text
stringlengths 7
4.92M
|
|---|
Glen Milton Storr
Dr Glen Milton Storr (22 December 1921 – 26 June 1990) was an Australian ornithologist and herpetologist. He joined the Western Australian Museum in 1962 and became Curator of Ornithology and Herpetology in 1965. He was a member of the Royal Australasian Ornithologists Union (RAOU), and served as Secretary of the Western Australian Branch of the RAOU in 1954.
Storr produced his postgraduate research on kangaroos. His tenure as curator at the WA museum ended in 1986.
Legacy
Storr was one of the most prolific alpha-taxonomists in herpetology, i.e. he described 232 species and subspecies of reptiles, which places him in the top-10 of all-time world-wide. He is commemorated in the scientific names of five species of reptiles: Carlia storri, Ctenotus storri, Lerista storri, Morethia storri, and Varanus storri.
References
External links
Category:1921 births
Category:1990 deaths
Category:Australian ornithologists
Category:Scientists from Western Australia
Category:20th-century zoologists |
Co-Anchor 2: Wow! That's sure a lot of ways to act out our faith. Now let's hear what our WCUU NUUs Analyst has to say about all this.
NUUs Analyst: Thank you, co-anchors. This is your NUUs Analyst with a comment on what you have just seen. Today's Big Question asks, "What are we?" UUs say, very logically that they are Unitarian Universalists. What are they? UUs are people who believe they should put their faith into action. In other words, it's not enough simply to believe something. You need to let your beliefs shape how you live your life. UUs have many different ideas about the big questions and their answers. But UUs do agree about some very important ideas. They agree on the UU Principles. They agree about the Golden Rule. They agree that wisdom can be found in many Sources. And they agree that we should focus on making our world a better place for everyone to live.
[Director: Cue the theme music.]
[Director: Cue the station break.]
Co-Anchor 1: This is [your real or stage name] signing off for WCUU.
Co-Anchor 2: That is W-C-U-U for Wisdom of the Community of Unitarian Universalists. And this is [your real or stage name] signing off, too. |
1. Introduction {#sec1-genes-07-00083}
===============
Colorectal cancer (CRC) is one of the most common cancers worldwide \[[@B1-genes-07-00083]\], which represents the second leading cause of cancer-related death in the Western countries \[[@B2-genes-07-00083]\]. Although great advancements in early diagnosis and treatment of CRC have been made, incidence and mortality remain high \[[@B3-genes-07-00083],[@B4-genes-07-00083]\]. Therefore, it is very urgent to find an effective therapy to fight this lethal disease. It is reported that several signal pathways contribute to and influence the initiation and progression of CRC, and molecular target agents including epigenetic target agents may be an underlying novel therapeutic strategy for acquiring profiles on survival of CRC patients.
Enhancer of zeste homologue 2 gene (EZH2), a core component of the human polycomb repressive complex 2 (PRC2), is deemed to tri-methylate histone H3 at lysine 27 and elicit gene silencing \[[@B5-genes-07-00083]\]. Increasing evidence indicates that EZH2 is associated with a number of cancers, including nasopharyngeal esophageal cancer, breast cancer, lung cancer and bladder cancer \[[@B6-genes-07-00083],[@B7-genes-07-00083],[@B8-genes-07-00083],[@B9-genes-07-00083]\]. Moreover, overexpression of EZH2 indicates the tumor more aggressive and is related to poor prognosis \[[@B10-genes-07-00083],[@B11-genes-07-00083],[@B12-genes-07-00083]\]. In our previous immunohistochemical research, we found that expression of the EZH2 was significantly higher in tumor tissues than the paired normal tissues, and EZH2 might facilitate tumorigenesis in CRC cells \[[@B13-genes-07-00083]\]. Therefore, EZH2 represents a promising potential target for combating CRC. It has been recognized that apoptosis and autophagy of tumor cells is crucial in tumorigenesis and progression of cancer, however, the exact role EZH2 plays in apoptosis and autophagy has not been fully elucidated in CRC.
In this study, we further investigated the effect of downregulation of EZH2 on CRC cells. We transfected EZH2-short hairpin RNA (shRNA) into CRC cell lines and used an EZH2 inhibitor 3-Deazaneplanocin A (DZNep), to examine the potential involvement of autophagy and apoptosis. We further explored influence on cell cycle after downregulation of EZH2. Our outcome in this study indicates that blocking expression of EZH2 would be an ideal strategy for combating colorectal cancer. Thus, more research should be done to get a better understanding of epigenetic mechanisms and the influence of EZH2 targeted agents on potential survival benefit in CRC patients. This may promote a novel clinical strategy for CRC treatment.
2. Materials and Methods {#sec2-genes-07-00083}
========================
2.1. Cell Lines and DZNep {#sec2dot1-genes-07-00083}
-------------------------
The human CRC cell lines (RKO, HCT116, SW480 and CCL224) were purchased from the Chinese Academy of Sciences (Shanghai, China) and cultured in the six-well dishes at the concentration of 1.5 × 10^5^/well as per the instructions of ATCC. All four cell lines were maintained in RPMI-1640 (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; Sijiqing Biological Engineering Materials Co., Hangzhou, China) at 37 °C with 5% CO~2~. DZNep, an EZH2 inhibitor, was purchased from sigma-Aldrich (SML0305, Sigma, St. Louis, MO, USA), and it was dissolved in water. The solution is stored in −20 °C with the concentration of 5 mg/mL. The RKO and HCT116 cells were treated with DZNep 24 h after culturing. After another 72 h, the total protein and RNA were extracted.
2.2. Construction of shRNA and Cell Transfection {#sec2dot2-genes-07-00083}
------------------------------------------------
shRNA sequences were synthesized by GENE CHEM (Shanghai, China). According to the EZH2 mRNA sequence in GenBank, three 19bp targeting sequences were designed. The relevant shRNA template oligonucleotide sequences are shown in [Table 1](#genes-07-00083-t001){ref-type="table"}. They were all confirmed by DNA sequencing. After plasmid transfection, LV‑EZH2-shRNA was harvested. The lentivirus was titrated to 1 × 10^9^ TU/mL. RKO and HCT116 cells were cultured at the concentration of 5 × 10^4^/well in a six-well dish for 24 h, then we added lentivirus and polybrene to the culture medium according to multiplicity of infection (MOI). We changed the medium 16 h after transfection, and the subsequent experiments were performed 72 h later.
2.3. Quantitative Real-Time Reverse Transcription PCR (QRT-PCR) {#sec2dot3-genes-07-00083}
---------------------------------------------------------------
We performed QRT-PCR to further investigate the mRNA expression of EZH2 in RKO and HCT116 cells. Total RNA was extracted using TRIzol (Invitrogen, Life Technologies, Carlsbad, CA, USA) and 5 μg of RNA was used to synthesize cDNA according to the manufacturer′s instructions. The PCR conditions consisted of 5 min at 95 °C 1 cycle，30 s at 95 °C，30 s at 55 °C，30 s at 72 °C and 7 min at 72 °C 40 cycles. The sequences for sense (S) and antisense (AS) primers are as follows: EZH2: GTACACGGGGATAGAGAATGTGG (S), GGTGGGCGGCTTTCTTTATCA (AS); GAPDH: TGACTTCAACAGCGACACCCA (S), CACCCTGTTGCTGTAGCCAAA (AS). Every experiment was performed three times and the samples were tested in triplicate. The relative fold changes in mRNA expression were calculated using the 2^--ΔΔCT^ method, where the average of ΔCT values for the amplicon of interest was normalized to that of GAPDH, and compared with the control specimens.
2.4. Western Blot {#sec2dot4-genes-07-00083}
-----------------
The whole proteins were extracted from RKO and HCT116 cells, and then they were lysed with RIPA (Beyotime Inc., NanTong, China) according to the manufacture′s protocol. The supernatants were collected after centrifugation at 16,000 r/min for 15 min at 4 °C. 40 μg of the protein was separated from each sample preparation using the SDS-PAGE and then transferred onto polyvinylidene difluoride (PVDF) membranes. Afterwards, the membranes were blocked and incubated respectively with rabbit anti-human EZH2 antibody (1:1000, CST, Boston, MA, USA), rabbit anti-human LC3A antibody (1:1000, CST), rabbit anti-human Ambra1 antibody (1:1000, Abcam) at 4 °C overnight. The membranes were subsequently washed three times with the TBST for 10 min and incubated with secondary anti-body (1:1000, Santa Cruz, CA, USA) at 37 °C for 1 h. Following this, the membranes were washed three times with Tris-buffered saline with Tween (TBST). Bands were finally visualized by using an ECL + Plus^TM^ Western blot system kit (Amersham, GE Healthcare, Chicago, IL, USA). All Western blots shown were representative results obtained from at least three independent experiments.
2.5. Cell Proliferation Assay {#sec2dot5-genes-07-00083}
-----------------------------
At a logarithmic phase, RKO and HCT116 cells were divided into three groups (untreated, control-shRNA, EZH2-shRNA). In the medical experiment, the CRC cells were divided into two groups (untreated, DZNep). At 6 h after transfection, RKO and HCT116 cells were digested, re-suspended, and inoculated into 96-well dishes. After 24, 48, and 72 h of incubation, cells were stained with 20 μL 3-(4, 5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide Methylthiazolyl tetrazolium (MTT) solution (5 mg/mL) at 37 °C for 4 h. Then supernatants were removed and formazan crystals were dissolved in 150 μL dimethyl sulfoxide (DMSO). The reaction product was quantified by measuring the optical density using test wavelength for 490 nm at room temperature. Every experiment was performed three times and the samples were tested in triplicate.
2.6. Cell Migration Assay {#sec2dot6-genes-07-00083}
-------------------------
Cell migration assays were performed using a transwell permeable supports system (Corning, New York, NY, USA). RKO and HCT116 cells that were under different treatments were incubated in medium. After 24 h of transfection, 2 × 10^4^/well RKO and HCT116 cells were resuspended in serum-free DMEM medium and seeded into the Transwell inserts uncoated with growth factor-reduced Matrigel (BD Biosciences, Bedford, MA, USA), whereas each lower chamber was filled with 500 μL complete culture mediun. After 24 h of incubation at 37 °C, the cells on the upper side of the insert filter were completely removed by wiping with a cotton swab, and the cells that had invaded were fixed in methanol and stained with 0.1% crystal violet. The cells were counted manually under an inverted microscope on five random fields (scale bar = 200 μm). Every experiment was performed three times.
2.7. Cell Apoptosis Analysis {#sec2dot7-genes-07-00083}
----------------------------
Cell apoptosis assays were detected by Annexin V-PI staining. Cells receiving different treatments were trypsinized with 0.25% trypsin in the absence of EDTA. The collection was washed with sufficient PBS twice and resuspended in 500 μL of binding buffer at a concentration of 0.2--1.0 × 10^6^ cells/mL. The samples were then double stained with 5 μL Annexin V and 5 μL PI at room temperature for 15 min in darkness. The samples were subsequently analyzed using a flow cytometer. Every experiment was performed three times.
2.8. Cell Cycle Analysis {#sec2dot8-genes-07-00083}
------------------------
The RKO and HCT116 cells that were transfected with control-shRNA or EZH2-shRNA or added DZNep were harvested after 5 days, when covered about 80%. The cells were digested with trypsin enzyme, and then the suspension was washed with D-Hanks and fixed with 75% ethanol on ice for 2 h. The cells were centrifuged at 1300 r/min for 5 min, and then washed with D-Hanks twice. PI (50 μg/mL) and 500 μL of Rnase (100 μg/mL) were added, and then cells were incubated in darkness at 4 °C for 15 min followed by analysis on a fluorescence activated cell sorting (FACS) can apparatus. Every experiment was performed three times.
2.9. Statistical Analysis {#sec2dot9-genes-07-00083}
-------------------------
The SPSS17.0 software (SPSS Inc., Chicago, IL, USA) was used for data analysis. The data were presented as the mean ± standard deviation (SD). Significant differences between groups were compared using the *t*-test. *p* \< 0.05 was considered statistically significant.
3. Results {#sec3-genes-07-00083}
==========
3.1. EZH2 Is Over-Expressed in CRC Cells {#sec3dot1-genes-07-00083}
----------------------------------------
We recently reported that EZH2 is highly expressed in human CRC tissues by Immunohistochemical (IHC) staining. However, EZH2 was absent or weakly expressed in the paired non-tumor tissues. In order to confirm the protein and mRNA expression of EZH2 in CRC cell lines (RKO, HCT116, SW480, and CCL224), we first performed Western blot and QRT-PCR in the present study. The results showed that all the four cell lines expressed relatively high level of EZH2 and RKO and HCT116 cells showed the relative elevation among them, which were used for further studies ([Figure 1](#genes-07-00083-f001){ref-type="fig"}).
3.2. EZH2-shRNA and DZNep Inhibited the Expression of EZH2 mRNA and Protein in RKO and HCT116 Cells {#sec3dot2-genes-07-00083}
---------------------------------------------------------------------------------------------------
Next, we examined the infection efficiency of EZH2-shRNA lentiviral vector plasmid on CRC cells by treating cells with 0.1 μL, 1 μL or 10 μL lentivirus for transfection. After 72 h, the fluorescence intensities were observed under fluorescence microscope ([Figure 2](#genes-07-00083-f002){ref-type="fig"}a), and then 0.5 μL was selected for further study. To test if EZH2 can be targeted by siRNA, three shRNA constructs (sh\#1, sh\#2 and sh\#3) were designed to act on different regions of the EZH2 mRNA sequence ([Table 1](#genes-07-00083-t001){ref-type="table"}). RKO and HCT116 cells were transfected with control-shRNA or EZH2-shRNA. As presented in [Figure 2](#genes-07-00083-f002){ref-type="fig"}a,b, sh\#2 showed highest deletion among them. Afterwards, we explored the impact of shRNAs on silencing EZH2 expression in RKO and HCT116 cells. At 72 h after transfection with sh\#2, the total protein and mRNA of all transfected and un-transfected cells were extracted and analyzed by Western blot and QRT-PCR. As shown in [Figure 3](#genes-07-00083-f003){ref-type="fig"}a--d, EZH2 expression was distinctly decreased at mRNA and protein levels in transfected cells with EZH2-shRNA compared with control-shRNA. Thus, the results showed that the specific shRNA to EZH2 effectively suppressed the expression of EZH2 in RKO and HCT116 cells. In addition, DZNep, an EZH2 inhibitor, was performed in CRC cell lines for 72 h at the concentration of 1 or 3 μmol/L. Moreover, the protein expression of EZH2 in RKO and HCT116 clearly decreased.
3.3. Effects of EZH2 Downregulation on the Growth and Migration of RKO and HCT116 Cells {#sec3dot3-genes-07-00083}
---------------------------------------------------------------------------------------
We further performed MTT assays to explore the influence of EZH2-shRNA on CRC cell proliferation at the time points of 24, 48, and 72 h of transfection. The results revealed that the EZH2‑shRNA group exhibited a markedly reduced proliferation rate compared with the control-shRNA and untreated groups (*p* \< 0.05, [Figure 4](#genes-07-00083-f004){ref-type="fig"}a--d). That is to say, downregulation of EZH2 inhibits cell proliferation in CRC cells. To further examine whether knockdown of EZH2 suppresses migration ability of RKO and HCT116 cells, we performed cell migration assays using transwell cell culture inserts. EZH2-shRNA or DZNep decreased the proliferation of RKO and HCT116 cells. Therefore, to rule out the possibility that the fewer number of viable cells with transmembrane in the EZH2-shRNA group was a result of EZH2's suppressive effect on cell proliferation, we detected the ability of migration by transwell assay after cells were transfected with EZH2-shRNA or not, or treated with DZNep or not. Images were captured after 24 h ([Figure 4](#genes-07-00083-f004){ref-type="fig"}e,g). The results from cell migration assay showed that the migration cell number of the EZH2-shRNA transfected group was significantly lower than that of untreated and control-shRNA groups (*p* \< 0.05, [Figure 4](#genes-07-00083-f004){ref-type="fig"}f). The cells treated with DZNep had a similar outcome (*p* \< 0.05, [Figure 4](#genes-07-00083-f004){ref-type="fig"}h). Collectively, these results suggested that the downregulation of EZH2 or addition of DZNep significantly inhibits the migratory capability of RKO and HCT116 cells.
3.4. Downregulation of EZH2 Induced Autophagy in RKO and HCT116 Cells {#sec3dot4-genes-07-00083}
---------------------------------------------------------------------
To analyze the impact of EZH2 on autophagy, RKO and HCT116 cells were treated with EZH2-shRNA. It is well known that the autophagy is determined by the level of LC3. LC3-I is located in the cytoplasm, when it conjugates to phosphatidylethanolamine, it transforms to LC3-II and recruits to autophagosomal membranes. LC3-II is a widely used marker to monitor autophagy. As presented in [Figure 5](#genes-07-00083-f005){ref-type="fig"}a,b, we found that compared with control group, knockdown of EZH2 increased the expression of LC3-II significantly. Moreover, the results of adding DZNep showed a similar trend. Moreover, levels of another autophagy-related gene-related protein Ambra1 increased. Taken together, our data suggested that depletion of EZH2 by specific shRNA or relative chemical inhibitor-induced autophagy in RKO and HCT116 cells.
3.5. Downregulation of EZH2 Induced Apoptosis in RKO and HCT116 Cells {#sec3dot5-genes-07-00083}
---------------------------------------------------------------------
We further performed experiments to evaluate whether depletion of EZH2 by specific shRNA or adding exogenous DZNep affected the apoptosis of RKO and HCT116 cells. As shown in [Figure 6](#genes-07-00083-f006){ref-type="fig"}, apoptosis rates in EZH2-shRNA group significantly increased when compared with the control-shRNA and untreated groups (*p* \< 0.01). After transfection, the apoptosis rate (early and late apoptotic cells) of RKO and HCT116 cells was 16.0% and 15.1% for the EZH2-shRNA group, which was significantly higher than that of the control-shRNA group (4.6% and 5.3%) or untreated group (3.8% and 2.5% respectively). DZNep could exert a similar effect on inducing apoptosis ([Figure 6](#genes-07-00083-f006){ref-type="fig"}c,d). Thus, these results suggested that depletion of EZH2 by specific shRNA or decrease of the expression of EZH2 by DZNep induced apoptosis in RKO and HCT116 cells.
3.6. Downregulation of EZH2 Induced Cell Cycle Arrest in RKO and HCT116 Cells {#sec3dot6-genes-07-00083}
-----------------------------------------------------------------------------
To investigate the effect of downregulation of EZH2 on the cell cycle of RKO and HCT116 cells, we used flow cytometry to monitor the percentage of cells that contained DNA at a relative level. As shown in [Figure 7](#genes-07-00083-f007){ref-type="fig"}, after the treatment with shRNA, the percentage of RKO and HCT116 cells in G1 phase in the EZH2-shRNA group was significantly higher than in the control group, as with DZNep. Meanwhile, the percentage of cells in S and G2 phase is decreased. That is to say, a decrease in the expression level of EZH2 inhibits G1/S transition.
4. Discussion {#sec4-genes-07-00083}
=============
With more and more research available, the epigenetic molecule EZH2 is regarded as a transcriptional repressor associated with many cancer types \[[@B14-genes-07-00083],[@B15-genes-07-00083],[@B16-genes-07-00083],[@B17-genes-07-00083]\]. Our previous study demonstrated that compared to normal tissues, colorectal cancer tissues expressed higher levels of EZH2. Elevated EZH2 was significantly correlated with TNM stage and lymph node metastasis in CRC tissues \[[@B13-genes-07-00083]\]. Moreover, many works demonstrate that upregulation of EZH2 is a sign of poor prognosis \[[@B10-genes-07-00083],[@B11-genes-07-00083],[@B12-genes-07-00083]\], which indicate that EZH2 as an oncogene. However, there is disparate point of view that high level expression of EZH2 inhibits aggressive T-acute lymphoblastic leukemia \[[@B18-genes-07-00083]\], which means EZH2 can also act as a tumor suppressor. In the present study, we investigated the influence of EZH2-shRNA or DZNep on CRC cells. We detected that EZH2 mRNA was highly expressed in CRC cell lines and the proliferation and migration ability of RKO and HCT116 cells was inhibited obviously after downregulation of EZH2. Meanwhile, the autophagy level and apoptotic rate were elevated. These results suggested that EZH2 plays an important role in CRC cell progression.
To evaluate whether EZH2 exerts influence on proliferation via regulation of cell cycle, we performed FACS analysis. The results showed that RKO and HCT116 cells transfected with EZH2-shRNA or treated with DZNep were arrested in G1 phase and decreased the rate of cells in G2 clearly. Thus, EZH2 may play a critical role to regulate the G1/S phase into G2 phase through the cell cycle arrest, which is associated with proliferation during tumor progression and leads to poor prognosis. However, downregulation of EZH2 made cells enter a period of stasis in G1 to inhibit the proliferation of cancer cell lines, which may reverse the condition of tumor and prolong the overall survival of patients \[[@B13-genes-07-00083],[@B19-genes-07-00083],[@B20-genes-07-00083],[@B21-genes-07-00083]\].
Moreover, the association between EZH2 and apoptosis was observed in RKO and HCT116 cells. Compared to control group, downregulation of EZH2 distinctly increased apoptotic rate of cells. Apoptosis has been recognized as a key system to clear aged or damaged cells, and it is also essential in the process of carcinogenesis. EZH2 plays a specific role in apoptosis and mediates the degree of it in many cancers \[[@B22-genes-07-00083],[@B23-genes-07-00083],[@B24-genes-07-00083],[@B25-genes-07-00083]\]. Targeting of EZH2, a potential therapeutic strategy, may induce apoptosis and tumor cell death. Furthermore, Zhu Z. et al. \[[@B22-genes-07-00083]\] considered EZH2 enhance the sensitivity of tumor to cisplatin, which also promotes apoptosis. Wu C. et al. \[[@B26-genes-07-00083]\] found that inhibition of EZH2 by genetic and pharmacological means sensitizes prostate cancer cells to camptothecin-induced apoptotic death and growth inhibition in culture and in mice. Taken together, EZH2 may repress apoptosis, while downregulation of EZH2 may accelerate apoptosis.
It is evident that autophagy has been recognized as an evolutionarily conserved catabolic process. It is thought to promote cell survival in response to stress by suppressing chronic tissue damage, inflammation, recycling cellular components and maintaining genome stability via its quality control function \[[@B27-genes-07-00083]\]. Autophagy is reported to play a dual role in cancer cells. On the one hand, autophagy can result in cell death under certain conditions (termed type II programmed cell death) \[[@B28-genes-07-00083]\]. On the other hand, autophagy sustains tumor metabolism, growth, and survival via nutrient recycling \[[@B29-genes-07-00083]\]. To date, it remains unclear whether autophagy acts fundamentally as a cell survival or cell death pathway, or both. In our study, we found increased expression of LC3-II and Ambra1 in CRC cell lines after transfection with EZH2-shRNA or addition of exogenous DZNep. LC3-II and Ambra1 are the marker proteins of occurrence of autophagy \[[@B30-genes-07-00083],[@B31-genes-07-00083],[@B32-genes-07-00083]\]. Our previous study evidenced that the increased expression of Ambra1 corresponded to the induction of autophagy \[[@B33-genes-07-00083]\]. Thus, this mean downregulation of EZH2 may induce autophagy in CRC cells.
More importantly, there are few studies that involve epigenetic gene and autophagy. There are multiple epigenetic mechanisms, such as chromatin modulation, histone modification, and microRNAs (miRNAs) that regulate the autophagy. For example, the activity of histone deacetylase SIRT1 \[[@B32-genes-07-00083]\] or histone mark H3K4me \[[@B34-genes-07-00083]\] regulates autophagy. As an epigenetic gene, EZH2 has only been reported to regulate in HCC cells \[[@B35-genes-07-00083]\] and glioblastoma multiforme \[[@B36-genes-07-00083]\]. To our knowledge, these findings provided important evidence that epigenetic gene EZH2 regulates autophagy in CRC cells.
The relationship between autophagy and apoptosis, an important question, has been widely studied in recent years. Although apoptosis and autophagy bear different morphological characteristics and physiological processes, they interact each other and sometimes can exert synergetic effects \[[@B37-genes-07-00083]\]. Apoptosis and autophagy share a lot of same properties. For example, Bcl-2 is a well-known inhibitor of both autophagy and apoptosis \[[@B38-genes-07-00083],[@B39-genes-07-00083]\]. Beclin1, VPS34 and ATG5 positively regulate autophagy and negatively regulate apoptosis \[[@B40-genes-07-00083],[@B41-genes-07-00083],[@B42-genes-07-00083]\]. Besides, the same cellular stresses can in some cases activate both autophagy and apoptosis \[[@B40-genes-07-00083]\]. Taking into account that autophagy and apoptosis are both related to cancerogenesis, our present research provided evidence that downregulation of EZH2 induces both autophagy and apoptosis in CRC cells. To clarify the relationship between autophagy and apoptosis caused by downregulation of EZH2 in CRC cells, further studies should be performed to investigate, for example, the impact of EZH2-shRNA or addition of EZH2 inhibitors on apoptosis rate when autophagy is inhibited.
There are some limitations in our study. Firstly, we didn't investigate the effect of depletion of EZH2 on colorectal cancer in vivo. Moreover, autophagy is a dynamic process, and we didn′t observe the autophagy flux. And the detailed mechanisms by which apoptosis and autophagy are regulated in CRC cells have not been fully elucidated. However, cell autophagy and apoptosis are complex networks, our research is still not enough to clarify the relationship between EZH2, autophagy and apoptosis. Thus, more research should be undertaken to get a better understanding of epigenetic mechanisms and the influence of EZH2 targeted agents on potential survival benefit in CRC patients, which may promote a novel clinical strategy for CRC treatment. Meanwhile, a variety of inhibitors suppress the EZH2 via different mechanisms, such as regulation of other targets or signal pathways, competing toward the SET domain of EZH2 and inducing relevant protein degradation \[[@B43-genes-07-00083],[@B44-genes-07-00083],[@B45-genes-07-00083]\]. All methods of inhibiting EZH2 seem have a potential benefit for treating solid tumors \[[@B45-genes-07-00083],[@B46-genes-07-00083],[@B47-genes-07-00083],[@B48-genes-07-00083]\]. For example, GSK126, an EZH2 competitive inhibitor, is undergoing phase I clinical trials for treating hypermethylation-related cancers \[[@B49-genes-07-00083]\]. However, many studies have also shown that the effect of prior competitive inhibitors is limited, which does not seem to obtain the same effect as knockdown of EZH2. Further research is needed to clarify these mechanisms and to detect the clinical survival benefit in this realm.
In summary, our study has partly unveiled the association of EZH2 with CRC cells. We observed that mRNA and protein of EZH2 were over-expressed in CRC cells. And we also found that the EZH2 level of protein and RNA was remarkably reduced by shRNA. We have further demonstrated that EZH2 has a role in mediating cell proliferation, migration, and restraining cell apoptosis and cell cycle arrest. More importantly, our data showed that EZH2 is related with autophagy. The autophagy induced by downregulation of EZH2 may explain the impact of EZH2 on CRC cell viability. Collectively, our study indicated that downregulation of the epigenetic gene EZH2 may contribute to eliminate the CRC cells, which may provide a potential mechanism for the treatment of colorectal cancer.
5. Conclusions {#sec5-genes-07-00083}
==============
Downregulation of EZH2 or adding exogenous inhibitors of EZH2 is essential for the induction of autophagy and apoptosis in CRC cells. Additionally, decrease of EZH2 also exerts the influence on cell cycle, proliferation and migration of CRC cells. It may provide a potential mechanism for the targeted treatment of colorectal cancer.
The present study was supported by Project of Nature Science Foundation of China (81672348), the Six Major Talent Peak Project of Jiangsu Province of China (2015-WSW-014), the Scientific Research Foundation for the Returned Overseas Chinese Scholars, State Education Ministry of China (fiftieth batch, 2015), the National Science Foundation of Jiangsu Province, China (BK2016255), Project of Medical Science and Technology Development Foundation of Jiangsu Province of China (YG201406) and Science and Technology Research Project of Changshu City of China (CS201504).
Yizhou Yao and Songbing He conceived and designed the experiments; Yizhou Yao, Kang Sun, Guofeng Pan, Liang Sun, and Songbing He performed the experiments; Yizhou Yao, Guoqiang Zhou, Yong Yang, Hao Hu, Xinguo Zhu and Songbing He analyzed the data; Zengfu Shang, Xiaodong Yang, Shenghua Zhan, Zhengyuan Yu, Peiyao Li and Songbing He contributed reagents/materials/analysis tools; Yizhou Yao and Songbing He wrote the manuscript. All authors have read and approved the final version.
The authors declare no conflict of interest.
{#genes-07-00083-f001}
{#genes-07-00083-f002}
{#genes-07-00083-f003}
{#genes-07-00083-f004}
{#genes-07-00083-f005}
{#genes-07-00083-f006}
{#genes-07-00083-f007}
genes-07-00083-t001_Table 1
######
Sequences and target of shRNA template oligonucleotides.
------------------------- ---------------------------------------------------
Target sequence 1 TAGGTTAATTGGGACCAAA
Sense strand 5'-3' CCGGGCTAGGTTAATTGGGACCAAACTCGAGTTTGGTCCCAATTAACC
Antisense strand 5'--3' AATTCAAAAAGCTAGGTTAATTGGGACCAAACTCGAGTTTGGTCCCAA
Target sequence 2 CAACATAGATGGACCAAAT
Sense strand 5'-3' CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTT
Antisense strand 5'--3' AATTCAAAAACCCAACATAGATGGACCAAATCTCGAGATTTGGTCCAT
Target sequence 3 GAAATCTTAAACCAAGAAT
Sense strand 5'-3' CCGGCGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAAG
Antisense strand 5'--3' AATTCAAAAACGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTT
------------------------- ---------------------------------------------------
[^1]: These authors contributed equally to this work.
|
'\"
'\" Copyright (c) 1990-1994 The Regents of the University of California.
'\" Copyright (c) 1994-1996 Sun Microsystems, Inc.
'\"
'\" See the file "license.terms" for information on usage and redistribution
'\" of this file, and for a DISCLAIMER OF ALL WARRANTIES.
'\"
.TH labelframe n 8.4 Tk "Tk Built-In Commands"
.so man.macros
.BS
'\" Note: do not modify the .SH NAME line immediately below!
.SH NAME
labelframe \- Create and manipulate 'labelframe' labelled container widgets
.SH SYNOPSIS
\fBlabelframe\fR \fIpathName\fR ?\fIoptions\fR?
.SO
\-borderwidth \-highlightbackground \-pady
\-cursor \-highlightcolor \-relief
\-font \-highlightthickness \-takefocus
\-foreground \-padx \-text
.SE
.SH "WIDGET-SPECIFIC OPTIONS"
.OP \-background background Background
This option is the same as the standard \fB\-background\fR option
except that its value may also be specified as an empty string.
In this case, the widget will display no background or border, and
no colors will be consumed from its colormap for its background
and border.
.OP \-class class Class
Specifies a class for the window.
This class will be used when querying the option database for
the window's other options, and it will also be used later for
other purposes such as bindings.
The \fB\-class\fR option may not be changed with the \fBconfigure\fR
widget command.
.OP \-colormap colormap Colormap
Specifies a colormap to use for the window.
The value may be either \fBnew\fR, in which case a new colormap is
created for the window and its children, or the name of another
window (which must be on the same screen and have the same visual
as \fIpathName\fR), in which case the new window will use the colormap
from the specified window.
If the \fB\-colormap\fR option is not specified, the new window
uses the same colormap as its parent.
This option may not be changed with the \fBconfigure\fR
widget command.
.OP \-height height Height
Specifies the desired height for the window in any of the forms
acceptable to \fBTk_GetPixels\fR.
If this option is less than or equal to zero then the window will
not request any size at all.
.OP \-labelanchor labelAnchor LabelAnchor
Specifies where to place the label. A label is only displayed if the
\fB\-text\fR option is not the empty string.
Valid values for this option are (listing them clockwise)
\fBnw\fR, \fBn\fR, \fBne\fR, \fBen\fR, \fBe\fR, \fBes\fR,
\fBse\fR, \fBs\fR,\fBsw\fR, \fBws\fR, \fBw\fR and \fBwn\fR.
The default value is \fBnw\fR.
.OP \-labelwidget labelWidget LabelWidget
Specifies a widget to use as label. This overrides any \fB\-text\fR
option. The widget must exist before being used as \fB\-labelwidget\fR
and if it is not a descendant of this window, it will be raised
above it in the stacking order.
.OP \-visual visual Visual
Specifies visual information for the new window in any of the
forms accepted by \fBTk_GetVisual\fR.
If this option is not specified, the new window will use the same
visual as its parent.
The \fB\-visual\fR option may not be modified with the \fBconfigure\fR
widget command.
.OP \-width width Width
Specifies the desired width for the window in any of the forms
acceptable to \fBTk_GetPixels\fR.
If this option is less than or equal to zero then the window will
not request any size at all.
.BE
.SH DESCRIPTION
.PP
The \fBlabelframe\fR command creates a new window (given by the
\fIpathName\fR argument) and makes it into a labelframe widget.
Additional
options, described above, may be specified on the command line
or in the option database
to configure aspects of the labelframe such as its background color
and relief. The \fBlabelframe\fR command returns the
path name of the new window.
.PP
A labelframe is a simple widget. Its primary purpose is to act as a
spacer or container for complex window layouts. It has the features
of a \fBframe\fR plus the ability to display a label.
.SH "WIDGET COMMAND"
.PP
The \fBlabelframe\fR command creates a new Tcl command whose
name is the same as the path name of the labelframe's window. This
command may be used to invoke various
operations on the widget. It has the following general form:
.CS
\fIpathName option \fR?\fIarg arg ...\fR?
.CE
\fIPathName\fR is the name of the command, which is the same as
the labelframe widget's path name. \fIOption\fR and the \fIarg\fRs
determine the exact behavior of the command. The following
commands are possible for frame widgets:
.TP
\fIpathName \fBcget\fR \fIoption\fR
Returns the current value of the configuration option given
by \fIoption\fR.
\fIOption\fR may have any of the values accepted by the \fBlabelframe\fR
command.
.TP
\fIpathName \fBconfigure\fR ?\fIoption\fR? \fI?value option value ...\fR?
Query or modify the configuration options of the widget.
If no \fIoption\fR is specified, returns a list describing all of
the available options for \fIpathName\fR (see \fBTk_ConfigureInfo\fR for
information on the format of this list). If \fIoption\fR is specified
with no \fIvalue\fR, then the command returns a list describing the
one named option (this list will be identical to the corresponding
sublist of the value returned if no \fIoption\fR is specified). If
one or more \fIoption\-value\fR pairs are specified, then the command
modifies the given widget option(s) to have the given value(s); in
this case the command returns an empty string.
\fIOption\fR may have any of the values accepted by the \fBlabelframe\fR
command.
.SH BINDINGS
.PP
When a new labelframe is created, it has no default event bindings:
labelframes are not intended to be interactive.
.SH EXAMPLE
.PP
This shows how to build part of a GUI for a hamburger vendor. The
\fBlabelframe\fR widgets are used to organize the available choices by
the kinds of things that the choices are being made over.
.PP
.CS
grid [\fBlabelframe\fR .burger \-text "Burger"] \e
[\fBlabelframe\fR .bun \-text "Bun"] \-sticky news
grid [\fBlabelframe\fR .cheese \-text "Cheese Option"] \e
[\fBlabelframe\fR .pickle \-text "Pickle Option"] \-sticky news
foreach {type name val} {
burger Beef beef
burger Lamb lamb
burger Vegetarian beans
bun Plain white
bun Sesame seeds
bun Wholemeal brown
cheese None none
cheese Cheddar cheddar
cheese Edam edam
cheese Brie brie
cheese Gruy\eu00e8re gruyere
cheese "Monterey Jack" jack
pickle None none
pickle Gherkins gherkins
pickle Onions onion
pickle Chili chili
} {
set w [radiobutton .$type.$val \-text $name \-anchor w \e
\-variable $type \-value $val]
pack $w \-side top \-fill x
}
set burger beef
set bun white
set cheese none
set pickle none
.CE
.SH "SEE ALSO"
frame(n), label(n), ttk::labelframe(n)
.SH KEYWORDS
labelframe, widget
'\" Local Variables:
'\" mode: nroff
'\" End:
|
Raman spectroscopy of iron to 152 gigapascals: implications for Earth's inner core
Raman spectra of hexagonal close-packed iron (varepsilon-Fe) have been measured from 15 to 152 gigapascals by using diamond-anvil cells with ultrapure synthetic diamond anvils. The results give a Gruneisen parameter gamma(0) = 1.68 (+/-0.20) and q = 0.7 (+/-0.5). Phenomenological modeling shows that the Raman-active mode can be approximately correlated with an acoustic phonon and thus provides direct information about the high-pressure elastic properties of iron, which have been controversial. In particular, the C(44) elastic modulus is found to be lower than previous determinations. This leads to changes of about 35% at core pressures for shear wave anisotropies. |
Trousseau (grape)
Trousseau or Trousseau Noir, also known as Bastardo and Merenzao, is an old variety of red wine grape originating in eastern France. It is grown in small amounts in many parts of Western Europe; the largest plantations are today found in Portugal, where most famously it is used in port wine. It makes deep cherry red wines with high alcohol and high, sour candy acidity, and flavours of red berry fruits, often complemented - depending on production - by a jerky nose and an organic, mossy minerality.
History and pedigree
Trousseau originated in eastern France where it was once widely cultivated, and DNA profiling has indicated that the variety has a parent-offspring relationship with Savagnin, and that it is a sibling to Chenin blanc and Sauvignon blanc. DNA profiling has likewise shown that Trousseau has been cultivated on the Iberian Peninsula for at least 200 years under several different names, including Bastardo, but it is unknown how it came to be introduced there.
Trousseau gris is a white mutation of Trousseau Noir, occasionally found in Jura and once common in California under the name 'Gray Riesling'.
Genouillet is the result of a cross between Gouais blanc (Heunisch) and Bastardo.
In 1938 Harold Olmo used Trousseau to pollinate the Vitis rupestris hybrid Alicante Ganzin to produce the Royalty variety.
Bastardo was crossed with the Georgian variety Saperavi to produce the Bastardo Magarachskii variety used in the Crimea.
Distribution and Wines
A little is grown in Argentina and in several regions of Spain, including the Canary Islands.
Australia
There are a small number of producers of Trousseau in Australia with plantings in Tasmania, Margaret River in Western Australia (Amato Vino release a small quantity each year in the Jura style) and Barossa Valley, South Australia. A small amount is also grown in eastern Australia under the name Gros Cabernet.
France
Trousseau is one of five grape varieties allowed in the Jura wine appellations, but only covers 5% of the Jura vineyards since it requires more sun than other Jura varieties to ripe. It is often used to stiffen blends with the pale Poulsard, which is easier to cultivate. In 2009, there was a total of of Trousseau in France.
Portugal
It is part of the blend for port wine and also an important variety for red wines in the Dão. A total of of Trousseau, mostly under the name Bastardo, is cultivated in the vineyards of Portugal. It is also grown in very small quantities in Madeira, and a small number of vintage wines labelled Bastardo were made.
Spain
In Spain Trousseau is grown under the names of Merenzao, Bastardo, Bastardo Negro, María Ordoña, Maturana Tinta, Tintilla, and Verdejo Negro. It is an authorised variety in the Galician DOPS of Ribiera Sacra and Valdeorras DOPs in Galicia. It has also been included in Rioja DOCa under the name of Maturana Tinta, but it is listed as a separate variety to Trousseau / Merenzao even though they are genetically indistinct.
USA
As in Portugal, it is used to make fortified wines in California.
Additionally, a select set of winemakers are experimenting with making table wines with the grape.
Vine and Viticulture
It needs hot, dry conditions to do well. The name Trousseau (from Old French trusse, meaning "a bundle") is possibly a reference to the shape of the bunch, it looks 'packed up'.
Synonyms
Trousseau is also known under the synonyms Abrunhal, Bastardinha, Bastardinho, Bastardo, Bastardo Do Castello, Bastardo Dos Frados, Bolonio, Capbreton Rouge, Carnaz, Chauche Noir, Cruchenton Rouge, Donzelino De Castille, Estaladiña, Graciosa, Gris De Salces, Gros Cabernet, Maria, Maria Adona, Maria Adorna, Maria Ardona, Maria Ordona, Maturana Tinta, Maturana Tinto, Maturano, Merenzano, Merenzao, Pardinho, Pecho, Pinot Gris De Rio Negro, Roibal, Sémillon Rouge, Tresseau, Triffault, Trousse, Trousseau,Trousseau Gris, Troussot, Trusiaux, Trusseau, Trussiau, Tintilla and Verdejo Tinto.
In the literature, it is often confused with Tressot.
See also
List of Port wine grapes
Notes and references
Further reading
External links
VIVC Bibliography
Wine Bastardo
Category:Red wine grape varieties |
Changes in the haemolymph protein pattern during ovarian maturation in Xylocopa litipes.
The haemolymph proteins of a hymenopteran insect Xylocopa litipes have been fractioned by the polyacrylamide gel disc electrophoresis. The haemolymph protein fractions have been examined histochemically. The changes taking place in the haemolymph protein pattern during vitellogenesis have been studied. Common protein fractions were observed in the haemolymph, fat body, ovary and testis. The role of sex specific protein during the vitellogenesis has been discussed. |
Read book online
Linda Robertson. Hallowed Circle
Persephone Alcmedi has been persuaded to compete for the position of High Priestess of the Cleveland, Ohio, coven — now that the former priestess, Vivian Diamond, has strangely gone missing. Unfortunately, there are a few small problems with the idea. Not only does Seph know rather more about Vivian’s disappearance than the other witches realize, but the epic struggle she’s just survived has left her with some highly unusual powers — ones that could be dangerous to reveal. Despite her reluctance, she agrees to participate, if only to prevent snooty Hunter Hopewell, an obnoxious but talented witch, from ending up in the winner’s circle.
Can Seph hide her secrets — including her connection to the master vampire-wizard Menessos — from the terrifyingly wise judges? Plus, there’s her rock ‘n’ roll werewolf boyfriend, Johnny, and some angry fairies to deal with…. |
1. Field
The present disclosure relates generally to aircraft and other vehicles and in particular to data for aircraft and other vehicles. Still more particularly, the present disclosure relates to a method and apparatus for delivering data to and from an aircraft or other vehicle.
2. Background
Computer systems are used in many aircraft. For example, a computer system in a commercial passenger aircraft may include multiple computers that communicate with each other through an aircraft network. Such computers may take various forms, such as a flight management system, a navigation computer, an engine indicating and crew alerting system (EICAS), an autopilot, an electronic flight bag, and other line-replaceable units or other types of data processing systems.
Computer systems on an aircraft may use software or programming to provide the logic or control for various operations and functions. The software used in computer systems on aircraft is commonly treated as parts in the airline industry. For example, a software application for use in a line-replaceable unit on an aircraft may be tracked separately from the line-replaceable unit itself. Aircraft software that is treated as an aircraft part may be referred to as a loadable software aircraft part, an aircraft software part, or simply as a software part. A software part may be considered a separately identified part of the configuration of an aircraft, rather than part of the hardware which operates the software.
Software parts may be installed into a computer system on an aircraft at various times. For example, a software part may be installed during the manufacturing of an aircraft. Further, a software part may be installed at a later time when the aircraft is in service. A software part may be installed on an aircraft to replace an existing software part, provide a new or improved feature, or for some other suitable purpose or various combinations of purposes.
Software parts are often loaded onto a computer system on an aircraft during maintenance and service for the aircraft when the aircraft is located in a hanger or other maintenance location. However, loading software parts and other information on an aircraft may be desirable at other times. For example, without limitation, an updated version of a software part for an entertainment system on an aircraft may provide more entertainment features for passengers. It may be desirable to make these improved features available on the aircraft as soon as possible.
It also may be desirable to download information from a computer system on an aircraft to a location off of the aircraft. For example, without limitation, an airline or other operator of an aircraft may desire to move operational data from an aircraft to a location off of the aircraft for storage, analysis, or for other appropriate purposes. Such operational data may include, for example, logs, events, sensor data, and other data that may be generated by an aircraft computer system or other devices on the aircraft. It may be desirable that such data is moved from the aircraft to the location off of the aircraft in a timely and secure manner.
Therefore, it would be desirable to have a method and apparatus that take into account at least some of the issues discussed above, as well as other possible issues. |
Behold! The Transit Mall's $2000 Trash Cans!
The transit mall downtown is opening for genuine MAX traffic soon and it is lookin' good. Really good. The kind of good only lots of money can buy.
There's been a lot of discussion at the city over the cost of the the "furniture elements" of the transit mall - the trashcans, bus shelters, benches and bike racks. How much money is too much money to spend on a trashcan or a bike rack? Well, TriMet architect Bob Hastings points out that the transit mall is "the most important thing we're doing for streetscape improvement in downtown Portland" and wanted to have the everyday elements "look good and stay good for 25 years." That's how the transit mall team wound up mandating very classy stainless steel elements. Sadly, stainless steel is expensive. Here's how the transit mall costs break down:
$2000 each ($376,000 total)
30 benches at $2600 each ($78,000 total)
53 bus shelters of varying sizes costing $3,844,780 total
and yes, 117 bike staples that clock in at $367, plus $100 installation costs. (about $55,000 total)
188 trashcans ateach ($376,000 total)
Current TriMet budget deficit: $13.5 million.
Anyway, the bike racks present an interesting dilemma. TriMet ordered 117 of them, but the city saw that is not nearly enough to meet demand and wants to install 100 more. Sadly, in the two years since the contract was signed, the price of the stainless steel bike racks has jumped to $900 each, plus installation fees. And while federal funds covered 60 percent of the initial costs of building the transit mall, it's not clear who will pick up the tab for future work (like, say, one of the trashcans gets set on fire). Not the federal government, that's for sure. Right now the Portland Bureau of Transportation is looking around for transit mall bike rack funding - maybe the PDC can shell out? According to PBOT's Sarah Figliozzi, Portland's famous blue staple bike racks cost only $150, including installation, and start to look shabby after about 10 years. But the city can't use those ubiquitous racks on the transit mall because of the strict, stainless-steel only design guidelines.
While the city and TriMet sort this out, Portlanders have found a practical solution:
|
1. Field of the Invention
The present invention relates generally to locating a vehicle using a mobile device, and more specifically to a vehicle sending location information to pre-designated mobile device with GPS capability when the engine of the vehicle is shut off.
2. Discussion of the Background
Today, many people have trouble remembering how to return to a particular location such as a common meeting place or where they parked their vehicle. This problem will most likely only get worse as the population ages and the aging generation face problems associated with memory loss. Forgetting where a vehicle is parked can be a serious problem in large parking lots such as malls, shopping centers, or amusement parks.
The Global Positioning System (GPS) is an example of a radio-based technology that is used to provide an earth based position using orbiting space satellites. As is well known in the art, currently there are twenty-four GPS space satellites in the GPS constellation orbiting in twelve-hour orbits, 20,200 kilometers above Earth configured such that there are six to eleven GPS satellites visible from any point on the Earth. GPS satellites broadcast specially coded signals that can be processed by GPS receivers. These GPS space satellites transmit on a primary and a secondary radio frequency, referred to as L1 and L2. The frequency of L1 is 1575.42 MHz (154 times the atomic clock) and the frequency of L2 is 1227.6 MHz (120 times the atomic clock). A typical GPS receiver retrieves GPS signals from at least three orbiting GPS space satellites and then calculates an earth based location, generally latitude and longitude coordinates. GPS signals from at least four orbiting GPS space satellites are necessary to calculate a three-dimensional earth based location, such as latitude, longitude and altitude. A GPS receiver calculates its location by correlating the signal delays from the GPS space satellites and combining the result with orbit-correction data sent by the satellites.
At present, there exist many different types of GPS receivers of varied capabilities which are commonly available for personal and governmental use. Typically, these GPS receivers are intended for navigational use in which the current calculated latitude and longitude location is displayed on some form of a geographic or topographical map. These systems are sometimes bulky and may require the user to manually program the system, such as entering a destination street address.
Because a typical user of a device intended to help the user remember how to return to a particular location is likely to be concerned about the size and complexity of the device, the device should be lightweight and simple to operate. Thus, a location device should have a simple user interface that is easy to operate with minimal or no user programming required. To this end, the location device should be able to utilize radio-based technology to automatically determine its current location. In addition, the location device should be carried by a user in order to be useful.
Thus, there exists an unmet need in the art for a lightweight and simple to use location device for registering and returning to a particular location. |
<?xml version="1.0" encoding="UTF-8"?>
<definitions
xmlns="http://www.omg.org/spec/BPMN/20100524/MODEL"
xmlns:camunda="http://camunda.org/schema/1.0/bpmn"
targetNamespace="Examples"
xmlns:tns="Examples">
<message id="message" name="startMessage" />
<process id="process" isExecutable="true">
<startEvent id="theStart" >
<messageEventDefinition messageRef="tns:message" />
</startEvent>
<sequenceFlow id="flow1" sourceRef="theStart" targetRef="task" />
<userTask id="task" name="my task" />
<sequenceFlow id="flow2" sourceRef="task" targetRef="theEnd" />
<endEvent id="theEnd" />
</process>
</definitions>
|
To determine whether itraconazole therapy is beneficial in the treatment of early pulmonary coccidioidomycosis. To ascertain improvement subjectively as well as radiographically and by other objective means. |
Many graphical user interfaces for computers are based on a desktop metaphor that creates a graphical environment simulating work at a desk. These graphical user interfaces typically employ a windowing environment within the desktop. The windowing environment presents the user with specially delineated areas of the screen called windows, each of which is dedicated to a particular application program, file, document, or group of files (e.g., a folder).
FIG. 1 is an illustration of a prior art graphical user interface 10 of a computer network folder 12 containing multiple computer files 14, such as document files, photo files, etc. It will be appreciated that computer files 14 in FIG. 1 are actually icons that represent or designate the files, but in the terminology of the art the icons or other symbols representing objects are referred to as the objects themselves. User interface 10 is rendered on display screens of user computers, for example.
Computer network folder 12 represents a computer or network space within which computer files 14 are stored. In the earliest personal computers, the folder in which a group of computer files was stored was dedicated to and accessible from only one computer. With the networking of computers, a folder such as computer network folder 12 may be accessible by many users from many different computers on a network.
In a computer network, for example, some network folders might be publicly shared and accessible to virtually any user on the network, and other folders might have access or sharing that is limited only to specified users. Folders with limited access or sharing would typically contain sensitive or private information that is not needed by all network users.
In prior art graphical user interface 10, computer files 14 are shown in computer network folder 12 in the same manner regardless of whether network folder 12 is widely shared, shared on a limited basis, or entirely private. A single layer of information, computer files 14, is rendered to identify the contents of folder 12. The single-layered representation does not indicate any other information or property, such as the extent to which files in the folder are shared, even though such a property could be very important to how a user works with the folder contents.
As a result, current implementations of shared computer spaces, like network folders or “shares,” can facilitate serious breaches of network security. When they create shared network spaces such as folder 14, users do not always maintain the access rights (i.e., shared access) so that in time the shared status of the space can be forgotten. As a result, sensitive files might then be stored in a network space that is shared with users for whom access rights are not intended.
Accordingly, the present invention provides a multi-layer graphical user interface that provides multiple types of information in at least two layers of a common display space, such as a window or desktop. In one implementation, a shared network folder includes two layers of display objects to separately represent files contained in the folder and users with whom the folder is shared. The first or top layer may represent the files with conventional words, icons or other symbols. The second or lower level may represent the users with whom the folder is shared with words, icons or other symbols that are dimmed, blurred, or otherwise de-emphasized relative to the top layer.
The multi-layer graphical user interface allows multiple distinct types of information to be rendered graphically in a common display space. As a result, the information of primary significance (e.g., the files) can be readily discernible by the user, while significant related information is rendered without degrading the display of primary significance with a clutter of display objects. In one implementation, the distinct types of information to be rendered may be selected from more than two distinct types of information in a type control bar.
Additional objects and advantages of the present invention will be apparent from the detailed description of the preferred embodiment thereof, which proceeds with reference to the accompanying drawings. |
Sekyra Foundation
The Sekyra Foundation is a private foundation created in 2018 by Czech entrepreneur Luděk Sekyra in support of moral universalism, liberal values, and civil society. The foundation receives funds for its activity from gifts by individuals and corporations, asset management, and business activity.
Purpose
The foundation is focused on support for civil society, the development of critical and philosophical thought, support for academic institutions and educational projects, sustainable development and protection of the environment, lectures, and publishing the works of important thinkers. Another mission of the foundation is the defense of political freedom, human rights, and cultural and religious diversity. In collaboration with leading universities around the world and Europaeum, the foundation is cultivating the legacy of key philosophers of the 20th century like John Rawls and Ludwig Wittgenstein, as well as intellectuals associated with Central and Eastern Europe, such as Isaiah Berlin, Leszek Kołakowski, Jan Patočka, and Karl Popper.
The Sekyra Foundation offers month-long stays at the University of Oxford for students at Charles University in Prague and reciprocal stays for English students in Prague. The renovated building of Sekyra House, part of Oxford’s Harris Manchester College, had its opening ceremony on November 6, 2014, to commemorate the anniversary of the Velvet Revolution and contains student housing as well as three study halls. Also in the building is a lecture hall named for Tomáš Halík. Luděk Sekyra is a member of the board of Harris Manchester College and one of its Foundation Fellows, as well as a member of Oxford’s Vice-Chancellor’s Circle and the Aristotelian Society in London.
Past projects
The Sekyra Foundation has supported several projects for the development of philosophical and intellectual dialogue, including “Jan Patočka and the Grounds for Political Action: Phenomenology, the Arts, and Civil Society”, a conference organized by The Rimbaud and Verlaine Foundation (2019); “Culture and Value after Wittgenstein”, a conference held at The Queen's College, Oxford (2019); “Inequality, Religion, and Society: John Rawls and After”, a conference dedicated to the philosophical legacy of the most significant political philosopher of the 20th century, John Rawls, which took place in early 2019 at Harvard University;
“Two Visions of Europe: What Sources of Hope for the Future?”, an international conference and seminar in the Cracking Borders, Rising Walls Series organized by Kultura Liberalna in Warsaw; the annual Central European Forum in Bratislava, a discussion conference founded by Václav Havel; a conference on Trust and Understanding organized by the Broumov Monastery; and “Margaret Thatcher in historical perspective”, a lecture organized by the Centre for Political Philosophy, Ethics and Religion at the Faculty of Arts, Charles University in Prague.
The Sekyra Foundation sponsored a project at the Institute for Human Sciences (Institut für die Wissenschaften vom Menschen) in Vienna called the “Annual International Editors’ Roundtable”, which includes authors and editors from prestigious intellectual non-academic periodicals from across the political spectrum (The Economist, The Week, openDemocracy, Eurozine, Esprit, FAZ, and Süddeutsche Zeitung) and the 57th International Congress of European Journalists, which took place in Prague for the first time in 2019 and was organized by former RFE/RL journalist Lída Rakušanová. It also arranged an evening discussion at the Václav Havel Library with the CEO of The New York Times Company Mark Thompson, and leading representatives of the Czech media.
The Sekyra Foundation supports the idea to erect a new building for the Czech National Library, recently revived by the Czech Centre of the PEN International and The Jan and Meda Mládek Foundation. One potential location is the former Žižkov freight railway station, part of which will be the site of a new neighborhood built by the Sekyra Group.
The Foundation is contributing to the publication of a three-volume set of memoirs of Dr. Emil Ščuka, who played an important role in the emancipation of the Roma national minority in the Czech Republic (published by the Václav Havel Library, 2019).
Partners
University of Oxford, UK
Edmond J. Safra Center for Ethics, Harvard University, Cambridge, USA
Athens Democracy Forum and The New York Times, USA
University of Notre Dame, USA
Europaeum, a network of leading European universities, Oxford, UK
The Centre for Political Philosophy, Ethics, and Religion, Charles University, Prague
Supported organizations
Václav Havel Library, Prague
Václav Havel Human Rights Prize
Czech Centre of PEN International, Prague
Czech Christian Academy, Prague
Liberal Institute, Prague
Kultura Liberalna, Warsaw
Czechoslovak Documentation Centre, Prague
European Journalists Association, London, UK
Institute Vienna Circle (Institut Wiener Kreis), Vienna
International Crisis Group, Washington, USA
Central European Forum, Bratislava, Slovakia[19]
Foyer, Sint-Jans-Moelenbeek, Belgium
The Rimbaud and Verlaine Foundation, London, UK
Salve, A Revue for Theology and Spiritual Life
Broumov Monastery
Klasika Plus, a classical music website
Sponsorship of the 30th anniversary of the Velvet Revolution
Festival of Freedom
Concert for the Future
Notes
External links
Sekyra Foundation website
Category:Foundations based in the Czech Republic
Category:Philanthropic organizations based in the Czech Republic |
Microgrids enable aggregation of various types of generating and non-generating sources as a unified control unit. Microgrid control networks are connected to various external networks for a variety of reasons, for example Supervisory Control and Data Acquisition (SCADA) networks for demand-response applications and enterprise networks or the Internet for remote monitoring and control.
These external connections expose the microgrid to threats from remote adversaries, especially cyber attackers. This becomes especially concerning for installations in sensitive sites like military bases, where military missions depend on critical infrastructure, like microgrids, for their success.
To address these issues, the present disclosure presents a cyber-security architecture that is based on a unique cyber-security strategy that, in some embodiments, can be achieved by hardware devices that provide strong cryptographic separation. Such a concept can provide a secure network of assured power enclaves (also called SNAPE) in some embodiments. |
So I ran into some problems with some minis I painted turning dull, gray, and fuzzy-looking after I sprayed them with clear-coat on a hot, humid summer day. As a refresher, my spiders and doppelgangers came out looking like this:
Glossing over the problem
I wanted to try to improve the look from here without a full repaint. I was considering just throwing a dark wash over the whole pieces and calling them done, but someone on Facebook suggested that going back over them with a clear gloss would help restore some of the original look. I had a little pint can of hardware-store variety Varathane brush-on gloss around, so I grabbed a few of the muted minis and spread a little onto them.
This did seem to help a bit! It looked like the gloss liquid was able to fill in the almost crystalline “fuzz” the spray coat had left, and they looked better. (Now, as I write this, I wonder if a matte paint-on liquid would have achieved the same, bit I’ve already put some gloss on the other muted minis so it’s too late to test that on this go-round.
With the colors still far from perfect but at least not looking like the minis had spent a month inside a vacuum cleaner, I was tempted to pronounce them done. But the glossy look (which the photo doesn’t convey very well) bothered me. The glossy look on what were supposed to be dirt bases was especially bothersome.
And so…
Tempting Fate
That night as my glossy minis dried, a storm came through, followed by a steady rain. Yesterday morning dawned the coolest and driest it’s been around here since early June. This meant that not only was I going to test yet another layer of clear coat – this time from among several brush-on matte candidates – but the conditions were right to try both another coat of the Krylon that was involved in the original problem as well as some Testor’s Dullcote I’d picked up locally to test out. My hope was to reduce the gloss without any further muting/dulling/fuzzing effects.
For brush-on testing, I used a matte version of the same Varathane product line I’d used for the gloss, since again I had some on a shelf in the garage anyway. I also used my monthly-ish 50% off coupon to pick up a bottle of Liquitex matte varnish.
The results?
Er, well.. they seemed to tone down the gloss just a little. Interestingly the Krylon did the best job of suppressing the shine. I’m still mulling over yet another coat of matte just to de-gloss a little more, but I think at that point these minis will be more clear-coat than plastic! I’m also still tempted to try that one last dark wash on the spiders…
Lessons learned
My take-aways from this little exercise are as follows:
When spraying, always wait for the right weather conditions!
When conditions aren’t ideal but you don’t want to wait, brush it on instead.
The initial results weren’t Krylon’s fault – they were mine, for not adhering to the first two bullet points above. While there may be some variations in the susceptibility to weather conditions across different formulations, the simple fact is that any of the products I tested are probably perfectly adequate for their intended purpose when used correctly.
Most of my spiders aren’t big enough to be “giant” spiders.
Bulleted lists look too small when there are only three bullets.
I just don’t know when to stop. Really. It’s a problem. It’s possible I need counseling for this. Let me list the reasons: <Thud sound as wife clubs me over the head and drags me away from the computer>
|
Jean-Claude Van Damme Planning a Real Kickboxing Match
It is being reported that Jean-Claude Van Damme is working on a new project, a documentary about his training for a K-1 kickboxing match in Last Vegas. This new movie will lead up to Van Damme actually getting into the ring for a real fight.
He will face off against Somluck Kamsing, a 35 year-old Thai fighter, who was the 1996 Olympic Gold medalist in boxing at 126 pounds and also fought in both the 2000 and 2004 Olympics. Kamsing even appeared in the Asian version of the "Fearless" film, in which he has a fight scene with Jet Li.
Van Damme is currently trying to organize the fight for next Summer, but some are worried that the Nevada State Athletic Commission will never allow for the 48 year-old actor to face-off against a former Olympian. Stay tuned.
"the Nevada State Athletic Commission will never allow for the 48 year-old actor to face-off against a former Olympian"
That's a Maximum Risk he'll have to take. Van Damme may face Sudden Death, as Somluck Kamsing is something of a Hard Target. He's a real Street Fighter. Kamsing is known to use both his fists for Double Impact, and that may give van Damme a Death Warrant, leaving him Nowhere to Run.
It's a real Bloodsport, taking on a pro like Kamsing. Then again, we all know Van damme believes in No Retreat, No Surrender, so hopefully we'll get to see which one is a true fighting Cyborg. It's going to be a battle to the finish between two Universal Soldiers.
Yup, The Expendables would have been a much better choice. On the other hand, the dude does hold a professional record of 18-2 from his professional martial arts competition days. Those 18 victories were all KO! And he knocked out those 18 fools while he was blind, after his brother had been paralyzed, his girlfriend kidnapped, the other brother had been set on fire and had two or three other twin brothers who didn't like him! ... and then he killed Bison and saved the world...
"That's a Maximum Risk he'll have to take. Van Damme may face Sudden Death, as Somluck Kamsing is something of a Hard Target. He's a real Street Fighter. Kamsing is known to use both his fists for Double Impact, and that may give van Damme a Death Warrant, leaving him Nowhere to Run.
It's a real Bloodsport, taking on a pro like Kamsing. Then again, we all know Van damme believes in No Retreat, No Surrender, so hopefully we'll get to see which one is a true fighting Cyborg. It's going to be a battle to the finish between two Universal Soldiers."
WAH WAH WAH.....
Nice...
Im pretty sure Van Damme is going to get the living sh*t kicked out of him.. Hes like 900 years old...
@mink, thats f*cking hilarious that you have his entire library... BUT you didn't mention his best film.. DOUBLE TEAM...
f*ckin' dennis rodman... that movie was f*ckin excellent...
I love van damme... and his level of cheese, its exciting..
Has anyone seen JCVD? I thought it was really quite good... but now hes all c*cky and thinks hes meryl streep because of it... but still it was f*cking good.
'I love van damme... and his level of cheese, its exciting.' - well said trig. That's how I have pretty much defined JC. He's cheesy... his acting is non-existent. But we all still watch the guy. He has moves (the splits is pretty predictable - but we all wish we could do that). Same as Seagal - he sucks... but he's watchable.
@acslaterson + mink - you're right, he'd get his ass handed to him in the battle. He's grasping at straws. Someone here commented is would be the best way to go out. I disagree - leaving with your head knocked off, isn't the way to go. He should stay out of this. Stick to 'acting' - get in Expendables 2. If should have been producing all along (like Seagal), then JC would have some money (his salary sucks).
@Mink - nice post with the movies titles. I see the lazies on here, instead of contributing just throw in the 1-line jab against it. I hope they plan to make a better showing out there in the real world (but... I doubt it).
"Much less than you spend beating off to your mother's wedding photos..."
Bull f*cking sh*t. EVERY random day I come to check for news when bored at work or whatever...EVERY RANDOM DAY, this Minkowski dork posts in every single thread...every one. There HAS to be something better to do in life than F5 one random f*ckin' website. I know every site has one, but what a sad commentary it truly is.
I wonder if f*cks on AICN, here, Bloody Disgusting, etc. know that their credibility is next to nothing until they actually do something with their own lives.
Then, you f*cking whining moron dipsh*t, either don't read the goddamned comments or go somewhere else. No one puts a gun to your shriveled head and forces you to read the comments. No one.
'I know every site has one, but what a sad commentary it truly is."
The 'sad commentary' as you so eloquently phrase the situation, is you moaning about someone posting something you don't like.
Either join in, make some discussion, have something relevant to read you c*ckroach of a human being. You don't post sh*t unless you're f*cking crying. Either lurk or join in, but don't make yourself into a bloody raging p*ssy just ebcause you can't do the manly thing and ignore posts you don't like.
People like you are the sort of parasite that refuses to vote, but then bitches because your guy didn't get elected. f*ck off. Slink back to the shadows where you obviously belong.
"I wonder if f*cks on AICN, here, Bloody Disgusting, etc. know that their credibility is next to nothing until they actually do something with their own lives."
I wonder if f*cks such as yourself know that no one asks for your 'credibility'. We post because we enjoy it, not for you. Your arrogance in thinking *you* decide relevance and worth kills me. I decide my own credibility and worth, not you, not some flunky that doesn't contribute save to whine and moan.
Jesus, there are some incredibly stupid f*cks on the internet that think this is all here for them. They sit and silence, offering nothing, but thinking they can decide all. Like royalty.
Just die, ok? Because obviously you're as big fat zero in life as you are on the internet.
@october_midnight - I'm not picking sides (I'm really not). But even I posted on this thread, here, just today, and on another one yesterday and people STICKING TO THE TOPIC AT HAND. Mink has. You haven't.
You have OPTIONS:
1. Scroll past any/all posters you don't like.
2. Go to another thread.
3. Post relating to the topic at hand instead of personal attacks.
4.Leave the site.
I doubt you use the same approach to people in public that you do here with the safe anonymity of the Internet. That's cowardly. If you DO talk to (and not with) people in public like you have here, it's only a matter of time before you'd get your ass kicked.
So, as I'm off topic, and have made this personal, and you'll probably think I AM picking sides... whatever.
Meh, blah blah blah....I still know you're a loser. I'm out, time for work. I'll check back tomorrow to see if there's any news, etc. I'm sure you'll post on every thread like always. Enjoy your massive social life.
@PeterParker - JC does hold some records, but you'd be the first to admit they were held 100 years ago. JC deserves respect for his accomplishments. He's an athlete, he trains hard, he tries hard (sometimes), and he's a household name. But bringing out his competitive records out this late in the game is akin to Grandparents at the bus stop showing off pics of their grandchildren to some poor schmuck still there awaiting the same bus.
So says the guy hiding behind an anonymous name and avatar, who never posts anything but little girl bitching. Yes, October_midnight, you've definitely cornered the winner department here at WP. Good job.
"If you DO talk to (and not with) people in public like you have here, it's only a matter of time before you'd get your ass kicked. "
Actually, I do. People are bigger pussies in real life. Or bullies, and you can't bully anyone over the internet, so these loser control freaks like October_midnight and LostRose get frustrated they can't control everything. They have to beg the site owner to take action so they can manipulate the online world to their liking. Pathetic.
Most guys don't want to go to jail, ruining an otherwise clean criminal record, or take the risk the mean crazy guy in front of them might be serious about kicking ass. The guys to worry about are the big ex-cons that don't care about losing teeth and heading back to jail.
Most of the people on the internet are the shrewish, frightened people you see in real life that go out of their way to avoid conflict.
Anyway, the worst people can do to you is kill you, right? Or call you a loser. And you're going to die anyway, so f*ck it.
Mink... you, I and others have seen it before (even on this thread earlier)... those that can't keep up or have nothing to offer, and were sent out of their mother's basement, over-indulged with low self-esteem and self-worth, clearly have little to contribute.
So they strike out. I know it has less to do with the person they think they're attacking (pretty cowardly) then the reflected it is of their own unhappy lives. They feel trapped in their present situations, no authority, no power, so they lash out.
Were I standing next to them I can guarantee you they wouldn't use that tone. And if they didn't pick up on my 15 second tutorial on how to scroll (past a poster they didn't like), I'd feed them their mouse completely against their will.
As for JC, yeah, I'm a fan of his. Still think (know) he should have jumped onto the Producing wagon a couple of decades ago.
JCVD took the wrong path. He came over here with nothing and took up action roles because that was his asset, his martial arts skills or whatever, and he sort of just stayed there. He displayed far less Arnold's initiative to excel and broaden his ability, never mind that JC wasn't ever picked up by a Cameron, which made a huge difference in Arnold's career.
JC only got real when he got really, really hungry, when he exhausted his options as an action actor. Mind you, he really ran those straight to DVD releases into the ground. he got cornered, I think, and all he was left to portray was himself. It's sad he had to run on empty to get real. Now he thinks he can fly high on that empty gas tank, and maybe he can, for a while anyway, but eventually he's going to have to realize that the show isn't going to go on forever for him.
He should've taken the Expendables role, and I think that's going to come back to haunt him sooner rather than later.
"Mink... you, I and others have seen it before (even on this thread earlier)... those that can't keep up or have nothing to offer, and were sent out of their mother's basement, over-indulged with low self-esteem and self-worth, clearly have little to contribute. "
When I hear people, who never post, complaining about people like me and you and others that DO contribute, I wonder about their motivations. I think your explanation more than suffices. I know I'm often very, very harsh, but even in the past when I've toed the line and refrained from attacks, in the very beginning of my stint here, and instead made lengthy posts with rather well made points and ideas, I was still attacked. So I think you're right.
It comes down to them, these lurkers, lacking the ability to control the situation, a situation that makes them feel inadequate because they have zero to offer in the way of opinion and thought. The only way they can redeem their worth is by throwing out how much money they make or that they have to 'get back to work'. Gunslinger did the same thing, never posting anything but attacks on me. When he got his ass kicked he crawled off mumbling implicitly about his job at 7-11. Whatever. And they call other people losers, when all they've accomplished in life is a coffin of a job. I'd rather be homeless and have an opinion, a mind, than live their dead end shallow lives.
"As for JC, yeah, I'm a fan of his. Still think (know) he should have jumped onto the Producing wagon a couple of decades ago."
Absolutely, would have been the smart thing to do... Joining the expendables cast would have also been the smart thing to do... But then again he is afterall, a french man...
@october_midnight... Dont be such a p*ssy.. Minks not the most agreeable person online, but hes got a lot to say about movies and is great for discussion on pretty much any topic... Isn't that the point of this blog? Discussion on all things movies?... Or am I in the wrong place...
I've flat out told mink to f*ck himself, but thats not because there was one particular post that my little bitch ass didn't like, it sure as to hell wasn't because he posts on here too often.. it was because of a disagreement.. Where you're coming from is a cowardly place and you should be f*cking ashamed of yourself... Im on here constantly, rangers on here constantly.. and a handful of other guys frequent this place and respond to EVERY thread... thats what its here for f*ck stick.. to respond to it. to discuss it... otherwise the comment section wouldn't exist..
I spend a lot of time on here because Im in the exhibition industry and I like to know all the news, and im a HUGE film fanatic.. and theres no way in hell i can sit in my living room and compare directors careers with my f*cking wife.. are you kidding me?... god that would be a nightmare.. But i CAN come on here and talk to my hearts content about films and media alike... You slandering mink for doing that is slandering every one of us..
Dont be a little bitch man.. how about be a part of the conversation instead.
Yeah, and even though it doesn't really matter, JB is getting higher film scores that Transformers 2. Bay really f*cked up critics-wise with ROTF. But he banked, so I'm sure TF3 is just around the corner.
And now the Hollywood moneymen know what everyone else already knew: Fox cannot carry a movie, not even ass and tit low-budget horror films, so I doubt we will see much of her beyond eye-candy supporting roles.
He got slammed at a Strip Club, in NYC under the 59th st. bridge, Scores[a Strip Club].
The guy who decked him was Zito. J-Claude tried to kick him and slipped, not making contact. Zito punched him. This happend some 5+ years ago. The only film I liked of his was "No Retreat, No surrender". He was the antagonist competitor. Not a major role.
I love reading these posts and seeing all the stupid f*cking idiots who nothing about movies or pretty much anything, trying to talk sh*t against those who actually know things and put damn good posts on this site all the time. And to those "idiots" I mentioned earlier, do some research and then try arguing, maybe you will sound intelligent and people will listen to what you have to say
Speaking of JC, I just love Universal Soldier. Anyone recall the ending? LOL. He's been 'dead' for like 25 years, and he shows up at his parents door, completely unaged, and his parents aren't the least bit dumbfounded or even concerned. They act like someone just delivered the mail. lol. And I tell you, you haven't laughed your ass off until you've watched Replicant with the audio commentary turned on. JC is totally drunk throughout! You can hear him stumbling over words and losing his thoughts. Its hilarious.
Sorry quagmre. You are misinformed. He did not slip. Zito, in a interview after the incident on Howard Stern, which I listened to live, admits he sucker punched Van Damme. Zito also readily admitted that when JC went down, Zito bid a hasty retreat. Zito said he ran out because he knew that if VD got up and used his legshe was dead. Zito said that VD is eceptional with his leg speed. I am not offering this for debate. I listed to the entire interview. I have also seen JC kicking a speed bag at a gym in Baltimore. He was kicking it like boxers punch the bag. Keepin rythmn with his f*cking kicks. This is incredibly hard. I can barely keep rythmn using my fists and have studied for years. Credit where its due people!
Van Damme should have been a masturbation and a stain on some couch. This guy has had original script chances (Universal Soldier & Time Cop - who directly adressed time paradoxes) and with all that - couldn't achieve diarrhea sh*t. |
Q:
Transform a Gumby newletter form to work with MailChimp
I have this form preset from Gumby framework:
<ul>
<li class="append field">
<input class="wide email input" type="email" />
<div class="medium primary btn">
<a href="#">Go</a>
</div>
</li>
</ul>
Codepen
I'd like to modify it so it would work as a mailchimp newsletter form:
<!-- Begin MailChimp Signup Form -->
<link href="//cdn-images.mailchimp.com/embedcode/slim-081711.css" rel="stylesheet" type="text/css">
<style type="text/css">
#mc_embed_signup{background:#fff; clear:left; font:14px Helvetica,Arial,sans-serif; }
/* Add your own MailChimp form style overrides in your site stylesheet or in this style block.
We recommend moving this block and the preceding CSS link to the HEAD of your HTML file. */
</style>
<div id="mc_embed_signup">
<form action="//mydomain.list-manage.com/subscribe/post?u=xxxxx&id=xxxxxx" method="post" id="mc-embedded-subscribe-form" name="mc-embedded-subscribe-form" class="validate" target="_blank" novalidate>
<div id="mc_embed_signup_scroll">
<label for="mce-EMAIL">Subscribe to our mailing list</label>
<input type="email" value="" name="EMAIL" class="email" id="mce-EMAIL" placeholder="email address" required>
<!-- real people should not fill this in and expect good things - do not remove this or risk form bot signups-->
<div style="position: absolute; left: -5000px;" aria-hidden="true"><input type="text" name="hash_number" tabindex="-1" value=""></div>
<div class="clear"><input type="submit" value="Subscribe" name="subscribe" id="mc-embedded-subscribe" class="button"></div>
</div>
</form>
</div>
Codepen
Could you guide me through the process?
A:
I started with the MailChimp Signup Form you gave and them I merged with the HTML/CSS code you wanted. Here's the code:
<div id="mc_embed_signup">
<form action="//mydomain.list-manage.com/subscribe/post?u=xxxxx&id=xxxxxx" method="post" id="mc-embedded-subscribe-form" name="mc-embedded-subscribe-form" class="validate" target="_blank" novalidate>
<div id="mc_embed_signup_scroll">
<ul>
<li class="append field">
<input type="email" value="" name="EMAIL" class="wide email input" id="mce-EMAIL" required>
<!-- real people should not fill this in and expect good things - do not remove this or risk form bot signups-->
<div style="position: absolute; left: -5000px;" aria-hidden="true"><input type="text" name="hash_number" tabindex="-1" value=""></div>
<div class="clear medium primary btn">
<input style="font-weight:bold;" type="submit" value="Go" name="subscribe" id="mc-embedded-subscribe" class="button">
</div>
</li>
</ul>
</div>
</form>
</div>
JSFIDDLE Demo:
https://jsfiddle.net/9f3db7Lw/1/
I tried with a 'domain.list-managed' i had to verify it if worked and it was ok. I think you can use it straight out the box if you replace with your domain.
Cheers,
Joel
|
SuperValu at Roches Stores
REDIRECT SuperValu (Ireland) |
122 Wn.2d 738 (1993)
863 P.2d 535
MIKHAIL KRAMAREVCKY, Respondent,
v.
THE DEPARTMENT OF SOCIAL AND HEALTH SERVICES, Petitioner. OLIVIA S. JINNEMAN, Respondent,
v.
THE DEPARTMENT OF SOCIAL AND HEALTH SERVICES, Petitioner.
No. 59514-3.
The Supreme Court of Washington, En Banc.
December 2, 1993.
Christine O. Gregoire, Attorney General, and Robert L. Schroeter and Sarah J. Coats, Assistants, for petitioner.
Barbara Baker of Puget Sound Legal Assistance Foundation and Elizabeth Schott and Yvette Hall War Bonnet of Evergreen Legal Services; Schroeter, Goldmark & Bender and William Rutzick, for respondents.
*740 JOHNSON, J.
The Department of Social and Health Services (DSHS) seeks review of a Court of Appeals determination that DSHS is estopped from recouping public assistance benefits it overpaid to the respondents. Mikhail Kramarevcky and Olivia Jinneman, the respondents, both qualified for public assistance benefits and provided DSHS with accurate information concerning their eligibility. At some point, DSHS began sending both respondents and their respective families an overpayment of benefits for which they were not qualified. They received these overpayments solely as a result of error on the part of DSHS, and through no fault or error of their own. The Court of Appeals held that equitable estoppel applied under the facts of these cases to estop DSHS from recouping these overpayments. We agree and affirm.
I
In 1987, a suit entitled Chaplin v. Sugarman, cause XX-X-XXXXX-X (Jan. 2, 1990) was filed in Thurston County Superior Court. The plaintiffs were a class of persons who had received overpayments of Medicaid or family assistance benefits because of some DSHS error. They sought a declaratory ruling that administrative law judges (ALJs) have the authority to consider equitable estoppel as a defense to the Department's recoupment claims.
DSHS opposed the action. It argued ALJs do not have the authority to consider equitable estoppel in the context of public assistance overpayments, and federal law requiring DSHS to recoup overpayments precluded application of estoppel. The Department also argued its acts of overpaying benefits should be deemed ultra vires under State v. Adams, 107 Wn.2d 611, 732 P.2d 149 (1987), thus precluding any application of the doctrine of equitable estoppel.
The Superior Court issued a memorandum opinion ruling in favor of the plaintiffs and rejecting each of the Department's arguments. DSHS did not appeal this ruling. The Superior Court entered an order directing DSHS to inform all class members of their right to request a hearing and to assert the defense of equitable estoppel. Mikhail Kramarevcky *741 and Olivia Jinneman were among the class of persons DSHS notified pursuant to the court's order.
Mikhail Kramarevcky is a refugee from the former Soviet Union. He arrived in the United States in April 1989 with his wife and minor son, Andre. The family speaks very little English and relied exclusively on DSHS for advice regarding their eligibility for public assistance. Between September 1989 and October 1990, the Kramarevckys received income and food assistance payments from DSHS under the Department's Family Independence Program (FIP).
In December 1989, Kramarevcky found a job and reported this to DSHS. He promptly gave the Department a copy of his first paycheck. DSHS failed, however, to follow its established procedures and did not send Kramarevcky monthly income report forms to complete and return. Uncertain as to what to do, Kramarevcky collected his wage receipts and brought them to DSHS in April 1990.
As a result of its failure to follow established procedures, DSHS did not take into account Kramarevcky's earned income when it computed his family's financial and food cash benefits during the 4-month period from February through May 1990. The Department later determined that Kramarevcky and his family had received an overpayment during this 4-month period of $1,375 in financial assistance and $262 in food assistance. DSHS sought to recoup this money from Kramarevcky.
An administrative hearing was held regarding these overpayments. Kramarevcky testified at the hearing with the aid of an interpreter. The ALJ found Kramarevcky had followed all proper procedures, had no reason to believe his eligibility had ceased, and could have been eligible for refugee job training reimbursement had he not received the overpayments. The ALJ also found both Kramarevcky and his wife are now partially disabled and have no income or resources with which to repay DSHS. The ALJ concluded each element of the defense of equitable estoppel had been met, and DSHS was estopped from recouping the overpaid amounts.
*742 Olivia Jinneman, the other respondent in this case, received categorically needy medical assistance under the Aid to Families with Dependent Children (AFDC) program between January 1988 and June 1989. This program is administered by DSHS. Jinneman provided accurate information to DSHS concerning her son Brandon's date of birth. Brandon turned 18 years old on April 29, 1988. He was not attending school at the time of his 18th birthday, and the family unit became ineligible for the AFDC program as a result. DSHS continued, however, to send Jinneman medical coupons from May 1, 1988, through June 30, 1989. Upon discovering its error, DSHS terminated Jinneman's medical assistance and assessed a $1,759.94 overpayment against her for medical assistance received during that 13-month period.
An administrative hearing was held regarding these overpayments. Jinneman testified at this hearing. The ALJ found that "[h]ad [Jinneman] been appropriately advised of medical assistance eligibility, she would have obtained alternative care such as from women's clinics, utilized medicine alternatives, or used other medical providers such as the fire department". Finding of fact 3 (Dec. 6, 1990). The ALJ also found Jinneman's average disposable income for the 11 months preceding the hearing was $527 a month, an amount barely adequate to meet her needs. As in Kramarevcky's case, the ALJ found each element of the defense of equitable estoppel had been met, and ruled DSHS was estopped from recouping the overpayments it had made to Jinneman.
DSHS sought review of the ALJs' decisions from a review judge in both the respondents' cases. In both cases, the review judge adopted the ALJs' findings of fact, but reversed the conclusions of law. The review judge ruled DSHS was not estopped from recouping the overpayments from either Kramarevcky or Jinneman.
The respondents sought judicial review. The Court of Appeals granted direct review and consolidated the two cases. The court reversed the review judge and reinstated the ALJs' determinations that DSHS was estopped from *743 recouping the overpayments it made to the respondents. Kramarevcky v. Department of Social & Health Servs., 64 Wn. App. 14, 822 P.2d 1227 (1992). DSHS sought review of the Court of Appeals decision, and this court granted review.
II
[1] The issue in these two consolidated cases is whether DSHS is equitably estopped under the facts of these cases from recouping public assistance benefits it overpaid to the respondents. The elements of equitable estoppel are: (1) a party's admission, statement or act inconsistent with its later claim; (2) action by another party in reliance on the first party's act, statement or admission; and (3) injury that would result to the relying party from allowing the first party to contradict or repudiate the prior act, statement or admission.[1]Robinson v. Seattle, 119 Wn.2d 34, 82, 830 P.2d 318, cert. denied, 121 L.Ed.2d 598 (1992). Equitable estoppel is based on the principle that:
a party should be held to a representation made or position assumed where inequitable consequences would otherwise result to another party who has justifiably and in good faith relied thereon.
Wilson v. Westinghouse Elec. Corp., 85 Wn.2d 78, 81, 530 P.2d 298 (1975).
Equitable estoppel against the government is not favored. See Finch v. Matthews, 74 Wn.2d 161, 169, 443 P.2d 833 (1968). Consequently, when a party asserts the doctrine against the government, two additional requirements must be met: equitable estoppel must be necessary to prevent a manifest injustice, and the exercise of governmental functions must not be impaired as a result of the estoppel. Shafer v. State, 83 Wn.2d *744 618, 622, 521 P.2d 736 (1974); Finch, 74 Wn.2d at 175. Courts should be most reluctant to find the government equitably estopped when public revenues are involved. Harbor Air Serv., Inc. v. Board of Tax Appeals, 88 Wn.2d 359, 367, 560 P.2d 1145 (1977).
A party asserting equitable estoppel against either the government or a private party must prove each element of estoppel with clear, cogent and convincing evidence. Pioneer Nat'l Title Ins. Co. v. State, 39 Wn. App. 758, 760-61, 695 P.2d 996 (1985) (equitable estoppel asserted against government); Colonial Imports, Inc. v. Carlton Northwest, Inc., 121 Wn.2d 726, 853 P.2d 913 (1993) (equitable estoppel asserted against private party). Under this burden of proof, the trier of fact must be convinced the fact in issue is "highly probable". Colonial Imports, 121 Wn.2d at 735; In re Sego, 82 Wn.2d 736, 739, 513 P.2d 831 (1973).
The Department has not placed the first two elements of equitable estoppel at issue. The Department apparently concedes its act of overpaying benefits to the respondents does satisfy the first element of estoppel, which involves an "act" inconsistent with a party's later claim. DSHS consequently has not raised the issue of whether its act of overpaying benefits is an ultra vires act to which equitable estoppel may not apply. See State v. Adams, 107 Wn.2d 611, 732 P.2d 149 (1987). DSHS did raise this argument before the Superior Court in Chaplin, and the Superior Court rejected it. See Chaplin v. Sugarman, Thurston Cy. cause XX-X-XXXXX-X (Jan. 2, 1990), mem. op. at 9. DSHS did not appeal the Superior Court's ruling and did not raise or brief the ultra vires question before the Court of Appeals or this court. The respondents argue collateral estoppel precludes reconsideration of issues decided by the Superior Court in Chaplin, and DSHS has not presented any briefing disputing this contention. This issue therefore remains for determination in an appropriate future case.
DSHS does argue, however, that the third element of equitable estoppel, which involves "injury" to the relying party, has not been established. The Department maintains that public *745 assistance recipients who received some overpayment for which they are later deemed substantively ineligible can never establish an "injury", as a matter of law, regardless of the particular facts of each case.
The Court of Appeals relied on the following two cases in determining that a party's substantive ineligibility is not a per se bar to establishing an "injury" for the purposes of equitable estoppel: Wilson v. Westinghouse Elec. Corp., 85 Wn.2d 78, 530 P.2d 298 (1975) and West v. Department of Social & Health Servs., 21 Wn. App. 577, 586 P.2d 516 (1978), review denied, 92 Wn.2d 1032 (1979).
In Wilson, the plaintiff had the option of either seeking early retirement with his private employer or seeking another position with the employer in a different capacity. He chose retirement based on the employer's representation regarding the amount he would receive as a monthly pension. A year later, the employer discovered it had overcalculated the plaintiff's pension benefits and sought to recoup the overpayments. The court held equitable estoppel precluded this recoupment. Wilson, 85 Wn.2d at 82. The court stated:
the plaintiff properly assumed that the payments tendered to him were accurate and structured his life accordingly. To allow [the employer] to repudiate its original representations and to require the plaintiff to repay the excess payments at this time would be highly inequitable and prejudicial.
Wilson, 85 Wn.2d at 82. Like the respondents in these cases, the plaintiff in Wilson was not substantively eligible for the overpayments. However, this fact did not bar consideration of whether equitable estoppel applied under the facts of that case.
DSHS maintains Wilson does not apply because estoppel was sought in that case against a private party, not the government. However, the "injury" element applies under Washington law to claims of estoppel against both private and governmental entities. Colonial Imports, at 734 (private party); Board of Regents v. Seattle, 108 Wn.2d 545, 551, 741 P.2d 11 (1987) (government). The court's interpretation of the "injury" element in Wilson therefore has relevance for *746 determining whether "injury" can be established in these cases.
The Court of Appeals also relied on West v. Department of Social & Health Servs., 21 Wn. App. 577, 586 P.2d 516 (1978), review denied, 92 Wn.2d 1032 (1979) in interpreting the "injury" requirement. In West, a mother placed her children in foster care. At the time, she was not properly informed by DSHS that she would incur financial obligations as an immediate result of this placement. The Department later sought payment of this financial obligation. The Court of Appeals held the elements of equitable estoppel had been met, and DSHS was estopped from collecting payment from the mother. West, 21 Wn. App. at 580. The mother in West was not substantively eligible for cost-free foster care. However, this substantive ineligibility did not bar the court from considering whether equitable estoppel applied under the facts of the case.
DSHS argues West should not be considered because it is not consistent with this court's decision in Griffin v. Department of Social & Health Servs., 91 Wn.2d 616, 590 P.2d 816 (1979). This contention lacks merit. In Griffin, parents placed their child in foster care and were informed at the time of their obligation to pay for this care and did not dispute their ability to pay. Griffin, 91 Wn.2d at 625-26. The court rejected the parents' later contention that equitable estoppel precluded DSHS from billing the parents for the child's care. Griffin, 91 Wn.2d at 631. Unlike the parents in Griffin, the mother in West was not informed of her support obligation at the time she placed her child in foster care. West is therefore distinguishable and not inconsistent with Griffin.
[2] Both West and Wilson support the Court of Appeals determination that a party's substantive ineligibility to receive a benefit is not a per se bar to establishing an "injury" for equitable estoppel purposes, and we agree with this determination. We note that courts in other jurisdictions have also reached decisions consistent with this conclusion. See, e.g., Fraga v. Department of Health & Rehab. Servs., *747 464 So.2d 144 (Fla. Dist. Ct. App. 1984); Kruse v. Department of Public Aid, ___ Ill. App.3d ___, 596 N.E.2d 743 (1992). The parties in these cases are therefore not barred from establishing an "injury" for the purposes of equitable estoppel.
[3] DSHS also argues the Court of Appeals erred because it held a party can always establish the "injury" requirement merely through his or her obligation to repay the overpayments. This argument mischaracterizes the nature of the Court of Appeals holding. The Court of Appeals determined more was required to establish "injury" than the mere obligation to repay. The court's opinion indicates that parties meet the "injury" requirement if they reasonably rely on the actions of another and change their position to their detriment as a result of this reliance. Kramarevcky, 64 Wn. App. at 22.
This interpretation of the "injury" requirement is consistent with prior Washington cases. To establish an "injury" for equitable estoppel purposes, a party must establish he or she justifiably relied to his or her detriment on the words or conduct of another. See Safeco Ins. Co. of Am. v. Butler, 118 Wn.2d 383, 405, 823 P.2d 499 (1992). In Washington, injury, prejudice and detrimental reliance have been used interchangeably to express the requirement that a party asserting equitable estoppel must show a detrimental change of position. State ex rel. Shannon v. Sponburgh, 66 Wn.2d 135, 143-44, 401 P.2d 635 (1965); Woodworth v. School Dist. 2, 92 Wash. 456, 463, 159 P. 757 (1916); Butler v. Supreme Court of Indep. Order of Foresters, 53 Wash. 118, 124, 101 P. 481 (1909).
The Court of Appeals determined "injury" in the form of detrimental reliance has been established under the facts of these cases, and it relied on the ALJs' findings of fact in reaching this conclusion. In Kramarevcky's case, the ALJ found that had DSHS correctly accounted for his earned income, Kramarevcky could have been eligible for job training reimbursement through the Refugee Assistance Program. *748 See WAC 388-55 (refugee assistance). In Jinneman's case, the ALJ found that if Jinneman had been properly advised of her eligibility, she would have obtained alternative care, utilized medicine alternatives, or used other medical providers such as the fire department or women's clinics.
The review judge adopted the ALJs' findings in both Kramarevcky's and Jinneman's case, noting the findings were based on the ALJs' opportunity to assess the credibility of the witnesses. The Court of Appeals determined these findings were sufficient to establish detrimental reliance in these two cases, and DSHS has not sought review of this determination from this court. The "injury" requirement has therefore been met in these cases.
[4, 5] DSHS next argues the Court of Appeals erred in determining the "manifest injustice" element had been met in these cases. The Department maintains the Court of Appeals erred because it inquired into the hardship the individual respondents would suffer if DSHS were allowed to recoup the overpayments. DSHS argues the court should have instead evaluated manifest injustice from the standpoint of all public assistance recipients who would suffer if DSHS were estopped because less money would be available for them.
The Department fails to cite any authority which lends support to the position that manifest injustice is to be determined by reference to third parties not involved in the particular proceeding. It is logical and appropriate for courts to inquire whether equitable estoppel is required to prevent manifest injustice to the party seeking estoppel. See, e.g., Harbor Air Serv., Inc. v. Board of Tax Appeals, 88 Wn.2d 359, 367, 560 P.2d 1145 (1977); Hasan v. Eastern Wash. Univ., 24 Wn. App. 829, 834-35, 604 P.2d 191 (1979).
In analyzing whether the respondents met their burden of showing they would suffer a manifest injustice, the Court of Appeals considered the following factors: (1) the respondents did not have the resources to repay the debt without drawing on funds currently needed to meet their most basic needs; (2) the respondents provided DSHS with timely and accurate *749 information, and the overpayments resulted solely from the Department's error; (3) the overpayments involved a continuation of benefits for which the respondents had been eligible, and there was no reason they would have been alerted to the fact of overpayment; and (4) there was no evidence the respondents were abusing the public assistance system. Kramarevcky, 64 Wn. App. at 23-24. These factors establish the "manifest injustice" element has been met in these cases.
DSHS also argues the Court of Appeals erred in determining that application of estoppel in these two cases will not impair governmental functions. The Court of Appeals observed the overpayments in this case resulted from DSHS' error alone, and estoppel may provide an impetus for DSHS to more adequately monitor and control such payments. Kramarevcky, 64 Wn. App. at 26. DSHS strenuously objects to the Court of Appeals observation that estopping DSHS in these cases could improve rather than impair governmental functions. However, the Department has not cited adequate authority supporting the contention that the Court of Appeals otherwise erred in concluding estoppel would not impair governmental functions in these cases.
[6] Finally, DSHS argues the respondents should be denied the defense of equitable estoppel as a matter of public policy. The Department points out it is required by statute to take necessary steps to recoup overpaid amounts from public assistance recipients. See 42 U.S.C. § 602(a)(22). DSHS maintains the application of equitable estoppel would be inconsistent with this statutory requirement, and therefore estoppel should not apply in this context. However, estoppel principles have been recognized in Washington for at least the past 100 years. See, e.g., Spokane St. Ry. v. Spokane Falls, 6 Wash. 521, 33 P. 1072 (1893) (city estopped from claiming it did not authorize building of railroad tracks). The court is therefore reluctant to find an abrogation of estoppel principles absent a clear showing of legislative intent. See Ames v. Department of Labor & Indus., 176 Wash. 509, 513-14, 30 P.2d 239, 91 *750 A.L.R. 1392 (1934). DSHS has not provided adequate support for the contention that such an intent has been evidenced in this context.
III
DSHS raises additional arguments that it did not raise below, and we decline to consider these arguments. RAP 2.5(a); Kennedy v. Seattle, 94 Wn.2d 376, 383, 617 P.2d 713 (1980). We conclude equitable estoppel properly applies under the facts of these cases. The Court of Appeals is affirmed.
ANDERSEN, C.J., and UTTER, SMITH, and GUY, JJ., concur. MADSEN, J. (dissenting)
In this case, the majority estops the Department of Social and Health Services (DSHS) from recouping benefits illegally and mistakenly conferred to the respondents. In doing so, the majority holds that substantive eligibility is not a requirement in establishing the injury element of estoppel against the government. The majority does so without addressing the related issue of whether the benefits constituted ultra vires acts to which estoppel does not apply. The majority's resolution of the case, however, implicitly determines this issue in a manner contrary to established precedent. A review of the rules controlling estoppel against the government indicates that the elements of estoppel against the government have not been established by the respondents.
ANALYSIS
The elements of equitable estoppel are: (1) an act or admission by the first party; (2) an act by another party in reliance on the first party's act; (3) an injury that would result to the relying party if the first party were not estopped from repudiating the original act. Robinson v. Seattle, 119 Wn.2d 34, 82, 830 P.2d 318, cert. denied, 121 L.Ed.2d 598 (1992). This court has generally been reluctant to apply the doctrine of equitable estoppel against the government, especially where public funds are implicated. Harbor Air Serv., Inc. v. Board of Tax Appeals, 88 Wn.2d 359, 367, 560 P.2d 1145 (1977); State ex rel. Bain v. Clallam Cy. Bd. of Comm'rs, 77 Wn.2d 542, *751 548, 463 P.2d 617 (1970); Finch v. Matthews, 74 Wn.2d 161, 443 P.2d 833 (1968); Wasem's, Inc. v. State, 63 Wn.2d 67, 70, 385 P.2d 530 (1963). A party asserting estoppel against the government is held to a higher standard than a party asserting estoppel against a private entity. Such parties are additionally required to show that estoppel is necessary to prevent a manifest injustice and that the estoppel will not impair governmental functions. Pioneer Nat'l Title Ins. Co. v. State, 39 Wn. App. 758, 760-61, 695 P.2d 996 (1985). Finally, parties asserting estoppel against the government must prove each element of estoppel with clear, cogent, and convincing evidence. Chemical Bank v. WPPSS, 102 Wn.2d 874, 905, 691 P.2d 524 (1984), cert. denied, 471 U.S. 1065, 471 U.S. 1075 (1985).
In this case, not one of the three elements of general estoppel has been satisfied: an act by the government, an act in reasonable reliance by the respondents, and an injury to respondents. The majority recognizes the first two issues, but refuses to fully reach them stating "[t]he Department has not placed the first two elements of equitable estoppel at issue." Majority, at 744. While it is generally true that this court confines itself to issues raised in the petition for review, the elements of estoppel are all interrelated and, in this case, the majority's decision implicates these other issues in a manner contrary to established law. In any case, an appellate court has inherent authority to consider issues which were not raised on appeal, or even at trial, if necessary for a proper decision. Falk v. Keene Corp., 113 Wn.2d 645, 659, 782 P.2d 974 (1989); Wood v. Postelthwaite, 82 Wn.2d 387, 510 P.2d 1109 (1973); Siegler v. Kuhlman, 81 Wn.2d 448, 502 P.2d 1181 (1972), cert. denied, 411 U.S. 983 (1973); RAP 12.1(b).[2] Finally, the parties have not shown that the application *752 of estoppel is necessary to avoid a manifest injustice or that the estoppel will not impair government functions.
A
Respondents Were Not Injured Because They Were Never Substantively Eligible for the Benefits
Contrary to the majority's opinion, substantive eligibility is an essential requisite in establishing the injury element of estoppel. Washington courts use injury, prejudice, and detrimental reliance interchangeably to express the premise that there must be a detrimental change in position due to reasonable reliance on an act. Butler v. Supreme Court of Indep. Order of Foresters, 53 Wash. 118, 124, 101 P. 481 (1909); Woodworth v. School Dist. 2, 92 Wash. 456, 159 P. 757 (1916); State ex rel. Shannon v. Sponburgh, 66 Wn.2d 135, 143-44, 401 P.2d 635 (1965). While Washington courts have not yet decided the issue of substantive eligibility as a pre-requisite for finding injury, federal courts have required a public assistance recipient to be substantively eligible for the benefit received before they will find an injury for purposes of estoppel. Heckler v. Community Health Servs. of Crawford Cy., Inc., 467 U.S. 51, 60, 81 L.Ed.2d 42, 104 S.Ct. 2218, 2224 (1984); Kennedy v. United States, 965 F.2d 413 (7th Cir.1992).
In Heckler, an agent of the Department of Health and Human Services informed a charitable health care provider that certain services provided for Medicare patients were reimbursable as reasonable Medicare expenses. The health care provider received reimbursement for several years until the agent discovered its error and requested reimbursement. The Supreme Court, in holding that estoppel could not be applied against the government, determined that the health *753 care provider's injury was the inability to retain money that it should never have received. Thus, the Heckler Court stated, there was no "legal right, either vested or contingent, or suffered any adverse change in its status" that could be characterized as detrimental reliance. Heckler, 467 U.S. at 61-62.
In Kennedy, the plaintiff failed to pay federal taxes and settled the debt with the Internal Revenue Service (IRS) for $23,382.20. An agent for the IRS sent the plaintiff a document reflecting the settlement amount. The plaintiff modified the document indicating that this amount was sufficient to satisfy the debt and all potential penalties. Later, a revenue officer aide discovered that the correct amount owed was $52,043.70. The plaintiff sought to estop the government from seeking repayment.
The Seventh Circuit reasoned that the parties never had the authority to enter into the settlement agreement and that the plaintiff received a benefit "[he] should never have received in the first place". Kennedy, at 418. The court cited Heckler for the proposition that "an estoppel claimant [is required] to demonstrate he or she was statutorily entitled to a benefit before the claimant can argue detriment from loss of the benefit at the government's hands". Kennedy, at 418 n. 2. The court ultimately held that the estoppel doctrine could not be used against the government "when the estoppel claimant's detriment is the loss of a windfall that could have never been statutorily effectuated through the process the claimant attempted to use". Kennedy, at 419.
Some state courts, most notably California and Oregon, have also distinguished between procedural eligibility and substantive eligibility in establishing the injury element of estoppel against the government. In Lentz v. McMahon, 49 Cal.3d 393, 777 P.2d 83, 261 Cal. Rptr. 310 (1989), the California Court of Appeal reasoned:
Estoppel against a county's assertion of purely procedural preconditions and limitations on benefits, when the county itself is responsible for the procedural default, will not defeat the underlying statutory policy of safeguarding accurate and *754 orderly administration of the welfare system. The policy considerations may well be different, however, when substantive preconditions of benefits are in issue.
Lentz, at 401. The court ascribed to the Supreme Court's view that it is "`"the duty of all courts to observe the conditions defined by [the legislative branch] for charging the public treasury."'" Lentz, at 402 (quoting Schweiker v. Hansen, 450 U.S. 785, 788-89, 67 L.Ed.2d 685, 101 S.Ct. 1468 (1981)). The Lentz court held that to prevent the State from recouping public benefits where the recipient was not substantively eligible "might amount to a bestowal of benefits not contemplated by the Legislature".[3]Lentz, at 402.
In reaching its decision, the court relied on other state decisions elucidating the same distinction. Lentz, at 401. In particular, the court relied on Thrift v. Adult & Family Servs. Div., 58 Or. App. 13, 646 P.2d 1358 (1982) and Glover v. Adult & Family Servs. Div., 46 Or. App. 829, 613 P.2d 495 (1980). In Glover, the Oregon Court of Appeals estopped a welfare agency from applying a "prior authorization" requirement and thereby declining to cover costs for medical treatment. The court reasoned that the applicant was substantively eligible for the services and had attempted to obtain the prior authorization, but that the agency had failed to process the forms correctly. Glover, at 836-37.
Later, in Thrift, the Oregon Court of Appeals revisited the issue in a case where an applicant, through an agency error, received an overpayment of benefits for which she was not substantively eligible. The court noted, "[t]his is not a case where agency error caused the petitioner to lose a benefit to which she was otherwise entitled" and declined to estop the agency from seeking reimbursement. Thrift, at 17; accord, Howard v. Employment Div., 63 Or. App. 227, 232-33, 663 P.2d 429, 432, review denied, 295 Or. 631 (1983); see Allen v. *755 Neal, 217 Tenn. 181, 396 S.W.2d 344 (1965) (holding that party cannot establish injury simply by not receiving a benefit that he had no right to receive in the first place).
The majority here, like the Court of Appeals below, states that the law has changed in Oregon and points to a more recent Oregon Court of Appeals case. In In re Tax Rate Assessment of Western Graphics Corp., 76 Or. App. 608, 710 P.2d 788 (1985) an agent of the Oregon Employment Division, acting within his authority, misinformed the party asserting estoppel that participation in a shared work plan would not affect the party's tax rate when, in fact, it raised the tax rate 75 percent higher. Western Graphics, at 612-13. The Western Graphics court distinguished between its earlier decision in Thrift, where the party asserting estoppel was not permitted to retain a windfall erroneously conferred by the State, and the case at hand where "[n]o benefits were lost" but the employer was required to pay higher taxes because of the misleading statements of the state agent. Western Graphics, at 613. The Oregon Court of Appeals held that estoppel applied to prevent the Oregon Employment Division from enforcing the higher tax rate. Western Graphics, at 616.
Although the court in Western Graphics did allow estoppel against the government, substantive eligibility was not an issue. There was no question that the party asserting estoppel was substantively eligible to participate in the shared work plan or that allowing the party to participate in that plan was within the Oregon Employment Division's authority. Rather, the issue was the government's ability to collect the higher taxes which the claimant would not have been responsible for were it not for the agency's affirmative misrepresentations. Western Graphics holds nothing more than that affirmative misconduct with respect to matters within an agency's authority may justify estoppel where sufficiently egregious. Accord, Wiggins v. Barrett & Assocs., Inc., 295 Or. 679, 691, 669 P.2d 1132 (1983) (affirmative representations of government agent justified estopping government); Pilgrim Turkey Packers, Inc. v. Department of Rev., 261 Or. 305, 493 P.2d 1372 (1972) *756 (ambiguous nature tax instructions misled party asserting estoppel and in turn supported applying estoppel against the government); Johnson v. Tax Comm'n, 248 Or. 460, 435 P.2d 302 (1967) (taxing authorities misled plaintiff into relying on tax form justified estopping the government from denying tax exemption). Western Graphics does not lend authority to the majority's conclusion that substantive eligibility is unnecessary for a finding of injury in estoppel.
Western Graphics is consistent with other Washington cases holding that estoppel may be applied against the government where the party asserting estoppel would not have been injured were it not for some affirmative act of the state agency within that agency's authority.[4]Shafer v. State, 83 Wn.2d 618, 624-25, 521 P.2d 736 (1974) (where Attorney General, acting within his authority, indicated that plaintiff should wait until all medical expenses had been incurred before filing claim, estoppel operated to prevent the State from asserting that claim was not timely); Shannon, 66 Wn.2d at 143 (where Liquor Control Board, acting within its authority, approved a change in location of licensee's premises, estoppel operated to prevent Liquor Control Board from reversing its decision).
This case does not involve the kind of affirmative misconduct that occurred in Western Graphics. DSHS never affirmatively informed Kramarevcky that he would continue to receive the same benefits even after he was employed. Neither did DSHS affirmatively state to Jinneman that she would continue to receive medical benefits after her son was through with school and 18 years old. Rather, in this case the State simply failed to reduce or cease benefits appropriately when the recipient was no longer substantively eligible.[5]
*757 The majority also relies on Wilson v. Westinghouse Elec. Corp., 85 Wn.2d 78, 530 P.2d 298 (1975) and West v. Department of Social & Health Servs., 21 Wn. App. 577, 586 P.2d 516 (1978), review denied, 92 Wn.2d 1032 (1979) for the notion that some Washington cases suggest that substantive eligibility is not a requirement in estoppel cases against the government.
In Wilson, the plaintiff chose to retire early based on his private employer's representation of benefits under the employee retirement plan. After the plaintiff retired, the employer notified him that its earlier representation of the benefits was incorrect. The plaintiff sought to estop his former employer from reducing benefits under equitable estoppel. The court held that the parties were mutually mistaken as to the amount of the benefits under the retirement plan. It ruled that, although Westinghouse could not recoup excess benefits already paid, it could reduce subsequent benefits to the correct amount.
Wilson is inapplicable to the instant case. First, in Wilson, estoppel was being asserted against a private party rather than the government. The burden on a party seeking to assert estoppel against the government is much higher because the orderly administration of government functions and the maintenance of the public treasury are implicated. Finch v. Matthews, 74 Wn.2d 161, 169-70, 443 P.2d 833 (1968). Second, in Wilson, overpayment was not the only act that induced the reliance of the party asserting estoppel. *758 The supervisor had affirmatively represented the value of the retirement benefits to the party asserting estoppel who, in turn, forwent other benefit options available to him.
Likewise, West offers little insight into the present case because substantive ineligibility was not an issue. West concerned the ability of DSHS to enforce an obligation for the financial support of a child in foster care. In West, the appellant mother put her children in foster care and signed a document stating:
I (WE) AM AWARE THAT MY CHILD IS TO BE PLACED IN FOSTER CARE, BY COURT ORDER OR BY MY REQUEST AND THAT FINANCIAL SERVICES OF DSHS WILL CONTACT ME IN RELATION TO FINANCIAL SUPPORT OF MY CHILD.
West, at 578. DSHS did not provide the mother of the children with any other notice that she would incur financial obligations by placing her children in foster care. Approximately 1 year later, DSHS served the appellant with a "Notice and Finding of Financial Responsibility". Appellant immediately removed her children from foster care and contested the debt. Upon reaching the court, she argued that DSHS was estopped from seeking payment because its notice was insufficient to apprise the appellant that she would have to pay for the foster care. The court held that the notice provided by DSHS was ambiguous and insufficient. The court estopped the agency from seeking payment.
The majority states that "[t]he mother in West was not substantively eligible for cost-free foster care." This statement misses the mark. Majority, at 746. The appellant in West was eligible to put her children in foster care, she just was not eligible for cost-free foster care. DSHS did not act beyond its authority in conferring the benefit to the mother. By failing to adequately inform her that she would incur some financial obligation for the care, DSHS acted in a manner that was binding on the State. Thus, appellant could successfully assert estoppel. The facts in West clearly render the case inapplicable in this instance. See Harbor Air Serv., Inc. v. Board of Tax Appeals, 88 Wn.2d 359, 367, 560 P.2d 1145 (1977) (where Department of Revenue, acting within its *759 authority, issued a correct, but misleading, statement limiting tax assessment, estoppel operated to prevent Department from later imposing additional taxes).
Finally, the majority asserts that injury was established in these cases in the ALJ's determination that, had the parties in this case known that their benefits would cease, they "would" or "could" have found benefits elsewhere. Majority, at 747-48. Elements established by virtue of speculation or conjecture are insufficient to warrant estoppel. PUD 1 v. Cooper, 69 Wn.2d 909, 918, 421 P.2d 1002 (1966). Even minimal showings of injury, or mere inconvenience, are insufficient for purposes of applying estoppel. Federal Way Disposal Co. v. Tacoma, 11 Wn. App. 894, 898, 527 P.2d 1387 (1974); Coalition on Gov't Spying v. King Cy. Dep't of Pub. Safety, 59 Wn. App. 856, 865, 801 P.2d 1009 (1990). In each of these cases, however, the administrative review judge found that evidence of detrimental reliance was insufficient.
In the case of Jinneman, the review judge held that "[i]n order for the ALJ to find that other programs would have been available to the Appellant, clear, cogent, and convincing evidence of the available assistance must be in the record." Review Decision (Jinneman), at 8. The review judge noted that the evidence was based only on "speculation" and "conjectur[e]", and held that "[i]n order to establish the element of injury, evidence in the record must exist to support a determination that other benefits were forfeited by the Appellant because of the receipt of the overpaid assistance and to show all or what part of the overpaid assistance could have been avoided." Review Decision (Jinneman), at 8.
Likewise, in Kramarevcky's case, the review judge reversed the ALJ's finding of injury which was based on the assumption that Kramarevcky "could have been eligible" for other aid. The review judge stated that in order for injury to be found from lost benefits, the availability of other benefits must be caused by the overissued assistance and the injury will only be equal to the amount of benefits proved lost "in the record by clear, cogent, and convincing evidence." Review Decision (Kramarevcky), at 4. The review judge reversed the *760 ALJ's conclusion of law because the record did not rise to the level of proof needed to show that alternative aid was available or that the amount of alternative aid would have been anywhere near the amount of the overpayment of benefits. Review Decision (Kramarevcky), at 4.
In conclusion, respondents cannot establish the injury element of estoppel because they were not substantively eligible for the benefits conferred in the first place. Although no Washington cases have dealt specifically with the issue, the majority's holding that substantive eligibility is not required when asserting estoppel against the government runs contrary to federal law and the law in other states. Furthermore, the respondents have failed to show by clear, cogent, and convincing evidence that they suffered an injury by forgoing other benefits or that the benefits allegedly forgone equaled the benefits improperly conferred in value.
B
The Act by DSHS Was Ultra Vires, and Estoppel Cannot Be Asserted Against the Government for Ultra Vires Acts
The majority fails to acknowledge that since the benefits in this case were not authorized by law, the acts of conferring them to the recipients were ultra vires acts to which estoppel may not apply. Furthermore, the majority's resolution of this case necessarily resolves the ultra vires issue contrary to established precedent.
It has long been the law in Washington that where a public agency acts beyond its legal authority causing injury to another, and that agency had no right to commit the act, the State, and public funds, cannot be held responsible. Wendel v. Spokane Cy., 27 Wash. 121, 124, 67 P. 576 (1902). Such acts are deemed ultra vires and do not meet the first estoppel element of an act by the first party; thus, the doctrine of equitable estoppel cannot prevent the State from repudiating them. State v. Adams, 107 Wn.2d 611, 614, 732 P.2d 149 (1987). In other words, the State does not "act" and will not be held estopped based on the ultra vires actions of its officers. *761 Board of Regents of UW v. Seattle, 108 Wn.2d 545, 552, 741 P.2d 11 (1987).
In this case, the Superior Court held simply that the actions of the State were "not ultra vires [acts] as that term was defined in Board of Regents ... and cases cited therein." Chaplin v. Sugarman, Thurston Cy. cause XX-X-XXXXX-X (Jan. 2, 1990), mem. op. at 9. A closer reading of Regents, and an analysis of the ultra vires doctrine, however, reveals that the Superior Court's ruling was in error.
In Regents, the Attorney General for the State failed to appear at a condemnation proceeding brought in 1906 by the City of Seattle and the court entered a default judgment in favor of the city. Regents, at 547. Some 80 years later, the State argued it was "not bound to the acts of the Attorney General in the 1906 litigation" because those acts were "ultra vires". Regents, at 552. The court distinguished between irregular acts within an agency's authority and ultra vires acts wholly without authority. It reasoned that, although the State was not bound by ultra vires acts, "[a]n act of an officer which is within his realm of power, albeit imprudent or violative of a statutory directive, is not ultra vires."[6]Regents, at 552 (citing Haslund v. Seattle, 86 Wn.2d 607, 622, 547 P.2d 1221 (1976); Seattle v. P.B. Inv. Co., 11 Wn. App. 653, 662, 524 P.2d 419 (1974)). The court held that the State was bound by the Attorney General's failure to appear in 1906. Regents, at 552.
The distinction between ultra vires acts and mere irregular acts for purposes of estoppel is not novel. A seminal case making this distinction is Wendel. In Wendel, a homesteader brought an action against Spokane County for damages caused by road construction. The county defended itself by arguing that it could not be held responsible for the unlawful *762 acts of its officers because such acts were ultra vires. Wendel, at 124. The court stated:
[W]e must not lose sight of the distinction which exists between acts which are absolutely ultra vires by reason of the corporation having no authority to act on the subject-matter it being wholly beyond the scope of its powers and those acts which in a sense are termed ultra vires, where the body has jurisdiction of the subject-matter, but, in the execution of its authority, trespasses upon the rights of others.
Wendel, at 124. Since the construction of the road was clearly within the authority of the county, and the county could have constructed the road without complication had it been more careful, the county could not defend itself under the ultra vires exception. Wendel, at 124.
The distinction in Wendel was reiterated in Haslund. In Haslund, a developer brought an action against the City of Seattle for damages arising out of the issuance of an invalid building permit. The permit violated the building code because it was issued conditionally. The city argued that the permit was ultra vires because it violated the code and, therefore, the city could not be held responsible. The court distinguished between ultra vires acts and irregular acts:
An ultra vires act is one performed without any authority to act on the subject. Here there is no plausible claim that the City did not have authority, through its building department, to issue building permits.
(Citation omitted.) Haslund, at 622 (citing Wendel). The court held that since the city could have issued a valid permit "the defense of ultra vires action is unavailable to [the city]". Haslund, at 622.
In P.B. Inv. Co., 11 Wn. App. at 654, the court considered a 1920 Seattle ordinance authorizing an irrevocable grant to use city streets. The City of Seattle argued that such a grant prejudiced the public, was beyond the city's authority and was, thus, ultra vires. The court held that although the grant was improper, the city could have accomplished the same by vacating the unneeded portion of the street thereby causing title to revert to the abutting property owner. The *763 court held that "[i]nasmuch as the City had the power to do what it did through the vacation process, it cannot be said that the City's act was ultra vires, ... even though the procedure it followed the granting of a private use by ordinance was itself defective." P.B. Inv., at 663; see also Noel v. Cole, 98 Wn.2d 375, 379, 655 P.2d 245 (1982) (estoppel applied against Department of Natural Resources to enforce timber contract even though environmental impact statement was lacking where contract was not ultra vires, but merely unauthorized and irregular, and where government would be unjustly enriched); Shafer, 83 Wn.2d at 618 (Attorney General's advice to delay filing of claim was improper but within its authority and constituted grounds to estop the State from arguing claim was untimely); Finch v. Matthews, supra (action in exchanging existing right of way for more convenient right of way without going through proper statutory methods was not ultra vires but merely unauthorized and irregular).
These cases demonstrate that agency actions that are improper but within an agency's legal authority are not ultra vires, but are irregular and unauthorized and do not bar estoppel. Conversely, acts wholly beyond an agency's authority are ultra vires and estoppel may not apply. State v. Adams, supra; Washington Educ. Ass'n v. Smith, 96 Wn.2d 601, 638 P.2d 77 (1981); Arbogast v. Westport, 18 Wn. App. 4, 567 P.2d 244, review denied, 89 Wn.2d 1017 (1977).
In Adams, a payroll computer had been programmed to give state employees a raise that was expected to be passed by the Legislature. The Legislature did not approve the raise, but the computer put it into effect anyway. The State then attempted to seek reimbursement from the employees who were overpaid and the employees asserted estoppel against the government. The court held that since neither the State nor the computer had authority to give the employees a raise, its acts must have been ultra vires and the equitable estoppel argument could not be applied against the government to stop it from seeking reimbursement. Adams, at 614-15.
*764 In Washington Educ. Ass'n, the agency had instituted a voluntary payroll deduction to facilitate contributions to political action committees. Pursuant to an attorney general opinion which held that the agency had no statutory authority for such deductions, the agency terminated the deductions. Washington Educ. Ass'n, at 604. The political action committees sought to estop the agency from terminating the deductions. The court held that, since the agency had no authority to make such deductions, its acts were ultra vires and equitable estoppel could not apply. Washington Educ. Ass'n, at 610.
In Arbogast, the Westport Police Department terminated the plaintiff's employment as dispatcher. At the time the plaintiff was discharged she was within a 1-year probationary period for new employees. The plaintiff argued that the probationary period was invalid and that only the mayor could discharge her. The mayor promptly discharged her and the plaintiff brought suit. The mayor then offered the plaintiff permanent employment and placed the plaintiff on a 45-day suspension while the city evaluated the legality of the probationary period. Subsequent to the suspension period, the mayor determined that the probationary period was legal and again terminated the plaintiff. Arbogast, at 6. The plaintiff sought to estop the mayor, arguing that she had turned down other employment opportunities during the suspension period. The plaintiff cited Haslund as support for her argument and the court stated:
Appellant argues that Haslund v. Seattle, 86 Wn.2d 607, 547 P.2d 1221 (1976), should determine the outcome of this case. In Haslund, the city building inspector issued a building permit and attached unauthorized conditions to it. The city was estopped from denying the validity of the permit, notwithstanding the illegality of the conditions. But in that case, the building inspector had the power to issue permits. He merely did so in an unauthorized manner. The present case in not analogous. Here the mayor had no authority to waive the 1-year probation period. It would be a different situation if he did have such authority but exercised it in violation of the ordinance's guidelines or added unauthorized conditions to the waiver.
*765 Arbogast, at 8. The court held that the mayor's acts were ultra vires and that the plaintiff could not apply estoppel. Arbogast, at 7; see also Barendregt v. Walla Walla Sch. Dist. 140, 26 Wn. App. 246, 611 P.2d 1385 (state penitentiary supervisor of education acted ultra vires when he committed the State to indemnifying the school district for wrongful termination liability), review denied, 94 Wn.2d 1005 (1980); Fitzgerald v. Neves, Inc., 15 Wn. App. 421, 550 P.2d 52 (1976) (prosecuting attorney's promises to "take care of the problem" were without any statutory authority and, therefore, ultra vires).
Under the preceding case law, a governmental agency acts ultra vires when it acts beyond its authority, and acts irregularly where it acts improperly but within its authority. In the two cases at hand, DSHS had no statutory authority to confer the benefits to the plaintiffs. Its acts were, therefore, ultra vires.
In Kramarevcky's case, DSHS should have reduced benefits when it began receiving Kramarevcky's paycheck stubs from his new job. DSHS had no authority to offer Kramarevcky the same benefits after he started his job. Likewise, Jinneman should not have received medical coupons for her son after he turned 18. In both of these cases, DSHS could not have offered the benefits legally under any other authority. These are not cases like Haslund, or P.B. Indus., where the agency could have accomplished the same result legally through different means. Rather, DSHS simply acted beyond its statutory authority and its acts were, therefore, ultra vires.
The majority justifies its failure to reach the ultra vires issue on the fact that DSHS did not place the "act" element at issue on appeal. Since benefits paid to substantively ineligible recipients are by nature ultra vires acts, however, DSHS implicitly raised the ultra vires issue by placing the "injury" element at issue on appeal. Moreover, although the majority states that the ultra vires issue "remains for determination in an appropriate future case" it implicitly determines the issue *766 by holding that estoppel may be asserted against the government for overpayments even where the recipient is substantively ineligible. Majority, at 744-45. Substantive ineligibility goes to the heart of whether the governmental act was ultra vires.
A benefit that is paid out to a recipient by an agency wholly without statutory authority is an ultra vires act. Such a recipient is also per se substantively ineligible for the benefit because no statute authorized the recipient to receive, or DSHS to confer, the benefit. Therefore, to hold that estoppel may be asserted against the government, even where the recipient was substantively ineligible, is to hold that estoppel may be asserted against the government even where it acts ultra vires.
As explained above, the majority relies on Wilson for the assertion that substantive eligibility is not a requirement in estoppel cases. The majority's use of Wilson is indicative of its failure to recognize the applicability of the ultra vires issue, and the necessity of that issue's resolution to this case.
DSHS argued in its brief that Wilson does not apply in the context of substantive eligibility because it involved a private party, not the government. The majority dismisses this argument by pointing out that "the `injury' element applies under Washington law to claims of estoppel against both private and governmental entities." Majority, at 745. This statement again misses the mark. While it may be true that injury is an element of estoppel even against the government, as was the case at the time Wilson was decided, the ultra vires defense to estoppel only applies in the governmental context. Noel, 98 Wn.2d at 379; former RCW 23A.08.040; Laws of 1965, ch. 53, § 7 (repealed 1989; current version RCW 23B.03.040).
The majority's holding that substantive eligibility is not a requirement for establishing the injury element of estoppel is, thus, clearly incorrect when a party is asserting estoppel against the government. In so holding, the majority fails to recognize that overpayments of public benefits to persons *767 substantively ineligible for the benefits are ultra vires acts to which estoppel may not apply.
C
Respondents Could Not Have Reasonably Relied on the Benefits Because They Are Imputed With a Knowledge of the Law When Asserting Estoppel Against the Government
In addition to the majority's failure to recognize the nuances of the injury element of estoppel applied against the government, the majority also declines to recognize that the reliance element of estoppel is treated differently in a governmental context. The majority's resolution of the reliance element runs contrary to law.
Absent fraud or misrepresentation, only those who have reasonably relied upon inconsistent acts or representations of the party against whom estoppel is asserted may assert estoppel. Leonard v. Washington Employers, Inc., 77 Wn.2d 271, 281, 461 P.2d 538 (1969); Wilson v. Westinghouse Elec. Corp., 85 Wn.2d 78, 530 P.2d 298 (1975); Concerned Land Owners v. King Cy., 64 Wn. App. 768, 827 P.2d 1017, review denied, 119 Wn.2d 1008 (1992). "Reliance is justified only when the party claiming estoppel did not know the true facts and had no means to discover them." Marashi v. Lannen, 55 Wn. App. 820, 824-25, 780 P.2d 1341 (1989).
Additionally, those who deal with the government may not reasonably rely on conduct of government agents that is contrary to law, even where the agency is clothed with "such indicia of authority that it would be estopped if it were a private person". State v. O'Connell, 83 Wn.2d 797, 825, 523 P.2d 872, 77 A.L.R.3d 874 (1974). Parties seeking to estop the government are imputed with a knowledge of the law. "It is also the generally accepted rule that the [government], ... cannot be estopped by unauthorized, illegal, or fraudulent acts or statements on the part of its officers and agents, even though benefits to the public have accrued and been accepted." Bennett v. Grays Harbor Cy., 15 Wn.2d 331, 341, 130 *768 P.2d 1041 (1942). "The rule is that persons dealing with such officers must, at their peril, ascertain the scope of their authority.'" Bennett, at 342 (quoting 2 E. McQuillin, Municipal Corporations § 519 (2d ed.)); accord, Heckler v. Community Health Servs. of Crawford Cy., Inc., 467 U.S. 51, 81 L.Ed.2d 42, 104 S.Ct. 2218 (1984); Clubb Oil Tools, Inc. v. M/V George Vergottis, 460 F. Supp. 835 (S.D. Tex. 1978); Noel, 98 Wn.2d at 379; Edwards v. Renton, 67 Wn.2d 598, 605, 409 P.2d 153, 33 A.L.R.3d 1154 (1965); Barendregt v. Walla Walla Sch. Dist. 140, supra.
In Barendregt, the Washington State Penitentiary entered into an agreement with the school district to hire teachers for the penitentiary. The penitentiary later sought to reduce its teaching staff and did not renew one of the teacher's contract. The teacher, Barendregt, brought suit against the school district for improprieties in the nonrenewal procedures under state law and prevailed. The district then filed a third party complaint against the state penitentiary. It alleged that the supervisor of penitentiary education had assured the district that if it incurred any expense because of Barendregt's nonrenewal, the State would indemnify the district. The district argued that the State was estopped from denying the indemnification. The district prevailed at trial and the State appealed.
In holding that estoppel could not apply against the State, the Court of Appeals held that the school district could not have reasonably relied on the superintendent's representations. Barendregt, at 251. The court explained that "`[w]hen dealing with an officer ... of [the State] ..., one must be presumed to have knowledge of the official's power and authority, and when one deals with them in a manner not in compliance with the law one does so at one's peril." Barendregt, at 250 (quoting State ex rel. Bain v. Clallam Cy. Bd. of Cy. Comm'rs, 77 Wn.2d 543, 549, 463 P.2d 617 (1970)).[7]
*769 Like the school district's reliance in Barendregt, the parties' reliance on the benefits provided by DSHS was not reasonable. First, the facts suggest that the parties knew that they should not have been receiving benefits. In Kramarevcky's case, it seems clear that he was aware that his benefits would be affected if he found a job, otherwise he would not have sent his paycheck stubs to DSHS. While the findings of fact are silent as to what information was provided to Jinneman when she applied for the Aid to Families with Dependent Children (AFDC) benefits, it is highly probable that she was informed that only dependent children under the age of 18 are eligible. Second, regardless of their actual knowledge, under the above case law, the parties are imputed with a knowledge of the law and any reliance on their part was unreasonable because DSHS had no authority to confer such benefits. Kramarevcky should be held to know that his benefits are affected if he secures employment. Jinneman should be held to know that she was eligible for benefits only because her son was under 18 years of age and in school.
D
Respondents Cannot Show the Additional Elements of Manifest Injustice and No Impairment of Governmental Functions
In holding that substantive eligibility is not a requirement of proving the injury element of estoppel, the majority implicates additional elements of estoppel which apply only where parties assert estoppel against the government.
Requiring the respondents to repay the debt here would not result in a manifest injustice because the respondents were never substantively eligible and because they have not *770 shown injury by way of forgoing other benefits. Furthermore, estoppel in this case will provide benefits contrary to law and will also prevent the State from recouping overpayments made to ineligible recipients.
As explained, parties asserting estoppel against the government must prove each element of estoppel with clear, cogent, and convincing evidence, and must also show that failure to apply estoppel will result in a manifest injustice and that the estoppel will not impair governmental functions. Finch v. Matthews, supra; Pioneer Nat'l Title Ins. Co. v. State, 39 Wn. App. 758, 760-61, 695 P.2d 996 (1985). The application of estoppel in this case runs contrary to statute, endangers the public treasury, and impairs governmental functions.
As explained in the ultra vires analysis, the benefits afforded the respondents are contrary to law. In essence, the application of estoppel creates benefits not provided for under statutory authority. The case at hand may be analogized to the line of federal court cases holding that estoppel may not be used to create coverage contrary to terms of an employee benefit plan governed by the Employment Retirement Income Security Act (ERISA) where the claimants were substantively ineligible. See, e.g., Davidian v. Southern Cal. Meat Cutters Union & Food Employees Benefit Fund, 859 F.2d 134 (9th Cir.1988) (and cases cited therein).
In Davidian, the claimant asserted estoppel to create coverage which did not exist under the substantive provisions of a benefit plan. The Ninth Circuit emphasized the policy reasons against allowing the claimant to increase the coverage with estoppel where a trust fund was involved. The court stated the rights of other employees properly covered under the fund had to be considered, and the fund assets should not be deflated because of the misrepresentations by the plan administrator. Davidian, at 136. The court equated the rule that estoppel may not apply to create a benefit in "violation of law" to the case before it where the coverage was "contrary to written plan provisions". Davidian, at 136 n. 3. Ultimately, the court held that the payment was illegal because *771 it was contrary to the written terms of the agreement and because payment "would represent a `diversion of contributions made on behalf of covered employees outside the terms of the trust". Davidian, at 136 (quoting Thurber v. Western Conference of Teamsters Pension Plan, 542 F.2d 1106, 1109 (9th Cir.1976)).
In this case, allowing the respondents to keep their benefits essentially creates coverage in a direct contravention of statutory authority. The fact that the public treasury is implicated in this case should make the court even more apprehensive to allow estoppel than cases involving employee trust funds.
Furthermore, federal and state law requires recoupment of overpayments. 42 U.S.C. § 602(a)(22) requires that a "State plan for aid and services to needy families with children must ... provide that the State agency will promptly take all necessary steps to correct any overpayment...." Likewise, 7 U.S.C. § 2022(b)(1)(B), the statute governing the food stamps program, states "[s]tate agencies shall collect any claim against a household arising from the overissuance of coupons...." State law similarly mandates recoupment and grants DSHS authority to declare an overpayment to be "a debt due the state". RCW 74.04.300; RCW 43.20B.030.
The majority opinion dictates that, even where a state agency acts ultra vires in conferring a benefit that the recipient was not substantively eligible for, a state may be estopped from seeking recoupment. Courts of this state have repeatedly abstained from granting relief on equitable grounds in contravention of statute. See Longview Fibre Co. v. Cowlitz Cy., 114 Wn.2d 691, 699, 790 P.2d 149 (1990); Department of Labor & Indus. v. Dillon, 28 Wn. App. 853, 855, 626 P.2d 1004 (1981); Rhoad v. McLean Trucking Co., 102 Wn.2d 422, 427, 686 P.2d 483 (1984). However, under the majority's holding that substantive eligibility is not a requirement to establish injury, the State is prevented from carrying out its duty to recoup overpayments even where the overpayments constituted ultra vires acts.
*772 CONCLUSION
The majority acknowledges that equitable estoppel against the government is disfavored and that each element must be proved by clear and cogent evidence. Yet here, not one of the elements of estoppel is satisfied. First, respondents did not establish the injury element because they were not substantively eligible for the benefits in the first place and because they did not establish by clear, convincing, and cogent evidence that they had forgone other aid in reliance on the improper benefits. Second, DSHS had no authority to act in conferring the benefits to the respondents; therefore, its acts were ultra vires and the State could not be held responsible for them. Third, respondents could not have reasonably relied on the benefits because they are imputed with a knowledge of the law and the limits of DSHS' authority. Finally, respondents failed to show the additional elements of estoppel against the government; manifest injustice and no impairment of governmental functions. So I dissent.
BRACHTENBACH and DURHAM, JJ., concur with MADSEN, J.
NOTES
[1] In addition to satisfying each of these elements, the party asserting the doctrine must be free from fault in the transaction at issue. Mutual of Enumclaw Ins. Co. v. Cox, 110 Wn.2d 643, 651, 757 P.2d 499 (1988). A party may not base a claim of estoppel on conduct, omissions, or representations induced by his or her own conduct, concealment, or representations. Mutual of Enumclaw, 110 Wn.2d at 651 (citing 31 C.J.S. Estoppel § 75, at 453-54 (1964)). This principle is known as the "clean hands" doctrine. Mutual of Enumclaw, 110 Wn.2d at 650. The respondents in this case have met this requirement.
[2] Where the parties did not raise the issue at trial, it is usually appropriate to request additional briefing or argument. Crawford v. Wojnas, 51 Wn. App. 781, 754 P.2d 1302, review denied, 111 Wn.2d 1027 (1988). Although this court may request additional briefing or reargument on issues raised by the court it may decline to do so for reasons of judicial economy. State v. Danforth, 97 Wn.2d 255, 643 P.2d 882 (1982). Here, such briefing is not necessary and reaching the issues does not prejudice the parties because they were raised in the trial court and the parties had notice that the elements of estoppel must be met. Alverado v. WPPSS, 111 Wn.2d 424, 759 P.2d 427 (1988), cert. denied, 490 U.S. 1004 (1989).
[3] See analysis, infra, at pages 770-71, of Davidian v. Southern Cal. Meat Cutters Union & Food Employees Benefit Fund, 859 F.2d 134 (9th Cir.1988) (use of estoppel prohibited where it would effectively create coverage contrary to terms of written agreement under Employment Retirement Income Security Act (ERISA)).
[4] See West v. Department of Social & Health Servs., 21 Wn.App. 577, 586 P.2d 516 (1978), review denied, 92 Wn.2d 1032 (1979).
[5] It should be noted that courts have refused to apply estoppel even where the plaintiff was substantively eligible for a benefit and the government was partly responsible for a procedural error that resulted in the benefit not being conferred. See, e.g., Schweiker v. Hansen, 450 U.S. 785, 67 L.Ed.2d 685, 101 S.Ct. 1468 (1981) (conduct of claims representative did not amount to affirmative misconduct justifying estoppel against Social Security Administration); Montana v. Kennedy, 366 U.S. 308, 314-15, 6 L.Ed.2d 313, 81 S.Ct. 1336 (1961) (act of American Consular agent in refusing to allow pregnant mother to leave Italy did not comprise sufficient misconduct to justify estoppel of United States from relying on child's foreign birth); United States Immigration & Naturalization Serv. v. Hibi, 414 U.S. 5, 8-9, 38 L.Ed.2d 7, 94 S.Ct. 19 (1973) (failure to publish rights under Nationality Act of 1940 did not estop United States from enforcing naturalization application deadline).
In any case, DSHS' overpayments of the benefits to the respondents, whether accompanied by affirmative statements or not, lacked all statutory authority. As will be explained in the analysis below, acts by state agencies that are wholly without legal authority are ultra vires and are not "acts" for purposes of estoppel. The affirmative misconduct analysis, therefore, does not apply in this case.
[6] The phrase "violative of statutory directive" is somewhat misleading and Regents should not be read to hold that the State may actually violate a statute and not act ultra vires. Webster's dictionary defines "directive" as "a general instruction as to conduct or procedure; as subject to directives of his political party". (Italics mine.) Webster's New International Dictionary 738 (1956). Thus, acts that are "violative of statutory directive" should be understood as acts that violate procedure rather than acts that violate statute.
[7] This rule is also the case in Oregon where courts have held that parties dealing with the government are imputed with a knowledge of the extent of the government agent's authority.
"Although a private agent, acting in violation of specific instructions, yet within the scope of his general authority, may bind his principal, the rule as to the effect of the like act of a public agent is otherwise, for the reason that it is better that an individual should occasionally suffer from the mistakes of public officers or agents, than to adopt a rule which, through improper combinations or collusions might be turned to the detriment and injury of the public."
Wiggins v. Barrett & Assocs., Inc., 295 Or. 679, 691, 669 P.2d 1132 (1983) (quoting Whiteside v. United States, 93 U.S. 247, 256, 23 L.Ed. 882 (1876)).
|
The BBC has ordered a second series of No Such Thing As The News, the spin-off from the hit podcast from the QI researchers.
A second series of eight episodes will start on BBC Two on October 12, running at 11.15pm on Wednesdays, after Newsnight.
The show was the first comedy to be commissioned by the BBC’s news and current affairs department since David Frost's That Was The Week That Was in 1962.
A low-cost TV version of the No Such Thing As A Fish podcast, the show consists of presenters Dan Schreiber, Anna Ptaszynski, Andrew Hunter Murray and James Harkin picking out interesting facts from the week’s news.
One Chortle commentator noted that the first series was shot so cheaply at Up The Creek comedy club in Greenwich, South London, that it ‘looks like a hostage video’.
But the BBC said: ‘While it’s undeniably cheap, its other point of difference is that it’s cheerful. Who would ever have thought the news could be this much fun?’
The series is produced by John Lloyd, the man behind The News Quiz, Not The Nine O’Clock News, Blackadder, Spitting Image and QI.
And the second series will include bonus material to be streamed live on the BBC News Facebook page.
• Read our review of series one here.
Published: 9 Sep 2016 |
Q:
Wrapping custom notes in texreg output
I'm trying to add a fairly long note to the bottom of a table created by texreg; I want this to simply wrap around, but there doesn't seem to be any functionality built into the function for doing so.
Take, e.g.:
texreg(lm(speed~dist,data=cars),
custom.note=paste("%stars. This regression should be",
"intepreted with strong caution as",
"it is likely plagued by extensive",
"omitted variable bias"))
Which, when compiled, gives something like:
The formatting is atrocious; much better would be something like replacing the standard output:
\multicolumn{2}{l}{\scriptsize{$^{***}p<0.001$, $^{**}p<0.01$, $^*p<0.05$. This regression should be intepreted with strong caution as it is likely plagued by extensive omitted variable bias}}
With more digestible wrapping:
\multicolumn{2}{l}{\scriptsize{$^{***}p<0.001$, $^{**}p<0.01$, $^*p<0.05$.}} \\
\multicolumn{2}{l}{\scriptsize{This regression should be intepreted with}} \\
\multicolumn{2}{l}{\scriptsize{strong caution as it is likely plagued by}} \\
\multicolumn{2}{l}{\scriptsize{extensive omitted variable bias}}
Which gives output much closer to what I'm looking for:
Is there a way to do this programatically?
A:
I might point out a neat alternative solution I received which could be of interest to you, at the latest when you need to update the texreg package.
Accordingly the custom note ends in a \multicolumn in the LaTeX code, thus we cannot use line break commands like par or \\. But we can achieve the automatic line break with \parbox. If we still want a custom line break we can use four backslashes \\\\. For better formatting we can use \\vspace{2pt} just at the beginning of the text content:
texreg(lm(speed ~ dist, data = cars),
custom.note = ("\\parbox{.4\\linewidth}{\\vspace{2pt}%stars. \\\\
This regression should be intepreted with strong caution as it is
likely plagued by extensive omitted variable bias.}"))
A:
With version 1.37.1 (released in May 2020), texreg introduces the threeparttable argument, which uses the threeparttable LaTeX package, which was designed for this purpose.
Example R code:
texreg(lm(speed ~ dist, data = cars),
custom.note = paste("\\item %stars. This regression",
"should be interpreted with strong",
"caution as it is likely plagued by",
"extensive omitted variable bias."),
single.row = TRUE,
threeparttable = TRUE)
Output:
\begin{table}
\begin{center}
\begin{threeparttable}
\begin{tabular}{l c}
\hline
& Model 1 \\
\hline
(Intercept) & $8.28 \; (0.87)^{***}$ \\
dist & $0.17 \; (0.02)^{***}$ \\
\hline
R$^2$ & $0.65$ \\
Adj. R$^2$ & $0.64$ \\
Num. obs. & $50$ \\
\hline
\end{tabular}
\begin{tablenotes}[flushleft]
\scriptsize{\item $^{***}p<0.001$; $^{**}p<0.01$; $^{*}p<0.05$. This regression should be interpreted with strong caution as it is likely plagued by extensive omitted variable bias}
\end{tablenotes}
\end{threeparttable}
\caption{Statistical models}
\label{table:coefficients}
\end{center}
\end{table}
Which is rendered as:
Note that the custom note must start with \\item. It is also possible to have multiple items and/or use bullet points to format multiple notes like in a list:
texreg(lm(speed ~ dist, data = cars),
custom.note = paste("\\item[$\\bullet$] %stars.",
"\\item[$\\bullet$] This regression",
"should be interpreted with strong",
"caution as it is likely plagued by",
"extensive omitted variable bias."),
single.row = TRUE,
threeparttable = TRUE)
The formatting is not perfect as you cannot set the desired width of the table; the note just adjusts to the width of the respective table. But I think it should be less of a problem in a realistic usage scenario where more than one model is displayed at a time and some of the coefficient names are longer than in the example. This solution also supports longtable environments, in which case the threeparttablex package is used instead.
Here is an example of how you could make it look nice with two models:
fit <- lm(speed ~ dist, data = cars)
texreg(list(fit, fit),
custom.note = paste("\\item[\\hspace{-5mm}] %stars.",
"\\item[\\hspace{-5mm}] This regression",
"should be interpreted with strong",
"caution as it is likely plagued by",
"extensive omitted variable bias."),
single.row = TRUE,
threeparttable = TRUE)
This yields:
\begin{table}
\begin{center}
\begin{threeparttable}
\begin{tabular}{l c c}
\hline
& Model 1 & Model 2 \\
\hline
(Intercept) & $8.28 \; (0.87)^{***}$ & $8.28 \; (0.87)^{***}$ \\
dist & $0.17 \; (0.02)^{***}$ & $0.17 \; (0.02)^{***}$ \\
\hline
R$^2$ & $0.65$ & $0.65$ \\
Adj. R$^2$ & $0.64$ & $0.64$ \\
Num. obs. & $50$ & $50$ \\
\hline
\end{tabular}
\begin{tablenotes}[flushleft]
\scriptsize{\item[\hspace{-5mm}] $^{***}p<0.001$; $^{**}p<0.01$; $^{*}p<0.05$. \item[\hspace{-5mm}] This regression should be interpreted with strong caution as it is likely plagued by extensive omitted variable bias.}
\end{tablenotes}
\end{threeparttable}
\caption{Statistical models}
\label{table:coefficients}
\end{center}
\end{table}
Which renders as:
|
Attributes of evidence-based occupational therapists in stroke rehabilitation.
A better understanding of the features characterizing expert evidence-based occupational therapists in stroke rehabilitation is needed to inform the design of educational and knowledge translation interventions aimed at addressing research-practice gaps. The study aimed to identify the attributes of evidence-based occupational therapy stroke rehabilitation experts from the perspective of their peers. Forty-six occupational therapy clinicians and managers completed an online questionnaire asking them to nominate "outstanding" and "expert evidence-based" occupational therapists in stroke rehabilitation and to explain their choices. A thematic analysis of respondents' statements was conducted. Both outstanding and expert evidence-based occupational therapists were perceived to be motivated self-learners; to have extensive knowledge, skills, and experience; to act as scholarly practitioners; to achieve superior client outcomes; and to work in specialized settings. The development of future strategies supporting occupational therapy students and clinicians to become lifelong learners should take into account key attributes of expertise, such as motivation for continuous learning and professional development. |
Mitochondrial Disorders And The Eye.
Mitochondria are cellular organelles that play a key role in energy metabolism and oxidative phosphorylation. Malfunctioning of mitochondria has been implicated as the cause of many disorders with variable inheritance, heterogeneity of systems involved, and varied phenotype. Metabolically active tissues are more likely to be affected, causing an anatomic and physiologic disconnect in the treating physicians mind between presentation and underlying pathophysiology. We shall focus on disorders of mitochondrial metabolism relevant to an ophthalmologist. These disorders can affect all parts of the visual pathway (crystalline lens, extraocular muscles, retina, optic nerve, and retro-chiasmaly) . After the introduction reviewing mitochondrial structure and function each disorder is reviewed in detail, including approaches to its diagnosis and most current management guidelines. |
Q:
Parse Cloud Code Promise not returning correctly
I thought I had this Promises thing figured out, but this function to get all results from a Query regardless of the 1000 item limit isn't working correctly. Could anyone explain to me where I'm going wrong here? Thanks!
This Cloud Job is in my main.js file:
//in main.js
Parse.Cloud.job("testQuery", function(request, status) {
var theClass = Parse.Object.extend("SomeClass");
var theQuery = new Parse.Query(theClass);
console.log("Here we go...");
queryHelper.getAllResultsForQuery(theQuery, console).then( function(result) {
//This code is called before getAllResultsForQuery finishes
console.log("Finished the search!");
status.success("yay");
}, function(error) {
console.log("Fail " + error);
status.error("failed!");
});
});
And this function is in queryHelper.js:
//in queryHelper.js
exports.getAllResultsForQuery = function(query, console) {
var resultArray = [];
var limit = 1000;
var sendQuery = function(skip) {
if (skip) {
query.greaterThan("createdAt", skip);
}
query.limit(limit);
query.ascending("createdAt");
query.find().then(function (newResults) {
receivedResults(newResults);
}, function (error) {
return Parse.Promise.error(new Error("query failed after " + resultArray.length + " results, error:" + error));
});
};
var receivedResults = function(received) {
resultArray = resultArray.concat(received);
console.log("Got " + received.length + " objects, now at " + resultArray.length);
if (received.length == limit) {
sendQuery(received[received.length-1].createdAt);
} else {
console.log("returning from getAllResults...");
return resultArray;
}
};
sendQuery();
};
When I run the code, the queryHelper.getAllResultsForQuery function seems to run just fine, but the Promise seems to fire before that function is finished, so the console output looks like this:
"Here we go…";
"Finished the search!";
"Got 1000 objects, now at 1000";
"Got 1000 objects, now at 2000";
"Got 1000 objects, now at 3000";
"Got 245 objects, now at 3245";
"returning from getAllResults…";
Am I making a rookie mistake somewhere?
A:
getAllResultsForQuery should return a promise directly. I marked added returns.
exports.getAllResultsForQuery = function(query, console) {
var resultArray = [];
var limit = 1000;
var sendQuery = function(skip) {
if (skip) {
query.greaterThan("createdAt", skip);
}
query.limit(limit);
query.ascending("createdAt");
return query.find().then(function (newResults) { //return added here
return receivedResults(newResults); //return added here
}, function (error) {
return Parse.Promise.error(new Error("query failed after " +
resultArray.length + " results, error:" + error));
});
};
var receivedResults = function(received) {
resultArray = resultArray.concat(received);
console.log("Got " + received.length + " objects, now at " +
resultArray.length);
if (received.length == limit) {
return sendQuery(received[received.length-1].createdAt).then(function (received) {
//added code here
resultArray.concat(results);
return resultArray;
}); //return added here
} else {
console.log("returning from getAllResults...");
return resultArray;
}
};
return sendQuery(); //return added here
};
|
The Antitrust Case Against Facebook, Google and Amazon - collinmanderson
https://twitter.com/WSJ/status/953358210852966401
======
collinmanderson
(linking to twitter to get around paywall)
|
package hcl
import (
"bufio"
"bytes"
"github.com/apparentlymart/go-textseg/v12/textseg"
)
// RangeScanner is a helper that will scan over a buffer using a bufio.SplitFunc
// and visit a source range for each token matched.
//
// For example, this can be used with bufio.ScanLines to find the source range
// for each line in the file, skipping over the actual newline characters, which
// may be useful when printing source code snippets as part of diagnostic
// messages.
//
// The line and column information in the returned ranges is produced by
// counting newline characters and grapheme clusters respectively, which
// mimics the behavior we expect from a parser when producing ranges.
type RangeScanner struct {
filename string
b []byte
cb bufio.SplitFunc
pos Pos // position of next byte to process in b
cur Range // latest range
tok []byte // slice of b that is covered by cur
err error // error from last scan, if any
}
// NewRangeScanner creates a new RangeScanner for the given buffer, producing
// ranges for the given filename.
//
// Since ranges have grapheme-cluster granularity rather than byte granularity,
// the scanner will produce incorrect results if the given SplitFunc creates
// tokens between grapheme cluster boundaries. In particular, it is incorrect
// to use RangeScanner with bufio.ScanRunes because it will produce tokens
// around individual UTF-8 sequences, which will split any multi-sequence
// grapheme clusters.
func NewRangeScanner(b []byte, filename string, cb bufio.SplitFunc) *RangeScanner {
return NewRangeScannerFragment(b, filename, InitialPos, cb)
}
// NewRangeScannerFragment is like NewRangeScanner but the ranges it produces
// will be offset by the given starting position, which is appropriate for
// sub-slices of a file, whereas NewRangeScanner assumes it is scanning an
// entire file.
func NewRangeScannerFragment(b []byte, filename string, start Pos, cb bufio.SplitFunc) *RangeScanner {
return &RangeScanner{
filename: filename,
b: b,
cb: cb,
pos: start,
}
}
func (sc *RangeScanner) Scan() bool {
if sc.pos.Byte >= len(sc.b) || sc.err != nil {
// All done
return false
}
// Since we're operating on an in-memory buffer, we always pass the whole
// remainder of the buffer to our SplitFunc and set isEOF to let it know
// that it has the whole thing.
advance, token, err := sc.cb(sc.b[sc.pos.Byte:], true)
// Since we are setting isEOF to true this should never happen, but
// if it does we will just abort and assume the SplitFunc is misbehaving.
if advance == 0 && token == nil && err == nil {
return false
}
if err != nil {
sc.err = err
sc.cur = Range{
Filename: sc.filename,
Start: sc.pos,
End: sc.pos,
}
sc.tok = nil
return false
}
sc.tok = token
start := sc.pos
end := sc.pos
new := sc.pos
// adv is similar to token but it also includes any subsequent characters
// we're being asked to skip over by the SplitFunc.
// adv is a slice covering any additional bytes we are skipping over, based
// on what the SplitFunc told us to do with advance.
adv := sc.b[sc.pos.Byte : sc.pos.Byte+advance]
// We now need to scan over our token to count the grapheme clusters
// so we can correctly advance Column, and count the newlines so we
// can correctly advance Line.
advR := bytes.NewReader(adv)
gsc := bufio.NewScanner(advR)
advanced := 0
gsc.Split(textseg.ScanGraphemeClusters)
for gsc.Scan() {
gr := gsc.Bytes()
new.Byte += len(gr)
new.Column++
// We rely here on the fact that \r\n is considered a grapheme cluster
// and so we don't need to worry about miscounting additional lines
// on files with Windows-style line endings.
if len(gr) != 0 && (gr[0] == '\r' || gr[0] == '\n') {
new.Column = 1
new.Line++
}
if advanced < len(token) {
// If we've not yet found the end of our token then we'll
// also push our "end" marker along.
// (if advance > len(token) then we'll stop moving "end" early
// so that the caller only sees the range covered by token.)
end = new
}
advanced += len(gr)
}
sc.cur = Range{
Filename: sc.filename,
Start: start,
End: end,
}
sc.pos = new
return true
}
// Range returns a range that covers the latest token obtained after a call
// to Scan returns true.
func (sc *RangeScanner) Range() Range {
return sc.cur
}
// Bytes returns the slice of the input buffer that is covered by the range
// that would be returned by Range.
func (sc *RangeScanner) Bytes() []byte {
return sc.tok
}
// Err can be called after Scan returns false to determine if the latest read
// resulted in an error, and obtain that error if so.
func (sc *RangeScanner) Err() error {
return sc.err
}
|
FROM lab41/caffe-cuda-base
MAINTAINER Yonas Tesfaye <yonast@lab41.org>
# Clone Caffe repo and move into it
RUN cd /root/caffe && \
cat Makefile.config.example | \
sed 's!# ANACONDA_HOME := $(HOME)/anaconda!ANACONDA_HOME := /opt/conda!' | \
sed 's!# $(ANACONDA_HOME)! $(ANACONDA_HOME)!' | \
sed 's!# PYTHON_INCLUDE := $(ANACONDA_HOME)!PYTHON_INCLUDE := $(ANACONDA_HOME)!' > /root/caffe/Makefile.config && \
sed -i 's/# CPU_ONLY/CPU_ONLY/g' Makefile.config && \
make clean && \
make -j"$(nproc)" all && \
make pycaffe
ENV PYTHONPATH /root/caffe/python
EXPOSE 5000
WORKDIR /root/caffe
|
Central billing
Central billing is a phrase used to describe the process of using the collective buying power of independent businesses to extract discounts from suppliers. It was pioneered in the convenience grocery sector convenience grocery sector in Europe.
How it works
The process is orchestrated by a middleman (wholesaler) who takes certain risks in order to profit from the process.
Typical example
A convenience store retailer takes delivery every day of bread, milk and other perishable items. Instead of paying cash they put them on the central billing account they holds with their wholesaler. At the end of the month they receive a bill from their wholesaler for all their purchases for the month. The wholesaler in turn pays the individual suppliers.
Benefits to supplier
The supplier still has to make multiple deliveries but instead of having to worry about collecting money from many individual stores it only collects one payment from the wholesaler. By this process the credit risk is removed from the supplier and placed on the wholesaler. In return for this the supplier makes a payment to the wholesaler to reflect these benefits, called a rebate or Long Term Agreement.
Benefit to retailer
The retailer benefits simply by the fact their admin is simplified. Instead of having to monitor many daily payments they simply have to write one cheque a month for potentially thousands of transactions. The pay the wholesaler who in turn pays the suppliers. In addition, they typically receive a rebate (LTA) on their purchases.
Benefit to wholesaler
The wholesaler benefits in a number of ways. Firstly they do not have to pass on in full all the LTA payments they receive. Secondly the offer a valuable service to retailers to whom they also sell other items to through their traditional wholesale channels. They do however assume the risk should the retailer fail to pay.
Centralised distribution
In many cases central billing has been superseded by central distribution. Under the centralised distribution model a wholesaler will provide everything their customer needs via their own supply chain. This eradicates the need for supplier deliveries and renders central billing redundant.
References
Category:Procurement |
UNPUBLISHED
UNITED STATES COURT OF APPEALS
FOR THE FOURTH CIRCUIT
No. 02-1387
ARNOLD B. CLARKE,
Plaintiff - Appellant,
versus
ATTORNEY GENERAL’S OFFICE; JUDGE KULP, Henrico
County Court; COMMONWEALTH’S ATTORNEY’S
OFFICE, of Virginia,
Defendants - Appellees.
Appeal from the United States District Court for the Eastern
District of Virginia, at Richmond. Robert E. Payne, District Judge.
(CA-02-98)
Submitted: June 20, 2002 Decided: June 25, 2002
Before MICHAEL and KING, Circuit Judges, and HAMILTON, Senior
Circuit Judge.
Affirmed by unpublished per curiam opinion.
Arnold B. Clarke, Appellant Pro Se.
Unpublished opinions are not binding precedent in this circuit.
See Local Rule 36(c).
PER CURIAM:
Arnold B. Clarke appeals the district court’s order denying
relief on his 42 U.S.C.A. § 1983 (West Supp. 2001) complaint. We
have reviewed the record and the district court’s opinion and find
no reversible error. Accordingly, we affirm on the reasoning of
the district court. Clarke v. Attorney Gen. Office, No. CA-02-98
(E.D. Va. Mar. 21, 2002). We dispense with oral argument because
the facts and legal contentions are adequately presented in the
materials before the court and argument would not aid the
decisional process.
AFFIRMED
2
|
1. Field of the Invention
The present invention generally relates to a control apparatus for an internal combustion engine equipped with a fuel injection cut-off function which is triggered, for example, whenever a traction control function of the origins becomes active. More particularly, the invention is concerned with an ignition control apparatus for controlling a demand voltage of a spark plug to thereby prevent generation of high-level noise and protect circuit components of the ignition system from being damaged due to rises in the spark plug demand voltage.
2. Description of the Related Art
In general, in internal combustion engines (hereinafter also referred to simply as the engine) for automobiles or the like, it is required to control optimally the fuel injection and the ignition timing on the basis of the running or operation state of the engine. To this end, a microcomputer-based control apparatus is employed which detects a reference angular position of the crank shaft for each of the engine cylinders. This information is used to control the amount of fuel injected and the ignition timing relative to the reference angular position by using a timer in accordance with the relevant quantities calculated or arithmetically determined on the basis of the engine operation state.
Related to this, it is noted that modern automobiles or motor vehicles are increasingly equipped with a traction control capability for suppressing the engine output torque, with a view to preventing overrun, slippage on a frozen road or similar unwanted events. The torque control may be realized by stopping supply of the ignition signal to the igniter for the cylinder under control. However, in order to prevent fuel wastage as well as discharge of unburned fuel mixture into the atmosphere, it is preferred to adopt a torque control which is based on the cut-off or interruption of the fuel injection.
FIG. 7 is a block diagram showing a conventional control apparatus designed, for example, for a four-cylinder internal combustion engine in which the fuel supply to the engine is realized through fuel injection and the ignition control is realized by distributing a high voltage to spark plugs of the individual cylinders, respectively. Referring to the figure, an angular position signal generating means 1 is provided in association with a rotatable shaft of the engine, such as a crank shaft, cam shaft or the like. The generating means 1 generates an angular position signal T at every predetermined reference angular position of the crank shaft as the engine operates. To this end, the angular position signal generating means 1 may be constituted by an electromagnetic pick-up device disposed in opposition to a disk mounted on the crank shaft or cam shaft for rotation therewith and having a projection formed in the periphery of the disk, which projection passes by the electromagnetic pick-up device as the crank or cam shaft rotates. Alternately, the angular position signal generating means 1 may be implemented in the form of a photoarray disposed in opposition to slits formed in the disk mentioned above. In any case, the angular position signal T contains the reference position information for the angular positions of the crank shaft as well as the cylinder identification information.
For detecting the engine operation states, there are provided a variety of sensors denoted representatively in FIG. 7 by reference numeral 2. These sensors 2 detect engine operation states such as engine load, temperature etc. The detection signals outputted by these sensors 2, will hereinafter be referred to as the engine operation state signal and designated generally by a reference character D.
The angular position signal T and the engine operation state signal D are supplied to a control means 4 which is constituted by a microcomputer for controlling the operation of the engine on the basis of these signals T and D. More specifically, the control means 4 detects or identifies the reference positions for the individual cylinders from the angular position signal T and arithmetically determines or calculates the fuel injection quantity and the ignition timing on the basis of the engine operation state D to thereby output control signals J and Q for the fuel injection and the ignition timing, respectively.
Connected to the outputs of the control means 4 are fuel injectors 5 for injecting the fuel mixture into the associated cylinders, respectively, in response to the fuel injection signal J and an ignition coil 6 driven by the ignition timing signal Q. A distributor 7 is connected to a secondary winding of the ignition coil 6 and has output terminals connected to spark plugs 8 of the individual cylinders, respectively. When electrical conduction through a primary winding of the ignition coil 6 is interrupted in response to the ignition timing signal Q, a high voltage is induced in the secondary winding of the ignition coil 6 and applied to the spark plug 8 of the associated cylinder for firing the fuel mixture therein through the electric discharge of the spark plug 8.
The control means 4 includes input interfaces 41 and 42 for fetching the angular position signal T and the engine operation state signal D, respectively. It further includes a fuel control unit 43 for arithmetically determining or calculating the fuel injection quantity for each cylinder on the basis of the angular position signal T and the engine operation state signal D, and an ignition control unit 44 for calculating the ignition timing for each cylinder, again on the basis of the angular position signal T and the engine operation state signal D. The control means 4 also includes an output interface 45 for applying the fuel injection signal J indicative of the fuel injection quantity as calculated to the fuel injector 5, and an output interface 46 for applying the ignition timing signal Q corresponding to the ignition timing as calculated to the ignition coil 6.
Next, operation of the conventional engine control apparatus will be described by reference to FIG. 7.
As the engine rotates the angular position signal generating means 1 generates the angular position signal T indicative of the reference position. This signal T is then inputted to the fuel control unit 43 and the ignition control unit 44 incorporated in the control means 4 via the input interface 41. The various sensors 2 detect the engine operation states, whereby the engine operation state signal D is inputted to the ignition control unit 44 of the control means 4 via the input interface 42.
The fuel control unit 43 detects the reference position for each cylinder on the basis of the angular position signal T and arithmetically determines the fuel injection quantity as well as the fuel injection timing on the basis of the engine operation state signal D to thereby generate the fuel injection signal J corresponding to the calculated fuel injection quantity. Signal J is applied to the fuel injector 5 via the output interface 45. On the other hand, the ignition control unit 44 detects the reference position for each cylinder from the angular position signal T and calculates the ignition timing conforming to the engine operation state indicated by the signal D to thereby generate the ignition timing signal Q indicative of the calculated ignition timing, which signal Q is then applied to the ignition coil 6 via the output interface 46.
At this point in time, a timer control starts from a reference position determined on the basis of the angular point signal T. More specifically, the fuel injectors 5 are sequentially driven, whereby the fuel mixture is injected to the respective cylinders. Further, interruptions of the electrical conduction through the ignition coil 6 bring about electric discharges sequentially between a rotating center electrode and stationary peripheral electrodes of the distributor 7, which results in generation of sparks in the spark plugs 8 in a sequential manner, whereby the individual cylinders under control are fired correspondingly.
However, when the traction control mentioned previously is triggered, the fuel injection signal J to the fuel injector 5 associated with the cylinder for which the traction control is to be effected is inhibited, whereby the fuel supply to that fuel injector 5 is cut off. On the other hand, the ignition control unit 44 continues to generate the ignition timing signal Q. In conjunction with this, it has been observed that although the demand voltage of the spark plug 8 (i.e., the voltage required for the electric discharge to take place in the spark plug) in the normal fuel injection mode lies within a range of 10 kV to 20 kV, the demand voltage may rise to a range of 20 kV to 30 kV when the fuel supply to the cylinder associated with the spark plug 8 is cut off. The reason why the spark plug demand voltage increases when the fuel injection is cut off may be explained as follows. When the cylinder continues to remain in the state where the fuel injection is interrupted, temperature within the cylinder decreases, as a result of which emission of thermions from the cathode electrode of the spark plug 8 decreases. At the same time, the cylinder pressure rises abnormally during the compression stroke due to increase in the air density or concentration.
In particular, in the case where the ignition timing is set in the vicinity of the top dead center (TDC), the increase in cylinder pressure during the compression stroke as well as that of the spark plug demand voltage can no longer be neglected.
Parenthetically, it should be added that fuel injection is also interrupted in an engine deceleration region, where the throttle valve is fully closed, because no output torque is demanded when the throttle valve is fully closed.
Moreover, such a rise of in the cylinder pressure is also observed when an abnormality occurs in the pressure control for a supercharger employed in a turbo-engine. In general, in turbo-engines, the intake air quantity is increased by using the supercharger in order to make available the output torque which is in excess of the stroke volume or cylinder capacity, wherein a fail-safe mechanism is provided for preventing the cylinder pressure from increasing beyond an upper limit value. Accordingly, when failure or abnormality occurs in the fail-safe mechanism, there exists a high probability of the cylinder pressure increasing abnormally.
When the voltage demand of the ignition plug 8 becomes high for the reasons mentioned above, serious problems arise, such as generation of high level electric noise injury or damage to the distributor 7, the spark plug 8 and/or other circuit components due to leakage of the abnormally high voltage. To protect the circuit components against damage from the voltage leakage, it is conceivable to increase the voltage withstanding capabilities of the individual circuit components. This is however undesirable because it necessitates implementing the whole system in a larger scale whereby additional expenditures are incurred.
As will now be appreciated from the foregoing, the engine control apparatus known heretofore suffers from problems including the generation of electric noise an unacceptably high level, and injury or damage to the distributor 7, the spark plug 8 and the like circuit components due to leakage of abnormally high voltage. In other words, no measures have been adopted for coping with the rise in spark plug demand voltage ascribable to the cut-off of fuel injection in the traction control or ascribable to failure in the failsafe mechanism in the case of the turbo-engine. |
‘We are still far from knowing what this project is really about.”
Mayor Malcolm Brodie had plenty of questions, despite the detailed revealing of the proposed $3.5 billion toll bridge to replace the Massey Tunnel.
article continues below
So it was a shame, and somewhat “unusual,” as described by the mayor, that no elected official from the City of Richmond was invited to Wednesday’s project announcement.
Half of the new, 10-lane (including HOV lanes), 3.5-kilometre span — the biggest in B.C.’s history — will be in Delta, so it was no surprise to see Delta mayor Lois Jackson and Delta North MLA Scott Hamilton appearing alongside the provincial transportation minister, Todd Stone.
Absent from formal proceedings at the project office, ironically in Ironwood, Richmond, was any official from this side of the Fraser River.
“Nobody from the City of Richmond was invited,” Brodie said bluntly. “You’ll have to ask the ministry why.”
The Ministry of Transportation didn’t return the News’ call before press time.
“Far more important than that, though,” said Brodie, “is what they announced and what’s still missing. There are questions that Richmond has been asking all along that still remain unanswered.”
Construction of the new bridge is set to begin in 2017 and finish in 2022. Although the toll rate is still to be determined, Stone said it would be comparable with the Port Mann Bridge pricing, which is $3.15 per crossing.
The project will include an HOV lane in each direction, as well as significant Highway 99 “improvements” at major intersections, such as at Highway 17A in Delta and Steveston and Westminster highways.
And dedicated transit/HOV lanes will be constructed between Bridgeport Road in Richmond and Highway 91 in Delta, as well as a transit-only ramp at Bridgeport Road.
However, Brodie is adamant that, despite Wednesday’s announcement, there are still major pieces of the tunnel replacement jigsaw missing.
“What about the northbound traffic (after the new bridge)? It sometimes goes back to the tunnel from the Oak Street Bridge? There is still going to be a logjam there,” said Brodie.
“Tolling will lead to more congestion on the Alex Fraser, which is going to be horrendous.
“Priorities? How did this become the province’s top project, rather than fixing public transit across the region?”
As far as a toll bridge causing traffic to slide over and further clog the Alex Fraser, Stone pointed to evidence that, despite an initial avoidance to use the newly tolled Port Mann Bridge, drivers eventually returned to the bridge, especially during peak time usage.
At Wednesday’s news conference, the project’s executive director, Geoff Freer, was also asked by the News about the potential loss of farmland on the Richmond side, due to the bridge’s construction.
Freer said there would actually be a “net gain” of farmland, due to highway rights of way going back into the Agricultural Land Reserve.
“What does net gain mean?” questioned Brodie, however. “There’s going to be a major amount of road widening. Tell us what we’re getting and what we’re losing.”
Questions were asked by the media of Port Metro Vancouver’s (PMV) involvement in the project, which was largely absent in the Project Definition Report, revealed Wednesday.
“Is this really a shipping project?” asked Brodie.
“(PMV) has said before there will be more dredging and I would still suggest we are going to see bigger vessels on that river. I’ve no doubt the benefits to the port are more significant (than what’s being portrayed). I’d like to know how much the port is going to put into this.”
In a response to the News’ questions, the port’s vice president of planning and operations, Peter Xotta, said, in regards to helping fund the new bridge, “it is much too early in the process to comment at this time.”
In answer to questions about deeper dredging in the river once the tunnel is decommissioned, Freer explained how it would not be possible unless other objects, such as water and sewer pipes, are removed.
“What we understand, from the port, is that there wont be any big change at all,” added Freer.
Removing portions of the tunnel, said the report, would increase the water draft by less than two metres.
Allan Baydala, PMV’s chief financial officer, has said previously that “while the removal of the tunnel may create greater depth at that point in the river, the amount of dredging required on either side of the former tunnel could be extensive and potentially cost prohibitive…(the tunnel’s)…removal will not have a significant impact on the size of ships…”
The port’s Xotta, however, told the News in a statement that PMV supports the bridge project “because it could allow for new options for using the Fraser River to support Canada’s trade objectives.”
Exactly what those options are, if it’s not larger vessels, wasn’t made clear.
Stone said the ministry is in discussion with the federal government — PMV is generally considered the federal entity — about funding.
“The port is one of the stakeholders and we’ve asked them to be involved, as there will be significant benefits from the movement of goods.”
The new bridge will have vertical clearance similar to that of the Alex Fraser Bridge.
Stone said the project will create 9,000 jobs, mostly in construction. Both Freer and Stone explained how they don’t believe the traffic will be any worse at the Oak Street Bridge, despite concerns that the current bottleneck at the tunnel will simply be passed north on Highway 99.
The report illustrates how, according to government calculations, 59 per cent of the traffic currently flowing north through the tunnel at peak times terminates in Richmond, before even hitting the Oak Street Bridge.
The third phase of public consultation on the project is now underway, through Jan. 28, 2016. More details on how to participate are available at www.masseytunnel.ca.
Traffic through the tunnel will be maintained while the new bridge is under construction. |
Murphy was released from the Hamilton County jail on Monday, and set to return home, which is less than two miles from the Kroger where he went No. 2. |
Constance Babington Smith
Constance Babington Smith MBE Legion of Merit FRSL (15 October 1912 – 31 July 2000) was a journalist and writer, but is probably best known for her wartime work in imagery intelligence.
Early life
Babington Smith was the daughter of the senior civil servant Sir Henry Babington Smith, a scion of the Babington family. Her mother, born Lady Elizabeth Bruce, was the daughter of the 9th Earl of Elgin, making Constance a granddaughter of a Viceroy of India and a great-great-granddaughter of the man who bought the Elgin Marbles. Constance came from a large family and was the seventh of nine children. Her father died in 1923, when she was ten. By then, her eldest brothers were already adults, whilst her youngest sister was just two years old.
She was educated at home at the family home 'Chinthurst', in Wonersh in Surrey.
She finished her education in France and moved to London in adult life.
A trained milliner, she worked for the milliner Aage Thaarup before the war and also Vogue magazine in London, before venturing into journalism, with The Aeroplane magazine.
War service
Her knowledge of aircraft took her into the WAAF in the Second World War. She served with the Central Interpretation Unit (CIU) at RAF Medmenham, Buckinghamshire, reaching the rank of Flight Officer. Serving alongside was her brother, Bernard Babington Smith (1905-1993), who was also a photo interpreter (PI) at Medmenham. Another fellow PI present at Medmenham was Winston Churchill's daughter, Sarah Oliver.
In 1942 she made an uncredited appearance in the Air Ministry feature film Target for Tonight, along with her fellow Medmenham colleague, Sqn Ldr Peter Riddell.
Working on the interpretation of aerial reconnaissance photographs, Constance was credited with the discovery of the V1 at Peenemunde, Germany.
In 1942, Babington Smith was Mentioned in Dispatches for her work and in 1945 she was awarded the MBE.
Her brother, Bernard, was also honoured for his work at the CIU, receiving the OBE.
She was portrayed in the 1965 film Operation Crossbow by Sylvia Syms.
After VE-Day Constance was attached to USAAF Intelligence in Washington, D.C. to continue her work on photographic interpretation, this time for the Pacific theatre.
In 1946, the United States awarded her the Legion of Merit.
Later life
From 1946 to 1950 she was a researcher for Life Magazine. She later moved to Cambridge, Britain, where she converted to Greek Orthodoxy and become a writer and biographer.
Her war memoir Evidence in Camera was in 1957 the first comprehensive narrative of British photographic reconnaissance in the Second World War. Because it was published before the revelation of wartime code-breaking, this book may also have contained a measure of Cold War disinformation.
Her cousin was the writer Rose Macaulay, Babington Smith writing a biography of her published in 1972.
She appeared in several episodes of the 1977 BBC TV series The Secret War, where she discussed her wartime work as a photo interpreter as it related to the subject of the episode.
Babington Smith was a founder and director of the Mosquito Memorial Appeal Fund, now the de Havilland Museum Trust.
Ancestry
Bibliography
How Photographic Detectives Solved Secret Weapons Mystery (LIFE, 28 October 1957)
Evidence In Camera (1957) - published as Air Spy in the US
Testing Time (1961)
Amy Johnson (1961)
Rose Macaulay (1972)
John Masefield; a Life (1978)
Iulia de Beausobre (1983)
Champion of Homeopathy: the Life of Margery Blackie (1986)
References
Further reading
Category:1912 births
Category:2000 deaths
Category:Writers from London
Category:English journalists
Category:20th-century English writers
Category:English biographers
Category:Recipients of the Legion of Merit
Category:20th-century British women writers
Category:Women's Auxiliary Air Force airwomen
Category:English Eastern Orthodox Christians
Category:20th-century biographers
Category:Fellows of the Royal Society of Literature
Constance
Category:Women biographers |
The stage veteran received acclaim as the wisecracking Sophia Petrillo on 'The Golden Girls.' Getty had been battling Lewy body dementia, her caretaker said.
Estelle Getty, whose acting career bloomed late in life with her Emmy-winning performance as Sophia Petrillo, the wisecracking mother of Bea Arthur's character on the popular NBC sitcom "The Golden Girls," died Tuesday. She was 84.
Getty, who also won notice for her performance on Broadway as Harvey Fierstein's mother in "Torch Song Trilogy," died at her home in Hollywood, said her friend and caretaker, Paul Chapdelaine. Getty had been battling Lewy body dementia for the last eight or nine years, he said.
"The only comfort at this moment is that although Estelle has moved on, Sophia will always be with us," Betty White, one of Getty's "Golden Girls" costars, said in a statement.
Getty was a veteran stage actress in New York City when she came to Los Angeles for the West Coast run of "Torch Song" in 1985, and her managers urged her to try making it in Hollywood. She told them she'd give it two months.
Six weeks later, she got the part of Sophia, an elderly mother who was forced to live with her divorced, middle-aged daughter and her daughter's two friends in a house in Miami.
Though about the same age as Arthur, Getty put on a wig, makeup and dowdy clothes and for seven years engaged in hilarious verbal combat with her TV daughter, Dorothy Zbornak, who towered over the tiny but feisty Sophia.
"Our mother-daughter relationship was one of the greatest comic duos ever, and I will miss her," Arthur said in a statement.
Freed from normal social constraints by a mild stroke, Sophia got many of the show's funniest lines, made even more droll by Getty's deadpan delivery. The intergenerational free-for-all often left Dorothy in stunned silence, from which she recovered by cooing ominously the name of the retirement home from which her mother had been rescued: "Shady Pines."
Dorothy [to Sophia]: Four women live in this house, the toilet seat never has to move, and you always manage to make it bang.
Getty, a natural comedian famous for her one-liners even in private life, played Sophia for laughs, but she also brought depth to the character. It was her idea that Sophia would always carry a purse because, she said, older women are forced to shed so many possessions in their later years that everything they own ends up in their purses.
"Nobody puts down their life very easily," she explained in a 1992 interview with Newsday.
In 1988, the year she won an Emmy for her performance as Sophia, Getty told The Times that she did not know what made her character so popular, but she thought it had something to do with her being so small.
"There's something about people identifying with little people, for various reasons," said the under-5-foot Getty, who sometimes referred to herself as "a miniature person." She said she also thought the difference in stature between her and Arthur set up a comic situation, since Sophia seemed always to be the one telling Dorothy to shut up.
Getty was born Estelle Scher on July 25, 1923, on the Lower East Side of Manhattan in New York City, the daughter of Polish immigrants.
She fell in love with the stage as a small child when her father took her to see a movie and five acts of vaudeville.
"I was stunned," she wrote in "If I Knew Then What I Know Now So What?," her 1988 memoir written with Steve Delsohn. "I had found my world."
By age 5, she was studying singing, dancing and dramatics at a settlement house. She graduated from Seward Park High School and began getting acting experience in the Borscht Belt in the Catskills in upstate New York.
After her marriage in 1946, she worked as a secretary and continued acting, eventually moving into motherly roles.
"I've played mothers to heroes and mothers to zeros," she wrote. "I've played Irish mothers, Jewish mothers, Italian mothers, Southern mothers, New England mothers, mothers in plays by Neil Simon and Arthur Miller and Tennessee Williams. I've played mother to everyone but Attila the Hun."
Getty also played Sylvester Stallone's mother in the 1992 film flop "Stop! Or My Mom Will Shoot," Cher's mother in the 1985 movie "Mask" and Barry Manilow's mother in the 1985 TV movie "Copacabana."
Being typecast, however, also gave Getty the most important roles of her career, including "Golden Girls" and "Torch Song Trilogy," in which for five years she played mother to Fierstein's drag queen in the Broadway production and on national tours. (Anne Bancroft played Fierstein's mother in the 1988 film version.)
Fierstein had met Getty in the late 1970s when playing in small theaters in New York and, Fierstein said, she "drove me crazy asking for a part." He told TV Guide in 1986 that when he got around to casting "Torch Song Trilogy," "It began to strike me as funny to imagine this teeny little thing bossing me around."
Reviewing "Torch Song Trilogy" when it opened in November 1983 at the Huntington Hartford Theatre in Hollywood, former Times theater critic Dan Sullivan called Getty's performance "tough, funny and wonderfully positive."
Getty had lived in the Los Angeles area since her "Golden Girls" days. Her husband of 57 years, businessman Arthur Gettleman, died in 2004. She is survived by her sons, Barry Gettleman and Carl Gettleman; her brother, David Scher; and her sister, Roslyn Howard. |
Athletics News
OFFICE OF ACADEMIC SUPPORT STUDENT-ATHLETE OF THE MONTH
Beginning with the 2006-07 school year, the Office of Academic Support has presented a monthly award to student-athletes who have performed well both in the classroom and in athletic competition. Below is a list of the winners. |
---
abstract: 'We use QCD sum rules to calculate the branching ratio for the production of the meson $X(3872)$ in the decay $B\to X(3872)K$, assumed to be a mixture between charmonium and exotic molecular $[c\bar{q}][q\bar{c}]$ states with $J^{PC}=1^{++}$. We find that in a small range for the values of the mixing angle, $5^\circ\leq\theta\leq13^\circ$, we get the branching ratio ${\mathcal{B}}(B\to XK)=(1.00\pm0.68)\times10^{-5}$, which is in agreement with the experimental upper limit. This result is compatible with the analysis of the mass and decay width of the mode $J/\psi(n\pi)$ and the radiative decay mode $J/\psi\gamma$ performed in the same approach.'
author:
- 'C.M. Zanetti'
- 'M. Nielsen'
- 'R. D. Matheus'
title: 'QCD Sum Rules for the production of the X(3872) as a mixed molecule-charmonium state in B meson decay'
---
Introduction
============
The $X(3872)$ state has been first observed by the Belle Collaboration in the decay $B^+\!\rightarrow\!X(3872)K^+\rightarrow\!J/\psi\pi^+\pi^- K^+$ [@belle1], and was later confirmed by CDF, D0 and BaBar [@Xexpts]. This was the first state of an increasing number of candidates for exotic hadrons discovered recently. The current world average mass is $m_X=(3871.4\pm0.6)\MeV$, and the width is $\Gamma<2.3
\MeV$ at 90% confidence level. BaBar Collaboration reported the radiative decay mode $X(3872)\to \gamma J/\psi$ [@belleE; @babar2], which determines $C=+$. Further studies from Belle and CDF that combine angular information and kinematic properties of the $\pi^+\pi^-$ pair, strongly favors the quantum numbers $J^{PC}=1^{++}$ or $2^{-+}$ [@belleE; @cdf2; @cdf3]. Although the new BaBar result favors the $J^{PC}=2^{-+}$ assignment [@newbabar], established properties of the $X(3872)$ are in conflict with this assignment [@kane; @bpps]. Therefore, in this work we will consider the $X(3872)$ as being a $J^{PC}=1^{++}$ state. BaBar Collaboration reported the upper limit of the branching ratio for the production in $B$ meson decay [@Aubert2005vi]: $$\label{branching}
{\mathcal B}(B^\pm\to K^\pm X(3872))<3.2\times10^{-4}.$$ Recently, Belle Collaboration presented the most precise measurement of the branching fraction ${\mathcal{B}}(B^\pm\to
X(3872)K^\pm){\mathcal{B}}(X(3872)\gamma
J/\psi)=(1.78^{+0.48}_{-0.44}\pm0.12)\times10^{-6}$ [@Bellenew].
The decay modes of the $X(3872)$ into $J/\psi$ and other charmonium states indicate the existence of a $\bar{c}c$ in its content. However the attempts to classify the state in the charmonium spectrum have to deal with the fact that the mass of the $X(3872)$ is not compatible with any of the possible candidates in the quark model [@bg]. Another problem comes from the measurement of the decay rates of the processes $X(3872) \to J/\psi\,\pi^+\pi^-\pi^0$ and $X(3872)\rightarrow\!J/\psi\pi^+\pi^-$, which are comparable [@belleE], =1.00.40.3, \[ratio\] that could indicate a strong isospin and G parity violation, which is incompatible with a $c\bar{c}$ structure.
The coincidence between the $X(3872)$ mass and the $D^{*0}D^0$ threshold: $M(D^{*0}D^0)=(3871.81\pm0.36)\MeV$ [@cleo], inspired the proposal that the $X(3872)$ could be a molecular $(D^{*0}\bar{D}^0-\bar{D}^{*0}D^0)$ bound state with small binding energy [@close; @swanson]. In particular, considering the $X(3872)$ as an admixture of neutral and charged components of molecules, i.e. $D^{0}\bar{D}^{*0}$ and $D^+D^{*-}$, the strong isospin violation observed in Eq. (\[ratio\]) could be explained in a very natural way [@oset2; @nnl]. There is also a possibility that the observed ratio of the $X$ decaying into $J/\psi+2\pi$ or $3\pi$ may not come from a large isospin breaking. In Ref. [@oset1] the isospin breaking is investigated in the dynamical generation of the $X$ as a molecular state, and it is found to be small. But, considering that the two pion and three pion states comes from the decays of $\rho$ and $\omega$ mesons, the small isospin breaking is compensated by the larger phase space of the $\rho$ meson, thus explaining the experimental data.
Another interesting interpretation for the $X(3872)$ is that it could be a compact tetraquark state [@maiani; @tera; @tera2].
The co-existence of both $\bar{c}c$ and multiquark components is subject of debate in many works, and it is supported by some experimental data. In Ref. [@Bignamini:2009sk], a simulation for the production of a bound $D^0\bar{D}^{*0}$ state with biding energy as small as 0.25 MeV, reported a production cross section that is an order of magnitude smaller than the cross section obtained from the CDF data. A similar result was obtained in Ref. [@suzuki] in a more phenomenological analysis. However, as pointed out in Ref. [@Artoisenet:2009wk], a consistent analysis of the $D^0\bar{D}^{*0}$ molecule production requires taking into account the effect of final state interactions of the $D$ and $D^*$ mesons.
Besides, the recent observation, reported by BaBar [@babar09], of the decay $X(3872)\to \psi(2S)\gamma$ at a rate: $ {{\cal B}(X \to
\psi(2S)\,\gamma)\over {\cal B}(X\to\psi\gamma)}=3.4\pm1.4, $ it is much bigger than the molecular prediction [@swan1]: $ {\Gamma(X
\to \psi(2S)\,\gamma)\over\Gamma(X\to\psi\gamma)}\sim4\times
10^{-3}.$
In the framework of the QCD sum rules (QCDSR) the mass of the $X$ were computed with good agreement with data, considering tetraquark [@x3872] and molecular structures [@nnl]. The same success is not found in decay widths calculations. In Ref. [@decayx] the decay width of the modes $J/\psi(n\pi)$ are calculated for the tetraquark structure, and the result is one order larger that the total width. In Ref. [@x3872mix; @x3872rad] the QCDSR approach was used to study the $X(3872)$ structure including the possibility of the mixing between two and four-quark states, where it was successfully applied to obtain the mass of the state and the decays widths for the modes $J/\psi(n\pi)$ and the radiative decay mode $J/\psi\gamma$. This was implemented following the prescription suggested in [@oka24] for the light sector. The mixing is done at the level of the currents and is extended to the charm sector. In a different context (not in QCDSR), a similar mixing was suggested already some time ago by Suzuki [@suzuki]. Physically, this corresponds to a fluctuation of the $c \overline{c}$ state where a gluon is emitted and subsequently splits into a light quark-antiquark pair, which lives for some time and behaves like a molecule-like state
The models for the quark structure can also be applied to study the production of the state in $B$ decays. This subject is studied in different approaches in Refs. [@bxk1; @bxk2; @bxk3]. In this work we will focus on production of the $X(3872)$, using the mixed two-quark and four-quark prescription of Ref. [@x3872mix; @x3872rad] to perform a QCDSR analysis of the process $B^\pm\to
X(3872)K^\pm$.
The decay $B\to X(3872)K$
=========================
The process $B\to X(3872)K$ occurs via weak decay of the $b$ quark, while the $u$ quark is a spectator. The $X$ meson as a mixed state of molecule and charmonium interacts via $\bar{c}c$ component of the weak current. In effective theory, at the scale $\mu\sim m_b\ll m_W$, the weak decay is treated as a four-quark local interaction described by the effective Hamiltonian (see Fig. \[fig1\]): $$\lb{ham}
{\mathcal{H}}_W=\frac{G_F}{\sqrt{2}}V_{cb}V_{cs}^*\left[\left(C_2(\mu)+
\frac{C_1(\mu)}{3}\right)
{\mathcal{O}}_2+\cdots\right]\,,$$ where $V_{ik}$ are CKM matrix elements, $C_1(\mu)$ and $C_2(\mu)$ are short distance Wilson coefficients computed at the renormalization scale $\mu\sim{\mathcal O}(m_b)$. The four-quarks effective operator is ${\mathcal{O}}_2=(\bar{c}\Gamma_\mu c)(\bar{s}\Gamma^\mu b)$, with $\Gamma_\mu=\gamma_\mu(1-\gamma_5)$.
The decay amplitude of the process is calculated from the Hamiltonian (\[ham\]), and it can be factorized by splitting the matrix element in two pieces: $$\begin{aligned}
\lb{amp}
{\mathcal M}
&=&i\frac{G_F}{\sqrt{2}}V_{cb}V_{cs}^*\left(C_2+\frac{C_1}{3}\right)\nn\\&
\times&\langle B(p)\vert J_{\mu}^W\vert K(p^\prime)\rangle\langle X(q)
\vert J^{\mu(\bar{c}c)}\vert0\rangle, \end{aligned}$$ where $p=p^\prime+q$, and the currents are $$\lb{wcurrents} J_{\mu}^W=\bar{s}\Gamma_\mu b\,,\quad
J_{\mu}^{(\bar{c}c)}=\bar{c}\Gamma_\mu c\,.$$ The matrix elements in Eq. ([\[amp\]]{}) are parametrized in the following way $$\lb{2pmatrix}
\langle X(q)\vert J_{\mu}^{(\bar{c}c)}\vert0\rangle=\lambda_W
\epsilon^*_\mu(q)\,,$$ and $$\lb{3pmatrix}
\langle B(p)\vert J_{\mu}^W\vert K(p^\prime)\rangle=f_+(q^2)(p_\mu+
p_\mu^\prime)+f_-(q^2)(p_\mu-p_\mu^\prime)\,.$$ The parameter $\lambda_W$ in (\[2pmatrix\]) gives the coupling between the current $J_\mu^{(\bar{c}c)}$ and the $X$ state. The form factors $f_\pm(q^2)$ describe the weak transition $B\to K$. Hence we can see that the factorization of the matrix element describes the decay as two separated sub-processes.
The decay width for the process $B^\pm\to X(3872)K^\pm$ is given by $$\lb{eqwidth}
\Gamma(B\to XK)=\frac{1}{16\pi m_B^3}\lambda^{1/2}(m_B^2,m_K^2,m_X^2)
\vert{\mathcal{M}}\vert^2,$$ with $\lambda(x,y,z)=x^2+y^2+z^2-2xy-2xz-2yz$. The invariant amplitude squared can be obtained from (\[amp\]):
$$\begin{aligned}
\vert\mathcal{M}\vert^2&=&\frac{G_F^2}{2}\vert V_{cb}V_{cs}\vert^2\left(C_2
+\frac{C_1}{3}\right)^2\nn\\\nn\\
&\times& \lambda(m_B^2,m_K^2,m_X^2)\lambda_W^2f_+^2(q^2)\vert_{q^2\to-m_X^2}
\,. \end{aligned}$$
We will use QCD sum rules in order to determine the parameter $\lambda_W$ and the form factor $f_+(q^2)$, and therefore we can obtain the width of the decay.
Two-point correlator
====================
The QCD sum rule approach [@svz; @rry; @SNB] is based on the two point correlator: $$\Pi_{\mu\nu}(q)=i\int d^4y~e^{iq\cdot y}\langle0\vert T\{J_\mu^X(y)
J_\nu^{(\bar{c}c)}\}\vert0\rangle\,,$$ where the current $J_\nu^{(\bar{c}c)}$ is defined in (\[wcurrents\]). For the $X$ meson we will follow [@oka24] and consider a mixed charmonium-molecular current as in Ref. [@x3872mix; @x3872rad]. For the charmonium part we use the conventional axial current: $$j'^{(2)}_{\mu}(x) = \bar{c}_a(x) \gamma_{\mu} \gamma_5 c_a(x).
\lb{curr2}$$ The $D^0$ $D^{*0}$ molecule is interpolated by [@liuliu; @dong; @stancu] (with $q=u$): $$\begin{aligned}
j^{(4q)}_{\mu}(x) & = & {1 \over \sqrt{2}}
\bigg[
\left(\bar{q}_a(x) \gamma_{5} c_a(x)
\bar{c}_b(x) \gamma_{\mu} q_b(x)\right) \nonumber \\
& - &
\left(\bar{q}_a(x) \gamma_{\mu} c_a(x)
\bar{c}_b(x) \gamma_{5} q_b(x)\right)
\bigg],
\lb{curr4} \end{aligned}$$ As in Ref. [@oka24] we define the normalized two-quark current as $$j^{(2q)}_{\mu} = {1 \over 6 \sqrt{2}} \uu j'^{(2)}_{\mu},
\lb{curr2}$$ and from these two currents we build the following mixed charmonium-molecular current for the $X(3872)$: $$J_{\mu}^q(x)= \sin(\theta) j^{(4q)}_{\mu}(x) + \cos(\theta)
j^{(2q)}_{\mu}(x).
\lb{field}$$ We will consider a small admixture of $D^+D^{*-}$ and $D^-D^{*+}$ components, then we have for the $X$ current: $$J_{\mu}^X(x)= \cos\alpha J_{\mu}^u(x)+\sin\alpha J_{\mu}^d(x),
\label{4mix}$$ with $J_{\mu}^u(x)$ and $J_{\mu}^d(x)$ given by Eq.(\[field\]).
Considering the $u$ and $d$ quarks to be degenerate, [*i.e.*]{}, $m_u=m_d$ and $\uu=\dd$, and inserting the currents (\[wcurrents\]) and (\[4mix\]) in the correlator we have in the OPE side of the sum rule $$\begin{aligned}
\Pi^{\mathrm{OPE}}_{\mu\nu}(q)&=&(\cos\alpha+\sin\alpha)\biggl(\sin\theta\,
\Pi^{4,2}_{\mu\nu}(q)\nn\\&+&\frac{\qq}{6\sqrt{2}}\cos\theta\,
\Pi^{2,2}_{\mu\nu}(q)\biggr)\,, \end{aligned}$$ where $$\begin{aligned}
\Pi^{2,4}_{\mu\nu}(q)&=&i\int d^4y ~e^{iq\cdot y}\langle0\vert T\{
J_\mu^{4q}(y)J_{\nu(\bar{c}c)}(0)\}\vert0\rangle\nn\\
\Pi^{2,2}_{\mu\nu}(q)&=&i\int d^4y ~e^{iq\cdot y}\langle0\vert T\{
J_\mu^{2q}(y)J_{\nu(\bar{c}c)}(0)\}\vert0\rangle\,. \end{aligned}$$ The contribution from the vector part of the current $J_\nu^{(\bar{c}c)}$ vanishes after the integration is performed, hence these correlators are equal (except for a minus sign) to the ones calculated in Ref. [@x3872mix] for the two-point correlator of the $X(3872)$.
On the phenomenological side the correlator is determined inserting the intermediate state of the $X$: $$\begin{aligned}
\Pi_{\mu\nu}^{phen}(q)&=&\frac{i}{q^2-m_X^2}\langle0\vert J^X_\mu\vert
X(q)\rangle\langle X(q)\vert J^{(cc)}_\nu\vert0\rangle\,,\nn\\
&=&\frac{i\lambda_X\lambda_W}{Q^2+m_X^2}\left(g_{\mu\nu}-\frac{q_\mu q_\nu}
{m_X^2}\right) \end{aligned}$$ where $q^2=-Q^2$, and we have used the definition (\[2pmatrix\]) and $$\langle0\vert J^X_\mu\vert X(q)\rangle=\lambda_X\epsilon_\mu(q)\,.$$ The parameter defining the coupling between the current $J^X_\mu$ and the $X$ meson has been calculated in Ref. [@x3872mix], and its value is $\lambda_X = (3.6 \pm 0.9)\times10^{-3} \GeV^5$. In the QCDSR approach a Borel transform to $Q^2\to M^2$ ($Q^2=-q^2$) is performed to improve the matching between both sides of the sum rules. The Borel transform exponentially suppresses the contribution from excited states in the phenomenological side of the sum rule. In the OPE side the Borel transform suppresses the contribution from higher dimension condensates [@nnl]. After performing the Borel transform we get in the structure $g_{\mu\nu}$:
$$\begin{aligned}
\lb{2psumrule}
\lambda_W\lambda_Xe^{-\frac{m_X^2}{M^2}}&=&-(\cos\alpha+\sin\alpha)
\biggl(\sin\theta\,\Pi^{24}(M^2)\nn\\&+&\frac{\qq}{6\sqrt{2}}\cos\theta\,
\Pi^{2,2}(M^2)\biggr)\,. \end{aligned}$$
This expression is analysed numerically to obtain the coupling parameter $\lambda_W$. We perform the calculation using the same values for the masses and QCD condensates listed in [@x3872mix], and in the same region in threshold parameter $s_0$ and Borel mass $M^2$ that we have used in the mass and $\lambda_X$ analysis in Ref. [@x3872mix], $\sqrt{s_0}=4.4\GeV$, $2.6 \GeV^2 \leq M^2 \leq
3.0 \GeV^2$. The mixing angles determined in the same reference are: $$\lb{mixangles}5^\circ \leq \theta \leq13^\circ\,,
\quad\alpha=20^\circ\,.$$ Taking into account the variation in the Borel mass parameter and the mixing angle $\theta$, the result for the $\lambda_W$ parameter is: $$\lb{lambdaW}
\lambda_W=(1.29\pm0.51)\GeV^2\,.$$
Three-point correlator
======================
The form factor of the $B\to K$ transition matrix (\[3pmatrix\]) can be evaluated from the three point correlator: $$\Pi_{\mu}(p,p^\prime)=\!\!\int d^4x \,d^4y \,e^{i(p^\prime\cdot x-\,p
\cdot y)}\langle0\vert T\{J_\mu^W(0)J_K(x)J^\dagger_B(y)\}\vert0\rangle$$
In the OPE side we use the weak current $J^W_\mu$ defined in (\[wcurrents\]) and the interpolating currents of the $B$ and $K$ pseudoscalar mesons: $$\begin{aligned}
J_K(x)=i\,\bar{u}_a(x)\gamma_5 s_a(x)\,,\quad J_B=i\,\bar{u}_a(x)
\gamma_5 b_a(x)\,. \end{aligned}$$ We work at leading order in $\alpha_s$ and consider condensates up to dimension 5 and terms linear in the mass of the $s$ quark.
The phenomenological side of the sum rule is computed by inserting the intermediate states of the $B$ and $K$ mesons in the correlator: $$\begin{aligned}
\Pi^{\mathrm{phen}}_\mu=-\frac{f_Bf_Km_K^2m_B^2 }{m_b(m_s+m_u)}\frac{(f_+(t)(p+
p^\prime)_\mu+f_-(t)q_\mu)}{(p^2-m_B^2)(p^{\prime2}-m_K^2)}\,,\nn\\ \end{aligned}$$ with $t=q^2=(p-p^\prime)^2$, using (\[3pmatrix\]) and the following definitions: $$\begin{aligned}
\langle0\vert J_K\vert K(p^{\prime})\rangle&=&f_K\frac{m_K^2}{m_s+m_u}\nn\\
\langle0\vert J_B\vert B(p)\rangle&=&f_B\frac{m_B^2}{m_b}\,. \end{aligned}$$ Performing a double Borel transform, $P^2\to M^2$ and $P^{\prime2}\to
M^{\prime2}$, and matching both sides of the sum rule, we get in the structure $(p_\mu+p^\prime_\mu)$ (with $P^2=-p^2$, $P^{\prime2}=-p^{\prime2}$, $Q^2=-q^2=-t)$:
$$\begin{aligned}
\lb{sr3p}
&&-\frac{f_Bf_Km_K^2m_B^2 f_+(t)}{m_b(m_u+m_u)}e^{-\frac{m_B^2}{M^2}-
\frac{m_K^2}{M^{\prime2}}}=\frac{-1}{4\pi^2}\int_{s_{\min}}^{s_0}
{\mathrm{ds}}\int_0^{u_0}{\mathrm{du}}\,\rho^{pert}(s,t,u)e^{-\frac{s}{M^2}
-\frac{u}{M^{\prime2}}}+\frac{1}{2}\uu(m_b+m_s)e^{-\frac{m_b^2}{M^2}}\nn\\
&&-\frac{m_0^2\uu e^{-\frac{m_b^2}{M^2}}}{8M^4M^{\prime2}} \biggl((m_b^3
+m_b^2m_s)(M^2+M^{\prime2})-M^2(m_b(M^2+2M^{\prime2}+t)+m_s(M^{\prime2}
+2M^2+t))\biggr)\,, \end{aligned}$$
where the perturbative contribution is given by
$$\begin{aligned}
&& \rho^{\mathrm{pert}}(s,t,u)=\frac{3}{4{\lambda}^{\frac{3}{2}}(s,t,u)}
\biggl[u(2m_b^2-s-t+u)\nn\\&\times&(2m_bm_s-s-u+t)+((s-m_b^2)(s-t+u)-2su)
\nn\\&\times&(2m_bm_s-s+t-u)+(s+u-mb^2)\lambda(s,t,u)\biggr]\,.\nn\\ \end{aligned}$$
The integration limit $s_{\min}$ is given by $$s_{\min}=m_b^2+\frac{m_b^2u}{m_b^2-t}\,.$$ $s_0=(m_B+\Delta_s)^2$ and $u_0=(m_K+\Delta_u)^2$ are the continuum threshold parameters for the $B$ and $K$ respectively. Note that, after the double Borel transform, the contributions from the quark condensate and mixed condensates of the $s$ quark are eliminated.
We use the following relation between the Borel masses $M^2$ and $M^{\prime2}$ [@gbbk]: $$M^{\prime2}=\frac{0.64\GeV^2}{m_B^2-m_b^2}M^2\,.$$
Result for the form factor
--------------------------
The sum rules are analysed numerically using the following values for quark masses and QCD condensates, and for meson masses and decay constants [@x3872; @narpdg; @pdg]: \[qcdparam\] &m\_b(m\_b)=4.7,m\_s=0.140\
&=-(0.230.03)\^3\^3,\
&m\_0\^2=0.8\^2,\
&m\_[B]{} = 5.279 m\_[K]{} = 493.677\
&f\_[B]{} = 0.170 ,f\_[K]{} = 0.160 . We use the value of the mixing angles $\al$ and $\theta$ given in (\[mixangles\]). For the continuum threshold parameters we take $\Delta_s=\Delta_u=0.5\GeV$.
In Fig. \[Q2vsM2\] we show the plot for the form factor $f_+$ calculated in the sum rules from Eq. (\[sr3p\]) as a function of the Borel mass $M^2$ and the momentum transfer $Q^2$. For the region $M^2\ge20\GeV^2$ shown in the plot the sum rule presents a good stability.
In the following analysis, to determine the $Q^2$ dependence of the form factor, we choose the Borel mass within the region of stability around the mass of the $B$ meson, $26 \GeV^2\leq M^2\leq30\GeV^2$. We fit (\[sr3p\]) within the stable region by matching both sides of the sum rule. In Fig. \[fit.form\] we show, through the dots, the QCDSR results for the form factor $f_+(Q^2)$ as a function of $Q^2$. The numerical results can be well fitted by a monopolar parametrization (shown by the solid line in Fig. (\[fit.form\])): $$\lb{fplus}
f_+(Q^2)=\frac{(17.55\pm0.04) \GeV^2}{(105.0\pm1.76)\GeV^2+Q^2}\,.$$ For the decay width calculation, we need the value of the form factor at $Q^2=-m_X^2$, where $m_X$ is the mass of the off-shell $X$ meson. Therefore we have: $$\lb{fpluspolo}
f_+(Q^2)\vert_{Q^2=-m_X^2}=0.195\pm0.003\,.$$
The decay width $B\to XK$
-------------------------
To determine the the decay width we insert, in the expression (\[eqwidth\]), the parameter $\lambda_W$ (\[lambdaW\]) obtained in the two-point sum rule calculation, and the value of the form factor $f_+$, from the three-point sum rule, at the $X$ meson pole (\[fpluspolo\]). The branching ratio is therefore calculated dividing the result by the total width of the $B$ meson $\Gamma_{\mathrm{tot}}=\hbar/\tau_B$: $$\lb{result}
\mathcal{B}(B\to X(3872)K)=(1.00\pm0.68)\times10^{-5}\,,$$ where we have used the mean life of the $B$ meson $\tau_B=1.638\times10^{-12}$ s, the CKM parameters $V_{cs}=1.023$, $V_{cb}=40.6\times10^{-3}$ [@pdg], and the Wilson coefficients $C_1(\mu)=1.082$, $C_2(\mu)=-0.185$, computed at $\mu=m_b$ and $\bar{\Lambda}_{\mathrm{MS}}=225\MeV$ [@buras]. The result (\[result\]) is in agreement with the experimental upper limit (\[branching\]).
For completeness we also compute the branching ratio for the $X$ as pure $\bar{c}c$ and molecular states. We choose the mixing angle as $\theta=90^\circ$ and $\theta=0^\circ$ in Eq. (\[field\]), and we get respectively for the pure molecule and pure charmonium: $$\lb{resmol}
{\mathcal{B}}(B\to X_{\mathrm{mol}}K)=(0.38\pm0.06)\times10^{-6}\,,$$ $$\lb{resccbar}
{\mathcal{B}}(B\to X_{\bar{c}c}K)=(2.68\pm0.50)\times10^{-5}\,.$$ Comparing the results for the pure states with the one for the mixed state (\[result\]), we can see that the branching ratio for the pure molecule is one order smaller, while the pure charmonium is larger.
The result for the pure molecular state in Eq. (\[resmol\]) can be compared with the one from Ref. [@bxk1]. In this work the authors study the production of the $X$ as a molecular state in the decay $B\to XK$ through the coalescence of charm mesons. The calculation of the branching ratio is strongly dependent on the choice of parameters, and it is found to be of order $10^{-4}$ to $10^{-6}$. In Ref. [@bxk3], the production of the $X$ as a $2^3P_1$ charmonium state is studied in pQCD, and their result for the branching ratio is $7.88^{+4.87}_{-3.76}\times10^{-4}$, which is an order bigger than our result for the pure charmonium (\[resccbar\]).
Summary and conclusions
=======================
We have presented a QCDSR analysis of the production of the $X(3872)$ state considering a mixed charmonium-molecular current in the decay $B\to XK$. We find that the sum rules result in Eq. (\[result\]), obtained by using the factorization hypothesis, is smaller, but compatible with the experimental upper limit. Since, it is known that non-factorizable contributions may play an important role in hadronic decays of $B$ mesons [@Khodjamirian], our result can be interpreted as a lower limit for the branching ratio.
This result was obtained by considering the mixing angles in Eqs. (\[4mix\]) and (\[field\]) with the values $\al=20^\circ$ and $5^\circ \leq \theta \leq 13^\circ$. The present result is also compatible with previous analysis of the mass of the $X$ state and the decays into $J/\psi\pi^0\pi^+\pi^-$ and $J/\psi\pi^+\pi^-$ [@x3872mix], and the radiative mode $\gamma J/\psi$ [@x3872rad], since the values of the mixing angles used in both calculations are the same. It is important to mention that there is no new free parameter in the present analysis and, therefore, the result presented here strengthens the conclusion reached in Refs. [@x3872mix; @x3872rad] that the $X(3872)$ is probably a mixture between a $c\bar{c}$ state and $D^0\bar{D}^{*0},~\bar{D}^0{D}^{*0},~D^+D^{*-}$ and $D^-D^{*+}$ molecular states. From Eq. (\[field\]) one may be tempted to say that the $c\bar{c}$ component of the state described by such current is dominant ($\sim$97%), like the conclusion presented in Ref. [@x3872mix]. However, from a closer look at Eq. (\[curr2\]), one can see that the $c\bar{c}$ component of our current is already multiplied by a dimensional parameter, the quark condensate, in order to have the same dimension of the molecular part of the current. Therefore, it is not clear that only the angle in Eq. (\[field\]) determines the percentage of each component. To try to evaluate the importance of each part of the current it is better to analyse the results obtained with each component, like the results presented in Eqs. (\[resmol\]) and (\[resccbar\]). From these results we see that the $c\bar{c}$ part of the state plays a very important role in the determination of the branching ratio. By the other hand, in the decay $X\to J/\psi\pi^+\pi^-$ and $X\to J/\psi\pi^+\pi^-\pi^0$, the width obtained in our approach for a pure $c\bar{c}$ state is [@x3872mix]: $$\lb{xppcc}
\Gamma(X_{\bar{c}c}\to J/\psi n\pi)=0\,,$$ and, therefore, the molecular part of the state is the only one that contributes to this decay, playing an essential role in the determination of this decay width. Also, for a pure $c\bar{c}$ state one gets: $$M_{X_{c\bar{c}}}=(3.52\pm0.05)~\mbox{GeV},$$ from where one sees again that the molecular part of the state plays a very important role in the determination of its mass.
Therefore, although we cannot determine the percentages of the $c\bar{c}$ and the molecular components in the $X(3872)$, we may say that both components are extremely important, and that, in our approach, it is not possible to explain all the experimental data about the $X(3872)$ with only one component.
Acknowledgment {#acknowledgment .unnumbered}
==============
The authors would like to thank M.E. Bracco for discussions. This work has been partially supported by FAPESP and CNPq.
[999]{}
S.-K. Choi [*et al.*]{} \[Belle Collaboration\], Phys. Rev. Lett. [**91**]{}, 262001 (2003).
V. M. Abazov [*et al.*]{} \[D0 Collaboration\], Phys. Rev. Lett. [**93**]{}, 162002 (2004); D. Acosta [*et al.*]{} \[CDF Collaboration\], Phys. Rev. Lett. [**93**]{}, 072001 (2004); B. Aubert [*et al.*]{} \[BaBar Collaboration\], Phys. Rev. D [**71**]{}, 071103 (2005).
K. Abe [*et al.*]{} \[Belle Collaboration\], hep-ex/0505037, hep-ex/0505038.
B. Aubert [*et al.*]{} \[BaBar Collaboration\], Phys. Rev. D [**74**]{}, 071101 (2006).
D. Abulencia [*et al.*]{} \[CDF Collaboration\], Phys. Rev. Lett. [**96**]{}, 102002 (2006).
D. Abulencia [*et al.*]{} \[CDF Collaboration\], Phys. Rev. Lett. [**98**]{}, 132002 (2007).
P. del Amo Sanches [*et al.*]{} \[BaBar Collaboration\] Phys. Rev. D [**82**]{}, 011101 (2010).
Yu. S. Kalashnikova and A. V. Nefediev, Phys. Rev. D [**82**]{}, 097502 (2010). T. J. Burns, F. Piccinini, A. D. Polosa and C. Sabelli, Phys. Rev. D [**82**]{}, 074003 (2010).
B. Aubert [*et al.*]{} \[BABAR Collaboration\], Phys. Rev. Lett. [**96**]{}, 052002 (2006) \[arXiv:hep-ex/0510070\].
V. Bhardwaj [*et al.*]{} \[ Belle Collaboration \], \[arXiv:1105.0177 \[hep-ex\]\].
T. Barnes and S. Godfrey, Phys. Rev. D [**69**]{}, 054008 (2004).
C. Cawfield [*et al.*]{} \[CLEO Collaboration\], Phys. Rev. Lett. [**98**]{}, 092002 (2007).
F.E. Close and P.R. Page, Phys. Lett. B [**578**]{}, 119 (2004).
E.S. Swanson, Phys. Rept. [**429**]{}, 243 (2006).
D. Gamermann, J. Nieves, E. Oset, E. Ruiz Arriola, Phys. Rev. D [**81**]{}, 014029 (2010).
M. Nielsen, F.S. Navarra, S.H. Lee, Phys. Rep. [**497**]{}, 41 (2010).
D. Gamermann, E. Oset, Phys. Rev. D [**80**]{}, 014003 (2009).
L. Maiani, F. Piccinini, A.D. Polosa, V. Riquer, Phys. Rev. D [**71**]{}, 014028 (2005).
K. Terasaki, Prog. Theor. Phys. [**122**]{}, 1285 (2009).
K. Terasaki, arXiv:1005.5573.
C. Bignamini, B. Grinstein, F. Piccinini, A. D. Polosa and C. Sabelli, Phys. Rev. Lett. [**103**]{}, 162001 (2009).
M. Suzuki, Phys. Rev. D [**72**]{}, 114013 (2005).
P. Artoisenet and E. Braaten, arXiv:0911.2016 \[hep-ph\]. B. Aubert [*et al.*]{} \[BaBar Collaboration\], Phys. Rev. Lett. [**102**]{}, 132001 (2009).
E.S. Swanson, Phys. Lett. B [**588**]{}, 189 (2004); Phys. Lett. B [**598**]{}, 197 (2004).
R.D. Matheus, S. Narison, M. Nielsen and J.-M. Richard, Phys. Rev. D [**75**]{}, 014005 (2007).
F.S. Navarra, M. Nielsen, Phys. Lett. B [**639**]{}, 272 (2006).
R. D. Matheus, F. S. Navarra, M. Nielsen and C. M. Zanetti, Phys. Rev. D [**80**]{}, 056002 (2009) \[arXiv:0907.2683 \[hep-ph\]\]. M. Nielsen and C. M. Zanetti, Phys. Rev. D [**82**]{}, 116002 (2010) \[arXiv:1006.0467 \[hep-ph\]\].
J. Sugiyama, T. Nakamura, N. Ishii, T. Nishikawa and M. Oka, Phys. Rev. D [**76**]{}, 114010 (2007).
E. Braaten and M. Kusunoki, Phys. Rev. D [**71**]{}, 074005 (2005) \[arXiv:hep-ph/0412268\]. E. Braaten and M. Kusunoki, Phys. Rev. D [**72**]{}, 014012 (2005) \[arXiv:hep-ph/0506087\]. X. Liu and Y. M. Wang, Eur. Phys. J. C [**49**]{}, 643 (2007).
M.A. Shifman, A.I. and Vainshtein and V.I. Zakharov, Nucl. Phys. B [**147**]{}, 385 (1979).
L.J. Reinders, H. Rubinstein and S. Yazaki, Phys. Rept. [**127**]{}, 1 (1985).
For a review and references to original works, see e.g., S. Narison, [*QCD as a theory of hadrons, Cambridge Monogr. Part. Phys. Nucl. Phys. Cosmol.*]{} [**17**]{}, 1 (2002) \[hep-h/0205006\]; [*QCD spectral sum rules , World Sci. Lect. Notes Phys.*]{} [**26**]{}, 1 (1989); [ Acta Phys. Pol.]{} B [**26**]{}, 687 (1995); [ Riv. Nuov. Cim.]{} [**10N2**]{}, 1 (1987); [ Phys. Rept.]{} [**84**]{}, 263 (1982).
Y.-R. Liu, X. Liu, W.-Z. Deng and S.-L. Zhu, Eur. Phys. J. C [**56**]{}, 63 (2008).
Y. Dong, A. Faessler, T. Gutsche and V.E. Lyubovitskij, Phys. Rev. D [**77**]{}, 094013 (2008).
Fl. Stancu, arXiv:0809.0408.
M.E. Bracco and M. Nielsen, Phys. Rev. D [**82**]{}, 034012 (2010).
S. Narison, Phys. Lett. B [**466**]{}, 345 (1999); B [ **361**]{}, 121 (1995); B [**387**]{}, 162 (1996); B [**624**]{}, 223 (2005).
K. Nakamura et al. (Particle Data Group), J. Phys. G 37, 075021 (2010)
G. Buchalla, A. J. Buras and M. E. Lautenbacher, Rev. Mod. Phys. [**68**]{}, 1125 (1996) \[arXiv:hep-ph/9512380\]. A. Khodjamirian and R. Ruckl, arXiv:hep-ph/9405310.
|
Q:
Call method upon setting a declared public property
The problem I have is the __set() magic method, by design, only works for undeclared properties. Is there a __set() like solution for declared properties where I can call upon a method when a property is set? Properties being declared would greatly increase the ease of use for the classes I am designing, especially for IDEs.
A:
No, you can't use any of the magic for properties and methods declared or visible in the current scope. Php only invokes them if it cannot find the declaration in the class. That's what the documentation says about it:
The overloading methods are invoked when interacting with properties or methods that have not been declared or are not visible in the current scope.
But you can help most IDEs, PhpStorm in particular, I'm sure Netbeans also supports it, by providing the PHPDoc for the class with the properties and methods:
/**
* @property string $myProperty
* @method string myMethod(int $param = 10)
*/
class MyClass
{
}
|
Read Christian news headlines from around the world. Conservative commentary, persecution headlines, Religion Today, and breaking Christian news. Find news stories that matter to Christians here at Crosswalk.com special news coverage! In addition you can find great articles and news stories about marriage, parenting, homeschool, jobs, personal finance and much more.Intersection of Life and Faith
Depression and Christmas
The "Holiday Blues," anxiety and even depression affect many people about this time of year. To some, remembrance of pleasant childhood memories now gone forever contrast with today's unpleasant realities. Issues such as family strife, unemployment with financial constraints, loneliness from prior losses of loved ones, isolation, unrealized expectations and even family gatherings with tension from estranged relatives may contribute to sadness and despair. The time of joy, cheer, wonderful family reunions and the enjoyment of deep, meaningful relationships just doesn't exist for many. Personal circumstances mock "It's a Wonderful Life."
But unfortunately, feelings of hopelessness and despair occur at any time of year for others. Unrelenting depression haunts the souls of many Christians day after day after day with nothing to blame, no clear cause and no sudden discovery of the underlying problem.
As a Christian medical doctor, I care for many committed Christians and have heard what follows.
She described her symptoms to me. She felt down, had no joy in formerly joyful activities, wanted to hide in her bedroom and pull the covers over her head, cried at anything and nothing, constantly barked at her husband and children and had considered suicide. She found simple chores impossible. Fellowship became painful to endure. Prayer became a hollow exercise. She searched her life for unconfessed sin and confessed it all. Worship meant talking with congregants after the service which took all her effort. She cried as she spoke. She tried everything her friends recommended; get out more, pray more, study the Bible more, exercise, take the latest nutriceutical, eat organic and even, "snap out of it." Nothing helped. I prescribed an anti-depressant for her.
Depression is the word in the church that must not be spoken. Those taking anti-depressants may find themselves stigmatized by pastors, elders or church members. I've had patients forbidden by husbands and elders from taking medicine for serious depression. I've had many Christian women take anti-depressants secretly, fearing the backlash waiting them should the church or their family find out.
I've heard some pastors rage from the pulpit, "We've given up God for a happy pill! Instead of depending on the power of God and the truth of his word, we've become the Prozac generation! Doctor's pass out depression pills like candy!" Perhaps you've heard sermons like that as well. Few conditions generate more controversy in the evangelical church than depression.
The word "depression" does not appear in the ESV translation of the Bible, but the Bible certainly addresses sorrow and despair often with vivid descriptions.
Even in David, the man after God's own heart, speaks of his despair. In Psalm 88:3-9, David writes,
For my soul is full of troubles,
and my life draws near to Sheol.
I am counted among those who go down to the pit;
I am a man who has no strength,
like one set loose among the dead,
like the slain that lie in the grave,
like those whom you remember no more,
for they are cut off from your hand.
You have put me in the depths of the pit,
in the regions dark and deep.(ESV)
David also wrote,
"Save me, O God! For the waters have come up to my neck. I sink in deep mire, where there is no foothold; I have come into deep waters, and the flood sweeps over me. Psalms 69: 1,2. (ESV)
The Bible generally attributes sorrow and despair to enemies or unconfessed sin, both of which can decidedly cause depression. Secret sins hurt the most. Failure to repent, turn from the sin and receive forgiveness and failure to appreciate the glory of God, the magnitude of His sacrifice, the joy of His service and the wonder of His love and His holy word can cause the Christian enter the darkness of despair.
The seriousness of spiritual depression and the need of repentance, forgiveness, turning from sin, restoration of relationships, seeking the face of God and recognition of the sovereignty of God cannot be overemphasized. Spiritual depression robs us of the certainty of God's care and providence. Pastor and elders must boldly proclaim the gospel seeking restoration of the straying or troubled saint. The family of God needs to be involved; encouraging, coming along side, supporting and helping the downcast. God can heal if He chooses—and He does.
The puritans recognized depression and called it melancholy of the soul. They admonished confession, repentance, forgiveness and pleading at the throne of God for mercy. But the Puritans also recognized an endogenous depression which happened to the spiritually upright, to those with no cause for the turmoil and despair within. Richard Baxter, a Puritan pastor wrote, "If other means will not do, neglect not medicine; and though they will be averse to it, as believing that the disease is only in the mind, they must be persuaded or forced to it."
My story continues,
When she return four weeks later, she said, "Doctor Anderson, I feel normal for the first time in eight years. I can pray and worship and fellowship again. Christ has become more real than ever. My husband and family cannot believe the change."
Pastors, elders and the church family need to acknowledge the medical side of depression and not just the spiritual side of depression. Medical depression exists and affects the saved and unsaved alike. The seriously depressed who find healing and relief in medical treatment benefit from the common grace of God which is showered on all humanity (it rains of the just and unjust alike). Those saints should not be castigated, belittled or shunned.
True medical depression is hard to understand for those who have never experienced it. But the depressed who find themselves in the pit with no way out, those who view suicide as a relief from this despair and those who wish for death every night as they crawl into bed understand. They need kindness, understanding, and help from the church without the side looks and whispers. They need the body of Christ to come along side, provide Christian love, care and help, just like one would with a grieving widow. The depressed need understanding and prayer, not a scold.
Matt Anderson, MD is an obstetrician/gynecologist who has practiced for 28 years. He and his wife have four married children and 14 grandchildren. He is a member of the American Association of Prolife Obstetricians and Gynecologists (aaplog.org). He and his wife attend the Mounds View campus of Bethlehem Baptist Church in Minneapolis, MN. Dr. Anderson has written for WORLD Magazine (worldmag.com) and occasionally blogs at mdviews.wordpress.com. |
EU Bickering Pauses for Nobel
Leaders Tout Past Achievements, but Struggle to Lay Out a Detailed Vision of the Future
ENLARGE
The European Union was awarded the Nobel Peace Prize on Monday at a ceremony in front of some 950 people at Oslo's city hall.
European Pressphoto Agency
By
Gabriele Steinhauser and
Kjetil Malkenes Hovland
Updated Dec. 10, 2012 7:28 p.m. ET
OSLO—The often fractious leaders of Europe took a break from constant questions about how to resolve their debt troubles Monday to celebrate their relative peace.
For a few hours, most of the leaders of a continent once racked by war joined to accept this year's Nobel Peace Prize amid grand ceremony, more than three years into an economic crisis that has plunged much of the continent into recession and stoked tensions among many of Europe's member states.
The head of the Nobel Committee, Thorbjørn Jagland, hailed the European Union for bringing peace after centuries of war as he handed over the diploma and medal at a ceremony before some 950 people at Oslo's city hall.
Invoking the specter of a previous economic crisis—that of the 1930s—that led to protectionism, nationalism and war, he said, "We know from the interwar years that this is what can happen when ordinary people pay the bills for a financial crisis triggered by others. But the solution now as then is not for the countries to act on their own at the expense of others."
Timeline: History of the EU
Herman Van Rompuy, left, José Manuel Barroso, in the middle, and Martin Schulz hold the Nobel Peace Prize after they accepted it on behalf of the EU during a ceremony at City Hall in Oslo on Monday. Suzanne Plunkett/Reuters
Accepting the prize, Herman Van Rompuy, president of the European Council, which brings together the governments of the 27 member states, recounted hearing stories of war firsthand from his family as a child in Belgium.
"In 1940, my father, then 17, had to dig his own grave. He got away; otherwise, I would not be here today," he said.
In the front two rows of the audience were 20 of the bloc's 27 leaders, including German Chancellor Angela Merkel and Italian Prime Minister Mario Monti, who over the weekend said he intends to resign.
British Prime Minister David Cameron, whose Conservative Party contains deep euro-skeptics, was among those who skipped the event. He instead sent Deputy Prime Minister Nick Clegg, who heads the more-euro-friendly Liberal Democrat Party.
Europe's leaders have been seeing a lot of each other as they muddle through the crisis. They are due to return to a summit in Brussels on Thursday for the next installment. But their views on where Europe needs to go remain far apart.
"Today's award gives Europeans a considerable task for the future," said French President François Hollande, who sat next to Ms. Merkel, with whom he has had somewhat chilly relations. "We don't want to be the heads of states and government who have renounced the European project."
Messrs. Van Rompuy and European Commission chief José Manuel Barroso spoke of the EU's past achievements, including reconciling Germany and France after the ravages of two world wars to the rapid integration of former Soviet-bloc states in Eastern Europe.
But Mr. Van Rompuy acknowledged that those memories were fading. "Parents struggling to make ends meet, workers recently laid off, students who fear that, however hard they try, they won't get their first job," he said. "When they think about Europe, peace is not the first thing that comes to mind.
"War has become inconceivable," he added. "Yet inconceivable does not mean impossible."
Some in Norway and farther afield argued that the award shouldn't have been made while Brussels is promoting austerity in some of Europe's most indebted states—especially Greece, Spain and Portugal—in response to the crisis.
An odd coalition of roughly 300 international peace activists and Norwegian political parties set on keeping their country outside the EU protested the award Sunday. "How can you award those who push my country and eventually the rest of the South of Europe back into the Middle Ages?" Dimitris Kodelas, a member of the Greek Parliament for the far-left Syriza party, asked the crowd.
Still, on Monday evening, the mood in the streets was more celebratory. and the crowd, estimated at 2,000, much larger. Messrs. Van Rompuy and Barroso and Martin Schulz, president of the European Parliament, waved from the balcony at the Grand Hotel to revelers below. After a torchlight parade through the streets, some in the crowd could be heard chanting, "EU, EU."
Corrections & Amplifications Martin Schulz is president of the European Parliament. An earlier version of this article misspelled his last name as Shultz.
This copy is for your personal, non-commercial use only. Distribution and use of this material are governed by our Subscriber Agreement and by copyright law. For non-personal use or to order multiple copies, please contact Dow Jones Reprints at 1-800-843-0008 or visit www.djreprints.com. |
A translational case study of empowerment into practice: A realist evaluation of a member-led dementia empowerment service.
Involving people with dementia in decision-making is widely accepted as a means of empowering them to lead more independent lives and have more meaningful roles in shaping their care. However, there is a need to conduct rigorous evaluations of empowerment-driven services and policies in order to develop a deeper understanding about how to optimise successful implementation. This paper presents the results of an evaluation of Dementia Northern Ireland, an organisation initiated and led by people with dementia. We used a realist evaluation approach that comprised interviews with 15 people with dementia, three staff and two board members, ethnographic observations, along with documentary analysis to identify 'what works, for whom, under what circumstances'. The analysis used realist logic to build up context-mechanism-outcome configurations. The Dementia Northern Ireland service model of empowerment revolved around the formation and maintenance of social groups of people with dementia. Facilitators, recruited and selected by people with dementia, supported six groups, consisting of one to four members with mild to moderate cognitive impairment. Facilitators helped expand empowerment groups, facilitate decision-making, awareness raising and consultation opportunities with group members. The 'Empowerment Groups' appeared to lead to the development of a shared social identity and a sense of collective strength as indicated by interview and observational data demonstrating an activist mentality among group members to challenge the stigma surrounding dementia. Group members also reported improved quality of life. Widespread implementation of the empowerment model has the potential to lead to reduced stigma and greater social inclusion, increased involvement of people with dementia as active co-producers of policy and service development, better services and support. This case study of Dementia Northern Ireland illustrates that there are boundaries and challenges to empowerment in terms of requiring additional support from staff without dementia. However, despite these challenges, empowerment-driven organisations can and should be committed to involving members in lead roles and key decision-making. |
Oil Holds Steady in New York on U.S. Budget Deadlock
By Mark Shenk -
Dec 24, 2012
Oil was little changed in New York
amid concern that U.S. lawmakers will miss a year-end budget
deadline, threatening to weaken the American economy.
Futures traded in a 66-cent-a-barrel range as Democrats and
Republicans discussed how to avoid more than $600 billion in tax
gains and spending cuts, known as the fiscal cliff, which are
scheduled to take effect Jan. 1. Failure to reach agreement
would push the U.S. into recession for the first half of 2013,
the nonpartisan Congressional Budget Office said.
“It looks like there may be a series of small deals,”
said Bill O’Grady, chief market strategist at Confluence
Investment Management in St. Louis, which oversees $1.4 billion.
“It may end up being more of a fiscal slope than a cliff.”
Crude oil for February delivery slipped 5 cents to settle
at $88.61 a barrel on the New York Mercantile Exchange. The
volume for all West Texas Intermediate oil futures traded was
down 81 percent from the 100-day average. WTI is the grade
traded on the Nymex.
The exchange shut at 1:30 p.m. New York time today, an hour
earlier than usual. There is no floor trading tomorrow because
of the Christmas holiday and all electronic transactions will be
booked for Dec. 26 for settlement purposes.
Brent oil for February settlement fell 17 cents to end the
session at $108.80 a barrel on the London-based ICE Futures
Europe exchange. The number of contracts changing hands was 78
percent lower than the 100-day average. The European benchmark
crude was at a premium of $20.19 a barrel to WTI, down from
$20.31 on Dec. 21.
Interim Bill
President Barack Obama on Dec. 21 urged leaders of both
parties to put together an interim bill to keep taxes from
rising on middle-income Americans and work on a more
comprehensive package. House Speaker John Boehner failed to win
support from his caucus for his proposal that would have
extended tax cuts on incomes below $1 million.
Members of the Organization of the Petroleum Exporting
Countries estimate that prices will stabilize above $100 a
barrel in 2013 and OPEC will hold an emergency meeting if they
fall below that level, Iran’s oil ministry said on its website
yesterday, citing Oil Minister Rostam Qasemi.
The drop in crude will accelerate if WTI crosses the 50-day
moving average, which is at $87.41, said Addison Armstrong,
director of market research at Tradition Energy in Stamford,
Connecticut. Technical analysts use historical patterns and
tools such as moving averages to predict price movements.
Price Targets
“If we can build some momentum to the down side, our next
target will be Friday’s low of $87.96 and then the 50-day moving
average,” Armstrong said. “Oil remains resolutely range-bound.
We’ve been in a $7-a-barrel range, between $84 and $91, for the
last two months.”
Futures in New York have traded between $85.05 and $90.54 a
barrel over the past two months amid budget negotiations and
mixed economic signals.
WTI has dropped 10 percent in 2012 as the U.S. shale boom
deepened the glut at Cushing, Oklahoma, America’s largest
storage hub and the delivery point for New York futures. That
has left it at an average discount of $17.45 a barrel to Brent
this year, compared with a premium of about 7 cents in the five
years through 2010. Brent, the benchmark grade for more than
half the world’s crude, has climbed 1 percent this year.
Speculator Wagers
Hedge funds boosted bullish bets on WTI by the most in more
than four months before the budget talks stalled. Money managers
raised net-long positions by 19 percent in the seven days ended
Dec. 18, according to the Commodity Futures Trading Commission’s
Dec. 21 Commitments of Traders report. It was the largest gain
since the week ended Aug. 7.
In London, hedge funds and other money managers raised
bullish bets on Brent crude by the most in three weeks,
according to data from ICE Futures Europe. Speculative bets that
prices will rise, in futures and options combined, outnumbered
short positions by 106,138 lots in the week to Dec. 18, the
exchange said today in its weekly Commitment of Traders report.
Electronic trading volume on the Nymex was 64,894 contracts
as of 2:05 p.m. Volume totaled 337,737 contracts on Dec. 21, 33
percent lower than the three-month average. Open interest was
1.48 million, the lowest level since Nov. 19. |
{#sp1 .337}
|
Pages
RECIPES
These are recipes that I like to use myself. Most of which I probably have no idea where I got them from any more. I hope you enjoy some of them.________________________________________________________________________________BUTTERMILK CINNAMON ROLLS
Mix and set aside 1 1/2 package yeast in 1/2 cup warm water and 2 tablespoon sugar. 1 cup buttermilk, heat to lukewarm and add 1 teaspoon salt,1/4 cup sugar,1/4 cup fat or oil. Add 1 cup flour and yeast and mix. add 1/2 teaspoon soda and 1 egg beaten. Beat well. Add 3 to 4 cups flour to make a real soft dough and knead 5 minuets. Let raise till double in bulk and make rolls or cinnamon rolls. Let rise till double in bulk.
Bake at 375% until brown...about 12 to 15 minuets. |
Restrictions imposed after terrorist killings
SRINAGAR: Authorities today imposed restrictions in parts of Srinagar, the summer capital of Jammu and Kashmir, as a precautionary measure to maintain law and order in view of the killings of three militants one of whom hailed from the city, police said.
Restrictions under Section 144 of the CrPc have been imposed in eight police station areas of Srinagar, a police official said.
He said the curbs have been imposed in the jurisdiction of Nowhatta, Khanyar, Rainawari, Safakadal, M R Gunj, Maisuma, Kralkhud and Soura police station areas of the city.
The official said the restrictions have been imposed as a precautionary measure to maintain law and order.
Three militants were killed in a pre-dawn encounter with security forces in Hakura area of Anantnag district of south Kashmir today.
Two of the slain militants were identified as Eesa Fazli, a resident of Soura area of the city here and Syed Owais, a resident of Kokernag in Anantnag. The identity of the third militant was being ascertained.
Meanwhile, a spontaneous shutdown was observed in many areas across the valley as shops and other business establishments were shut and public transport was minimal, the official said.
Clashes between groups of youths and security forces broke out in several areas of the city, he said.
He said stone pelting have been reported from Soura, Anchar, Old Barzulla, Lal Chowk and other areas of the city.
Authorities have ordered closure of schools and other educational institutions as a precautionary measure in Srinagar and south Kashmir.
Kashmir University has suspended classes for the day and postponed examinations as well. Islamic University of Science and Technology has also postponed examinations for today.
Mobile internet speeds have also been reduced across the valley. Police have issued an advisory for the citizens, seeking their cooperation.
“Your police seeks cooperation of citizens for maintaining order and ensuring peace. Today you will find restrictions in some parts of city # Srinagar. While it is a cause of inconvenience, we assure these control orders are temporary. For any assistance pl dial 100 (sic),” the Jammu and Kashmir Police tweeted. |
Q:
What can be done to extend the fertility of a woman?
I want to ask the question: "what is the age cut-off for female fertility", but I think that varies a lot between women.
Instead, I ask, what can be done to extend the fertility of a woman? Basically, what can be done to slow down the onset of menopause?
A:
According to WebMD,
There is no way to delay menopause; it can only be sped up, not slowed down, by external factors.
Factors that DO affect menopause age:
the age her mother experienced menopause
smoking
chemotherapy
ovarian surgery
ethnicity
Factors that do NOT:
age of first period
pregnancy and breastfeeding
use of hormonal birth control methods
Factors being studied, but have unknown effects:
bisphenol A (BPA), a chemical used to make certain plastic
If you are only worried about the egg quality, egg retrieval before the age of 35 is best. For eggs retrieved after 35, you may want to pay for genetic testing. Different physicans have different cutoffs recommendations, but 35 is the most common one. The uterus "quality" doesn't decline with age. Even women who have experienced menopause can take hormones to carry a pregnancy with a frozen embryo.
|
The sweetness enhancers used herein are known as natural and artificial sweeteners, however, they are used herein in a much lower concentration near their sweetness detection threshold.
These sweetness enhancers include Naringin dihydrochalcone (NarDHC), mogroside V or swingle extract comprising mogroside V, rubusoside or rubus extract comprising rubusoside, stevioside, and rebaudioside A.
Naringin dihydrochalcone has been used as a sweetener in concentrations well above its sweetness detection level. It has also been used in combination with stevioside to reduce the off-note of stevioside (JP10276712).
Swingle (also known as Lou Han Gou (LHG)) contains various naturally-derived terpene glycosides, in particular various mogrosides including mogroside IV, mogroside V, siamenoside I, and 11-oxo mogroside V. A swingle/LHG juice based sweetening system that provides a reduced sweet or unpleasant aftertaste is disclosed in U.S. Pat. No. 5,433,965 and WO 94/18855 by Fischer et al.
Rubus extract contains rubusoside and is used at a concentration well above its sweetness detection level as a sweetener and in combination with sugars. Sweetener compositions of various terpene glycosides including mogrosides and rubusoside at 0.1% to 10% by weight (1,000 ppm-100,000 ppm) are disclosed in US20020132037.
The sweet terpene glycoside stevioside and rebaudioside A have been used in mixtures with sugars including sucrose at above sweetness detection threshold (Schiffman et al., Chem. Senses 2000, 131-140, Schiffman et al., Brain Res. Bull., 1995, 105-120, Schiffman et al., Food Qual. And Pref. 2006 (internet pre-publication)).
Applicant has found that certain known sweeteners, namely mogroside V/swingle extract, rubusoside/rubus extract, and naringin dihydrochalcone (NarDHC), are sweetness enhancers and can be used in a low concentration near their sweetness detection threshold in combination with certain sweeteners, including certain artificial sweeteners, including in particular the sugars sucrose, fructose, glucose, high fructose corn syrup (containing fructose and glucose), xylose, arabinose, and rhamnose, the sugar alcohols erythritol, xylitol, mannitol, sorbitol, and inositol, and the artificial sweeteners AceK, aspartame, neotame, sucralose, and saccharine, to enhance the sweetness of said sweeteners.
None of these sweetness enhancers has been previously used near its sweetness detection threshold, alone or in combination, to enhance the sweetness of the above-mentioned sweeteners. |
Trends in Medicare Reimbursement for Orthopedic Procedures: 2000 to 2016.
Understanding trends in reimbursement is critical to the financial sustainability of orthopedic practices. Little research has examined physician fee trends over time for orthopedic procedures. This study evaluated trends in Medicare reimbursements for orthopedic surgical procedures. The Medicare Physician Fee Schedule was examined for Current Procedural Terminology code values for the most common orthopedic and nonorthopedic procedures between 2000 and 2016. Prices were adjusted for inflation to 2016-dollar values. To assess mean growth rate for each procedure and subspecialty, compound annual growth rates were calculated. Year-to-year dollar amount changes were calculated for each procedure and subspecialty. Reimbursement trends for individual procedures and across subspecialties were compared. Between 2000 and 2016, annual reimbursements decreased for all orthopedic procedures examined except removal of orthopedic implant. The orthopedic procedures with the greatest mean annual decreases in reimbursement were shoulder arthroscopy/decompression, total knee replacement, and total hip replacement. The orthopedic procedures with the least annual reimbursement decreases were carpal tunnel release and repair of ankle fracture. Rate of Medicare procedure reimbursement change varied between subspecialties. Trauma had the smallest decrease in annual change compared with spine, sports, and hand. Annual reimbursement decreased at a significantly greater rate for adult reconstruction procedures than for any of the other subspecialties. These findings indicate that reimbursement for procedures has steadily decreased, with the most rapid decrease seen in adult reconstruction. [Orthopedics. 2018; 41(2):95-102.]. |
CHA helps Jo resolve issues with her insurance
Jo Young is an actress living in Manhattan. A few years ago she enrolled in Medicaid, and has continued to recertify each year through the NYSOH Marketplace. Shortly after undergoing surgery, she tried to make an appointment at her primary care doctor for monitoring, but the office informed her that her Medicaid had been discontinued. Jo was shocked and extremely worried, as she needed regular care and follow-ups, but couldn’t afford those services without insurance. After going many months without medical care, Jo decided to seek assistance from Community Health Advocates.
A CHA Advocate at the Community Service Society made several calls and discovered that Jo’s enrollment in a food assistance program had been mistaken as a duplicate application in the Medicaid system, consequently overriding Jo’s eligibility status. The Advocate helped Jo get this mistake fixed, and her Medicaid was reinstated. “If it weren't for the dedicated Community Health Advocates (CHA) team, I might still be without medical care.” Now Jo does not have to worry about accessing the lifesaving care she needs, and can focus on acting and staying healthy. “[CHA’s] dedication and persistence paid off, and I'm happy to say I now have excellent, consistent coverage. I owe it all to my friends at CHA!”
“Sometimes you simply need a helping hand, and CHA certainly held my hand along my arduous journey through the healthcare world.” -- Jo |
François Isaac de Rivaz
François Isaac de Rivaz (Paris, December 19, 1752 – Sion, July 30, 1828) was an inventor and a politician. He invented a hydrogen-powered internal combustion engine with electric ignition and described it in a French patent published in 1807. In 1808 he fitted it into a primitive working vehicle – "the world's first internal combustion powered automobile".
Biography
Isaac was born in Paris to a family from Valais. In 1763 the family settled in Moûtiers in Savoy (Kingdom of Sardinia). The last two boys, Anne Joseph and Isaac, came to settle in St. Gingolph in Valais. It is not known at which schools he studied, but he became fluent in Latin plus mastering mathematics and geometry, whilst continuing his study of mechanics throughout his life. He qualified as both a surveyor and notary and worked for the state of Valais.
Isaac had many interests plus an intuitive and extremely curious mind which was driven by the demon of discovery. His experimental work was overflowing. He experimented with steam-powered vehicles in the late 18th century. He also studied the ignition of combustible gases.
Internal combustion engine
After retirement from the Army, living in Switzerland, he invented a primitive internal combustion engine which he constructed in 1807. It was powered by a mixture of hydrogen and oxygen manually ignited by electric spark, but the engine neither involved the in-cylinder compression, the crank, nor the connecting rod. A year later, Isaac built an early automobile for his new engine to power. His engine was never commercially successful.
Alternative claims for internal combustion engines
Coincidentally, in 1807 Nicéphore Niépce installed his 'moss, coal-dust and resin'-fueled Pyréolophore internal combustion engine in a boat and powered up the river Saone in France to be granted a patent by the Emperor Napoleon Bonaparte. The discrete, virtually simultaneous, implementations of these two designs of internal combustion in different modes of transport means that the de Rivaz engine can be correctly described as "the worlds first use of an internal combustion engine in an auto-mobile (in 1808)", whilst the "Pyréolophore (in 1807) was the world's first use of an internal combustion engine in a ship".
Although de Rivaz's early work is credited as the first use of the internal combustion engine in an automobile, the further development and mass production of the invention never truly began until the late nineteenth century.
In 1824, the French physicist Nicolas Léonard Sadi Carnot scientifically established the thermodynamic theory of idealized heat engines. This highlighted the shortcoming of these pioneering designs, whereby they needed a compression mechanism to increase the difference between the upper and lower working temperatures and potentially unlock sufficient power and efficiency. Gasoline was not used for internal combustion engines until 1870 when carburetors were invented to convert non-combustible liquid fuels into a combustible gaseous mixture form.
See also
De Rivaz engine
Timeline of transportation technology
Timeline of hydrogen technologies
History of the internal combustion engine
Pyréolophore
Nicéphore Niépce
References
External links
1807 Francois Isaac de Rivaz - internal combustion engine
Category:1752 births
Category:1828 deaths
Category:People associated with the internal combustion engine |
The present invention relates to a pneumatic tire whose tread portion is provided with sipes, more particularly to a design of a pair of sipes capable of preventing cracks at the bottoms of the sipes and improving demolding of the vulcanization mold with siping blades.
Pneumatic tires are often provided in the tread portion with sipes in order to adjust the rigidity of ground contacting tread elements such as block, rib and the like, or increase edge effect for improving the traction performance and braking performance on icy roads for example. If such sipped tire receives a force to open the sipes during rolling and as a result stress concentrates at the bottoms of the sipes, there is a possibility that cracks occur at the bottoms of the sipes.
In Japanese Patent Application Publication No. H3(1991)-007604, in order to prevent cracks, a sipe (a) is provided at the bottom with a circular cross sectional shape (c) whose diameter is larger the thickness (w) of the sipe as shown in FIG. 5(a).
If such sipes (a) are formed at small intervals by the use of siping blades (g) provided on the inside of a vulcanizing mold, then it becomes hard to demold or the rubber (ba) between the siping blades (g) is torn off by the siping blades (g) when demolding as shown in FIG. 5(b). |
It has all the benefits of Unlimited (talk, text, data) and literally more! One of those extras is streaming on us. With AT&T Unlimited &MoreSM plans you can stream 30+ live channels with unlimited access to more than 15,000 titles, live and on demand, through the WatchTV app for no charge! For pricing, visit our package page.
Check out what the AT&T Newsroom has to say about our new unlimited plans!
ChrisZ, AT&T Community Specialist
AT&T Customer Care
Need help with an account specific question? Post a new question here on the forums by clicking the "Ask a Question" button.For additional support, please visit us at our AT&T services hub.Follow us on: Twitter @ATTCares and @DIRECTVService
Re: AT&T Unlimited & More Plans – Get The Scoop!
Need help with an account specific question? Post a new question here on the forums by clicking the "Ask a Question" button.For additional support, please visit us at our AT&T services hub.Follow us on: Twitter @ATTCares and @DIRECTVService
*I am an AT&T employee, and the postings on this site are my own and don't necessarily represent AT&T's position, strategies or opinions.
Re: AT&T Unlimited & More Plans – Get The Scoop!
It's a nice price increase also for folks that have unlimited choice and unlimited plus.... Just so you are all aware... Pic is with 6 lines and 2 watches with military discount.....
Award for Community Excellence 2019 Achiever**The views and opinions expressed on this forum are purely my own. Any product claim, statistic, quote, or other representation about a product or service should be verified with the manufacturer, provider, or party.
Re: AT&T Unlimited & More Plans – Get The Scoop!
Can you get the unlimited without all the extra entertainment! Don't need extra entertainment services. Currently have 30 GB plan for 3 iPhones but the young men tend to use all the data and tend to be almost over this month and its not even 28th which is the last day of the billing for us. So debating on changing as there is no 30 GB plan like we were offer long time ago as we have a family shared plan. We have roll over data which only last for 1 billing but that doesn't always help.
So looking for another option worried if I change in-between billing cycle will have all these charges added to my bill. Plus I don't want them to have option to use these options with extra enterntainment can it be turn off by the main person on the account?
Re: AT&T Unlimited & More Plans – Get The Scoop!
Can you get the unlimited without all the extra entertainment! Don't need extra entertainment services.
Call 611 and ask for retention and see if they can still offer you the unlimited plans. I think it's $5 cheaper (after the $10 autopay discount) and you can also ask AT&T for the additional $10 unlimited loyalty discount.
Let us know how that works, please!
So looking for another option worried if I change in-between billing cycle will have all these charges added to my bill. Plus I don't want them to have option to use these options with extra enterntainment can it be turn off by the main person on the account?
The entertainment only works if enabled by the main line on the account.
Rember the Golden Rule: Treat others how you would like to be treated.
Just because my answer does not solve your issue (or agree with you), it may still be correct information...
Stating a fact about how something works, is NOT taking sides, it's just stating a fact...
Information provided might not be for "you" only, it might be clarification for other community members.
This is the public AT&T Community Forum (not AT&T support), please do not post personal info.
When provided an answer, please click "Accept solution" which helps other people to find an answer more quickly.
The (very) fine print - This footer is at the bottom of all my posts, its particulars may, or may not, apply to you & your post.
Award for Community Excellence 2019 Achiever**The views and opinions expressed on this forum are purely my own. Any product claim, statistic, quote, or other representation about a product or service should be verified with the manufacturer, provider, or party.
Re: AT&T Unlimited & More Plans – Get The Scoop!
Auto pay is not included in the bottom number.
Award for Community Excellence 2019 Achiever**The views and opinions expressed on this forum are purely my own. Any product claim, statistic, quote, or other representation about a product or service should be verified with the manufacturer, provider, or party.
Re: AT&T Unlimited & More Plans – Get The Scoop!
Is this a bait and switch? Why did it change once I changed the plan? It goes from 80 to 90 even though it clearly states both plans are the same price!
That's NOT what 'bait and switch' means. If they're lying about the price, it's just called "lying" (not 'bait and switch')
Everywhere it says $80 it says including 'autopay/paperless discount'.
This image that YOU uploaded says $90 and then right under it says 'autopay/paperless discount is pending'.
Rember the Golden Rule: Treat others how you would like to be treated.
Just because my answer does not solve your issue (or agree with you), it may still be correct information...
Stating a fact about how something works, is NOT taking sides, it's just stating a fact...
Information provided might not be for "you" only, it might be clarification for other community members.
This is the public AT&T Community Forum (not AT&T support), please do not post personal info.
When provided an answer, please click "Accept solution" which helps other people to find an answer more quickly.
The (very) fine print - This footer is at the bottom of all my posts, its particulars may, or may not, apply to you & your post.
Award for Community Excellence 2019 Achiever**The views and opinions expressed on this forum are purely my own. Any product claim, statistic, quote, or other representation about a product or service should be verified with the manufacturer, provider, or party.
Re: AT&T Unlimited & More Plans – Get The Scoop!
What's the point of this if we already have television service through AT&T/DirecTV? Do we not have access to our television service for free through an app already? Why do the mobile share plans have to be so expensive yet BARELY cheaper so you can practically force the upgrade? Why does AT&T feel such a need to screw over so many loyal customers just to make a buck? If I can't access my television through my smart tv's without more boxes, I'm about to take advantage of cancelling my service before the initial period is up and, yet again, AT&T can kiss my bum. I hated you when I sold this mess door to door. Love the service itself, but despise your sheisty ways of treating your customers. It's really and truly just SAD.
Re: AT&T Unlimited & More Plans – Get The Scoop!
AND- WHY CAN'T THERE JUST BE REGULAR OLE UNLIMITED WITHOUT ALL THIS? Was going to sign a wireless contract, but until you can do better, nada. You will more than likely be losing this customer regardless as soon as I hear some answers to my inquiry. I was here in the forum to understand bill credits, and I think I've jarred some sense back into my head with just perusing forum discussions. Shame, shame.
Re: AT&T Unlimited & More Plans – Get The Scoop!
I am afraid to make any more changes. In the beginning I had family share plan but in order to get the direct tv doesn't count against your data I had to switch to what I have now which is some kind of unlimited plan. Not 6 ,months after I made the change guess what..or it doesn't matter what kind of plan you have now you can watch direct through the app and it will, not count against your data. Well all fine and good but I can't switch back to what I had now. I have been with this company since the days of the Motorola bag phones and Cingular/bellsouth mobility. From what I can tell the company does things like this to get you to move from a plan that may be better for you to a plan that is more better for the company and then wham its too late to go back.
Re: AT&T Unlimited & More Plans – Get The Scoop!
on this new plan can you have an additional device added like a tablet for the same $10 month I'm paying now? Probably not. I have read and read the fine print till my eyes hurt and I can't fine anything about it except the company does offer a separate plan for like 30 plus dollars a month so there you go again. I loose for $10 a month tablet and have to play an additional sum just to keep that and its for less data.
Re: AT&T Unlimited & More Plans – Get The Scoop!
on this new plan can you have an additional device added like a tablet for the same $10 month I'm paying now? Probably not. I have read and read the fine print till my eyes hurt and I can't fine anything about it except the company does offer a separate plan for like 30 plus dollars a month so there you go again. I loose for $10 a month tablet and have to play an additional sum just to keep that and its for less data.
THREE options:
$20 for a tablet to have unlimited.
$10 for a tablet to have 1GB.
FREE to share 15GB from your phone to your tablet.
Rember the Golden Rule: Treat others how you would like to be treated.
Just because my answer does not solve your issue (or agree with you), it may still be correct information...
Stating a fact about how something works, is NOT taking sides, it's just stating a fact...
Information provided might not be for "you" only, it might be clarification for other community members.
This is the public AT&T Community Forum (not AT&T support), please do not post personal info.
When provided an answer, please click "Accept solution" which helps other people to find an answer more quickly.
The (very) fine print - This footer is at the bottom of all my posts, its particulars may, or may not, apply to you & your post.
Award for Community Excellence 2019 Achiever**The views and opinions expressed on this forum are purely my own. Any product claim, statistic, quote, or other representation about a product or service should be verified with the manufacturer, provider, or party.
Re: AT&T Unlimited & More Plans – Get The Scoop!
I am afraid to make any more changes. In the beginning I had family share plan but in order to get the direct tv doesn't count against your data I had to switch to what I have now which is some kind of unlimited plan.
Who told you that? From the day ATT bought Direct TV, which is before they offered an unlimited data plan again, DTV app use was sponsored data. (DTV acquired in 2014, Unlimited + TV plan in 2016).
Not 6 ,months after I made the change guess what..or it doesn't matter what kind of plan you have now you can watch direct through the app and it will, not count against your data. Well all fine and good but I can't switch back to what I had now. I have been with this company since the days of the Motorola bag phones and Cingular/bellsouth mobility. From what I can tell the company does things like this to get you to move from a plan that may be better for you to a plan that is more better for the company and then wham its too late to go back.
You can switch to a shared plan. The 20 gig plan is $100 plus $20 for phones, $10 tablets. No overage charges.
(The following is included after all posts to save typing) I don’t work for AT&T. My replies are based on experience and reading content available on the website. Our answers are honest, but not always appreciated. If you posted personal information, please edit and remove.
Award for Community Excellence 2019 Achiever**The views and opinions expressed on this forum are purely my own. Any product claim, statistic, quote, or other representation about a product or service should be verified with the manufacturer, provider, or party. |
The Boy Wonder won’t be flying into primetime after all.
The CW and Warner Bros. TV have been forced to scrap their plans for “The Graysons.” Show, which had been given a put pilot commitment, was set to revolve around Batman sidekick Robin in his pre-Caped Crusader days.
Decision to yank the project came from Warner Bros. Pictures Group prexy Jeff Robinov, who initially gave his blessing but changed his mind in recent days.
“Warner Bros. TV never had 100% clearance,” said one exec familiar with the project.
The CW had been counting on “The Graysons” to fill the void left by the likely series end of “Smallville.” Like “Smallville,” “The Graysons” is a superhero origins story. Show was developed to revolve around the world of Dick “DJ” Grayson before taking on the iconic Robin identity.
Project was to be the latest DC Comics franchise to be mined for the smallscreen by Warner Bros. TV. “Smallville” exec producers Kelly Souders and Brian Peterson were set to write and exec produce, while Wonderland Sound and Vision’s McG and Peter Johnson were also aboard to exec produce.
According to studio insiders, Robinov has decreed that Warner Bros. “rethink its DC Comics strategy” and as a result didn’t want to do anything big with a DC franchise at the moment — at least when it came to “Graysons.”
“The studio has opted not to go forward with the development of ‘The Graysons’ at this time as the concept doesn’t fit the current strategy for the Batman franchise,” the studio said in a statement. “Warner Bros. Television is currently working on several replacement options for the CW.”
It’s understood that “The Dark Knight” helmer Christopher Nolan never signed off on the TV show; one insider said the helmer was uncomfortable with having a TV show related to the Batman franchise on the air. But according to the studio, the decision to scrap the show rested solely on Robinov and not Nolan.
Others wondered whether Warner Bros. got nervous over the idea of having a both an active Batman TV series and film series at the same time. “Smallville” and, before that, “Lois & Clark,” were launched during a lengthy hiatus from the bigscreen for Superman. Some believe 2006’s “Superman Returns” was hurt at the box office because of the simultaneous TV show.
A script had not yet been written for “The Graysons,” which was still in early stages of development. Word of “The Graysons” first emerged last month (Daily Variety, Oct. 1) — prematurely, in hindsight.
The one-hour “Graysons” was to be set in modern times and focus on young DJ as he faced challenges involving first loves, young rivals and his family — a famous juggling act — as he grew up. (In Batman lore, Grayson was part of a family act called “The Flying Graysons” and orphaned after a gangster had his parents killed.)
Insiders said Warner Bros. TV is now scanning its library for other potential franchises to develop for the CW. The netlet is already kicking the tires on other franchises for next year, including a revival of CBS Paramount’s “Melrose Place.”
Coincidentally, a new animated Batman series, “Batman: The Brave and the Bold,” bows on Cartoon Network next Friday. |
Q:
Can "mon bon" refer only to "my friend," or could it mean "my muse" or "my angel"?
Need to understand if phrase "mon bon" means "mon bon ami" or can suggest other meanings such as "muse" or "guardian angel."
A:
I think mon bon is more like my friend, but with quite a bit of condescension. It is quite dated too. I don't think anybody uses that today, unless there is a resurgence in popular speech.
|
Cannabinergic pain medicine: a concise clinical primer and survey of randomized-controlled trial results.
This article attempts to cover pragmatic clinical considerations involved in the use of cannabinergic medicines in pain practice, including geographical and historical considerations, pharmacokinetics, pharmacodynamics, adverse effects, drug interactions, indications, and contraindications. Topics include molecular considerations such as the 10-fold greater abundance of cannabinoid type 1 receptors compared to µ-opioid receptors in the central nervous system and anatomic distributions of cannabinoid receptors in pain circuits. The article uses a narrative review methodology drawing from authoritative textbooks and journals of cannabinoid medicine, Food and Drug Administration-approved cannabinoid drug labels, and current and historical pain medicine literature to address core clinical considerations. To survey the current evidence base for pain management with cannabinergic medicines, a targeted PubMed search was performed to survey the percentage of positive and negative published randomized-controlled trial (RCT) results with this class of pain medicines, using appropriate search limit parameters and the keyword search string "cannabinoid OR cannabis-based AND pain." Of the 56 hits generated, 38 published RCTs met the survey criteria. Of these, 71% (27) concluded that cannabinoids had empirically demonstrable and statistically significant pain-relieving effects, whereas 29% (11) did not. Cannabis and other cannabinergic medicines' efficacies for relieving pain have been studied in RCTs, most of which have demonstrated a beneficial effect for this indication, although most trials are short-term. Adverse effects are generally nonserious and well tolerated. Incorporating cannabinergic medicine topics into pain medicine education seems warranted and continuing clinical research and empiric treatment trials are appropriate. |
Incisor disocclusion in rats affects mandibular condylar cartilage at the cellular level.
The effect of altered occlusion on the mandibular condylar cartilage remains unclear. This study investigated the effect of unilateral incisor disocclusion on cartilage thickness, on mitotic activity and on chondrocytes maturation and differentiation in the mandibular condylar cartilage of rats. The upper and lower left incisors were trimmed 2mm every second day in five rats. In other five rats, the incisor occlusion was not altered. Condylar tissues from both sides of each mandible were processed and stained for Herovici's stain and immunohistochemistry for bromodeoxyuridine (BrdU), transforming growth factor-beta1 (TGF-beta1), alkaline phosphatase (ALP) and osteocalcin (OCN). Measurements of cartilage thickness and the numbers of immunopositive cells for each antibody were analysed by one-way analysis of variance (ANOVA). No significant differences were observed in cartilage thickness after 7 days of unilateral incisor disocclusion. However, the numbers of immunopositive cells for BrdU as a marker of DNA synthesising cells, TGF-beta1 as a marker of chondrocytes differentiation, and ALP and OCN as markers of chondrocytes maturation, were significant higher in the cartilage cells on both sides when incisor occlusion was unilaterally altered. Interestingly, alkaline phosphatase was highly expressed on the condylar side of incisor disocclusion, whereas osteocalcin was highly expressed on the side opposite to the incisor disocclusion. It is demonstrated that after 7 days, unilateral incisor disocclusion affects the mandibular condylar cartilage at the cellular level by increasing the mitotic activity and by accelerating chondrocytes maturation. Chondrocytes maturation appears more accelerated on the side opposite to incisor disocclusion. |
The menarche experience in twenty-three foreign countries.
Ninety-five women (aged 18-26) from 23 countries were interviewed regarding their first menstrual experience. Among the areas discussed were (1) their preparation for menarche, (2) messages from others at the time of menarche, and (3) their own emotional reactions to the first period. Although the mother, as might be expected, was the main source of information, almost one-third of the girls received no maternal assistance prior to menarche. The chief reaction of others to a girl's first period centered on help with the hygienic routine. Only in Iran was a non-hygienic response more common--reassurance of the normality of the event. The emotional reactions of the women themselves differed widely. Asians most often reported feeling "embarrassed" and "surprised." In contrast, Iranians most frequently mentioned feeling "more grown up". The discussion includes a comparison of the international women's descriptions of their menarche with data available on American samples. Finally, the paper concludes with an analysis of the importance of a culture's response to the menarcheal female. |
Fernhill House First Birthday !!
Tuesday 24th April, 2018
Today we have been celebrating our first birthday at Fernhill House. It was Fish n chips and cake all round for residents and staff, followed by an afternoon of entertainment by Reza Farrell who sang to us some classic 40's and 50's song's. We had a brilliant time!! |
[Surgical treatment of coronary artery-pulmonary artery fistula].
We experienced 4 cases of left coronary artery-pulmonary artery fistula. Two cases had small fistulas associated with atherosclerotic coronary lesions, and the other 2 had large fistulas with aneurysmal enlargement. In the former 2 cases, ligation of the fistulas and closure of the opening of fistula into the pulmonary artery through pulmonary arteriotomy were performed together with coronary artery bypass grafting and left ventricular aneurysmectomy. In one of the latter 2 cases, the fistula arising from the anterior descending branch was ligated and the opening of fistula draining into the pulmonary artery was closed through pulmonary arteriotomy. In another case, both openings of the fistula into the anterior descending branch and the pulmonary artery were closed from inside through incision of the dilated fistula. In all 4 cases, operations were performed using cardiopulmonary bypass and retrograde coronary perfusion, which could afford good heart protection even in cases with coronary lesions and coronary steal phenomenon. All cases went an uneventful postoperative course. Postoperative angiograms showed disappearance of the fistulas in 3 cases. In one case, however, residual fistula was found because a fine fistula might be overlooked. In such a case with complicated fistulas with aneurysmal enlargement, fistulas should be examined carefully through incision of the enlarged anomalous vessels. In this paper, diagnosis, operative indication and treatment for coronary artery-pulmonary artery fistula were discussed. |
What makes rape a special kind of violence? It’s not the physical damage, which can be very minimal; it’s the emotional damage, which can be catastrophic.
Rape makes you afraid; it taints your trust in the world and twists how you see it. It drives you into a prison of fear.
But all other violence does that as well. What’s truly special about rape is simple. It takes a bludgeon to your ability to bond with others in the most intimate way.
Rape robs you of your ability to see innocence.
“Get rid of men and you get rid of rape.”
The sexual exploitation of women by men is the greatest taboo in our society; there is nothing more stigmatized than being a rapist of women. Rape is a call to action; today it’s dressed up in new terms but it still harkens back to that primitive urge to protect female sexuality from foreign interlopers. Modern gynocentrists did not invent rape hysteria; they inherited it and they are using it the way everyone throughout history has—as a tool to grind away at things they don’t like.
For the woman on the street, rape hysteria is shoved down her throat over and over till she vomits it up without thinking, all over herself and her life. It seeps into every interaction, every step she takes into the outer world. ‘Is this man going to rape me? All men are guilty! I’m never safe and it’s their fault!’
That’s where rape hysteria wants all women to be. Frightened, helpless… impotent. Calling upon a higher authority to save them. And, of course, robbing the men around them of their innocence.
“All men are responsible for rape culture.”
But rape isn’t something that happens to women; it isn’t something done to women by men. It’s a human problem and it’s a human problem that does not know gender. More men are raped in prison a year than women in the general population. More boys in juvenile facilities are raped than girls. And they are raped by women. There are surveys that show just as many men are raped in romantic relationships—date-raped—as women.
That leaves stranger rape; 26% of all non-institutional rape. It may well be that most stranger-rapists are men; but it does not follow that a vast majority of their victims are women. An argument can be made that men under-report; and studies have shown that rapists who are heterosexual in their consenting relationships will rape based on vulnerability not sex.
Statically women are not more vulnerable to rape.
And there is something else; in reading about the victimization of men by women, another story emerges.
Female potency.
Male victims, teens and adults, are changed by having been raped by a woman—they are suicidal, addicted, dysfunctional, unhinged, helpless, hurting. In the background of many male rapists of adult women is sexual abuse done to them by women. The vagina employed as a weapon can carve and twist a man so badly he defies society’s most fundamental taboo—male on female rape.
The vagina is a weapon every bit as potent as a penis.
It can steal innocence.
“All sex is rape.”
A child does not see innocence. To a child the world is good and bad; the good pleases the child, the bad displeases her. The world is made of good and bad people. Good people benefit the child; bad people do not.
Innocence, to a child, if it is seen is seen as weakness and a threat. Someone else’s weakness threatens the child’s absolute claim to the attention and effort of adults. In the child’s calculus need equals worth and other’s needs lessen the child’s worth. The only eyes that can see innocence are those that know they can take it away. Or protect it.
Innocence is inspiration. A call to protect and provide, to be strong. It may be passive but it is powerful. It’s why someone will brave flames—literal or metaphorical—to save another. Like children, many women expect men to fill them with passion. But passion only exists in those who can bear the sight of innocence.
“The personal is political.”
Before I started to read about men’s rights I was, like every other woman, bound by rape hysteria. Men in my eyes bore their burden of guilt and I, in turn, bore my burden of fear.
But I was lucky.
I stumbled upon the men’s rights movement and saw things—statistics, studies—they pulled up from the depths of our society’s subconscious—things that would silently slip down into the deep if it weren’t for them.
All the evidence I’ve seen against rape hysteria is not good enough for those who profit from keeping women in a prison of fear; but it’s good enough for me to question my obligation to stay.
I realized women have sexual potency. And if women are equally responsible for rape, then they have an equal responsibility to be responsible. Because women can take away men’s—and boy’s—innocence. There was no need for men to carry a burden of guilt; nor was there a need for me to carry a burden of fear.
A weight lifted from me in that moment; a weight I never knew I carried till it was gone.
Before I had always seen my husband—and every other man—as either a good man or a bad man; but never innocent. His actions were always deliberate, if he did me harm he was a villain with the blackest heart; if he did me good, he was a knight-in-shining armor.
After, he became innocent.
“The fear of rape limits women’s potential.”
Women infected by rape hysteria will meet bad men, creepy men, evil men. And they’ll meet good men, real men, strong men.
But they will never meet an innocent man.
They are poorer for it.
My name is Typhonblue and I am a survivor of rape hysteria. |
Give your illustrations an old etched or engraved appearance with my new collection of 30 free brushes for Adobe Illustrator. These brushes feature a variety of hand-drawn line patterns in horizontal, vertical, diagonal and cross-hatched orientations that can be used to apply shading to your digital drawings. After being scanned from hand-made pen strokes, they were then processed into Illustrator brushes that seamlessly repeat along paths of any length without stretching or deforming.
How to use the vintage shading brushes
Open the brushes file into Illustrator by choosing ‘Load Brushes’ from the Brushes panel menu. Each brush can then be applied to a path that has been drawn with the Brush, Pencil, Line or Pen tool. To change the scale of the brush, alter the stroke weight to increase or decrease its size.
The brush stroke will likely extend beyond the desired shading area. One technique to trim it to size is by drawing a temporary shape and set it as a clipping mask to make the excess portions invisible.
An alternative masking technique is to add an Opacity Mask to the path, then paint over the unwanted areas with the Blob brush (or a black-filled shape) to hide the excess.
Download My Free Vintage Shading Brushes |
Q:
Get image content from httpResponse in Android
Am trying to get a image from a http response, but am failing to convert the stream to bitmap.
Please let me know, what am i missing here.
FYI - the image content is received as raw binary & its a jpeg image.
Procedure followed:
Make HttpRequest.
In response check for 200 -> get the httpentity content.
convert the stream to bitmap using BitMap factory.
Set the bitmap to imageview
Doing this in postExecute of the AsyncTask
HttpClient httpclient = new DefaultHttpClient();
HttpGet httpget = new HttpGet(endpoint);
// Adding Headers ..
// Execute the request
HttpResponse response;
try {
response = httpclient.execute(httpget);
if (response.getStatusLine().getStatusCode() == 200) {
// Get hold of the response entity
HttpEntity entity = response.getEntity();
if (entity != null) {
InputStream instream = entity.getContent();
return instream;
// instream.close();
}
}
}
Doing this in postExecute of the AsyncTask
if (null != instream) {
Bitmap bm = BitmapFactory.decodeStream(instream);
if(null == bm){
Toast toast = Toast.makeText(getApplicationContext(),
"Bitmap is NULL", Toast.LENGTH_SHORT);
toast.show();
}
ImageView view = (ImageView) findViewById(R.id.picture_frame);
view.setImageBitmap(bm);
}
Thanks in Advance.
A:
Finally found the answer for this. below is the snippet - might help for the newbees working with http responses.
HttpClient httpclient = new DefaultHttpClient();
HttpGet httpget = new HttpGet(endpoint);
// Adding Headers ..
// Execute the request
HttpResponse response;
try {
response = httpclient.execute(httpget);
if (response.getStatusLine().getStatusCode() == 200) {
// Get hold of the response entity
HttpEntity entity = response.getEntity();
if (entity != null) {
InputStream instream = entity.getContent();
String path = "/storage/emulated/0/YOURAPPFOLDER/FILENAME.EXTENSION";
FileOutputStream output = new FileOutputStream(path);
int bufferSize = 1024;
byte[] buffer = new byte[bufferSize];
int len = 0;
while ((len = instream.read(buffer)) != -1) {
output.write(buffer, 0, len);
}
output.close();
}
Instead of saving the file to disk, we can have the contents in the bytearray and get the bitmap from that.
ByteArrayOutputStream baos = new ByteArrayOutputStream();
int bufferSize = 1024;
byte[] buffer = new byte[bufferSize];
int len = 0;
try {
// instream is content got from httpentity.getContent()
while ((len = instream.read(buffer)) != -1) {
baos.write(buffer, 0, len);
}
baos.close();
} catch (IOException e) {
e.printStackTrace();
}
byte[] b = baos.toByteArray();
Bitmap bmp = BitmapFactory.decodeByteArray(b, 0, b.length);
ImageView imageView = (ImageView)findViewById(R.id.picture_frame);
imageView.setImageBitmap(bmp);
FYI - In android fileoutput stream writing to local disk have to be done in non UI thread(have used async task in my case & that part is not added here).
Thanks ..
|
[Mini-Series]: Lucio Laugelli – “Su Marte non c’è il Mare”
“Su Marte non c’è il mare “is an independent mini-series, directed by Lucio Laugelli. It is about the suburbs life in a Northern Italy city (Alessandria and Asti area) and, at the same time, a shocking story that destabilizes lives of the main characters. 15 minutes-4 episodes, each filmed with the contribution of Cral Foundation. Soundtrack features the extraordinary contribution of Turin-based band Perturbazione.
The Story: A thirty-years old man, with a job he doesn’t like, rents illegally the house left to him by his grandfatherto a particular customer that only wants it on Friday night, but it pays very well. From that timeit’s all for the best, but he will discover soon that something doesn’t square with the situation. |
package edas
//Licensed under the Apache License, Version 2.0 (the "License");
//you may not use this file except in compliance with the License.
//You may obtain a copy of the License at
//
//http://www.apache.org/licenses/LICENSE-2.0
//
//Unless required by applicable law or agreed to in writing, software
//distributed under the License is distributed on an "AS IS" BASIS,
//WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
//See the License for the specific language governing permissions and
//limitations under the License.
//
// Code generated by Alibaba Cloud SDK Code Generator.
// Changes may cause incorrect behavior and will be lost if the code is regenerated.
// ResultInListRootStacks is a nested struct in edas response
type ResultInListRootStacks struct {
RootStack []RootStack `json:"RootStack" xml:"RootStack"`
}
|
<?php
/**
* Cache of file objects, wrapping some RepoGroup functions to avoid redundant
* queries. Loosely inspired by the LinkCache / LinkBatch classes for titles.
*
* ISSUE: Merge with RepoGroup?
*
* @ingroup FileRepo
*/
class FileCache {
var $repoGroup;
var $cache = array(), $notFound = array();
protected static $instance;
/**
* Get a FileCache instance. Typically, only one instance of FileCache
* is needed in a MediaWiki invocation.
*/
static function singleton() {
if ( self::$instance ) {
return self::$instance;
}
self::$instance = new FileCache( RepoGroup::singleton() );
return self::$instance;
}
/**
* Destroy the singleton instance, so that a new one will be created next
* time singleton() is called.
*/
static function destroySingleton() {
self::$instance = null;
}
/**
* Set the singleton instance to a given object
*/
static function setSingleton( $instance ) {
self::$instance = $instance;
}
/**
* Construct a group of file repositories.
* @param RepoGroup $repoGroup
*/
function __construct( $repoGroup ) {
$this->repoGroup = $repoGroup;
}
/**
* Add some files to the cache. This is a fairly low-level function,
* which most users should not need to call. Note that any existing
* entries for the same keys will not be replaced. Call clearFiles()
* first if you need that.
* @param array $files array of File objects, indexed by DB key
*/
function addFiles( $files ) {
wfDebug( "FileCache adding ".count( $files )." files\n" );
$this->cache += $files;
}
/**
* Remove some files from the cache, so that their existence will be
* rechecked. This is a fairly low-level function, which most users
* should not need to call.
* @param array $remove array indexed by DB keys to remove (the values are ignored)
*/
function clearFiles( $remove ) {
wfDebug( "FileCache clearing data for ".count( $remove )." files\n" );
$this->cache = array_diff_keys( $this->cache, $remove );
$this->notFound = array_diff_keys( $this->notFound, $remove );
}
/**
* Mark some DB keys as nonexistent. This is a fairly low-level
* function, which most users should not need to call.
* @param array $dbkeys array of DB keys
*/
function markNotFound( $dbkeys ) {
wfDebug( "FileCache marking ".count( $dbkeys )." files as not found\n" );
$this->notFound += array_fill_keys( $dbkeys, true );
}
/**
* Search the cache for a file.
* @param mixed $title Title object or string
* @return File object or false if it is not found
* @todo Implement searching for old file versions(?)
*/
function findFile( $title ) {
if( !( $title instanceof Title ) ) {
$title = Title::makeTitleSafe( NS_FILE, $title );
}
if( !$title ) {
return false; // invalid title?
}
$dbkey = $title->getDBkey();
if( array_key_exists( $dbkey, $this->cache ) ) {
wfDebug( "FileCache HIT for $dbkey\n" );
return $this->cache[$dbkey];
}
if( array_key_exists( $dbkey, $this->notFound ) ) {
wfDebug( "FileCache negative HIT for $dbkey\n" );
return false;
}
// Not in cache, fall back to a direct query
$file = $this->repoGroup->findFile( $title );
if( $file ) {
wfDebug( "FileCache MISS for $dbkey\n" );
$this->cache[$dbkey] = $file;
} else {
wfDebug( "FileCache negative MISS for $dbkey\n" );
$this->notFound[$dbkey] = true;
}
return $file;
}
/**
* Search the cache for multiple files.
* @param array $titles Title objects or strings to search for
* @return array of File objects, indexed by DB key
*/
function findFiles( $titles ) {
$titleObjs = array();
foreach ( $titles as $title ) {
if ( !( $title instanceof Title ) ) {
$title = Title::makeTitleSafe( NS_FILE, $title );
}
if ( $title ) {
$titleObjs[$title->getDBkey()] = $title;
}
}
$result = array_intersect_key( $this->cache, $titleObjs );
$unsure = array_diff_key( $titleObjs, $result, $this->notFound );
if( $unsure ) {
wfDebug( "FileCache MISS for ".count( $unsure )." files out of ".count( $titleObjs )."...\n" );
// XXX: We assume the array returned by findFiles() is
// indexed by DBkey; this appears to be true, but should
// be explicitly documented.
$found = $this->repoGroup->findFiles( $unsure );
$result += $found;
$this->addFiles( $found );
$this->markNotFound( array_keys( array_diff_key( $unsure, $found ) ) );
}
wfDebug( "FileCache found ".count( $result )." files out of ".count( $titleObjs )."\n" );
return $result;
}
}
|
Healthy Cake Batter Overnight Dessert Oats
These Cake Batter Overnight Dessert Oats have all the flavor of cake, just in a healthier package. This easy overnight oats recipe is sweet and uber filling, yet sugar free, gluten free, dairy free, and vegan!
Cake Batter for breakfast? Hell to the yes!
While this may not look like a slice of cake, it sure tastes like one. Just close your eyes, shove a giant spoonful into your face, and enjoy. Every bite is sweet and buttery and vanilla-y, you’ll seriously question how it could be healthy.
These Cake Batter Overnight Dessert Oats have all the flavor of cake, just in a healthier package. This easy overnight oats recipe is sweet and uber filling, yet sugar free, gluten free, dairy free, and vegan!
In a bowl, stir together a splash of almond milk and the nut butter until completely smooth. Stir in the remaining milk and vanilla extract.
Stir in the oats, sweetener, and salt. Cover and refrigerate overnight.
Serve and enjoy in the morning along with natural rainbow sprinkles, sliced strawberries or bananas, mini chocolate chips, or spoons alone!
Recipe Notes
If you want super duper creamy oats with a hit of protein, add ¼ cup of Greek yogurt to the recipe. If you’re vegan, feel free to stir in 1-2 tablespoons of your favorite vegan vanilla protein powder plus an extra splash of almond milk.
I don’t know about you, but the minute I wake up… no, the SECOND I wake up… the only thing that’s on my mind is food.
WTF? (“Where’s The Food?”)
Immediately after food, my brain switches over to coffee. WHERE’S THE COFFEE?!?!
Does that sound like your morning routine too? If so, then I’m glad we’re in this together.
This Cake Batter Oatmeal is our saving grace. Just mix together 5 ingredients, stick it in the fridge, go to bed, and BAM! Breakfast is all done and ready for you come morning time.
All you gotta do is roll out of bed (or jump out, depending on how excited you are for this damn good brekky), open the fridge, and dig in with a spoon. Yep, you’re welcome. Imagine how much more awesome your mornings would be with Cake Batter Overnight Oats in it?!?
Which would you rather have? An amazingly buttery and sweet slice of cake or a healthy breakfast? Why not both? Because you totally can with a bowl full of Cake Batter Overnight Oats!
For real guys. I’m not lying. This tastes like cake. Now go. Go make a bowl of this for breakfast. I command you! 😉
.
With love and good eats,
.
– Jess
.
Want to join the healthy dessert club?
Subscribe to the newsletter and get decadent, yet healthy, treats sent straight to your inbox... FREE!
Hey Jessica!
I am a beginning bodybuilder/health-nut who has a reigning sweet tooth and I just want to thank you so much for making it so easy for me to stick to my lifestyle while truly enjoying it!
while the other guys are eating bland chicken and rice for breakfast, I get cake batter oat meal! 😀 Plus I see results faster than most because im not tempted to cheat!
I pray that the Lord continues to bless you and your work and that your chocolate cup flows over in abundance! ^_^
Kasey~
Kasey-
Oh YAY I’m glad! That seriously made me SO happy to read that 😀
Cake Batter Oatmeal just makes life wayyy better 😉
Thank you so much for being so kind. I wish you all the best in your bodybuilding and competitions!
-Jess
I love cake batter flavored things. Unfortunately, they are usually filled with crap… and that’s definitely not what I am looking for. So I am sooo excited to find your healthier cake battery option, that’s for breakfast!! WINNNNNER!
Your email address will not be published. Required fields are marked *
Comment
Name *
Email *
Website
Save my name, email, and website in this browser for the next time I comment.
Recipe Rating
Welcome to Desserts With Benefits®! My name is Jessica and there’s a good chance I’m eating cake as we speak (healthy cake, of course)! Here at DWB, we use good-for-you ingredients to make balanced treats we can feel good about eating. (Read More »)
Join the Healthy Dessert Recipe Club!
Never miss a recipe, and get treated with some exclusive recipes and free goodies!
Jessica’s Cookbooks!
DIY Protein Bars: Easy, Healthy, Homemade No-Bake Treats That Are Packed With Protein is a collection of 48 ahhhmazing protein bar recipes!
Print available on Amazon.com.
PDF Download available on Etsy.
.
Naughty or Nice: The ULTIMATE Healthy Dessert Cookbook is a collection of 70 delicious, good-for-you recipes that’ll make you ask, “Is this naughty or is this nice?!”
Print and Kindle available on Amazon.com.
NEW! Baking Videos
Desserts With Benefits® is a participant in the Amazon Services LLC Associates Program, an affiliate advertising program designed to provide a means for sites to earn advertising fees by advertising and linking to Amazon.com. |
Electrospinning collagen/chitosan/poly(L-lactic acid-co-ε-caprolactone) to form a vascular graft: mechanical and biological characterization.
For blood vessel tissue engineering, an ideal vascular graft should possess excellent biocompatibility and mechanical properties. For this study, a elastic material of poly (L-lactic acid-co-ε-caprolactone) (P(LLA-CL)), collagen and chitosan blended scaffold at different ratios were fabricated by electrospinning. Upon fabrication, the scaffolds were evaluated to determine the tensile strength, burst pressure, and dynamic compliance. In addition, the contact angle and endothelial cell proliferation on the scaffolds were evaluated to demonstrate the structures potential to serve as a vascular prosthetic capable of in situ regeneration. The collagen/chitosan/P(LLA-CL) scaffold with the ratio of 20:5:75 reached the highest tensile strength with the value of 16.9 MPa, and it was elastic with strain at break values of ~112%, elastic modulus of 10.3 MPa. The burst pressure strength of the scaffold was greater than 3365 mmHg and compliance value was 0.7%/100 mmHg. Endothelial cells proliferation was significantly increased on the blended scaffolds versus the P(LLA-CL). Meanwhile, the endothelial cells were more adherent based on the increase in the degree of cell spreading on the surface of collagen/chitosan/P(LLA-CL) scaffolds. Such blended scaffold especially with the ratio of 20:5:75 thus has the potential for vascular graft applications. |
During the 18-day trial involving more than a dozen witnesses, the supervisor denied regularly passing wind in the communal office.
He said he could not recall thrusting his backside at Mr Hingst and pretending to fart, although he conceded he could not rule it out either.
"I may have done it once or twice, maybe. But I can't recall."
One former employee said he witnessed Mr Short fart when he walked over to the printer but argued it was typical office "mucking around".
He said Mr Hingst may have been offended because he was of German descent, "whereas us Australians are sort of brought up you sort of accept it or think oh it's just – that's what happens".
Justice Zammit said the evidence suggested Mr Short's flatulence was "an offence that has its origins in cultural difference – rather than the sort of fear, distress, humiliation or victimisation that one would ordinarily expect in a bullying scenario".
Flatulence not 'intimidation'
The judge rejected claims about the frequency of the supervisor's flatulence or that it was targeted at Mr Hingst.
She said even if the claims were true, it would not necessarily amount to bullying.
"It is difficult to see how Mr Short's conduct could have intimidated or caused distress to the [administrator]," the judge said.
"[Mr Hingst] was able to spray Mr Short with deodorant and give him the nickname 'Mr Stinky'. Indeed, on [his] own evidence, had he not lost his job and been abused over the telephone, the flatulence would 'never have been a big issue'."
On allegations Mr Short yelled at Mr Hingst several times over the phone that he had "f---ed up" and was "not worth [his salary]", the judge found no supportive evidence for the claim.
She concluded no Construction Engineering Australia staff had bullied or harassed Mr Hingst and noted evidence that domestic stress and dismissal probably led to Mr Hingst's psychiatric injuries.
"It is in a sense tragic that the plaintiff's redundancy appears to lie at the heart of his problems.
"It seems, regrettably, to have generated a misplaced sense of unfairness at the loss of his job." |
Carotenoid profiling, in silico analysis and transcript profiling of miRNAs targeting carotenoid biosynthetic pathway genes in different developmental tissues of tomato.
Carotenoid biosynthetic pathway is one of the highly significant and very well elucidated secondary metabolic pathways in plants. microRNAs are the potential regulators, widely known for playing a pivotal role in the regulation of various biological as well as metabolic processes. miRNAs may assist in the metabolic engineering of the secondary metabolites for the production of elite genotypes with increased biomass and content of various metabolites. miRNA mediated regulation of carotenoid biosynthetic genes has not been elucidated so far. To illustrate the potential regulatory role of miRNAs in carotenoid biosynthesis, transcript profiling of the known miRNAs and their possible target carotenoid genes was undertaken at eight different developmental stages of tomato, using stem-loop PCR approach combined with quantitative RT-PCR. The inter-relationship amongst carotenoid content, biosynthetic genes and miRNAs was studied in depth. Comparative expression profiles of miRNA and target genes showed variable expression in different tissues studied. The expression level of miRNAs and their target carotenoid genes displayed similar pattern in the vegetative tissues as compared to the reproductive ones, viz. fruit (different stages), indicating the possibility of regulation of carotenoid biosynthesis at various stages of fruit development. This was later confirmed by the HPLC analysis of the carotenoids. The present study has further enhanced the understanding of regulation of carotenoid biosynthetic pathway in plants. The identified miRNAs can be employed to manipulate the biosynthesis of different carotenoids, through metabolic engineering for the production of lycopene rich tomatoes. |
Mortsel
Mortsel () is a city and municipality close to the city of Antwerp located in the Belgian province of Antwerp. The municipality only comprises the city of Mortsel proper. On January 1, 2006 Mortsel had a total population of 24,427 people. The total area is 7.78 km² which gives a population density of 3,138 inhabitants per km². This is the highest population density of any municipality in the Flemish Region (Flanders), and second-highest (to Saint-Nicolas) outside the Brussels-Capital Region.
Geography
The city consists of the areas Mortsel-Dorp, Oude-God and Luithagen. Mortsel is bordered by Antwerp (districts Wilrijk, Berchem and Deurne), Borsbeek, Boechout, Hove, and Edegem.
History
Mortsel was the scene for one of the major collateral damage tragedies of World War II. On April 5, 1943, the Minerva car factory, then used to repair Luftwaffe planes, was the target of a big bombing raid by the USAAF. Unfortunately most bombs missed the target and hit a residential area instead, resulting in the deaths of 936 civilians, including 209 children, exceeding the civilian death toll of the Guernica raid which modern estimates put at 400.
The last V2 launched against Antwerp also fell in Mortsel, killing 27 people, on March 27, 1945.
Economy
The headquarters of Agfa-Gevaert are situated in Mortsel.
Notable people
Alex Agnew, stand-up comedian
Luc Brewaeys, (born in Mortsel in 1959), composer, conductor, pianist and recording producer
Bart De Wever, politician
Timo Descamps, actor
Koen Lenaerts, President of the European Court of Justice
Clem Schouwenaars (b. Mortsel, 1932–1993), writer
Tamino, musician
Luc Tuymans, painter
Jos Vandeloo, writer
See also the :Category:People from Mortsel.
See also
Crossing the Lines
References
External links
Category:Municipalities of Antwerp (province)
Category:Populated places in Antwerp (province)
Category:Populated places in Belgium |
Eosinophil degranulation status in allergic rhinitis: observations before and during seasonal allergen exposure.
Despite the fact that extensive degranulation is a likely prerequisite for a pathogenic role of eosinophils, little is known about the degranulation status of these cells in eosinophilic conditions. The present study of the ultrastructure of tissue eosinophils explores eosinophil degranulation in allergic rhinitis before and during seasonal allergen exposure. A total of 23 patients scored symptoms q.d., prior to and during the pollen season. The numbers of mucosal eosinophils and their degranulation status were determined in nasal biopsies. Furthermore, nasal lavage fluid levels of eosinophil cationic protein (ECP) and alpha2-macroglobulin were assessed as indices of eosinophil activity and plasma exudation, respectively. Seasonal allergen exposure was associated with increased nasal symptoms, increased lavage fluid levels of ECP and alpha2-macroglobulin, and increased numbers of tissue eosinophils. In the tissue, transmission electron microscopy revealed a moderate piecemeal degranulation already prior to the season (mean+/-sd 37+/-2.7% altered granules). Seasonal allergen exposure increased this degranulation (87+/-1.8%), and produced local areas with extensive deposition of granule proteins. The degree of eosinophil degranulation correlated with levels of ECP in lavage fluids obtained at histamine challenge. In conclusion, this study demonstrated that the nasal mucosa in allergic rhinitis features moderately degranulated eosinophils already at nonsymptomatic baseline conditions. In association with the development of symptomatic seasonal allergic rhinitis, the tissue deposition of eosinophil granule proteins is dramatically elevated through increased eosinophil numbers, together with markedly augmented degranulation of individual cells. |
Evaluation of four HIV antigen tests.
A direct comparison of different HIV antigen assays is very helpful in making an informed choice, not only for the testing laboratories but also for healthcare workers in the developing world who are looking for reliable and inexpensive tests/methods in the follow-up of their treated patients. As a follow-up to the study published previously [Fransen K., Martens G., Stynen D., Goris A., Nys P., Nkengasong J., Heyndrickx L., Janssens W., van der Groen G., 1997. J. Med. Virol. 53, 31--35] where only two tests have been compared, four different commercial methods for HIV antigen determination in plasma and supernatant of cell cultures have now been evaluated on a limited sample size (88): COULTER HIV-1 p24 Antigen Assay (Coulter), (Test 1) INNOTEST HIV Antigen mAb (Innogenetics) (Test 2), Genetic Systems HIV-1 Ag EIA (Sanofi-Pasteur(1)) (Test 3) and VIDAS HIV P24 II (bioMérieux) (Test 4). Of the four tests used in this study, Test 2 was by far the most sensitive test. In a population of 88 follow-up samples from 35 different patients representing all stages of infection, the test detected confirmed p24 antigen at least once in 85.7% (30/35) of these patients, versus Test 3 in 74.3% (26/35), Test 4 in 71.4% (25/35), and Test 1 in 48.6% (17/35) of the patients. Test 2 detected confirmed p24 antigen in 84.9% of the follow-up samples, followed by Test 4 (65.9%), Test 3 (64.8%) and Test 1 (39.8%). Finally, Test 2 also proved best for detecting genetically diverse isolates. |
Conhecido como o "doleiro dos doleiros", Dario Messer disse a sua namorada, em uma conversa interceptada pela Polícia Federal, que pagou propina mensal ao procurador Januário Paludo, integrante da força-tarefa da "lava jato" no Ministério Público Federal do Paraná. A propina, segundo o doleiro, seria para evitar que ele fosse investigado.
Reprodução/FacebookDoleiro disse que pagava propina mensal ao procurador Januário Paludo
Os diálogos entre Messer e a namorada foram revelados neste sábado (30/11) pelo UOL. Segundo a reportagem, a conversa ocorreu em agosto de 2018 e foi obtida pela Polícia Federal do Rio de Janeiro. Em um relatório produzido em outubro, a PF classificou o fato como "grave" e cobrou providências. O documento já foi enviado à Procuradoria-Geral da República.
Na conversa, Messer diz à namorada que uma testemunha de acusação de um dos processos contra ele teria uma reunião com Paludo. "Sendo que esse Paludo é destinatário de pelo menos parte da propina paga pelos meninos todo mês", afirmou o doleiro. Os meninos citados por Messer, segundo o UOL, seriam seus auxiliares em operações de lavagem de dinheiro e que, hoje, se tornaram delatores da "lava jato".
Januário Paludo é um dos mais antigos integrantes da força-tarefa da "lava jato" e também um dos mais experientes. Atuou no caso Banestado nos anos 90. O nome dele apareceu algumas vezes na "vaza jato", série de reportagens com conversas privadas de procuradores que atuam na operação. Em uma delas, Paludo desdenhou do pedido do ex-presidente Lula para deixar a prisão e acompanhar o velório do irmão. "O safado só queria viajar", disse.
Em nota, o MPF-PR repudiou "suposições infundadas contra o procurador". "A ação penal que tramitou contra Dario Messer em Curitiba foi de responsabilidade de outro procurador que atua na procuradoria da República no Paraná, o qual trabalhou no caso com completa independência. Nem o procurador Januário Paludo, nem a força-tarefa atuaram nesse processo", diz a nota.
Ainda segundo o MPF, Messer é alvo de investigação na "lava jato" do Rio de Janeiro, "razão pela qual não faz sequer sentido a suposição de que um procurador da força-tarefa do Paraná poderia oferecer qualquer tipo de proteção". Por fim, os integrantes da força-tarefa afirmam ter plena confiança no trabalho de Paludo, "pessoa com extenso rol de serviços prestados à sociedade e respeitada no Ministério Público pela seriedade, profissionalismo e experiência". |
Queen Margaret University, Musselburgh
A full ironmongery package for Queen Margaret University, Musselburgh. The new campus is a vibrant new academic village with high-tech buildings and attractive landscaped spaces, featuring an innovative learning resource centre at the heart of the development. The contractor was Grattan & Hynds.
Recent Projects
Traynor Williams Ironmongery strives to offer amazing customer service. We have a combined 100 years experience with a vast experience of architectural ironmongery. We have a wide range of clients throughout Scotland and the United Kingdom.
What our clients say
“We are happy with the consistently high standard of service and value the longstanding relationship we have with Traynor Williams Ironmongery. We happily recommend their services to any firm considering them for their ironmongery products and services.” |
GENOME ANNOUNCEMENT
===================
The zygomycete *Rhizopus* microsporus is a terrestrial filamentous fungus that is used in food fermentation but also is known to cause rice seedling blight, which leads to substantial losses in agriculture, as well as mucormycoses in immunocompromised patients ([@B1], [@B2]). Phytopathogens, such as R. microsporus strain ATCC 62417, harbor endosymbiotic bacteria of the genus Burkholderia ([@B3], [@B4]) producing the antimitotic agent rhizoxin ([@B5][@B6][@B7]). Surprisingly, these symbiotic fungi lose their ability to produce mature sporangia and vegetative spores in the absence of the endobacteria ([@B8]). An analysis of the genome sequence of the endosymbiont Burkholderia rhizoxinica has revealed bacterial symbiosis factors ([@B9][@B10][@B12]). Besides information gained from genetic bar code studies ([@B13]), nothing is known about the genomic differences between symbiotic and symbiont-free R. microsporus strains.
For each strain, multiple libraries (paired-end, 2-kb mate-pair, 3 × 5-kb mate-pair) were sequenced with Illumina HiSeq 2000. R. microsporus CBS 344.29 was additionally sequenced using Illumina MiSeq V2. The reads were quality trimmed, error corrected ([@B14]), digitally normalized ([@B15]), and finally assembled with AllPaths-LG ([@B16]) (LGC Genomics, Berlin, Germany). The assemblies were postprocessed using SOAP GapCloser ([@B17]). Transcriptome sequencing was performed using HiSeq 2000 100 bp. CBS 344.29 was cultured on potato dextrose agar (PDA) plates for 3 days at 30°C. ATCC 62417 was cultured under three different conditions, namely, with and without the endosymbiont (B. rhizoxinica) on PDA plates, and with bacterium in Vorkultur medium at 30°C for 3 days. The culture with Vorkultur medium was sequenced using the 454 FLX Titanium platform, and the contigs were assembled using Newbler (454 Life Sciences). rRNA was detected and removed with riboPicker ([@B18]).
Structural and functional gene annotation were performed as described previously ([@B19], [@B20]). Protein sequences from *Lichtheimia hyalospora* (Joint Genome Institute \[JGI\]), *Mucor circinelloides* (Broad Institute), *Phycomyces blakesleeanus* (JGI), *Rhizopus delemar* (Broad Institute), and R. microsporus var. microsporus (JGI) were mapped to the reference genomes. The transcriptome assemblies of Newbler, Cufflinks ([@B21]), and genome-independent and genome-guided Trinity ([@B22]) were combined using EvidentialGene ([@B23]). The resulting assembly was checked for contamination with the help of BLAST, the NCBI nonredundant database, and the UniProt fungal knowledge base.
The genome assembly is based on sequencing data amounting to 15.9 Gbp (CBS 344.29) and 15.7 Gbp (ATCC 62417), which represent a 310-fold estimated genome coverage. The assembly for CBS 344.29 consists of 1,554 scaffolds, with a total size of 49.2 Mbp (*N*~50~, 53 kbp), whereas the assembly of ATCC 62417 consists of 1,386 scaffolds, with a total size of 49.6 Mbp (*N*~50~, 198 kbp). The exceptionally low G+C content of the assemblies are 34.5% and 33.4%, respectively. Using CEGMA ([@B24]), we identified 431 and 451 core proteins within the respective genomes. During the genome annotation, we utilized RNA sequencing (RNA-seq) data amounting to 5.5 Mbp (CBS 344.29) and 5.1 Mbp (ATCC 62417), which represent an estimated 100-fold transcriptome coverage. For CBS 344.29, we predicted 19,564 genes and 20,209 transcripts, of which 10,698 have GO categories, 14,642 have InterPro domains, and 3,879 contain transmembrane domains. For ATCC 62417, we predicted 18,869 genes and 23,603 transcripts, of which 9,704 have GO categories, 17,264 have InterPro domains, and 4,807 contain transmembrane domains. The GO annotations of the fungus have been made available for enrichment analysis with FungiFun2 ([@B25]).
Nucleotide sequence accession numbers.
--------------------------------------
This whole-genome shotgun project has been deposited in DDBJ/ENA/GenBank under the accession numbers [CCYT01000001](CCYT01000001) to [CCYT01001386](CCYT01001386) (strain ATCC 62417) and [CDGI01000001](CDGI01000001) to [CDGI01001554](CDGI01001554) (strain CBS 344.29). The versions described in this paper are the first versions. The genome data and additional information are also available at the HKI Genome Resource (<http://www.genome-resource.de>/).
**Citation** Horn F, Üzüm Z, Möbius N, Guthke R, Linde J, Hertweck C. 2015. Draft genome sequences of symbiotic and nonsymbiotic *Rhizopus microsporus* strains CBS 344.29 and ATCC 62417. Genome Announc. 3(1):e01370-14. doi:10.1128/genomeA.01370-14.
This work was financially supported by the Deutsche Forschungsgemeinschaft (DFG), in the CRC/Transregio 124 "Pathogenic fungi and their human host: Networks of interaction," subproject INF (to J.L.) and in the Jena School for Microbial Communication (JSMC) (to Z.Ü. and N.M.).
|
Q:
OpenCart load Model outside Controller
I'm working on an OpenCart project, that requires a lot of customization.
for my project I have to change something in the cart library (system/library/cart.php).
I would have to call a custom function that's defined inside the product model (catalog/model/catalog/product.php).
In a controller, loading a Model and using its functions is easy:
$this->load->model("catalog/product");
$this->model_catalog_product->customFunction();
But how do you load a model outside a controller?
You can't create a new instance of the model, I already tried that:
require_once("catalog/model/catalog/product.php");
$a_model = new ModelCatalogProduct();
This obviously doesn't work cause models weren't intended to be used in such a way.
I also tried to use the scope resolution operator ( ModelCatalogProduct::customFunction())
It doesn't work either.
I could pass all the required info as arguments, but I would rather use the model inside the cart library class, cause the changes would be global.
Is it even possible to load a model outside a controller in OpenCart?
A:
If it's only one method that you need to copy, you would be best adding a method to the Cart class itself. The Cart class will work with the $this->db->query() calls as it already has $db assigned to it even though it's not a Controller/Model
Edit
Should you wish to do this, you could do something similar to the following
public function test() {
global $loader, $registry;
$loader->model('catalog/product');
$model = $registry->get('model_catalog_product');
$result = $model->getProduct(123);
}
A:
You are able to load a model outside a controlled.
If You need to load a model inside of another model, You could load it the very same way using $this->load->model('my_module/my_model');.
If You need to load a model inside of template file or other custom PHP script, look at the index.php file where the Registry is instanciated - You would need to instanciate it the same way. So Your custom code could look like:
$registry = new Registry();
$my_model = $registry->load->model('my_module/my_model');
$my_model->customFunction();
Anyway I highly recommend not to edit/change the core library files unless You are sure there is no other way how to implement/do what You need.
As Jay Gilford proposed I would implement that function or it's call to the catalog/checkout/cart.php, potentially confirm or success depending on the scope and functionality You would like to implement.
|
[Desktop Entry]
Name=Anbox
GenericName=Android in a box
Version=1.0
Type=Application
Icon=anbox
Exec=anbox launch --package=org.anbox.appmgr --component=org.anbox.appmgr.AppViewActivity
Terminal=false
|
Early voting turnout high
Long lines form at the Coweta Voter Registration Office on the first day of early voting, and turnout has remained high.
Cowetans, as well as voters all over the state, have been taking advantage of early voting in a big way.
In the first three days of the 15-day early voting period, 4,047 Cowetans cast their ballots on the electronic voting machines. The Coweta Voter Registration Office had mailed out 2,155 absentee ballots.
Be in the know the moment news happens
Subscribe to Daily and Breaking News Alerts
Email Address
Election day is Nov. 6.
Statewide, 211,861 early votes were cast by Oct. 16, according to Georgiavotes.com. That includes in-person early voting as well as absentee voting by mail. At the same time for the 2014 mid-term elections, the total was 67,372.
This election bears more resemblance to the 2016 presidential election in terms of turnout than the 2014 midterms, according to Coweta Elections Superintendent Jane Scoggins. In 2014, a popular incumbent governor was on the ballot, while this year there is a fiercely contested and nationally watched governor’s race.
Total early voting turnout in 2016 was 31,439, with 3,112 absentee ballots, according to Scoggins.
Scoggins thinks Coweta might reach or beat that turnout this year. Typically, early voting starts off slow and turnout grows over time.
“I expect it to stay busy. And we’re ready,” Scoggins said.
Scoggins said she’s gotten quite a few phone calls from people who think something is wrong with their absentee ballot because there is no race for Coweta Sheriff on it.
There are several candidates campaigning to succeed Sheriff Mike Yeager, but there is no election yet. Yeager has been nominated to be U.S. marshal for the Northern District of Georgia, but hasn’t yet been confirmed or taken that office, and is still Coweta’s sheriff. An election won’t be called until Yeager officially announces he is leaving the post.
Scoggins is also seeing quite a few people turning in absentee ballots and having them canceled so they can vote on the electronic voting machines.
If you’ve received an absentee ballot and decide you don’t want to vote by mail, simply bring your ballot to either the early voting location and have it canceled, or bring it to your polling place on election day.
“You must bring that ballot with you,” Scoggins said. “Once you’ve been issued that ballot, it is like you’ve voted."
Scoggins' office has received an unusually high number of absentee ballot requests. There are multiple organizations that have been sending people pre-printed ballot applications, Scoggins said.
She’s had some people bring in the ballots and say they never requested them. When she shows them their signed ballot request, “They say ‘oh, I didn’t know that is what that was,’” she said.
Early voting runs Monday through Friday, 8:30 a.m. to 4:30 p.m., through Nov. 2. There will be early voting Saturday, Oct. 27, from 9 a.m. to 4 p.m.
Early voting takes place at two locations: the Coweta Voter Registration Office at 22 East Broad St. in downtown Newnan, and the Central Community Center, 65 Literary Lane, Newnan, near the intersection of Lower Fayetteville Road and Ga. Hwy. 154.
For more information about early voting, call 770-254-2615 and press zero.
Miss Your Newspaper?
Please call 770-304-3373 to report a missed paper.
If you did not receive your newspaper by 6:30 a.m. on Wednesday through Saturday or by 7 a.m. on Sunday, you can report it by calling our circulation number at 770-304-3373.You must call between 7 - 11 a.m. in order for a circulation representative to deliver a newspaper to you. |
Fast forward to 2030 and the children who started school in 2017 will need to be just as skilled in critical thinking, creativity and empathy as they are in literacy and numeracy and technology.
It is impossible to accurately predict the jobs of the future, says Mark Scott, the secretary of the NSW Department of Education, but schools will need to prepare the next generations of students for a world that will be dominated by intelligent machines.
"Children are now facing a more uncertain future than any child has faced since the Industrial Revolution," Mr Scott said.
Mr Scott this week gave a speech to the Trans-Tasman Business Circle where he outlined publicly for the first time his vision for education of the future. It was the springboard for the launch of work being done within the department to prepare students for a fast-changing world. |
{
"runtimeTarget": {
"name": ".NETCoreApp,Version=v3.0",
"signature": ""
},
"compilationOptions": {},
"targets": {
".NETCoreApp,Version=v3.0": {
"PluginG/1.0.0": {
"dependencies": {
"Dictionary.Domain": "1.0.0",
"ExternalServiceForPluginD": "1.0.0",
"Microsoft.Extensions.Configuration.Abstractions": "3.0.0",
"Prise.IntegrationTestsContract": "1.0.0",
"Prise.Plugin": "1.0.0",
"Prise.PluginBridge": "1.0.0"
},
"runtime": {
"PluginG.dll": {}
}
},
"Microsoft.Extensions.Configuration.Abstractions/3.0.0": {
"dependencies": {
"Microsoft.Extensions.Primitives": "3.0.0"
},
"runtime": {
"lib/netcoreapp3.0/Microsoft.Extensions.Configuration.Abstractions.dll": {
"assemblyVersion": "3.0.0.0",
"fileVersion": "3.0.19.46305"
}
}
},
"Microsoft.Extensions.DependencyInjection/3.0.0": {
"dependencies": {
"Microsoft.Extensions.DependencyInjection.Abstractions": "3.0.0"
},
"runtime": {
"lib/netcoreapp3.0/Microsoft.Extensions.DependencyInjection.dll": {
"assemblyVersion": "3.0.0.0",
"fileVersion": "3.0.19.46305"
}
}
},
"Microsoft.Extensions.DependencyInjection.Abstractions/3.0.0": {
"runtime": {
"lib/netstandard2.0/Microsoft.Extensions.DependencyInjection.Abstractions.dll": {
"assemblyVersion": "3.0.0.0",
"fileVersion": "3.0.19.46305"
}
}
},
"Microsoft.Extensions.Primitives/3.0.0": {
"runtime": {
"lib/netcoreapp3.0/Microsoft.Extensions.Primitives.dll": {
"assemblyVersion": "3.0.0.0",
"fileVersion": "3.0.19.46305"
}
}
},
"Newtonsoft.Json/11.0.2": {
"runtime": {
"lib/netstandard2.0/Newtonsoft.Json.dll": {
"assemblyVersion": "11.0.0.0",
"fileVersion": "11.0.2.21924"
}
}
},
"Dictionary.Domain/1.0.0": {
"dependencies": {
"Newtonsoft.Json": "11.0.2"
},
"runtime": {
"Dictionary.Domain.dll": {}
}
},
"ExternalServiceForPluginD/1.0.0": {
"runtime": {
"ExternalServiceForPluginD.dll": {}
}
},
"Prise.IntegrationTestsContract/1.0.0": {
"runtime": {
"Prise.IntegrationTestsContract.dll": {}
}
},
"Prise.Plugin/1.0.0": {
"dependencies": {
"Microsoft.Extensions.DependencyInjection": "3.0.0"
},
"runtime": {
"Prise.Plugin.dll": {}
}
},
"Prise.PluginBridge/1.0.0": {
"runtime": {
"Prise.PluginBridge.net3.dll": {}
}
}
}
},
"libraries": {
"PluginG/1.0.0": {
"type": "project",
"serviceable": false,
"sha512": ""
},
"Microsoft.Extensions.Configuration.Abstractions/3.0.0": {
"type": "package",
"serviceable": true,
"sha512": "sha512-Lge/PbXC53jI1MF2J92X5EZOeKV8Q/rlB1aV3H9I/ZTDyQGOyBcL03IAvnviWpHKj43BDkNy6kU2KKoh8kAS0g==",
"path": "microsoft.extensions.configuration.abstractions/3.0.0",
"hashPath": "microsoft.extensions.configuration.abstractions.3.0.0.nupkg.sha512"
},
"Microsoft.Extensions.DependencyInjection/3.0.0": {
"type": "package",
"serviceable": true,
"sha512": "sha512-yDsuNA/BT4j9qrcRs0NUNHQAJfywFWX18ZZ+shxXJL+/nIfz3vhuRTfnYgvFeQlNBlgmgdSjOcs4ajgoS6Q/Ng==",
"path": "microsoft.extensions.dependencyinjection/3.0.0",
"hashPath": "microsoft.extensions.dependencyinjection.3.0.0.nupkg.sha512"
},
"Microsoft.Extensions.DependencyInjection.Abstractions/3.0.0": {
"type": "package",
"serviceable": true,
"sha512": "sha512-ofQRroDlzJ0xKOtzNuaVt6QKNImFkhkG0lIMpGl7PtXnIf5SuLWBeiQZAP8DNSxDBJJdcsPkiJiMYK2WA5H8dQ==",
"path": "microsoft.extensions.dependencyinjection.abstractions/3.0.0",
"hashPath": "microsoft.extensions.dependencyinjection.abstractions.3.0.0.nupkg.sha512"
},
"Microsoft.Extensions.Primitives/3.0.0": {
"type": "package",
"serviceable": true,
"sha512": "sha512-6gwewTbmOh+ZVBicVkL1XRp79sx4O7BVY6Yy+7OYZdwn3pyOKe9lOam+3gXJ3TZMjhJZdV0Ub8hxHt2vkrmN5Q==",
"path": "microsoft.extensions.primitives/3.0.0",
"hashPath": "microsoft.extensions.primitives.3.0.0.nupkg.sha512"
},
"Newtonsoft.Json/11.0.2": {
"type": "package",
"serviceable": true,
"sha512": "sha512-IvJe1pj7JHEsP8B8J8DwlMEx8UInrs/x+9oVY+oCD13jpLu4JbJU2WCIsMRn5C4yW9+DgkaO8uiVE5VHKjpmdQ==",
"path": "newtonsoft.json/11.0.2",
"hashPath": "newtonsoft.json.11.0.2.nupkg.sha512"
},
"Dictionary.Domain/1.0.0": {
"type": "project",
"serviceable": false,
"sha512": ""
},
"ExternalServiceForPluginD/1.0.0": {
"type": "project",
"serviceable": false,
"sha512": ""
},
"Prise.IntegrationTestsContract/1.0.0": {
"type": "project",
"serviceable": false,
"sha512": ""
},
"Prise.Plugin/1.0.0": {
"type": "project",
"serviceable": false,
"sha512": ""
},
"Prise.PluginBridge/1.0.0": {
"type": "project",
"serviceable": false,
"sha512": ""
}
}
} |
/*
* Copyright (c) 1999
* Silicon Graphics Computer Systems, Inc.
*
* Copyright (c) 1999
* Boris Fomitchev
*
* This material is provided "as is", with absolutely no warranty expressed
* or implied. Any use is at your own risk.
*
* Permission to use or copy this software for any purpose is hereby granted
* without fee, provided the above notices are retained on all copies.
* Permission to modify the code and to distribute modified code is granted,
* provided the above notices are retained, and a notice that the code was
* modified is included with the above copyright notice.
*
*/
#ifndef _STLP_NUM_PUT_C
#define _STLP_NUM_PUT_C
#ifndef _STLP_INTERNAL_NUM_PUT_H
# include <stl/_num_put.h>
#endif
#ifndef _STLP_INTERNAL_LIMITS
# include <stl/_limits.h>
#endif
_STLP_BEGIN_NAMESPACE
_STLP_MOVE_TO_PRIV_NAMESPACE
// __do_put_float and its helper functions. Strategy: write the output
// to a buffer of char, transform the buffer to _CharT, and then copy
// it to the output.
//----------------------------------------------------------------------
// num_put facet
template <class _CharT, class _OutputIter>
_OutputIter _STLP_CALL
__copy_float_and_fill(const _CharT* __first, const _CharT* __last,
_OutputIter __oi,
ios_base::fmtflags __flags,
streamsize __width, _CharT __fill,
_CharT __xplus, _CharT __xminus) {
if (__width <= __last - __first)
return copy(__first, __last, __oi);
else {
streamsize __pad = __width - (__last - __first);
ios_base::fmtflags __dir = __flags & ios_base::adjustfield;
if (__dir == ios_base::left) {
__oi = copy(__first, __last, __oi);
return __fill_n(__oi, __pad, __fill);
}
else if (__dir == ios_base::internal && __first != __last &&
(*__first == __xplus || *__first == __xminus)) {
*__oi++ = *__first++;
__oi = __fill_n(__oi, __pad, __fill);
return copy(__first, __last, __oi);
}
else {
__oi = __fill_n(__oi, __pad, __fill);
return copy(__first, __last, __oi);
}
}
}
#if !defined (_STLP_NO_WCHAR_T)
// Helper routine for wchar_t
template <class _OutputIter>
_OutputIter _STLP_CALL
__put_float(__iostring &__str, _OutputIter __oi,
ios_base& __f, wchar_t __fill,
wchar_t __decimal_point, wchar_t __sep,
size_t __group_pos, const string& __grouping) {
const ctype<wchar_t>& __ct = *__STATIC_CAST(const ctype<wchar_t>*, __f._M_ctype_facet());
__iowstring __wbuf;
__convert_float_buffer(__str, __wbuf, __ct, __decimal_point);
if (!__grouping.empty()) {
__insert_grouping(__wbuf, __group_pos, __grouping,
__sep, __ct.widen('+'), __ct.widen('-'), 0);
}
return __copy_float_and_fill(__CONST_CAST(wchar_t*, __wbuf.data()),
__CONST_CAST(wchar_t*, __wbuf.data()) + __wbuf.size(), __oi,
__f.flags(), __f.width(0), __fill, __ct.widen('+'), __ct.widen('-'));
}
#endif /* WCHAR_T */
// Helper routine for char
template <class _OutputIter>
_OutputIter _STLP_CALL
__put_float(__iostring &__str, _OutputIter __oi,
ios_base& __f, char __fill,
char __decimal_point, char __sep,
size_t __group_pos, const string& __grouping) {
if ((__group_pos < __str.size()) && (__str[__group_pos] == '.')) {
__str[__group_pos] = __decimal_point;
}
if (!__grouping.empty()) {
__insert_grouping(__str, __group_pos,
__grouping, __sep, '+', '-', 0);
}
return __copy_float_and_fill(__CONST_CAST(char*, __str.data()),
__CONST_CAST(char*, __str.data()) + __str.size(), __oi,
__f.flags(), __f.width(0), __fill, '+', '-');
}
template <class _CharT, class _OutputIter, class _Float>
_OutputIter _STLP_CALL
__do_put_float(_OutputIter __s, ios_base& __f,
_CharT __fill, _Float __x) {
__iostring __buf;
size_t __group_pos = __write_float(__buf, __f.flags(), (int)__f.precision(), __x);
const numpunct<_CharT>& __np = *__STATIC_CAST(const numpunct<_CharT>*, __f._M_numpunct_facet());
return __put_float(__buf, __s, __f, __fill,
__np.decimal_point(), __np.thousands_sep(),
__group_pos, __f._M_grouping());
}
inline void __get_money_digits_aux (__iostring &__buf, ios_base &, _STLP_LONGEST_FLOAT_TYPE __x)
{ __get_floor_digits(__buf, __x); }
#if !defined (_STLP_NO_WCHAR_T)
inline void __get_money_digits_aux (__iowstring &__wbuf, ios_base &__f, _STLP_LONGEST_FLOAT_TYPE __x) {
__iostring __buf;
__get_floor_digits(__buf, __x);
const ctype<wchar_t>& __ct = *__STATIC_CAST(const ctype<wchar_t>*, __f._M_ctype_facet());
__convert_float_buffer(__buf, __wbuf, __ct, wchar_t(0), false);
}
#endif
template <class _CharT>
void _STLP_CALL __get_money_digits(_STLP_BASIC_IOSTRING(_CharT) &__buf, ios_base& __f, _STLP_LONGEST_FLOAT_TYPE __x)
{ __get_money_digits_aux(__buf, __f, __x); }
// _M_do_put_integer and its helper functions.
template <class _CharT, class _OutputIter>
_OutputIter _STLP_CALL
__copy_integer_and_fill(const _CharT* __buf, ptrdiff_t __len,
_OutputIter __oi,
ios_base::fmtflags __flg, streamsize __wid, _CharT __fill,
_CharT __xplus, _CharT __xminus) {
if (__len >= __wid)
return copy(__buf, __buf + __len, __oi);
else {
//casting numeric_limits<ptrdiff_t>::max to streamsize only works is ptrdiff_t is signed or streamsize representation
//is larger than ptrdiff_t one.
_STLP_STATIC_ASSERT((sizeof(streamsize) > sizeof(ptrdiff_t)) ||
(sizeof(streamsize) == sizeof(ptrdiff_t)) && numeric_limits<ptrdiff_t>::is_signed)
ptrdiff_t __pad = __STATIC_CAST(ptrdiff_t, (min) (__STATIC_CAST(streamsize, (numeric_limits<ptrdiff_t>::max)()),
__STATIC_CAST(streamsize, __wid - __len)));
ios_base::fmtflags __dir = __flg & ios_base::adjustfield;
if (__dir == ios_base::left) {
__oi = copy(__buf, __buf + __len, __oi);
return __fill_n(__oi, __pad, __fill);
}
else if (__dir == ios_base::internal && __len != 0 &&
(__buf[0] == __xplus || __buf[0] == __xminus)) {
*__oi++ = __buf[0];
__oi = __fill_n(__oi, __pad, __fill);
return copy(__buf + 1, __buf + __len, __oi);
}
else if (__dir == ios_base::internal && __len >= 2 &&
(__flg & ios_base::showbase) &&
(__flg & ios_base::basefield) == ios_base::hex) {
*__oi++ = __buf[0];
*__oi++ = __buf[1];
__oi = __fill_n(__oi, __pad, __fill);
return copy(__buf + 2, __buf + __len, __oi);
}
else {
__oi = __fill_n(__oi, __pad, __fill);
return copy(__buf, __buf + __len, __oi);
}
}
}
#if !defined (_STLP_NO_WCHAR_T)
// Helper function for wchar_t
template <class _OutputIter>
_OutputIter _STLP_CALL
__put_integer(char* __buf, char* __iend, _OutputIter __s,
ios_base& __f,
ios_base::fmtflags __flags, wchar_t __fill) {
locale __loc = __f.getloc();
// const ctype<wchar_t>& __ct = use_facet<ctype<wchar_t> >(__loc);
const ctype<wchar_t>& __ct = *__STATIC_CAST(const ctype<wchar_t>*, __f._M_ctype_facet());
wchar_t __xplus = __ct.widen('+');
wchar_t __xminus = __ct.widen('-');
wchar_t __wbuf[64];
__ct.widen(__buf, __iend, __wbuf);
ptrdiff_t __len = __iend - __buf;
wchar_t* __eend = __wbuf + __len;
// const numpunct<wchar_t>& __np = use_facet<numpunct<wchar_t> >(__loc);
// const string& __grouping = __np.grouping();
const numpunct<wchar_t>& __np = *__STATIC_CAST(const numpunct<wchar_t>*, __f._M_numpunct_facet());
const string& __grouping = __f._M_grouping();
if (!__grouping.empty()) {
int __basechars;
if (__flags & ios_base::showbase)
switch (__flags & ios_base::basefield) {
case ios_base::hex: __basechars = 2; break;
case ios_base::oct: __basechars = 1; break;
default: __basechars = 0;
}
else
__basechars = 0;
__len = __insert_grouping(__wbuf, __eend, __grouping, __np.thousands_sep(),
__xplus, __xminus, __basechars);
}
return __copy_integer_and_fill((wchar_t*)__wbuf, __len, __s,
__flags, __f.width(0), __fill, __xplus, __xminus);
}
#endif
// Helper function for char
template <class _OutputIter>
_OutputIter _STLP_CALL
__put_integer(char* __buf, char* __iend, _OutputIter __s,
ios_base& __f, ios_base::fmtflags __flags, char __fill) {
char __grpbuf[64];
ptrdiff_t __len = __iend - __buf;
// const numpunct<char>& __np = use_facet<numpunct<char> >(__f.getloc());
// const string& __grouping = __np.grouping();
const numpunct<char>& __np = *__STATIC_CAST(const numpunct<char>*, __f._M_numpunct_facet());
const string& __grouping = __f._M_grouping();
if (!__grouping.empty()) {
int __basechars;
if (__flags & ios_base::showbase)
switch (__flags & ios_base::basefield) {
case ios_base::hex: __basechars = 2; break;
case ios_base::oct: __basechars = 1; break;
default: __basechars = 0;
}
else
__basechars = 0;
// make sure there is room at the end of the buffer
// we pass to __insert_grouping
copy(__buf, __iend, (char *) __grpbuf);
__buf = __grpbuf;
__iend = __grpbuf + __len;
__len = __insert_grouping(__buf, __iend, __grouping, __np.thousands_sep(),
'+', '-', __basechars);
}
return __copy_integer_and_fill(__buf, __len, __s, __flags, __f.width(0), __fill, '+', '-');
}
#if defined (_STLP_LONG_LONG)
typedef _STLP_LONG_LONG __max_int_t;
typedef unsigned _STLP_LONG_LONG __umax_int_t;
#else
typedef long __max_int_t;
typedef unsigned long __umax_int_t;
#endif
_STLP_DECLSPEC const char* _STLP_CALL __hex_char_table_lo();
_STLP_DECLSPEC const char* _STLP_CALL __hex_char_table_hi();
template <class _Integer>
inline char* _STLP_CALL
__write_decimal_backward(char* __ptr, _Integer __x, ios_base::fmtflags __flags, const __true_type& /* is_signed */) {
const bool __negative = __x < 0 ;
__max_int_t __temp = __x;
__umax_int_t __utemp = __negative?-__temp:__temp;
for (; __utemp != 0; __utemp /= 10)
*--__ptr = (char)((int)(__utemp % 10) + '0');
// put sign if needed or requested
if (__negative)
*--__ptr = '-';
else if (__flags & ios_base::showpos)
*--__ptr = '+';
return __ptr;
}
template <class _Integer>
inline char* _STLP_CALL
__write_decimal_backward(char* __ptr, _Integer __x, ios_base::fmtflags __flags, const __false_type& /* is_signed */) {
for (; __x != 0; __x /= 10)
*--__ptr = (char)((int)(__x % 10) + '0');
// put sign if requested
if (__flags & ios_base::showpos)
*--__ptr = '+';
return __ptr;
}
template <class _Integer>
char* _STLP_CALL
__write_integer_backward(char* __buf, ios_base::fmtflags __flags, _Integer __x) {
char* __ptr = __buf;
if (__x == 0) {
*--__ptr = '0';
if ((__flags & ios_base::showpos) && ((__flags & (ios_base::oct | ios_base::hex)) == 0))
*--__ptr = '+';
// oct or hex base shall not be added to the 0 value (see '#' flag in C formating strings)
}
else {
switch (__flags & ios_base::basefield) {
case ios_base::oct:
{
__umax_int_t __temp = __x;
// if the size of integer is less than 8, clear upper part
if ( sizeof(__x) < 8 && sizeof(__umax_int_t) >= 8 )
__temp &= 0xFFFFFFFF;
for (; __temp != 0; __temp >>=3)
*--__ptr = (char)((((unsigned)__temp)& 0x7) + '0');
// put leading '0' if showbase is set
if (__flags & ios_base::showbase)
*--__ptr = '0';
}
break;
case ios_base::hex:
{
const char* __table_ptr = (__flags & ios_base::uppercase) ?
__hex_char_table_hi() : __hex_char_table_lo();
__umax_int_t __temp = __x;
// if the size of integer is less than 8, clear upper part
if ( sizeof(__x) < 8 && sizeof(__umax_int_t) >= 8 )
__temp &= 0xFFFFFFFF;
for (; __temp != 0; __temp >>=4)
*--__ptr = __table_ptr[((unsigned)__temp & 0xF)];
if (__flags & ios_base::showbase) {
*--__ptr = __table_ptr[16];
*--__ptr = '0';
}
}
break;
//case ios_base::dec:
default:
{
#if defined(__HP_aCC) && (__HP_aCC == 1)
bool _IsSigned = !((_Integer)-1 > 0);
if (_IsSigned)
__ptr = __write_decimal_backward(__ptr, __x, __flags, __true_type() );
else
__ptr = __write_decimal_backward(__ptr, __x, __flags, __false_type() );
#else
typedef typename __bool2type<numeric_limits<_Integer>::is_signed>::_Ret _IsSigned;
__ptr = __write_decimal_backward(__ptr, __x, __flags, _IsSigned());
#endif
}
break;
}
}
// return pointer to beginning of the string
return __ptr;
}
template <class _CharT, class _OutputIter, class _Integer>
_OutputIter _STLP_CALL
__do_put_integer(_OutputIter __s, ios_base& __f, _CharT __fill, _Integer __x) {
// buffer size = number of bytes * number of digit necessary in the smallest Standard base (base 8, 3 digits/byte)
// plus the longest base representation '0x'
// Do not use __buf_size to define __buf static buffer, some compilers (HP aCC) do not accept const variable as
// the specification of a static buffer size.
char __buf[sizeof(_Integer) * 3 + 2];
const ptrdiff_t __buf_size = sizeof(__buf) / sizeof(char);
ios_base::fmtflags __flags = __f.flags();
char* __ibeg = __write_integer_backward((char*)__buf+__buf_size, __flags, __x);
return __put_integer(__ibeg, (char*)__buf+__buf_size, __s, __f, __flags, __fill);
}
_STLP_MOVE_TO_STD_NAMESPACE
//
// num_put<>
//
#if (_STLP_STATIC_TEMPLATE_DATA > 0)
# if !defined (__BORLANDC__)
template <class _CharT, class _OutputIterator>
locale::id num_put<_CharT, _OutputIterator>::id;
# endif
# if (defined (__CYGWIN__) || defined (__MINGW32__)) && \
defined (_STLP_USE_DYNAMIC_LIB) && !defined (__BUILDING_STLPORT)
/*
* Under cygwin, when STLport is used as a shared library, the id needs
* to be specified as imported otherwise they will be duplicated in the
* calling executable.
*/
template <>
_STLP_DECLSPEC locale::id num_put<char, ostreambuf_iterator<char, char_traits<char> > >::id;
/*
template <>
_STLP_DECLSPEC locale::id num_put<char, char*>::id;
*/
# if !defined (_STLP_NO_WCHAR_T)
template <>
_STLP_DECLSPEC locale::id num_put<wchar_t, ostreambuf_iterator<wchar_t, char_traits<wchar_t> > >::id;
/*
template <>
_STLP_DECLSPEC locale::id num_put<wchar_t, wchar_t*>::id;
*/
# endif
# endif /* __CYGWIN__ && _STLP_USE_DYNAMIC_LIB */
#else /* ( _STLP_STATIC_TEMPLATE_DATA > 0 ) */
//typedef num_put<char, char*> num_put_char;
typedef num_put<char, ostreambuf_iterator<char, char_traits<char> > > num_put_char_2;
//__DECLARE_INSTANCE(locale::id, num_put_char::id, );
__DECLARE_INSTANCE(locale::id, num_put_char_2::id, );
# if !defined (_STLP_NO_WCHAR_T)
//typedef num_put<wchar_t, wchar_t*> num_put_wchar_t;
typedef num_put<wchar_t, ostreambuf_iterator<wchar_t, char_traits<wchar_t> > > num_put_wchar_t_2;
//__DECLARE_INSTANCE(locale::id, num_put_wchar_t::id, );
__DECLARE_INSTANCE(locale::id, num_put_wchar_t_2::id, );
# endif
#endif /* ( _STLP_STATIC_TEMPLATE_DATA > 0 ) */
// issue 118
#if !defined (_STLP_NO_BOOL)
template <class _CharT, class _OutputIter>
_OutputIter
num_put<_CharT, _OutputIter>::do_put(_OutputIter __s, ios_base& __f,
char_type __fill, bool __val) const {
if (!(__f.flags() & ios_base::boolalpha))
return this->do_put(__s, __f, __fill, __STATIC_CAST(long,__val));
locale __loc = __f.getloc();
// typedef numpunct<_CharT> _Punct;
// const _Punct& __np = use_facet<_Punct>(__loc);
const numpunct<_CharT>& __np = *__STATIC_CAST(const numpunct<_CharT>*, __f._M_numpunct_facet());
basic_string<_CharT> __str = __val ? __np.truename() : __np.falsename();
// Reuse __copy_integer_and_fill. Since internal padding makes no
// sense for bool, though, make sure we use something else instead.
// The last two argument to __copy_integer_and_fill are dummies.
ios_base::fmtflags __flags = __f.flags();
if ((__flags & ios_base::adjustfield) == ios_base::internal)
__flags = (__flags & ~ios_base::adjustfield) | ios_base::right;
return _STLP_PRIV __copy_integer_and_fill(__str.c_str(), __str.size(), __s,
__flags, __f.width(0), __fill,
(_CharT) 0, (_CharT) 0);
}
#endif
template <class _CharT, class _OutputIter>
_OutputIter
num_put<_CharT, _OutputIter>::do_put(_OutputIter __s, ios_base& __f, _CharT __fill,
long __val) const
{ return _STLP_PRIV __do_put_integer(__s, __f, __fill, __val); }
template <class _CharT, class _OutputIter>
_OutputIter
num_put<_CharT, _OutputIter>::do_put(_OutputIter __s, ios_base& __f, _CharT __fill,
unsigned long __val) const
{ return _STLP_PRIV __do_put_integer(__s, __f, __fill, __val); }
template <class _CharT, class _OutputIter>
_OutputIter
num_put<_CharT, _OutputIter>::do_put(_OutputIter __s, ios_base& __f, _CharT __fill,
double __val) const
{ return _STLP_PRIV __do_put_float(__s, __f, __fill, __val); }
#if !defined (_STLP_NO_LONG_DOUBLE)
template <class _CharT, class _OutputIter>
_OutputIter
num_put<_CharT, _OutputIter>::do_put(_OutputIter __s, ios_base& __f, _CharT __fill,
long double __val) const
{ return _STLP_PRIV __do_put_float(__s, __f, __fill, __val); }
#endif
#if defined (_STLP_LONG_LONG)
template <class _CharT, class _OutputIter>
_OutputIter
num_put<_CharT, _OutputIter>::do_put(_OutputIter __s, ios_base& __f, _CharT __fill,
_STLP_LONG_LONG __val) const
{ return _STLP_PRIV __do_put_integer(__s, __f, __fill, __val); }
template <class _CharT, class _OutputIter>
_OutputIter
num_put<_CharT, _OutputIter>::do_put(_OutputIter __s, ios_base& __f, _CharT __fill,
unsigned _STLP_LONG_LONG __val) const
{ return _STLP_PRIV __do_put_integer(__s, __f, __fill, __val); }
#endif /* _STLP_LONG_LONG */
// lib.facet.num.put.virtuals "12 For conversion from void* the specifier is %p."
template <class _CharT, class _OutputIter>
_OutputIter
num_put<_CharT, _OutputIter>::do_put(_OutputIter __s, ios_base& __f, _CharT /*__fill*/,
const void* __val) const {
const ctype<_CharT>& __c_type = *__STATIC_CAST(const ctype<_CharT>*, __f._M_ctype_facet());
ios_base::fmtflags __save_flags = __f.flags();
__f.setf(ios_base::hex, ios_base::basefield);
__f.setf(ios_base::showbase);
__f.setf(ios_base::internal, ios_base::adjustfield);
__f.width((sizeof(void*) * 2) + 2); // digits in pointer type plus '0x' prefix
# if defined(_STLP_LONG_LONG) && !defined(__MRC__) //*ty 11/24/2001 - MrCpp can not cast from void* to long long
_OutputIter result = this->do_put(__s, __f, __c_type.widen('0'), __REINTERPRET_CAST(unsigned _STLP_LONG_LONG,__val));
# else
_OutputIter result = this->do_put(__s, __f, __c_type.widen('0'), __REINTERPRET_CAST(unsigned long,__val));
# endif
__f.flags(__save_flags);
return result;
}
_STLP_END_NAMESPACE
#endif /* _STLP_NUM_PUT_C */
// Local Variables:
// mode:C++
// End:
|
List of ambassadors of China to Belgium
The Chinese ambassador to Belgium is the official representative of the government of China to the government of Belgium.
From 1973 to 2005 the Chinese ambassador in Brussels was also accredited to the European Community.
List of Representatives
References
Ministry of Foreign Affairs of the People's Republic of China'', Chinese Ambassadors to Belgium, 驻比利时王国历任大使 </ref>
Belgium
China |
Q:
Storing a String array in the SharedPreferences
I was wondering if it could be possible to save in the shared preferences an array of Strings, in a way that, every time we save a certain String, we store it in that array.
For example I have a list of locations with a certain ID that I want to mark as favorite.
The ideal situation would be, having an array and saving a certain location ID (let's call it Location1) in that array, so next time I want to mark a new location as favorite (let's call it Location2), I retrieve that array (which so far contains Location1) and add the ID of this new location I want to add (Location2).
Android has methods to store primitive objects, but not for arrays.
Any idea in order to do this, please?
A:
This is doable: I was just blogging about it:
SAVE YOUR ARRAY
//String array[]
//SharedPreferences prefs
Editor edit = prefs.edit();
edit.putInt("array_size", array.length);
for(int i=0;i<array.length; i++)
edit.putString("array_" + i, array[i]);
edit.commit();
RETRIEVE YOUR ARRAY
int size = prefs.getInt("array_size", 0);
array = new String[size];
for(int i=0; i<size; i++)
prefs.getString("array_" + i, null);
Just wrote that so there might be typos.
A:
You could make the array a JSON array and then store it like this:
SharedPreferences settings = getSharedPreferences("SETTINGS KEY", 0);
SharedPreferences.Editor editor = settings.edit();
JSONArray jArray = new JSONArray();
try {
jArray.put(id);
} catch (JSONException e) {
e.printStackTrace();
}
editor.putString("jArray", jArray.toString());
editor.commit();
You can then get the array like this:
SharedPreferences settings = getSharedPreferences("SETTINGS KEY", 0);
try {
JSONArray jArray = new JSONArray(settings.getString("jArray", ""));
} catch (JSONException e) {
e.printStackTrace();
}
Just an alternative solution that I have used in the past
A:
Write methods to read and write a serialized array. This shouldn't be too difficult. Just flatten the array of strings into a single string that you store in the preferences. Another option would be to convert the array into an XML structure that you then store in the preferences, but that is probably overkill.
|
Igor Muradyan
Igor Muradyan (; 29 April 1957 – 17 June 2018) was an Armenian political activist and politologist. He was one of the earliest leaders of the Karabakh movement, along with
Zori Balayan, Silva Kaputikyan and Viktor Hambardzumyan.
Born in Odessa, Muradyan grew up in Baku, where many Armenians lived during the Soviet period. He finished the Plekhanov Institute of National Economy in Moscow. According to Thomas de Waal, "Muradian was a Soviet insider. He worked as an economist in the state planning agency Gosplan in Yerevan and had good connections among Party cadres."
Muradyan was later critical of the Nagorno-Karabakh authorities, calling the unrecognised Nagorno-Karabakh Republic "a failed experiment" and criticising its authorities for not being able to come up with a clear strategy for its existence and arguing for Nagorno-Karabakh's incorporation into Armenia.
References
External links
Category:Armenian activists
Category:People from the Republic of Artsakh
Category:1957 births
Category:Azerbaijani Armenians
Category:2018 deaths
Category:Armenian political scientists
Category:Members of the Karabakh Committee |
Move max distance you can and measure how long they actually moved, then recalculate the steps.IE if you have 100 steps/mm and you set it to move 10mm and it only moved 8 then you need more steps/mm(100/8)*10 = new steps/mm
Np, You can find my facebook group here, if you like. It's a bit easier talking there :) https://www.facebook.com/betrue3d/Cheers
I cant remember how I came to it, but I think I read somehwere that a huge amount of steps was needed, so I entered a very high number, but you calculate it the same way. It's the drive from a floppy drive, hence the difference.Ie start with 6000 or something and see :)
The Micro SD is not meant to store .gcode files on an print, unless you upload files to it through terminal or lan, which are rather flaky on this.You use SD card reader in TFT or similar or print via USB.
Heya LarryThanks.1) Yes, if they have same voltage.2) You copy the setup for the fan you use but just specify the new pin. If you only have one extruder as most people, the extruder 2 pin is free P2.63) http://smoothieware.org/3d-printer-guide#using-two-steppers-motor-on-a-single-driverHope it helps :)
If you want access to your network from some other network, you always need to setup your router to portforward the necesary ports as well as setup firewall in your router (not all routers announce them as seperate functions).Everything can be viewed remotely this way. Always. Just a matter of configuring the network.MAC: you might need mac versions of the programs, but don't see why not.Just keep in mind that this instructables contains ALL steps, and you might not need all steps for your particular setup.Maybe take a look at Astroprint. I like that way more than OctoPrint :)
The things you mention are not electronic words or anything.. have you tried googling the words?Protrusion = Something that protudes from something.Washers = round flat metal discs with hole in the middle for your screw.Mount holes = the holes you use to mount/attach the partsYou really just need to make prepare the moving part so you can attach things to it. Flatten/cut away as necessary, and drill holes you might need.Try look in here, as they made a nice manual. You can use their info even though you don't print the parts as they do.https://www.thingiverse.com/thing:902826
When you say internet, do you mean your local wireless network?You don't have to have it on internet. I don't know how you woud controll it without having it on your local network.You can't use USB or SD in your printer? That would be the best option if you don't use the remote options in Octoprint in any case.
Have you tried using Google?https://www.google.dk/search?q=3d+printer+solid+state+relay&oq=3D+printer+solid+stateBut here's a thread:http://www.soliforum.com/topic/9004/sd4-heatbed-installation/I'm a bit confused as you say the hotbed output gives 110VAC... the hotebed does not provide any output. You can say how much Wattage it is rated at and what voltage it needs. This will give you the amperage your PSU at least needs to be + 20%Why do you need 5v to activate it the bed/SSR? It's easier just to use the bed output.Hope it helps.Cheers
For the heater problem you propably need to define your heater 2 with the correct pins - meaning other pins than you use for heater 1.After you have defined the pins correctly, you should do the mandatory PID tuning of the heater :)
I'm actually not sure, but I have been asked this before.I personally used an external driver board and driver connected to the pins on the driver I wanted to "clone". This way they are given the exact same instructions.
Without jumpers means you run without microstepping.If you insert all 3 jumpers it might not move at all at untill you modify steps/mm since it means 1/16 microstepping. If you use the jumpers and modify the steps you are going to get a much smoother and quieter result. The torque is also going to be a tad less, but nothing you should be able to notice on a 3D printer.What is your steps/mm now?
Hello entropy,You just solder all pins on. Regardless of jumpersettings.Jumpers depends on multistepping settings you want to achieve. I've corrected the jumper table. It had lost it formating for some reason.I recommend having all 3 jumpers in place to use highest microstepping.CNC people are going to say you should run wiht lowest multistepping as possible for greatest power, but 3D printer is not a CNC, and we want the smoother running -> lower noice while the power is still plenty for any 3D Printer.jumper Yes/No step size1 2 3no no no full stepyes no no half stepno yes no 1/4 stepyes yes no 1/8 stepyes yes yes 1/16 step
Here are a couple of explanatatory pages:https://www.circuitspecialists.com/blog/unipolar-stepper-motor-vs-bipolar-stepper-motors/andhttps://www.quora.com/What-is-the-difference-between-bipolar-unipolar-stepper-motorBut really, you just want bipolar motors.I don't know what "idk" means. We are from many different countries, so using abbreviations often ruins the understanding between us. Same with "plz", which _I_ know means please, but again... abbreviations are bad, especially made up ones :) I don't know what you mean with "chopping constant durrent drive"?Id say that you should find a different motor, if it doesn't work using an a4988 driver :)
Nice find! I havn't had this issue myself, so quite odd. Your firmware is much newer than when I used Marlin though, so it might have changed.If you have the energy to do so, you should report it on the Github site for Marlin.
Have you tried with different Gcode files? Made sure the baudrate is the same on display and in firmware? (It must be since you can move it, but just to be sure).Try updating firmware on both.The MKS Base 1.5 is not smoothieware but normal 8bit marlinhttps://www.aliexpress.com/store/product/3D-Printer-Control-motherboard-MKS-BASE-V1-0-compatible-RAMPS-1-4-Printer-Control-Reprap-MendelPrusa/1047297_2031109769.htmlNewest 32bit Smoothiewaere is MKS Sbase 1,3 https://www.aliexpress.com/store/product/3Dpriter-control-board-MKS-SBase-V1-0-32-s-Motherboard-compatible-Smoothieware-open-source-firmware-support/1047297_32384368763.htmlNotice how smoothieware is Sbase, and the other is BaseRegards,MortenDenmark
Hello CharleWThank you for your feedback. In order to use the LCD12864 you need to scroll down in the configuration.h file and uncomment the:REPRAP_DISCOUNT_FULL_GRAPHIC_SMART_CONTROLLERIt is not:REPRAP_DISCOUNT_SMART_CONTROLLERYou can get more info on your LCD here:http://reprap.org/wiki/RepRapDiscount_Full_Graphic_Smart_ControllerHope it helps
Heya mshievitz. It's stable now? Asking as I played a bit with it (not overly much), but had some issues with the fans I use to cool the printed objects.Can't rule out wheter it was just the fans though :)Nice input :)
Hello HIM,I do not own an MKS Gen 1,4 board.You are welcome to contact MKS and ask for it, as they might want me to make an instructables, if enough people are asking for it.The Gen 1,4 is working as Ramps 1.4 but with a bit different layout.
It's much cheaper to buy directly from the manufacturer. Even though you have to pay import taxes and vat etc.But we have a few sellers in Denmark. I don't know about their shipping policy or pricing though.http://3deksperten.dk/mks-sbase-v1-3-controller-board-mainboard-32bit.htmlRegards,Morten
I have no experience using smoothieware on corexy, but I guess it should work fine.I do not know if second homing works differently on CoreXY. Is it important for you it moves out and back in?Firmware from makerbase.com is just a really old version of the original firmware, so I'll not recommend using that.I'll recommend you go back to new firmware and check your endstops are working.Reason for the "noise from steppers untill reset" is because they are powered on. You can issue the Gcode M18 http://reprap.org/wiki/G-code#M18:_Disable_all_stepper_motors to turn motors off. This will remove the noise and make steppers easy to move.You should not move the steppers/axes manually with motors engaged. Worst case you can ruin the drivers on the controller board.
Win_install.cmd is only if you want to compile your own firmware - we don't want to do that. At least not in my instructables, where we use the pre-compiled firmware.bin filesNot entirely sure what you mean about config file, but I think you have misunderstodd how the firmware works.1) You do not want/need to use the win_install.cmd to compile your own firmware.2) You copy over the firmware.bin file from smoothiewares github (I link directly to it)3) You copy over your config.txt file4) You power off - including remove USB.5) Reconnect USB and the card flashes (reads) the firmware to the card.6) The firmware.bin file is automatically renamed firmware.curRegarding 12v. Might be because your 5v through USB isn't high enough amperage.
Edited the section regarding drivers and firmware in an attempt to make it more clear to use MKS drivers and firmware from Smoothieware.I removed some links directed at MKS, as they removed the info I linked to. They have changed some on their Github, but I'm trying to find out why and what. (asking them)Remember the "nice comment policy" people. In the past days we have had an unfortunate individual trolling in here, which is rather sad all considering.
I'm not attacking Smoothieware. I'm PROMOTING smoothieware. FOR FREE.What I am doing is helping people for free. Doing your work. For Free. I'm stating facts about the unfriendly tone of your Google groups, as thousands of people see them (gathered from all the countless messages I recieve).It's ok you view it differently, since you have promoted that kind of environment.Just please do not come over here, and ruin the good mood.In this forum, we try to HELP each other. Not Critize each other.
Regarding your "document".. I can put together an endless list of pointless attacks you have made, here, on your own foras, github and especially on the reprap forums.. but I try to focus on furthering the community, not hammering anyone.Yes, I can get carried away now and then, I am humand, and this is not my work, so my work cap is not on... but I do not go search for people to annoy.. like you do here.Can't you see how bad it is you come here like this Arthur? I'm freaking trying to promote Smoothieware, but you, as the people who has most to gain, work very actively to destroy it by being so darned negative.
You know you can save as draft and then publish it all when you are done?Reprap.me, the maker of the Original Diamond Hotend, are working on a 5way Diamond Hotend now. Just to answer @Tengo10Heatsinks not being properly prepared on this photo, but the Diamond tip is :)
I have crimped my own motor wires. I usually start using a needle-clamp (I think it's called that. I'm danish). I then use a very cheap crimp tool I bought in Biltema (Scandinavian store). But it's the same as any cheap crimp tool you can buy anywhere. Sometimes tweak it with my needle-plier after crimping to make it fit into the plugs.
Hello Googliola. I believe you can run must of the gpio pins as pwn though not as true "hpwm" setting? Just a thought?I really do not know about the on off stuff. I always turn my printer physically on/off, and it sounds like you are more at home with the configuration than me ?I'm sure you can ask on smoothies google groups on how to use it. They might have an idea. Just don't start out with "hi, I'm using MKS Sbase board..." ?
problem is that for most people it is much easier to setup using a graphical interface.If all else fails, go check out Astroprint. I vastly prefer that one over Octoprint as well, since it was made for normal people, and with focus on intuitive usage and not geekstuff over useability like Octoprint.
Hello Kanataa.You are correct, I do have an Ultimaker where it homes to the bottom, meaning to MAX.The way to fault find is:1) Connect using Pronterface 2) Check endstop status by issuing M119. Correct firmware if necessary.3) Check your Z moves the desired direction when you hit the move buttons. + = bed moves away from nozzle.4) Adjust firmware if needed to correct direction of move.5) Be ready to turn off power and then hit Z-home - G28 Z06) If it moves the wrong way, check that Z-min is 0 and Z max is 200 (or what your max is)7) try again.I have written 2 Instructables about <a href="https://www.instructables.com/id/Motion-Configurati... target="_blank">Motion Configuration</a> and <a href="https://www.instructables.com/id/Configuring-Endsto... tar...
Hello Kanataa.You are correct, I do have an Ultimaker where it homes to the bottom, meaning to MAX.The way to fault find is:1) Connect using Pronterface 2) Check endstop status by issuing M119. Correct firmware if necessary.3) Check your Z moves the desired direction when you hit the move buttons. + = bed moves away from nozzle.4) Adjust firmware if needed to correct direction of move.5) Be ready to turn off power and then hit Z-home - G28 Z06) If it moves the wrong way, check that Z-min is 0 and Z max is 200 (or what your max is)7) try again.I have written 2 Instructables about <a href="https://www.instructables.com/id/Motion-Configurati... target="_blank">Motion Configuration</a> and <a href="https://www.instructables.com/id/Configuring-Endsto... target="_blank">Configuring endstops</a> which you might find helpful.You can ofcourse also write here :)
Thank you for your nice words.I'm sorry I really don't have any ideas other than Googling, and I think it's better you do your own googling :)If you have the option to hook up the pi to a monitor and keyboard it will make it easier for you?Cheers,Morten
I'd try to contact the seller. I am not MKS or even an affiliate. I just write Instructables for topics I find interesting :)
Ok. That might be nice for some people :)I havn't seen any officially supported firmwares on the smoothieboard platform. I'm just personally loath to get firmware with only partial support.I used Marlin for a long time and never was a fan. Just too messy, and the whole compile procedure alone was enough for me to dump it :)I make lots of changes all the time though, which most people don't do.I'm going to jump on the Duet Wifi soon. Just waiting to recieve the Duex5 expansion board to go with Diamond hotend 5way prototype <wink>
Awesome info HaydnH.It can't be fixed by setting segment size to very small in firmware? (I havn't read up on it)
Awesome. Glad you found the problem. I've been rather busy with my new Extruder http://www.thingiverse.com/thing:1914288 , so havn't had time to look it up myself.I must admit I'm totally at a loss when people say "pull-up" but I know you can shift a jumper to decide wheter the voltage on endstops are 3.3 or 5v
If it is S3D I think you should contact them. It is a paid commercial product so they might be able to help some.I would test using Cura or other slizer first though. Cura 2.3 have a lot of awesome changes from previous versions, so you might be surprised :)
Firstly: Thank you for interest and feedback. Always nice hearing from people using the instructables. :)Could you copy/paste your section with the temperature settings from your config file please?I would like to see the pin-assignments for the sensors.Which client program do you use for issuing Gcodes? I prefer Pronterface as it loads really fast, so nice for troubleshooting.
I'm just using the config I list through my instructables. I use Cura 2.3 and no custom settings really.
Shouldn't get too hot with fan on. I have mine under my cabinet case and it's just passively cooled with some air getting through 1cm gap under the casing.I have 0.85v on my XY, so yours shouldn't get too hot.. tried with different prints over 2 hours?
No. You can only use Smoothieware on it, but if it freezes over 1-2 hours and it's doing it for more than just 1 file, I bet it is due to overheating.Have you tried measuring heat off the drivers or around the board? What is your voltage on drivers?Maybe the controller is placed inside the printer and gets hot?
If my previous reply (from today/just now) doesn't pan out.. or maybe just start by doing it: contact MKS and/or the seller about the issue.. if it's hardware issue you want to let them know as soon as possible.
Great. Glad it worked out :) I just googled it some and can see various people have experienced the same. Some from bad SD cards instead though.
Don't worry about pronterface yet.Firstly please answer the first question as I can't track down faults with no information.Also please try the SD formatter I linked to. Windows and other OSs tends to mess up cardsWhich 2 files do you put on the SD card? You need to put on:firmware.bin andconfig.txtAfter you power printer off and on (also remove usb cable) you should have:firmware.curconfig.txtRegarding pronterface:Don't bother trying to connect untill you have the right files on the SD card as you just can't.Remember to specify the right COM port and BAUD rate.Does the Sbase show up as a com port when you connect it, and have you installed the windows drivers?
I don't understand the difference between "FIRMWARE.CUR" and "firmware.cur" aside from you using capital letters?You want to use the firmware from Smoothieware and not from MKS:https://github.com/Smoothieware/SmoothiewareI use nightly build (edge) but you might want to use stable untill you know it works for you.http://triffid-hunter.no-ip.info/Smoothie.html
Try using https://www.sdcard.org/downloads/formatter_4/ to format the card.Which 2 files do you put on the SD card? You need to put on:firmware.bin andconfig.txtAfter you power printer off and on (also remove usb cable) you should have:firmware.curconfig.txtHope it helps |
#add_subdirectory(cartesian)
add_subdirectory(noncartesian)
|
note cards/greeting cardsLetter writing is becoming a lost art. These beautiful blank cards will inspire you to revive that antique way of communication. Receiving a hand-written note will always brighten your day. |
Over-expression of FRZB in gastric cancer cell suppresses proliferation and induces differentiation.
Frizzled motif associated with bone development (FRZB) was a member of secreted frizzled related proteins (sFRPs) family. Previous evidences showed that FRZB played role in embryogenesis and diseases such as osteoarthritis and prostate cancer. The purpose of our study is to clarify the role of FRZB in gastric cancer cell proliferation and differentiation. The expression of FRZB in gastric cancer tissues were detected by immunohistochemistry. The expression of FRZB in eight gastric cancer cell lines and one immortal gastric epithelial cell GES-1 were detected by western blotting and real-time quantitative PCR. To investigate the role of over-expressed FRZB in gastric cancer cells, FRZB/pcDNA3.1 plasmid was constructed and transfected into gastric cancer cell line SGC7901. The changes of biological features in these stable transfectants were examined. FRZB was highly expressed in gastric cancer (90%), intestinal metaplasia (100%) and gastric dysplasia (90%), but no or just weakly (3/40) expressed in normal gastric mucosa. FRZB staining was stronger in intestinal-type gastric cancer tissues than that in diffuse-type ones and was positive correlated with differentiation grade. The expression of FRZB in eight gastric cancer cell lines was higher than in GES-1. Over-expressed FRZB inhibited cell proliferation in vitro and in vivo which was first caused by prolonged cell division progression in G2/M phase, and second by higher sensitivity to apoptotic inducing factors and spontaneous apoptosis. Our findings gave evidences that FRZB suppressed gastric cancer cell proliferation and modulated the balance between proliferation and differentiation in gastric cancer. |
1. Field of the Invention
This invention relates to a system and method for molding parts, and more particularly, a system and method for molding parts from contaminated molding materials using a single thermal heat rise.
2. Description of Related Art
In the field of thermoplastic molding, it is common to mold parts using either an injection or compression molding process. Due to the size of the orifices used in the injection molding equipment, it is often difficult to injection mold with reinforcing fibers, such as glass fibers, having a length over one-eighth inch because such fibers are not easily injected into or conveyed through the injection mold equipment. In addition, it is difficult to use contaminated molding materials such as those collected in plastics recycling programs unless they have been substantially cleaned, processed and put into a usable form and size prior to being used in the injection molding equipment. Such cleaning and processing are expensive and can substantially increase the cost of using the contaminated materials, thereby making them economically impractical.
Another problem with the thermoplastic processes of the past is that the thermoplastics become degraded and lose, for example, their strength when exposed to multiple heat rises.
In general, there are two basic types of compression molding processes which may be used for molding thermoplastics. First, a sheet molding process involves placing a reinforcement, such as a glass mat, between sandwiching layers of a thermoplastic and heating the materials to produce a single sheet of material. The single sheet of material is then cut to the desired size and then reheated to molding temperature before being placed in a compression molding press. This process has the disadvantage of higher cost because of the apparatus required, the material handling costs incurred in making the sheet, handling and cutting the sheet, and the like. The material used to make the sheet is also subject to three thermodynamic cycles, a first cycle when the thermoplastic sheet is formed, a second cycle when the thermoplastic sheets and glass mat are molded together, and a third cycle when the resulting sheet is heated to molten temperature prior to molding the part.
The second form of thermoplastic compression is bulk molding compounds by producing a billet of molten material that is placed into a compression molding press which molds the molten material into a part. Effectively placing and distributing long reinforcing fibers in the billet has heretofore required complex machinery. For example, U.S. Pat. No. 5,165,941 issued to Ronald C. Hawley on Nov. 24, 1992, discloses an extruder apparatus and process for compounding thermoplastic resin and fibers. The Hawley extruder includes an apparatus for compounding thermoplastic resin and reinforcing fibers incorporating a resin extruder in which thermoplastic resin pellets are melted in a second, compounding, extruder in which the molten thermoplastic resin is mixed in intimate contact with long reinforcing fibers. The melted thermoplastic resin is not fed into the device with the fibers, but rather is introduced into the compounding extruder at a point downstream of the inlet point for reinforcing fibers, so that the fibers are mechanically worked and heated before coming into contact with heated, molten thermoplastic resins.
The Hawley device generally suffers from complexity that raises the investment and maintenance costs.
The compression molding of products using polymeric material and glass fibers has traditionally produced a material referred to as fiber glass reinforced plastic. This material exhibits characteristics better than the reinforced plastics, but does not exhibit strength, elasticity or impact resistance comparable to thermoplastic materials which are specifically designed to exhibit these characteristics. Most fiberglass reinforced plastic currently in the market is thermoset and is essentially a solidified mixture of fiber glass and plastic without benefit of chemical bonding or specific methods of enhancing polymer entrapment of the glass fibers because the glass fibers are merely immobilized in the resin in which it is embodied.
In addition, thermoset materials are generally not recyclable other than as filler materials, while thermoplastic materials can be remelted and remolded.
In the field of molded parts, many products are currently made from a variety of materials using moldable plastic. In the sporting goods field for example, bicycles, basketball backboards, toy vehicles and the like are commonly produced using multiple plastic materials. Compression molding has been a common method for producing basketball backboards and related parts of basketball goal assemblies, such as the support pull for the basketball backboard for many years. Heretofore, compression molding of basketball backboards and related parts has typically been limited to thermoset materials, which is characterized by placement of a cold charge in a compression mold. Thermoset process materials have certain drawbacks, including the fact that these material are generally not recyclable other than as filler materials. In general, there are two basic types of compression molding processes which may be used for molding thermoplastics. The following description of these two processes outline some of the difficulties that have prevented use of compression molding thermoplastics in the basketball goal assembly field.
The first type is a sheet molding process that involves a reinforcement, such as a glass mat, between sandwiching layers of a thermoplastic and heating the materials to produce a single sheet of material. The single sheet of material is then cut to the desired size and then reheated to molding temperature before being placed in a compression molding press. This process has the disadvantage of higher cost because of the apparatus required, the material handling cost incurred in making the sheet, handling and cutting the sheet, and the like. The material used to make the sheet is also subject to three thermodynamic cycles, a first cycle when the thermoplastic sheet is formed, a second cycle when the thermoplastic sheets and glass mat are molded together, and a third cycle when the resulting sheet is heated to molted temperature before molding the part.
A second form of thermoplastic compression is bulk molding compounds by producing a billet of molten material that is placed into a compression molding press which molds the molten material into a part. Effectively, placing and distributing long reinforcing fibers in the billet has heretofore required complex machinery as discussed in detail in parent application Ser. No. 08/220,906, now issued as U.S. Pat. No. 5,591,384.
In addition, in recent years it has been increasingly common to provide graphics on the front face of molded parts, including the backboard, for a variety of reasons, such as aesthetic appeal to the consumer, product and source identification, and the like. However, the only commercially acceptable method of applying graphics have been silk-screened with inks or by applying decals.
Silk-screening is time consuming and tends to fade after prolonged exposure to sunlight and the elements. Decals are also expensive and can peel off after time.
An example of a prior art basketball backboard with silk-screen graphics is a backboard sold as xe2x80x9cShurShotxe2x80x9d. The silk-screen ShurShot backboard is believed to be about 48 inches across and mates a structurally foam polystyrene molded in a multiple-port injection process. The backboard is molded in the natural color of polystyrene, which is milky white. The entire ShurShot backboard is subsequently spray painted both to seal the polystyrene and to protect the backboard from ultraviolet radiation. Finally, graphics are silk-screened on the front face of the backboard.
In some prior art applications, a graphics display was printed on a styrene sheet and laid by hand into a mold for forming the backboard. Alignment of the sheet was accomplished by aligning holes in the sheet on pins in the mold provided for producing the mounting holes in the backboard. Upon injecting styrene into the mold, the back portion of the graphics sheet melted to cause it to be joined to the face of the backboard. As styrene is relatively easy to print on, its use in this prior art process was conducive to the production of backboards provided with sheets having graphics printed thereon.
One of the problems encountered with printing on parts or backboards molded using the system of the parent application Ser. No. 08/220,906 was that printing on polyolefin materials was difficult because the polyolefin-based materials were relatively non-porous and, therefore, not receptive to printing inks.
What is needed, therefore, is an apparatus and method for molding thermoplastic parts which is simple and economical and which preserves the length of the reinforcing fibers, evenly distributes the reinforcing fibers or any other filler materials while maintaining flexibility of the material type in products fabricated, is capable of capitalizing on use of various contaminated thermoplastics to allow use of post consumer recycled material, and which provides a compounding and fabrication environment which promotes chemical bonding and molecular orientation to enhance the characteristics of the molded part.
The foregoing also demonstrates the need for a compression molding apparatus and method for making parts, such as sporting goods equipment including basketball backboards from recycled thermoplastic materials without requiring the extensive cleaning and processing that heretofore has made use of thermoplastics for these products in practical. There is also a need to improve the in-mold graphics process to permit the basketball backboard and other plastic molded parts of basketball goal assemblies to be compression molded with thermoplastic resin materials having improved in-molded graphics.
It is therefore a primary object of this invention to provide a method and apparatus which facilitates overcoming one or more of the aforementioned problems.
In one aspect of the invention, this invention comprises a plasticator for creating a billet of moldable material including a feeder for receiving a plurality of molding materials comprising a predetermined amount of a polyester, other carbocyclic and reinforcing fibers and a suspender coupled to said feeder for receiving the molding materials, for creating a molten suspension of the molding materials without damaging a substantial number of the reinforcing fibers, and also for creating the billet.
In one aspect of the invention, this invention comprises a plasticator for creating a billet of moldable material including a feeder for receiving a plurality of molding materials comprising a predetermined amount of a polyester, other carbocylics and reinforcing fibers, and a suspender coupled to the feeder for receiving the molding materials, for creating a molten suspension of the molding materials without damaging a substantial number of the reinforcing fibers, and also for creating the billet.
In another aspect of the invention, this invention comprises a method for creating a billet for molding a part comprising the steps of (a) loading a plasticator with molding materials, the molding materials comprising a polyester, other carbocylics and reinforcing fibers, (b) heating the molding materials to a predetermined temperature, (c) blending the molding materials in order to create a molten suspension wherein a majority of the reinforcing fibers remain generally undamaged, and (d) extruding the molten suspension in order to form a billet having preselected billet characteristics.
In yet another aspect, this invention comprises a plasticator for creating a billet from a plurality of molding materials, the plasticator comprising plasticating means for receiving the molding materials and for creating a molten suspension of the molding materials, and control means associated with the plasticating means for controlling the suspension characteristics applied to the molding materials in order to plasticity the plurality of molding materials into a billet having predetermined billet characteristics.
In still another aspect, this invention comprises a system for molding a part comprising a plasticator for creating a billet from a plurality of molding materials, the plasticator comprising plasticating means for receiving the molding materials and for creating a molten suspension of the molding materials, control means associated with the plasticating means for controlling the suspension characteristics applied to the molding materials in order to plasticity the plurality of molding materials into a billet having predetermined billet characteristics, and a press having a mold for receiving the billet and for molding the billet into the part.
In yet another aspect, this invention comprises a plasticating process comprising the steps of loading a plasticator with a plurality of molding materials, creating a mixture with the plurality of molding materials in the plasticator, and plasticating the mixture of the plurality of molding materials at a controlled temperature and pressure in order to create a billet having predetermined billet characteristics.
In a still further aspect, the invention comprises a screw for use in a plasticator having a barrel, the screw comprising a root and a plurality of threads configured to permit a polyester, other carbocylics and a plurality of reinforcing fibers to be mixed to provide a billet having predetermined billet characteristics without damaging a substantial number of the reinforcing fibers.
It is an object of this invention to provide a system and method for using long reinforcing fibers that can be loaded simultaneously along with the thermoplastics being used.
Another object is to facilitate providing a system and method which is simple and economical and which provides a process that generally preserves the length of the reinforcing fibers through the plasticating and molding process.
Another object of this invention is to provide a method and apparatus which evenly distributes any filler materials, such as reinforcing fibers, which are used in the apparatus and method.
Still another object of the invention is to provide a method and apparatus which facilitates using contaminated molding materials which have heretofore been undesirable for use because of their contamination or because they are expensive to clean sufficiently for use.
Still another object of this invention is to provide a method and apparatus which facilitates or enhances chemical bonding and molecular orientation of the polymer molding materials being used.
Yet another object is to provide a system and method for efficiently and effectively in-molding graphics into a part such as a basketball backboard or other sporting equipment.
In a still further aspect of the invention this invention comprises a plasticating process comprising the steps of loading a plasticator with a plurality of molding materials, creating a mixture with the plurality of molding materials in the plasticator, and plasticating the mixture of said plurality of molding materials at a controlled temperature and pressure in order to create a billet having predetermined billet characteristics.
In another aspect of the invention a process for molding a part comprises the steps of placing a sheet into a mold prior to molding, placing a billet onto the sheet, compression molding the sheet and the billet to produce a part such that the sheet becomes integrally molded with the part.
In another aspect of the invention a molded part comprising a compression molded part molded from a plurality of materials comprising a predetermined amount of a reinforcing fiber and thermoplastic polymers, a sheet integrally molded into said part, the sheet comprising a graphics side facing away from the part.
In still another aspect of the invention a basketball backboard comprising a backboard member molded from a plurality of materials comprising a predetermined amount of a reinforcing fiber and thermoplastic polymers, and a sheet integrally molded into the backboard member, the sheet comprising a graphics side facing away from the part.
These objects and others will be more apparent when the following description is read in conjunction with the claims and drawings. |
Mario and lawege games
Mario And Luigi Games. You searched for mario and luigi, we found the following search results from our collection of online games for you to play on. Luigi Mario games online free for kids to play, no download. Luigi Cave World 3 is a classic 2D platform game for kids, teens, and nostalgic grownups where. The first three games have the playable characters say "Nintendo!" when the game boots up (Mario and Luigi in Mario & Luigi: Superstar Saga · Mario & Luigi: Partners in Time.
Mario and lawege games Video
Evolution of Final Bosses in Mario & Luigi Games (2003-2017) Watch the game walkthrough. Super mario save luigi. He is manipulated once again when he is turned into Shrowser by the Elder Princess Shroob. The badges are part of a gauge that fills when an action command is executed well. Retrieved from " https: Super Mario Save Luigi Game Description. Partners in Time , beans are used to buy badges. Dream Teamwas announced during February 14, 's Nintendo Direct. Flash Super Mario Bros. The badges are part of a gauge bauernhof puzzle fills when an action command is executed. In battle, Mario and Luigi can attack either by using one of their basic attacks jumping or with a hammer or by using a special Bros. You need to install the Adobe Flash Player to play the game! New Best Games Best Of New. Each title has the player controlling Mario and Luigi to fight the antagonists. This game has a rating of 92 out of based on user ratings. Superstar Saga in the Action , Adventure , Arcade , Challenge , Emulator , Fighting , Funny , GBA , Mario , Miscellaneous , Platform , RPG , Skill , and Tricky gaming categories. Mario Tractor 2 Player. See our Mobile Games category for games compatible with tablet and mobile devices. When Princess Peach has traveled to the past, Princess Shroob manages to capture her, but not without Peach trapping the Elder Princess Shroob - the real leader of the shoobs - in the Cobalt Star. Super Mario Bros Star Scramble 2: Combine the power of Mario and Luigi to pull off a super special tag-team move and immerse yourself inside the bright, cartoonish, and humorous world. Much like Luigi, Baby Luigi is a more timid brother than Baby Mario. Galaxy online armor games on Social Media: Created from brewing 25 Chuckle Beans, the Chuckle Blend gives 4 SPEED to the brother that uses it. Fawful later gives Bowser a Vacuum Mushroommaking Bowser inhale everything around him, including Mario, Luigi, Princess Peach, and other characters. Bowser later reveals that he is merely using Antasma to advance his own schemes. Personal tools Not logged in Talk Contributions Create account Log in. In all games, she is kidnapped at some point. Play more games like Mario and Luigi: Enemies are encountered on the overworld, and the player can interact the enemy and enter into a battle scene. October 6, Nintendo 3DS.
Mario and lawege games - Service ist
As Bowser and Paper Bowser were arguing, Paper Bowser Jr. Paper Mario can create copies of himself to mitigate his low HP and attack multiple times at once. Although the storylines are similar to the story in game, there are multiple variations and twists. Superstar Saga , their stats elevate. When there is trouble, Mario attempts to solve the problem as quickly as he can, dragging Luigi alongside him. Grab all the coins to reveal the star. |
Acute exposure of rabbit jejunum to ethanol. In vitro uptake of hexoses.
The effect of acute exposure of rabbit jejunum to ethanol on the uptake of three hexoses was examined in vitro. With ethanol present in the preincubation medium for 30 min, or directly in the incubation medium for 6 min, glucose uptake was reduced. Kinetic analysis demonstrated that ethanol in the preincubation medium was associated with a rise in the value of the apparent Michaelis constant (Km*), whereas the inhibition of glucose uptake observed with ethanol present directly in the incubation medium was associated with a reduction in the apparent passive permeability coefficient (Pd*), a reduction in the maximal transport rate (Jdm), and an increase in Km*. When increasing concentrations of ethanol were added to the preincubation or to the incubation medium, there was a reduction in the uptake of both 1 mM and 40 mM glucose, galactose, and 3-O-methyl glucose. The addition of 40 mM galactose or 1 mM phloridzin to 40 mM glucose was associated with a 50% reduction in glucose uptake, but this uptake was not further inhibited by the addition of 6% ethanol (v/v). Similarly, the uptake of 3-O-methyl glucose was inhibited by the addition of 40 mM glucose or galactose but no further reduction in uptake was achieved by adding ethanol. Finally, galactose uptake was inhibited by adding 40 mM glucose or 40 mM 3-O-MG, but the addition of 6% ethanol was associated with no further decline in the uptake of galactose.(ABSTRACT TRUNCATED AT 250 WORDS) |
AcadeMir Charter School West has partnered with Sounds of Excellence School of Music and will now be offering after-school MUSIC LESSONS!
This Thursday, December 15, 2016 at 6:00 p.m., there will be an orientation with the Sounds of Excellence School of Music owner to answer any of your questions and to give you more information on what’s starting in January! |
Dismissed and Memorandum Opinion filed March 4, 2004
Dismissed and Memorandum Opinion filed March 4, 2004.
In The
Fourteenth Court of Appeals
____________
NO. 14-04-00095-CR
____________
CARL DENNIS
FOSTER, Appellant
V.
THE STATE OF
TEXAS, Appellee
On Appeal from the
182nd District Court
Harris County,
Texas
Trial Court Cause No. 711,264
M E M O R A N D U M O P I N I O N
The trial court signed a judgment adjudicating appellant=s guilt for possession of more than
four, but less than 200, grams of cocaine and sentencing appellant to
confinement for thirty years in the Institutional Division of the Texas
Department of Criminal Justice on June 29, 1998. Appellant=s pro se notice of appeal was not
filed until January 26, 2004. The record
before this court contains no indication that appellant was granted an
out-of-time appeal by the Texas Court of Criminal Appeals.
A defendant=s notice of appeal must be filed within thirty days after
sentence is imposed when the defendant has not filed a motion for new
trial. See Tex. R. App. P. 26.2(a)(1). A notice of appeal which complies with the
requirements of Rule 26 is essential to vest the court of appeals with
jurisdiction. Slaton v. State,
981 S.W.2d 208, 210 (Tex. Crim. App. 1998).
If an appeal is not timely perfected, a court of appeals does not obtain
jurisdiction to address the merits of the appeal, and it can take no action
other than to dismiss the appeal. Id.
Accordingly, the appeal is ordered dismissed.
PER CURIAM
Judgment rendered and Memorandum
Opinion filed March 4, 2004.
Panel consists of Chief Justice
Hedges and Justices Frost and Guzman.
Do Not Publish C Tex. R. App. P. 47.2(b).
|
Zhou Xiaoping
Zhou Xiaoping (born 24 April 1981) is a Chinese essayist and popular blogger. His most well-known works are Please Do Not Fail this Era!, Young, do you really know about this country?, Where did our heroes go?, and Nine Tricks of the United States Cultural Cold War. He is a supporter of communist party rule and has expressed nationalist, anti-American and anti-Western sentiment. Zhou is noted for praising by Communist Party General Secretary Xi Jinping at a conference on art and literature. Xi lauded Zhou for spreading "positive energy" in 2014..
Life
Zhou was born and raised in Zigong, Sichuan, after junior high school, he started to publish works in 1996. "Cutlassfish Zhou"(周带鱼)became the nickname for his nationalist, pro-Communist, pro-Chinese government and anti-American writing. Zhou has been praised by General Secretary Xi Jinping for his "positive energy".
Works
Please Do Not Fail this Era! ()
Young, do you really know about this country? ()
Where did our heroes go? ()
Nine Tricks of the United States Cultural Cold War ()
References
External links
Category:1981 births
Category:Writers from Zigong
Category:Living people
Category:Archibald Prize Salon des Refusés People's Choice Award winners
Category:People's Republic of China writers
Category:Chinese bloggers |
Carretera Costera Riviera Mayo
Carretera Costera Riviera Mayo (Mayo Riviera Coastal Road) formerly known as Brecha de Sinaloa is a state road in the Mexican state of Sonora. It runs from Agiabampo to Yavaros.
Route description
As of January 2009 Mayo Riviera Coastal Road is a dirt road except the part running from the intersection to the road to Mexican Federal Highway 15 in Las Bocas to the beach of Camahuiroa. This part was opened in 2008.
References
Category:State highways in Sonora |
This invention relates generally to fuel burner control system and, more particularly, to a burner control system that utilizes a resistive heater element for igniting fuel emanating from a fuel burner.
The continuing interest in reduced energy consumption and increased safety has resulted in the development of safer and more fuel efficient burner control systems. Of particular note has been the extensive replacement of pilot burner systems with systems employing electronic ignitors that are energized only when main burner ignition is desired. Such electronic ignitor systems eliminate the fuel loss entailed by pilot burners during periods in which full burner operation is not required. Spark ignitors and resistive heater elements are two common mechanisms utilized to ignite fuel in electronic burner control systems. Although spark ignitors exhibit a number of desirable characteristics, resistive heating elements have certain inherent features that offer unique operational advantages. For example, a resistive heater element can establish a larger thermal mass than a conventional spark ignitor and, therefore, can provide more reliable ignition of less than optimum fuel and air mixtures. In addition, the positioning of a resistive heater ignitor with respect to a burner is less critical than that required for an analogous spark ignitor.
The object of this invention, therefore, is to provide an improved burner control system that employs a resistive heater element as a fuel igniting mechanism. |
Nope failed...it wants libcurl.so.4.1.0 which I could only find with ssl support which then requires a host of extra libraries...getting silly I thought.....unless theres a non ssl libcurl.so.4.1.0 floating around.
Nope failed...it wants libcurl.so.4.1.0 which I could only find with ssl support which then requires a host of extra libraries...getting silly I thought.....unless theres a non ssl libcurl.so.4.1.0 floating around.
So the libcurl is a bit of a sticking point.
I think the developer is using it for extra functions rather than ssl.
I looked at the sources but many commands such as easy_curl_xxx were being called needing the newer version.
And clive needs python......blah
mike
edit...could compiling libcurl.so.4.1.0 without ssl support be a possibility...might be useful for other apps..just a thought
Well was suggested I put up my gui...it runs cclive (video) or wget (file) as appropriate and included the real gtklogfileviewer (renamed) cos the substitute is erm not good enough. Pop into /usr/bin
Just for peeps to play with..I use it all the time...needs working cclive.
0.4.7 is considerably larger and 0.3.1 still handles you tube and google so I've hung onto that version myself.
mike
edit..added a v2 thats easier for multiple downloads and try different formats
edit 2 cclive 0.3.1 added just for completeness.....it too needs the curl update
edit 3 oops fixed v2 for spaces in file names...
edit 4 just changed to latest one with relaid gui ...been using it for a while now.
Just finishing a rewrite that neatens thing up a bit...will post after testing.
Ok... put everything together...the one for 0.4.7 not fully tested but there's only 2 minor syntax changes anyway....
edit 5 Ok rewrite done and now added a better display of current downloads and the ability to choose and stop then from it. Since -c is used a stopped/killed download can be resumed by using the same address and destination name.
edit 6 Ouch...spaces in names messing up wget detection so more wrestling with bash and hopefully fixed now..the 0.4.7 gui may work as is with the latest release but will be checking soon,....yes but some additional formats added...should be fine for 0.4.7 or 0.5.7
You cannot post new topics in this forumYou cannot reply to topics in this forumYou cannot edit your posts in this forumYou cannot delete your posts in this forumYou cannot vote in polls in this forumYou cannot attach files in this forumYou can download files in this forum |
565 F.3d 308 (2009)
Michael ROSALES, Petitioner-Appellant,
v.
Nathaniel QUARTERMAN, Director, Texas Department of Criminal Justice, Correctional Institutions Division, Respondent-Appellee.
No. 09-70013.
United States Court of Appeals, Fifth Circuit.
April 14, 2009.
*309 Gregory William Wiercioch, Texas Defender Service, San Francisco, CA, for Petitioner-Appellant.
Carole Susanne Callaghan, Postconviction Litigation Div., Austin, TX, for Respondent-Appellee.
Before DAVIS, BENAVIDES and STEWART, Circuit Judges.
PER CURIAM:
Petitioner Michael Rosales is scheduled to be executed Wednesday, April 15, 2009. On April 8, 2009, he filed motions in the Northern District of Texas for appointment of counsel to assist in clemency proceedings and for a stay of his execution. Rosales appeals the district court's denial of both motions for stay of execution and for appointment of counsel, asking us to reverse and to grant the motions. For the reasons set forth below, we AFFIRM the judgment of the district court.
*310 I. BACKGROUND
The procedural history of Rosales's case is as follows:
In May 1998, Rosales was convicted and sentenced to death for the murder of Mary Felder, which occurred during the course of a burglary or robbery. On direct appeal, Rosales' conviction and sentence w[ere] affirmed by the Texas Court of Criminal Appeals ("TCCA"); the United States Supreme Court denied certiorari review. Rosales also sought state and federal habeas relief, both of which were denied. On April 7, 2004, less than one week before his scheduled execution, Rosales filed a successive state habeas application arguing that he is mentally retarded and thus his execution is barred by Atkins v. Virginia, 536 U.S. 304, 122 S.Ct. 2242, 153 L.Ed.2d 335 (2002)....
On April 12, 2004, one day before his scheduled execution, the TCCA held that Rosales' application failed to "set out sufficient facts to raise a bona fide claim under Atkins" and therefore dismissed his application as an abuse of the writ and denied his motion for a stay of execution. Ex parte Rosales, No. 55, 761-02 (Tex. Crim App.2004). That same day, Rosales filed a petition for writ of certiorari at the United States Supreme Court as well as a motion requesting a stay of execution and authorization to file a successive petition for writ of habeas corpus in this court. While the Supreme Court denied his petition on May 17, 2004, this court had already granted his request for a stay of execution as well as his motion for leave to file a successive petition on April 13, 2004. On April 15, 2004, Rosales filed a motion in federal district court requesting the appointment of counsel, permission to proceed in forma pauperis, permission to file a skeletal petition, and expenses to retain an investigator and a mental health expert. The motion was granted on April 22, 2004. On May 21, 2004, Rosales filed his amended petition and attached affidavits or declarations from eleven different witnesses....
Rosales v. Quarterman, 291 Fed.Appx. 558, 559-60 (5th Cir.2008). After conducting an evidentiary hearing, the district court denied Rosales's petition. Rosales then moved this court for a COA. On August 19, 2008, this court granted Rosales a COA as to his Atkins claim out of "an abundance of caution." Id. at 562. The court concomitantly affirmed the district court judgment dismissing that claim. Id. at 563. The Supreme Court denied Rosales's petition for certiorari on February 23, 2009. Rosales v. Quarterman, ___ U.S. ___, 129 S.Ct. 1317, ___ L.Ed.2d ___ (2009).
After the denial of certiorari, the presiding judge of the 364th Judicial District Court of Lubbock County, Texas, scheduled Rosales's execution for Wednesday, April 15, 2009. Therefore, under Texas law, any application that Rosales sought to make to the Texas Board of Pardons and Paroles Clemency Section ("Clemency Board") was due no later than March 25, 2009. See 37 Tex. Admin. Code §§ 143.43(a) (requiring the written application on behalf of a convicted person seeking recommendation of a reprieve from execution to be delivered to the Clemency Board no later than twenty-one calendar days before the execution date), 143.57(b) (requiring the written application on behalf of a convicted person seeking recommendation of commutation of death penalty to lesser penalty to be delivered to the Clemency Board no later than twenty-one calendar days before the execution date).
Rosales did not file an application with the Clemency Board for either a reprieve of execution or commutation of his death *311 penalty prior to the deadline, nor does the record indicate that he has made any such request or filing to date.
On Wednesday, April 8, 2009, Rosales filed motions for appointment of counsel and for stay of execution in federal district court, and the State filed its opposition to both. The same day, in a single-paragraph opinion, the district court stated that Rosales's motion should be denied "in all things," and cited to Harbison v. Bell, ___ U.S. ___, 129 S.Ct. 1481, 1486, 173 L.Ed.2d 347 (2009), which quotes the statutory language from 18 U.S.C. § 3599(e): "once federally funded counsel is appointed to represent a state prisoner in § 2254 proceedings, she `shall also represent the defendant in such ... proceedings for executive or other clemency as may be available to the defendant'" (emphasis added by district court). Although the district court did not elaborate on its reasoning, presumably the emphasis on "as may be available" indicates that the motions were denied because the court concluded that state clemency relief was no longer available because Rosales's deadline to file an application with the Clemency Board had passed.
On April 9, 2009, Rosales appealed, and the parties completed their briefing the next day.
II. DISCUSSION
A. Application for Stay of Execution
Rosales argues that the district court has the power to stay his execution to allow his new counsel time to prepare and make a filing with the Clemency Board under McFarland v. Scott, 512 U.S. 849, 857-58, 114 S.Ct. 2568, 129 L.Ed.2d 666 (1994). However, McFarland does not grant the district court or this court greater authority to stay an execution than is found in the statutory language of 28 U.S.C. § 2251, and Rosales's reliance on the case for a broad reading of the district court's power to issue a stay is misplaced.
"Federal courts cannot enjoin state-court proceedings unless the intervention is authorized expressly by federal statute or falls under one of two other exceptions to the Anti-Injunction Act." McFarland, 512 U.S. at 857, 114 S.Ct. 2568. However, "[t]he federal habeas corpus statute grants any federal judge `before whom a habeas corpus proceeding is pending' power to stay a state-court action `for any matter involved in the habeas corpus proceeding.'" Id. (quoting § 2251) (emphasis added); see also Williams v. Cain, 143 F.3d 949, 950 (5th Cir.1998).
The power to issue a stay of execution comes from § 2251, and the question is whether there is a pending or potential habeas corpus proceeding before the court. See Teague v. Johnson, 151 F.3d 291 (5th Cir.1998) ("once the appellate mandate issues, a habeas petition is no longer pending before the court of appeals, and we have no jurisdiction to stay proceedings under § 2251"); Williams, 143 F.3d at 950 (holding district court has no power under § 2251 to stay execution when there is no pending habeas proceeding); see also Howard v. Dretke, 157 Fed.Appx. 667, 670-72 (5th Cir.2005) (unpublished) (holding both the district court and this court lacked jurisdiction to grant stay of execution in conjunction with motion for appointment of counsel that was not tied to pending or proposed habeas proceeding in the district court, relying on the language of § 2251, Williams, and Teague). There is no dispute in this matter that no habeas petition remains pending in the federal courts. Therefore, both the district court and this court are without jurisdiction to enter a stay of execution.
*312 B. Motion for Appointment of Counsel
Rosales argues that he is entitled to appointed counsel to investigate and present his argument for clemency to the Clemency Board, pursuant to the recent holding of the United States Supreme Court in Harbison v. Bell, ___ U.S. ___, 129 S.Ct. 1481, 173 L.Ed.2d 347 (2009). In Harbison, the Supreme Court announced that 18 U.S.C. § 3599 authorizes federally appointed counsel to represent their clients in state clemency proceedings and entitles them to compensation for that representation.
[O]nce federally funded counsel is appointed to represent a state prisoner in § 2254 proceedings, she "shall also represent the defendant in such ... proceedings for executive or other clemency as may be available to that defendant." § 3599(e). Because state clemency proceedings are "available" to state petitioners who obtain representation pursuant to subsection (a)(2), the statutory language indicates that appointed counsel's authorized representation includes such proceedings.
129 S.Ct. at 1486. Until the Harbison decision, this court's precedent denied appointment of federal counsel for post-habeas state clemency proceedings. See Clark v. Johnson, 278 F.3d 459 (2002).
However, we do not read Harbison so broadly as to require the appointment of new counsel where the already-appointed counsel has never withdrawn from the case and is well familiar with the facts on which the petitioner claims his clemency petition should be based. Reviewing the record, attorneys were appointed counsel to Rosales in April 2004 to file a successive habeas petition containing his Atkins claim. As those attorneys have never withdrawn from the case, we agree with the State that Rosales had appointed counsel during the time in which he could have made an application to the Clemency Board.
Moreover, in reviewing the papers submitted to this court, we note that there is no assertion made that there is any additional evidence in support of Rosales's Atkins claim beyond that which was presented to the district court and Fifth Circuit in his habeas proceeding. Rosales's motion asserts that there might be evidence of a pre-age eighteen onset of mental retardation to be uncovered with additional resources. But beyond that speculative assertion, he does not specify what evidence might be uncovered that was not discovered during his habeas litigation.
Finding this case factually and procedurally distinguishable from Harbison, we find no abuse of discretion in the district court's denial of Rosales's motion for the appointment of counsel.
III. CONCLUSION
For the foregoing reasons, we AFFIRM the judgment of the district court.
|
Q:
How to get count of post of each user by day on mongodb?
How to get count of post of each user by day on mongodb? I have a similar dataset like below
{ "_id" : ObjectId("58863104f9881947d6d328c3"),
"time" : 1484755908748,
"user" : "mjt",
"post" : "lorem ipsum...."
},
{ "_id" : ObjectId("58863104f9881947d6d328c3"),
"time" : 1484755908748,
"user" : "joe",
"post" : "lorem ipsum...."
}
....
simple try I did but gave error
db.collection.aggregate([
{ $project: {user:1,
isoTime : {$dayOfMonth : {$add : [new Date(0),"$time"]}} }},
{$group : {_id:"$isoTime", count: {$sum:1}}}
])
this gives error :
"ok" : 0,
"errmsg" : "can't convert from BSON type null to Date",
"code" : 16006,
"codeName" : "Location16006"
A:
You actually need to filter your collection for documents which have the time field (i.e. it is not null) and where the type is NOT a date and then group per user per day using the $dateToString operator which produces a formatted date time string that will represent the day.
Run the following aggregate operation to get the count of posts per day
db.collection.aggregate([
{ "$match": { "time": { "$exists": true, "$not": { "$type": 9 } } } },
{
"$group": {
"_id": {
"$dateToString": {
"format": "%Y-%m-%d",
"date": { "$add": [new Date(0), "$time"] }
}
},
"count": { "$sum": 1 }
}
}
])
And this pipeline should give you both the number of posts per user per day and the overall post count for that day:
db.collection.aggregate([
{ "$match": { "time": { "$exists": true, "$not": { "$type": 9 } } } },
{
"$group": {
"_id": {
"user": "$user",
"yearMonthDay": {
"$dateToString": {
"format": "%Y-%m-%d",
"date": { "$add": [new Date(0), "$time"] }
}
}
},
"count": { "$sum": 1 }
}
},
{
"$group": {
"_id": "$_id.yearMonthDay",
"userCounts": {
"$push": {
"user": "$_id.user",
"count": "$count"
}
},
"total": { "$sum": "$count" }
}
}
])
|