this study from rcp , and has no conflicts of interest to declare .

backgroundcurrent medical and scientific research indicates that rosacea , a chronic and often debilitating skin condition that primarily affects the central face , may be caused by an overactive or excessive inflammatory immune response . regardless of etiology , the accompanying redness and inflammation is unsightly and difficult for the patient . anatabine is an alkaloid from the plant family solanaceae that has been shown in several preclinical studies to modulate proinflammatory signaling pathways.objectivea cream containing anatabine was developed and evaluated in an open - label case series study for safety and effects on the appearance of the skin in 10 patients with mild to moderate rosacea.methodspatients applied the cream to the face twice daily for a period of 30 days . patients and the study physician completed safety and efficacy assessments at study end.resultsresults showed that 50% of the patients self - reported improvement in the appearance of their skin , and the physician noted improvement in 70% of the patients . photographs taken before and after 30 days of cream use provide visual evidence of the improvement in several patients . there were no complications or adverse events reported by any of the patients in the study , indicating that the anatabine cream was safe and very well tolerated.conclusionthe results of this open - label case series show that a facial cream containing anatabine can improve the appearance of the skin in patients with mild to moderate rosacea and suggest that a double - blind , vehicle - controlled trial in a larger number of subjects is warranted .

simulation modeling is an operational research technique that can be used to predict the impact of specified changes to a defined pathway , such as changes to the screening policies for diabetic retinopathy in this instance . by using existing data , such as the incidence and progression rates of diabetic retinopathy , we can construct a model that simulates the progression of the disease and patient screening , thereby allowing us to alter parameters to generate predictions on the impact of certain changes . the patient - oriented simulation technique ( post ) is a well - regarded example of a simulation model that has been used to evaluate screening strategies for diabetic retinopathy ( 1,11 ) . we developed a new model , retinopathy screening simulation ( ress ) , that builds upon post , by placing it within a modeling framework that explicitly models each patient separately , allowing us to more easily model screening and retinopathy progression . in ress , each patient has a state that specifies how far their retinopathy has progressed , whether they have lost their vision , or whether they have died . . national screening committee grading system ( 5 ) : r0 indicates no retinopathy , and r1 , r2 , and r3 indicate background diabetic retinopathy ( bdr ) , preproliferative diabetic retinopathy ( pre - pdr ) , and pdr , respectively . worst eye ( the one that has the most advanced development of retinopathy ) . a patient who has lost their vision in at least one eye has a state called vision loss , and a patient who has died has a state called death . in our model , patients are given a baseline grade of retinopathy and an age . this flowchart summarizes the process steps that patients in the model follow . for every day that elapses in the model , a patient in the model may die ( which is dependent upon their age and progression of their retinopathy ) or may progress to the next stage of retinopathy . in addition , a patient may have a screening or treatment appointment scheduled on that day . if a patient in the model is due to be screened , they may or may not attend , depending on their compliance . if they do not attend , another appointment is arranged . if they do not arrange another appointment after this , they are removed from the model . patients in the model who attend a screening appointment are screened for retinopathy using digital retinal photography ( 3 ) , which is carried out by retinal screening graders . the probability that the test provides a true positive or a true negative is given by the test s sensitivity and specificity , respectively . if a patient receives a negative result , no further action is taken , and their next screening appointment is arranged according to their risk . r0 and r1 patients are screened annually ( except in the proposed new policy , where r0 patients are screened every 2 years ) and r2 patients are screened every 6 months , in line with the minimum standards derived from the nice guidelines ( 4 ) . if a patient receives a positive result , this is assessed by a secondary retinal grader , such as the retinal screening service manager , who checks the results of the primary grader to maximize diagnostic accuracy . if the secondary grader identifies that the patient does not have retinopathy , or they have stage r1 or r2 retinopathy , the patient s next screening appointment is arranged according to their disease progression . if the graders identify the patient as having pdr ( r3 ) , treatment is given . if a patient in the model is to be treated , then the treatment may or may not succeed . if the treatment does succeed , the patient s probability of developing vision loss from state r3 is reduced . either way , for simplification , the patient does not attend any further screening appointments . when populating the retinopathy model ( ress ) , we considered two different scenarios : the 2s ( or two - stream ) scenario represents the current world order , in which patients are screened either annually or every 6 months , and the 3s ( or three - stream ) scenario represents the proposed strategy of screening r0 patients every 2 years , rather than annually . for simplification , we assume 1 year to be 365 days and 6 months to be 182 days . each scenario was simulated for 15 years and replicated 10 times , with results averaged over the replications . royal devon and exeter supplied an anonymized patient dataset for the project , which was comprised of those records that could be cross - matched across both the internal screening administration system and the internal clinical database , to provide all required data . this provided us with 3,537 unique patient records and 33,810 unique screening appointments dating from 1991 to 2011 , of which 2,201 patients were type 2 diabetic patients . patient records included patient sex , date of diagnosis of diabetes , type of diabetes , screening dates , and latest screening grade . appointment records specified the date and time of the appointment , the patient s age at the appointment , whether or not the appointment was cancelled and the reason for cancellation , and the screening grade given as an outcome of the appointment . the royal devon and exeter data show that patients are 86% likely to attend a screening appointment . if an appointment is missed , an alternative appointment is usually arranged within a few days , but can be much longer if the patient has to be fitted into a clinic at the hospital . as such , the average time given by the royal devon and exeter data is 93 days . although this is not representative of common shorter waits , we implement this figure in the model as a worst - case scenario . we used a diabetes incidence rate of 4.42/1,000 person - years in the model as an initial estimate ( 17 ) and increased this by 4.1% of the initial incidence rate at the end of each year ( 18 ) . the ages of patients in the model were drawn directly from the patient data supplied by royal devon and exeter . mortality rates for patients in the model were based on data from a 2005 study of mortality in diabetic patients ( 19 ) , which also included a cox proportional hazards model , from which we estimated rate adjustments for the various stages of retinopathy . rates were averaged across both sexes for each age group and were converted to daily mortality rates . the r - grade distributions at baseline in the model were taken from the first screening grades on record for each type 2 diabetic patient in the royal devon and exeter data . therefore , for patients within the model , 54.9% started at r0 , 37.6% at r1 , 4.9% at r2 , and 2.6% at r3 . this compares to 73% at r0 , 18% at r1 , 2% at moderate r2 , and 0.5% at r3 in the liverpool diabetic eye study ( 7 ) . the higher rates of background retinopathy and above at baseline in the royal devon and exeter data may indicate an increased risk of retinopathy in this population . sensitivity and specificity data for the digital retinal photography screening test were supplied by royal devon and exeter and are 98.86 and 99.52% , respectively . they also provided an nhs cost figure of 37 per screening episode , which is typical of screening units in the u.k . positive results are typically assessed within 1 week after the screening appointment , but the dataset included data from a period of historical backlogs ; therefore , the average across the dataset was 20 days . we used a value of 20 days in the model to represent a worst - case scenario . grading assessments ( after initial grading ) are assumed to be 100% accurate , as they are checked multiple times by other graders . if a patient in the model is diagnosed with pdr ( r3 ) , they are sent for treatment 14 days later , which is the minimum requirement according to nhs quality assurance standards ( 20 ) . a patient s laser photocoagulation treatment occurs as a single episode in the model , for the purposes of simplification , and is 84% likely to succeed ( 21 ) . if successful , the treatment reduces the risk of progression to vision loss by 90% ( 3 ) . the data supplied by royal devon and exeter did not include a way of tracking disease progression rates . we conducted an extensive search of papers published after the wisconsin epidemiologic study of diabetic retinopathy ( 12 ) , upon which the post study was based ( 1,11 ) , to see if there had been any newer , but similar , large - scale cohort studies that drew from a wide diabetic population and looked at the progression of diabetic retinopathy . we found the closest match to be a cohort study of diabetic patients in melbourne ( 13 ) , in which baseline checks were performed between 1992 and 1994 , with follow - up checks performed 5 years later . over 5 years , the probability of progression from no retinopathy to background retinopathy was 0.096 , from background to preproliferative retinopathy was 0.187 , from preproliferative to proliferative retinopathy was 0.25 , and from proliferative retinopathy to vision loss was 0.22 . the melbourne cohort included a 22.6% prevalence of insulin - treated diabetic patients and a higher mean hemoglobin a1c ( hba1c ) , a potential indication of poor diabetes control , in people who progressed to retinopathy ( 13 ) . the progression rates used in this study therefore implicitly include those patients who are at higher risk of developing diabetic retinopathy ( 13 ) . diabetic maculopathy is a form of retinopathy that is common in the elderly and typically occurs after bdr has developed ( 11 ) . patients are screened for maculopathy in their retinopathy screening sessions , as patients can develop combinations of retinopathy and diabetic macular edema ( dmo ) or clinically significant macular edema ( csmo ) ( 11 ) in conjunction with their diabetes . of all patients in the royal devon and exeter data , 8.5% were recorded as having some form of diabetic maculopathy ( grade m1 of the u.k . national screening committee grading system ) ( 5 ) . to minimize complexity in ress , and because our focus was on the diabetic retinopathy complication , which more commonly causes blindness and affected more patients than maculopathy in the royal devon and exeter dataset , we did not include a simulation of the progression of maculopathy in ress . however , to ensure that the results obtained from ress would remain applicable even when considering patients who develop maculopathy , we developed a small spreadsheet model using microsoft excel that includes maculopathy and calculates the expected number of patients in each possible stage of disease progression for each year in a 15-year period . unlike ress , the maculopathy comparison model only simulates the progression of patients diabetes complications and does not consider screening , as this requires a more complex modeling framework , such as that used for ress . however , this is not problematic , because we were simply seeking to assess how maculopathy progression rates affect the proportion of patients that lose their vision . maculopathy can occur at any stage of progression of diabetic retinopathy ( 11 ) and therefore can not be simulated using a single linear disease progression path . instead , we took into account all of the possible permutations of retinopathy and maculopathy ( both dmo and csmo severities ) and modeled each potential route of progression as a separate path . specifically , a diabetic patient can develop retinopathy and/or maculopathy in any one of seven different ways ( table 1 ) , each of which can be considered a path of progression of the disease ( 11 ) . progression paths in the maculopathy comparison model for each path , a population of 5,000 type 2 diabetic patients was modeled over a period of 15 years . we used progression rates from the post study ( 1,11 ) to determine the predicted number of patients at each stage in the path in each year . all patients start without retinopathy or maculopathy ( r0m0 ) in the maculopathy comparison model , no patients die for simple comparison between paths , and , for simplification and to mimic a cohort - style study , no new patients are added over time . simulation modeling is an operational research technique that can be used to predict the impact of specified changes to a defined pathway , such as changes to the screening policies for diabetic retinopathy in this instance . by using existing data , such as the incidence and progression rates of diabetic retinopathy , we can construct a model that simulates the progression of the disease and patient screening , thereby allowing us to alter parameters to generate predictions on the impact of certain changes . the patient - oriented simulation technique ( post ) is a well - regarded example of a simulation model that has been used to evaluate screening strategies for diabetic retinopathy ( 1,11 ) . we developed a new model , retinopathy screening simulation ( ress ) , that builds upon post , by placing it within a modeling framework that explicitly models each patient separately , allowing us to more easily model screening and retinopathy progression . in ress , each patient has a state that specifies how far their retinopathy has progressed , whether they have lost their vision , or whether they have died . . national screening committee grading system ( 5 ) : r0 indicates no retinopathy , and r1 , r2 , and r3 indicate background diabetic retinopathy ( bdr ) , preproliferative diabetic retinopathy ( pre - pdr ) , and pdr , respectively . worst eye ( the one that has the most advanced development of retinopathy ) . a patient who has lost their vision in at least one eye has a state called vision loss , and a patient who has died has a state called death . in our model , patients are given a baseline grade of retinopathy and an age . this flowchart summarizes the process steps that patients in the model follow . for every day that elapses in the model , a patient in the model may die ( which is dependent upon their age and progression of their retinopathy ) or may progress to the next stage of retinopathy . in addition , a patient may have a screening or treatment appointment scheduled on that day . if a patient in the model is due to be screened , they may or may not attend , depending on their compliance . if they do not attend , another appointment is arranged . if they do not arrange another appointment after this , they are removed from the model . patients in the model who attend a screening appointment are screened for retinopathy using digital retinal photography ( 3 ) , which is carried out by retinal screening graders . the probability that the test provides a true positive or a true negative is given by the test s sensitivity and specificity , respectively . if a patient receives a negative result , no further action is taken , and their next screening appointment is arranged according to their risk . r0 and r1 patients are screened annually ( except in the proposed new policy , where r0 patients are screened every 2 years ) and r2 patients are screened every 6 months , in line with the minimum standards derived from the nice guidelines ( 4 ) . if a patient receives a positive result , this is assessed by a secondary retinal grader , such as the retinal screening service manager , who checks the results of the primary grader to maximize diagnostic accuracy . if the secondary grader identifies that the patient does not have retinopathy , or they have stage r1 or r2 retinopathy , the patient s next screening appointment is arranged according to their disease progression . if the graders identify the patient as having pdr ( r3 ) , treatment is given . if a patient in the model is to be treated , then the treatment may or may not succeed . if the treatment does succeed , the patient s probability of developing vision loss from state r3 is reduced . either way when populating the retinopathy model ( ress ) , we considered two different scenarios : the 2s ( or two - stream ) scenario represents the current world order , in which patients are screened either annually or every 6 months , and the 3s ( or three - stream ) scenario represents the proposed strategy of screening r0 patients every 2 years , rather than annually . for simplification , we assume 1 year to be 365 days and 6 months to be 182 days . each scenario was simulated for 15 years and replicated 10 times , with results averaged over the replications . royal devon and exeter supplied an anonymized patient dataset for the project , which was comprised of those records that could be cross - matched across both the internal screening administration system and the internal clinical database , to provide all required data . this provided us with 3,537 unique patient records and 33,810 unique screening appointments dating from 1991 to 2011 , of which 2,201 patients were type 2 diabetic patients . patient records included patient sex , date of diagnosis of diabetes , type of diabetes , screening dates , and latest screening grade . appointment records specified the date and time of the appointment , the patient s age at the appointment , whether or not the appointment was cancelled and the reason for cancellation , and the screening grade given as an outcome of the appointment . the sex of 53 patients ( 1.5% ) was not specified . the royal devon and if an appointment is missed , an alternative appointment is usually arranged within a few days , but can be much longer if the patient has to be fitted into a clinic at the hospital . as such , the average time given by the royal devon and exeter data is 93 days . although this is not representative of common shorter waits , we implement this figure in the model as a we used a diabetes incidence rate of 4.42/1,000 person - years in the model as an initial estimate ( 17 ) and increased this by 4.1% of the initial incidence rate at the end of each year ( 18 ) . the ages of patients in the model were drawn directly from the patient data supplied by royal devon and exeter . mortality rates for patients in the model were based on data from a 2005 study of mortality in diabetic patients ( 19 ) , which also included a cox proportional hazards model , from which we estimated rate adjustments for the various stages of retinopathy . rates were averaged across both sexes for each age group and were converted to daily mortality rates . the r - grade distributions at baseline in the model were taken from the first screening grades on record for each type 2 diabetic patient in the royal devon and exeter data . therefore , for patients within the model , 54.9% started at r0 , 37.6% at r1 , 4.9% at r2 , and 2.6% at r3 . this compares to 73% at r0 , 18% at r1 , 2% at moderate r2 , and 0.5% at r3 in the liverpool diabetic eye study ( 7 ) . the higher rates of background retinopathy and above at baseline in the royal devon and exeter data may indicate an increased risk of retinopathy in this population . sensitivity and specificity data for the digital retinal photography screening test were supplied by royal devon and exeter and are 98.86 and 99.52% , respectively . they also provided an nhs cost figure of 37 per screening episode , which is typical of screening units in the u.k . positive results are typically assessed within 1 week after the screening appointment , but the dataset included data from a period of historical backlogs ; therefore , the average across the dataset was 20 days . we used a value of 20 days in the model to represent a worst - case scenario . grading assessments ( after initial grading ) are assumed to be 100% accurate , as they are checked multiple times by other graders . if a patient in the model is diagnosed with pdr ( r3 ) , they are sent for treatment 14 days later , which is the minimum requirement according to nhs quality assurance standards ( 20 ) . a patient s laser photocoagulation treatment occurs as a single episode in the model , for the purposes of simplification , and is 84% likely to succeed ( 21 ) . if successful , the treatment reduces the risk of progression to vision loss by 90% ( 3 ) . the data supplied by royal devon and exeter did not include a way of tracking disease progression rates . we conducted an extensive search of papers published after the wisconsin epidemiologic study of diabetic retinopathy ( 12 ) , upon which the post study was based ( 1,11 ) , to see if there had been any newer , but similar , large - scale cohort studies that drew from a wide diabetic population and looked at the progression of diabetic retinopathy . we found the closest match to be a cohort study of diabetic patients in melbourne ( 13 ) , in which baseline checks were performed between 1992 and 1994 , with follow - up checks performed 5 years later . over 5 years , the probability of progression from no retinopathy to background retinopathy was 0.096 , from background to preproliferative retinopathy was 0.187 , from preproliferative to proliferative retinopathy was 0.25 , and from proliferative retinopathy to vision loss was 0.22 . the melbourne cohort included a 22.6% prevalence of insulin - treated diabetic patients and a higher mean hemoglobin a1c ( hba1c ) , a potential indication of poor diabetes control , in people who progressed to retinopathy ( 13 ) . the progression rates used in this study therefore implicitly include those patients who are at higher risk of developing diabetic retinopathy ( 13 ) . diabetic maculopathy is a form of retinopathy that is common in the elderly and typically occurs after bdr has developed ( 11 ) . patients are screened for maculopathy in their retinopathy screening sessions , as patients can develop combinations of retinopathy and diabetic macular edema ( dmo ) or clinically significant macular edema ( csmo ) ( 11 ) in conjunction with their diabetes . of all patients in the royal devon and exeter data , 8.5% were recorded as having some form of diabetic maculopathy ( grade m1 of the u.k . national screening committee grading system ) ( 5 ) . to minimize complexity in ress , and because our focus was on the diabetic retinopathy complication , which more commonly causes blindness and affected more patients than maculopathy in the royal devon and exeter dataset , we did not include a simulation of the progression of maculopathy in ress . however , to ensure that the results obtained from ress would remain applicable even when considering patients who develop maculopathy , we developed a small spreadsheet model using microsoft excel that includes maculopathy and calculates the expected number of patients in each possible stage of disease progression for each year in a 15-year period . unlike ress , the maculopathy comparison model only simulates the progression of patients diabetes complications and does not consider screening , as this requires a more complex modeling framework , such as that used for ress . however , this is not problematic , because we were simply seeking to assess how maculopathy progression rates affect the proportion of patients that lose their vision . maculopathy can occur at any stage of progression of diabetic retinopathy ( 11 ) and therefore can not be simulated using a single linear disease progression path . instead , we took into account all of the possible permutations of retinopathy and maculopathy ( both dmo and csmo severities ) and modeled each potential route of progression as a separate path . specifically , a diabetic patient can develop retinopathy and/or maculopathy in any one of seven different ways ( table 1 ) , each of which can be considered a path of progression of the disease ( 11 ) . progression paths in the maculopathy comparison model for each path , a population of 5,000 type 2 diabetic patients was modeled over a period of 15 years . we used progression rates from the post study ( 1,11 ) to determine the predicted number of patients at each stage in the path in each year . all patients start without retinopathy or maculopathy ( r0m0 ) in the maculopathy comparison model , no patients die for simple comparison between paths , and , for simplification and to mimic a cohort - style study , no new patients are added over time . the proportion of type 2 diabetic patients in the ress model who are predicted to lose their vision within 15 years is 1.9% ( 0.1 sd ) and is identical under both scenarios ( fig . the figure shows the total proportion of type 2 diabetic patients in the model who lost their vision within the simulated period of 15 years . results are shown for both the current screening policy ( 2s ) and the proposed three - tier screening policy ( 3s ) . results are averaged over 10 replications of the simulation . over 15 years , the proposed new screening policy ( the 3s scenario ) is predicted to incur 1,360,516 ( 10,036 sd ) in costs for screening type 2 diabetic patients , compared with 1,834,060 ( 21,286 sd ) with the current screening policy ( the 2s scenario ) ( fig . 3 ) . this represents a 25.8% reduction in screening costs if type 2 diabetic patients without retinopathy are screened every 2 years instead of annually . furthermore , ress predicts that only 12,561 screening appointments ( 227 sd ) would be carried out for type 2 diabetic patients without retinopathy over 15 years under the new screening policy , compared with 23,611 appointments ( 454 sd ) under the existing policy , a reduction of 11,050 appointments over 15 years or 737 appointments per year . the figure compares the estimated total type 2 diabetic patient screening costs over 15 years of the current screening policy ( 2s ) with the proposed three - tier screening policy ( 3s ) . , we found that the results were insensitive to variations in all of the key parameter values , with the exception of progression rates of retinopathy . unsurprisingly , here the outputs were highly sensitive to variation and gave vision loss percentages ranging from 0.71 to 5.71% of the population when halving and doubling the implemented progression rates , respectively . the melbourne study does report a significantly lower incidence of new retinopathy diagnosis than other studies ( 13 ) but points out that the retinopathy progression rates were similar to other studies ( within a maximum of 11% variation ) , including the wisconsin epidemiologic study of diabetic retinopathy ( 12 ) . we are therefore confident that the progression rates reported by the melbourne study and used to parameterize our model are sufficiently representative . of all the permutations tested in the maculopathy comparison model , the highest percentage of patients who are predicted to lose their vision within 15 years is 1.2% , which refers to patients who develop both dmo and csmo in the background stages of retinopathy ( path f ) . this compares to 2.1% of patients for the group that never develops maculopathy , only retinopathy ( path a ) . when building any model , it is vital to extensively verify and validate it to maximize the reliability of the predictions that it generates . verification is the process of checking that the model performs as expected by the design and that it is free of errors , whereas validation checks that the model produces the kind of behavior and outputs that would be expected . our model predicts that it is safe to screen type 2 diabetic patients who have not been diagnosed with retinopathy every 2 years , rather than annually , because the proportion of patients who develop retinopathy - mediated vision loss is unaffected . furthermore , such a policy could reduce the cost of screening by 25% , thereby mitigating the problem of increased demand on screening services arising from significant increases in diabetic prevalence . the proportion of patients developing vision loss remains the same under the new policy because retinopathy progresses slowly , and a screening interval of 2 years is sufficiently frequent to identify patients at or before the proliferative stage , where treatment can be given . by increasing the screening interval for patients without retinopathy , however , even if a patient progresses through one or two stages of retinopathy in the 2-year interval , they will be screened more frequently once this is identified . it is unlikely that a lower - risk patient would progress from no retinopathy to the proliferative stage within a 2-year period , given the slow rate of progress of the disease for many patients . the proportion of patients who lose their vision when considering maculopathy complications never exceeds that of the population that never develops maculopathy . therefore , the 2-year screening interval predicted to be safe by ress would not be problematic for these patients . although the predictions generated by ress are compelling , it is prudent to highlight potential caveats to a proposed policy of 2-year screening intervals . first , diabetic care is most effective when individualized ( 2224 ) , and the importance of retinal clinicians using discretion on a case - by - case basis can not be overstated . diabetic retinopathy has been shown to be closely linked to individual risk factors ( 2528 ) , and in some cases such risks ( longer duration of diabetes , poor metabolic control , or a dramatic change in glycemic levels ) may necessitate more frequent screening because of the potentially higher rates of progression in these patients . even if these patients do not show signs of retinopathy , more frequent screening may be prudent due to the increased risk for this subpopulation . second , there is concern that longer screening intervals could lead to patients misunderstanding the severity of retinopathy or forgetting to attend screening appointments ( 16 ) . however , this is unlikely to be problematic if a computerized call - recall system is used to administer the screening program , but could be explored by comparing the impact of nonattendance with the cost and resource benefits of a 2-year screening interval . nevertheless , it may be wise to ensure that any potential screening interval changes are coupled with a strategy of educating patients about retinopathy and emphasizing the importance of good control in managing the diabetic condition . third , some of the key risk factors for diabetic retinopathy , such as the level of glycemic control and blood pressure , are also associated with other nonocular complications , such as nephropathy , neuropathy , and strokes ( 2 ) . more frequent screening may be beneficial in identifying such complications earlier , although patients with diabetes would continue to receive annual check - ups for their condition even with a reduction in retinopathy screening , and therefore such risk factors could be identified at these sessions . even with these caveats , the predictions generated by the model certainly present an appealing argument for extending the screening interval for diabetic retinopathy in a subset of type 2 diabetic patients . although our study did not look at linking patients clinical risk factors with their recommended screening intervals , our results imply that significant benefits can be brought about simply by reducing the screening interval for patients who have not yet developed retinopathy . our predictions also support the findings of other studies that have found longer screening intervals for diabetic retinopathy to be cost - effective ( 7,15,16 ) . we would therefore recommend a review of the current nice guidelines , which suggest an annual retinopathy screening , at minimum , for diabetic patients , as a way of addressing the projected increased burden that will be placed on nhs screening services without increasing the risk of poor outcomes . in addition , extensions to this research that explicitly consider the impact of risk factors , such as through individualization of screening intervals ( 29 ) , may be beneficial in assessing whether diabetic patients who have developed retinopathy can also be screened less frequently , depending on their clinical assessment and control of their condition .

objectivein the u.k . , people with diabetes are typically screened for retinopathy annually . however , diabetic retinopathy sometimes has a slow progression rate . we developed a simulation model to predict the likely impact of screening patients with type 2 diabetes , who have not been diagnosed with diabetic retinopathy , every 2 years rather than annually . we aimed to assess whether or not such a policy would increase the proportion of patients who developed retinopathy - mediated vision loss compared with the current policy , along with the potential cost savings that could be achieved.research design and methodswe developed a model that simulates the progression of retinopathy in type 2 diabetic patients , and the screening of these patients , to predict rates of retinopathy - mediated vision loss . we populated the model with data obtained from a national health service foundation trust . we generated comparative 15-year forecasts to assess the differences between the current and proposed screening policies.resultsthe simulation model predicts that implementing a 2-year screening interval for type 2 diabetic patients without evidence of diabetic retinopathy does not increase their risk of vision loss . furthermore , we predict that this policy could reduce screening costs by 25%.conclusionsscreening people with type 2 diabetes , who have not yet developed retinopathy , every 2 years , rather than annually , is a safe and cost - effective strategy . our findings support those of other studies , and we therefore recommend a review of the current national institute for health and clinical excellence ( nice ) guidelines for diabetic retinopathy screening implemented in the u.k .

background : congenital insensitivity to pain with anhidrosis ( cipa ) is characterized by recurrent episodes of infections and unexplained fever , anhidrosis ( inability to sweat ) , and absence of reaction to noxious stimuli , self - mutilating behavior , mental retardation and damages to oral structures . in this article , we have demonstrated the signs and symptoms of 4 children that refer to the pediatrics department of the imam khomeini hospital and assay about their complications with this disease . they mostly presented by recurrent osteomyelitis in their feet that severely controlled by antibiotic therapy and even surgery . this syndrome can be diagnosed by clinical and paraclinical tests together but it would be better to confirm by genetic test . the diagnosis of this syndrome helps us to try for the better quality of life for the patients and avoid unnecessary amputations . pain alters the quality of life more than any other health - related problem , and it is one of the implements of body protection . it interferes with sleep , mobility , nutrition , thought , sexual activity , emotional well - being , creativity , and self - actualization . congenital insensitivity to pain is a rare disorder , first described in 1932 by dearborn as congenital pure analgesia . congenital insensitivity to pain and anhydrosis ( cipa ) is a very rare and extremely dangerous condition . pain - sensing nerves in these patients are not properly connected in parts of brain that receive the pain messages . cipa is extremely dangerous , and in most cases the patient does n't live over age of 25 . although some of them can live a fairly normal life , they must constantly check for cuts , bruises , self - mutilations , and other possible unfelt injuries . self - mutilation is an almost invariable feature of this disorder , most often involving the teeth , lips , tongue , ears , eyes , nose , and fingers[24 ] . people with cipa also can not feel extreme temperatures , or sweat , both creating even more necessary care [ 57 ] . however , in a patient with cipa , the gene encoding the neurotrophic tyrosine - kinase receptor ( ntrk1 gene ) , is mutated in a way that interferes and halts the autophosphorylation process , therefore stopping signals of pain and temperature from being sent to the brain . he had several hospitalizations because of fever , seizure , heel sores and osteomyelitis ( fig . 1 ) . he had no reaction to pain and could not feel pain or heat . the immune tests ( complements , nitroblautetrazolium ( nbt ) test , immune globulins ) and viral markers such as hbv , hcv and hiv tests , blood gas and serum uric acid were all normal . this patient was referred to us to control the infection of hill sore ( an ulceration measuring 10mm10 mm ) . we did our best to control the infection by administering appropriate antibiotics and by the debridement of necrotic tissues to avoid limb amputation and to keep his quality of life as good as possible . he had also massive osteolysis in his mandible in which attemts were made for appropriate dental procedures . the other sites such as lung , heart , abdomen and eyes were normal in physical examination . finger tip osteolysis ( right ) and painless heel sore ( left ) in a 12 year old boy with cipa syndrome case 2 : a 13 year old girl was referred to our department because of purulent discharge from a deep sore in the talus and calcaneus of her right foot with history of recurrent osteomyelitis from the first months of life . she occasionally had hyperthermia , and convulsions , high fever with abnormal electroencephalogram ( eeg ) and received anticonvulsant drugs . the patient had first experienced osteomyelitis when she was 3 years old in her buttocks and lumbar sites . her last hospitalization was because of a resistant infection which did not respond to different antibiotics during the 3 preceding months . because of a harmful deformity in her heel and ineffective antibiotics , after an orthopedic consult , an amputation was performed ( fig . 2 ) . three weeks after the amputation , however , she came back with massive cellulitis in the site of surgery which progressed to the knee but she did n't feel any pain . osteolysis on her fingertips was seen , but there was no sign of ocular disturbance ( fig . mandibular lysis , dental deformity ( right ) and post amputation cellulitis , recurrent infection ( left ) in a 13 year old girl with cipa syndrome case 3 : an 8-year - old girl was referred to the pediatric department of imam khomeini hospital because of fever , severe edema of right leg , inflammation and purulent discharge from the fistula in both legs especially right foot . she was mentally retarded and hit her heel onto the ground without any sensation of pain . she did not respond to any painful stimuli or heat shock , but could feel pressure and touch . there were some scars on her skin on different sites of the body which were , according to her parents , heat scars . because of chronic osteomyelitis , debridement of infectious site was performed and antibiotics administered several times . an emg - ncv revealed a small fiber disturbance and low amplitude of snaps due to a skin problem . a family history revealed that her parents were cousins , and she was the fourth child of this family with other children being normal . she had a history of recurrent seizures which were treated as a metabolic disease since she was 4 months old for 4 years but there was no efficacy ( fig . irregularity and lysis of bones case 4 : a 7 year old girl , the child of consanguineous ( first cousins ) parents , presented to the pediatrics department in imam khomeini hospital 6 years ago with swelling and erythema in her right foot . she had a history of several episodes of osteomyelitis and gangrene of the right and left foot . further , she had osteolytic lesions in her mandible and the vestibular epithelium of the mandible was destroyed . all of her teeth fell out when she was 3 years old , and she had total alopecia from 6th month of age . the disease was misdiagnosed as chronic granulomatous disease ( cgd ) and treated with intravenous immunoglobulin ( ivig ) . in this admission seven years ago she became a candidate of amputation of her foot , but as she did n't agree , so received a graft and pin . now she developed irregularity in the physeal and epiphyseal plate in tibia and fibula and had fracture of epiphyseal plate . there are few cases of insensitivity to pain described in the literature , but there is no standard treatment . patients with cipa can live a fairly normal life [ 4 , 7 , 10 ] . three of our patients had mild mental retardation and attended special schools . however , there are certain precautions that need to be taken in order to ensure the safety of the patient . the patient must constantly check for cuts , bruises , self - mutilations , and other possible unfelt injuries . also , they must regularly visit their doctor to receive a full work up to be sure that they do not have any insensitive internal problems that can be fatal . there are sixty documented cases in the united states[1 , 9 , 1117 ] . while some reports indicate that these patients can only live up to five years and predict a poor prognosis for this disorder [ 4 , 18 , 19 , 20 ] , all of our patients were older . the reasons for death among patients with cipa are things that could otherwise be treated . a heat attack , for instance , is much more dangerous for patients with cipa because they do not feel it , therefore do not know that they need to be hospitalized[2 , 21 , 22 ] . although patients with cipa often experience trauma , bony fractures , and osteomyelitis because of insensitivity to pain . therefore , such patients may undergo surgery such as osteotomy and amputation , in three of our cases the involved joint was saved without amputation by utilizing conservative measures . three of our patients had severe osteolysis in the oral cavity with osteolysis and finger tips amputation as a result of self mutilation . congenital insensitivity to pain with anhydrosis may be misdiagnosed as leprosy , based on similar symptoms of severe injuries to the hands and feet , which is not match with our cases according to other findings . on the other hand , cipa is the fourth type of hereditary sensory and autonomic neuropathy ( hsan ) , known as hsan iv ( it is also referred to as hsan type iv ) . the aim of reporting this syndrome is to make physicians familiar with this condition and to avoid unnecessary surgeries and even amputations , to use conservative treatments and make the diagnosis of this syndrome easier without extra laboratory requests . unfortunately in our country we do not have the facility to confirm the diagnosis by genetic tests so we have to start treatment by clinical and paraclinical findings to make the patients quality of life better . this study shows that we should notice the combination of some different signs and symptoms to find this syndromic disease .

backgroundbackground : congenital insensitivity to pain with anhidrosis ( cipa ) is characterized by recurrent episodes of infections and unexplained fever , anhidrosis ( inability to sweat ) , and absence of reaction to noxious stimuli , self - mutilating behavior , mental retardation and damages to oral structures.case presentationin this article , we have demonstrated the signs and symptoms of 4 children that refer to the pediatrics department of the imam khomeini hospital and assay about their complications with this disease . they mostly presented by recurrent osteomyelitis in their feet that severely controlled by antibiotic therapy and even surgery . they had no pain sensation in spite of deep sore and infection.conclusionthis syndrome can be diagnosed by clinical and paraclinical tests together but it would be better to confirm by genetic test . the diagnosis of this syndrome helps us to try for the better quality of life for the patients and avoid unnecessary amputations .

for many years , alcoholic liver disease and viral hepatitis - induced liver disease were considered the main causes of liver disease morbidity and mortality . however , with the dramatic increase in the prevalence of obesity , nonalcoholic fatty liver disease ( nafld ) has become the most common chronic liver disease and is now receiving greater attention globally . nafld describes a pathologic condition characterized by significant lipid deposition in the hepatocytes of the liver parenchyma in patients with no history of excessive alcohol consumption . the spectrum of nafdl includes hepatic steatosis , nonalcoholic steatohepatitis , chronic fibrosis and cirrhosis . the true incidence and prevalence of the disease is difficult to ascertain accurately due to lack of effective screening tests that can be applied to the entire population . population - based epidemiological studies using ultrasound imaging as a diagnostic modality have detected the presence of fatty liver in 13% to 22% of the population of lean nonalcoholic subjects . estimates in the united states population suggest that up to 30% of adults may have nafld . the prevalence estimates from several other countries are quite variable , but depict a highly prevalent condition , with ~20% of the adult population with ultrasound - defined nafld . the prevalence of nafld increases to 5055% in type-2 diabetics and patients with hypertriglyceridemia , and to 75% in obese persons . increasing evidence indicates that nafld is the hepatic component of a systemic metabolic syndrome that includes obesity , insulin resistance , hyperlipidemia , and hypertension . approximately 90% of patients with nafld have 1 characteristic features of metabolic syndrome and about 33% have the complete diagnosis . in individuals with nafdl , the prevalence of metabolic syndrome increases with increasing body mass index , from 18% in normal - weight subjects to 67% in obese subjects . furthermore , with the addition of each of the components of the metabolic syndrome , the risk of steatosis increases exponentially . criticism has been leveled at the syndrome in part because of varying and incomplete definitions and the lack of a unifying mechanism . in addition , the individual components of the metabolic syndrome themselves are adequate to predict the risk of cardiovascular disease or diabetes . although the clinical usefulness of metabolic syndrome has been questioned , it is still considered useful as an educational concept [ 1114 ] . the metabolic syndrome is estimated to affect about 20% of the lithuanian middle - aged urban population [ 1517 ] . in this study we aimed to assess the prevalence of the following metabolic risk factors among men and women with nafld : obesity , hypertension , dyslipidemia , and diabetes . the study was conducted in accordance with the recommendations laid down by the 18 world medical assembly ( helsinki , 1964 ) and all applicable amendments . this was an epidemiologic study . in order to ensure that the data reflect the health status of patients living in urban as well as rural areas , randomly selected family physicians throughout lithuania the regions covered included anykiai , elektrnai , jonava , jurbarkas , kaunas , kdainiai , klaipda , kretinga , marijampol , maeikiai , palanga , panevys , plung , prienai , radvilikis , raseiniai , iauliai , ilal , taurag , utena , and vilnius . every patient fulfilling the inclusion criteria who visited the physician on a working day for any reason was asked to take part in the study . patients included in the study had to be outpatients with nafld , aged 1880 years old . the diagnosis of nafld had to be confirmed during previous consultations by means of ultrasonography , liver biopsy , computed tomography or magnetic resonance imaging and documented in the patient s record . the following exclusion criteria were applied : pregnancy , alcoholic liver disease ( established diagnosis of alcoholic liver disease or confirmed alcohol intake in daily doses 40 g for men and 20 g for women ) , known or evidenced virus hepatitis , autoimmune hepatitis , toxic liver damage , gene pathology , and confirmed absence of liver pathology . the following data were collected during a single patient visit : weight , height , waist circumference , body mass index ( bmi ) , age , sex , leisure - time physical activity , concomitant diseases , and use of antioxidants , cytoprotective agents , insulin secretagogues , and lipid - lowering agents . demographic and medical data were retrieved from patients cards , while anthropometric parameters ( height , weight , bmi and waist circumference ) were measured during the study visit . height ( cm ) and weight ( kg ) were measured with indoor clothing and without shoes . the waist circumference ( cm ) was measured at the level of the umbilicus , with the participant standing and breathing normally . hypertension was defined as elevated blood pressure at or above 140/90 mm hg ( 130/80 mm hg for diabetics ) or a history of hypertension and use of antihypertensive medication . dyslipidemia was defined as abnormal fasting lipid profile ( total cholesterol > 5.0 mmol / l or low - density lipoprotein ( ldl ) cholesterol > 3.0 mmol / l or high - density lipoprotein ( hdl ) cholesterol leisure - time physical activity was classified into 3 categories : ( 1 ) low ( almost completely inactive , e.g. , reading , watching television , housework , etc . ) , ( 2 ) moderate ( some physical activity for > 4 hours per week ( eg , walking , cycling , light exercising , light gardening , etc . ) , and ( 3 ) high ( vigorous physical activity for > 3 hours per week , e.g. , running , jogging , swimming , heavy gardening , or regular exercise or competitive sports several times per week ) . bmi was calculated by dividing the individual s body weight by the square of his / her height : bmi = weight ( kg)/height ( m ) . abdominal obesity was defined as waist circumference > 102 cm in men and > 88 cm in women . sample size was calculated based on the following assumptions : anticipated prevalence of nafdl is 20% ( p=0.2 ) , its absolute precision is 3% ( d=0.03 ) , and confidence level is 95% . for sample size calculation the following equation was used : based on the above assumptions , the minimum sample size for this study was calculated to be 780 patients . parametric student s t - test test or non - parametric wilcoxon test was applied to test the difference between continuous data . in total , 804 patients were recruited in the study and of these 798 were included in the analysis ( 6 patients were protocol violations ) . there were 298 ( 37.3% ) men and 500 ( 62.7% ) women among the study participants . the mean ( standard deviation [ sd ] ) age of patients was 58.1 ( 10.7 ) years ; range , 23 to 80 years . women were slightly older than men ( mean age , 60.29.6 vs. 54.511.4 years ; p<0.05 ) . the prevalence of obesity ( bmi > 30 kg / m ) was 69.9% among study patients and it was significantly higher among women compared to men ( 75.4% vs. 60.7% , p<0.05 ) ; 62.4% of the men and 89.2% of the women hypertension and dyslipidemia were also highly prevalent in this group of nafdl patients , and metabolic risk factors were more prevalent among women ( table 1 ) . the prevalence of diabetes was similar in both men and women ; 21.9% of patients had diabetes ; all except 1 were cases of type 2 diabetes mellitus . the prevalence of metabolic risk factors was compared in different age groups ( 60 years and > 60 years ) separately in men and in women . there were no differences in the mean bmi in the proportion of men or women with bmi > 30 kg / m or central obesity in the 2 age groups ( table 2 ) . the proportion of patients with diabetes was also significantly higher among elderly men and was numerically higher among elderly women . dyslipidemia was more common among women aged > 60 years , while no such age - related differences were observed in men . very few nafdl patients ( 3.1% ) reported high leisure - time physical activity ( regular vigorous exercise , competitive sports or similar physical activity for at least 3 hours per week ) . among women , the proportion of subjects reporting low leisure - time physical activity was higher than that among men ( 45.8 vs. 29.2% ; p<0.05 ) . consequently , there were more men than women with moderate physical activity ( 66.1 vs. 52.0% ; p<0.05 ) . in both sexes , the level of leisure - time physical activity was lower in older patients ( table 3 ) . the most common medicines were cytoprotective agents , ursodeoxycholic acid , pentoxifylline , betaine or phospholipid preparations ( 24.9% ) , lipid - lowering drugs ( 21.3% ) , and antioxidants vitamin e , n - acetylcysteine , selenium , or beta - carotene ( 19.1% ) . insulin secretagogues ( metformin , pioglitazone or rosiglitazone ) were used by 11.7% of patients . almost 30% of patients received combined treatment and the most frequent combination was a lipid - lowering drug and a cytoprotective agent ( 10.6% ) . in this study we found that metabolic risk factors were highly prevalent in patients with nafld . more than two - thirds of patients were obese , and similar proportions of patients had hypertension or dyslipidemia . an italian study showed that nafld was associated with most of the features of the metabolic syndrome obesity , hyperglycemia , hyperinsulinemia , hypertriglyceridemia , and systolic hypertension . several studies reported that nafld is 3 to 5 times more common in men than in women [ 2123 ] , while others stated that the risk of this disease is greater among women . we did not evaluate the prevalence of nafld ; however , the number of female patients in our study was approximately 1.5-fold higher than the number of males . besides , most of metabolic risk factors , which are also generally considered as nafdl risk factors ( obesity , hypertension , dyslipidemia ) , were more prevalent among women compared to men . since the women in this study population were significantly older than the men , we conducted a further analysis to determine if these differences could have been caused by age rather than sex . the distribution of obesity parameters ( mean bmi , proportion of patients with bmi > 30 kg / m or central obesity ) was similar in the 2 age groups , thus the difference observed in men and women was most likely determined by sex . contrarily , the differences in the prevalence of arterial hypertension and diabetes seemed to be related to advanced age , as the prevalence of these diseases was higher among older men and women . published data on the prevalence of metabolic syndrome among lithuanian men and women are inconsistent . a study that used the definition of international diabetes federation , reported that the prevalence of metabolic syndrome was almost two - fold higher among men compared to women ( 28.1% vs. 16.6% ) ( 15 ) . other studies , which employed world health organization or national cholesterol education program adult treatment panel iii criteria , reported opposite results , showing higher prevalence among women . one lithuanian study also reported some sex - related differences in the prevalence of metabolic syndrome components in patients with acute ischemic syndromes . in this study women were significantly older than men ; however , the potential confounding effect of age was not analyzed . there is no specific therapy for nafld that has clearly been proven effective ; however several pharmacological options , including antioxidants , lipid lowering agents , hepatoprotective agents , and insulin secretagogues , have been tried with some successes . in our study , the most common medicines being cytoprotective agents , followed by lipid - lowering drugs and antioxidants . it is recommended to initiate pharmacological treatment only when there is no change in the course of disease after adequate lifestyle changes have been undertaken . the published results of several studies in nafld populations have reported that short - term moderate weight loss with regular physical activity leads to improvement in liver biochemical tests and to resolution of hepatic steatosis . however , available information on leisure - time physical activity suggests that lifestyle - related therapeutic modalities were not fully utilized in this group , especially among women . the physicians who participated in the study constituted only about 3% of the family physicians in lithuania . although almost half of lithuanian administrative regions were covered and efforts were made to invite physicians working in urban as well as rural areas , it is possible that the study population was not representative of the general population . second , the enrollment of a greater proportion of women into the study , and the fact that they were older than men , may have biased the results . the effect of this potential bias was reduced by applying stratification by sex and age . further studies involving a control group are needed for a better understanding of true prevalence of metabolic risk factors in the population of patients with nafdl in lithuania . obesity , arterial hypertension , and dyslipidemia were more prevalent among women compared to men ; however , the differences in the prevalence of hypertension seemed to be determined by advanced age .

summarybackgroundnonalcoholic fatty liver disease ( nafld ) is the most common chronic liver disease ; there is growing evidence that it is a hepatic manifestation of a metabolic syndrome . this study aimed to assess the prevalence of metabolic risk factors among patients with nafld.material/methodsoutpatients with nafld were recruited into the study . family physicians recorded patients demographic and anthropometric data , leisure - time physical activity , concomitant diseases , and pharmacological treatment for nafld into standardized case report forms.resultsin total , data on 798 patients were analyzed . most patients were women and they were older than the men ( mean age , 60.29.6 vs. 54.511.4 years ; p<0.05 ) . metabolic risk factors ( obesity , arterial hypertension , dyslipidemia ) were highly prevalent in the study patients , and these factors were more prevalent among women . there were no differences in the mean body mass index ( bmi ) , in the proportion of men or women with bmi > 30 kg / m2 or central obesity in the 2 age groups ( 60 years and > 60 years ) . hypertension and diabetes were more prevalent among older men and women . dyslipidemia was more common among older women . the level of leisure - time physical activity was lower in women and in older patients . the most frequently prescribed pharmacological agents were cytoprotective agents , lipid - lowering drugs , and antioxidants.conclusionsmetabolic risk factors were highly prevalent among patients with nafld . obesity , hypertension , and dyslipidemia were more prevalent among women . the differences in the prevalence of hypertension seemed to be influenced by older age of women .

a 26-year - old female patient presented with left knee pain after slip down while walking . on a physical examination , mild swelling and tenderness were identified in the medial aspect of the left knee . the power of quadriceps muscles was intact but she complained of pain during flexion - extension . the range of motion was limited due to pain : 90 flexion and 10 extension . grossly , patellofemoral maltracking was not identified but the patella size of both knees was smaller than normal . plain radiographs showed small patellae with abnormal morphology and hypoplastic medial femoral condyles in both knees ( fig . mri images showed a partial rupture of the gastrocnemius medial head , but the meniscus and cruciate ligaments were intact ( fig . the sagittal fat - suppressed t2-weighted image showed thinning of the proximal patellar tendon and non - visualization of the articular cartilage in the patellofemoral compartment ( fig . the axial fat - suppressed t2-weighted image showed a small patella ( 1.00.61.5 cm in size ) with lateral displacement , thick eccentric non - ossified patellar cartilage with central high signal portion , and elongated medial patellofemoral ligament with a tear at the femoral attachment site . also , the trochlear groove was shallow ( trochlear depth , 0.2 cm ) , suggestive of trochlear dysplasia . normal morphology of the medial and lateral facets on the posterior surface of the patella was not found ( fig . and the coronal fat - suppressed t2-weighted image showed a hypoplastic width of the medial femoral condyle ( medial femoral condyle , 1.96 cm ; lateral femoral condyle , 2.39 cm ) ( fig . 2c ) . additional plain radiographs were taken for the evaluation of incidental findings of the small patella . the reported radiographic changes of sps are hypoplastic or absent patella with pelvic and foot abnormalities3 ) . pelvic abnormalities include absent / delayed / irregular ischial ossification at the ischiopubic synchondrosis , infra - acetabular axe - cut notches , high iliac angles , large femoral heads with narrowed femoral necks , coxa valga and vara , and hypoplastic lesser trochanters . foot anomalies include widened first web space between toes , flat - foot or club - foot deformity , brachydactyly , and tarsal coalition . some specific bony changes consistent with the diagnostic features of sps were identified in the patient 's knee , pelvis and foot . hypoplastic ossification of the ischiopubic junction was observed on the pelvis radiograph , but an infra - acetabular axe - cut notch or a large femoral head with narrowed femoral neck was not observed ( fig . increases in the web space between the first and second toes ( an intermetatarsal angle of 18 for the right foot and an intermetatarsal angle of 19 for the left foot ) were observed along with the short fourth and fifth rays on the foot radiographs ( fig . we recommended additional genogram survey to the patient because findings suggestive of sps were observed . the patient 's height and weight were about 152 cm and 47 kg , respectively , showing less than 5th percentile values of stature . there were no other morphological changes such as facial dysmorphism or nail dysplasia on her appearance . she said that her patellae had been found to be smaller than normal people in the past but did not present with related complaints or additional clinical symptoms . the patient 's family history revealed that she is the first of two daughters , and no one had been diagnosed with sps . the patient was treated conservatively with non - steroidal anti - inflammatory drugs and temporary immobilization due to partial injury to the gastrocnemius muscle . after 3 weeks of conservative treatment , her symptoms improved and she returned to her normal life with pain - free full range of motion . sps , also known as ischiopatella dysplasia , coxo - podo - patellar syndrome , ischio - pubic - patella syndrome or scott - taor syndrome , is a rare autosomal dominant disorder characterized by the absence or hypoplasia of the patella and various anomalies of the pelvis and feet . the syndrome was described first by scott and taor2 ) in 1979 . in their study , among twelve members of a family affected by patellar hypoplasia / aplasia , seven individuals showed abnormalities of the pelvic girdle and upper femora . in 1981 , vanek4 ) reported 3 familial cases that showed infra - acetabular axe - cut notches besides hypoplastic patellae . fifteen patients with a similar disorder were described by morin et al.5 ) under the diagnosis of coxo - podo - patellaire syndrome . of those , eleven patients whose feet had been examined showed an increased space between the first and second toes . in most of them , kozlowski and nelson3 ) reported two sporadic cases that showed more generalized bone changes and dysmorphic features . the two patients had a number of facial dysmorphic features with prominent forehead , posteriorly angulated ears , broad nasal bridge , long philtrum , high plate , and prominent lower lip . the diagnostic radiographic changes of sps are hypoplastic or absent patella with minor hypoplastic / dysplastic knee changes and pelvic abnormalities3 ) . pelvic abnormalities include absent / delayed / irregular ischial ossification at the ischiopubic synchondrosis , infra - acetabular axe - cut notches , high iliac angles , large femoral heads with narrowed femoral necks , coxa valga and vara , and hypoplastic lesser trochanters . other major features include anomalies of the feet , a wide space between the 1st and 2nd toes , flat - foot or club - foot deformity , brachydactyly , other hypoplastic / dysplastic changes , and tarsal coalition . our patient showed bony changes with diagnostic features of sps in the knee , pelvis , and foot . according to our literature review , mri scans showed thick eccentric non - ossified patellar cartilage , elongated medial patellofemoral ligament , hypoplastic medial femoral condyle , and trochlear dysplasia . normal morphology of medial and lateral facets on the posterior surface of the patella was not found . also , thinning of the proximal patellar tendon and non - visualization of the articular cartilage of the patellar undersurface were identified . these findings could be clinically relevant because elongation of the medial patellofemoral ligament and trochlear dysplasia with eccentric non - ossified patellar cartilage might lead to patellofemoral maltracking with an osteochondral lesion or an acute dislocation or an extensor mechanism injury . though the patient in this study only had a gastrocnemius injury at the origin site , physicians should carefully examine abnormalities with mri when an sps patient has a trauma to the knee . the skeletal dysplasia resulted from the mutations in the human homologue of the tbx4 gene1 ) . the sps phenotype suggests that human tbx4 mutations do not affect early stages of limb development , such as limb - bud initiation , but do have a profound impact on the later stages . the late influence of tbx4 mutations is manifested by patellar aplasia / hypoplasia and anomalies of the posterior structures of the foot , such as the space between the first and second toes and short fourth and fifth rays . completion of ischiopubic formation is another very late process in human development , which is disrupted in individuals with sps . with respect to the need of evaluation of systemic organ dysfunction in kidney or neuropathy , nail patella syndrome ( nps ) is an autosomal dominant disorder due to mutations in the lmx1b gene6 ) . other features include hypoplasia or absent patellae , a single iliac horn on each side extending backwards and outwards from the mid part of the iliac bone , and elbow deformities , mainly hypoplasia of the radial head and/or capitellum causing subluxation or dislocation7 ) . one of the most serious manifestations of nps is kidney disease since approximately one third of patients develop renal involvement including glomerulonephritis or nephrotic syndrome and their complications8 ) . it may be either unilateral or bilateral and may be familial , being transmitted in an autosomal - dominant mode patella aplasia - hypoplasia ( ptlah)9 ) . in ptlah , hereditary motor and sensory neuropathy could be presented and congenital aplasia / hypoplasia of the patella are also clinical key features . finally , very rare causes of absent or hypoplastic patellae include arthrogryposis - like kuskokwim syndrome , trisomy 8 , and coffin - siris syndrome10 ) . in conclusion , sps is an autosomal - dominant bony dysplasia of the pelvis , knees , and feet . therefore , it is important to perform a complete skeletal survey on all patients with absent or hypoplastic patellae . also , it is advised to perform mri evaluation to find out any acute patellofemoral injuries when an sps patient has a trauma to the knee .

small patella syndrome ( sps ) is characterized by aplasia or hypoplasia of the patella and pelvic girdle abnormalities , including bilateral absence or delayed ossification of the ischiopubic junction and infra - acetabular axe - cut notches . here , we report a case of sps in a 26-year - old female . magnetic resonance image ( mri ) showed a small patella with thick eccentric non - ossified patellar cartilage and femoral trochlear dysplasia with hypoplastic patellar undersurface . to our knowledge , this is the first report of mri findings in sps . mri findings could be clinically relevant because elongation of the medial patellofemoral ligament and trochlear dysplasia with eccentric non - ossified patellar cartilage might lead to patellofemoral maltracking with an osteochondral lesion or acute dislocation or an extensor mechanism injury . though the patient presented in this case report only had a gastrocnemius injury at the origin site , physicians should carefully examine abnormalities with mri when an sps patient has a trauma to the knee .

alzheimer 's disease ( ad ) is the most common form of dementia clinically characterized by insidious onset and progressive impairment of memory and other cognitive functions , ultimately resulting in complete dependency and death of the patient . the key features of ad brains are neuronal and synapse loss , extracellular plaques composed of amyloid- ( a ) peptides and intraneuronal neurofibrillary tangles consisting of hyperphosphorylated tau protein . although most patients develop ad at later age , with a prevalence estimates ranging from 4.4% in persons aged 65 years to 22% at ages 90 and older , it is mainly the research performed on the rare autosomal dominant early - onset form of ad that provided valuable insights into disease pathogenesis . several penetrant autosomal dominant mutations have been identified ( http://www.molgen.ua.ac.be/admutations/ ) , leading to early - onset familial ad within three genes : presenilin 1 ( psen1 ) , presenilin 2 ( psen2 ) , and amyloid precursor protein ( app ) genes . the apolipoprotein e gene ( apoe ) was identified as a major risk factor contributing to the pathogenesis of late - onset alzheimer disease 's ( load ) . however , the apoe e4 allele is neither necessary nor sufficient for the occurrence of the disease . many snps have been analyzed to identify new susceptibility candidate genes for the load . recently , two independent genome - wide studies have demonstrated a new locus on chromosome 9p21.3 implicated in load susceptibility in caucasians [ 8 , 9 ] . zchner and colleagues in their work individuated several snps in three different genes : the cyclin - dependent kinase inhibitors ( cdkn2a , cdkn2b ) and methylthioadenosine phosphorylase ( mtap ) , and they conducted an allelic association test to evaluate the genetic effect of these genes . in light of these results , we investigated the role of three snp 's in the cdkn2a gene ( rs11515 , rs3731246 , and rs3731211 ) and one in the cdkn2b gene ( rs598664 ) using an association study carried out in a group of caucasian load patients . our study group included 488 caucasian subjects : 238 load patients ( 63.9% females , age at onset 72.9 5.6 years , mean sd , mini mental state examination score 20.2 5.4 points ) and 250 nondemented controls ( 62.4% females , mean age 71.5 5.7 years ; sd ) ( table 1 ) . all subjects were enrolled in the study at the neurology unit of the department of neurological and psychiatric sciences of the university of florence and at paul flechsig institute for brain research , university of leipzig , germany . patients ( 19.7% autopsy proven ) were clinically evaluated according to published guidelines , and the ad diagnosis fulfilled the diagnostic and statistical manual of mental disorders criteria ( dsm - iv ) [ 10 , 11 ] . all controls were carefully assessed using a rigorous clinical history evaluation and a general / neurological examination , in order to exclude the presence of any neurological disorder . the study protocol was approved by the local ethics committee and conducted in accordance with the provisions of the helsinki declaration ; informed consent for genetic screening was obtained from the study participants or , where appropriate , a relative or legal representative . dna was extracted from white blood cells using the phenol - chloroform procedure and all of the genotyping was performed by kbioscience ( http://www.kbioscience.co.uk/ ) . kbiosciences uses a novel form of competitive allele specific pcr system ( kaspar ) that is a proprietary kbioscience invented genotyping chemistry . the accuracy greater than 99% is achieved and a routine quality control measures is performed on all genotyping . apoe genotypes were determined in all subjects using polymerase chain reaction ( pcr ) and restriction fragment length polymorphism ( rflp ) methods , as previously described . differences in distribution between cases and controls were tested using chi - square test ( epiinfo software v. 3.3.2 available free at http://www.cdc.gov/epiinfo/ ) . in order to evaluate the association between genotypes and alleles and ad , odds ratios ( ors ) and corresponding 95% confidence intervals ( cis ) were calculated using logistic regression models ( spss software ver . 18.0 for windows ( chicago , ill , usa ) ) . further analysis were performed by using logistic regression models adjusted for gender , age ( in continuous ) , and presence of apoe e4 . a p - value of < .05 was considered statistically significant . linkage disequilibrium ( ld ) between the snps was analyzed using powermarker software , version 3.25 ) ( http://statgen.ncsu.edu/powermarker/ ) . table 1 gives the distribution of 238 load cases and 250 controls according to gender , recruitment site , age , and other selected characteristics . the mean of the mini mental state examination score ( mmse ) points was higher in controls than cases . conversely , cases reported more frequently the presence of e4 compared to controls ( 44.1% versus 11.6% ) . the frequencies of all snps were in hardy - weinberg equilibrium in ad patients and controls . moreover , no correlation between mean age at onset and all snps genotypes was observed and no interaction between apoe gene was found ( data not shown ) . we found no differences in the allelic or genotypic frequencies between ad patients and controls for any of the snps ( table 2 ) . we found no association between ad and rs11515 genotype ( = 3.47 ; p = .17 ) and allele ( = 3.2 ; p = .07 ) , rs3731246 genotype ( = 1.13 ; p = .56 ) and allele ( = 1.17 ; p = .27 ) , rs3731211 genotype ( = 0.57 ; p = .75 ) and allele ( = 0.0 ; p = .96 ) , rs598664 genotype ( = 1.11 ; p = .57 ) , and allele ( = 1.15 ; p = .28 ) . none of the unadjusted ors were statistically significant , and when we adjusted for gender , age ( in continuous ) , and apoe e4 these results did not substantially change ( data not shown ) . moreover , as reported by zchner and colleagues , we found that rs11515 snp was in linkage disequilibrium ( ld ) with rs37361246 ( r = 0.64 ) , rs3731211 ( r = 0.33 ) and rs598664 ( r = 0.55 ) . recent studies reported informative results regarding genomewide association and linkage studies on chromosome 9 as candidate region for load . in particular , pericak - vance and colleagues identified the load locus on 9p21.3 in a genomewide microsatellite - based linkage screen on 466 ad families and confirmed in a genetic study of a consanguineous israeli - arab community . in 2007 hamshere and colleagues analyzing 723 affected relative pairs with genomewide linkage analysis showed evidence for disease locus for load on chromosome 9p . in 2008 zchner identified a chromosomal area under the linkage peak containing several potential ad candidate genes and analyzed cdkn2a and cdkn2b genes . among the different snps identified , the rs11515 localized in the 3-utr of cdkn2a was the most significant even if no transcription - factor - binding site , micro - rna target site , or conserved regulatory potential has been detected ; other snps are all in intron regions . many studies have been carried out on numerous putative gene polymorphisms candidate in ad pathogenesis and , with the exception of apoe , that is , the only confirmed genetic risk factor , results are still contrasting . in our case - control association study we analyzed four snps , three in the cdkn2a gene ( rs15515 , rs3731246 , and rs3731211 ) and one in cdkn2b ( rs598664 ) in a sample of 488 caucasian subjects including 238 load and 250 controls . our data set of 238 load patients was evaluated as having a power to detect an or of 2.0 at a 5% significance rate between 86.7 and 96.6 for all snps . however , to detect an or at 1.5the usual genetic main - effect for complex disorder our data has a power between 40.4 and 59 for all snps . thus , the study is not sufficiently powered and this is one of the limitations of our study . we did not find any association between these snps and ad risk in contrast to zchner 's results : this may be due to the different study design . in fact , zchner and colleagues reported a linkage and association study in 674 ad families , whilst we conducted a case control association study . moreover , only in 47 patients ( 19.7% ) of ad cases the autopsy confirmed the diagnosis . furthermore no correlation between mean age at onset and all snps genotypes , and no interaction between apoe gene was observed , suggesting that the genes do not act synergistically . in conclusion , our results did not confirm the hypothesis , suggested by zchner and colleagues that cdkn2a and cdkn2b at 9p21 are implicated in the susceptibility in the load . in fact , our data show no evidence of an association between all the studied snps and disease risks , thus a possible role of cdkn2a and cdkn2b as a genetic risk factor implicated in the susceptibility to ad was not confirmed . in lights of these contrasting results further studies are needed to elucidate the role of these genes in the susceptibility of ad .

alzheimer 's disease ( ad ) is the most common form of dementia clinically characterized by progressive impairment of memory and other cognitive functions . many genetic researches in ad identified one common genetic variant ( 4 ) in apolipoprotein e ( apoe ) gene as a risk factor for the disease . two independent genome - wide studies demonstrated a new locus on chromosome 9p21.3 implicated in late - onset alzheimer 's disease ( load ) susceptibility in caucasians . in the present study , we investigated the role of three snp 's in the cdkn2a gene ( rs15515 , rs3731246 , and rs3731211 ) and one in the cdkn2b gene ( rs598664 ) located in 9p21.3 using an association case - control study carried out in a group of caucasian subjects including 238 load cases and 250 controls . the role of cdkn2a and cdkn2b genetic variants in ad is not confirmed in our load patients , and further studies are needed to elucidate the role of these genes in the susceptibility of ad .

the study was composed of two finnish population - based cohorts , the pieksmki cohort and the health 2000 study . the pieksmki cohort originally consisted of 1,294 subjects from the town of pieksmki in eastern finland ( 13,14 ) . the eligible population consisted of all individuals born in 1942 , 1947 , 1952 , 1957 , and 1962 , of which 71% ( 923 ) participated in the initial examination in 1997 and 690 of these attended a follow - up survey in 20032004 . the health 2000 study is a finnish cross - sectional health survey carried out in 20002001 ( 15 ) . the overall health 2000 study ( 8,028 persons ) was representative of the finnish population 30 years of age and above . a supplemental study of 1,353 participants 4676 years of age was carried out in order to study diabetes risk factors more thoroughly ; this group was analyzed in the current study . in total , 2,090 participants from the two cohorts had glucose tolerance and comprehensive metabolite data measured . all individuals treated for diabetes ( n = 46 ) or on lipid medication ( n = 162 ) were excluded from analyses . the two studies served as mutual replication of cross - sectional findings . in the longitudinal substudy , 618 individuals ( 59% women ) from the pieksmki cohort had data on oral glucose tolerance test ( ogtt ) at the 6.5-year follow - up ( 19972003 ) and were not treated pharmacologically for diabetes . all participants gave written informed consent , the study protocols were approved by the local ethics committees , and the studies were conducted in accordance with the declaration of helsinki . all participants underwent a 2-h ogtt using a 75-g glucose load with the zero time point in a fasting condition . plasma glucose concentrations were determined using an automated hexokinase method ( intercoefficient of variation [ inter - cv ] 1.9% ) ( peridochrom glucose god - pap ; boehringer ingelheim , mannheim , germany ) for the pieksmki cohort and a dehydrogenase assay for the health 2000 study ( inter - cv 1.7% ) ( merck , darmstadt , germany ) . insulin concentrations at 0 , 30 , and 120 min during the ogtt were determined by radioimmunoassay ( inter - cv 5.7% ) ( phadeseph insulin ria ; pharmacia , uppsala , sweden ) in the health 2000 study . alanine aminotransferase was assayed by a kinetic method using a cobas 6000 analyzer ( hitachi , tokyo , japan ) . circulating metabolites were quantified from fasting serum samples using high - throughput nuclear magnetic resonance ( nmr ) spectroscopy ( 16 ) . this nmr platform has been applied in various epidemiological and genetic studies ( 6,1721 ) . detection of small molecule solutes from native serum , such as various amino acids and glycolysis substrates , was enabled by spectroscopy settings that suppress the broad spectral signals from lipoprotein particles . lipid constituents and the diversity of fatty acid saturation were measured from serum lipid extracts ( 17 ) . baseline and follow - up samples from the pieksmki cohort were measured in a single measurement series ( 13 ) . details of the nmr experimentation and metabolite quantification have been described previously ( 1618 ) . peripheral insulin sensitivity index was estimated based on matsuda isi ( 22 ) and insulin secretion index calculated as total insulin area under the curve per total glucose area under the curve during the ogtt ( 3 ) . metabolite tracking ( the likelihood of maintaining the original fractile over time ) was assessed with spearman correlation coefficients between the baseline and follow - up concentrations . associations of circulating metabolites with glucose levels as outcomes were assessed with linear regression models separately for each metabolite . all models were adjusted for sex , age , bmi , systolic blood pressure , hdl cholesterol ( hdl - c ) , and triglycerides . adjustment for hdl - c and triglycerides was omitted for serum lipid extract measurements to minimize collinearity . cross - sectional analyses were conducted separately for the two cohorts and combined using inverse variance weighted meta - analysis assuming fixed effect size . for these cross - sectional analyses , an additional criterion was that each metabolite was nominally significant ( p < 0.05 ) in both cohorts with concordant direction of effect . we tested for sex differences but did not find significant metabolite sex interactions . to ease comparison of effects , -regression coefficients are reported throughout in units of 1-sd increase in glucose levels ( outcome ) per 1-sd increase in metabolite concentration ( predictor ) . metabolites displaying cross - sectional associations with glycemia were analyzed for association with insulin sensitivity and insulin secretion indices for 975 individuals from the health 2000 study . the same metabolites were further analyzed for the subset of 618 individuals with longitudinal data on glucose tolerance at the 6.5-year follow - up . changes in metabolite levels during the follow - up period were tested for association with changes in glucose levels . finally , the metabolites were analyzed to assess whether baseline metabolite levels would be predictive of fasting and postload glucose at the 6.5-year follow - up . these longitudinal analyses were also adjusted for baseline glucose and insulin levels , and statistical significance was inferred for two - tailed p < 0.05 . all participants underwent a 2-h ogtt using a 75-g glucose load with the zero time point in a fasting condition . plasma glucose concentrations were determined using an automated hexokinase method ( intercoefficient of variation [ inter - cv ] 1.9% ) ( peridochrom glucose god - pap ; boehringer ingelheim , mannheim , germany ) for the pieksmki cohort and a dehydrogenase assay for the health 2000 study ( inter - cv 1.7% ) ( merck , darmstadt , germany ) . insulin concentrations at 0 , 30 , and 120 min during the ogtt were determined by radioimmunoassay ( inter - cv 5.7% ) ( phadeseph insulin ria ; pharmacia , uppsala , sweden ) in the health 2000 study . alanine aminotransferase was assayed by a kinetic method using a cobas 6000 analyzer ( hitachi , tokyo , japan ) . circulating metabolites were quantified from fasting serum samples using high - throughput nuclear magnetic resonance ( nmr ) spectroscopy ( 16 ) . this nmr platform has been applied in various epidemiological and genetic studies ( 6,1721 ) . detection of small molecule solutes from native serum , such as various amino acids and glycolysis substrates , was enabled by spectroscopy settings that suppress the broad spectral signals from lipoprotein particles . lipid constituents and the diversity of fatty acid saturation were measured from serum lipid extracts ( 17 ) . baseline and follow - up samples from the pieksmki cohort were measured in a single measurement series ( 13 ) . details of the nmr experimentation and metabolite quantification have been described previously ( 1618 ) . peripheral insulin sensitivity index was estimated based on matsuda isi ( 22 ) and insulin secretion index calculated as total insulin area under the curve per total glucose area under the curve during the ogtt ( 3 ) . metabolite tracking ( the likelihood of maintaining the original fractile over time ) was assessed with spearman correlation coefficients between the baseline and follow - up concentrations . associations of circulating metabolites with glucose levels as outcomes were assessed with linear regression models separately for each metabolite . all models were adjusted for sex , age , bmi , systolic blood pressure , hdl cholesterol ( hdl - c ) , and triglycerides . adjustment for hdl - c and triglycerides was omitted for serum lipid extract measurements to minimize collinearity . cross - sectional analyses were conducted separately for the two cohorts and combined using inverse variance weighted meta - analysis assuming fixed effect size . for these cross - sectional analyses , an additional criterion was that each metabolite was nominally significant ( p < 0.05 ) in both cohorts with concordant direction of effect . we tested for sex differences but did not find significant metabolite sex interactions . to ease comparison of effects , -regression coefficients are reported throughout in units of 1-sd increase in glucose levels ( outcome ) per 1-sd increase in metabolite concentration ( predictor ) . metabolites displaying cross - sectional associations with glycemia were analyzed for association with insulin sensitivity and insulin secretion indices for 975 individuals from the health 2000 study . the same metabolites were further analyzed for the subset of 618 individuals with longitudinal data on glucose tolerance at the 6.5-year follow - up . changes in metabolite levels during the follow - up period were tested for association with changes in glucose levels . finally , the metabolites were analyzed to assess whether baseline metabolite levels would be predictive of fasting and postload glucose at the 6.5-year follow - up . these longitudinal analyses were also adjusted for baseline glucose and insulin levels , and statistical significance was inferred for two - tailed p < 0.05 . baseline characteristics of the 1,873 individuals from the two population - based studies are shown in table 1 . the study population represents middle - aged , community - dwelling men and women free of lipid - lowering medication and diabetes treatment . absolute concentrations and interquartile ranges of the fasting metabolite levels in both cohorts and at the follow - up survey are given in supplementary table 1 along with tracking coefficients of the metabolites over the 6.5-year follow - up . most metabolites displayed tracking comparable to that of glucose during the follow - up period , suggesting that the metabolite levels are not solely reflecting immediate dietary intake . baseline characteristics of the study population metabolites associated with fasting and/or 2-h glucose at baseline are listed in table 2 . in total , 19 metabolite measures were cross - sectionally associated with glycemia ( meta - analyzed p < 0.001 ) and nominally significant with the same direction of effect in both cohorts . the significant metabolites comprise a spectrum of gluconeogenesis substrates , branched - chain and aromatic amino acids , 1-acid glycoprotein , as well as fatty acid species and saturation measures . metabolites were positively associated with increased glycemia with the exceptions of glycine , -6 fatty acids / total fatty acids , and double bonds / fatty acid chain . association magnitudes reached up to = 0.19 for fasting as well as postload glucose , where the unit of -regression coefficient indicates increase in sds of glucose ( 0.9 and 2.1 mmol / l for fasting and 2-h glucose , respectively ) per 1-sd increase in metabolite concentration . for comparison , the association magnitude of bmi with glycemia was = 0.21 for both fasting and postload glucose , yet the metabolite associations were adjusted for this established risk factor . the majority of metabolites displayed similar magnitude of association for fasting and postload glucose ; however , fatty acid metabolites tended to be more strongly associated with postload glycemia . further , the associations were generally stronger for amino acids and gluconeogenesis precursors than for the fatty acid measures . to assess whether the fasting state metabolite levels reflect postload glycemia independently of fasting glucose , we tested 2-h glucose associations with additional adjustment for fasting glucose , as shown in table 2 . albeit attenuated , most metabolite associations remained significant , in particular for gluconeogenic substrates and fatty acid measures . associations of all analyzed metabolites with fasting and 2-h glucose are illustrated separately for the two cohorts along with cross - sectional associations at the follow - up survey in supplementary fig . the metabolite associations were coherent for both cohorts , and the associations remained essentially unaltered at the follow - up survey , thus indicating consistency of the associations across study setting and time . cross - sectional associations of metabolites with fasting and postload glucose deficiencies of insulin action and insulin secretion may underpin the metabolite associations with fasting and postload glucose ( 6,23 ) . associations of the metabolites with peripheral insulin sensitivity and total insulin secretion indices in the health 2000 study are shown in supplementary fig . most of the metabolites were associated with both insulin sensitivity and total insulin secretion during ogtt ; however , all associations with insulin secretion vanished when conditioning on insulin sensitivity , whereas the insulin sensitivity associations remained significant upon conditioning on insulin secretion . the regulation of fasting metabolite levels may follow changes in glucose tolerance over time ( 24 ) . associations between the changes in metabolites and changes in glucose during the follow - up period are shown in fig . the changes in the majority of the metabolites were associated with changes in fasting glucose during the 6.5-year follow - up period , and changes in fatty acid metabolites also paralleled changes in postload glucose . notably , changes in branched - chain amino acids and phenylalanine levels were not associated with changes in glycemia during follow - up . changes in metabolite concentrations vs. change in fasting glucose ( blue triangle ) and 2-h glucose ( red triangles ) during 6.5-year follow - up adjusted for sex , age , baseline bmi , systolic blood pressure , hdl - c , triglycerides , insulin , and glucose . association magnitudes are in units of 1-sd change in glucose level per 1-sd change in metabolite concentration . the metabolites linked with glycemia in cross - sectional analyses ( table 2 ) could potentially be markers of perturbations in glucose homeostasis associated with glucose tolerance later in life . to address this question , we tested whether the metabolites would be predictive of 6.5-year fasting and 2-h glucose in 618 individuals from the pieksmki cohort who attended follow - up . results of these longitudinal analyses are shown for significant metabolites ( p < 0.05 ) in table 3 . branched - chain amino acids predicted both 6.5-year fasting and postload glycemia ( = 0.14/0.11 for fasting/2-h glucose for the sum of leucine , isoleucine , and valine ) . the most prominent association was observed for leucine ( = 0.18/0.15 , corresponding to 0.11/0.24 mmol higher glucose per 17 mol / l leucine higher than the median ) . in addition , phenylalanine and 1-acid glycoprotein were prospectively associated both with fasting and 2-h glucose ( p < 0.05 ) . in contrast , alanine , lactate , and pyruvate as well as tyrosine were exclusive predictors of 6.5-year postload glucose ( p < 0.05 for all ) . of notice , none of the fatty acid measures exhibited significant associations in prospective settings . interestingly , the prospective associations displayed a pattern opposite to that observed for the changes of metabolites with glycemia ; the changes in those metabolites , which were predictors of either fasting or postload glycemia , were not associated with the changes in the corresponding glucose level during the follow - up period ( fig . the ability of the metabolites to predict 6.5-year glycemia may be compared with the predictive ability of baseline glucose for estimating glycemia at follow - up . the prospective metabolite associations were up to 40% of the magnitude of that for baseline glucose versus 6.5-year glycemia ( table 3 ) . the moderate association magnitudes are partly accounted for by the adjustment for baseline glucose as well as insulin and other established risk factors . thus , the associations were not solely driven by the small number of individuals with overt diabetes . the results were virtually unchanged when excluding individuals on blood pressure lowering medication and hormone treatment ( data not shown ) . this metabolic profiling study identified 19 circulating metabolite measures associated with fasting or postload glucose in a general population setting of middle - aged men and women . amino acids , gluconeogenesis precursors , and fatty acids displayed metabolic footprints of both elevated fasting glucose and attenuated glucose tolerance . alanine , lactate , pyruvate , and tyrosine were selective predictors of 6.5-year postload glucose , suggesting that these metabolites could be markers of deteriorating glucose tolerance later in life . branched - chain amino acids predicted both fasting and postchallenge glucose levels , confirming their suspected role as markers of future glycemia ( 7 ) . multiple metabolic abnormalities are associated with the progression toward type 2 diabetes ( 25 ) . hence , it is to be expected that circulating levels of numerous metabolites are reflective of the degree of glycemia ( 5 ) . our results exemplify the diversity of metabolites associated with glucose levels in a nondiabetic population independent of conventional metabolic risk factors ( table 2 ) . despite differences in cardiovascular morbidity and mortality between individuals with impaired fasting glucose and impaired glucose tolerance , their cardiometabolic risk factor profiles are similar ( 4,26 ) . correspondingly , we found the cross - sectional metabolite associations with baseline fasting and 2-h glucose to be of comparable magnitude . importantly , the fasting metabolite concentrations were reflecting the degree of postchallenge glucose , thus indicating that glucose tolerance may partly be observed in the fasting metabolite profile . however , the small effect sizes also suggest that ogtt response can not be accurately inferred from the fasting metabolite profile . gluconeogenesis plays a pivotal role in glucose homeostasis ( 27 ) . in this study , three precursors of gluconeogenesis , alanine , lactate , and pyruvate , were predictors of postchallenge glucose after 6.5-year follow - up ( table 3 ) . the molecular mechanisms of how these gluconeogenic substrates are related to future glucose tolerance remain elusive . lactate has been associated with the prevalence of diabetes in older adults , and decreased oxidative capacity has been proposed to underpin this association ( 28 ) . fasting levels of alanine and pyruvate are highly correlated ( r = 0.59 ) , which could suggest that the metabolites are reporters of the same pathophysiological effect . on the other hand , pyruvate is involved in multiple glycolytic pathways , including pyruvate cycling pathways in the mitochondria that might underlie the prospective association ( 25,29 ) . the interconversion between pyruvate and alanine is catalyzed by alanine amino aminotransferase , a liver enzyme for which the plasma levels have been linked with obesity , liver fat extent , and the risk for diabetes ( 21,30 ) ; however , the correlations between alanine aminotransferase and alanine and pyruvate were modest ( r = 0.12 for both metabolites ) . alanine , lactate , and pyruvate were predictive of postchallenge glucose , but not fasting glycemia , at the follow - up survey . elevation of postload glucose is characterized by peripheral insulin resistance , whereas individuals with isolated high fasting glucose have been linked with attenuated insulin secretion and hepatic insulin resistance ( 1,3,812 ) . the prominent associations of the gluconeogenesis substrates with the peripheral insulin sensitivity index support this connection ( supplementary fig . on the other hand , essentially all the metabolites linked with glycemia were associated with impaired insulin sensitivity rather than insulin secretion . these results therefore do not fully elucidate the differences between fasting and postload glycemia observed in the longitudinal analyses . despite the cross - sectional associations with insulin sensitivity , the gluconeogenesis substrates remained predictors of postload glucose even when adjusting for baseline glucose and insulin . because glucose regulation is essential in metabolic fuel homeostasis , the circulating levels of gluconeogenesis precursors could potentially reflect impaired insulin sensitivity prior to elevation of fasting glucose and insulin levels . analyses of the changes in metabolites during follow - up indicated that alanine , lactate , and pyruvate levels were following changes in fasting but not postload glucose ( fig . 1 ) . these findings support that the gluconeogenic substrates contain a component of information that is not only related to immediate glucose levels but also reflects future glucose tolerance . in a nested case - control setting , alanine was predictive of incident diabetes more than a decade later ( p = 0.04 ) ( 7 ) . together with our population - based results , this suggests that metabolic perturbations causing elevated circulating alanine , lactate , and pyruvate could be early markers of attenuated glucose tolerance that may eventually progress to diabetes . circulating levels of five branched - chain and aromatic amino acids have been associated with insulin resistance ( 6,23,31,32 ) and reported to predict the development of future diabetes ( 7 ) . leucine , isoleucine , valine , phenylalanine , and tyrosine were all associated with glycemia and insulin sensitivity at baseline and predictors of fasting and/or postchallenge glucose in this study . these findings indicate that the amino acids are not only markers of the risk for overt diabetes but also predictors of future glycemia in the general population . importantly , the changes in branched - chain amino acids and phenylalanine concentrations did not parallel changes in fasting glucose during the follow - up . thus , whereas fasting glucose changes are accompanied by altered levels of fatty acids and gluconeogenic substrates , the regulation of branched - chain amino acids appears to be less tightly connected to changes in glycemia ( fig . 1 ) . these results suggest that abnormalities in branched - chain amino acid metabolism precede the development of hyperglycemia , and this may partly explain how the amino acids mediate the risk for future diabetes . experimental animal studies have suggested a mechanistic role of branched - chain amino acids in the development of insulin resistance ( 32 ) ; however , it remains unsettled whether the amino acids are causally implicated in humans . although our results are compatible with a functional role of branched - chain and aromatic amino acids in the pathogenesis of hyperglycemia , the elevated amino acid concentrations could also potentially be secondary markers of metabolic abnormalities that may not be fully observed in baseline glucose and insulin levels from a single time point . in this relation , we have recently shown that branched - chain amino acids as well as alanine , pyruvate , and 1-acid glycoprotein all are regulated by a variant in the gene encoding glucokinase regulatory protein ( gckr ) , which is suspected to affect the glucose sensory mechanism and indirectly affect lipid and amino acid metabolism ( 6,20,21,33 ) . in a similar manner , the prospective associations of amino acids and gluconeogenesis substrates with glycemia could reflect perturbations in glucose sensing , which eventually may lead to hyperglycemia . low - grade , systemic inflammation has been associated with the risk for diabetes ( 34,35 ) . the acute - phase protein 1-acid glycoprotein ( orosomucoid ) is an abundant immunomodulator protein in circulation , which is induced by stressful conditions such as infections and inflammation , and elevated levels have been found in diabetic patients ( 36,37 ) . expression of 1-acid glycoprotein has been linked with metabolic signaling , including hyperglycemia , and has been suggested to modulate immune responses to protect adipose tissue from inflammation and metabolic dysfunction ( 37 ) . in this study , 1-acid glycoprotein was prospectively associated with both fasting and postchallenge glucose ( table 3 ) . 1-acid glycoprotein has previously been linked with the risk for incidence of diabetes in the atherosclerosis risk in communities ( aric ) study ; however , the association was not independent of baseline bmi , insulin , and glucose ( 35 ) . our results suggest that 1-acid glycoprotein is not only related to metabolic dysfunction cross - sectionally but also a predictor of future glycemia , and thus highlight the role of prolonged inflammation as a risk marker for attenuating glucose tolerance . the role of metabolic dysfunction in the pathogenesis of diabetes has primarily focused on lipoproteins and lipid - induced mechanisms ( 5,38,39 ) . in contrast to this notion , the metabolites predictive of glycemia in this study were amino acids and gluconeogenesis substrates rather than lipid composition measures . comprehensive lipid profiling was recently used to identify a pattern of triacylglycerides associated with insulin resistance and the risk for future diabetes ( 8) . our results are somewhat surprising in this respect ; whereas several fatty acid species and saturation measures were cross - sectionally associated with glycemia and impaired insulin sensitivity ( table 2 and supplementary fig . however , the triacylglycerol signature linked with the risk for diabetes was composed of lipid species not quantifiable by the high - throughput metabolic profiling platform . these results may suggest that information on the molecular character of lipid components , including specific chain length and saturation content , is beneficial for elucidating the etiology of lipid - mediated hyperglycemia . as a limitation , we note that our study was inadequately powered to assess the risk for incidence of diabetes . although the cross - sectional associations were mutually replicated in two cohorts , the prospective associations merit further validation in independent populations . insulin action was approximated by ogtt - based surrogates , which have limited ability to separate contributions from peripheral and hepatic insulin resistance ( 1 ) . our study was conducted in a homogenous finnish population and care must be taken before generalization to other age groups and ethnicities . in conclusion , high - throughput profiling revealed a diverse metabolic footprint of glycemia in middle - aged men and women . alanine , lactate , and pyruvate were predictors of postchallenge glucose after a 6.5-year follow - up , indicating that early signs of attenuating glucose tolerance may be observed in gluconeogenesis precursors quantified from fasting serum samples . 1-acid glycoprotein as well as branched - chain and aromatic amino acids predicted both fasting and postload glycemia , but the changes in amino acid levels did not follow glucose changes over time . these findings support the notion that alterations in amino acid metabolism precede perturbations in glucose homeostasis , and the circulating amino acid levels may serve as predictors of future glycemia in a general population setting .

objectivemetabolite predictors of deteriorating glucose tolerance may elucidate the pathogenesis of type 2 diabetes . we investigated associations of circulating metabolites from high - throughput profiling with fasting and postload glycemia cross - sectionally and prospectively on the population level.research design and methodsoral glucose tolerance was assessed in two finnish , population - based studies consisting of 1,873 individuals ( mean age 52 years , 58% women ) and reexamined after 6.5 years for 618 individuals in one of the cohorts . metabolites were quantified by nuclear magnetic resonance spectroscopy from fasting serum samples . associations were studied by linear regression models adjusted for established risk factors.resultsnineteen circulating metabolites , including amino acids , gluconeogenic substrates , and fatty acid measures , were cross - sectionally associated with fasting and/or postload glucose ( p < 0.001 ) . among these metabolic intermediates , branched - chain amino acids , phenylalanine , and 1-acid glycoprotein were predictors of both fasting and 2-h glucose at 6.5-year follow - up ( p < 0.05 ) , whereas alanine , lactate , pyruvate , and tyrosine were uniquely associated with 6.5-year postload glucose ( p = 0.0030.04 ) . none of the fatty acid measures were prospectively associated with glycemia . changes in fatty acid concentrations were associated with changes in fasting and postload glycemia during follow - up ; however , changes in branched - chain amino acids did not follow glucose dynamics , and gluconeogenic substrates only paralleled changes in fasting glucose.conclusionsalterations in branched - chain and aromatic amino acid metabolism precede hyperglycemia in the general population . further , alanine , lactate , and pyruvate were predictive of postchallenge glucose exclusively . these gluconeogenic precursors are potential markers of long - term impaired insulin sensitivity that may relate to attenuated glucose tolerance later in life .

hepatitis c virus ( hcv ) has infected about 170 million patients worldwide and it has been considered as a major cause of liver failure and hepatocellular carcinoma ( hcc ) ( 1 ) . patients with transfusion - dependent thalassemia are at higher risk of acquiring hcv infection , especially those who received their first transfusion in iran before the introduction of the hcv donor - screening program in 1995 ( 2 ) . liver failure as the consequence of hcv infection is the second cause of mortality in thalassemic patients ( 2 ) . iron overload following frequent blood transfusion deteriorates liver fibrosis in these patients ( 4 ) . antiviral therapy and achievement of sustained virological response ( svr ) can act to avoid liver failure and hcc , and can also decrease reservoir of hcv infection in thalassemic patients . combination of pegylated - interferon ( peg - ifn ) and ribavirin ( rbv ) has been established as the standard anti - hcv therapy . although rbv is not approved by the food and drug administration ( fda ) for patients with thalassemia because of increasing hemolytic anemia , there are some published data regarding the safety and increment of svr following administration of rbv in patients with thalassemia ( 5 , 6 ) . however , patients with thalassemia have some comorbidities due to iron overload and peg - ifn / rbv combination therapy . moreover , treatment with peg - ifn and rbv in patients with thalassemia is associated with more adverse effects and more needs of transfusion ( 7 ) . on the other hand , the mono - therapy with peg - ifn resulted in low svr rate in thalassemic patients with hcv genotype-1 infection , which seems to be caused by liver iron overload and absence of rbv ( 5 ) . numerous factors including gender , age , hcv rna level prior to treatment , stage of liver fibrosis , and hcv genotypes have been shown to determine the success rate to antiviral therapy ( 8) . in addition , a number of recently published genome - wide association studies ( gwas ) have shown that polymorphisms within the interferon lambda ( ifnl ) genomic region result in differences between patients responses to anti - hcv treatment ( 9 - 11 ) . among these single nucleotide polymorphisms ( snps ) , rs12979860 ( located 3 kb upstream of the il28b ( ifnl3 ) gene in intron 1 of ifnl4 gene ) and rs8099917 ( located 8 kb upstream of the ifnl3 gene ) have been identified as two predictive factors of response to antiviral therapy . given that antiviral therapy in thalassemic patients with hepatitis c is more difficult than in non - thalassemic patients , detection of predictive factors for svr is necessary . unfortunately , there are currently no reports in the literature regarding the role of these snps in thalassemic patients with hcv infection , who were treated with peg - ifn and rbv . we aimed to assess the impact of rs12979860 and rs8099917 polymorphisms on the rate of response to combination therapy with peg - ifn and rbv in thalassemic patients with chronic hepatitis c ( chc ) . in this cross - sectional study from 2010 to 2013 , 143 transfusion - dependent thalassemic patients , who had hcv rna > 50 iu / ml for more than six months were evaluated and treated at the tehran hepatitis clinic a clinic associated with the baqiyatallah research center for gastroenterology and liver diseases ( brcgl ) . patients who were co - infected with hepatitis b virus and human immunodeficiency virus , decompensated cirrhotic patients , cases with hcc , and those who had contraindication for interferon therapy including severe heart failure , poorly controlled diabetes mellitus , poorly controlled psychiatric disorder , and also , patients with baseline hemoglobin below 8 g / dl were excluded from the study . all study participants provided an informed consent and the study design was approved by the ethics committee of brcgl . all of the patients were treated with combination of peg - ifn--2a ( pegasys , roche , basel , switzerland ) and rbv ( copegus , roche , basel , switzerland ) or peg - ifn--2b ( pegintron , schering - plough , puerto rico , usa ) and rbv ( rebetol , schering - plough , puerto rico , usa ) . the dose of pegasys was 180 g subcutaneously once a week in combination with oral rbv 600 - 1000 mg per day according to patients weight and hemoglobin level . the dose of pegintron was 80 , 100 or 120 g subcutaneously once a week according to patients weight in combination with oral rbv 600 - 1000 mg per day according to patients weight and hemoglobin level . the treatment duration was 24 weeks for hcv genotype-3 infection or 48 weeks for hcv genotype-1 infection , which could be extended regarding patient s response and compliance . in patients with hcv genotype-1 infection , who achieved partial early virological response , the treatment course was extended to 72 weeks . all patients who were infected with mixed hcv genotypes had hcv genotype-1 as a component of the hcv pool and as a result they were treated the same way as patients with hcv genotype-1 infection and were considered as hcv genotype-1- infected patients in the subsequent analysis . serum hcv rna level was measured at weeks 4 , 12 , 24 , 48 and 72 during treatment and 24 weeks after treatment cessation . undetectable hcv rna ( < 10 iu / ml ) at the end of four weeks of treatment was considered as rapid virological response ( rvr ) . early virological response ( evr ) was defined as undetectable hcv rna at the end of week 12 ( complete evr , cevr ) or at least 2 - log decrease in hcv rna at the end of week 12 in comparison with the baseline hcv rna level ( partial evr , pevr ) . undetectable hcv rna six months after the treatment cessation was considered as svr , which determined the treatment success . treatment non - response was defined as < 2 -log decrease in hcv rna level at week 12 , compared to the baseline or detectable hcv rna at week 24 . if undetectable level of hcv rna was achieved at the end of treatment and the hcv rna became detectable six months later , the patient was considered as a relapse case . assessment of hcv rna level was carried out using cobas taqman hcv test v2.0 ( roche diagnostics ) , according to the manufacturer s instructions . in this study , the detailed protocol of the polymerase chain reaction - restriction fragment length polymorphism ( pcr - rflp ) method for genotyping of rs12979860 and rs8099917 snps has been previously described ( 12 ) . briefly , genomic dna was extracted from patients peripheral blood using the qiaamp dna blood mini kit ( qiagen , hilden , germany ) , according to the manufacturer s instructions . the pcr was performed using accupower pcr premix ( bioneer corp . , daejeon , south korea ) with the following conditions : 94c for five minutes , 35 cycles of 94c for 20 seconds , 66c for 20 seconds , and 72c for 20 seconds , followed by 72c for five minutes . primers used for the reaction included : rs12979860 , 5 - gcggaaggagcagttgcgct - 3 and 5-ggggctttgctgggggagtg-3 ; or rs8099917 , 5-cccacttctggaacaaatcgtccc-3 and 5-tctcctccccaagtcaggcaacc-3. next , the pcr amplicons were digested for more than one hour with 10 u of restriction endonuclease : bstui for rs12979860 or bsrdi for rs8099917 ( fermentas of thermo fisher scientific , waltham , ma , united states ) . the digested pcr products were separated on 3% agarose gels revealing the following sized fragments : rs12979860 , 196 and 45 bp for the cc genotype , 241 , 196 and 45 bp for the ct genotype , or 241 bp for the tt genotype ; rs8099917 , 552 bp for the tt genotype , 552 , 322 and 230 bp for the gt genotype , and 322 and 230 bp for the gg genotype . grading of inammation and staging of brosis were determined by the modified knodell scoring system ( 13 ) . grade on liver biopsy of 6 was considered as mild , 7 - 12 as moderate , and 13 as severe liver necro - inflammation . stage on liver biopsy of 2 was considered as mild , 3 - 4 as moderate , and 5 as severe liver fibrosis ( cirrhosis ) . liver histology was evaluated by an expert pathologist , who was blind to the study design . continuous variables with normal distribution were expressed by mean standard deviation ( sd ) and continuous variables deviated from the normal distribution by median ( interquartile range ) . fisher exact test was used for analysis of categorical variables , t - test for continuous variables with normal distribution , and mann - whitney u test for continuous variables deviated from normal distribution . the hardy - weinberg equilibrium ( hwe ) was assessed for both rs12979860 and rs8099917 snps , and the linkage disequilibrium ( ld ) between these snps was calculated . all baseline variables with a p < 0.1 in univariate analysis were entered to a logistic regression model . to prevent multi - collinearity resulted by the ld between the two snps different logistic regression models with inclusion of a single snp were considered ( 14 ) . in this cross - sectional study from 2010 to 2013 , 143 transfusion - dependent thalassemic patients , who had hcv rna > 50 iu / ml for more than six months were evaluated and treated at the tehran hepatitis clinic a clinic associated with the baqiyatallah research center for gastroenterology and liver diseases ( brcgl ) . patients who were co - infected with hepatitis b virus and human immunodeficiency virus , decompensated cirrhotic patients , cases with hcc , and those who had contraindication for interferon therapy including severe heart failure , poorly controlled diabetes mellitus , poorly controlled psychiatric disorder , and also , patients with baseline hemoglobin below 8 g / dl were excluded from the study . all study participants provided an informed consent and the study design was approved by the ethics committee of brcgl . all of the patients were treated with combination of peg - ifn--2a ( pegasys , roche , basel , switzerland ) and rbv ( copegus , roche , basel , switzerland ) or peg - ifn--2b ( pegintron , schering - plough , puerto rico , usa ) and rbv ( rebetol , schering - plough , puerto rico , usa ) . the dose of pegasys was 180 g subcutaneously once a week in combination with oral rbv 600 - 1000 mg per day according to patients weight and hemoglobin level . the dose of pegintron was 80 , 100 or 120 g subcutaneously once a week according to patients weight in combination with oral rbv 600 - 1000 mg per day according to patients weight and hemoglobin level . the treatment duration was 24 weeks for hcv genotype-3 infection or 48 weeks for hcv genotype-1 infection , which could be extended regarding patient s response and compliance . in patients with hcv genotype-1 infection , who achieved partial early virological response , the treatment course was extended to 72 weeks . all patients who were infected with mixed hcv genotypes had hcv genotype-1 as a component of the hcv pool and as a result they were treated the same way as patients with hcv genotype-1 infection and were considered as hcv genotype-1- infected patients in the subsequent analysis . serum hcv rna level was measured at weeks 4 , 12 , 24 , 48 and 72 during treatment and 24 weeks after treatment cessation . undetectable hcv rna ( < 10 iu / ml ) at the end of four weeks of treatment was considered as rapid virological response ( rvr ) . early virological response ( evr ) was defined as undetectable hcv rna at the end of week 12 ( complete evr , cevr ) or at least 2 - log decrease in hcv rna at the end of week 12 in comparison with the baseline hcv rna level ( partial evr , pevr ) . undetectable hcv rna six months after the treatment cessation was considered as svr , which determined the treatment success . treatment non - response was defined as < 2 -log decrease in hcv rna level at week 12 , compared to the baseline or detectable hcv rna at week 24 . if undetectable level of hcv rna was achieved at the end of treatment and the hcv rna became detectable six months later , the patient was considered as a relapse case . assessment of hcv rna level was carried out using cobas taqman hcv test v2.0 ( roche diagnostics ) , according to the manufacturer s instructions . in this study , the detailed protocol of the polymerase chain reaction - restriction fragment length polymorphism ( pcr - rflp ) method for genotyping of rs12979860 and rs8099917 snps has been previously described ( 12 ) . briefly , genomic dna was extracted from patients peripheral blood using the qiaamp dna blood mini kit ( qiagen , hilden , germany ) , according to the manufacturer s instructions . daejeon , south korea ) with the following conditions : 94c for five minutes , 35 cycles of 94c for 20 seconds , 66c for 20 seconds , and 72c for 20 seconds , followed by 72c for five minutes . primers used for the reaction included : rs12979860 , 5 - gcggaaggagcagttgcgct - 3 and 5-ggggctttgctgggggagtg-3 ; or rs8099917 , 5-cccacttctggaacaaatcgtccc-3 and 5-tctcctccccaagtcaggcaacc-3. next , the pcr amplicons were digested for more than one hour with 10 u of restriction endonuclease : bstui for rs12979860 or bsrdi for rs8099917 ( fermentas of thermo fisher scientific , waltham , ma , united states ) . the digested pcr products were separated on 3% agarose gels revealing the following sized fragments : rs12979860 , 196 and 45 bp for the cc genotype , 241 , 196 and 45 bp for the ct genotype , or 241 bp for the tt genotype ; rs8099917 , 552 bp for the tt genotype , 552 , 322 and 230 bp for the gt genotype , and 322 and 230 bp for the gg genotype . grading of inammation and staging of brosis were determined by the modified knodell scoring system ( 13 ) . grade on liver biopsy of 6 was considered as mild , 7 - 12 as moderate , and 13 as severe liver necro - inflammation . stage on liver biopsy of 2 was considered as mild , 3 - 4 as moderate , and 5 as severe liver fibrosis ( cirrhosis ) . liver histology was evaluated by an expert pathologist , who was blind to the study design . continuous variables with normal distribution were expressed by mean standard deviation ( sd ) and continuous variables deviated from the normal distribution by median ( interquartile range ) . fisher exact test was used for analysis of categorical variables , t - test for continuous variables with normal distribution , and mann - whitney u test for continuous variables deviated from normal distribution . the hardy - weinberg equilibrium ( hwe ) was assessed for both rs12979860 and rs8099917 snps , and the linkage disequilibrium ( ld ) between these snps was calculated . all baseline variables with a p < 0.1 in univariate analysis were entered to a logistic regression model . to prevent multi - collinearity resulted by the ld between the two snps different logistic regression models with inclusion of a single snp were considered ( 14 ) . , 143 thalassemic patients with mean age of 24.47 were included ; most of them were infected with hcv genotype-1 ( 61.5% ) followed by hcv genotype-3 ( 35.7% ) . the most frequent rs12979860 genotype was ct ( 50.3% ) and the rs8099917 genotype was tt ( 60.7% ) ( table 1 ) . the distribution of both rs12979860 and rs8099917 genotypes were in hwe ( p = 0.50 and p = 0.36 , respectively ) . on the other hand , the two snps were in a moderate ld ( d = 1.0 , r = 0.44 ) . abbreviations : alt , alanine transaminase ; ast , aspartate transaminase ; min , minimum ; max , maximum ; iqr , interquartile range . ( % ) or mean sd . the data were missed in less than 10% of patients . in the present study , 95 ( 66.4% ) patients received peg - ifn--2a and 48 ( 33.6% ) were treated with peg - ifn--2b . treatment was prolonged for 72 weeks in 11 ( 12.0% ) patients with hcv genotype-1 infection regarding pevr achievement . treatment was withdrawn in 25 ( 27.2% ) patients with hcv genotype-1 infection and in six ( 11.8% ) patients with hcv genotype-3 infection because of breakthrough or non - response . treatment course was not withdrawn in any patients due to adverse events or non - compliance . within the cohort of 143 patients , 70 ( 49.0% ) had svr , 31 ( 21.7% ) non - response or breakthrough and 42 ( 29.4% ) relapse . the rate of svr was higher in patients , who were treated with peg - ifn--2b compared to the response rate of the patients , who received peg - ifn--2a ; however , the difference was not statistically significant . among 11 patients with pevr , who underwent 72 weeks of prolonged treatment , three ( 27.3% ) achieved svr . the rates of rvr , cevr , svr , relapse and non - response in relation to hcv genotypes are shown in figure 1 . the rate of virological responses was significantly lower in patients with hcv genotype-1 infection than that of patients with hcv genotype-3 infection , including rvr ( p = 0.015 ; or = 0.3 ; ci = 0.12 - 0.75 ) , cevr ( p = 0.001 ; or = 0.22 ; ci = 0.09 - 0.58 ) and svr ( p = 0.015 ; or = 0.42 ; ci = 0.21 - 0.84 ) . furthermore , the rate of non - response was significantly higher in patients with hcv genotype-1 infection than in patients with hcv genotype-3 infection ( p = 0.035 ; or = 2.78 ; ci = 1.33 - 8.33 ) yet the relapse rate was not significantly different among patients with hcv genotype-1 and hcv genotype-3 infection ( p = 0.57 ; or = 1.35 ; ci = 0.63 - 2.86 ) . among baseline parameters , hcv rna level of < 600 000 iu / ml , rs12979860 cc and rs8099917 tt genotypes were significantly correlated with achievement of cevr in patients with hcv genotype-1 infection ( table 2 ) . multivariate analysis of these parameters showed that rs12979860 and rs8099917 snps and hcv rna level remained as predictors of cevr in thalassemic patients with hcv genotype-1 infection ( table 3 ) . furthermore , among baseline predictors , rs12979860 and rs8099917 snps were found to be the only parameters associated with achievement of svr in thalassemic patients with hcv genotype-1 infection ( table 4 ) . on the other hand , the on - treatment responses including rvr and cevr were significantly associated with achievement of svr in hcv genotype-1 infection ; odds ratio ( or ) of 4.89 and 16.44 , respectively ( table 4 ) . the sensitivity , specificity , positive predictive value ( ppv ) and negative predictive value ( npv ) of rs12979860 cc genotype for prediction of svr were 55.3% , 79.6% , 65.6% and 71.7% , respectively . abbreviations : cevr , complete early virological response ; or , odds ratio ; ref , reference . abbreviations : cevr , complete early virological response ; svr , sustained virological response ; or , odds ratio ; ref , reference ; rvr , rapid virological response . the data were missed in less than 10% of patients . the data were missed in more than 10% of patients . in the group with hcv genotype-3 infection , the number of patients who did not achieve cevr was very small ( six cases ) and as a result the statistical power was too low to assess the parameters influencing achievement of cevr . among baseline parameters , female sex and age of < 24 were associated with achievement of svr in patients with hcv genotype-3 infection ( table 5 ) , however in multivariate analysis , only age of < 24 remained as a predictor of svr in these patients ( table 6 ) . moreover , rvr and cevr were both associated with achievement of svr with or of 16.62 and 11.07 , respectively ( table 5 ) . abbreviations : cevr , complete early virological response ; svr , sustained virological response ; or , odds ratio ; ref , reference ; rvr , rapid virological response . genotype-1 infection , the majority of patients with rs12979860 cc genotype achieved svr while the majority of patients with rs12979860 ct genotype relapsed and the majority of patients with rs12979860 tt genotype were non - responders ( p linear - by - linear association = 0.002 ) ( figure 2a ) . in hcv genotype-3 infection , the highest svr rate was observed in rs12979860 cc genotype and there was a trend in the decrease of svr in ct and tt genotypes . furthermore , in the group with hcv genotype-3 infection , the lowest rate of non - response was observed in patients with rs12979860 cc genotype , which gradually increased in ct and tt genotypes ( p linear - by - linear association = 0.122 ) ( figure 2b ) . a , the rate of svr , relapse and non - response in thalassemic patients with hcv genotype-1 infection in relation to rs12979860 genotypes ; b , the rate of svr , relapse and non - response in thalassemic patients with hcv genotype-3 infection in relation to rs12979860 genotypes . , 143 thalassemic patients with mean age of 24.47 were included ; most of them were infected with hcv genotype-1 ( 61.5% ) followed by hcv genotype-3 ( 35.7% ) . the most frequent rs12979860 genotype was ct ( 50.3% ) and the rs8099917 genotype was tt ( 60.7% ) ( table 1 ) . the distribution of both rs12979860 and rs8099917 genotypes were in hwe ( p = 0.50 and p = 0.36 , respectively ) . on the other hand , the two snps were in a moderate ld ( d = 1.0 , r = 0.44 ) . abbreviations : alt , alanine transaminase ; ast , aspartate transaminase ; min , minimum ; max , maximum ; iqr , interquartile range . ( % ) or mean sd . the data were missed in less than 10% of patients . in the present study , 95 ( 66.4% ) patients received peg - ifn--2a and 48 ( 33.6% ) were treated with peg - ifn--2b . treatment was prolonged for 72 weeks in 11 ( 12.0% ) patients with hcv genotype-1 infection regarding pevr achievement . treatment was withdrawn in 25 ( 27.2% ) patients with hcv genotype-1 infection and in six ( 11.8% ) patients with hcv genotype-3 infection because of breakthrough or non - response . treatment course was not withdrawn in any patients due to adverse events or non - compliance . within the cohort of 143 patients , 70 ( 49.0% ) had svr , 31 ( 21.7% ) non - response or breakthrough and 42 ( 29.4% ) relapse . the rate of svr was higher in patients , who were treated with peg - ifn--2b compared to the response rate of the patients , who received peg - ifn--2a ; however , the difference was not statistically significant . among 11 patients with pevr , who underwent 72 weeks of prolonged treatment , the rates of rvr , cevr , svr , relapse and non - response in relation to hcv genotypes are shown in figure 1 . the rate of virological responses was significantly lower in patients with hcv genotype-1 infection than that of patients with hcv genotype-3 infection , including rvr ( p = 0.015 ; or = 0.3 ; ci = 0.12 - 0.75 ) , cevr ( p = 0.001 ; or = 0.22 ; ci = 0.09 - 0.58 ) and svr ( p = 0.015 ; or = 0.42 ; ci = 0.21 - 0.84 ) . furthermore , the rate of non - response was significantly higher in patients with hcv genotype-1 infection than in patients with hcv genotype-3 infection ( p = 0.035 ; or = 2.78 ; ci = 1.33 - 8.33 ) yet the relapse rate was not significantly different among patients with hcv genotype-1 and hcv genotype-3 infection ( p = 0.57 ; or = 1.35 ; ci = 0.63 - 2.86 ) . among baseline parameters , hcv rna level of < 600 000 iu / ml , rs12979860 cc and rs8099917 tt genotypes were significantly correlated with achievement of cevr in patients with hcv genotype-1 infection ( table 2 ) . multivariate analysis of these parameters showed that rs12979860 and rs8099917 snps and hcv rna level remained as predictors of cevr in thalassemic patients with hcv genotype-1 infection ( table 3 ) . furthermore , among baseline predictors , rs12979860 and rs8099917 snps were found to be the only parameters associated with achievement of svr in thalassemic patients with hcv genotype-1 infection ( table 4 ) . on the other hand , the on - treatment responses including rvr and cevr were significantly associated with achievement of svr in hcv genotype-1 infection ; odds ratio ( or ) of 4.89 and 16.44 , respectively ( table 4 ) . the sensitivity , specificity , positive predictive value ( ppv ) and negative predictive value ( npv ) of rs12979860 cc genotype for prediction of svr were 55.3% , 79.6% , 65.6% and 71.7% , respectively . abbreviations : cevr , complete early virological response ; or , odds ratio ; ref , reference . abbreviations : cevr , complete early virological response ; svr , sustained virological response ; or , odds ratio ; ref , reference ; rvr , rapid virological response . in the group with hcv genotype-3 infection , the number of patients who did not achieve cevr was very small ( six cases ) and as a result the statistical power was too low to assess the parameters influencing achievement of cevr . among baseline parameters , female sex and age of < 24 were associated with achievement of svr in patients with hcv genotype-3 infection ( table 5 ) , however in multivariate analysis , only age of < 24 remained as a predictor of svr in these patients ( table 6 ) . moreover , rvr and cevr were both associated with achievement of svr with or of 16.62 and 11.07 , respectively ( table 5 ) . abbreviations : cevr , complete early virological response ; svr , sustained virological response ; or , odds ratio ; ref , reference ; rvr , rapid virological response . in hcv genotype-1 infection , the majority of patients with rs12979860 cc genotype achieved svr while the majority of patients with rs12979860 ct genotype relapsed and the majority of patients with rs12979860 tt genotype were non - responders ( p linear - by - linear association = 0.002 ) ( figure 2a ) . in hcv genotype-3 infection , the highest svr rate was observed in rs12979860 cc genotype and there was a trend in the decrease of svr in ct and tt genotypes . furthermore , in the group with hcv genotype-3 infection , the lowest rate of non - response was observed in patients with rs12979860 cc genotype , which gradually increased in ct and tt genotypes ( p linear - by - linear association = 0.122 ) ( figure 2b ) . a , the rate of svr , relapse and non - response in thalassemic patients with hcv genotype-1 infection in relation to rs12979860 genotypes ; b , the rate of svr , relapse and non - response in thalassemic patients with hcv genotype-3 infection in relation to rs12979860 genotypes . in the present study , the prevalence of rs12979860 and rs8099917 genotypes in patients with thalassemia was similar to that of the other iranian chc patients . given that iran is located in the middle east region with caucasian ethnicity and based on the results of previous studies the major rs12979860 genotype was ct followed by cc and tt , and also the major rs8099917 genotype was tt followed by gt and gg in patients with chc ( 15 - 17 ) . the most prevalent hcv genotype in the patients with thalassemia of the present study was hcv genotype-1a followed by hcv genotype-3a that was similar to other studies on patients with and without thalassemia in iran ( 18 - 20 ) . in this study , the response rate to peg - ifn and rbv was 41.3% in thalassemic patients with hcv genotype-1 infection and 62.8% in thalassemic patients with hcv genotype-3 infection . these data were similar to the results of a recent meta - analysis , which showed that svr rate in thalassemic patients with hcv genotype-1 , who were treated with conventional - or peg - ifn and rbv , was lower than its rate in thalassemic patients with hcv genotype-3 ( 21 ) . a study on 280 thalassemic patients with chc , who were treated with peg - ifn monotherapy or peg - ifn and rbv , showed that the addition of rbv to peg - ifn increased the rate of svr especially in patients with hcv genotype-1 ( 5 ) . however , the rate of rbv - associated anemia and the need for transfusion were more in patients with thalassemia who were treated with combination of peg - ifn and rbv versus patients with thalassemia who were treated with peg - ifn monotherapy ( 5 ) . therefore , it was recommended to add low - dose rbv to peg - ifn therapy in thalassemic patients considering their clinical situation . moreover , it seems that the rate of svr in patients with thalassemia , who were treated with combination of peg - ifn and rbv , was lower than non - thalassemic patients due to suboptimal dose of rbv and iron overload in the liver ( 5 , 22 , 23 ) . furthermore , the rate of treatment side - effects , rbv dose reduction and discontinuation of therapy due to side - effects in thalassemic patients with chc are often more than non - thalassemic patients . overall , antiviral therapy in transfusion - dependent thalassemic patients with hcv infection is conflicting . in the present study , iron overload in thalassemic patients with chc aggregates liver fibrosis and many of these patients have cirrhosis at the time of therapy , so the risk of liver decompensation should be considered in these patients during antiviral therapy . in addition , other adverse effects of iron overload such as heart failure , diabetes mellitus and hypothyroidism were observed more frequently in patients with thalassemia , which can cause more difficulties during peg - ifn therapy ( 24 ) . on the other hand , monotherapy with peg - ifn has low response rate , and the combination of peg - ifn and rbv therapy significantly results in higher rate of svr , however we should note that the addition of rbv can increase blood transfusion frequencies and thus may aggregate the adverse effects of iron overload especially heart failure . regarding these facts , the threshold of starting hcv antiviral therapy with peg - ifn and rbv is different in patients with thalassemia compared to other patients and also its adverse effects are more life threatening . even in some patients with major co - morbidities , the physician should compare the risk of antiviral therapy to the risk of liver failure before starting therapy . as a result , the detection of predictive factors of svr is very important in patients with thalassemia . based on the previous studies on non - thalassemic patients , who were treated with peg - ifn and rbv , several factors such as female gender , younger age , low stage of liver fibrosis , low level of pretreatment hcv rna , hcv genotypes-2 and-3 and host genetics such rs12979860 cc and rs8099917 tt genotypes have been known as the favorable predictive factors of svr ( 25 - 27 ) . however , the results of this study showed that rs12979860 cc and rs8099917 tt genotypes were the only predictive factors of svr in patients with thalassemia , who were infected with hcv genotype-1 . in contrast to non - thalassemic patients , there was no association between pretreatment hcv rna level and stage of liver fibrosis with svr in these patients . moreover , two previous studies showed that pretreatment hcv rna level and stage of fibrosis were not associated with svr in patients with thalassemia ( 5 , 28 ) . similar to previous studies , the effect of on - treatment response ( rvr and cevr ) was more important than the baseline predictors . there are no studies in the literature that have assessed the association between polymorphisms near the il28b gene and svr in patients with thalassemia , who were treated with peg - ifn and rbv . a study on patients with thalassemia , who were treated with conventional - ifn monotherapy , showed that the tt genotype of rs8099917 and cc genotype of rs12979860 polymorphisms were associated with svr ( 28 ) . moreover , surprising data showed that npv of rs12979860 for svr achievement was 71.7% , which means that the majority of patients with non - cc genotypes of rs12979860 did not achieve svr . however , high npv of rs12979860 snp in patients with thalassemia may motivate physicians to treat patients with rs12979860 non - cc genotypes with new direct - acting antiviral ( daa ) agents with fewer side effects . there was no relationship between polymorphisms near the il28b gene and the response rate in thalassemic patients with hcv genotype-3 infection . this may be due to the small sample size and more studies should be conducted . a recent meta - analysis on non - thalassemic patients with hepatitis c genotype-3 infection showed that the tt genotype of rs8099917 and cc genotype of rs12979860 were the predictors of svr and rvr in caucasian patients , who were treated with combination of peg - ifn and rbv ( 29 ) . the first generation of daas , including ns3/4a protease inhibitors ( pis ) ( telaprevir or boceprevir ) , have been proved effective in chc patients , who were infected with hcv genotype-1 in 2011 . however , these medications cause more severe anemia than dual therapy with peg - ifn and rbv , so these drugs can not be used for patients with thalassemia . fortunately , several new daas , including second - wave and second - generation ns3 , ns5a and ns5b inhibitors are approved for the treatment of hcv infection . they have higher antiviral potency , fewer adverse effects and shorter treatment duration compared to telaprevir and boceprevir regimens and some of them have pan - genotypic effects while their efficacy is not related to the host genetics ( 30 ) . furthermore , newer regimens are interferon - and ribavirin - free ( 31 , 32 ) . in recent findings , these treatments did not result in hemolysis and anemia as an adverse side effect and also these medications were used in cirrhotic patients . however , these new daas regimens have several and considerable drug - drug reactions ( 33 ) . we should note that the majority of thalassemic patients with hepatitis c live in developing countries and these newer regimens might not be affordable soon . in addition , these new treatments were not evaluated in trials for patients with thalassemia and their safety is unknown for these patients . it should be considered that many of these patients have cardiac disease secondary to iron overload and they use cardiac drugs , however their drug reactions with new daas is unknown . in conclusion , polymorphisms near the il28b gene were the only predictive factor of response to treatment with peg - ifn and rbv regimen in patients with thalassemia and as a result we suggest the identification of these polymorphisms in all of thalassemic patients with chc genotype-1 before making decisions on antiviral therapy . in thalassemic patients with rs12979860 cc genotype and without severe comorbidities , the physician can motivate them to start combination therapy with peg - ifn and rbv regimen as soon as possible . upon availability of newer daas with high cost in developing countries , it is rational to try the dual therapy before using new daas in these patients . based on high virological response rate to peg - ifn and rbv combination therapy in patients infected with hcv genotype-3 , we can treat these patients with peg - ifn and rbv combination therapy , regardless of ifnl polymorphisms .

backgroundhepatitis c virus ( hcv ) is the major cause of liver failure in thalassemic patients . in these patients , iron overload and their comorbidities make difficulties during pegylated - interferon ( peg - ifn ) and ribavirin ( rbv ) therapy.objectiveswe aimed to assess the impact of polymorphisms near the il28b gene on virological response in hcv - infected thalassemic patients , who were treated with peg - ifn and rbv.patients and methodsthis cross - sectional study was conducted on 143 thalassemic patients with chronic hepatitis c , who were treated with a combination of peg - ifn and rbv regimen . the rs12979860 and rs8099917 polymorphisms were assessed as the most common polymorphisms near the il28b gene by the polymerase chain reaction - restriction fragment length polymorphism ( pcr - rflp ) method.resultsthe rate of sustained virological response ( svr ) was significantly lower in thalassemic patients with hcv genotype-1 infection compared to patients with hcv genotype-3 infection . among baseline predictors , rs12979860 and rs8099917 polymorphisms were found to be the only parameters associated with achievement of svr in thalassemic patients with hcv genotype-1 infection however , there was no association between these polymorphisms and the rate of svr in thalassemic patients with hcv genotype-3 infection.conclusionsin hcv genotype-1- infected thalassemic patients with rs12979860 cc genotype and without severe comorbidities , peg - ifn and rbv combination therapy can be tried yet in those with rs12979860 ct / tt it may be reasonable to treat cases with new direct - acting antivirals .

various investigations have focused on it due to its biological activities , high tendency to recur and different growth mechanisms in comparison with other cystic lesions . many studies have been conducted on cell - cycle associated proteins such as antiapoptotic markers ( tp53 , bcl-2 ) and cell proliferation markers ( ki67 , proliferating cell nuclear antigen , epidermal growth factor receptor [ egfr ] ) . these studies have shown different biological and proliferative activities for the lining epithelium of kcot . bcl-2 , which is located in the external membrane of mitochondria , endoplasmic reticulum and nuclear membrane , play an important role in apoptosis . uncontrolled expression of bcl-2 has been found before histopathologic changes in the early stage of neoplasm . epidermal growth factor receptor is the most important growth factor ligand on the cell surface . overexpression of egfr - related genes is seen in many neoplasms , which causes the over sensitivity of cells to the normal level of growth factor . therefore , it causes specific phenotypes of cells , which can affect the cellular reaction to the treatment . kichi et al . have reported that bcl-2 is seen only in kcot and not in dentigerous cyst . sandra et al . have reported strong expression of bcl-2 in ameloblastoma and suggested that antiapoptotic proteins are expressed more than apoptotic proteins in ameloblastoma . in a study done by shear , expression of egfr marker the strongest reaction was related to kcot , and the weakest was in the radicular cyst . indeed , because of specific activity of kcot in comparison with other odontogenic cysts , it is possible to evaluate the expression of egfr and bcl-2 proteins in kcot compared with dentigerous cyst and ameloblastoma . expression of these proteins provides us with the knowledge about the biological activity of kcot . in this study , the expression of egfr and bcl-2 proteins in kcot was evaluated and compared with dentigerous cyst and ameloblastoma . in a cross - sectional study , paraffin - embedded tissues of 16 kcot , 16 dentigerous cysts , and 16 ameloblastoma samples were obtained from the archives in department of oral pathology , dental school , isfahan university of medical sciences . in order to detect the specific antigens of egfr and bcl-2 , briefly , the main procedures were : serial sectioning ( in 3 - 4 um sections ) , deparafinization , rehydration , and antigen retrieval . all specimens were then placed in the phosphate - buffered saline ( pbs ) and treated for 5 min in protein block solution to prevent any false staining . the specimens were then incubated for 30 min with primary antibody of egfr ( ncl - egfr-384 ) clone egfr25 , bcl-2 ( ncl - bcl-2 - 486 ) clone 3.1 ( novocastra / germany ) . furthermore , the sections were exposed to novolink polymer ( re7112 ) or a secondary antibody for 30 min and washed with pbs . they were then incubated for 5 min with diaminobenzidine for visualization . after washing the slides finally , the slides were mounted after being dried . to quantify the percentage of positive cells within the lesions of egfr and bcl-2 markers , the sections were observed by two oral pathologists separately by olympus light microscope ( cx21fs , tokyo , japan ) at 400 magnification . the score of egfr staining and bcl-2 in each specimen / layer was calculated by the following formulas : score of egfr staining in each layer = d iscore of egfr staining in each specimen = td tidistribution ( d ) : mean percentage of stained cells by 1000 cells in each layerintensity of staining in each layer ( i ) : negative ( 0 ) , weak ( + 1 ) , moderate ( + 2 ) , severe ( + 3)pattern of staining in each specimen ( p ) : membranous , cytoplasmic , membranous cytoplasmictotal distribution of each ( td ) : mean distribution of the total layertotal intensity ( ti ) : mean intensity of total layer . score of egfr staining in each layer = d i score of egfr staining in each specimen = td ti distribution ( d ) : mean percentage of stained cells by 1000 cells in each layer intensity of staining in each layer ( i ) : negative ( 0 ) , weak ( + 1 ) , moderate ( + 2 ) , severe ( + 3 ) pattern of staining in each specimen ( p ) : membranous , cytoplasmic , membranous cytoplasmic total distribution of each ( td ) : mean distribution of the total layer total intensity ( ti ) : mean intensity of total layer . according to the distribution , the intensity of bcl-2 staining was classified as below : d / td intensity < % 1:0/10 - 25%:+1/25 - 50%:+2/>50%:+3 . whitney and kruskul wallis tests using spss software ( spss inc . , chicago , il , usa ) . the results of immunohistochemical staining of egfr marker showed that none of the kcot specimens expressed egfr with the score of 0 . dentigerous cysts also indicated the score of 1.2 [ figures 1 and 2 , table 1 ] . there was no difference between the intensity of egfr expression in ameloblastoma and dentigerous cyst specimens . on the other hand , 91.8% of cells in ameloblastoma and 74.8% of cells in dentigerous cyst expressed this protein . the pattern of expression in 94% of ameloblastoma specimens was membranous , and it was membranous - cytoplasmic in 100% of dentigerous cysts specimens . there was a significant difference between egfr expression in peripheral and internal layers of ameloblastoma . 98.4% of the peripheral layer cells and 85.3% of the internal layer cells expressed egfr protein . the intensity of egfr expression was also significantly different in peripheral and internal layers ( p = 0.01 ) . in the evaluation of different layers of dentigerous cysts , the scores of egfr expression in basal cells versus supra - basal and superficial layers were 1.85 and 0.47 , respectively . ( p < 0.01 ) the results of immunohistochemical evaluation of bcl-2 marker revealed that the intensity of bcl-2 expression was not significantly different in ameloblastoma and kcot . the intensity of bcl-2 expression in ameloblastoma showed statistically significant differences compared with dentigerous cyst [ figures 3 and 4 , table 2 ] . expression of bcl-2 protein with high intensity in all of the ameloblastoma specimens ( as a neoplastic lesion ) and kcot ( as a cystic lesion with neoplastic features ) indicated the abnormal control of cell - cycle in these two lesions . this result can be due to the increase of cell vitality and invasive growth pattern of the lesion , which is similar to those reported by lo muzio et al . strong expression of bcl-2 in the peripheral layers and minimal expression in the central layers of ameloblastoma indicated the high potential of cell vitality in peripheral layers . it can be argued that bcl-2 has an important role in the survival of main cells in the peripheral layers of ameloblastoma . higher expression of bcl-2 in the basal layer of kcot is related to the physiological potency of the basal layer as a cell source for epithelium . according to the present results , no expression of egfr ( as the most important protein in neoplastic proliferation ) no expression of this protein and high level of bcl-2 protein expression show that aggressive features of kcot are related to apoptotic proteins . however , the aggressive potential of kcot is not as severe as that of a neoplasm such as ameloblastoma . indeed , the significant expression of antiapoptotic proteins with lack of proliferative proteins can cause a neoplastic condition with less aggressive features . high and severe expression of egfr and bcl-2 in ameloblastoma shows the neoplastic nature of this lesion . , egfr expression causes an increase in the proliferation and aggressive activity of this lesion . therefore , its treatment needs aggressive surgical techniques . in aggressive ameloblastoma cases , control of proliferation and cell vitality the goal of investigations is to find less aggressive methods such as a monoclonal antibody of anti - egfr protein to prevent functional damage of the chewing system and deformity caused by surgical procedures . anti - egfr drugs and radiotherapy have synergistic effects in controlling the neoplasm and decreasing the recurrence . in physiological conditions all cases of dentigerous cyst indicated a membranous - cytoplasmic expression of egfr with lower value and distribution than ameloblastoma . kichi et al . have reported the high distribution of tdt - mediated dutp - biotin nick end labeling positive cells in the superficial layers and lack of these cells in the basal and middle layers of dentigerous cyst . however , these findings show apoptosis in the superficial layer of dentigerous cyst . furthermore , in ameloblastoma , more severe expression and higher distribution of egfr protein in the peripheral layer of ameloblastoma have the same pattern as bcl-2 expression compared with the central layer . li et al . have reported that the proliferative nature of cells decreases from the peripheral layer to the central layer of tumoral mass . biological activities , high tendency to recur and growth mechanisms of kcot are different in comparison with other cystic lesions that are related to apoptotic proteins . however , the aggressive potential of kcot is not as severe as that of the neoplasms such as ameloblastoma .

background : keratocystic odontogenic tumor ( kcot ) is a developmental odontogenic cyst on which various investigations have been focused due to its biological activities , high tendency to recur and different growth mechanisms in comparison with other cystic lesions . previous studies have shown different biological and proliferative activities for the lining epithelium of kcot . the aim of this study was immunohistochemical evaluation of bcl-2 and epidermal growth factor receptor ( egfr ) expression in kcot compared with dentigerous cyst and ameloblastoma.materials and methods : formalin - fixed and paraffin - embedded tissue sections of 16 cases of kcot , 16 cases of dentigerous cyst and 16 cases of ameloblastoma were immunohistochemically analyzed to determine bcl-2 and egfr proteins expression . biotin - stereotavidin method was used . it was observed by two oral pathologists separately , and the data were analyzed by mann whitney and kruskul wallis . p < 0.05 was considered as significant.results:regardless of staining intensity , all cases of ameloblastoma and kcot except dentigerous cases were positively stained for bcl-2 . expression of bcl-2 was higher in the peripheral layer of ameloblastoma and basal layer of kcot . furthermore , all cases of ameloblastoma and dentigerous cysts except kcot samples were positively stained for egfr . expression of egfr was higher in the peripheral layer of ameloblastoma and basal layer of dentigerous cysts.conclusion:according to the expression of bcl-2 in ameloblastoma and kcot , and no expression of egfr in kcot , it can be concluded that the biological activity and growth mechanisms of kcot are different compared with other cystic lesions . however , the aggressive potential of kcot is not as severe as that of a neoplasm such as ameloblastoma .

a 36-year old man , 165 cm and 61.1 kg in height and weight , experienced cervical cord injury ( c3-c4 ) due to a motorbike accident in december 2009 resulting in secondary quadriplegia . the patient underwent posterior laminectomy and fusion of the c3 - 5 level because of the instability of the cervical spine in march 2010 . the patient was sent to a pain clinic at our hospital in june 2010 because of severe lower limb spasticity due to secondary quadriplegia . at that time , the spasticity index was 1/1 at the elbow , 3/3 at the hip joint , 3/3 at the knee , and 1+/1 + at the ankle according to the modified ashworth scale . the lower limb spasticity of the patient was exacerbated by the supine position and minimal irritation . in particular , an operation was needed because of a severe coccyx sore but it could not be done because the patient was not able to take the prone position due to the spasticity . the department of rehabilitation had been injecting dantrolene 200 mg and baclofen 50 mg per day for five months to reduce spasticity , which was similar to the maximum dose of each drug but there was no particular improvement in the spasticity . we decided to perform chemodenervation of the obturator nerve using bont - b ( myobloc , solstice neurosciences , usa ) to reduce the lower limb spasticity of the patient . a sufficient explanation was provided to the patient about the operation and its complications and written consent was received from him . there were no abnormal findings in the preoperative blood test , urinalysis , and electrocardiography ( ecg ) . during the operation , we monitored the blood pressure , ecg , and pulse oxygen saturation . the patient took the supine position , but the involuntary flexion was so severe because of the lower limb spasticity that he opened the hip joint as much as possible with the help of an assistant and fixed both lower limbs while bending the knee joints . then , the pubic tubercle and anterior superior iliac spine were identified . on the line connecting the two points , the locations of the femoral artery and femoral vein were found using an ultrasound linear probe ( 6 - 13 mhz , micromaxx , sonosite , usa ) . moving the linear probe medially and distally , we first checked the pectineus muscle and then the adductor longus as well as the adductor brevis . later , we identified the interfascial layer in between the two adductors and then the anterior branch of the obturator nerve . we identified the posterior branch of the obturator nerve by moving the linear probe to the inner side since it exists at the interfascial layer between the adductor brevis and the adductor magnus . local anesthesia was done with 1% lidocaine and a 22-g needle was inserted to the interfascial layer where the anterior branch of the obturator nerve is . after checking the hydrodissection by injecting 1 ml of 2% lidocaine , 5 ml of 2% lidocaine was injected slowly ( fig . the needle was inserted to the interfascial layer between the adductor brevis and the adductor magnus where the posterior branch of the obturator nerve is to do a diagnostic block ( fig . the nerve block was also done to the anterior and posterior branches of the obturator nerve on the opposite side one by one in the same manner . while the patient was in the supine position for 30 minutes , we observed if lower limb spasticity was reduced and if other complications took place . after 30 minutes , the spasticity index was reduced from 3/3 to 1+/1 + without any complications . we decided to do the chemodenervation of the obturator nerve using bont - b and approached it in the same manner through the marked region from the diagnostic block . bont - b 1,250 units to each branch and 2,500 units to each of the both obturator nerves were injected . we verified that there were no complications by catamnesis for 30 minutes after we finished the procedure . the follow - up observation of three months after the procedure showed that the spasticity of the hip joint was maintained at 1+/1 + , and the involuntary reflex was reduced greatly . as in this case , lower limb spasticity due to quadriplegia increases muscle tone and stretch reflex and thereby , results in problems such as causing discomfort in patients , interfering with rehabilitation treatment , and lowering perineal hygiene . thus , obturator nerve blocks are done to relax the hip adductor muscles involved in lower limb spasticity . generally , a diagnostic nerve block is followed by chemodenervation using alcohol and phenol in order to extend the period of the obturator nerve block . bont is used with two methods : direct injection of bont into the adductor muscles causing lower limb spasticity and obturator nerve block . there has been a report that the reduction of spasticity was achieved by directly injecting bont - a into the adductor muscles , but there has been no report on obturator nerve block using bont to our knowledge . bont has been used to treat various diseases since scott treated a patient with strabismus by injecting it to the affected muscles . since bont acts through the inhibition of acetylcholine secretion , it can affect all regions where acetylcholine is secreted including the neuromuscular junction , preganglionic neuron , and parasympathetic post ganglionic neuron . for instance , bont can be used to treat cervical dystonia and hemifacial spasm , which are caused by hyperactivity of the muscles , and to treat hyperhidrosis , which is caused by excessive activation of sweat glands innervated by the sympathetic nerve . recently , bont has been used to treat various diseases including complex regional pain syndrome and overactive bladder and to perform sympathetic nerve blocks . bont has been classified into seven types : types a , b , c , d , e , f , and g depending on the type of antigen . among them , only types a and b are used clinically . both bont - a and bont - b seem to both inhibit acetylcholine secretion , but their mechanisms for inhibition and target proteins are different . bont - a binds to snap-25 ( synaptosomal - associated protein 25 ) , which is one of the subunits of snare ( soluble n - ethylmaleimide - sensitive - factor attachment protein receptor ) that causes fusion of the presynaptic membrane and synaptic vesicles and thus , cleaves the synaptic vesicles so that they can not fuse . however , bont - b inhibits acetylcholine secretion by cleaving the synaptobrevin involved in the exocytosis of acetylcholine . the different target proteins affects the duration of action of bont - a and bont - b . according to a study that compared the duration of action of bont - a and bont - b in the treatment of cervical dystonia , the duration of action of bont - b was 12.1 weeks and that of bont - a 14 weeks ( p = 0.033 ) , indicating that bont - b had a shorter duration of action than that of bont - a . another drawback of bont - b is that the incidence of dry mouth and dysphagia are not rare and the incidence rate is higher than that of bont - a . however , it has been reported that the use of bont - b was never stopped because of complications since most of them were mild . first , bont - b is effective for managing patients with type a - resistance . one report has stated that 5 - 10% of patients showed resistance when bont - a was repeatedly injected over a short interval of two months . it is also known that treatment with bont - b is effective without showing any particular resistant among such patients . bont - a is produced in a powder formulation to avoid lyophilization whereas bont - b is produced in a liquid formulation . bont - b is stored at room temperature or in a refrigerator ( 2 - 25 ) . in addition , bont - b is stable in the sense that the potency does not decrease over time even after initially opening the container . bont - a should be kept in a freezer ( -5 ) or refrigerator and must be used within four hours after diluting it with 0.9% saline solution under refrigeration . in other words , the liquid form of bont - b can be used for injection until supplies run out , while the reconstituted lyophilized powder of bont - a in 0.9% saline solution has to be used within four hours after dilution . the greatest advantage of chemodenervation with bont compared with alcohol and phenol is that the damage to the surrounding tissues can be minimized . alcohol and phenol cause nerve blocks by denaturing proteins and inadvertent dysesthesia or chemical neuritis may accompany the treatment . these may be due to abnormal reactions following permanent protein denaturation or complications caused by the diffusion of the chemical agents to the surrounding tissues . however , bont does not have such complications because it just inhibits acetylcholine secretion and does not cause tissue denaturation . in this case report , bont was injected to the surrounding regions of the obturator nerve to achieve reduced spasticity of the thigh adductors , which is different from previous case reports where bont was directly injected into the muscles . one animal study on the mechanism of bont reported that the injected bont permeates to the nerve sheath and inhibits acetylcholine secretion at the neuromuscular junctions . this means that bont injection into a region around a nerve can also have the effect of reducing spasticity , which is the same as direct bont injection into the muscles . bont - b may be more useful for intramuscular injection and nerve block than bont - a since bont - b diffuses to the surrounding tissues to a lesser degree than that of bont - a as reported by . however , this property may be a drawback of bont when compared with with alcohol or phenol . for example , one study showed that it took about 91 days to recover the function of the neuromuscular junction after the injection of bont was . this period of time is almost the same as the duration of action of bont , which is 2 - 3 months . since the duration of action is shorter than the mean duration of action of alcohol and phenol , the nerve block has to be done repeatedly , which is expensive . however , this may be compensated by bont - a since it was reported to be superior in terms of cost - effectiveness in cases where an anti - spastic drug was first injected into patients with lower limb spasticity compared to cases where a reduction in spasticity was achieved with bont - a . with respect to the bont - b dosage , one study reported that no significant complications were found when an initial dosage of 2,500 - 10,000 units was given to patients with cervical dystonia . in our case for both obturator nerve blocks , we used 2,500 units each for the right and left sides . we thought it appropriate not to increase the initial dosage greatly unless the patient had undergone bont treatment in advance . further studies are need so that bont - b may be used more widely in chemodenervation .

obturator nerve block has been commonly used for pain management to prevent involuntary reflex of the adductor thigh muscles . one of several options for this block is chemical neurolysis . neurolysis is done with chemical agents . chemical agents used in the neurolysis of the obturator nerve have been alcohol , phenol , and botulinum toxin . in the current case , a patient with spasticity of the adductor thigh muscle due to cervical cord injury had obturator nerve neurolysis done with botulinum toxin type b ( bont - b ) . most of the previous studies have used bont - a with only a few reports that have used bont - b . bont - b has several advantages and disadvantages over bont - a . thus , we report herein a patient who successfully received obturator nerve neurolysis using bont - b to treat adductor thigh muscle spasm .

leiomyomas are benign smooth muscle tumors that are relatively common , especially in the uterus ( about 95% ) . in the oral cavity oral leiomyomas present as slow - growing , asymptomatic submucosal masses , usually in the tongue , hard palate or buccal mucosa . other less frequent locations are the floor of the mouth and the gingiva . due to its unspecific clinical presentation , the diagnosis is made after a histological study . a 32-year - old male patient , with an unremarkable medical or habit history , came with an asymptomatic round firm swelling , normal in color and freely movable over the right submandibular region for the last 1 month . the mass was excised under local anesthesia as a single firm 1.5 2 cm soft tissue mass . the histological report showed a well - circumscribed tumor constituting of spindle shaped cells [ figure 1 ] . the immunohistochemical study revealed the expression of vimentin [ figure 2 ] and smooth muscle actin ( sma ) [ figure 3 ] within the tumor cells , whereas expression of cytokeratin was negative . no signs of any recurrence were observed six months after the excision of the lesion . bundles of spindle - shaped cells with oval nuclei intersecting each other ( h and e , 200 ) tumor cells with positivity for vimentin ( ihc , 400 ) lesional tissue showing diffuse positivity for smooth muscle actin ( sma ) ( ihc , 400 ) the source of smooth muscle in the oral cavity is either the arterial tunica media as suggested by stout , or the ductus lingualis and the circumvallate papillae as proposed by glass or heterotopic embryonal tissue . oral leiomyoma is more frequent in men than in women , with a 1.43:1 ratio . the majority of the cases reported indicated an asymptomatic slow - growing mass , firm to touch and the color of the lesions depended on their depth and on their vascularity . most of the lesions are asymptomatic masses but some authors have reported symptomatic lesions , most frequently having difficulty in chewing or swallowing , and loose teeth , induced due to local growth . oral leiomyomas are not very big tumors , with an average size between 1 and 2 cm , and with a history of less than a year . our case was of 1.5 2 cm and had a history of one month ; this corroborates with the published literature . several oral tumors should be included in the differential diagnosis , benign lesions such as fibroma , neurofibroma , or malignant ones such as leiomyosarcoma . leiomyosarcoma should be taken into account based on a combination of mitotic index ( at least two mitotic figures per 10 high power fields is likely malignant ) , degree of nuclear atypia and zonal necrosis . the world health organization ( who ) distinguishes three types of leiomyomas : leiomyoma ( solid ) , angiomyoma ( vascular leiomyoma ) , and epitheloid leiomyoma ( leioblastoma ) . special stains such as mason 's trichrome , van geison 's stain or mallory 's phosphotungstic acid ( ptah ) are specific for muscle cells and collagen fibers . immunohistochemical studies to make the differential diagnosis with other spindle cell tumors can be useful .

oral leiomyoma is a benign smooth muscle tumor with a low incidence . oral leiomyomas present as slow growing , asymptomatic sub mucosal masses , usually in the tongue , hard palate or buccal mucosa . they may be seen at any age and are usually discovered when they are 1 to 2 cm in diameter . the diagnosis is mainly determined by histological studies and special stains that confirm the smooth muscle origin . surgical excision appears to be the best line of treatment and recurrence is unexpected . the purpose of this article is to present a case of a 32-year old male with a 1 month history of a leiomyoma on his right submandibular region .

synovial chondromatosis is a rare intraarticular benign condition arising from the synovial membrane of the joints , synovial sheaths or bursae around the joints . primary synovial chondromatosis typically affects the large joints in the third to fifth decade of life , although involvement of smaller joints and presentation in younger age group is also documented . the purpose of this case report is to document this rare extra articular synovial pathology present inside the baker s cyst which required open synovectomy and debridement to eradicate it . a 43 yearold male presented with a two year history of pain , swelling and restriction of right knee joint . after the clinical and radiological assessment , open synovectomy , removal of cyst and thorough joint debridement procedure was performed . a synovial chondromatosis is a rare benign neoplasm that is caused by metaplasia of the synovium into chondrocytes . milligram classified the disease into three phases : early ( active intrasynovial disease but no loose bodies ) , transitional disease ( active disease and loose bodies ) , and late phase ( multiple loose bodies but no intrasynovial disease ) . involvement of smaller joints has also been reported , which includes distal radioulnar , tibio - fibular , metacarpophlangeal and metatarsophalangeal joint . synovial chondromatosis has an incidence of 1:100,000 in bursae around the knee and occurs de novo in an otherwise normal joint . it has a slightly male predominance and is most common in the 3rd to 5th decades of life . it is usually a monoarticular disease , although polyarticular involvement is reported in up to 5% of cases . the majority of intraarticular disease involves the knee ( 50% ) , with the hip , elbow and shoulder less commonly affected . bursae around the joints are also important rare locations for synovial chondromatosis ; only a few case reports have been described in literature , the exact figure of which is not known . it occurs twice as frequently in men than women and usually presents with increasing joint pain and swelling during the third to fifth decade of a patient s life . a patient with synovial chondromatosis experiences a decreased range of motion , palpable swelling , effusion , and crepitus . my aim is to present a case of synovial chondromatosis inside a baker s cyst , which is a rare for this synovial pathology . a 43 year old male presented with one year history of pain , swelling and restriction of right knee joint . on examination , the right knee was kept in 15 - 20 degrees flexion with obvious quadriceps wasting . there was a diffuse tenderness all around the knee , medial joint line being the mosttender site . there was a bony hard slightly movable swelling palpated in the popliteal fossa on the medial aspect . patient had fixed flexion deformity of 15 degree with further flexion up to 110 degrees . instability tests were negative and there was no abnormality upon examination of distal neurovascular status . plain x - ray of the right knee joint shows a large radiodense body behind the femoral and tibial condyle ( fig . mri showed effusion , synovial hypertrophy and a loose calcific body behind the femoral condyle extending upto upper tibia(fig . t2 mr i images of the affected knee showing extent of swelling and loose bodies . posterior incision was given and a large cyst of around 74 cm was removed which was originating beneath the semimembranous tendon ( fig . synovium and the bodies were sent for histo - pathological examination which confirmed the diagnosis of synovial chondromatosis with papillary hyperplasia of the synovium . post - operatively patient was instructed about knee mobilization and strengthening exercises and followed up at one , three and six months . patient s range of movement was 0 - 130 degree of flexion without pain at three months post - operative period . patient typically presents with swelling , pain and restriction of movements and normally in their third to fifth decade , though there are reports of its occurrence in childhood . plain radiograph , ultrasound , ct and mri are the imaging modalities which can be used to assist in diagnosing this condition . since , knee joint is anatomically complex , location and extension of the lesions also vary . extent of the disease can vary from affecting merely cruciate ligaments to extensive involvement of the knee joint . nodules of the metaplastic growth are usually embedded within the synovium or loosely attached to it . total knee arthroplasty is also an option if synovial chondromatosis is coexistent with osteoarthritis . in my case , i preferred open procedure because of co existence of baker s cyst . this also helped me to thoroughly debride the growths along the medial condyle , which was not possible if arthroscopic method had been used ( although an expert in arthroscopy may argue otherwise ) . pigmented villonodular synovitis , synovial hemangioma , and lipomaarborescens are few conditions which can mimic synovial chondromatosis . a synovial chondromatosis is a rare condition but one which can be highly aggressive and destructive . this case , with its rare presentation of extraarticular disease , highlights the importance of careful clinical assessment , lateral thinking , appropriate use of investigation , and careful pre - operative planning . a rare case of synovial chondromatosis inside the baker s cyst is described here with successful treatement by open synovestomy and cyst excision . synovial chondromatosis is a rare condition but one which can be highly aggressive and destructive . this condition normally presents with multiple loose bodies within the joint or over the synovial bed . synovial chondromatosis presenting as fixed nodular outgrowths from the marginal synovial tissue is an atypical feature . open synovectomy and thorough debridement should be preferred especially in patients with such an extent of the disease , where arthroscopy does not seem to be a practical option . this case with its rare presentation of extraarticular disease inside the baker s cyst highlights the importance of careful clinical assessment , lateral thinking , appropriate use of investigation , and careful pre - operative planning .

introduction : synovial chondromatosis is a rare intraarticular benign condition arising from the synovial membrane of the joints , synovial sheaths or bursae around the joints . primary synovial chondromatosis typically affects the large joints in the third to fifth decade of life , although involvement of smaller joints and presentation in younger age group is also documented . the purpose of this case report is to document this rare extra articular synovial pathology present inside the baker s cyst which required open synovectomy and debridement to eradicate it.case report : a 43 yearold male presented with a two year history of pain , swelling and restriction of right knee joint . after the clinical and radiological assessment , open synovectomy , removal of cyst and thorough joint debridement procedure was performed . histopathological study confirmed the findings of synovial chondromatosis.conclusion:synovial chondromatosis is a rare benign condition . complete synovectomy offers reliable cure rate .

the inhabitants of such countries ( about 1,110,000,000 ) correspond to 16% of the world population . this means that asbestos use continues in a large part of the world . in this context it would be opportune that data on the incidence of malignant mesothelioma , a sentinel event indicating the effects of asbestos exposure , are available . in fact , data on mesothelioma incidence / mortality are lacking for a large majority of the world population . in the present study the available data on mesothelioma incidence in the last years have been reviewed , in order to delineate the trend of mesothelioma epidemic . the highest mesothelioma incidence rates are reported from some countries in europe ( uk , the netherlands , malta , belgium ) and in oceania ( australia , new zealand ) . mesothelioma mortality has been monitored in great britain since 1968 . the annual number of deaths from mesothelioma progressively increased , being 153 in 1968 and 2,360 in 2010 . in 2011 the numbers of deaths was 2,291 . in the period 2000 - 2011 the age - standardized incidence rates ( world population ) ( asir w ) in the uk were 3.3 - 3.6 per 100,000 among men , and 0.5 - 0.7 among women [ figure 1 ] . age - standardized ( world ) incidence rates per 100,000 , 2000 - 2011 in australia , the annual number of mesothelioma cases progressively increased passing from 156 in 1982 to 666 in 2009 . asir ( w ) in 2011 were 3.2 per 100,000 among men and 0.7 among women . mesothelioma incidence rates in australia in the period 1982 - 2010 are reported in figure 2 . the figure 3 shows a comparison of the incidence rates among men in the uk and australia . age - standardized ( world ) incidence rates per 100,000 , 1982 - 2010 mesothelioma in australia and in the uk . age - standardized ( world ) incidence rates per 100,000 , men , 2000 - 2011 in the netherlands the mean annual number of mesotheliomas registered in the period 2008 - 2011 was 526 . in 2011 the asir ( w ) were 2.85 per 100,000 among men , and 0.35 among women . in new zealand the number of cases registered in the period 2000 - 2010 ranged between 60 and 102 . the asir ( w ) among men were 3.2 per 100,000 in the period 2005 - 2006 , and 2.5 in the period 2009 - 2010 . in 2010 in belgium , 273 mesotheliomas were registered in 2011 ( 223 men , and 50 women ) . the asir ( w ) were 2.0 per 100,000 among men , and 0.4 among women . high incidence rates were observed also in the republic of malta ( about 400,000 inhabitants ) . in the biennium 2005 - 2006 the asir ( w ) among men was higher than 3 per 100,000 ; wide fluctuations were seen in the following years with values of 2.20 in 2009 and of 1.06 in 2012 . among women the rates ranged between 0.0 and 0.62 . a second group of countries includes a large part of europe , and the united states . in denmark , the asir ( w ) has progressively increased in the period 1943 - 2009 , reaching a maximum in the biennium 2008 - 2009 with a rate of 1.76 per 100,000 . among women the incidence rate remained relatively stable with a maximum of 0.5 per 100,000 in the quinquennium 1973 - 1977 . in finland , the asir ( w ) among men was 0.2 per 100,000 in the quiquennium 1966 - 1970 , progressively raised in the following decades reaching the value of 1.4 in the period 1996 - 2000 and the value of 1.5 in the period 2001 - 2012 [ figure 4 ] . among women the incidence rate was 0.1 in the decade 1966 - 1975 ; in the period 1976 - 2000 the rate ranged between 0.3 and 0.5 and was 0.3 in the period 2001 - 2012 . age - standardized ( world ) incidence rates per 100,000 men , 1966 - 2012 in norway , the asir ( w ) among men was 0.1 per 100,000 in the quinquennium 1963 - 1967 , 1.6 in the quinquennium 2003 - 2007 , and 1.4 in the quinquennium 2008 - 2012 [ figure 5 ] . among women the asir ( w ) ranged between 0.0 and 0.2 in the period 1963 - 2007 ; in the period 2008 - 2012 the rate was 0.3 . age - standardized ( world ) incidence rates per 100,000 men , 1963 - 2012 in sweden , mesothelioma incidence showed fluctuations in the period 2000 - 2011 . the asir ( w ) ( including malignant synovialoma ) among men reached a maximum of 1.55 per 100,000 in 2002 and a minimum of 0.97 in 2008 . the rate was 1.11 in 2011 , and 1.34 in 2012 . among women the asir ( w ) in the period 2000 - 2011 ranged between a minimum of 0.23 in 2005 and a maximum of 0.51 in 2004 ; the rate was 0.29 in 2010 and 0.38 in 2012 . in iceland , the asir ( w ) of pleural cancer in the period 2007 - 2011 were 0.9 among men and 0.2 among women . in germany , the number of mesothelioma cases registered in 2010 amounted to 1673 ( 1320 men and 353 women ) . mesothelioma incidence remained stable in the period 2000 - 2010 . among men the asir ( w ) was 1.8 per 100,000 in 2000 , and 1.4 - 1.5 in the following years . among women the rate was 0.5 in 2000 , and 0.3 in the following period . in france , after the data of the mesothelioma surveillance national program the mean annual number of cases in the period 1998 - 2010 was 675 among men ; among women the number of cases ranged between 200 and 370 . the data corresponded to a crude incidence among men of 2.3 per 100,000 . in italy , after the data collected by the national mesothelioma registry , in 2008 the asir ( on italian population ) among men was 3.55 per 100,000 for pleural mesothelioma and 0.24 for peritoneal mesothelioma ; among women the rates were 1.35 and 0.12 , respectively . in croatia , the asir ( w ) in the period 2001 - 2011 ranged between 1.17 and 1.84 per 100,000 among men , and between 0.20 and 0.44 among women . the highest rates were reached in 2009 for men and in 2010 for women . in austria , the asir ( w ) in the period 2003 - 2011 were around 1 per 100,000 among men ( 1.2 in 2009 ) , and 0.3 - 0.4 among women . in cyprus , the asir ( w ) among men showed marked variations in the period 1998 - 2009 with a minimum of 0.1 per 100,000 and a maximum of 1.9 ( in 2006 ) . in the biennium 2008 - 2009 mesothelioma incidence in the united states has been the object of a recent study . in the period 2003 - 2008 over 3000 cases were diagnosed each year , with a maximum of 3284 in 2005 . in this period the mean asir ( on us population ) was 1.93 per 100,000 among men , and 0.41 among women . in israel , the asir ( w ) in the period 2000 - 2010 among jews men ranged between 0.41 and 1.23 per 100,000 , being higher than 1 in 2003 and in 2008 . in the same period , among the jewish women the rates ranged between 0.14 and 0.31 . in south africa the number of mesotheliomas diagnosed histologically in 2004 amounted to 180 cases ( 147 in men and 33 in women ) . the asir ( w ) were 1.07 per 100,000 among men , and 0.18 among women . low incidence / mortality rates are reported from various countries of central europe , ireland , spain , and from several countries of asia . in poland , the asir among men was 0.3 per 100,000 in the period 1999 - 2001 , 0.4 in the following biennium , and 0.5 - 0.6 in the following years [ figure 6 ] . in the same period the rate among women ranged between 0.1 and 0.3 . age - standardized ( world ) incidence rates per 100,000 , 1999 - 2011 in estonia , 166 mesothelioma cases were registered in the period 1968 - 2004 ( 89 in men , and 26 in women ) . in addition it has been reported that 21 cases were registered in the period 2003 - 2007 with asir of 0.3 per 100,000 among men , and 0.1 among women . 79 cases of malignant mesothelioma were registered in the period 2005 - 2008 ( 50 in men , and 29 in women ) . in ireland , 337 cases of malignant pleural mesothelioma were registered in the period 1994 - 2009 , with 87.6% involving men . mean annual asir ( on the european population ) were 0.5 per 100,000 in the period 1994 - 1997 , and 0.7 in the period 2006 - 2009 . in 2011 34 cases have been registered ( 28 in men , and 6 in women ) , with asir ( w ) of 0.8 per 100,000 among men , and 0.2 among women . mortality data from pleural cancer in spain were recently reported by lopez abente et al . in the period 1975 - 2010 , mortality rate among men , age - standardized on the european population , was 0.6 per 100,000 both in the quiquennium 2001 - 2005 as well as in the quinquennium 2006 - 2010 . in japan , the number of deaths from mesothelioma increased from 500 in 1995 to 1,400 in 2012 [ figure 7 ] . the increase involved mainly men , while a smaller increase has been observed among women ( from 144 in 1995 to 272 in 2012 ) . no . of deaths in the period 1995 - 2012 in lebanon , in the period 2004 - 2008 the asir ( w ) among men ranged between 0.3 and 0.6 per 100,000 the number of registered mesotheliomas is extremely low , with two cases reported in 2009 , and six cases registered in 2010 . however , it has been estimated that in 2011 cancer registries covered only 13% of the population . low mesothelioma incidences are reported from south korea , taiwan , hong kong , and singapore . in india , 25 population - based cancer registries are active , covering 7.45% of the population . mesothelioma cases have been reported only in four of such registries with asir ( w ) of 0.05 - 0.08 per 100,000 among men and 0.05 - 0.1 among women . in thailand , one of the major importers and users of asbestos , only sporadic cases of mesothelioma have been reported . in the middle east the gulf center for cancer registration provides data on the cancer incidence in six countries ( bahrain , kuweit , oman , qatar , saudi arabia , and united arab emirates ) , whose population amounts to about 33 million people . in the period 1998 - 2007 , data are not available for very large countries such bangladesh , brazil , indonesia , nigeria , pakistan , and russia . the most recent available incidence rates among men in some countries are reported in figure 8 . age - standardized ( world ) incidence rates per 100,000 , men it is well known that inside a given country mesothelioma incidence shows huge variations from one area to another . consequently , incidence rates at a national level are in some way misleading . especially in large countries , the high incidence / mortality rates observed in small areas are hidden , when the incidence at a national level is considered . the key factor is the clustering of mesothelioma cases in very restricted areas . generally , these areas are or have been the site of asbestos mines , or asbestos industries in which asbestos was largely employed ( mainly shipyards and asbestos - cement factories ) . good examples of such uneven distribution are offered by great britain , sweden , italy , croatia , united states , etc . in italy the difference in mortality rates from pleural cancer among men from one province to another in the period 1988 - 1997 reached the value of 40 folds . malignant mesothelioma is proteiform and the alternative diagnoses include from one side flogistic - reactive processes and from the other various other types of neoplasia . immunohistochemical reactions are useful in distinguishing between epithelial mesothelioma and carcinoma metastasis ; for sarcomatoid mesothelioma the relevance of immunohistochemical findings is markedly reduced , since the mesothelial markers are often negative . beside the well - known histological types of mesothelioma , a rare variety has recently been described , that may simulate both radiologically and histologically an interstitial pneumopathy or other pathological lesions . relevant elements to confirm or to exclude the diagnosis of mesothelioma may come from the necropsy . moreover , necropsy may reveal mesotheliomas that clinically have not been suspected or not demonstrated . however , necropsy practice showed a dramatic decline in the last decades ; probably this fact has serious effects on the knowledge of mesothelioma . problems may also arise in the mesothelioma registration ; for instance an inadequate registration of the death causes has been detected in the past in japan . finally , an important point to consider is the age classes in which the highest mesothelioma incidences occur . after the study of henley et al . on the mesothelioma incidence in the united states , mean annual incidence rate among men in the period 2003 - 2008 was 8.34 per 100,000 in the age class 65 - 74 , but reached the value of 17.07 in the class 75 - 84 , and 17.62 in the class 85 and more . in australia , the incidence rate among men in 2008 was 40.1 in the age class 75 - 79 , 46.0 in the class 80 - 84 , and 50.0 in the class 85 and more . when the patient is old or very old , the examinations that are conducted are more reduced and this reflects on the diagnosis reliability . the low mesothelioma incidence / mortality in some countries like japan or poland have already been object of different interpretations and discussion . the relatively low mortality from mesothelioma registered in japan does not agree with the fact that this country was one of the most important shipbuilders in the world , particularly in the second half of the xx century , but also in the first half of the same century . also the low incidence rates registered in poland does not seem to agree with the high shipbuilding activity of the country . the low mortality from mesothelioma in spain is also difficult to interpret and seems to be in contrast with the fact that this country showed a marked increase in shipbuilding activity in the second half of the xx century . in this period the production passed from 51,000 tons in 1955 to 830,000 in 1971 , and the annual number of ships passed from 23 to 161 . the highest mesothelioma incidence rates are reported from some countries in europe ( uk , the netherlands , malta , belgium ) and in oceania ( australia , new zealand ) . the annual number of deaths from mesothelioma progressively increased , being 153 in 1968 and 2,360 in 2010 . in 2011 the numbers of deaths was 2,291 . in the period 2000 - 2011 the age - standardized incidence rates ( world population ) ( asir w ) in the uk were 3.3 - 3.6 per 100,000 among men , and 0.5 - 0.7 among women [ figure 1 ] . age - standardized ( world ) incidence rates per 100,000 , 2000 - 2011 in australia , the annual number of mesothelioma cases progressively increased passing from 156 in 1982 to 666 in 2009 . asir ( w ) in 2011 were 3.2 per 100,000 among men and 0.7 among women . mesothelioma incidence rates in australia in the period 1982 - 2010 are reported in figure 2 . the figure 3 shows a comparison of the incidence rates among men in the uk and australia . age - standardized ( world ) incidence rates per 100,000 , 1982 - 2010 mesothelioma in australia and in the uk . age - standardized ( world ) incidence rates per 100,000 , men , 2000 - 2011 in the netherlands the mean annual number of mesotheliomas registered in the period 2008 - 2011 was 526 . in 2011 the asir ( w ) were 2.85 per 100,000 among men , and 0.35 among women . in new zealand the number of cases registered in the period 2000 - 2010 ranged between 60 and 102 . the asir ( w ) among men were 3.2 per 100,000 in the period 2005 - 2006 , and 2.5 in the period 2009 - 2010 . in 2010 in belgium , 273 mesotheliomas were registered in 2011 ( 223 men , and 50 women ) . the asir ( w ) were 2.0 per 100,000 among men , and 0.4 among women . high incidence rates were observed also in the republic of malta ( about 400,000 inhabitants ) . in the biennium 2005 - 2006 the asir ( w ) among men was higher than 3 per 100,000 ; wide fluctuations were seen in the following years with values of 2.20 in 2009 and of 1.06 in 2012 . among women the rates ranged between 0.0 and 0.62 . a second group of countries includes a large part of europe , and the united states . in denmark , the asir ( w ) has progressively increased in the period 1943 - 2009 , reaching a maximum in the biennium 2008 - 2009 with a rate of 1.76 per 100,000 . among women the incidence rate remained relatively stable with a maximum of 0.5 per 100,000 in the quinquennium 1973 - 1977 . in finland , the asir ( w ) among men was 0.2 per 100,000 in the quiquennium 1966 - 1970 , progressively raised in the following decades reaching the value of 1.4 in the period 1996 - 2000 and the value of 1.5 in the period 2001 - 2012 [ figure 4 ] . among women the incidence rate was 0.1 in the decade 1966 - 1975 ; in the period 1976 - 2000 the rate ranged between 0.3 and 0.5 and was 0.3 in the period 2001 - 2012 . age - standardized ( world ) incidence rates per 100,000 men , 1966 - 2012 in norway , the asir ( w ) among men was 0.1 per 100,000 in the quinquennium 1963 - 1967 , 1.6 in the quinquennium 2003 - 2007 , and 1.4 in the quinquennium 2008 - 2012 [ figure 5 ] . among women the asir ( w ) ranged between 0.0 and 0.2 in the period 1963 - 2007 ; in the period 2008 - 2012 the rate was 0.3 . age - standardized ( world ) incidence rates per 100,000 men , 1963 - 2012 in sweden , mesothelioma incidence showed fluctuations in the period 2000 - 2011 . the asir ( w ) ( including malignant synovialoma ) among men reached a maximum of 1.55 per 100,000 in 2002 and a minimum of 0.97 in 2008 . the rate was 1.11 in 2011 , and 1.34 in 2012 . among women the asir ( w ) in the period 2000 - 2011 ranged between a minimum of 0.23 in 2005 and a maximum of 0.51 in 2004 ; the rate was 0.29 in 2010 and 0.38 in 2012 . in iceland , the asir ( w ) of pleural cancer in the period 2007 - 2011 were 0.9 among men and 0.2 among women . in germany , the number of mesothelioma cases registered in 2010 amounted to 1673 ( 1320 men and 353 women ) . mesothelioma incidence remained stable in the period 2000 - 2010 . among men the asir ( w ) was 1.8 per 100,000 in 2000 , and 1.4 - 1.5 in the following years . among women the rate was 0.5 in 2000 , and 0.3 in the following period . in france , after the data of the mesothelioma surveillance national program the mean annual number of cases in the period 1998 - 2010 was 675 among men ; among women the number of cases ranged between 200 and 370 . the data corresponded to a crude incidence among men of 2.3 per 100,000 . in italy , after the data collected by the national mesothelioma registry , in 2008 the asir ( on italian population ) among men was 3.55 per 100,000 for pleural mesothelioma and 0.24 for peritoneal mesothelioma ; among women the rates were 1.35 and 0.12 , respectively . in croatia , the asir ( w ) in the period 2001 - 2011 ranged between 1.17 and 1.84 per 100,000 among men , and between 0.20 and 0.44 among women . the highest rates were reached in 2009 for men and in 2010 for women . in austria , the asir ( w ) in the period 2003 - 2011 were around 1 per 100,000 among men ( 1.2 in 2009 ) , and 0.3 - 0.4 among women . in cyprus , the asir ( w ) among men showed marked variations in the period 1998 - 2009 with a minimum of 0.1 per 100,000 and a maximum of 1.9 ( in 2006 ) . in the biennium 2008 - 2009 mesothelioma incidence in the united states has been the object of a recent study . in the period 2003 - 2008 over 3000 cases were diagnosed each year , with a maximum of 3284 in 2005 . in this period the mean asir ( on us population ) was 1.93 per 100,000 among men , and 0.41 among women . in israel , the asir ( w ) in the period 2000 - 2010 among jews men ranged between 0.41 and 1.23 per 100,000 , being higher than 1 in 2003 and in 2008 . in the same period , among the jewish women the rates ranged between 0.14 and 0.31 . in south africa the number of mesotheliomas diagnosed histologically in 2004 amounted to 180 cases ( 147 in men and 33 in women ) . the asir ( w ) were 1.07 per 100,000 among men , and 0.18 among women . low incidence / mortality rates are reported from various countries of central europe , ireland , spain , and from several countries of asia . in poland , the asir among men was 0.3 per 100,000 in the period 1999 - 2001 , 0.4 in the following biennium , and 0.5 - 0.6 in the following years [ figure 6 ] . in the same period the rate among women ranged between 0.1 and 0.3 . age - standardized ( world ) incidence rates per 100,000 , 1999 - 2011 in estonia , 166 mesothelioma cases were registered in the period 1968 - 2004 ( 89 in men , and 26 in women ) . in addition it has been reported that 21 cases were registered in the period 2003 - 2007 with asir of 0.3 per 100,000 among men , and 0.1 among women . 79 cases of malignant mesothelioma were registered in the period 2005 - 2008 ( 50 in men , and 29 in women ) . in ireland , 337 cases of malignant pleural mesothelioma were registered in the period 1994 - 2009 , with 87.6% involving men . mean annual asir ( on the european population ) were 0.5 per 100,000 in the period 1994 - 1997 , and 0.7 in the period 2006 - 2009 . in 2011 34 cases have been registered ( 28 in men , and 6 in women ) , with asir ( w ) of 0.8 per 100,000 among men , and 0.2 among women . mortality data from pleural cancer in spain were recently reported by lopez abente et al . in the period 1975 - 2010 , 6037 deaths were registered . mortality rate among men , age - standardized on the european population , was 0.6 per 100,000 both in the quiquennium 2001 - 2005 as well as in the quinquennium 2006 - 2010 . in the same periods mortality rates among women were 0.2 per 100,000 . in japan , the number of deaths from mesothelioma increased from 500 in 1995 to 1,400 in 2012 [ figure 7 ] . the increase involved mainly men , while a smaller increase has been observed among women ( from 144 in 1995 to 272 in 2012 ) . of deaths in the period 1995 - 2012 in lebanon , in the period 2004 - 2008 the asir ( w ) among men ranged between 0.3 and 0.6 per 100,000 . among women it ranged between 0.0 and 0.1 . in jordan , the number of registered mesotheliomas is extremely low , with two cases reported in 2009 , and six cases registered in 2010 . however , it has been estimated that in 2011 cancer registries covered only 13% of the population . low mesothelioma incidences are reported from south korea , taiwan , hong kong , and singapore . in india , 25 population - based cancer registries are active , covering 7.45% of the population . mesothelioma cases have been reported only in four of such registries with asir ( w ) of 0.05 - 0.08 per 100,000 among men and 0.05 - 0.1 among women . in thailand , one of the major importers and users of asbestos , only sporadic cases of mesothelioma have been reported . in the middle east the gulf center for cancer registration provides data on the cancer incidence in six countries ( bahrain , kuweit , oman , qatar , saudi arabia , and united arab emirates ) , whose population amounts to about 33 million people . in the period 1998 - 2007 , data are not available for very large countries such bangladesh , brazil , indonesia , nigeria , pakistan , and russia . the most recent available incidence rates among men in some countries are reported in figure 8 . it is well known that inside a given country mesothelioma incidence shows huge variations from one area to another . consequently , incidence rates at a national level are in some way misleading . especially in large countries , the high incidence / mortality rates observed in small areas are hidden , when the incidence at a national level is considered . the key factor is the clustering of mesothelioma cases in very restricted areas . generally , these areas are or have been the site of asbestos mines , or asbestos industries in which asbestos was largely employed ( mainly shipyards and asbestos - cement factories ) . good examples of such uneven distribution are offered by great britain , sweden , italy , croatia , united states , etc . in italy the difference in mortality rates from pleural cancer among men from one province to another in the period 1988 - 1997 reached the value of 40 folds . malignant mesothelioma is proteiform and the alternative diagnoses include from one side flogistic - reactive processes and from the other various other types of neoplasia . immunohistochemical reactions are useful in distinguishing between epithelial mesothelioma and carcinoma metastasis ; for sarcomatoid mesothelioma the relevance of immunohistochemical findings is markedly reduced , since the mesothelial markers are often negative . beside the well - known histological types of mesothelioma , a rare variety has recently been described , that may simulate both radiologically and histologically an interstitial pneumopathy or other pathological lesions . relevant elements to confirm or to exclude the diagnosis of mesothelioma may come from the necropsy . moreover , necropsy may reveal mesotheliomas that clinically have not been suspected or not demonstrated . however , necropsy practice showed a dramatic decline in the last decades ; probably this fact has serious effects on the knowledge of mesothelioma . problems may also arise in the mesothelioma registration ; for instance an inadequate registration of the death causes has been detected in the past in japan . finally , an important point to consider is the age classes in which the highest mesothelioma incidences occur . after the study of henley et al . on the mesothelioma incidence in the united states , mean annual incidence rate among men in the period 2003 - 2008 was 8.34 per 100,000 in the age class 65 - 74 , but reached the value of 17.07 in the class 75 - 84 , and 17.62 in the class 85 and more . in australia , the incidence rate among men in 2008 was 40.1 in the age class 75 - 79 , 46.0 in the class 80 - 84 , and 50.0 in the class 85 and more . when the patient is old or very old , the examinations that are conducted are more reduced and this reflects on the diagnosis reliability . the low mesothelioma incidence / mortality in some countries like japan or poland have already been object of different interpretations and discussion . the relatively low mortality from mesothelioma registered in japan does not agree with the fact that this country was one of the most important shipbuilders in the world , particularly in the second half of the xx century , but also in the first half of the same century . also the low incidence rates registered in poland does not seem to agree with the high shipbuilding activity of the country . the low mortality from mesothelioma in spain is also difficult to interpret and seems to be in contrast with the fact that this country showed a marked increase in shipbuilding activity in the second half of the xx century . in this period the production passed from 51,000 tons in 1955 to 830,000 in 1971 , and the annual number of ships passed from 23 to 161 . the most recent data available on mesothelioma epidemiology show that in many countries the incidence of the tumor does not present signs of attenuation . on the basis of global asbestos consumption in the last decades this lack of data does not allow that an adequate consciousness of the risk is obtained . the epidemic of asbestos - related diseases in general and of mesothelioma in particular requires that the problem is faced in a more incisive way by health international institutions .

background : mesothelioma incidence has taken epidemic proportions in various countries . the trend of the epidemic remains undefined.objective:to collect the most recent available data on mesothelioma incidence in order to determine the present trend of the epidemic.materials and methods : data of the cancer and mesothelioma registries have been reviewed . in addition , numerous researchers were contacted to obtain supplementary information.results:the highest incidence rates are reported from some countries in europe ( united kingdom , the netherlands , malta , belgium ) , and in oceania ( australia , new zealand ) . relatively low incidence / mortality rates are reported from japan and from central europe . in many countries a trend to increase continues to be observed . data are not available for the mostly populous countries.conclusion:mesothelioma epidemic does not show signs of attenuation . the lack of data for a large majority of the world does not allow that the consciousness of the risks related to asbestos exposure is reached .

helicobacter pylori is a microaerophilic , gram - negative bacterium that colonizes human gastric mucosa [ 1 , 2 ] . although most individuals with a chronic gastric infection of h. pylori are asymptomatic , this bacterium causes peptic ulcer or gastric cancer in a subpopulation of susceptible hosts [ 1 , 2 ] . the development of gastric disease associated with h. pylori infection is determined by the interplay between bacterial virulence factors and host immune responses . the cag - pathogenicity island ( pai ) is one of the most important virulence factors of h. pylori . infection with strains of h. pylori carrying cag - pai is associated with severe gastric disease , including gastric cancer . chronic infection with h. pylori is characterized by a strong t helper type 1 ( th1 ) response in the gastric mucosa [ 4 , 5 ] . th1 cells produce ifn--mediated mucosal host defense against this organism as shown by the fact that ifn--deficient mice fail to eradicate the bacteria from their stomachs upon oral administration of this organism . although it is well established that the gastric mucosa of patients with h. pylori infection is characterized by adaptive th1 responses , the innate immune responses leading to such th1 responses are poorly understood . pattern recognition molecules particularly toll - like receptors ( tlrs ) play a crucial role in host defense against mucosal pathogens . tlrs are evolutionarily conserved receptors , which recognize microbial antigens and contribute to host defense by producing proinflammatory cytokines and antimicrobial peptides . the activation of tlrs in antigen - presenting cells ( apcs ) by tlr ligands associated with h. pylori has in fact been shown to be involved in the generation of protective th1 responses against h. pylori . in addition , the neutrophil - activating protein of h. pylori induces th1 responses via tlr2-mediated il-12 secretion in apcs . thus , it is clear that the detection of h. pylori - associated antigens by apcs expressing tlrs plays a role in the induction of protective anti - h . given the fact that most gastric apcs are localized in the submucosal areas and that h. pylori adheres to the luminal surface of the epithelium , it is likely that innate immune responses by gastric epithelial cells ( ecs ) directly activated by the organism are involved in the immunopathogenesis of h. pylori - associated gastric diseases . tlr signaling may be involved in the development of h. pylori - associated gastric disease since patients with gastric adenocarcinoma are more likely to carry the tlr4 polymorphisms . however , on the other hand , tlr signaling may not necessarily play a major role since gastric ecs have been shown to be hypo - responsive to tlr ligands . another possibility is that epithelial cell signaling occurs through nucleotide - binding oligomerization domain , leucine - rich repeat - containing ( nlr ) proteins , that is , a rapidly emerging family of innate immune regulatory molecules that function much like tlrs but with different signaling mechanisms . nucleotide - binding oligomerization domain 1 ( nod1 ) is of particular relevance in this context since nod1 , a member of the nlr family proteins , recognizes small peptides derived from peptidoglycan ( pgn ) , a component of bacterial cell walls , and is expressed in apcs and gastric ecs . in addition , viala et al . has shown that eradication of h. pylori requires the sensing of pgn by cytosolic nod1 expressed in gastric ecs . since this latter discovery , several mechanisms regarding nod1-mediated mucosal host defense against h. pylori have been proposed . in this paper , we focus on these mechanisms with the aim of explaining just how nod1 signaling contributes to gastric inflammation and host defense against h. pylori . nod1 consists of a c - terminal lrr ( leucine - rich region ) , a central nod , and an n - terminal card ( caspase - activating domain ) domain . whereas tlrs are associated with the plasma membrane or endosomal vesicles , nod1 is expressed in the cytosol . importantly , most gastrointestinal cell lines and primary ecs express nod1 [ 15 , 16 ] . ifn- activates the promoter of nod1 via nuclear translocation of ifn - regulatory factor 1 ( irf1 ) to up - regulate the expression of nod1 in intestinal ecs whereas nf-b activation by tnf does not alter the nod1 expression in these cells [ 16 , 17 ] . it is now established that nod1 senses a small molecule derived from bacterial cell wall pgn . a minimum motif of nod1 ligand is -d - glutamyl - meso - diaminopimelic acid called ie - dap . in contrast , pgn derived from most gram - negative bacteria contains ie - dap . thus , nod1 functions as a sensor for gram - negative bacteria . in support of this idea , it has been shown that nod1 participates in host defense against mucosal infection with gram - negative bacteria such as shigella , escherichia coli , and h. pylori [ 18 , 19 ] although no functional mutations have been found to be associated with upper gastrointestinal diseases caused by chronic infection with h. pylori . one pathway of nod1 signaling relates to its ability to activate nf-b and map kinases . such signaling is initiated by the detection of nod1 ligands by the lrr domain of nod1 which is then followed by the recruitment of a downstream effector molecule , rick . rick is a card - containing serine / threonine kinase that physically binds to nod1 through a card - card interaction . rick then undergoes k63-linked ubiquitination and acquires the ability to recruit and activate tgf--activated kinase 1 ( tak1 ) ; the latter , in turn , initiates activation of nf-b subunits through phosphorylation and k48-linked ubiquitination of ib. this sequence of events suggests that the binding of rick to nod1 and its k63-linked polyubiquitination is a key step in the nod1-mediated signaling cascade with respect to responses involving nf-b and map kinases and , as we shall see to other responses as well . this supposition is fully supported by the fact that nod1 responses are severely curtailed in rick - deficient cells . the above nod1 signaling pathway emphasizes the importance of ubiquitination in the signaling cascade . on the one hand , conjugation of k48-linked polyubiquitin chains with the inhibitory protein ib leads to proteasomal degradation of ib and the nuclear translocation of nf-b subunits such as p65 and p50 . on the other hand , conjugation of k63-linked polyubiquitin chains to rick , rather than causing rick degradation leads to the creation of a scaffold that enables recruitment of signaling components , such as tak1 . the ligases that conjugate k63-linked polyubiquitin chains to rick have recently been identified as the cellular inhibitors of apoptosis proteins ( ciap ) , ciap1 , and ciap2 . these proteins bind to nod1 following the latters ' activation by its ligands and have c - terminal ring finger domains with e3 ligase activity which then k63-ubiquitinate the rick ( figure 1 ) . as shown in recent studies [ 19 , 23 , 24 ] , the stimulation of ecs with nod1 ligands leads to robust production of proinflammatory chemokines . we confirmed and extended these findings with studies showing that such stimulation induced th1 chemokines ( ifn--induced protein of 10 kda , ip-10 ) in gastrointestinal ecs including freshly isolated primary ecs both in the presence and absence of ifn-. initially , we and others attributed such induction to a signaling pathway involving nf-b , along the lines described above . we noted , however , that the possible involvement of nf-b was based largely on signaling studies utilizing transfected cells , in which nod1 and/or an nf-b reporter gene were overexpressed , rather than on studies employing cells expressing endogenous nod1 stimulated under physiologic conditions . this introduced the possibility that signaling pathways not involving nf-b activation play an important role in nod1 induction of chemokines in ec . in an extensive series of studies to investigate this possibility we found that indeed , stimulation of ec by nod1 ligand and production of ip-10 was not accompanied by substantial nf-b activation , but rather by the induction of type i ifn which leads to ip-10 production by inducing the ip-10 transcription complex , ifn - stimulated gene factor 3 ( isgf3 ) . this comes about via a unique nod1 signaling pathway that involves initial interaction of activated rick with traf3 , followed by the activation of tank - binding kinase 1(tbk1 ) and ikk and downstream irf7 to induce the production of ifn- and , as mentioned isgf3 ( figure 1 ) . isgf3 , which is a heterotrimer composed of stat1 , stat2 , and irf9 , not only acts as a transcription factor for ip-10 , but also for irf7 which induces further ifn- production and further rounds of ip-10 production . overall , these studies showed that , at least with respect to ecs , nod1 utilizes a signaling pathway more commonly identified with cell signaling by viruses . whether this signaling pathway also defines nod1 function in other kinds of cells , such as macrophages , remains to be seen . the majority of patients with h. pylori - associated gastritis have a higher nod1 expression in gastric epithelial cells as compared with controls or h. pylori - nonassociated gastritis , which suggests the involvement of nod1 signaling in the development of human gastric inflammation . in addition , animal studies demonstrate that a marked increase of bacterial load in the stomachs of nod1-deficient mice is observed upon acute infection with cag - pai - positive , but not cag - pai - negative h. pylori as compared with nod1-intact mice [ 15 , 17 ] . these data are related to the fact that the detection of h. pylori - derived pgn by gastric ecs is at least partially dependent on a functional type iv secretion apparatus . , h. pylori expressing functional cag - pai efficiently delivered radio - labeled pgn into the ecs , whereas h. pylori strain 251harboring nonfunctional cag - pai failed to deliver radio - labeled pgn . in addition , these finding were supported by studies showing that infection with h. pylori induced il-8 production by the gastric epithelial cell line , ags cells , in an nod1/cag - pai - dependent manner . it should be noted , however , that kaparakis et al . have recently provided evidence for the existence of a cag - pai - independent mechanism for nod1 activation . these authors purified outer membrane vesicles ( omvs ) from cag - pai - positive and -negative bacteria . h. pylori - derived omvs containing numerous components of bacterial cell walls including pgn , induced il-8 production by ags cells via an nod1-dependent and cag - pai - independent fashion . in addition , nod1-deficient mice exhibit defective innate and adaptive immune responses to omvs upon oral challenge with omvs . patients infected with strains lacking a functional type iv secretion system still have inflammation and th1 responses . these data regarding nod1 activation by omvs may partially explain the mechanisms by which nod1-mediated th1 responses against h. pylori are induced in the absence of functional cag - pai . on the basis of this new data , further studies to determine the conditions under which nod1 activation upon h. pylori infection requires functional type iv secretion apparatus are warranted . the generation of th1 responses is required for mucosal host defense against h. pylori infection [ 4 , 6 ] . although the mechanism by which recognition of h. pylori - derived pgn by cytosolic nod1 activates the protective response is not completely understood , two main models have been proposed ( figure 2 ) . the first model for the role of nod1 activation in h. pylori infection is based on the antimicrobial activity of defensins produced by ecs . grubman et al . showed that h. pylori infection induces the production of human defensin 2 ( hbd2 ) by ags cells in an nod1/cag - pai - dependent fashion . transfection of sirna specific to hbd2 impairs the killing of h. pylori , as shown by the increased number of bacteria in culture supernatants from ags cells infected with cag - pai - positive h. pylori . these authors imply that nod1 induction of hbd2 upon infection with cag - pai - positive h. pylori may be mediated by nf-b activation , but this is unclear since nf-b activation is assessed by reporter gene assays that may not reflect endogenous nf-b regulation . consistent with these results , the expression of murine -defensin 4 ( an orthologue of hbd2 ) is markedly reduced in the gastric mucosa of nod1-deficient mice as compared with nod1-intact mice . these data regarding hbd2 induction by nod1 suggest that nod1 mediates host defense by the direct killing of h. pylori through induction of hbd2 . however , the contribution of nod1-induced defensins to the generation of th1 responses remains unknown . the second model for the role of nod1 activation in h. pylori infection is based on the production of type i ifn and activation of the isgf3 signaling mediated by nod1 . as we described in the previous section regarding nod1 signaling pathways , the stimulation of gastrointestinal ecs including primary cells with nod1 ligands leads to a robust production of ifn- and the subsequent induction of isgf3 . we therefore addressed the role of this new signaling pathway in cag - pai - positive h. pylori infection . in in vitro studies we found that h. pylori infection of ags cells led to a massive increase of ifn- and ip-10 production , which was accompanied by the activation of both stat1 and stat2 , suggesting that cag h. pylori organisms do indeed activate epithelial cells via the ifn--isgf3 pathway . although h. pylori infection of the ags cells results in nf-b activation , nf-b activation induced by h. pylori infection is independent of nod1 . the infection of ags cells in the presence of sirna specific for nod1 resulted in the impaired nuclear translocation of stat1 and production of ifn- and ip-10 , but unchanged nuclear translocation of nf-b subunit , p65 . these results are consistent with previous studies of hirata et al . , who showed that h. pylori organisms can activate nf-b in epithelial cell lines through myd88-dependent mechanisms , but not nod1-dependent mechanisms , and viala et al . who reported that primary gastric epithelial cells infected with h. pylori produce chemokines in the absence of the nuclear translocation of nf-b p65 . in further in vivo studies of nod1 activation during h. pylori infection we found a marked increase of bacterial load in the stomachs of nod1-deficient mice as compared with nod1-intact mice . furthermore , this was associated with reduced production of type i ifn - isgf3-associated cytokines and chemokines such as ifn- , ip-10 , and ifn- rather than nf-b - associated cytokines such as tnf . thus , the activation of type i ifn and isgf3 signaling via nod1 is responsible for the generation of protective th1 responses against h. pylori . this idea was confirmed by the fact that gene silencing of stat1 , a component of isgf3 , increases the bacterial burden in the stomach of nod1-intact mice due to impaired th1 and type i ifn responses . therefore , it is likely that nod1-mediated type i ifn production and isgf3 activation provide protective th1 responses upon infection with cag - pai - positive h. pylori . in support of this model , ip-10 expression is observed in the gastric mucosa of patients with chronic h. pylori infection . recent studies addressing the role of nod1 in mucosal host defense against h. pylori have been focusing on acute innate responses as assessed by cell - culture or animal infection models . thus , it is unclear how nod1 activation is involved in the development of various gastric diseases associated with chronic h. pylori infection . in this regard , il-17 may play an important role in the chronic inflammatory responses to h. pylori infection as shown by the overproduction of this cytokine in h. pylori - infected human gastric mucosa . in addition , vaccination of mice against h. pylori results in efficient eradication due to enhanced il-17 production in the gastric mucosa [ 30 , 31 ] . it is possible that nod1 activation in response to h. pylori infection is involved in the generation of gastric th17 responses since nod1 triggering is required to instruct the onset of both th1 and th17 responses . infection with cag - pai - positive h. pylori leads to the activation of nod1 in gastric ecs and to the induction of several host defense factors including hbd2 , ifn- , and ip-10 , all of which regulate bacterial growth . recent studies have shown that nod1 activation is mediated in ecs largely , if not entirely , by nod1 induction of ifn- and thus a signaling pathway ordinarily activated by viral infection . this has important implications for our views on how the mucosal system utilizes innate immune mechanisms to deal with chronic bacterial infections . interestingly , proinflammatory cytokine responses induced by tlr ligands are markedly enhanced in the presence of nod1 ligands . therefore , it is possible that the synergistic activation of nod1 and tlrs in gastric apcs also plays a role in mucosal host defense against this organism . thus , future studies addressing whether or not nod1 expression in apcs contributes to host defense against h. pylori will be of great interest .

infection of the stomach with helicobacter pylori is an important risk factor for gastritis , peptic ulcer , and gastric carcinoma . although it has been well established that persistent colonization by h. pylori is associated with adaptive th1 responses , the innate immune responses leading to these th1 responses are poorly defined . recent studies have shown that the activation of nucleotide - binding oligomerization domain 1 ( nod1 ) in gastric epithelial cells plays an important role in innate immune responses against h. pylori . the detection of h. pylori - derived ligands by cytosolic nod1 induces several host defense factors , including antimicrobial peptides , cytokines , and chemokines . in this paper , we review the molecular mechanisms by which nod1 contributes to mucosal host defense against h. pylori infection of the stomach .

anti - n - methyl - d - aspartate receptor ( nmdar ) encephalitis is an autoimmune disease that generates antibodies to the nmda receptor . it typically affects young women and is accompanied by abnormal behavior , seizure , mental deterioration , and dysautonomia . the clinical course begins with viral prodromal symptoms during the first week , followed by insanity symptoms for up to three weeks and neurological symptoms such as severe abnormal movements , hypoventilation , and seizure for several weeks to several months . recently in south korea , many case reports of this disease have been published , as the neurology department of a university hospital can perform an antibody test for anti - nmdar encephalitis . in our case , the patient was referred to us following continued fever after hospitalization due to abnormal behavior and frequent mood changes . she had no abnormal findings on brain mri and cerebrospinal fluid ( csf ) testing , but a malformation of the ovary was found and antibodies to nmdar were found in the blood and csf , which led to the diagnosis of anti - nmdar encephalitis . her continued uncontrollable fever was due to dysautonomia . we report this case because it is critical to check for anti - nmdar encephalitis as a cause of fever when the patient shows neurological and psychiatric symptoms along with fever . 36-year - old woman who was hospitalized by the psychiatry department due to abnormal behavior and frequent mood changes for 2 days was referred to the department of infectious diseases on day 6 for continued fever , which lasted for 2 more days . she had been healthy with no particular medical history , but complained of chills and headache starting 5 days before her hospitalization . two days before her hospitalization , she showed frequent mood changes , such as suddenly crying about difficult work and then smiling soon after , saying she felt better . she also complained of visual hallucinations and insomnia , and showed hyperactivity such as desultorily walking around the house . she was diagnosed with type 1 bipolar disorder and was hospitalized by the psychiatry department . after calming down , she remembered everything she had said and done . on the second day of hospitalization , she shouted that she gave birth to a baby and bit her own and her mother 's hands , indicating catatonia . she then developed a fever and was referred to the infectious disease department . at the time , the patient looked at other people only when she was called , and she spoke in gibberish with unclear pronunciations . blood pressure was 150/100 mmhg , heart rate was 109 per minute , and respiratory rate was 23 per minute . her test results for cranial nerves , movement , senses , and reflexes were normal . the brain mri conducted on the first day of her hospitalization showed no special findings . due to the hematologic test results showed a white blood cell count of 13,370/mm , ( neutrophils 73.7% , lymphocytes 19.3% ) , hemoglobin of 12 g / dl , platelet count of 369,000/mm , erythrocyte sedimentation rate of 3 mm / h , procalcitonin of 0.06 ng / ml , blood urea nitrogen of 2.84 mg/ dl , creatinine of 0.59 mg / dl , and albumin of 4.26 g / dl . c - reactive protein was 1.09 mg / dl , aspartate aminotransferase was 189 iu / l , alanine aminotransferase was 72 iu / l , creatine phosphokinase was 24,406 iu / l , and lactate dehydrogenase was 1,255 iu / l . because there was a fever after the contaminated wound on her finger and her creatine phosphokinase and lactate dehydrogenase were increased , the fever was judged to be caused by skin soft tissue infection . thus , cefazolin ( 1 g every 8 hours ) was administered for 7 days . no strain was identified from the blood culture , but enterococcus faecalis was identified in the wound culture . the wound improved but the fever continued so the medication was changed to levofloxacin ( 750 mg / day ) , which was administered for 5 days . after that , her fever continued at 37.8 to 38.9 , so the drug was changed to ampicillin / sulbactam ( 2,000/1,000 mg every 8 hours ) . no strain was identified on repeated blood cultures , and no heart noise was detected by stethoscope . her creatine phosphokinase and lactate dehydrogenase decreased to normal ranges during week 3 of her hospitalization . the patient 's fever and abnormal behavior continued , so her csf was tested on day 21 of her hospitalization . the csf pressure was 10 cm h2o , proteins were 26.19 mg / dl , sugar was 78 mg / dl , and white blood cells were 2/mm ( lymphocytes 100% ) . a pelvic ct on day 26 of the hospitalization found a 5.5 cm mixed density in the right adnexa , which was mixed with a 2.5 1.3 cm cyst , adipose tissues , and a calcified area ( fig . the patient was diagnosed with anti - nmdar encephalitis and methylprednisolone ( 1 g / day ) was administered . on day 28 , the right adnexa was removed laparoscopically . the tissue findings indicated a mature cystic teratoma . on day 29 of the hospitalization , which was the third day of steroid administration and 2 days after the operation after 5 days of administration of methylprednisolone , it was changed to dexamethasone ( 10 mg / day for 14 days ) . on day 40 of her hospitalization , nonspecific slow waves appeared on the electroencephalogram . on day 46 of her hospitalization , she was discharged and her medication was changed to 60 mg of oral prednisolone , which was slowly reduced until it was fully stopped after 4 weeks . at present , she is leading a normal life with no signs of type 1 bipolar disorder , and is under follow up . this is a case report of the diagnosis of anti - nmdar encephalitis as a cause of fever that developed during the hospitalization of a patient in the psychiatry department due to abnormal behavior and insanity symptoms . after it was reported in 2005 that 4 women with ovarian teratoma showed symptoms such as memory loss , insanity , metal deterioration , and decreased respiration , the possibility of paraneoplastic syndrome was raised . later , anti - nmdar encephalitis received much attention and has been frequently reported since the discovery of antibodies to nmdar was reported by dalmau , et al . in 2007 . nmdar is involved in the formation and memory of synapses and is an isoform of the nr1 subunit that combines with glycin and the nr subunit , which combines with glutamate . anti - nmdar encephalitis has been found to be caused by immunoglobulin ( ig)-g1 and igg3 , which combine with the nr1 subunit . the prevalence of anti - nmdar encephalitis is not accurately known , but it accounts for about 37 - 50% of encephalitis cases of unknown origin . a prospective multicenter study on the cause of encephalitis in the united kingdom found that anti - nmdar encephalitis accounted for approximately 4% of cases and was the next most frequent cause after acute disseminated encephalomyelitis . in the california encephalitis project , anti - nmdar encephalitis appeared in 4.2% of patients aged 30 or under and was the most frequent cause of encephalitis of unknown origin . in south korea , a university conducted a test of antibodies to nmdar in 721 patients with encephalitis of unknown origin , and 40 of them were positive . a test of the antibodies to nmdar will help in the diagnosis in cases of encephalitis of unknown origin . seventy percent of patients start with symptoms similar to a cold , such as nausea , fever , headache , and fatigue . psychiatric symptoms appear within 2 weeks and may include cognitive disorders such as confusion and memory loss , insanity such as paranoia , hallucinations , agitation , depression , anxiety , and automutilation , as well as convulsions . these symptoms are often misdiagnosed as schizophrenia or bipolar disorder . for several weeks to several months , neurological complications may lead to hypoventilation and trance , which requires mechanical ventilation . after that , the patient may exhibit sequelae such as impulse disorder and sleep disorder for several months to several years . our case also showed abnormal behavior and fever as initial symptoms , but the cause of the fever was mistaken as skin and soft tissue infection because she had lacerated wounds on her right thumb and left forefinger and was treated with antibiotics , which brought about difficulty in the diagnosis . it has been found that ovarian teratoma is associated with a higher frequency of the characteristic symptoms of anti - nmdar encephalitis and the removal of the teratoma improves the symptoms more quickly and decreases recurrences . in the present case , a cystic teratoma was discovered in the right adnexa on a pelvic ct after anti - nmdar encephalitis was suspected as the cause of the fever of unknown origin . the adnexa was immediately removed and the patient 's fever was alleviated by the second day after the operation . if examination findings are not characteristic , an nmdar antibody test can be conducted on the serum and csf . if the result is positive , ultrasound , ct , and mri tests are conducted to look for a tumor . if no tumor is found , high dose steroid shock therapy and immunoglobulin or plasma exchange should be considered . if the patient shows a good response to treatment , he / she will need conservative treatment , and sustained treatment with immunosuppressants such as mycophenolate mofetil is required , as well as periodic follow up because of the possibility of future tumor development . if there is a tumor , high dose steroid shock therapy and immunoglobulin or plasma exchange should be considered when the tumor is removed . if the patient is not responsive to the treatment , rituximab , cyclophosphamide , or both could be used . at present , our patient has slowly decreased and stopped the steroids without using any immunosuppressants , and she is now under follow up . however , some patients have continued problems with cognitive functions such as under standing , memory , concentration , and expression , and with motor functions such as walking and swallowing . a two - year follow up study found that about 80% of the patients showed good results ( modified rankin scale of 0 - 2 ) . patients who did not use immunosuppressants in the early stage and patients who did not receive treatment in the intensive care unit showed a better prognosis . the present case report shows that the possibility of anti - nmdar encephalitis should be considered in patients with fever of unknown origin who exhibit insanity symptoms , because it is not uncommon . the presence of a tumor must be determined immediately and the tumor must be removed if one is found , and steroid or immunoglobulins must then be used quickly .

encephalitis associated with antibodies to the n - methyl - d - aspartate receptor ( nmdar ) has variable clinical manifestations . patients are often diagnosed with infectious processes because of prodromal symptoms and autonomic manifestations . approximately 70% of patients have prodromal symptoms consisting of headache , fever , nausea , vomiting , and diarrhea , along with frequent autonomic manifestations , including tachycardia , and fluctuating blood pressure . a 36-year - old woman presented with uncontrolled fever and skin and soft tissue infections . she had shown psychiatric symptoms and abnormal behavior , and had been diagnosed with bipolar disorder . antibodies to nmdar were positive in cerebrospinal fluid ( csf ) and serum samples , and pelvic computed tomography detected a large ovarian teratoma . the patient improved dramatically after removal of the teratoma and administration of corticosteroid therapy . when confronted with a young woman with uncontrolled fever and acute psychiatric symptoms , physicians should suspect anti - nmdar encephalitis .

anemia is a frequent occurrence in human immunodeficiency virus ( hiv ) patients ( incidence 23% as reported by kumaraswamy et al . ) . it occurs due to multiple etiologies , such as anemia of chronic disease due to uncontrolled virus , medication induced myelosuppression or hemolysis and infection related hypo - production . pure red cell aplasia ( prca ) is a rare cause , which selectively affects the erythroid bone marrow cells . there have been very few reports of zidovudine ( azt ) and lamivudine ( 3tc ) induced prca , of which two have been reported from india . a 52-year - old male was diagnosed hiv-1 positive 5 months back in november 2012 while investigating for fever and weight loss . he was started incorrectly on two nucleoside reverse transcriptase inhibitors - azt/3tc combination by his local practitioner . after 4 months of therapy , the patient presented to us with a 1 month history of gradually progressive fatigue and 2 weeks history of exertional dyspnea progressing to dyspnea at rest . examination revealed severe pallor , resting tachycardia , pitting pedal edema , and signs of hyperdynamic circulation . he was hypoxic on room air confirmed by arterial blood gas ( ph - 7.39 , po2 -68 , pco2 -30 , hco3 -25 ) . systemic examination revealed an ejection systolic murmur grade 3/6 in a pulmonary area with use of accessory muscles of respiration and mild nontender hepatomegaly . he was investigated as shown in table 1 ( baseline investigations ) and table 2 . after workup , the differential diagnosis was thought to be either drug induced or secondary to an opportunistic infection ( mycobacterium avium - complex , parvovirus , fungal infections ) or even possibly immune reconstitution inflammatory syndrome ( iris ) . however , his repeat cd4 - 207 and viral load - 25,000 copies / ml were better which made the possibility of an opportunistic infection less likely . similarly , the absence of fever , lymphadenopathy , any pulmonary infiltrates or uveitis ruled out the possibility of iris . serial complete blood count values over 4 months liver and renal function tests on admission for etiological diagnosis , a bone marrow aspiration and biopsy were performed . aspiration revealed a marked paucity of erythroid precursors 3% , myeloid : erythroid ratio of 20:1 , giant pronormoblasts with cytoplasmic protrusions and bone marrow biopsy showed a prominent erythropoietic cell line suppression . his serum erythropoietin ( epo ) level was elevated - 750 iu / ml ( normal - 100250 iu / ml ) . bone marrow microbiology for tuberculosis mycobacteria growth indicator tube , fungal culture , and parvovirus deoxyribose nucleic acid ( dna ) polymerase chain reaction ( pcr ) were negative ( to rule out opportunistic infection ) . he responded clinically and hematologically to azt withdrawal . since his new regimen consisted of 3tc it is usually associated with autoimmune states , pregnancy , infections , etc . , it is defined as anemia with normal leukocyte and platelet counts , corrected reticulocyte count < 1% and < 5% erythroid precursors in bone marrow in the absence of hemolysis . in contrast , mean corpuscular volume ( mcv ) is almost always increased in any patient on azt , in fact , it is used as a marker of adherence even in patients without anemia , hence the mcv serves as a rapid and easy differentiator of the two conditions . in parvovirus infection , the erythroid lineage is prominently affected ; however , neutropenia and thrombocytopenia are also frequent . these manifestations are more common in hiv patients with more advanced immunodeficiency . for diagnosis , investigations for parvovirus - b19 dna in the serum or bone marrow is warranted as in acquired immune deficiency syndrome ( aids ) patients , parvovirus antibodies may be undetectable or show only weak igm titers . parvovirus - associated prca was ruled out in our patient as parvovirus dna pcr was negative . autoimmune hemolysis was unlikely in view of a negative coombs test . at the time of diagnosis both have been associated with prca but in our case , we attributed this to azt as stopping of this drug reversed the hematological abnormality even while 3tc was continued . there are two mechanisms of prca in aids , first - an autoimmune response due to dysregulated immune status and second - a myelosuppressive effect of art . the possible mechanisms for hematosuppression could be due to the synergistic action of azt and 3tc . most physicians believe that withdrawal of azt + 3tc combination is enough , and that bone marrow examination is not mandatory . as per balakrishnan et al . , prca typically occurs within the first 3 months of therapy with azt/3tc but , there are reports of azt - induced prca occurring even after 4 years of treatment . in our patient , this complication occurred 4 months after starting therapy . anemia resolved on drug discontinuation and reappeared on rechallenge . as per cohen et al . , erythroid aplasia appears to be a major cause of anemia occurring within the first 3 months of treatment . the earliest sign is anemia with a stable or only a slight increase in the mcv . epo levels in a patient with hiv and anemia are generally lower than expected for the degree of anemia and treatment with epo results in the correction of anemia . an exception to this is patients with azt - associated anemia in which epo levels are high . in our patient , it is a normocytic normochromic anemia which differentiates it from the usual macrocytic anemia produced by azt . since azt is widely used in india , physicians should be cognizant of this complication as it is reversible with simple drug substitution .

pure red cell aplasia ( prca ) is an uncommon hematological disorder affecting selectively the erythroid cell lines . prca is defined as anemia with normal leukocyte and platelet counts , a corrected reticulocyte count < 1% , < 5% erythroid precursors in the bone marrow and an absence of hemolysis . we describe a case of zidovudine ( azt ) induced prca causing severe anemia in a patient taking antiretroviral therapy ( art ) after 4 months of starting therapy and in whom all other causes were excluded . the hematological abnormalities resolved after azt was replaced with tenofovir and the patient remained transfusion independent thereafter . a slowly progressive normocytic - normochromic anemia and reticulocytopenia , without leukopenia and thrombocytopenia in a patient , should raise the suspicion of prca . search for underlying diseases , infections and drugs may help in the diagnosis and etiology of acquired prca . elimination of potentially causative factors may induce complete recovery . azt is a well - known cause of anemia and thus should be used with caution in the initiation of art .

the incidence of deep vein thrombosis ( dvt ) in pediatric patients is significantly much lower than adults . most of the pediatric in - patients with major trauma , sepsis do not undergo routine screening for dvt . we present a case of a 12-year - old boy presented to us with minor trauma to right ankle associated with swelling , pain and had associated cough , and fever . on investigation with plain x - ray of right ankle / chest , and blood parameters , patient was treated with iv cloxacillin and ample of rest . during the course of treatment , patient s condition deteriorated with fever , tachycardia and a swollen leg without much pain . duplex scan was performed where the right leg revealed thrombosis of popliteal vein , while ct scan of chest with angiogram ruled out possibility of pulmonary embolism . however , ct chest showed pneumonia with pulmonary effusion . patient recovered completely and there was no recurrence during follow up period of 6 months . the possibility of dvt in pediatric should be kept in mind and when suspected , should be properly investigated and treated . incidence of deep vein thrombosis ( dvt ) is significantly low in paediatric patients in comparison to the adults . these days , more children are hospitalized for longer duration due trauma and various medical problems . however , the disease is very much under - diagnosed and under - reported probably due to less awareness among treating physicians , a significantly large number pediatric patients may be asymptomatic . furthermore , routine screening for dvt is not done in this age group despite longer duration of immobilization and intensive care treatments . most of the reported cases in literature are related to malignancy , central catheters site infections and neurosurgical injuries . we are presenting this case report after receiving consent from patient s father & approval by the hospital ethical committee . 12-year - old boy presented with history of trauma to his right ankle three days back . patient was febrile with 38.5 degree celsius temperature ; tachycardia at 125/min and respiratory rate 25/min . right ankle was mildly swollen with redness , local rise of temperature , tenderness over lateral malleolus , lower 3rd leg laterally ( fig . his blood parameters were ; haemoglobin-12.5gm%;total count- 21.28k / ul ; neutrophils-19.77k / ul ; lymphocytes-0.75k / ul% , crp- 360.1mg / l(positive ) ; esr--60mm / hr ; rafactor - negative ; aso - titre- 400iu / ml ; sickling - negative . patient was admitted for treatment of suspected cellulitis , pediatric opinion was sought for cough . chest x - ray : revealed pneumonia , therefore he was started on iv cloxacillin 1gm four times daily . later blood culture revealed growth of staphylococcus aureus which was sensitive to cloxaciilin . on the 3rd day , patient s general condition deteriorated with persistently elevated temperature , tachycardia ( 140/min ) , respiratory rate at 40/min and spo2- 87% at room air with moderate swelling on whole of right leg with tender calf and a positive homan sign . there was no evidence of embolism , but showed right sided pleural effusion and bilateral patchy pneumonia . the duplex scan of right lower limb was suggestive of popliteal vein thrombosis ( fig . 2 , 3 ) , thrombophilia work up for protein c & s ; anti- thrombin iii was negative . patient was treated with low molecular heparin and iv cloxacillin ( for pneumonia ) in intensive care unit . patient improved clinically , calf swelling was reduced and blood parameters were also reverting to normalcy at the time of discharge . patient was discharged on 14th day and was treated with warfarin for next 3 months . patient was followed up for period of 6 months , and there were no signs of recurrence . although the development of deep venous thrombosis in pediatric patients is unusual , it certainly does occur and can be complicated by the development of pulmonary embolism and the long - term sequelae of the postphlebitic syndrome . most of the cases reported in the literature are often associated with long term hospitalizations , intensive care treatment and central lines / deep musculoskeletal structures associated sepsis.[1 , 2 , 3 , 4 , 5 ] . it is possible that the disease is significantly under diagnosed in children because the index of suspicion of pediatric practitioners is low , a substantial number of patients may have no symptoms , and dvt screening is not routinely performed . there are many risk factors identified to be associated with dvt among children . among them , sepsis , immobility , trauma , operative procedures , indwelling femoral venous line and malignancy are more frequently reported . while , obesity , hypercoagulability state and previous history of dvt / pulmonary embolism are less frequent . our patient had trauma to his right ankle followed by superficial soft tissue infection and an associated pneumonia , but he did not have rest of the risk factors mentioned above . despite moderate swelling of leg , patient did not have any other local symptoms . in order to diagnose dvt the low incidence of dvt noted in this study suggests that dvt screening in patients who are at low risk and have no symptoms is not appropriate and that dvt prophylaxis is unnecessary in pediatric patients with fewer than three risk factors for the development of dvt . the risk of clinically significant thromboembolic event in trauma patients under age 13 is negligible . our hospital does not have the policy of routine screening and prophylaxis therapy for dvt in pediatric patients . although contrast venography is considered the standard criterion for diagnosis of dvt , time , personnel , cost , exposure to radiation and invasive nature of the study ( need for venous access ) potentially limit the ability to perform the study in emergency settings . ultrasonography is an alternative method for thrombus detection and is widely preferred . although the d - dimer test was negative , as the clinical suspicion of dvt was high , we went on to do duplex scan ; which confirmed popliteal vein thrombosis . incorporating d - dimer testing into a diagnostic strategy with clinical estimation of pretest probability and ultrasound imaging simplifies the diagnosis of deep - vein thrombosis in outpatients without compromising safety . we further investigated our patient with computer tomographic pulmonary angiography to rule out pulmonary embolism , as he had respiratory symptoms with staphylococcus aureus growth on blood culture . in s. bouchoucha et al study , the occurrence of dvt was significantly associated with septic pulmonary locations . low - molecular weight heparin therapy has many benefits over unfractionated heparin agents and may be more appropriate for the prophylaxis or treatment of children and adolescents with dvt because of its acceptable safety and efficacy . the incidence of dvt in a pediatric in - patient is still a possibility in trauma and sepsis . the careful clinical assessment of pediatric in - patient is important to the diagnosis of deep vein thrombosis . the incidence of popliteal vein thrombosis is on rise in pediatric trauma & septic patients . when suspected , it should be adequately investigated & properly treated to prevent further complications .

introduction : the incidence of deep vein thrombosis ( dvt ) in pediatric patients is significantly much lower than adults . most of the pediatric in - patients with major trauma , sepsis do not undergo routine screening for dvt.case report : we present a case of a 12-year - old boy presented to us with minor trauma to right ankle associated with swelling , pain and had associated cough , and fever . on investigation with plain x - ray of right ankle / chest , and blood parameters , patient was suspected of having cellulitis of right leg with chest infection . patient was treated with iv cloxacillin and ample of rest . during the course of treatment , patient s condition deteriorated with fever , tachycardia and a swollen leg without much pain . duplex scan was performed where the right leg revealed thrombosis of popliteal vein , while ct scan of chest with angiogram ruled out possibility of pulmonary embolism . however , ct chest showed pneumonia with pulmonary effusion . patient was treated with low molecular heparin and iv cloxacillin for pneumonia . patient recovered completely and there was no recurrence during follow up period of 6 months.conclusion:the possibility of dvt in pediatric should be kept in mind and when suspected , should be properly investigated and treated .

health and behavior are closely related subjects because most disease is typically rooted in an individual s unhealthy behaviors and habits . individual behavior is likely to decrease or increase cancer risk , heart attacks , strokes , and similar physical damage ( 1 ) . chronic diseases are nowadays considered serious threats to health and longevity in developing countries . the world health organization ( who ) reports that 70% of mortalities in iran are due to chronic diseases ( 2 ) . also in iran , the highest burden of diseases is related to noncommunicable diseases . obesity , arterial hypertension , lack of physical activities , hypercholesterolemia , and addiction are five factors of primary risks , which have devoted the largest share to burden of diseases ( 3 ) . one of the most influential factors in the incidence of disease is unhealthy lifestyle and its transformations . fifty - three percent of causes of death are associated with individual lifestyles ( 4 ) . positive behavior patterns such as proper diet , regular exercise and physical activities , avoidance of alcohol and tobacco consumption play a significant role in individual health promotion ( 5 ) . lifestyle modification requires changing behaviors that constitute a major part of daily life habits of individuals ( 6 ) . healthy diet and consumer culture are considered as the most prominent factors of lifestyle and the most effective in promoting public health . generally , good nutrition and healthy eating leads to the overall stable health of society ( 7 ) . food habits and culture are interrelated , i.e. , nutritional behavior patterns of a society is a part of its cultural patterns . in other words , beliefs , values , and social norms day after day , the evidence shows that cultural and social foundations such as nutritional habits , education , and literacy , and awareness and access to information as well as nutritional literacy play a prominent role in shaping healthy nutritional behaviors and decisions . for this reason , over the recent years , more attention has been given to the role of culture and nutritional literacy ( 8) . consequently , being aware of opinions , demands , needs , preferences , behaviors , and beliefs of customers is regarded as a basic and important principle , which plays a critical role in designing intervention programs to promote healthy eating behaviors . therefore , relying on conditions and real needs of people and considering their beliefs and sanitary norms , studies that are able to present programs to modify the nutritional patterns of a society are among today s top health priorities ( 9 ) . qualitative methods , collecting in - depth data , can assist health trainers to discover the origin of health - related problems and behaviors along with environmental factors from the perspective of those who are directly involved with the problems . because nutritional behavior is a series of beliefs and habits that rely on social norms and values , we need to further discover the behavior in its cultural context before creating plans to improve it . different qualitative studies have been conducted in terms of examining and understanding views ( 1113 ) , beliefs and experiences ( 14 ) , and nutrition teaching ( 15 ) as well as barriers to healthy eating behaviors ( 16 , 17 ) . obviously , forming nutritional beliefs is considered a subculture , which , as with other social phenomena , is of great importance . in conducting exploratory studies regarding healthy diet , therefore , taking sociocultural aspects of forming wrong nutritional beliefs into consideration seems essential . these aspects help health practitioners consider different possibilities in planning and developing training interventions . focusing on various nutritional behaviors in different cultures and the anonymity of nutritional behaviors and their causes in sanandaj , first by conducting qualitative research on nutritional behaviors and beliefs , the meaning of healthy food and causes of nutritional behaviors in the target population will be explained . this formative study , conducted for the first time in iran , will help us to determine appropriate interventions to improve nutrition literacy in women . this research is part of a mixed - method study , which is conducted based on content analysis . the participants were composed of 18- to 50-year - old married women who were referred to four health care centers in sanandaj , which were selected using purposive sampling . written informed consent was obtained from all participants who were free to participate in the study or exit the study at any point during the research . the criterion for the adequacy of research sample was data saturation ; finally , 50 women covered by a health care center participated in the study . using semistructured interviews , the data were collected through group discussions and individual in - depth interviews . during five sessions of discussion groups - minimum of six and maximum of 10 people in each group - and eight individual interviews , the data were collected . the time period for discussion groups and individual interviews were between 1 and 2 hours and 1.5 hours , respectively . this time period varied , depending on the condition and process of the sessions or interviews . for example , how do you define a healthy diet ? to maintain a healthy diet , what actions do you take ? afterward and gradually , deeper questions were asked , in line with the research questions . interviews began in late october 2013 and ended in late june 2014 until data saturation . in the last interview , no new data were obtained . after gathering the data , content analysis was employed . immediately , after each session , on the day of the interview , all recorded interviews were thoroughly transcribed in detail . to fully understand the situation and get involved in the process of the interviews , the interviews were listened to , and the transcribed data were studied several times by the researcher . following that , coding ( converting the semantic and meaningful units to shorter , understandable , and desired concepts ) was completed . to identify similarities and differences , to merge similar codes and to form categories , subcategories were classified based on similarities , differences , and appropriateness and categories were extracted as well . finally , reconsidering categories , subcategories , codes , and data , main themes of the study were extracted . maxqda version 10 was employed for coding and classification of the interview texts . to ensure accuracy and reliability of the obtained qualitative data , criteria such as acceptability , reliability , stability , and transmissibility long - term involvement of the researcher with the research topic , data , and observing extracted codes and also immediate transcription , detailed record of all steps of the research , and providing a similar position for participants are all considered as approval of acceptability research . some parts of the interviews , along with extracted codes , categories , and subcategories , were assessed by some observers outside the research team who were familiar with qualitative research methods . sampling in this study utilized maximum diversity , which helps with transmissibility to increase the results . nutritional habits and behaviors of participants were classified into two categories : representation of nutritional behavior based on consumption pattern and representation of nutritional behavior based on consumption method . for the former , eight consumption pattern subcategories were formed : meat , dairy , fast food , local foods , fruits and vegetables , soft drinks , and oils . for the latter ( representation of nutritional behavior based on consumption method ) , there were two subcategories : consumption method in line with health ( healthy one ) and consumption method inconsistent with health ( unhealthy one ) . they believed that imagining non - meat meals is nearly impossible , and there are very few non - meat foods they can cook for their meals . one of them said , all our meals contain meat , even if the amount is little ; to us , meat adds flavor to the food . meat makes food tasty and a free - meat food would be almost tasteless . in most cooking programs on tv , they use meat to train people how to cook different kinds of food . most participants reported either low or no fish consumption , which is primarily blamed on the unpleasant smell of fish . the same participant , for example , said , there is no fish in our diet . i have frequently heard on tv that fish is a healthy food and it should be eaten at least once a week , but we just ca nt because , if i eat fish , i will get sick . the most widely consumed meat mentioned by participants was chicken . they typically believe that its low price and wide variety of foods that include chicken make it a popular meat . a participant confirmed that it is cheaper and lots of food can be cooked using it . he also said , as i have heard from tv , it is healthier than red meat . if one eats red meat regularly , the risk of heart disease and hypertension will increase . some believe that the lightweight ones are healthier , but i do nt think so ! eating them leads to unwanted hair growth and hormone elevated . however , it is still common and all consume it . however , they also mentioned low consumption of milk and whey . per one participant : as doctors tell us , three to four glasses of milk should be drunk daily . if i drink milk , i will suffer from intestinal pain because my intestine is not compatible with milk . even my daughter sometimes eats yogurt as a snack but is reluctant to drink milk . she hates it . in response to fruit and vegetable consumption , most participants noted low consumption , especially for their children ; only a small number mentioned consuming fruit besides cake and other refreshments as their snacks . one of the women , complaining about unwillingness of kids in terms of fruit consumption , said , from time to time , i put vegetables on the table to be consumed with main courses , but my husband eats a little and my kids do nt eat . however , they eat a lot of junk food such as pastry , cookies , chocolate , chips , cheese puffs , etc . when asked about fast food , most participants believed that fast food consumption is harmful and causes cancer . however , due to its delicious flavor and quick preparation , they believe its consumption is unavoidable . therefore , most participants noted consuming fast food once a month . i know that the nutritional value of sausage is very low , and it is believed to cause anemia and cancer . yet , once a month , we eat it : either i make it at home or we go out to it . i ca nt help eating them , you know , because i really love spicy sausages , especially hindi ones . another participant mentioned : we should include everything in our diet ; our body needs everything . eating fast food one or twice a month will not harm our body that much . nevertheless , most participants felt that the healthiest dishes are local and confirmed high consumption , especially in fall and winter . i usually cook them , especially in the fall and winter ; we often consume them once or twice a week . some cooked traditional and local foods such as tarhana , lentils , and frumenty ( wheat dish ) ; one participant believed that they clean ( purge ) inner parts of body . she noted , bean soup ( consists of wheat , pea , lentil , and red beans ) , for example , strengthens the body and is almost chemical - free . asking about cereal consumption , most participants replies noted daily consumption of rice . they believed that meals should be accompanied by rice ( rice is an iranian staple food ) , and there are a few food meals without rice . another participant noted : we consume rice almost every day , and i do nt think it is unhealthy . we do test yearly and have no serious problem , so no need to reduce the amount of rice . another category was the representation of nutritional behaviors based on consumption method , which contained two subcategories : healthy and unhealthy methods of consumption . in terms of healthy methods of consumption , cooked meals instead of fried , more consumption of white meat rather than red , consumption of less fatty dishes , and eating fresh food were mentioned by participants . i use enough ingredients while cooking meals so that everything is eaten in that meal . even when i go shopping , i do not purchase a lot so that i keep them in the refrigerator for a long time . we used to consume fried foods a lot . due to the increase number of diseases , however , over the last years i have either cooked the meals or steamed them . at first , my husband complained about it , but after a while he got used to it . most of the time he buys chicken and fish . on the other hand , in regards to unhealthy consumption , participants mentioned the following : beverage drinking along with high consumption of soft drinks , high consumption of junk food such as crisps and cheese puffs , eating too fast , drinking tea immediately after the meal , and excessive consumption of fried and high - calorie foods . in our family , according to one participant , after finishing the meal , we drink tea without delay , although it is believed that it is better to be delayed due to anemia . one participant said , my kids drink water while eating a meal regularly . they , then , drink buttermilk and coca - cola , a habit they have learned from their dad . we used to drink delester with all meals , even fried eggs . my husband and i became too fat , so we decided to reduce the amount of delester . the main objective of this study was to identify nutritional behavior through group discussions as well as individual interviews to design and implement interventions to promote nutritional literacy . the collected data through interviews and discussion groups were divided into two main categories : representation of nutritional behavior based on consumption pattern and representation of nutritional behavior based on consumption methods . women s nutritional behaviors , in this study , revealed dietary patterns and consumption methods . nowadays , to evaluate the effect of diet on health , nutrition experts use a dietary patterns approach and add such analysis to other traditional analyses ( such as dishes , nutrients , and food groups ) in this regard ( 18 ) . encompassing nutritional behaviors of individuals , analysis ( based on dietary patterns ) can provide researchers with more information about nutritional etiology of diseases ( 19 ) . conceptually , the investigation of dietary patterns is closer to reality because people do not receive nutrients separately , and their varied diet includes different combinations of nutrients , which can interfere with each other or have a synergistic effect ( 20 ) . on the other hand , investigation and interpretation of foods and specific nutrients seem difficult because there is a strong relationship between different foods and nutrients . in the analysis of dietary patterns , this could be advantageous because dietary patterns are designed based on dietary habits ( 21 ) . besides , if nutritional interventions are designed and implemented based on changes in dietary patterns , they will be more complete and easier to implement ( 22 , 23 ) . dietary pattern analysis helps us to make dietary recommendations to patients because , in terms of translating words , they can better understand dietary patterns more than nutritional benefits . the healthy pattern is rich in vegetables , fruit , beans , whole grains , and fish ; western patterns contain a large amount of meat products , red meat , butter , full - fat dairy products , egg , and cereals ( 24 ) . thus far , only one study in the country ( tehran ) has been conducted in which common dietary patterns among female teachers were investigated ( 25 ) . the study employed factor analysis on the data obtained from ffq and identified three common dietary patterns : healthy dietary pattern contained plenty of fruit , vegetables ( especially leafy green vegetables and cabbage ) , tomatoes , poultry , tea , fruit juice , and whole grains ; in the western dietary pattern , refined grains , red meat , butter , meat products , full - fat dairy products , pizza , potato , hydrogenated vegetable oils , soft drinks , sweets and desserts were abundantly consumed , and vegetables and low - fat dairy products were scarcely consumed . traditional dietary patterns consisted of a considerable amount of refined grains , potato , whole grains , tea , hydrogenated vegetable oil , cereals , and red meat broth . findings of the current study shows that dietary behaviors of participants are mainly based on western patterns . high consumption of red meat , refined grains such as rice , high - calorie snacks and sweets , processed meat products as well as low consumption of fruits , vegetables , and whole grains has comprehensively formed the dietary pattern of participants . the similarity between western dietary patterns and our society is not surprising because , in our country , in terms of lifestyle , physical activity , and diet , fast changes are happening . urbanization and improving economic conditions are the main reasons for such changes ( 26 , 27 ) . previous studies in terms of western dietary patterns indicate changes in dietary patterns of people and being away from healthy dietary patterns and their relation with problems such as obesity ( 28 ) , attention deficit hyperactivity disorder ( 29 ) , and metabolic syndrome and its components as well as some inflammatory biomarkers ( 30 , 31 ) . research has indicated that observing dietary patterns are a valid method for evaluating the relation of nutrition and diseases , and dietary patterns resulting from statistical methods have a significant relationship with diseases . however , some researchers believe that , in dietary patterns analysis , dietary behaviors such as pattern , time , and number of meals and snacks should be considered ( 32 ) . yet , considering the limited information in terms of common dietary patterns in iran , on the one hand , and the high prevalence of noncommunicable diseases , on the other , dietary patterns might play a significant role in the increasing prevalence of these diseases . therefore , nutrition researchers are required to first identify these patterns and then investigate their relationship with common diseases in the country and , finally , design interventions to promote healthy eating behaviors based on the dietary pyramid . the harvard rebuilt dietary pyramid ( harvard health book ) is a comprehensive guide to design interventions to a healthy diet , which does not have the downsides of the usda pyramid . at the base of the pyramid , it is also advises low consumption of saturated fat , sweets , carbonated beverages , fast and fried foods , potato , and red meat ( 33 ) . adopting appropriate nutritional strategies such as through the healthy eating pyramid , which is used in this study , can help people s health promotion and the improvement of their nutritional behaviors . through deep understanding of women s nutritional behaviors and their perspectives on benefits , barriers , and appropriate ways of communication as well as their demands , the results of this qualitative study provides a solid foundation for development and designing interventions to nutritional literacy promotion based on their needs . because most participants want to learn healthy diet skills , the designed interventions to healthy nutritional behavior should be based on empowering women and providing facilitator factors of a healthy diet . also while designing , with a holistic perspective , individual and social aspects of healthy diet should be taken into account . moreover , within the framework of exchange theory , the benefits of healthy behavior should be increased and its barriers should be reduced so that the customer reaches his goal , which is to promote his nutritional behavior and nutritional literacy .

introductionhealth and behavior are closely related subjects because disease is typically rooted in individuals unhealthy behaviors and habits . this study aims to identify women s nutritional habits and behaviors in order to design interventions to promote nutritional literacy.methodsthis qualitative research is part of a mixed method ( quantitative - qualitative ) study , conducted based on content analysis . data were collected using semistructured interviews , group discussions , and in - depth interviews with married women , aged 1850 years , who were referred to four health care centers in sanandaj in 20132014.resultsnutritional habits and behaviors of participants were classified into two categories : representation of nutritional behavior based on consumption pattern and representation of nutritional behavior based on consumption method . for the former , eight consumption pattern subcategories were formed : meat , dairy , fast food , local foods , fruits and vegetables , soft drinks , and oils . the latter ( representation of nutritional behavior based on consumption method ) , included two subcategories : consumption method in line with health and consumption method inconsistent with health.conclusionresults of this qualitative study provide a solid foundation for development and designing interventions to nutritional literacy promotion based on needs . the designed intervention to healthy nutritional behavior should be based on empowering women and providing facilitator factors of a healthy diet . while designing this study , with a holistic perspective , individual and social aspects of a healthy diet should be taken into account .

hepatocellular carcinoma ( hcc ) is a malignant tumor with hepatocellular differentiation and one of the most common cancers in the world . this type of cancer is often diagnosed when the survival time is measured in months which leads to high death rates . in the meantime , recent advances in computer vision and digital microscopy have expanded cancer diagnosis by automatic classification on histopathological images in various type of cancers , including lung cancer , breast cancer , prostate cancer , and thyroid cancer . for the purpose of supporting histopathology diagnosis of hcc , nec corporation has developed an anatomical pathology diagnosis assisting system for automatic classification of hcc images . we then tried to enhance the system by developing an experimental system of feature measurement software for liver biopsy . the system provides pathologists the quantitative measurement of tissue morphology using a digital slide of hematoxylin and eosin ( h&e ) stained liver tissue specimen , as well as the hcc detection based on those measurement results . liver tissues are primarily constructed by liver cell called hepatocyte , stroma and sinusoid ( liver 's capillary ) . the morphological features of hepatocyte nuclei are mostly used as histopathological features in conventional hcc diagnosis . nevertheless , the other regions of tissue liver also has potential to provide crucial information for the analysis , such as morphological features based on the characteristics of hepatic trabecular , sinusoid , stroma structures , cytoplasm , and fat droplets for diagnosing hcc images . hepatocellular carcinoma images itself can be extracted from two kind of liver tissues ; surgically resected samples and biopsy resected samples . in surgical sample , the tissue is removed from the patient through operation by cutting the affected area . meanwhile , biopsy sample is removed using needles and often utilize computed tomography scan or ultrasound to help guide the surgeon to the right area . due to the extracting method , the area of extracted tissue in the surgical sample is large and clear while it is thin , torn and a lot of glass area in the biopsy samples . liver tissue types ; ( a ) , ( b ) , ( c ) , and ( d ) shows the examples of whole slide image ( wsi ) of surgical sample , region - of - interest ( roi ) of surgical sample , wsi of biopsy sample , and roi of biopsy sample respectively in this study , we are focusing on the classification process of hcc images in the system . earlier , an automatic classification of hcc images has been introduced by kiyuna et al . based on 13 types of nuclear and structural features , where each feature consists of 6 statistical distributions . the experiment was carried out on a set of histopathological images extracted from a collection of surgically resected samples . in order to improve the classification performance , we have developed methods to segment the liver tissue and quantify additional tissue features such as trabecular morphology and the changes of the tissue morphology . this is important since the characteristics of both tissue types may give different influence on the feature values extracted from the images . thus , by combining surgical and biopsy samples in the process , the system will be able to handle and classify hcc images with higher extent by facilitating the characteristics of biopsy samples in addition to the increment of the amount of training data . some experiments are set up to evaluate the proposed methods using support vector machine ( svm ) classifier . the evaluation results on the impact of the segmentation and the additional features and type of data in the hcc detection performance are reported in this paper . liver tissues are constructed by several components , such as sinusoids , lymphocytes , red blood cells , and hepatic trabecular . with regards to hcc diagnosis , features from certain components can be more crucial compared to the other . hepatocyte nuclei , major components of trabecular other than the cytoplasm , have been utilized as one of the main sources of features used by pathologist in hcc diagnosis . however , liver tissue does not consist of hepatocyte only , thus there are nuclei that belong to the other cells in the tissue . in addition , existed some components that are relatively looks similar with hepatocyte nuclei such as lymphocytes . both nuclei and lymphocytes have round shape and dark color compared to its surrounding in h&e stained image , although lymphocytes have smaller size . when employing image processing to analyze hcc , it is necessary to identify nuclei that belong to hepatocyte only in order to get a reliable hepatocyte nuclei features . to overcome this problem , we have developed several methods to segment the histological components , including sinusoids , fat droplets , stroma , hepatic cell cords ( trabecular ) , and nuclei . for example , by segmenting and extracting sinusoid regions , we can recognize hepatic cell cords and stroma regions . additionally , some features can only be derived when the histological components have been segmented first , such as the thickness of trabecular . from the developed methods , 6 masked images were generated for each region - of - interest ( roi ) images that is , ( 1 ) fat mask , ( 2 ) fiber mask , ( 3 ) glass mask , ( 4 ) nuclei mask , ( 5 ) red blood cell mask , and ( 6 ) sinusoid mask . figure 2 shows the example of a masked roi image along with its original image . unmasked ( a ) and masked ( b ) liver tissue . here , all area other than trabecular are masked in white color , hepatocyte nuclei in black color while cytoplasm are kept using the original color kiyuna et al . have introduced 13 nuclei and structural features where 6 statistical distributions were calculated for each features , which consisted of , 10 , 30 , 50 , 70 , 90 percentiles and standard deviation . the features are ( 1 ) area , ( 2 ) peripheral , ( 3 ) circularity , ( 4 ) length of long axis of elliptic fit , ( 5 ) length of short axis of elliptic fit , ( 6 ) ratio of short and long axis lengths , ( 7 ) texture angular second moment of grey level co - occurrence matrix ( glcm ) , ( 8) texture contrast of glcm , ( 9 ) texture homogeneity of glcm , ( 10 ) texture entropy of glcm , ( 11 ) contour complexity of cell , ( 12 ) nuclei density , and ( 13 ) trabecular thickness . however , we also extract the 13 features on hcc images that have been masked by the stroma segmentation first , such that those features are derived from hepatocytes only . therefore , we have two groups of nuclei features ; 78 nuclei features that are calculated from unmasked tissues and another 78 nuclei features that are calculated from masked tissues . in the previous study , kiyuna et al . introduced two features related to liver structure , which are nuclei density and trabecular thickness . to include some other characteristics of hepatocyte structure that are also used by pathologists in analyzing hcc image ishikawa et al . have developed techniques to quantify some morphological features for hepatic trabecular analysis related to hcc cases . for example , hepatocyte trabecular will get thicker and may become multilayer in the case of cancer . they are ( 1 ) nuclei - cytoplasm ratio , ( 2 ) nuclei density , ( 3 ) average number of layers , ( 4 ) , standard deviation of number of layers , ( 5 ) average of nuclei eccentricity , ( 6 ) standard deviation of nuclei eccentricity , ( 7 ) graph - based nuclei distance , ( 8) graph - based nuclei alignment , ( 9 ) sinusoid weighted sum of mutual angle distribution histogram ( wsma ) , and ( 10 ) trabecular wsma . in addition to trabecular features , we also extended the features by including 11 features of tissue changes . these are features related to the state of fat droplets , cytoplasm , and stroma . this group of features describes the characteristics of the tissue and not directly related to the cancer . nevertheless , the features will provide additional information to the nuclei and trabecular features for the classification . the features are ( 1 ) area ratio of fatty degeneration , ( 2 ) number of fat droplets , ( 3 ) average value of fat droplet area , ( 4 ) standard deviation of fat droplet area , ( 5 ) red color of cytoplasm , ( 6 ) green color of cytoplasm , ( 7 ) blue color of cytoplasm , ( 8) average value of clearness index , ( 9 ) standard deviation of clearness index , ( 10 ) area ratio of stroma , and ( 11 ) structural feature of stroma . more details on these features can be referred to the works by ishikawa et al . and the experiments were performed on a collection of histopathology images supplied by the department of pathology at keio university , japan . the images consisted of 147 and 116 h&e stained whole slide images ( wsi ) of surgical and biopsy resected samples respectively . the surgical samples were collected from 111 patients ( varying from 1 to 16 samples per patient ) while the biopsy samples were collected from 108 patients ( 1 or 2 samples per patient ) . from the surgical samples , 1076 roi images were extracted as 2048 2048 pixels of tiff images ( 2 - 11 images per slide ) , where 543 of the images were hcc positive . as for the biopsy samples , 1054 roi images having the same size and image type were extracted ( 1 - 27 images per slide ) , where 550 images were hcc positive . all slide images were captured using the nanozoomer 2.0ht slide scanner ( hamamatsu photonics k.k . , hamamatsu , japan ) at 20 ( equivalent to 0.46 m / pixel ) as nanozoomer digital pathology image ( before being converted to tiff images ) , and had been labeled by experienced pathologists at the department . additionally , the pathologist had also graded the hcc positive cases from the surgical samples based on edmondson and steiner grading system ( egs ) that is , well differentiated ( g1 ) , moderately differentiated ( g2 ) , poorly differentiated ( g3 ) , and undifferentiated ( g4 ) . to reduce the color variation due to the staining process , color correction processes introduced by murakami et al . we used svm for the classification with radial basis function as the kernel type and libsvm as the library . five - fold cross validation was used in order to evaluate the classification performance . when partitioning the roi images , we kept rois from the same slide on the same group in order to avoid rois from the same slide being divided into both training and test data . in the process , we made some combinations on the sets of training data from both biopsy and surgery samples . to evaluate the new features , we also did the experiments on several sets of features . . 78 unmasked nuclei features78 masked nuclei features10 trabecular features11 tissue changes features . 78 unmasked nuclei features 78 masked nuclei features 10 trabecular features 11 tissue changes features . to see the effect of masking , we did experiments on the 78 unmasked nuclei features and 78 masked nuclei features so that we could compare the rates of each classification . we then combined the masked nuclei features with 10 trabecular and 11 tissue changes features to evaluate the effect of the new features . note that since the 10 trabecular features are more comprehensive in representing the liver structural characteristics , we removed the trabecular thickness liver tissues are constructed by several components , such as sinusoids , lymphocytes , red blood cells , and hepatic trabecular . with regards to hcc diagnosis , features from certain components can be more crucial compared to the other . hepatocyte nuclei , major components of trabecular other than the cytoplasm , have been utilized as one of the main sources of features used by pathologist in hcc diagnosis . however , liver tissue does not consist of hepatocyte only , thus there are nuclei that belong to the other cells in the tissue . in addition , existed some components that are relatively looks similar with hepatocyte nuclei such as lymphocytes . both nuclei and lymphocytes have round shape and dark color compared to its surrounding in h&e stained image , although lymphocytes have smaller size . when employing image processing to analyze hcc , it is necessary to identify nuclei that belong to hepatocyte only in order to get a reliable hepatocyte nuclei features . to overcome this problem , we have developed several methods to segment the histological components , including sinusoids , fat droplets , stroma , hepatic cell cords ( trabecular ) , and nuclei . for example , by segmenting and extracting sinusoid regions , we can recognize hepatic cell cords and stroma regions . additionally , some features can only be derived when the histological components have been segmented first , such as the thickness of trabecular . from the developed methods , 6 masked images were generated for each region - of - interest ( roi ) images that is , ( 1 ) fat mask , ( 2 ) fiber mask , ( 3 ) glass mask , ( 4 ) nuclei mask , ( 5 ) red blood cell mask , and ( 6 ) sinusoid mask . figure 2 shows the example of a masked roi image along with its original image . unmasked ( a ) and masked ( b ) liver tissue . here , all area other than trabecular are masked in white color , hepatocyte nuclei in black color while cytoplasm are kept using the original color kiyuna et al . have introduced 13 nuclei and structural features where 6 statistical distributions were calculated for each features , which consisted of , 10 , 30 , 50 , 70 , 90 percentiles and standard deviation . the features are ( 1 ) area , ( 2 ) peripheral , ( 3 ) circularity , ( 4 ) length of long axis of elliptic fit , ( 5 ) length of short axis of elliptic fit , ( 6 ) ratio of short and long axis lengths , ( 7 ) texture angular second moment of grey level co - occurrence matrix ( glcm ) , ( 8) texture contrast of glcm , ( 9 ) texture homogeneity of glcm , ( 10 ) texture entropy of glcm , ( 11 ) contour complexity of cell , ( 12 ) nuclei density , and ( 13 ) trabecular thickness . however , we also extract the 13 features on hcc images that have been masked by the stroma segmentation first , such that those features are derived from hepatocytes only . therefore , we have two groups of nuclei features ; 78 nuclei features that are calculated from unmasked tissues and another 78 nuclei features that are calculated from masked tissues . in the previous study , kiyuna et al . introduced two features related to liver structure , which are nuclei density and trabecular thickness . to include some other characteristics of hepatocyte structure that are also used by pathologists in analyzing hcc image ishikawa et al . have developed techniques to quantify some morphological features for hepatic trabecular analysis related to hcc cases . for example , hepatocyte trabecular will get thicker and may become multilayer in the case of cancer . they are ( 1 ) nuclei - cytoplasm ratio , ( 2 ) nuclei density , ( 3 ) average number of layers , ( 4 ) , standard deviation of number of layers , ( 5 ) average of nuclei eccentricity , ( 6 ) standard deviation of nuclei eccentricity , ( 7 ) graph - based nuclei distance , ( 8) graph - based nuclei alignment , ( 9 ) sinusoid weighted sum of mutual angle distribution histogram ( wsma ) , and ( 10 ) trabecular wsma . in addition to trabecular features , we also extended the features by including 11 features of tissue changes . these are features related to the state of fat droplets , cytoplasm , and stroma . this group of features describes the characteristics of the tissue and not directly related to the cancer . nevertheless , the features will provide additional information to the nuclei and trabecular features for the classification . the features are ( 1 ) area ratio of fatty degeneration , ( 2 ) number of fat droplets , ( 3 ) average value of fat droplet area , ( 4 ) standard deviation of fat droplet area , ( 5 ) red color of cytoplasm , ( 6 ) green color of cytoplasm , ( 7 ) blue color of cytoplasm , ( 8) average value of clearness index , ( 9 ) standard deviation of clearness index , ( 10 ) area ratio of stroma , and ( 11 ) structural feature of stroma . more details on these features can be referred to the works by ishikawa et al . and kiyuna et al . have introduced 13 nuclei and structural features where 6 statistical distributions were calculated for each features , which consisted of , 10 , 30 , 50 , 70 , 90 percentiles and standard deviation . the features are ( 1 ) area , ( 2 ) peripheral , ( 3 ) circularity , ( 4 ) length of long axis of elliptic fit , ( 5 ) length of short axis of elliptic fit , ( 6 ) ratio of short and long axis lengths , ( 7 ) texture angular second moment of grey level co - occurrence matrix ( glcm ) , ( 8) texture contrast of glcm , ( 9 ) texture homogeneity of glcm , ( 10 ) texture entropy of glcm , ( 11 ) contour complexity of cell , ( 12 ) nuclei density , and ( 13 ) trabecular thickness . however , we also extract the 13 features on hcc images that have been masked by the stroma segmentation first , such that those features are derived from hepatocytes only . therefore , we have two groups of nuclei features ; 78 nuclei features that are calculated from unmasked tissues and another 78 nuclei features that are calculated from masked tissues . in the previous study , kiyuna et al . introduced two features related to liver structure , which are nuclei density and trabecular thickness . to include some other characteristics of hepatocyte structure that are also used by pathologists in analyzing hcc image ishikawa et al . have developed techniques to quantify some morphological features for hepatic trabecular analysis related to hcc cases . for example , hepatocyte trabecular will get thicker and may become multilayer in the case of cancer . they are ( 1 ) nuclei - cytoplasm ratio , ( 2 ) nuclei density , ( 3 ) average number of layers , ( 4 ) , standard deviation of number of layers , ( 5 ) average of nuclei eccentricity , ( 6 ) standard deviation of nuclei eccentricity , ( 7 ) graph - based nuclei distance , ( 8) graph - based nuclei alignment , ( 9 ) sinusoid weighted sum of mutual angle distribution histogram ( wsma ) , and ( 10 ) trabecular wsma . in addition to trabecular features , we also extended the features by including 11 features of tissue changes . these are features related to the state of fat droplets , cytoplasm , and stroma . this group of features describes the characteristics of the tissue and not directly related to the cancer . nevertheless , the features will provide additional information to the nuclei and trabecular features for the classification . the features are ( 1 ) area ratio of fatty degeneration , ( 2 ) number of fat droplets , ( 3 ) average value of fat droplet area , ( 4 ) standard deviation of fat droplet area , ( 5 ) red color of cytoplasm , ( 6 ) green color of cytoplasm , ( 7 ) blue color of cytoplasm , ( 8) average value of clearness index , ( 9 ) standard deviation of clearness index , ( 10 ) area ratio of stroma , and ( 11 ) structural feature of stroma . more details on these features can be referred to the works by ishikawa et al . and murakami et al . the experiments were performed on a collection of histopathology images supplied by the department of pathology at keio university , japan . the images consisted of 147 and 116 h&e stained whole slide images ( wsi ) of surgical and biopsy resected samples respectively . the surgical samples were collected from 111 patients ( varying from 1 to 16 samples per patient ) while the biopsy samples were collected from 108 patients ( 1 or 2 samples per patient ) . from the surgical samples , 1076 roi images were extracted as 2048 2048 pixels of tiff images ( 2 - 11 images per slide ) , where 543 of the images were hcc positive . as for the biopsy samples , 1054 roi images having the same size and image type were extracted ( 1 - 27 images per slide ) , where 550 images were hcc positive . all slide images were captured using the nanozoomer 2.0ht slide scanner ( hamamatsu photonics k.k . , hamamatsu , japan ) at 20 ( equivalent to 0.46 m / pixel ) as nanozoomer digital pathology image ( before being converted to tiff images ) , and had been labeled by experienced pathologists at the department . additionally , the pathologist had also graded the hcc positive cases from the surgical samples based on edmondson and steiner grading system ( egs ) that is , well differentiated ( g1 ) , moderately differentiated ( g2 ) , poorly differentiated ( g3 ) , and undifferentiated ( g4 ) . to reduce the color variation due to the staining process , color correction processes introduced by murakami et al . we used svm for the classification with radial basis function as the kernel type and libsvm as the library . when partitioning the roi images , we kept rois from the same slide on the same group in order to avoid rois from the same slide being divided into both training and test data . in the process , we made some combinations on the sets of training data from both biopsy and surgery samples . to evaluate the new features , we also did the experiments on several sets of features . . 78 unmasked nuclei features78 masked nuclei features10 trabecular features11 tissue changes features . 78 unmasked nuclei features 78 masked nuclei features 10 trabecular features 11 tissue changes features . to see the effect of masking , we did experiments on the 78 unmasked nuclei features and 78 masked nuclei features so that we could compare the rates of each classification . we then combined the masked nuclei features with 10 trabecular and 11 tissue changes features to evaluate the effect of the new features . note that since the 10 trabecular features are more comprehensive in representing the liver structural characteristics , we removed the the experiments were performed on a collection of histopathology images supplied by the department of pathology at keio university , japan . the images consisted of 147 and 116 h&e stained whole slide images ( wsi ) of surgical and biopsy resected samples respectively . the surgical samples were collected from 111 patients ( varying from 1 to 16 samples per patient ) while the biopsy samples were collected from 108 patients ( 1 or 2 samples per patient ) . from the surgical samples , 1076 roi images were extracted as 2048 2048 pixels of tiff images ( 2 - 11 images per slide ) , where 543 of the images were hcc positive . as for the biopsy samples , 1054 roi images having the same size and image type were extracted ( 1 - 27 images per slide ) , where 550 images were hcc positive . all slide images were captured using the nanozoomer 2.0ht slide scanner ( hamamatsu photonics k.k . , hamamatsu , japan ) at 20 ( equivalent to 0.46 m / pixel ) as nanozoomer digital pathology image ( before being converted to tiff images ) , and had been labeled by experienced pathologists at the department . additionally , the pathologist had also graded the hcc positive cases from the surgical samples based on edmondson and steiner grading system ( egs ) that is , well differentiated ( g1 ) , moderately differentiated ( g2 ) , poorly differentiated ( g3 ) , and undifferentiated ( g4 ) . to reduce the color variation due to the staining process , color correction processes introduced by murakami et al . we used svm for the classification with radial basis function as the kernel type and libsvm as the library . five - fold cross validation was used in order to evaluate the classification performance . when partitioning the roi images , we kept rois from the same slide on the same group in order to avoid rois from the same slide being divided into both training and test data . in the process , we made some combinations on the sets of training data from both biopsy and surgery samples . to evaluate the new features , we also did the experiments on several sets of features . as described in section 2.2 , we have 4 groups of features as follow . 78 unmasked nuclei features78 masked nuclei features10 trabecular features11 tissue changes features . 78 unmasked nuclei features 78 masked nuclei features 10 trabecular features 11 tissue changes features . to see the effect of masking , we did experiments on the 78 unmasked nuclei features and 78 masked nuclei features so that we could compare the rates of each classification . we then combined the masked nuclei features with 10 trabecular and 11 tissue changes features to evaluate the effect of the new features . note that since the 10 trabecular features are more comprehensive in representing the liver structural characteristics , we removed the it shows that combinations of the new features with the nuclei and structural features can improve the accuracy for about 13% depending on the type of training and test data . for example , in biopsy samples , the sensitivity is improved from 84.7% to 88.2% while the specificity is unchanged ( 91.9% ) . figure 3(a ) shows the receiver operating characteristics ( roc ) curves when biopsy samples having different set of features are used as the test data along with their sensitivity values when specificity is 90% . the area under curves ( auc ) values are 0.941 , 0.940 , 0.940 , and 0.960 in the case of b0 , b1 , b2 , and b3 respectively . on the other hand , figure 3(b ) shows the roc curves in the case of surgical samples , having auc values 0.957 , 0.955 , 0.951 , and 0.968 in s0 , s1 , s2 , and s3 respectively . receiver operating characteristics curves for hepatocellular carcinoma classification on ( a ) experiment b1 , b2 , b3 , and ( b ) experiment s1 , s2 , s3 table 2 shows the comparison between the true positive rates on hcc grades between the method by kiyuna et al . with the proposed method in surgical samples . here , we remove roi images having 2 or more grades detected in an image for the comparison and only use images that are labeled to one of the grades in egs . from the table , we can see that the detection rate for the well - differentiated tumors has the highest improvement that is , from 65.0% to 77.5% , by the addition of new features . this is because the nuclei shapes in the case of well - differentiated tumors are similar with normal liver , yet there are deformations in the arrangement of cell pattern . therefore , appending the new features to the classification process can expand the difference between the normal tissues and the tissues having low - grade cancer . as the state of cancer is getting worst , the sinusoid areas become disappear and thus the sinusoid segmentations for undifferentiated tumors are sometimes inaccurate . moreover , the lack of samples in this grade may also contribute to the misclassification . further works are required to investigate the grade using more training data and to improve the sinusoid segmentation . the combination of nuclear , trabecular and other tissue features enables improved classification rate in hcc detection using svm . furthermore , the masking process on the nuclei features facilitates the reliability of the nuclei features since falsely detected nuclei are removed from the quantification . the proposed method improves the chance of early hcc detection , which is very important and has been one of the main challenges in the area , and thus it is recommended by the pathologists . the hcc classification scheme introduced in this paper is implemented in the prototype feature measurement software for liver biopsy , and the probability of hcc is visualized for every roi in the wsi . it will support pathologists in the hcc diagnosis along with the quantitative measurements of tissue morphology .

background : recent breakthroughs in computer vision and digital microscopy have prompted the application of such technologies in cancer diagnosis , especially in histopathological image analysis . earlier , an attempt to classify hepatocellular carcinoma images based on nuclear and structural features has been carried out on a set of surgical resected samples . here , we proposed methods to enhance the process and improve the classification performance.methods:first , we segmented the histological components of the liver tissues and generated several masked images . by utilizing the masked images , some set of new features were introduced , producing three sets of features consisting nuclei , trabecular and tissue changes features . furthermore , we extended the classification process by using biopsy resected samples in addition to the surgical samples.results:experiments by using support vector machine ( svm ) classifier with combinations of features and sample types showed that the proposed methods improve the classification rate in hcc detection for about 1 - 3% . moreover , detection rate of low - grades cancer increased when the new features were appended in the classification process , although the rate was worsen in the case of undifferentiated tumors.conclusions:the masking process increased the reliability of extracted nuclei features . the additional of new features improved the system especially for early hcc detection . likewise , the combination of surgical and biopsy samples as training data could also improve the classification rates . therefore , the methods will extend the support for pathologists in the hcc diagnosis .